EP1948806A2 - Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants - Google Patents

Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants

Info

Publication number
EP1948806A2
EP1948806A2 EP06819167A EP06819167A EP1948806A2 EP 1948806 A2 EP1948806 A2 EP 1948806A2 EP 06819167 A EP06819167 A EP 06819167A EP 06819167 A EP06819167 A EP 06819167A EP 1948806 A2 EP1948806 A2 EP 1948806A2
Authority
EP
European Patent Office
Prior art keywords
nucleic acid
acid molecule
polypeptide
according
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06819167A
Other languages
German (de)
French (fr)
Inventor
Dimitar Douchkov
Patrick Schweizer
Uwe Zierold
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
BASF Plant Science GmbH
Original Assignee
BASF Plant Science GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to EP05110468 priority Critical
Application filed by BASF Plant Science GmbH filed Critical BASF Plant Science GmbH
Priority to EP06819167A priority patent/EP1948806A2/en
Priority to PCT/EP2006/067865 priority patent/WO2007054441A2/en
Publication of EP1948806A2 publication Critical patent/EP1948806A2/en
Application status is Withdrawn legal-status Critical

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8282Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for fungal resistance

Abstract

The invention relates to a method for creating or increasing pathogen resistance in plants by reducing the expression of at least one armadillo repeat polypeptide or a functional equivalent thereof. The invention also relates to novel nucleic acid sequences coding for a Hordeum vulgare armadillo repeat (HvARM) polynucleotide, homologous sequences (ARM1) thereof, the use thereof in processes to obtain pathogen resistance in plants, as well as nucleic acid structures, expression cassettes, and vectors which contain said sequences and are suited to render plants resistant to fungi. The invention further relates to transgenic organisms, especially plants, which are transformed by means of said expression cassettes or vectors, as well as cultures, parts, or transgenic reproductive material derived therefrom.

Description

Use of armadillo repeat (ARM1 ^ polynucleotides to achieve pathogen resistance in plants

description

The invention relates to a method for generating or increasing an Pathogenre- consistency in plants by reducing the expression of at least one armadillo repeat polypeptide or a functional equivalent thereof. The invention relates to new nucleic acid sequences coding for a Hordeum vulgare armadillo repeat (HvARM) polynucleotide and homologous sequences describes (ARM1) of which as well as their use in methods for obtaining a pathogen resistance in plants, and to nucleic acid constructs, expression cassettes and vectors comprising these sequences, and which are geeigntet to convey a -Pilzresistenz in plants. The invention further concerns with these expression cassettes or vectors transformed transgenic organisms, in particular plants, derived cultures, parts or transgenic propagation material.

There are few approaches, the plant resistance to pathogens, especially fungal pathogens lend. This lack is due in part to the complexity of the biological systems. The achievement of resistance to patent thogenen precludes even that little is known about the interactions between pathogen and plant. The large number of different pathogens developed by these organisms infection mechanisms and coming from the plant, families and species defense mechanisms interact with each other varied.

Fungal pathogens have essentially developed two strategies infection. Some fungi enter through the stomata into the host tissue (eg rusts, Septoria, Fusarium species) and penetrate the mesophyll tissue, while others on the cuticle the underlying epidermal cells penetrate (eg Blumeria species).

The infections caused by fungal pathogens lead to the infested plants for the activation of plant defense mechanisms. It could be shown that immune reactions against epidermis-penetrating fungi often begin with the formation of a penetration resistance (papilla cell wall with callose as the main component) below the fungal penetration (Elliott et al Mol Plant Microbe Interact 15: 1069-77; of 2002.). ,

However, the plant's defense mechanisms only confer an insufficient protection against pathogen infection in many cases. The formation of a penetration resistance to pathogens whose infection mechanism comprises a penetration of epidermal or mesophyll is both for monocotyledonous and dicotyledonous plants of great importance. You can probably training formation of a broad-spectrum resistance to obligatory biotrophic, hemibiotrophic and necrotrophic fungi allow as opposed to described mlo-mediated resistance.

Therefore, the present invention had the object of providing a method for producing a resistance of plants to penetrating pathogens.

The object is solved by the embodiments characterized in the claims.

Accordingly, the invention relates to a method for increasing the resistance to one or more penetrating pathogen (s) in a monocotyledonous or dicotyledonous plant, or part of a plant, for example in an organ, tissue, a cell or a part of a plant cell, for example in an organelle, characterized in that the activity or amount of an armadillo repeat ARM1 protein in the plant, or a part of the plant, for example, in an organ, tissue, a cell or a part of a cell, for example in a cell compartment, for example in an organelle is compared to a control plant or a part of a control plant, for example, the organ, tissue, cell or part of a cell, for example in a cell compartment, for example in an organelle, diminished or reduced.

Preferably, in the inventive method, a race-unspecific resistance is achieved. Thus, for example, be achieved by the inventive method, a broad-spectrum resistance to obligate biotrophic and / or hemibiotrohpe and / or necrotrophic fungi of plants, in particular against mesophyll, epidermis or into the mesophyll penetrating pathogens.

Surprisingly, it has on the one hand observed that the gene silencing has means dsRNAi a gene coding for an armadillo repeat protein HvARM barley, an increase in resistance of monocotyledonous and dicotyledonous plants against pathogenic PiIz- result. So this negative control function has been shown by fungal pathogens in cases of infestation for the Armadillo repeat ARM1 protein from barley (Hordeum vulgare) (HvARMI), wheat (Triticum aestivum) and thale cress (Arabidopsis thaliana).

As part of a TIGS (= Transient Induced Gene Silencing) analysis in barley by the method of Schweizer et al. (Plant J. 2000 Dec; 24 (6):. 895-903), it was found that by a dsRNAi-mediated silencing of the gene HvARM resistance against Blumeria graminis f. sp. hordei (including Erysiphe graminis DC. f. sp. hordei) greatly increased. This effect was also (PTGS) can be achieved in dicotyledonous species such as Arabidopsis thaliana by induction of post transcriptional gene silencing. This emphasizes the universal significance of the loss of function of homologous HvARMI- genes for the formation of a broad-spectrum pathogen resistance of the plant.

The Armadillo repeat motif was discovered in Drosophila melanogaster originally in the segment-polarity gene Armadil- Io. It encodes a beta-catenin, which plays an important role in cell-cell adhesion and in cell differentiation. Armadillo (ARM) Repeat proteins contain tandemly arranged copies of a degenerate sequence of about 42 amino acids which encodes a three-dimensional structure for mediating protein-protein interactions (Azevedo et al. (2001) Trends Plant Sci. 6, 354- 358). Most of these proteins are involved in intracellular signal transduction and in the regulation of gene expression in the context of cellular development processes. Unlike animals, two herbal armadillo repeat proteins have only been functionally characterized: When a gene is PHOR1 (photoperiod-responsive 1) from potato, for which a role in gibberellic acid signal transduction was demonstrated (Amador V, Cell 10; 106 (3). 343-54) in the second armadillo repeat protein is ARC1 (Armadillo repeat Containing protein 1) from rapeseed, which interacts with the receptor kinase SRK1 (Gu et al (. 1998) Proc. Natl. Acad. Sci. USA 95, 382-387). Thus in the regulation of self-incompatibility of rapeseed, it plays a major role. Transgenic plants in which the expression is reduced from ARC1 by silencing, show a reduced self. Interestingly, ARC1 belongs to the U-Box subclass of armadillo repeat proteins to the 18 genes in Arabidopsis include (Azevedo et al. (2001) Trends Plant Sci. 6, 354-358). The U-box is a motif consisting of about 70 amino acid residues. In addition to the HECT and the RING finger proteins they probably form a third class of ubiquitin E3 ligases, whose primary function is to determine the substrate specificity of Ubiquitinierungsmaschi- nerie (Hatakeyama et al. (2001) J. Biol. Chem. 76 331 11-33120).

Preferably, the genes or nucleic acids used or expri--programmed proteins whose experession is reduced, an identity of 40% or more, preferably 50%, 60%, 70%, 80%, 85%, 90%, 95%, 97%, 98%, 99% or more as compared with the respective sequence of HvARM (SEQ ID NO: 1 or SEQ ID NO: 2). The genes with the highest homologies to HvArm from rice (Acc. No .: XM_479734.1, XM_463544, AP003561, or XM_506432), tobacco (AY219234) and Arabidopsis (Acc No. NM_127878, AC004401, BT020206, AB007645, NM_115336, AK118613 , AL138650, AL133314, AC010870, AY125543, AY087360, AB016888, AK175585, AL049655, AY096530 and AK1 18730) thus take probably similar functions HvARM true in the plant. In the following, therefore, they are grouped under the term "Aimadillo repeat ARM1" or "ARM1" protein. HvARM or HvARMI however, relate to such a protein from barley.

Recently another vegetable armadillo repeat protein has been described in maize SpH 1, for which a regulation of plant cell death was detected under the abiotic stress response. The loss of function of the corresponding gene leads (16 (10) Zeng LR, (2004) Plant Cell.: 2795- 808) to a so-called Lesion M / 77 / c phenotype, affecting the agronomic performance of the plant.. Interestingly, the sequence homology of Sph 1 to HvARM is only 23.4% at the amino acid level. induce by theory a requirement or limitation indicates the low sequence homology to the membership of HvARM and SpH 1 to different subclasses of armadillo repeat proteins in addition to the different functions.

It was therefore surprising that the reduction of the gene expression of HvARMI by RNAi-mediated silencing leads to an increase of the resistance of barley against powdery mildew of barley and that in wheat (Triticum aestivum) and thale cress (Arabidopsis thaliana), this negative control function in an attack by PiIz- pathogenic was also demonstrated.

In a further embodiment, the invention therefore relates to a method for producing a plant with increased resistance to one or thogen more herbal patent (e), preferably with a broad-spectrum resistance, in particular PiIz- pathogens, for example from the classes Ascomycetes, Basidiomycetes, Chytridiomyce- tes or Oomycetes, preferably from mildew fungi of the family Erysiphaceae, genus Blumeria, and more preferably of, by reducing the expression of a protein which is characterized in that it contains at least one armadillo repeat. Preferably, the protein comprises two, more preferably more than two armadillo repeats.

In another embodiment, the activity of an armadillo repeat polypeptide is reduced in the inventive method, for example blocked or switched off which does not comprise U-Box substantially, that either does not include U-Box or does not comprise functional U-Box.

In another embodiment, the activity of a polypeptide is reduced in the inventive process, turned off, for example, which is encoded by a polynucleotide comprising at least one nucleic acid molecule selected from the group consisting of: (a) nucleic acid molecule encoding at least one polypeptide comprising the sequence shown in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or sequence shown 62;

(B) nucleic acid molecule which comprises at least one polynucleotide of the sequence in

SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 comprising ;

(C) nucleic acid molecule encoding a polypeptide whose sequence has an identity of at least 50% to the sequences of SEQ ID No: 2;

(D) nucleic acid molecule of (a) to (c) encoding a fragment or an epitope of the sequences according to SEQ. ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, encoding 61 or 62;

(E) nucleic acid molecule encoding a polypeptide which is recognized by a monoclonal antibody directed against a polypeptide which leküle by the Nukleinsäuremo- according to (a) encoding to (c), is detected;

(F) nucleic acid molecule with a nucleic acid molecule according to (a) under stringent conditions hybridizes to (c); and

(G) nucleic acid molecule which acid molecule according from a DNA library using a nucleic (a) to (c) or their part-fragments of at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt, as probe under stringent hybridization conditions;

or comprises a complementary sequence thereof.

Preferably in the present process in particular, the resistance to mesophyll and / or epidermal cells is increased penetrating pathogens.

In one embodiment, the resistance XM_463544 AP003561 is achieved in that the expression of a polypeptide, preferably a polypeptide encoded by the above-described nucleic acid molecule, for example, a ARM1 from rice (Acc. No .: XM_479734.1,,, or XM_506432 ), tobacco (AY219234) and Arabidopsis (Acc NM_127878, AC004401, BT020206, AB007645, NM_1 15336, AK118613, AL138650, AL133314, AC010870, AY125543, AY087360, AB016888, AK175585, AL049655, AY096530 and reduces AK118730), reduced or is blocked. On the other hand, known methods may also include the endogenous activity of these polypeptides is reduced can be reduced or blocked, such as by mutation of a genomic coding region for the active site, for binding sites for localization signals, for domains, clusters, etc. such as of codie by the person skilled in - Governing regions for coiled coil, HEAT, FBOX, LRR, IBIB, C2, WD40, Beach, U-box, or aND domains. The activity can be inventively reduced by mutations that affect the secondary, tertiary, or quaternary structure of the protein.

Mutations can be introduced for example by EMS mutagenesis. Domains can be identified by suitable computer programs, such as SMART, or InterPRO, such as in Andersen P., The Journal of Biol. Chemistry, 279, 38, pp. 40053-40061, 2004 or Y. Mudgil, Plant Physiology, 134, 59-66, 2004, and described in publications mentioned. The appropriate mutants can then, for example by TII ling (Henikoff et al Plant Physiol 2004 June; 135 (2):.. 630-6) are identified.

In another embodiment, the reduction in the polypeptide quantity, activity or function of a Armadillo repeat ARM1 protein in a plant combined with an increase in the polypeptide quantity, activity or function of other resistance factors, is preferably of a Bax inhibitor 1 protein (BI-1), preferably of the Bax inhibitor 1 protein from Hordeum vulgare (GenBank Acc No .: AJ290421), Nicotiana tabacum (GenBank Acc No .: AF390556), rice (GenBank Acc No .: AB025926), Arabidopsis (GenBank Acc No .: AB025927) and tobacco and rape (GenBank Acc No .: AF390555, Bolduc N et al (2003). Planta 216: 377-386) or ROR2 (eg from barley (GenBank Acc No .: AY246906), SNAP34 (eg from barley (GenBank Acc No .: AY247208) and / or the lumenal binding protein BiP for example from rice (GenBank Acc

AF006825). An increase can be achieved by mutagenesis or overexpression of a transgene zBua.

In one embodiment, a reduction in the amount of protein, activity or function of the proteins RacB (for example from barley (GenBank Acc.-No .: AJ344223)), CSL1 (for example from Arabidopsis (GenBank Acc.-No .: NM116593), HvNaOX (eg from barley (GenBank Acc No .: AJ251717) MLO (eg from barley (GenBank Acc Z83834) achieved.

The activity or function of MLO, BI-1 and / or NaOX can analogously as for MLO in WO 98/04586; WO 00/01722; WO 99/47552 and the other publications mentioned hereinbelow be reduced or inhibited described, the contents of which are incorporated herein and expressis verbis incorporated, in particular the activity and inhibition of MLO to describe. The description of the abovementioned publications describes drive encryption, methods, and particularly preferred embodiments for reducing or inhibiting the activity or function of MLO, the examples indicate specifically how this can be executed. The reduction of the activity or function, if appropriate of the expression of BI-1 is described in WO 2003020939 in detail, which is herewith expressly incorporated into the present expressis comparable to description with ALS. The description of the abovementioned publication describes processes and methods for lessening or inhibiting the activity or function of BI-1, the examples indicate specifically how this can be executed. The reduction or inhibition of the activity or function of BI-1 according to the in WO 2003020939 particularly preferred embodiments and examples, and constitutively in the performed there as being particularly preferred illustrated organisms, in particular in a plant, for example, or in a part is particularly preferably thereof, for example in a tissue, but especially at least in the epidermis or in a considerable part of the epidermal cells. The reduction of the activity or function, if appropriate of the expression of BI-1 is described in WO 2003020939 detail. The skilled artisan will find in WO 2003020939, the sequences that encode BI-1 proteins and can also identify with the BI-1 provided in WO 2003020939 method.

The reduction of the activity or function, if appropriate of the expression of NaOX is described in detail in PCT / EP / 03/07589, which is herewith expressly expressis verbis as in the present specification taken with. The description of the abovementioned publication describes processes and methods for reducing or inhibiting the activity or function of NaOx, the examples indicate specifically how this can be executed. The reduction or inhibition of the activity or function of NaOx according to the particularly sawn in PCT / EP / 03/07589 preferred exemplary forms and examples, and in the illustrated therein as being especially preferred organisms is particularly preferably carried out in particular constitutively in a plant, for example, or a portion thereof, for example in a tissue, but especially advantageously at least in the epidermis or in a considerable part of the epidermal cells. The skilled worker finds in PCT / EP / 03/07589, the sequences decode co- for NaOx proteins and can identify the questions in PCT / EP / 03/07589 are methods and NaOx.

The terms "reduce", "reduce" or "repremieren" or their nouns are used synonymously.

By "reduction", "reducing" or "repression" or their verbs in the present invention understood that the activity in the plant is lower than in a control plant or in a part of a plant is lower than in a corresponding part of a control plant, for example in an organ, an organelle, a tissue, or a cell. In preferred embodiments, the activity of said polypeptide 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95 %, 97%, 99% or even less than in the control. in one embodiment finds substantially particularly preferably no or no expression of the said polypeptide place. Accordingly, these terms also include the complete inhibition or blocking an activity, for example by a knock out of a gene.

"Reduce", "reducing", "decrease" or "decrease", "repression" or "repress" comprises the partial or essentially complete, based on different cell-biological mechanisms suppression or blocking of the functionality of a protein.

A reduction in the sense of the invention also comprises a quantitative reduction of a protein up to a substantially complete (ie lack of detectability of activity or function or lack of immunological detectability of the protein), or complete absence of the protein. The expression of a particular protein or the activity or function in a cell or an organism is preferably reduced by more than 50%, especially preferably by more than 80%, and reduced in particular by more than 90%.

In a further embodiment can be carried out one for a ARM1 protein-encoding nucleic acid molecule, for example in combination with a tissue-specific increase in the activity of a Bax inhibitor-1 protein expression in the mesophyll tissue through. The reduction of the Armadillo repeat ARM1 amount of protein in a transgenic plant, for example BI-1 in the mesophyll tissue offers the chance to have a complete and comprehensive fungal resistance in plants to generate.

In another embodiment, the increase in the polypeptide quantity, activity or function of the Bax inhibitor 1 protein is carried out from Hordeum vulgare (Gevtäank Acc.-No .: AJ290421), (from Nlcotlana tabacum {GenBank Acc.-No .: AF390556), rice GenBank Acc No .: AB025926), Arabidopsis (. GenBank Acc No .: AB025927) and tobacco and rape (GenBank Acc No .: AF390555, Bolduc N et al (2003) Planta 216: 377-386) or ROR2 (eg from barley (GenBank Acc No .: AY246906), SNAP34 (eg from barley (GenBank Acc No .: AY247208) and / or the lumenal binding protein BiP for example from rice (GenBank Acc No . AF006825) combined with the reduction in the amount of protein, activity or function of the proteins RacB (for example from barley (GenBank Acc No .: AJ344223), CSL1 (for example from Arabidopsis (GenBank Acc.-No .: NM116593), HvNa- OX (for example from barley (GenBank Acc.-No .: AJ251717), and / or MLO (for example from barley (GenBank Acc Z83834). Thus, in one embodiment at least one of the above for overexpression o the increased activity suitable genes activated or overexpressed and / or at least one of the above suitable for reducing Gene reduced.

An increase in the expression can be achieved as described herein. Increasing the expression or function herein both the activation or enhancement of the expression or function of the endogenous protein including a de novo expression and an increase or enhancement by the expression of a transgenic protein or factor.

"Organism" in the invention means "nonhuman organisms" as long as the term refers to a viable multicellular organism.

"Plant" within the scope of the invention all dicotyledonous or monocotyledonous plants. Plants are preferred under the class of Liliatae (Monocotyledoneae or monocotyledonous plants) can be subsumed. Included under the term includes the mature plants, seed, shoots and seedlings, and to functional derived parts, propagation material, plant organs, tissue, protoplasts, callus and other cultures, for example cell cultures, and any other types of groups of plant cells or structural units. Mature plants refers to plants at any developmental stage beyond the seedling. seedling refers to a young, immature plant at an early stage of development.

"Plant" includes annual and perennial dicotyledonous or monocotyledonous plants but includes, by way of example, not limitation, those of the genera Bromus, Asparagus, Pennisetum, Lolium, Oryza, Zea, Avena, Hordeum, Secale, Triti- cum, sorghum and Saccharum on.

In a preferred embodiment, the method applied to monocotyledonous plants, for example from the family Poaceae, particularly preferably to the genera Oryza, Zea, Avena, Hordeum, Secale, Triticum, Sorghum, and Saccharum, very particularly preferably plants of agricultural significance such as eg Hordeum vulgare (barley), Triticum aestivum (wheat), Triticum aestivum subsp.spelta (spelled), triticale, Avena sativa (oats), Secale cereale (rye), sorghum bicolor (sorghum), Zea mays (maize), Saccharum officinarum (sugar cane), or Oryza sativa (rice) angewen- det.

"Epidermal tissue" or epidermis means the outer tissue layers of the plants you can turn to be multilayered;. There epidermis "enriched" gene expression, such as eg Cer3 that can serve as a marker; Hannoufa.A. (1996) Plant J. 10 (3), 459- 467th

The term "epidermis", the skilled person preferably means the predominant tissue of primary aerial parts of the plant, so the shoot, leaves, flowers, fruits and seeds. Externally, the epidermal cells excrete a wasserabsto- sequent layer, the cuticle The roots are surrounded by the rhizodermis. which is similar to the epidermis in many ways, but also has significant differences to her. the epidermis arises from the outermost layer of the apical meristem. the rhizodermis is less clear. Depending on the type they may developmentally either the root cap or the primary cortex attributed . are the epidermis can be attributed to a number of functions: it protects the plant from drying out and regulates the transpiration will protect the plant from a wide variety of chemical and physical external influences, against being eaten by animals and infestation by parasites It is the exchange of gases, at the Sekr. Etion of certain metabolites and involved in the absorption of water. In their receptors for light and mechanical stimuli are included. so that it acts as a signal transformer between the environment and plant. According functions the various functions, the epidermis comprises a number of differently differentiated cells. There are also species-specific variants and different organization of the epidermis in the different parts of a plant. Essentially it consists of three categories of cells: the "actual" epidermal cells, the cells of the stomata (stomata) and trichomes (Greek .: trichoma, hair), epidermal Notes to the financial with different shapes, structure and function.

The "actual", ie, the least specialized epidermal cells make up the bulk of the cells of the final fabric. They are either polygonal (slab or plate shaped) or elongated in the plan. The walls between them are often wavy or sinuate. What makes this form is induced during development is unknown, the present hypotheses explain the situation unsatisfactory. Elongated epidermal cells are found in organs or organ parts that are elongated themselves, like stems, petioles and leaf veins and on the leaves of most monocots. Upper and lower side of laminae can be covered by differently structured epidermis with both the shape of the cells, the thickness of the walls as well as the distribution and number of specialized cells (stomata and / or trichomes) may vary per unit area. Large variations are also found within individual families, for. As in the Crassulaceae. In most cases the epidermis is single-layered, but are in species from sev- eral families (Moraceae: most Ficus species; Piperaceae: Peperonia [Pepe- ronie] Begoniaceae, Malvaceae, etc.) been proven multi-layered water-storing epidermis. Epidermal outwardly from a Cutinschicht (cuticle), which covers as a continuous film all epidermal surfaces. It can be structured either smooth or bulges, rods, folds and furrows. But it is not always caused by visible observation of the surface folding of the cuticle on the formation of cuticular rods. There are cases where cuticular folding is only the expression of the underlying protrusions of the cell wall. Epidermal appendages of various form, structure and function are called trichomes and also understood herein, the term "epidermis" .. They act as protection, support and glandular hairs in

Form of scales, different papillae and roots, as absorbent hairs. Epidermal cells alone are involved in their education. Often, a trichome is formed only of such a cell, sometimes several are involved in the development.

Also encompassed by the term "epidermis" are papillae. Papillae are Ausstül- pungen the epidermal surface. The textbook example are the papillae on flower surfaces of pansy (Viola tricolor) and the leaf surfaces of many species from tropical rain forest. They give the surface a velvety consistency. some epidermal cells can be constructed as a water reservoir. A typical example are the water vesicles at the surfaces of many Mesembryanthemum species and other succulents. in some plants, for example in bellflower (Campanula persicifolia) the outer walls of the epidermis are thickened like a lens

The bulk of all tissues is the tissue or parenchyma. Among the pa- renchymatischen tissues include the mesophyll which can be differentiated into sheets in palisade and spongy. Consequently, those skilled a parenchymatous mesophyll tissue beneath. Parenchymati- cells are always alive, usually rounded or angular, rarely elongated. The pith of the shoots, the storage tissues of the fruits, seeds, root and other underground organs are also parenchymas as the mesophyll. "Me sophyllgewebe" means the leaf tissue lying between the epidermal layers, consisting of the palisade tissue, the sponge tissue and veins.

The mesophyll is particularly pronounced divided in dicots and many monocots, in palisade and spongy parenchyma in the leaves of most ferns and phanerogams. A "typical" leaf is dorsiventral built. The palisade parenchyma is mostly on the upper leaf surface directly below the epidermis. The spongy parenchyma fills the underlying space. It is traversed by a voluminous intercellular whose gas space is connected via the stomata in direct contact with the outside world.

The palisade parenchyma consists of elongated cylindrical cells. In some species, the cells are irregular, occasionally bifurcate (Y-shaped: arm palisade parenchyma). Such variants are found in ferns, conifers and a few angiosperms (for example in some Ranunculaceae and Caprifoliaceae species [example: elder]). In addition to the just described, most widely used form of organization, the following variants have been found: palisade parenchyma at the leaf base. Particularly noticeable in scaly leaves. Example: (Thuja), and in the leaves of wild garlic (Allium ursinum)

Palisade parenchyma at both leaf faces (top and bottom). Frequently in plants of dry habitats (xerophytes). For example, lettuce (Lactuca serriola); Annularly closed palisade parenchyma: In cylindrically organized in leaves and needles of the conifers.

The variability of the spongy parenchyma and the training of Schwammpa- renchyms themselves are even more varied than that of the palisade. It is usually referred to as aerenchyma, because it contains a variety of interconnected intercellular spaces.

The mesophyll may include assimilation tissue called, but the terms mesophyll and assimilation tissue are not to be used as synonyms. There are chloroplast leaves, only slightly different in structure from comparable green leaves. Consequently, they comprise mesophyll, but assimilation does; conversely, assimilation eg instead of in sections of the shoot. Further aids for characterizing epidermis and media sophyll the expert, for example, found in v. GUTTENBERG, H .: Textbook of general botany. Berlin: Akademie-Verlag, 1955 (5th ed.), HABERLANDT, G .: Physiological plant anatomy. Leipzig: W. Engelmann 1924 (6th ed.); TROLL, W .: morphology of plants. Volume 1: Vegetation organs. Berlin: Gebr Borntraeger, 1937. TROLL, W. Practical introduction to plant morphology. Jena: VEB G. Thieme Verlag 1954/1957; TROLL, W., HÖHN, K .: General Botany. Stuttgart: F. Enke Verlag, 1973 (4th ed.)

Consequently epidermis or epidermal cells can be histological or biochemical, including molecular biology, characterized. In one embodiment, the epidermis is characterized biochemically. The epidermis can be characterized in one embodiment by the activity of one or more of the following promoters:

WIR5 (= GstA1), acc. X56012, Dudler & Swiss, unpublished. GLP4, acc. AJ310534; Wei.Y .; (1998) Plant Molecular Biology 36, 101-112.

GLP2a, acc. AJ237942, Schweizer.P., (1999). Plant J 20, 541-552.

Prx7, acc. AJ003141, Kristensen BK, 2001. Molecular Plant Pathology, 2 (6), 31 1-317

GerA, acc. AF250933; Wu S, 2000. Plant Phys Biochem 38, 685-698

OsROCI, acc. AP004656 RTBV, acc. AAV62708, AAV62707; Klöti, A, 1999, PMB 40, 249-266

Cer3; Hannoufa A (1996) Plant J. 10 (3), 459-467.

In another embodiment, the epidermis is characterized in that only some of the promoters are active, for example 2, 3, 5 or 7 or more, but at least one is the above-enumerated active. In one embodiment, the epidermis is characterized in that all the abovementioned promoters are active in the tissue or the cell. Consequently mesophyll mesophyll or can be biochemically characterized including histologically. In one embodiment, the mesophyll is characterized biochemically. The mesophyll can be in form in an execution by the activity of one or more of the following promoters:

PPCZmI (= PEPC); Kausch.AP, (2001) Plant Mol. Biol. 45, 1-15

OsrbcS, Kyozuka et al Piant Phys: 1993 102: Kyozuka J, 1993. Plant Phys 102 991- 1000

OsPPDK, acc. AC099041.

TaGF-2.8, acc. M63223; Schweizer.P., (1999). Plant J 20, 541-552.

TaFBPase, acc. X53957 ;.

TaWISI, acc. AF467542; US 200220115849 HvBISI, acc. AF467539; US 200220115849

ZmMISI, acc. AF467514; US 200220115849

HvPRI a, acc. X74939; Bryngelsson et al. Molecular Plant-Microbe Interactions (1994)

HvPRI b, acc. X74940; Bryngelsson et al. Molecular Plant-Microbe Interactions (1994)

HvB1, 3gluc; acc. AF479647 HvPrxδ, acc. AJ276227; Kristensen et al MPP 2001 (see above)

HvPAL, acc. X97313; Wei, Y .; (1998) Plant Molecular Biology 36, 101-1 12th

In another embodiment, the mesophyll is characterized in that only some of the promoters are active, for example 2, 3, 5 or 7 or more, but at least one of the enumerated above. In one embodiment, the mesophyll is characterized in that all of the abovementioned promoters are active in the tissue or the cell.

In one embodiment, all of these promoters are active in the epidermis of a plant or a plant of the invention in the epidermis used in the invention or manufactured and in the mesophyll. In one embodiment, only a part of the abovementioned promoters are active, for example 2, 5, 7 or more, but at least one of the above listed promoters each enabled.

"Nucleic acids" means biopolymers of nucleotides which are linked via phosphodiester bonds (polynucleotides, polynucleic acids). Depending on the type of sugar in the nucleotides (ribose or deoxyribose), a distinction between the two classes of the ribonucleic acids (RNA) and deoxyribonucleic acids ( DNA).

The term "harvesting" means all gained through agricultural cultivation of plants and collected as part of the harvesting process plant parts. "Resistance" refers to preventing, the repressing, the reduction or weakening of disease symptoms of a plant following infection by a pathogen. Symptoms can more diverse be kind, but preferably comprise those which directly or indirectly lead to a deterioration of the quality of the plant, the quantity of the yield, the suitability for use as feed or food or complicate the sowing, cultivation, harvesting or processing of the crop.

In a preferred embodiment, the following symptoms are alleviated, reduced or prevented: formation of pustules and spores bearings on the surfaces of the affected tissue, maceration of the tissues, spreading necroses of tissue accumulation of mycotoxins, for example from Fusarium graminearum or F. culmorum, penetration of the epidermis and / or of the mesophyll, etc.

"Lending", "existence", "generating" or "increasing" a pathogen or the like means that the defense mechanisms of a specific plant or nell in a part of a plant, for example in an organ, a tissue, a cell or organisms by application of the method according to the invention in comparison to an appropriate control, for example, the wild type of the plant ( "control plant", "Ausgangspflan- ze"), the process of the invention has not been applied, under otherwise identical conditions (such as climate, growing conditions, Patho - GenArt etc.) an increased resistance against one or more pathogens comprising. Preferably, in a plant have at least the epidermis and / or Mesophyl- tissue or organs which have an epidermis and / or Mesophyl fabric, an increased resistance to the pathogen or (e). For example, the resistance is increased in the leaves.

In one embodiment, the resistance in lemma (lemma), palea (palea), and / or glume (anther primordium) is increased.

Thus, in one embodiment, in the above-mentioned organs and tissues, the activity of the protein Armadillo repeat ARM1 according to the invention is reduced.

In addition to the abovementioned adverse effects - - for example also the penetration efficiency of a pathogen into the plant or plant cell, or the proliferation efficiency in or on the same process, the increased resistance preferably wherein the disease symptoms manifested in a reduced manifestation of the disease symptoms. Changes in cell wall structure, for example, represent a fundamental mechanism of pathogen, such as shown in Jacobs AK, et al. (2003) Plant Cell, 15 (11): 2503-13.

In the present case, the disease symptoms are preferably preferably reduced by at least 10% or at least 20%, more preferably at least 40% or 60%, very especially preferably by at least 70% or 80%, most preferably by at least 90% or 95% or more.

"Pathogen" within the scope whose interactions with a plant of the above-described disease symptoms of the invention organisms, especially pathogens means organisms from the mushroom kingdom. Preferably epidermis or mesophyll is understood penetrating pathogen under pathogen, particularly preferably pathogens that penetrate through stomata in plants and then penetrate mesophyll cells. Preference is given to organisms of the phyla Ascomycota and Basidiomycota are called. Particularly preferred the families Blumeriaceae, Pucciniaceae, Mycosphaerellaceae and Hypocreaceae.

Particularly preferred are organisms of these families who belong to the genera Blumeria, Puccinia, Fusarium or Mycosphaerella.

Most preferably, the species Blumeria graminis, Puccinia triticina, Puccinia striiformis, Mycosphaerella graminicola, Stagonospora nodorum are Fusarium graminearum, Fusarium culmorum, Fusarium avenaceum, poae Fusarium and Microdochium nivale.

However, it is to be assumed that the reduction of the expression of HvARM, its activity or function also brings about resistance to other pathogens. Particularly preferred Ascomycota are such as Fusarium oxysporum (Fusarium wilt of tomato), Septoria nodorum and Septoria tritici (glume blotch of wheat), Basidi- omyceten such as Puccinia graminis (stem rust of wheat, barley, rye, oats), Puccinia recondita (leaf rust (of wheat), Puccinia dispersa brown rust on rye), Puccinia (hordei (leaf rust of barley), Puccinia coronata crown rust of oats)

In preferred embodiments, the inventive method leads to resistance

Barley against the pathogen:

Puccinia graminis f.sp. hordei (barley stem rust), Blumeria graminis f.sp. hordei

(Barley powdery mildew, Bgh);

for wheat to the pathogens:

Fusarium graminearum, Fusarium avenaceum, Fusarium culmorum, Puccinia graminis f.sp. tritici, Puccinia recondita f.sp. tritici, Puccinia striiformis, Septoria nodorum, Septoria tritici, Septoria avenae, Blumeria graminis f.sp. tritici (Gers tenmehltau BGT) or Puccinia graminis f.sp. tritici (Wheat stem rust)

for corn against the pathogens: Fusarium moniliforme var subglutinans, Puccinia sorghi or Puccinia polysora.

sorghum to the pathogens:

Puccinia purpurea, Fusarium monilifonne, Fusarium graminearum or Fusarium oxysporum.

in soybeans against the pathogens

Phakopsora pachyrhizi and Phakopsora meibromae.

"Armadillo repeat Arm1 polypeptide" or "Armadillo repeat ARM1 protein" or "arm" or "Arm1" and variations thereof means within the scope of the invention, a protein having one or more armadillo repeats ..

In a particularly preferred embodiment, the invention relates to a armadillo repeat ARM1 polypeptide has the activity shown in the examples has. In one embodiment, a protein is understood with a homology to a sequence shown in SEQ ID NO under a Armadillo repeat ARM1 Protein: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 or in figures amino acid sequence, for example an armadillo repeat ARM1 polypeptide from barley (HvARM) according to SEQ ID NO: 2 and / or rice (Oryza sativa) according to SEQ ID NO: 4, 6, 8, and / or 10, and / or from tobacco (Nicotiana tabacum) according to SEQ ID NO .: 12 and / or from A. thaliana shown in SEQ ID NO: 14 , 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, and / or 44, or in accordance with one of the consensus sequences shown in SEQ ID NO .: 60, 61 or 62 or a functional fragment thereof. In one embodiment, the invention relates to functional equivalents of the above-mentioned polypeptide sequences.

"Polypeptide amount" means, for example, the molecule number or moles of armadillo repeat ARM1 polypeptide molecules in an organism, a tissue, a cell or a cell compartment. "Degradation" of polypeptide refers to the molar number of reducing the Armadillo repeat ARM1 polypeptides, in particular in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 , 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 shown in an organism, a tissue, a cell or a cell compartment - for the comparison - for example by one of the methods described below a suitable control, for example the wildtype (control plant) same genus and species has not been applied to this method, under otherwise identical conditions (such as culture conditions, age of the plants, etc.). The reduction amounts to at least 5%, preferably at least 10% or at least 20%, particularly preferably at least 40% or 60%, very preferably at least 70% or 80%, most preferably at least 90%, 95% or 99%, and in particular 100%. Another object of the present invention, the generation of a Patho- is genresistenz by reducing the function or activity of an armadillo repeat ARM1 polypeptide comprising the sequences shown in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 or a homo- logs thereof and / or a polypeptide to such a homology of at least having 40% and / or a functional equivalent of the above polypeptides.

Homology between two nucleic acid sequences, the identity of the nucleic is acid sequence over the entire sequence length understood that (by comparison with the aid of the program algorithm GAP Wisconsin Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA; et Altschul al (1997) Nucleic Acids Res. 25: 3389 et seq.), setting the following parameters:

Gap Weight: 50 Length Weight: 3

Average Match: 10 Average Mismatch: 0

Having 1 sequence were comparable, upon comparison with the sequence SEQ ID NO:: By way of example, a sequence having a homology of at least 80% at the nucleic acid with the sequence SEQ ID NO 1 by the above program algorithm with the above parameter set, homology of at least 80%.

Homology between two polypeptides, the identity of the amino acid sequence over the entire sequence length, by comparison with the aid of the program algorithm GAP (Wisconsin Package Version 10.0, University of Wisconsin, Genetics Computer Group (GCG), Madison, USA), setting the following parameters is calculated:

Gap Weight: 8 Length Weight: 2

Average Match: 2,912 Average Mismatch: -2,003

a sequence having 2, understood upon comparison with the sequence SEQ ID NO:: By way of example, a sequence having a homology of at least 80% at the polypeptide having the sequence SEQ ID NO 2 by the above program algorithm with the above parameter set has a homology of has at least 80%.

In a preferred embodiment of the present invention, for example in a plant organ, plant tissue, a plant cell, or part of a plant cell, for example a plant-zenspezifischen organelle, the armadillo repeat ARM1 is in the plant or in a part of a plant, protein activity, function or polypeptide quantity reduced.

In one embodiment of the method of the invention the activity of a polypeptide containing at least one, preferably two or more Armadillo re- peats reduced.

In one embodiment, the polypeptide is reduced in a plant or in a part of the plant has no U box in the 5'-UTR.

By "Armadillo repeat" is a sequence understood the tandemly arranged copies of a degenerate sequence of about 42 amino acids encoding a three-dimensional structure for mediating protein-protein interactions (Azevedo et al. (2001) Trends Plant Sci. 6, 354-358). For example, the polypeptide which is employed in the inventive method, or polypeptide of the invention an activity that is involved in the intracellular signal transduction or in the regulation of gene expression in the context of cellular development processes.

The Armadillo repeat ARM1 protein is encoded, for example, comprising a nucleic acid molecule selected from the group consisting of a nucleic acid molecule consisting of:

a) nucleic acid molecule encoding a polypeptide set forth in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 36, 38, 42, 44, 60, 61 or 62 showed overall sequence comprises;

b) nucleic acid molecule which comprises at least one polynucleotide of the sequence according to SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33 , 35, 37, 39, 41, or 43 comprising;

c) nucleic acid molecule encoding a polypeptide whose sequence has an identity of 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97%, 98%, 99% or more to the sequences SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 comprising ;

d) nucleic acid molecule of (a) to (c), the functional for a fragment or an epitope of the sequences according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 encoding, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62;

e) nucleic acid molecule encoding a polypeptide which is recognized by a monoclonal antibody directed against a polypeptide which leküle by the Nukleinsäuremo- according to (a) encoding to (c), is detected; and

f) nucleic acid molecule which hybridizes under stringent conditions with a nucleic acid molecule according to (a) to (c) or their part-fragments consisting (of at least 15 nucleotides nt), preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt hybridized;

g) nucleic acid molecule which acid molecule according to (from a DNA library using a nucleic a) to (c) or their part-fragments of at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt can be isolated as a probe under stringent hybridization conditions;

or comprises a complementary sequence thereof, or is a functional equivalent thereof.

According to the invention the activity of said polypeptides in a plant or a part of a plant, preferably in the epidermis and / or mesophyll cells of a plant, as explained above, is reduced.

In one embodiment, the activity of ARM1 in lemma, palea and / or GIu- me is reduced.

Under Εpitop "refers to the specificity of the antibodies determining regions of an antigen (antigenic determinant).

Accordingly, an epitope is the part of an antigen that actually comes into contact with the antibody.

Such antigenic determinants are the regions of an antigen to which the T-TIMË receptors react and produce antibodies in the sequence, which specifically bind Antigene- determinant / epitope of an antigen. Antigens or the epi tope are therefore capable of the immune response of an organism with the result of the formation of specific - to induce antibody - directed against the epitope. Epitopes consist for example of linear sequences of amino acids in the primary structure of proteome inen, or complex secondary or tertiary protein structures. A hapten is understood to be a out of the context of the antigen epitope which is dissociated environment. Although haptens have an antibody directed against it by definition, haptens may not always be able to, for example, injection into an organism to induce an immune response. To this end, haptens are coupled to Trägermole- molecules. As an example, dinitrophenol was (DNP) mentioned that (bovine serum albumin) was directed to the production of antibodies against DNP after coupling to BSA. (Bohn, A., King, W. 1982). Haptens are therefore in particular (often small molecule or small) substances that trigger an immune response itself, but certainly if they were linked to a high molecular weight support.

Among the antibodies generated thus find those that can bind the hapten alone.

In one embodiment, the present invention relates to an antibody against a polypeptide characterized herein, in particular a monoclonal antibody of a polypeptide binds that comprises an AA sequence or consisting of sequences set forth in SEQ ID No: 2, 4, 6, 8 , are 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or 62 shown.

Antibodies in the context of the present invention can contribute to the identification and isolation of the present invention disclosed polypeptides from organisms, preferably plants, especially preferably monocotyledonous plants, can be used. The antibodies can also be synthetic both monoclonal, polyclonal, when, or consist of antibody fragments such as Fab, Fv or scFv fragments resulting from proteolytic degradation. "Single chain" Fv (scFv) fragments are single chain fragments containing connected via a flexible linker sequence, only the variable regions of the heavy and light antibody chains. Such scFv fragments can also be produced as recombinant antibody derivatives. A presentation of such antibody fragments on the surface of filamentous phages enables the direct selection te bind with high affinity scFv molecules from combinatorial phage libraries.

Monoclonal antibodies can be obtained according to the method described by Kohler and Milstein (Nature 256 (1975), 495).

"Functional equivalents" of an armadillo repeat ARM1 protein preferably means those polypeptides which are at the by the sequences SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26 , or polypeptides described 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 62 have a homology of at least 40%, and have substantially the same properties or possess functions. the homology is preferably 50%, 60%, 70%, 80%, 90%, more preferably 95%, 97%, 98%, 99% or more.

Functional equivalence may be determined under identical conditions as possible, for example, by comparing the phenotypes of the test organisms after expression of the respective polypeptides, or by reducing the expression or activity of the polypeptides to be compared in the source organisms. "Essentially the same properties" of a functional equivalent especially imparting a pathogen-resistant phenotype or imparting or increasing pathogen resistance to at least one pathogen in reduction of the polypeptide quantity, activity or function of said functional armadillo repeat ARM1 protein equivalent in a plant means, organ , tissue, part or cells, especially in epidermal or mesophyll cells of the same, preferably as measured by the penetration efficiency of a pathogen such as shown in the examples.

"Analogous conditions" are kept identical between the experiments to be compared is essentially that all conditions such as, for example, culture or growing conditions, assay conditions (such as buffer, temperature, substrates, Pathogenkonzentration etc.), and the approaches to be compared, the solely by the sequence Armadillo repeat ARM1 polypeptides, their origin organism and possibly distinguish the pathogen.

"Functional equivalents" also means natural or artificial mutation variants of the Armadillo repeat ARM 1 polypeptides according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 and homologous polypeptides from other monocotyledonous and dicotyledonous plants, which continue to have essentially identical properties. homologous polypeptides from herein described preferred plants are preferred. To the methods disclosed in this invention Armadillo repeat ARM1 protein sequences homologous sequences from other plants may be prepared by database search or by screening of gene banks for example - will be found easily - using the Armadillo repeat ARM1 protein sequences as search sequence or probe ,

Functional equivalents may also, for example, by one of the inventive poly peptide according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34 be 36, 38, 42, 44, 60, 61 or 62 by substitution, insertion or deletion and these polypeptides have a homology of at least 40%, 50, 60%, preferably at least 80%, preferably at least 90%, particularly preferably at least 95%, most preferably at least 98% and are characterized by substantially the same functional characteristics as the polypeptides according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62.

Functional equivalents also are those sequences of the invention Nukleinsäurese- according to SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 by substitution, insertion or deletion acid molecules derived nucleic, and have a homology of at least 40%, 50, 60%, preferably 80%, preferably at least 90%, more preferably at least 95%, most preferably at least 98% to any of polynucleotides of the invention as shown in SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, and encode polypeptides having essentially identical func- tional properties such polypeptides according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 , 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62nd

Examples of the present invention in the process to be reduced functional equivalents of the Armadillo repeat ARM1 proteins according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 can be, for example, from organisms whose genomic sequence is known, by homology comparisons find from databases.

Also, the screening of cDNA or genomic libraries of other organisms mechanisms, preferably as the host for the transformation of suitable plant species, using the SEQ ID No. of the specified below:, 1, 3, 5, 7, 9, 1 1, 13 sequences nucleic acid described 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 or parts thereof as a probe, is a common to the skilled worker to homologues in to identify other species. The have the nucleic acid sequence according to SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37 , 39, 41, or 43 have a length of at least 20 bp, preferably at least 50 bp, preferably at least 100 bp, very especially preferably at least 200 bp, most preferably at least 400 bp. The probe may also be one or more kilobases in length, for example 1 Kb, 1, 5 Kb or 3 Kb can For the screening of the libraries also a Sub-SEQ ID. No: 1, 3, 5, 7, 9, 1 1 , sequences 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 described complementary DNA strand, or a fragment thereof with a length between 20 bp and several kilo bases.

In the process of this invention also such DNA may be used molecules which hybridize under standard conditions with the by SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27 29, 31, 33, 35, 37, 39, 41, or 43 described and for armadillo repeat ARM 1 proteins encoding nucleic acid molecules, which encode complementary to these nucleic acid molecules or parts of the above and, as complete sequences, the substantially over the same properties, preferred functional properties as set forth in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36 , or polypeptides described 38, 42, 44, 60, 61, 62 have.

"Standard hybridization conditions" is to be understood broadly and means, depending on the application, stringent and less stringent hybridization conditions. Such hybridization conditions are, inter alia, in Sambrook J, Fritsch EF, Maniatis T et al., In Molecular Cloning (A Laboratory Manual), 2nd edition, Cold Spring Harbor Laboratory Press, 1989, pages 9:31 to 9:57) or in Current Protocols in Molecular bio- logy, John Wiley & Sons, NY (1989), 6.3.1-6.3.6. described.

The skilled person will choose hybridization conditions from his expert knowledge out, enabling it to differentiate between specific and non-specific hybridizations.

Example, the conditions may be selected during the washing step from low-stringency conditions (approximately 2X SSC at 50 ° C) and high-stringency conditions (approximately 0.2X SSC at 50 ° C preferably at 65 ° C) (2 O x SSC: 0 3M sodium citrate, 3M NaCl, pH 7.0). Moreover, the temperature during the washing step from low stringency conditions at room temperature, about 22 ° C, advertising up to higher-stringency conditions at approximately 65 ° C raised the. Both parameters, salt concentration and temperature can be varied simultaneously or individually, wherein the other parameter is kept constant. During hybridization, denaturing agents such as formamide or SDS can be used. In the presence of 50% formamide, hybridization is preferably carried out at 42 ° C. Some preferred conditions for hybridization and washing step are given below:

(1) Hybridization conditions can be selected for example from the following conditions:

a) 4X SSC at 65 ° C, b) 6X SSC at 45 ° C, c) 6X SSC, 100 ug / ml denatured, fragmented fish sperm DNA at 68 ° C, d) 6X SSC, 0.5% SDS, 100 ug / ml denatured salmon sperm DNA at 68 ° C, e) 6X SSC, 0.5% SDS, 100 ug / ml denatured, fragmented salmon sperm DNA, 50% formamide at 42 ° C. f) 50% formamide, 4XSSC at 42 ° C, or g) 50% (vol / vol) formamide, 0.1% bovine serum albumin, 0.1% Ficoll, 0.1% polyvinylpyrrolidone, 50 mM sodium phosphate buffer pH 6.5, 750 mM NaCl, 75 mM Natriumeitrate at 42 ° C, or h) 2X or 4X SSC at 50 ° C (low-stringency condition), i) 30 to 40% formamide, 2X or 4X SSC at 42 ° C (low-stringency condition) , j) 500 mN sodium phosphate buffer pH 7.2, 7% SDS (g / v), 1 mM EDTA, 10 ug / ml single stranded DNA, 0.5% BSA (w / v) (Church and Gilbert, Genomic sequencing. Natl Acad Sci USA 81 proc.... 1991 1984) (2) wash steps can be selected for example from the following conditions:

a) 0.015 M NaCl / 0.0015 M sodium citrate / 0.1% SDS at 50 ° C. b) 0.1X SSC at 65 ° C. c) 0.1 X SSC, 0.5% SDS at 68 ° C. d) 0.1X SSC, 0.5% SDS, 50% formamide at 42 ° C. e) 0.2X SSC, 0.1% SDS at 42 ° C. f) 2X SSC (at 65 ° C low-stringency condition).

In one embodiment, the hybridization conditions are selected as follows:

It is chosen a hybridization buffer comprising formamide, NaCl and PEG 6000.. The presence of formamide in the hybridization buffer destabilizes double-stranded nucleic acid molecules, whereby the hybridization temperature can be lowered to 42 ° C, without thereby reducing the stringency. The use of salt in the hybridization buffer increases the renaturation rate of a duplex DNA, or the hybridization efficiency. Although PEG increases the viscosity of the solution, which has a negative effect on renaturation rates, the concentration of the probe in the remaining medium is increased by the presence of the polymer in the solution, which increases the rate of hybridization. The composition of the buffer is:

I hybridization buffer 250 mM sodium phosphate buffer pH 7.2 1 mM EDTA 7% SDS (g / v) 250 mM NaCl 10 ug / ml ssDNA

5% polyethylene glycol (PEG) 6000 40% formamide

Hybridizations are performed at 42 ° C overnight. The filters are the next morning 3x min 2χSSC + 0.1% SDS for approx 10th washed.

In a further preferred embodiment of the present invention, an increase of resistance in the Inventive process according achieved in that

(A) is reduced by expressing at least one of the Armadillo repeat ARM1 protein;

(B) the stability of at least one of the Armadillo repeat ARM1 protein or corresponding to this Armadillo repeat ARM1 protein mRNA molecules is reduced;

(C) the activity of at least one of the Armadillo repeat ARM1 protein is reduced; (D) the transcription of at least one of the Armadillo repeat gene encoding a protein genes ARM1 is reduced by expression of an endogenous or artificial transcription factor; or

(E) an exogenous armadillo repeat ARM1 protein activity reducing factor is added to the food or the medium.

"Gene expression" and "expression" are synonymously to use and mean the realization of the information that is stored in a nucleic acid molecule. The reduction of the expression of a gene, therefore, includes the reduction of the polypeptide of the encoded protein, including the armadillo repeat ARM 1 polypeptide or the Armadillo repeat ARM1 protein function. The reduction of the gene expression of an armadillo repeat ARM1 protein gene can be -beispielsweise realized in many ways by one of the methodological below.

"Reduction", "decrease" or "decrease" is to be interpreted protein function well in conjunction with an armadillo repeat ARM1 protein or Armadillo repeat ARM1 and comprises the partial or essentially complete, based on different cell-biological mechanisms suppression or blocking of the functionality an armadillo repeat ARM1 polypeptide in a plant or egg nem derived part, tissue, organ, cells or seeds.

A reduction in the sense of the invention also comprises a quantitative reduction of an armadillo repeat ARM1 polypeptide to an essentially complete absence of the Armadillo repeat ARM1 polypeptide (ie lack of detectability of armadillo repeat ARM1 protein function or lack of immunological detectability of the Armadillo -Repeat ARM1 protein). The expression of a particular Armadillo repeat ARM1 polypeptide or the Armadillo repeat ARM1 protein function in a cell or an organism is preferably reduced by more than 50%, more preferably by more than 80%, very especially preferably by more than 90%, ( "control plant") has not been applied to this method as compared to a suitable control, ie, the wild type of the same type, for example of the same genus, species, variety, cultivar, etc., under otherwise substantially identical conditions (such as culture conditions, age the plants etc., reduced).

Various strategies for reducing the expression of an armadillo repeat ARM1 protein or Armadillo repeat ARM1 protein according to the invention are described function. The skilled artisan will recognize that a number of other methods are available to influence the expression of a polypeptide or Armadillo repeat ARM1 the Armadillo repeat ARM1 protein function in the desired manner. In one embodiment, a reduction in the armadillo repeat protein function ARM1 is achieved by using at least one method selected from the group of in the process of this invention:

a) introducing a nucleic acid molecule coding for ribonucleic acid molecules suitable (for the formation of double-stranded ribonucleic dsRNA), wherein the sense strand of the dsRNA molecule has at least homology of 30% to the inventive nucleic acid molecule, for example one of the nucleic acid molecules according SEQ ID No: 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, or encoding a sequence Consesnusse- as shown comprises or in SEQ ID NO .: 60, 61, or 62, a fragment of at least 17 base pairs, with at least 50% homology to an inventive nucleic acid molecule, for example according to SEQ ID No: 1, 3, 5, 7 , 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, or encoding a Consenussequenz as shown in SEQ ID

NO .: 60, 61, or 62 or a functional equivalent thereof having, or ensuring their expression border expression cassette or expression cassettes.

b) introducing a nucleic acid molecule coding for an antisense ribonucleic acid molecule which has at least a homology of 30% to the non-coding strand of the nucleic acid molecules of the invention, for example a nucleic acid molecule of S SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, or encoding a Conse- nussequenz as shown in SEQ ID NO .: 60, 61 or having 62 or a fragment of at least 15 base pairs, with at least 50% homology with a noncoding strand of a nucleic acid molecule of the invention, for example according to SEQ ID nO: 1, 3, 5, 7, 9, 11, 13, 15 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 or encoding as shown for a Consenussequenz in SEQ ID NO .: 60, 61, or a functional equivalent 62oder having the same. Includes those methods in which the antisense nucleic acid sequence against an armadillo repeat ARM1 protein gene (ie genomic DNA sequences) or a Armadillo repeat ARM1 protein gene transcript is directed (i.e. RNA sequences), respectively. are also included α- anomeric nucleic acid sequences.

c) introducing of a ribozyme which specifically by an inventive nucleic acid molecule Exemplified as shown in SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, or encoding a Consenussequenz as shown 60, 61, or 62, or encoded by the ribonucleic acid molecules functional Äquivaltenten cleaves in SEQ ID NO .: eg catalytically , or whose expression guaranteeing expression cassette. d) introducing an antisense nucleic acid molecule as specified in b) in combination with a ribozyme or an expression cassette ensuring expression.

e) introducing nucleic acid molecules coding for sense ribonucleic acid molecules of a polypeptide according to the invention, for example according to the sequences SEQ ID SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 polypeptides which zumin- least a 40% homology to the amino acid sequence of an inventive

comprise protein, or is a functional equivalent thereof.

f) introducing a nucleic acid sequence encoding suitable for a dominant-negative polypeptide to suppress the Armadillo repeat ARM1 protein function or an ensuring their expression expression cassette.

g) introducing a factor that specifically Armadillo repeat can bind ARM1 polypeptides or coding for these DNA or RNA molecules or of an expression cassette ensuring expression.

h) introducing a viral nucleic acid molecule, which causes a degradation of coding for armadillo repeat ARM1 protein mRNA molecules or of an expression cassette ensuring expression.

i) introducing a nucleic acid construct suitable for inducing a homologous recombination on genes coding for armadillo repeat protein ARM1.

j) introducing one or more mutations in one or more for armadillo repeat

ARM1 genes encoding proteins for generating a loss of function (for example generation of stop codons, shifts in the reading frame etc.)

Each of these methods may bring about a reduction in the armadillo repeat ARM1 protein expression or Armadillo repeat ARM1 protein function within the meaning of the invention. A combined use is also conceivable. Further methods are known to the skilled worker and can comprise the hindering or prevention of the processing of the Armadillo repeat ARM1 polypeptide, the transport of the armadillo repeat ARM1 polypeptide or its mRNA, inhibition of ribosomal attachment, inhibition of RNA splicing, induction of an armadillo repeat ARM 1 include protein RNA-degrading enzyme and / or inhibition of translational elongation or termination. A reduction of the Armadillo repeat ARM1 protein function - Polypeptidemenge is preferably achieved by a reduced expression of an endogenous protein gene armadillo repeat ARM1.

The individual preferred methods are briefly described below:

a) introducing a double-stranded armadillo repeat protein ARM1 RNA nucleic acid sequence (Armadillo repeat ARM1 protein dsRNA)

The method of regulating genes by means of double-stranded RNA ( "double-stranded RNA interference"; dsRNAi) has been described many times for animal and plant organisms (for example Matzke MA et al (2000) Plant Mol Biol 43: 401-415; Fire A. et al. (1998) Na- ture 391: 806-81 1; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035; WO 00/63364). Efficient gene suppression can also be demonstrated in transient expression or following transient transformation, for example as a result of a biolistic transformation (Schweizer P et al (2000) Plant J 2000 24:. 895-903). dsRNAi methods are based on the phenomenon that the simultaneous introduction of complementary strand and counterstrand of a Gentranskrip- tes a highly efficient suppression of the expression of the corresponding gene is loading acts. The phenotype caused a corresponding knock-out mutants very close (Waterhouse PM et al (1998) Proc Natl Acad Sci USA. 95: 13959-64).

The dsRNAi method has in the reduction of protein expression proved to be particularly efficient and advantageous (WO 99/32619).

With respect to the double-stranded RNA molecules Armadillo repeat means preferably one of the sequences according to SEQ ID No ARM1 pro- tein nucleic acid sequence: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, or encoding a Consenussequenz as shown frequencies 60, 61, or 62 or Se in SEQ ID NO .: that in these are substantially identical, preferably at least 50%, 60%, 70%, 80% or 90% or more, for example about 95%, 96%, 97%, 98% or 99% or more, or fragments thereof comprising at least 17 base pairs in length are. "Substantially identical" means here that the dsRNA sequence may also have insertions, deletions and individual point mutations in comparison to the Armadillo repeat ARM1 protein target sequence while still bringing about an efficient reduction of the expression. In one embodiment, the homology is as defined above at least 50%, for example about 80%, or about 90%, or about 100%, between the "sense" strand of an inhibitory dsRNA and a part portion of an armadillo repeat ARM1 protein nucleic acid sequence (or be- see the "antisense" strand and the complementary strand of a armadillo repeat ARM1 protein nucleic acid sequence). The length of the partial section is about 17 bases or more, for example approximately 25 bases, or about 50 bases, about 100 bases, about 200 bases or about 300 bases. Alternatively, a "substantially identical" dsRNA may also be defined as a nucleic acid sequence which is capable of hybridizing with part of an armadillo repeat ARM1 protein gene transcript under stringent conditions.

Also, the "antisense" RNA strand may have insertions, deletions and individual point mutations in comparison to the complement of the "sense" RNA strand. Preferably, the homology is at least 80%, for example about 90%, or about 95%, or about 100%, between the "antisense" RNA strand and the complement of the "sense" RNA strand.

"Subsection of the" sense "RNA transcript" of a nucleic acid molecule encoding an armadillo repeat ARM1 polypeptide or a functional equivalent thereof means fragments of an RNA or mRNA transcribed from a for armadillo repeat ARM1 polypeptide or a functional equivalent thereof encoding nucleic acid molecule, preferably a armadillo repeat ARM 1 protein Gen. The fragments preferably have a sequence length of about 20 bases or more, for example approximately 50 bases, or approximately 100 bases, or approximately 200 bases, or approximately 500 bases. Also comprised is the complete transcribed RNA or mRNA.

The dsRNA may consist of one or more strands of polymerized ribonucleotides exist. It can furthermore be present modifications of both the sugar-phosphate backbone and of the nucleosides. For example, the phosphodiester linkages of natural RNA may be modified in that they comprise at least one nitrogen or sulfur hetero atom. Bases can be modified to the effect that the activity is, for example, limited by adenosine deaminase. These and other modifications are described below in the methods for stabilizing antisense RNA.

Of course, can be introduced into the cell or organism to achieve the same purpose, a plurality of individual dsRNA molecules, the sequence segments in each case comprise one of the above-defined ribonucleotide.

The dsRNA can be produced enzymatically or wholly or partly by chemical synthesis.

If the two strands of the dsRNA in a cell or plant are brought together, this can be done in different ways:

a) transformation of the cell or plant with a vector comprising both expression cassettes, b) cotransformation of the cell or plant with two vectors, where one comprises the expression cassettes with the "sense" strand, the other the expression cassettes with the "antisense" - strand comprises, and / or

c) crossing two plants which have been transformed with one vector, where one comprises the expression cassettes with the "sense" strand and the other comprising the expression cassettes with the "antisense" strand.

The formation of the RNA duplex can be either outside the cell or be initiated within the same. As described in WO 99/53050, the dsRNA can also comprise a hairpin structure by "sense" - and "anti-sense" strand (for example an intron) are joined by a "linker". The self-complementary dsRNA structures are preferred since they only require the expression of a construct and always comprise the complementary strands in an equimolar ratio.

The expression cassettes encoding the "antisense" - or "sense" strand of a dsRNA or the self-complementary strand of the dsRNA are preferably inserted into a vector and, using the methods described below (beispielswei- se using selection markers) in the genome of a plant inserted to ensure permanent expression of the dsRNA.

The dsRNA can be introduced using an amount which enables at least one copy per cell. Higher amounts (for example at least 5, 10, 100, 500 or 1000 copies per cell) may bring about more efficient reduction.

A 100% sequence identity between dsRNA and a gene transcript Armadillo repeat ARM1 protein or the gene transcript of a functionally equivalent gene is a possible embodiment, but not absolutely necessary in order to effect an efficient reduction of the Armadillo repeat ARM1 protein expression. Accordingly, there is the advantage that the method is tolerant to sequence deviations as may be present as a result of genetic mutations, polymorphisms or evolutionary divergences. The large number of highly conserved amino acid residues among various armadillo repeat ARM1 protein sequences of different plants - as shown in the figures on the basis of consensus sequences - suggesting a high degree of conservation of this polypeptide within plants, so that expression of a dsRNA derived from one of the disclosed Armadillo repeat ARM1 protein sequences according to SEQ SEQ. ID No: SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 also will have a beneficial effect in other plant species. It may also be possible due to the large number of conserved residues and the homology between the individual Armadillo repeat ARM1 polypeptides and their functional equivalents, with a single dsRNA sequence starting from a particular Armadillo repeat ARM1 protein sequence of an organism generated, to suppress the expression of further homologous Armadillo repeat ARM1 polypeptides and / or their functional equivalents of the same organism, or the expression of armadillo repeat ARM1 polypeptides in other related species. For this purpose, the dsRNA preferably comprises sequence regions of armadillo repeat ARM1 protein gene transcripts which correspond to conserved regions. Said conserved regions can be readily derived from sequence comparisons, z. As shown in the Fiquren. Preferably, sequences are derived from those displayed in the figures conserved regions of the consensus sequence dsRNA. are considered particularly conserved regions: AA702 to AA739, AA742 and AA752, AA760 and AA762, AA771 to 779, AA789 to AA790, AA799 and AA821, AA829 and AA843, AA879 and AA905, AA924 and AA939 the consensus sequence shown in the figures.

A dsRNA can be synthesized chemically or enzymatically. Cellular RNA polymerases or bacteriophage RNA polymerases can be used (such as T3, T7 or SP6 RNA polymerase). Suitable methods for the in vitro expression of RNA are described (WO 97/32016; US 5,593,874; US 5,698,425, US 5,712,135, US 5,789,214, US 5,804,693). A chemically or enzymatically synthesized in vitro dsRNA can rese prior to introduction into a cell, tissue or organism from the reaction mixture for example by extraction, precipitation, electrophoretic be purified chromatography or combinations of these methods completely or partially. The dsRNA can be introduced directly into the cell or else be applied extracellularly (for example into the interstitial space).

However, the plant of the dsRNA is preferably stably with an expression construct, the pression the ex realized transformed. Appropriate processes are described further below.

b) Introduction of an armadillo repeat ARM1 protein antisense nucleic acid sequence

Methods for suppressing a specific polypeptide by preventing the accumulation of its mRNA by the "antisense" technology are in many cases - even in plants - (Sheehy et al (1988) Proc Natl Acad Sci USA 85: 8805-8809; US 4,801, 340th .; mol JN et al (1990) FEBS Lett 268 (2): 427-430). The antisense nucleic acid molecule hybridizes with, or binds to, the cellular mRNA and / or genomic DNA encoding the target polypeptide to be suppressed callose synthase. Characterized the transcription and / or translation of the target polypeptide is suppressed. The Hybri- can zation in a conventional manner via the formation of a stable duplex, or - by binding the antisense nucleic acid molecule to the duplex of the genomic DNA by specific interaction in the large groove of the DNA helix - in the case of genomic DNA.

An antisense nucleic acid molecule suitable for reducing an armadillo repeat ARM1 polypeptide, for example, the inventive nucleic acid molecule according to SEQ ID No can acid sequence using the coding for this polypeptide nuc: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 or a nucleic acid molecule thereof, are derived according to the base pairing rules of Watson and Crick coding for a functional equivalent. The antisense nucleic acid molecule can be complementary to the entire transcribed mRNA of said polypeptide, are limited to the coding region or only consist of one oligonucleotide, which is complementary to a portion of the coding or non-coding sequence of the mRNA. Thus, the oligonucleotide may, for example, be complementary to the region encompassing the translation start for said polypeptide. Antisense nucleic acid molecules may have a length of, for example 20, 25, 30, 35, 40, 45 or 50 nucleotides have, but may also be longer and 100, 200 include 500, 1000, 2000 or 5000 nucleotides. Antisense nucleic acid molecules can be synthesized recombinantly expressed, or chemically or enzymatically using methods known to the skilled worker. In the chemical synthesis, natural or modified nucleotides can be used. Modified nucleotides can impart the antisense nucleic acid molecule increased biochemical stability and increased physical see stability of the duplex formed of antisense nucleic acid sequence and target sequence sense- lead. can be used, for example, phosphorothioate derivatives and acridine substitierte nucleotides such as 5-fluorouracil, 5-bromouracil, 5-Chlorouracil, 5- lodouracil, hypoxanthine, xanthine, 4-acetylcytosine, 5- (carboxy-hydroxylmethyl) uracil, 5- carboxymethylaminomethyl-2- thiouridine, 5-carboxymethylaminomethyluracil, di- hydrouracil, ß-D-Galactosylqueosin, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylamino-methyluracil, 5- methoxyaminomethyl-2-thiouracil, beta-D-mannosyl queosine, 5'Methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5-oxyacetic acid, pseudouracil, Queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid, 5-methyl- 2-thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil and 2,6-diaminopurine.

In a further preferred embodiment, the expression of an armadillo repeat ARM1 polypeptide can be inhibited by nucleic acid molecules that are complementary to a conserved (for example, as described above) or a region of a regulated latorischen Armadillo repeat ARM1 protein gene (eg, an armadillo repeat ARM1 protein promoter and / or enhancer) and which form triple-helical structures with the DNA double helix so that the transcription of the armadillo repeat ARM1 protein gene is reduced. Such methods have been described ben (Helene C (1991) Anticancer Drug Res 6 (6): 569-84; Helene C et al (1992) Ann NY Acad Sci 660:. 27-36; mower LJ (1992) Bioassays 14 ( 12): 807-815).

In another embodiment, the antisense nucleic acid molecule can be an α- anomeric nucleic acid. Such α-anomeric nucleic acid molecules form specific double-stranded hybrids fish with complementary RNA in which - in contrast to the conventional beta-nucleic acids - the two strands run parallel to each other (Gautier C et al (1987) Nucleic Acids Res 15: 6625-6641.) , The antisense nucleic acid molecule can furthermore also comprise 2'-O-methylribonucleotides (Inoue et al (1987) Nucleic Acids Res. 15: 6131-6148) or chimeric RNA-DNA analogs include (Inoue et al (1987) FEBS Lett. 215: 327- 330).

c) introducing of a ribozyme which specifically coding for armadillo repeat protein ribonucleic acid cleaves, for example catalytically.

Catalytic RNA molecules or ribozymes can be adapted to any target RNA and cleave the phosphodiester backbone at specific positions, whereby the target RNA is functionally disabled (Tanner NK (1999) FEMS Microbiol Rev 23 (3): 257 -275). The ribozyme is not itself modified, but is capable of cleaving further target RNA molecules in an analogous, thus acquiring the properties of an enzyme.

are used to the mRNA of an enzyme to the supprimieren- to split and prevent translation - - eg callose synthases: (585-591 (1988) Nature 334 Haselhoff and Gerlach eg Ηammerhead "ribozymes) In this manner, ribozymes . methods of expressing ribozymes for reducing specific polypeptides have been described (EP 0291533, EP 0321201, EP 0360257). in plant cells, a ribozyme expression has also been described (Steinecke P et al. (1992) EM - BO J 11 (4):... 1525-1530; de Feyter R et al (1996) mol Gen Genet 250 (3): 329-338), ribozymes can be identified by a selection process from a library of diverse ribozymes (Bartel D and Szostak JW (1993) Science. 261: 141 1-1418) Preferably, the binding regions of the ribozyme to hybridize to the conserved regions of the ARM-protein as described above.

d) Introduction of an armadillo repeat ARM 1 protein antisense nucleic acid sequence combined with a ribozyme. Advantageously, the above-described antisense strategy can be coupled with a ribozyme method. The incorporation of ribozyme sequences into "antisense" RNAs imparts these same "antisense" RNAs this enzyme-like, RNA-cleaving property and thus increases their efficiency in inactivating the target RNA. The manufacture and use of suitable ribozyme "antisense" RNA molecules is described, for example in Haseloff et al. (1988) Nature 334: 585-591.

The ribozyme technology can increase the efficiency of an antisense strategy. Overall suitable target sequences and ribozymes can be for example as described in "Steinecke P, Ri bozymes, Methods in Cell Biology 50, Galbraith et al. Eds, Academic Press, Inc. (1995), pp 449-460", by calculating the secondary structure are determined by ribozyme and target RNA and by their interaction (Bayley CC et al (1992) Plant mol Biol 18 (2): 353-361; Lloyd AM and Davis RW et al (1994) mol Gen Genet.... 242 (6): 653-657). For example, derivatives of the Tetrahymena L-19 IVS RNA can be constructed complementary regions to the mRNA of the supprimieren- to the Armadillo repeat ARM1 protein comprise (see also US 4,987,071 and US 5,116,742).

e) Introduction of an armadillo repeat protein ARM1 sense nucleic acid sequence for inducing a cosuppression

The expression of an armadillo repeat protein ARM1 nucleic acid sequence in sense orientation can lead to cosuppression of endogenous corresponding homologous gene. The expression of sense RNA with homology to an endogenous gene can reduce the expression of the same or off, similar to that described for antisense approaches (Jorgensen et al (1996) Plant Mol Biol 31 (5): 957-973; Goring et. .. 279-289; Van der Krol: al (1991) Proc Natl Acad Sci USA 88: 1770-1774;; Smith et al (1990) mol Gen Genet 224th 447-481 Napoli et al (1990) Plant Cell 2 . et al (1990) Plant Cell 2: 291-99). Here, the introduced construct the homologous gene to be reduced represent all or only partially. The possibility of translation is required. The application of this technology to plants is described for example by Napoli et al. (1990) The Plant Cell 2: 279-289 and US 5,034,323.

The cosuppression is preferably realized using a sequence which is substantially identical to at least the same part of the nucleic acid sequence encoding an armadillo repeat ARM1 protein or a functional equivalent, for example, the nucleic acid molecule of the invention, including the nucleic acid sequence according to SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 or the nucleic acid sequence coding for a functional equivalent thereof. f) introduction of nucleic acid sequences encoding a dominant-negative protein Armadillo repeat ARM1.

The reduction of the activity of an armadillo repeat ARM1 protein can probably also be realized by expression of a dominant-negative variant of this protein Armadillo repeat ARM1. A process for reducing the function or activity of a polypeptide by means of coexpression of its dominant-negative form are known in the art (Lagna G and Hemmati-Brivanlou A (1998) Current Topics in De- velopmental Biology 36: 75-98; Perlmutter RM and Alberola- Ila J (1996) Current Opini- on in Immunology 8 (2): 285-90; Sheppard D (1994) American Journal of Respiratory Cell & Molecular Biology 1 1 (1): 1-6.; Herskowitz I (1987) Nature 329 (6136): 219-22).

A dominant-negative armadillo repeat ARM1 protein variant can be made that are part of the armadillo repeat ARM1 are and as their mutation the polypeptide loses its function, for example by changing amino acid residues. Preferably to be mutated amino acid residues are those that are conserved in the Armadillo repeat ARM1 proteins of different organisms. Such conserved regions can be, for example, by computer-aided comparison ( "A- lignment") determined. These mutations for achieving a dominant-negative armadillo repeat ARM1 protein variant are preferably at the level of the nucleic acid sequence coding for armadillo repeat proteins ARM1 performed. A corresponding mutation can be, for example, by PCR-mediated in vitro mutagenesis using suitable oligonucleotide primers, by means of which the desired mutation is introduced can be realized. These common methods are used in the art. For example, (Kyoto Takara Shuzo,) can be used for this purpose, the "LA PCR in vitro Mutagenesis Kit".

g) Introduction of armadillo repeat ARM1 protein genes, RNAs or polypeptide binding factors.

A reduction of an Armadillo repeat ARM1 protein / gene expression is gertranskriptionsfaktoren with specific DNA binding factors, eg factors of the zinc finger transcription possible. These factors attach to the genomic sequence indicative of the endogenous target gene, preferably in the regulatory regions, and bring about repression of the endogenous gene. The use of such a method enables the reduction of the expression of an endogenous armadillo repeat ARM1 protein gene, without the sequence must be engineered. Corresponding methods for producing corresponding factors are described (Dreier B et al (2001) J Biol Chem 276 (31): 29466-78; Dreier B et al (2000) J Mol Biol 303 (4):. 489-502; Beerli. RR et al (2000) Proc Natl Acad Sci USA 97 (4):.. 1495-1500; Beerli RR et al (2000) J Biol Chem 275 (42):. 32,617 to 32,627; Segal DJ and Barbas CF 3rd (2000 ) Cum Opin Chem Biol 4 (1): 34-39; Kang and Kim JS JS (2000) J Biol Chem 275 (12): 8742-8748; Beerli RR et al (1998) Proc Natl Acad Sci USA 95 (25th . 215-218; Tsai SY et al: -:;:) 14628- 14633 Kim JS et al (1997) Proc Natl Acad Sci USA 94 (8) A Klug (1999) J mol Biol 293 (2) 3620 3616. (1998) Adv Drug DENV Rev 30 (1-3):. 23-31; Mapp AK et al (2000) Proc Natl Acad Sci USA 97 (8): 3930-3935; Sharrocks AD et al (1997) Int J. Biochem Cell Biol 29 (12): 1371-1387; Zhang L et al (2000) J Biol Chem 275 (43). 33850-33860).

The selection of these factors can be carried out using a suitable piece of an Armadillo repeat protein gene ARM1. Preferably, this portion is located in the region of the promoter region. For gene suppression, it can also be in the region of the coding exons or introns. The corresponding portions are skilled in the art by database search of the Genbank or - starting from an armadillo repeat protein ARM1 cDNA whose gene is not present in the library - by screening a genomic library for corresponding genomic clones. The required processes are familiar to the expert.

Moreover, factors may be introduced into a cell, which inhibit the armadillo repeat protein ARM1 target polypeptide itself. The polypeptide-factors such as aptamers (Famulok M and Mayer G (1999) Curr Top Microbiol Immunol 243: 123-36) or antibodies or antibody fragments. The extraction of these factors is described and known in the art. For example, a cy- toplasmatischer scFv antibody was employed to increase the activity of the phytochrome A proteome (to modulate in genetically modified tobacco plants (Owen M et al (1992) Biotechnology NY) 10 (7):. 790-794; Franken E et al. (1997) Curr Opin Biotechnol 8 (4): 41 1-416; Whitelam (1996) trend Plant Sci 1: 286-272).

Gene expression can also be tailor-made low-molecular-weight synthetic see suppressing compounds, for example of the polyamide type (Dervan PB and Bürli RW (1999) Current Opinion in Chemical Biology 3: 688-693; Gottesfeld JM et al (2000) Gene Expr. 9 (1-2): 77-91). These oligomers consist of 3- (dimethylamino) propylamine, N-methyl-3-hydroxypyrrole, N-methylimidazole and N-methylpyrrole from the building blocks and can be adapted to each piece of double-stranded DNA so that they bind sequence-specifically in the major groove and the expression block of the gene sequences therein. Corresponding methods are described (see, inter alia, Bremer RE et al (2001) Bioorg Med Chem 9 (8): 2093-103; Ansari AZ et al (2001) Chem Biol 8 (6):.... 583-92; Gottesfeld . JM et al (2001) J mol Biol 309 (3): 615-29; Wurtz NR et al (2001) Org Lett 3 (8):. 1201-3; Wang CC et al (2001) Bioorg Med. Chem. 9 (3): 653-7; Urbach AR and Dervan PB (2001) Proc Natl Acad Sci USA 98 (8): 4343-8; Chiang SY et al (2000) J Biol Chem 275 (32): 24246-.. 54). h) Introduction of the Armadillo repeat ARM1 protein RNA degradation causing viral nucleic acid molecules and expression constructs.

The Armadillo repeat ARM1 protein expression can effectively by inducing the specific armadillo repeat ARM1 protein RNA degradation by the plant with the aid of a viral expression system (amplicon) (Angell, SM et al. (1999) Plant J. 20 (3) : realized 357-362). also referred to as "VIGS" (viral induced gene silencing) - - These systems bring nucleic acid sequences with homology to the transcripts to be suppressed by means of viral vectors into the plant. The transcription tion is then - presumably mediated by plant defense mechanisms against viruses - off. Suitable techniques and methods are described (Ratc- Liff F et al (2001) Plant J 25 (2): 237-45; Fagard M and Vaucheret H (2000) Plant Mol Biol 43 (2-3):. 285-93; . Anandalakshmi R et al (1998) Proc Natl Acad Sci USA 95 (22): 13079-84; Ruiz MT (1998) Plant Cell 10 (6): 937-46).

The methods of the dsRNAi, cosuppression by means of sense RNA and the "VIGS" ( "virus-induced gene silencing") are also referred to as "post-transcriptional gene silencing" (PTGS). PTGS methods are particularly advantageous because the demands on the homology between the endogenous gene to be suppressed and the transgenically expressed sense or dsRNA nucleic acid sequence are less than for example a traditional antisense approach. Corresponding homology criteria are mentioned in the description of the dsRNAI method and can generally be applied to PTGS methods or dominant-negative approaches. Due to the high homology between the Armadillo repeat ARM1 proteins from corn, wheat, rice and barley that polypeptide can be closed in plants to a high degree of conservation. So you can probably using armadillo repeat ARM1 protein-nucleic acid molecules such as shown herein, in particular through derived from the consensus sequences nucleic acid molecules or eg of the nucleic acid molecules from Arabidopsis, barley, maize or rice, the expression of homologous armadillo Repeat ARM1 polypeptides effectively suppress other species without the isolation and structure elucidation of the Armadillo repeat ARM1 protein homologues would be mandatory. This significantly facilitates the work.

i) introducing a nucleic acid construct suitable for inducing a homologous recombination on genes coding for armadillo repeat proteins ARM1 - for example for generating knockout mutants.

For producing a homologous recombinant organism with reduced armadillo repeat ARM1 protein function, for example, uses a nucleic acid construct strukt, which includes at least a portion of an endogenous Armadillo repeat ARM1 protein gene by a deletion, addition or substitution of at least one nucleotide - Example, in the conserved regions - is altered so that the functionality is reduced or completely eliminated.

For example, the primary, secondary, tertiary, or quaternary structure may be disrupted, for example, so that the one or more Bindungsfähikgeit armadillo repeats is no longer present. Such a disorder can be effected for example by the mutation of one or more residues that are highlighted in the consensus sequence as a conserved or highly conserved.

The change may involve (for example the promoter) of the gene and the regulatory elements, so that the coding sequence expression (transcription and / or translation) will remain unchanged, however, is omitted and is reduced.

In the conventional homologous recombination, the modified region is flanked at its 5 'and 3' end by further nucleic acid sequences, which must have a sufficient length for allowing the recombination. The length is usually in a range of several hundred or more bases up (to several kilobases Thomas KR and Capecchi MR (1987) Cell 51: 503; Strepp et al (1998) Proc Natl Acad Sci USA 95 (8).: 4368 to 4373). for example a plant - - for homologous recombination, the host organism is transformed with the recombination construct using the methods described below and successfully recombined clones selected using, for example, an antibiotic or herbicide resistance.

j) introduction of mutations into endogenous Armadillo repeat ARM1 protein genes for generating a loss of function (for example generation of stop codons, shifts in the reading frame etc.)

Further suitable methods for reducing the Armadillo repeat ARM1 protein function are the introduction of nonsense mutations into endogenous Armadillo repeat ARM1 protein genes, for example by generating knockout mutants with the aid of, for example, T-DNA mutagenesis (Koncz et al. (1992) Plant mol Biol 20 (5): 963-976), ENU (N-ethyl-N-nitrosourea) - mutagenesis or homoiger recombination (Hohn B and Puchta (1999) H Proc Natl Acad Sci USA 96: 8321- 8323rd) or EMS Mutagene- se (Birchler JA, Schwartz D. Biochem Genet 1979 Dec; 17 (11-12.): 1173-80; Hoffmann GR Mutat Res 1980 Jan; 75 (1):.. 63-129 ). Point mutations can be generated by means of DNA-RNA hybrid oligonucleotides, which are also known as "chimeraplasty" (Zhu et al (2000) Nat Biotechnol 18 (5):. 555-558, Cole-Strauss et al (1999) Nucl Acids. Res 27 (5): 1323-1330; Kmiec (1999) Gene therapy American Scientist 87 (3): 240- 247). The cell or tissue-specific reduction of the activity of a sARM1 may for example be effected by a suitable construct that an above-mentioned nucleic acid molecule, for example, is expressed with a suitable tissue-specific promoter, for example, the antisense RNA, dsRNA, RNAi, ribozyme, for example, a promoter as described herein to be specific for epidermis or mesophyll.

"Mutations" within the meaning of the present invention acid sequence of a gene variant in a plasmid or in the genome of an organism, the modification of the nucleic. Mutations can for example arise as a result of errors during the replication or caused by mutagens. The rate of spontaneous mutations in the cell genome organisms is very low, but a variety of biological, chemical or physical mutagens are known to the skilled professional.

Mutations comprise substitutions, additions, deletions of one or more nucleic acid residues. Substitutions are understood leinsäurebasen the exchange of individual nucleic, one distinguishes between transitions (substitution of a purine base for a purine base or a pyrimidine for a pyrimidine base) and transversions (substitution of a purine to a pyrimidine base (or vice versa).

By addition or insertion is defined as the incorporation of additional nucleic acid residues in the DNA, which may cause shifts in the reading frame. In such frameshifts a distinction between "in frame" insertions / additions and "out of frame" insertions. The "in-frame" insertions / additions, the reading frame is maintained and enlarged by the number of proteins encoded by the inserted nucleic acids amino acid polypeptide is produced. In "out of frame" insertions / additions, the original reading frame is lost and the formation of a complete and functional polypeptide, in many cases, of course, depending on the location of the mutation no longer possible.

Deletions describe the loss of one or more base pairs, which likewise lead to "in frame" or "out of frame" shifts in the reading frame and the associated consequences regarding the formation of an intact protein.

The usable for generating random or targeted mutations mutagenic agents (mutagens) and the applicable methods and techniques are

known specialist. Such methods and mutagens are described for example in AM van Harten [(1998), "Mutation breeding: theory and practical applications", Cambridge University Press, Cambridge, UK], E Friedberg, G Walker, W boiling [(1995), "DNA re- pair and Mutagenesis ", Blackwell Publishing], or K. Sankaranarayanan, JM Genti- Ie, LR Ferguson [(2000)," Protocols in Mutagenesis ", Elsevier Health Sciences]. For the introduction of targeted mutations common molekulabiologische methods and procedures such as in vitro mutagenesis kits, LA PCR in vitro mutagenicity can nesis Kit "(Takara Shuzo, Kyoto), or PCR mutagenesis can be used using geeigen- ter primer.

As stated above, there are a variety of chemical, physical and biological mutagens.

The listed below are by way of example but not by limitation.

Chemical mutagens can be divided according to their mechanism of action. Thus, there are base analogues (ZB5-bromouracil, 2-aminopurine), mono- and bifunctional alkylated-regulating agents (eg monfunktionale such as ethyl methyl sulfonate, dimethyl sulfate, or bifunctional like dichloroethyl, Mitomycin, Nitrosoguanidine - dialkylnitrosamine, N- nitrosoguanidine derivatives) or intercalating substances (such as acridine, ethidium bromide).

Physical mutagens are for example ionizing radiations. Ionizing radiations are electromagnetic waves or particle which are capable of ionizing molecules, ie to remove from these electrons. can thereby induce mutations cause the residual ions are usually very reactive, so that, if they occur in living tissue, for example, great damage to the DNA, and (at low intensity). Ionizing radiations include gamma rays (photon energy of about one MeV Mega electron volts), X-rays (photon energy of several or many kiloelectronvolts keV) or ultraviolet light (UV light, photon energy of about 3.1 eV). UV light causes the formation of dimers between bases are most commonly thymidine dimers, caused by the mutations.

The classic generation of mutants by treating the seeds with mutagenized-stabilizing agents such as ethyl methyl sulfonate (EMS) (Birchler JA, Schwartz D. Biochem Genet 1979 Dec; 17 (11-12):.. 1173-80; Hoffmann GR Mutat Res. 1980 Jan; 75 (1): 63-129), or ionizing radiation has (for example, Tn5, Tn903, Tn916, Tn1000, Balcells et al, 1991, May BP et al (2003..) by the use of biological mutagens, for example, transposons Proc Natl Acad Sci US A. September 30; 100 (20):. 1 1541-6), or molecular biological methods, such as mutagenesis by T-DNA insertion (Feldman, KA Plant J. 1: 71-82.1991, Koncz et al (. 1992) Plant mol Biol 20 (5): 963-976 been expanded).

the use of chemical or biological mutagens to produce mutated gene variants is preferred. In the case of chemical agents, the production of mutants through the use of the EMS is especially preferred (ethyl methyl sulfonate) mutagenesis mentioned. the T-DNA mutagenesis or Transposonmuta- is preferably genesis called by the generation of mutants using biological mutagens.

Thus, such polypeptides for the inventive method can be used for example, which is a result of a mutation of a polypeptide, for example, according to the invention as shown in SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 24, 26, 28, 30, 32, 34, 36, 38, 42, 44, 60, 61 or 62 receives.

All substances and compounds which directly or indirectly, a reduction of the Po lypeptidmenge cause RNA quantity, gene activity or a polypeptide armadillo repeat ARM1 protein, in this application, under the name "anti armadillo repeat protein ARM1 compounds" summarized. The term "anti-Armadillo repeat protein compound ARM1" explicitly includes the next in the above loading method described for use nucleic acid sequences, peptides, proteins or other factors.

In a further preferred embodiment of the present invention is an increase in the resistance to pathogens from the families of Blumeriaceae, Pucciniaceae, Mycosphaerellaceae and Hypocreaceae in a mono- or dicotyledo- NEN plant, or an organ, tissue or a cell thereof, achieved by:

a) introducing a recombinant expression cassette comprising, in functional linkage with a promoter active in plants an "anti-Armadillo repeat ARM1 protein compound" in a plant cell;

b) regeneration of the plant from the plant cell, and

c) expression of said "anti-Armadillo repeat ARM1 protein compound" in an amount and for a time sufficient to a pathogen resistance in said

generating plant or to increase.

"Transgenic" means, for example with respect to a nucleic acid sequence, an expression cassette or a vector comprising said nucleic acid sequence or an organism transformed with said nucleic acid sequence, expression cassette or vector, all those constructions brought about by recombinant methods or organisms in which either

a) the Armadillo repeat ARM1 protein nucleic acid sequence, or b) (a) and (b) are not functionally linked to the Armadillo repeat ARM1 protein nucleic acid sequence genetic control sequence, for example a promoter, or c) in their natural genetic environment or have been modified by recombinant methods, wherein the modification example, a substitution, addition, deletion, or insertion of one or more nucleotide residues (s) can be. Natural genetic environment means the natural chromosomal locus in the original organism or the presence in a genomic library. In the case of a genomic library, the natural genetic environment of the Nukleinsäurese- is frequency preferably at least partially preserved. The environment flanks the nucleic acid sequence at least on one side and has a sequence length of at least 50 bp, preferably at least 500 bp, particularly preferably at least 1000 bp, very particularly preferably at least 5000 bp. A naturally occurring expression cassette - for example the naturally occurring combination of the armadillo repeat ARM1 protein promoter with the corresponding Armadillo repeat ARM1 protein gene - becomes a transgenic expression cassette when the latter by non-natural, synthetic ( "artificial") methods such as for example, a Mutagenisie- tion is changed. Corresponding methods are described (US 5,565,350; WO 00/15815).

in the context of the invention, "introducing" encompasses all processes which are suitable for an "anti-Armadillo repeat ARM1 protein compound", directly or indirectly, into a plant or a cell, compartment, tissue, organ or seed to introduce the same or there to to generate. Direct and indirect methods. The introduction can lead or a temporary (transient) presence of an "anti-Armadillo repeat ARM1 protein compound" "(for example a dsRNA) but (stable) also to a permanent.

According to the different nature of the approaches described above, the "anti Armadillo repeat ARM1 protein compound" exert its function directly (for example by insertion into an endogenous Armadillo repeat ARM1 protein gene). but the function (for example, in antisense approaches) or by transcription and translation into a protein are applied (for example, binding factors) and indirectly after transcription into an RNA. Both direct and indirectly acting "anti-callose synthase compounds" are included in the invention.

"Introduction" includes in the context of the present specification, for example methods such as transfection, transduction or transformation.

"Anti Armadillo repeat ARM1 compound" thus encompasses, for example, also rekom- binante expression constructs, the expression (ie transcription and possibly trans- lation), for example, an armadillo repeat ARM1 protein dsRNA or Armadillo repeat ARM1 protein "antisense" - RNA - preferably in a plant or a part, tissue, organ or seed thereof - condition. In said expression constructs / expression cassettes is a Nukleinsäuremo- lekül whose expression (transcription and, if appropriate, translation) an "anti armadillo repeat ARM1 protein compound" is generated, preferably in operable linkage with at least one genetic control element (e.g. a promoter) which ensures expression ensured in plants. If the expression construct is introduced directly into the plant and the "anti Armadillo repeat ARM1 protein compound" (for example, the armadillo repeat ARM1 protein dsRNA) to be generated therein in planta, thus plant-specific genetic control elements (for example, promotional factors) are preferred. however, may also be generated in other organisms or in vitro and then introduced into the plant the "anti Armadillo repeat ARM1 protein compound". In this all prokaryotic or eukaryotic genetic control elements (for example promoters) are preferred, which allow expression in the chosen respectively for the manufacturing plant.

A "functional" linkage means, for example, the sequential arrangement of a promoter with the expressed nucleic acid sequence (for example, an "anti Armadillo repeat ARM1 protein compound") and, if appropriate, further regulatory elements such as, for example, a terminator in such a way that each of the regulatory (or regulatory) elements to sense or anti-sense RNA to fulfill its function in the transgenic expression of the nucleic acid sequence, depending on the arrangement of the nucleic acid sequences. a direct linkage in the chemical sense is not necessarily required. Genetic control sequences such as enhancer sequences, can exert on the target sequence can fulfill its function even from more remote positions or even from other DNA molecules. arrangements in which that is to be expressed transgenically nucleic acid sequence positioned behind the functioning as a promoter sequence, are preferred, so that both sequences covalently With are interconnected. Preferably, the distance between the promoter sequence and the nucleic acid sequence to be expressed transgenically is less than 200 base pairs, especially preferably less than 100 base pairs, very particularly preferably less than 50 base pairs.

Operable linkage, and the preparation of an expres- sion cassette can be realized by means of customary recombination and cloning techniques as described, for example, in Maniatis T, Fritsch EF and Sambrook J (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor (NY), in Silhavy TJ, Berman ML and Enquist LW (1984) Experiments with Gene Fusions, Cold Spring Harbor Laboratory, Cold Spring Harbor (NY), in Ausubel FM et al. (1987) Current Protocols in Molecular Biology, Greene Publishing Assoc. and Wiley Interscience and Gelvin et al. (1990) In: Plant Molecular Biology Manual are described. Between the two sequences as well as additional sequences can be posi- tioned, for example, have the function of a linker with particular restriction enzyme cleavage sites or of a signal peptide. Also, the insertion of sequences can result in expression of fusion proteins. Preferably, the expression cassette, consisting of a linkage of promoter and nucleic acid sequence to be expressed, integrated into a vector and be inserted for example by transformation into a plant genome.

An expression cassette but also such constructions are to be understood in which a promoter - behind an element of choice, such as an endogenous Armadillo repeat ARM1 protein gene is placed, and, a, in this example, by expression of - for example, by homologous recombination antisense armadillo repeat ARM1 protein RNA is effected the reduction according to the invention an armadillo repeat ARM1 protein. Similarly, also an element, such as an "anti Armadillo repeat ARM1 protein compound" (for example, a nucleic resequenz coding for an armadillo repeat ARM1 protein dsRNA or Armadillo repeat ARM 1 protein antisense RNA) in such a way behind an endogenous promoter placed be, that the same effect occurs. Both approaches lead to expression cassettes according to the invention.

Plant-specific promoters means in principle any promoter which, in plants or plant parts, cells the expression of genes, in particular foreign genes - may tissues control cultures. The expression can be for example constitutive, inducible or development-dependent.

Preferred promoters are:

a) Constitutive promoters

Vectors which make possible constitutive expression in plants (.: 2195-2202 Benfey et al (1989) EMBO J 8) are preferred. "Constitutive" promoter means

Promoters, preferably at all times during plant development ensure expression in numerous, preferably all, tissues over a substantial period of plant development. Preferably, in particular a plant promoter or a promoter derived from a plant virus. In particular, preferably the promoter of the 35S-Transkript.es of the CaMV cauliflower mosaic virus (Franck et al 1980 () Cell 21: 285-294; Odell et al (1985) Nature 313:.. 810- 812; Shewmaker et al (. 1985) Virology 140: 281-288; Gardner et al (1986) Plant mol Biol. 6: 221- 228) or the 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey et al (1989) EMBO J. 8: 2195-2202). Another suitable constitutive promoter is the "Rubisco small subunit (SSU)" - promoter (US 4,962,028), the promoter of the Nopa- linsynthase from Agrobacterium, the TR dual promoter, the OCS (octopine synthase) promoter from Agrobacterium, the ubiquitin promoter ( . Holtorf S et al (1995) Plant mol Biol 29: 637-649), the ubiquitin 1 promoter (Christensen et al (1992). Plant mol Biol 18: 675-689; Bruce et al (1989) Proc Natl Acad Sci. USA 86: 9692-9696), the Smas promoter, the cinnamyl alcohol dehydrogenase promoter (US 5,683,439), the promoters of vacuolar ATPase subunits or the promoter of a proline-rich protein from wheat (WO 91/13991), and further promoters of genes whose constitutive expression is known to those skilled in plants. As a constitutive promoter most preferably the promoter of the nitrilase-1 (nit1) gene from A. thali- ana (GenBank Acc.-No .: Y07648.2, nucleotides 2456-4340, Hillebrand et al's (1996) Gene. 170: 197 -200).

b) Tissue-Specific Promoters

In some embodiments, promoters are used with specificity for the anthers, ovaries, flowers, leaves, stems, roots or seeds.

Seed-specific promoters such as the phaseolin promoter (. US 5,504,200; Bustos MM et al (1989) Plant Cell 1 (9): 839-53), the 2S albumin gene (Josefsson LG et al (1987) J Biol Chem. 262: 12196-12201), the legumin mol Gen Genet 215 (2) (Shirsat A et al (1989.): 326-331), the USP (. unknown seed protein; Bäumlein H et al (1991) mol Gen Genet 225 (3 ): 459-67), the napin gene (US 5,608,152; Stal- mountain K et al (1996) L Planta 199:. 515-519), the sucrose binding protein (WO 00/26388) or the legumin B4 promoter (LeB4; . Bäumlein H et al (1991) mol Gen Genet 225:. 121-128; Baeumlein et al (1992) Plant Journal 2 (2): 233-9; Fiedler U et al (1995) Biotechnology (NY) 13 (10. ): 1090f), the oleosin-promoter from Arabidopsis (WO 98/45461), the Bce4 promoter from Brassica (WO 91/13980). Further suitable seed-specific promoters are those of the genes coding for the "High Molecular Weight Glutenin" (HMWG), gliadin, branching enzyme, ADP glucose Pyrophospha- (AGPase) or starch synthase. Furthermore preferred are promoters which permit seed-specific expression in monocots such as maize, barley, wheat, rye, rice etc. are preferred. the promoter of the lpt2 or lpt1 gene (WO 95/15389, WO 95/23230) or the promoters can be used advantageously described 99/16890 (promoters of the hordein gene, the glutelin gene, the oryzin gene in WO, the prolamin gene, the gliadin gene, the zein gene, the kasirin gene or the secalin gene).

Tubers, storage root- or root-specific promoters such as the patatin promoter class I (B33), and the promoter of the cathepsin D inhibitor potato.

Leaf-specific promoters such as the promoter of cytosolic FBPase from potato (WO 97/05900), the SSU promoter (small subunit) of the Rubisco (ribulose-1, 5- bisphosphate carboxylase) or the ST-LSI promoter from potato (Stockhaus et al. (1989 ) EMBO J 8: 2445 to 2451). Epidermis-specific promoters such as the OXLP gene ( "oxalate oxidase like protein"; Wei et al (1998) Plant Mol Biol. 36: 101-112..).

Other tissue-specific promoters include the following:

Flower-specific promoters such as, for example, the phytoene synthase promoter (WO 92/16635) or the promoter of the P-rr gene (WO 98/22593).

Anther-specific promoters such as the 5126 promoter (US 5,689,049, US 5,689,051), the globl promoter and FAE

Zein promoter.

c) Chemically inducible promoters

The expression cassettes may also comprise a chemically inducible promoter (review article:. Gatz et al (1997) Annu Rev Plant Physiol Plant Mol Biol. 48: 89- 108) by which voted the expression of the exogenous gene in the plant at a loading time can be controlled. Such promoters such as the PRP1 promoter (Ward et al (1993) Plant Mol Biol. 22: 361-366), a salicylic acid inducible promoter (WO 95/19443), a through benzenesulfonamide-inducible promoter (EP 0388186) , a tetracyclin-inducible promoter (Gatz et al (1992) Plant J. 2: 397-404), an abscisic acid-inducible promoter (EP 0335528) or a (by ethanol or cyclohexanone-inducible promoter WO 93 / 21334) can also be used. For example, expression may be of a reducing the Armadillo repeat ARM1 protein function or inhibiting molecule, such as the above-enumerated dsRNA, ribozymes, antisense nucleic acid molecules, etc. are induced at appropriate times.

d) Stress- or pathogen-inducible promoters

Very particularly advantageous is the use of inducible promoters for expression of the RNAi used for reducing the callose synthase polypeptide quantity, activity or function constructs, which for example, when using pa- thogen-inducible promoters, expression only when needed (ie pathogen infestation) is provided ,

Therefore, in the inventive process active promoters are used in an embodiment in plants in which it is pathogen-inducible promoter. Pathogen-inducible promoters include the promoters of genes which are induced as a result of infection by pathogens, such as, for example, genes of PR proteins, SAR proteins, beta-1, 3-glucanase, chitinase and the like (for example Redolfi et al. (1983) Neth J Plant Pathol 89: 245-254; Uknes, et al (1992) Plant Cell 4: 645-656; Van Loon (1985) Plant mol Viral 4:11 1-1 16; Marineau et al (1987) Plant mol.. Biol 9: 335-342; Mat- ton et al (1987) Molecular Plant-Microbe Interactions 2:.. 325-342; Somssich et al (1986) Proc Natl Acad Sci USA 83: 2427-2430; Somssich et al (. 1988) mol Gen generation tics 2: 93-98; Chen et al (1996) Plant J 10: 955-966; Zhang and Sing (1994) Proc Natl Acad Sci USA. 91: 2507-2511; Warner, et al. (1993) Plant J 3: 191-201; Siebertz et al (1989) Plant Cell 1: 961-968 (1989)..

Also comprised are wounding-inducible promoters such as that of the pinll gene (Ryan (1990) Ann Rev Phytopath 28: 425-449; Duan et al (1996) Nat Biotech. 14: 494-498), of the wun1 and wun2 gene (US 5,428,148), the win1- and win2 gene (Stanford et al (1989). mol Gen Genet 215: 200-208), of systemin (McGurl et al (1992). Science 225: 1570-1573), of the WIP1 gene (Rohmeier et al (1993) Plant mol Biol 22: 783-792; Eckelkamp et al (1993) FEBS Letters 323:.. 73-76), of the MPI gene (Corderok et al (1994) Plant J 6 (2. ): 141-150) and the like.

A source of further pathogen-inducible promoters is the PR gene family. A number of elements in these promoters have proven advantageous. Thus -364 to -288 in the promoter region of PR-2d salicylate specificity (chel Bu et al. (1996) Plant Mol Biol 30, 493-504). The sequence 5'-TCATCTTCTT-3 'occurs in the promoter of the barley beta-1, 3-glucanase and in more than 30 other stress-induced genes. This region binds a nuclear protein in tobacco, whose abundance is increased by salicylate. The PR-1 promoters from tobacco and Arabidopsis (EP-A 0332104, WO 98/03536) are also suitable as pathogen-inducible promoters. Preferred since particularly specifically induced by pathogen that are "acidic PR / - 5?" - (aPR5) promoters from barley: and wheat (Rebmann et (Schweizer et al (1997) Plant Physiol 1 14 79-88.) al. (1991) Plant mol Biol 16: 329-331). aPR5 proteins accumulate within about 4 to 6 hours after the pathogen and show only a very low background expression (WO 99/66057). One approach to achieve increased pathogen-induced specificity is the generation of synthetic promoters from combinations of known pathogen-responsive elements EIe- (Rushton et al (2002) Plant Cell 14, 749-762;. WO 00/01830; WO 99/66057). Further pathogen-inducible promoters from different species are known in the art (EP-A 1165794, EP-A 1062356, EP-A 1041148, EP-A 1032684).

Further pathogen-inducible Promtoren include flax Fis / promoter (WO 96/34949), the Vst1 promoter (Schubert et al (1997) Plant Mol Biol. 34: 417-426) and the EAS4 sesquiterpene cyclase promoter from tobacco (US 6,100,451). Further preferred promoters are those which are induced by biotic or abiotic stress, such as the pathogen-inducible promoter of the PRP1 gene (or GST1 promoter), for example, from potato (WO 96/28561;. Ward et al (1993) Plant Mol Biol 22: 361-366), the heat inducible hsp70 or hsp80-promoter from tomato (US 5,187,267), the kälteinduzierare alpha-amylase promoter from potato

(WO 96/12814), the light-inducible PPDK promoter or the verwundungsinduzier- te pinll promoter (EP-A 0375091).

e) mesophyll tissue specific promoters

In the novel process mesophyll promoters such as the promoter of the wheat Germin 9f-3.8 gene (GenBank Acc No .: M63224) or barley GerA promoter can be used in one embodiment (WO 02/057412). Said promoters are particularly advantageous because they are both metal sophyllgewebe-specific and pathogen-inducible. Also suitable is the mesophyll-specific Arabidopsis CAB-2 promoter (GenBank Acc No .: X15222), and the Zea mays PPCZmI promoter (GenBank Acc No .: X63869) or homologs thereof. Mesophyll-tissue-specific means that caused by the specific interaction of existing in the promoter sequence cis-elements and binding to these transcription factors limiting the transcription of a gene to as few comprise the mesophyll plant tissue, preferably a confined to the mesophyll tissue transcription is meant.

Of other promoters which are expressed primarily in the mesophyll or in the epidermis, see the above enumeration inserted.

f) Development-dependent promoters

Further suitable promoters are, for example, fruit-maturation-specific promoters such as, for example, the fruit ripening-specific promoter from tomato (WO 94/21794, EP 409 625). "Development-dependent promoters" includes, for some of the tissue-specific promoters, since individual tissues develop by nature in a development-dependent.

Particularly preferred are constitutive promoters and leaf and / or stem-specific, pathogen-inducible, root-specific, mesophyll-tissue-specific promoters, with constitutive, pathogen-inducible, mesophyll-tissue-specific and root-specific promoters being most preferred.

It can be operably linked with the acid sequence to be expressed nucleic further more promoters which allow expression in further plant tissues or in other organisms, such as bacteria E.cσ //. Suitable plant promoters are in principle all the promoters described above are possible.

Further for expression in plants suitable promoters are described (Rogers et al (1987) Meth in Enzymol 153: 253-277; Schardl et al (1987) Gene 61:... 1-11; Berger et al (1989) Proc Natl Acad Sci USA 86: 8402-8406).

may be operably linked leinsäuresequenzen the nucleic contained in the inventive expression cassettes or vectors with additional genetic control sequences besides a promoter. The term genetic control sequences is to be understood broadly and means all those sequences which have an effect on the materialization or the function of the expression cassette of the invention. Genetic control sequences modify for example the transcription and translation in prokaryotic or eukaryotic organisms. Preferably, the expression cassettes of the invention include 5 'upstream of the respective transgene to be expressed nucleic acid sequence, a promoter with one of the abovementioned specificity and 3'-downstream a terminator sequence as additional genetic control sequence and, if appropriate, further customary regulatory elements, in each case operably linked to the nucleic acid sequence to be expressed transgenically.

Genetic control sequences also comprise further promoters, promoter elements or minimal promoters capable of modifying the expression-controlling properties. Thus, genetic control sequences, for example, tissue-see expression additionally dependent on certain stress factors. Corresponding elements are, for example, for water stress, abscisic acid (Lam E and Chua NH J Biol Chem 1991; 266 (26):. 17131 -17135) and heat stress (Schoffl F et al, Molecular & General Genetics 217 (2-3):. 246-53, 1989).

In principle, all natural promoters with their regulatory sequences as those mentioned above, used for the inventive method. Darüberhi- Naus can be advantageously used, synthetic promoters.

Genetic control sequences furthermore also comprise the 5'-untranslated regions, introns or noncoding 3 'regions of genes such as example, the actin-1 intron, or the Adh1-S introns 1, 2 and 6 (in general: The Maize Handbook, Chapter 1 16, Freeling and Walbot, Eds., Springer, New York (1994)). It has been shown that this can play a significant role in the regulation of gene expression. Thus, it was shown that 5'-untranslated sequences can enhance the transient Expressi- on heterologous genes. Examples of translation enhancers is the 5'-leader sequence from the tobacco mosaic virus (Gallie et al (1987) Nucl Acids Res. 15: 8693-8711) and the like. You can also promote tissue specificity (Rouster J et al (1998) Plant J. 15: 435-440).

The expression cassette may advantageously comprise one or functionally linked to the promoter contain several so-called "ene hancer sequences", make possible an increased recombinant expression of the nucleic acid sequence. Also, at the 3 'end of the nucleic acid sequences to be expressed transgenically additional advantageous sequences may also be inserted, such as further regulatory elements or terminators. The nucleic acid sequences to be expressed transgenically may be included in one or several reindeer copies in the gene construct.

Suitable as control sequences, polyadenylation signals are plant polyadenylation signals, preferably those which substantially T-DNA polyadenylation signals from Agrobacterium tumefaciens, in particular gene 3 of the T-DNA (octopine synthase) of the Ti plasmid pTiACHS (Gielen et al. (1984) EMBO J 3: 835 ff) or functional equivalents thereof. Examples of particularly suitable terminator sequences are the OCS (octopine synthase) terminator and the NOS (nopaline synthase) terminator.

Control sequences are furthermore understood that allow homologous recombination or insertion into the genome of a host organism or which permit removal from the genome. In homologous recombination, for example the natural promoter of a particular gene a promoter with specificity for the embryonal epidermis and / or the flower can be replaced.

An expression cassette and the vectors derived from it may comprise further functional elements. The term functional element is to be understood broadly and means all those elements that have an impact on production, multiplication or function of the expression cassettes of the invention, vectors or transgenic organisms. as examples, but not by limitation to name:

the, preferably herbicides, such as kanamycin, G 418, bleomycin, hygromycin or phosphinotricin etc. confer resistance to a metabolism inhibitor such as 2-deoxyglucose-6-phosphate (WO 98/45456), antibiotics or biocides a) selection marker. Especially preferred selection markers are those which confer resistance to herbicides. Examples which may be mentioned are: DNA sequences which encode phosphinothricin acetyltransferases (PAT) and inactivate glutamin synthase inhibitors (bar and pat genes), 5-Enolpyruvyl- shikimate-3-phosphate (EPSP synthase genes), the overall resistance gen ® glyphosate (N- ( phosphonomethyl) glycine), the glyphosate-degrading enzymes encoding ® gox gene (glyphosate oxidoreductase), the deh gene (encoding a dehalogenase which inactivates dalapon), sulfonylurea- and imidazolinone-inactivating acetolactate synthases, and bxn genes, which xynil degrading bromo- nitrilase encode the aasa gene, which confers resistance to the antibiotic spectinomycin, the Streptomycinphosphotransfe- rase (SPT) gene, which allows resistance to streptomycin, the Neomy- cinphosphotransferas (NPTII) gene, which confers resistance to kanamycin or

Geneticidin gives, the hygromycin phosphotransferase (HPT) gene, which mediates resistance to hygromycin, the acetolactate synthase gene (ALS), which confers resistance to sulfonylurea herbicides (for example mutated ALS variants with, for example, the S4 and / or Hra mutation).

b) Reporter genes which encode readily quantifiable proteins and, via their color or enzyme activity, provide an assessment of the transformation efficacy or the expression site or time. Most particularly preferred reporter proteins (Schenbron E, Groskreutz D. Mol Biotechnol 1999; 13 (1):. 29-44) as the "green fluorescence protein" (GFP) (Sheen et al (1995) Plant.

Journal 8 (5): 777-784; . Haseloff et al (1997) Proc Natl Acad Sci USA 94 (6): 2122- 2127; . Reichel et al (1996) Proc Natl Acad Sci USA 93 (12): 5888-5893; Tian et al. (1997) Plant Cell Rep 16: 267-271; WO 97/41228; Chui WL et al. (1996) Curr Biol 6: 325-330; Leffel SM et al. (1997) Biotechniques. 23 (5): 912-8), the nicoltransferase Chloramphe-, a luciferase Science 234: 856-859; Millar et al (1992) Plant Mol Biol Rep 10: (Ow et al (1986). 324-414). the aequorin gene (Prasher et al (1985) Biochem Biophys Res Commun 126 (3):. 1259-1268), the ß-galactosidase, R locus gene (encoding a protein which regulates the production of anthocyanin pigments (red coloring) in plant tissue regulated, allowing direct analysis of the promoter activity without adding additional auxiliaries or chromogenic substrates; Della Porta et al., In: Chromosome Structure and Function: Impact of New Concepts, 18th Stadler Genetics Symposium, 11: 263-282, 1988), especially preferably is the ß-glucuronidase (Jefferson et al., EMBO J., 1987, 6, 3901-3907).

c) Origins of replication which ensure replication of the expression cassettes or vectors according to the invention in, for example, E. coli. Examples are ORI (origin of DNA replication), the pBR322 ori or the P15A ori (Sambrook et al .: Molecular Cloning. A Laboratory Manual, 2 πd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989).

d) Elements which mediated for Agrobacterium plant transformation are required, such as the right or left border of the T-DNA or the vir region.

For selection of successfully transformed cells, it is usually necessary additionally to introduce a selectable marker which the successfully transformed cells resistance to a biocide (for example a herbicide), a metabolism inhibitor such as 2-deoxyglucose-6-phosphate (WO 98/45456 ) or an antibiotic gives. The selection marker permits the selection of transformed cells of non- transformed (McCormick et al (1986) Plant Cell Reports 5:. 81-84).

The introduction of an expression cassette of the invention into an organism or cells, tissues, organs, parts or seeds thereof (preferably into plants or plant cells, tissues, organs, parts or seeds) can be effected advantageously using vectors in which the expression cassettes corresponds are met. The expression cassette may in the vector (for example a plasmid) via a suitable restriction cleavage site are introduced. The resulting plasmid is first introduced into E. coli. Correctly transformed E. coli are selective oniert, grown, and the recombinant plasmid obtained familiar to the skilled worker. Restriction analysis and sequencing may serve to verify the cloning step.

Vectors may be, for example plasmids, cosmids, phages, viruses or else Agrobacte- rien. In an advantageous embodiment, the introduction of the expression cassette is realized by means of plasmid vectors. Such vectors allow stable integration of the expression cassette into the host genome.

The generation of a transformed organism (or a transformed cell) requires, be that the corresponding DNA molecules and thus formed in sequence of the gene expression of RNA molecules or proteins in the appropriate host cell is introduced.

For this procedure, which is termed transformation (or transduction or transfection), a variety of methods are available (Keown et al (1990) Methods in Enzymology 185:. 527-537). Thus, the DNA or RNA can be introduced directly by way of example by microinjection or by bombardment with DNA-coated microparticles. The cell may also chemically, for example with polyethylene glycol, are permeabilized so that the DNA is capable of diffusing into the cell. The DNA can also be introduced by protoplast fusion with other DNA-containing units such as minicells, cells, lysosomes or liposomes. Electroporation is another suitable method for introducing DNA, wherein the cells are permeabilized reversibly by an electrical pulse. Corresponding methods are described (for example by Bilang et al (1991) Gene 100:.. 247-250; Scheid et al (1991) Mol Gen Genet 228: 104-112; Guerche et al (1987) Plant Science 52: 111-. 1 16; Neuhause et al (1987) Theor Appl Genet 75: 30-36; Klein et al (1987) Nature 327:.. 70- 73; Howell et al (1980) Science 208:.. 1265; Horsch et al ( 1985) Science 227: 1229-

1231; De Block et al. (1989) Plant Physiology 91: 694-701; Methods for Plant Molecular Biology (Weissbach and Weissbach, eds.) Academic Press Inc. (1988); and Methods in Plant Molecular Biology (Schuler and Zielinski, eds.) Academic Press Inc. (1989)).

In plants, the methods of transforming and re-generation of plants from plant tissues or plant cells for transient or stable transformation are preferably used. Suitable methods are especially protoplast transformation by polyethylene glycol-induced DNA uptake, the biolistic method with the gene gun, ie the so-called "particle bombardment" method, electroporation, incubation of dry embryos in DNA-comprising solution, and microinjection.

In addition to these "direct" transformation techniques, transformation can be carried out by bacterial infection, for example by means of Agrobacterium tumefaciens or Agrobacterium rhizogenes. The methods are described for example, in Horsch RB et al. (1985) Science 225: 1229f).

When agrobacteria are used, the expression cassette must be integrated into specific plasmids, either into an intermediate vector (shuttle or intermediate vector) or into a binary vector. If a Ti or Ri plasmid by which to apply transform, preferably at least the right border, most preferably, however, the right and the left border of the Ti or Ri plasmid T-DNA as flanking region associated with the introduced expression cassette.

Binary vectors are preferably used. Binary vectors can replicate both in E.colia \ s in Agrobacterium. They usually contain a selection marker gene and a linker or polylinker flanked by the right and left T-DNA border sequence. They can be transformed directly into Agrobacterium (Holsters et al (1978) Mol Gen Genet. 163: 181-187). The selection marker permits selection of transformed agrobacteria and is for example the nptII gene that confers resistance to kanamycin. Which in this case acts as host organism Agrobacterium should already contain a plasmid with the vir region. This is required for transferring the T-DNA to the plant cell. An Agrobacterium transformed can be used for transforming plant cells. The use of T-DNA for transforming plant cells has been intensively investigated and described (EP 120 516; Hoekema, In: The Binary Plant Vector System, Offsetdrukkerij Kanters BV, Alblasserdam, Chapter V; An et al (1985) EMBO J. 4: 277-287). Various binary vectors are known and some are commercially available such as pBI101.2 or pBIN19 (Clontech Laboratories, Inc. USA).

In the case of injection or electroporation of DNA or RNA into plant cells no special requirements are placed on the plasmid used. Simple plasmids such as those of the pUC series can be used. If intact plant-zen be regenerated from the transformed cells, it is necessary that an additional selectable marker gene is located on the plasmid.

Stably transformed cells, ie those which contain the introduced DNA integrated into the DNA of the host cell, can be selected from untransformed cells when a selectable marker is part of the introduced DNA. As markers example, any gene can function, that resistance to antibiotics or herbicides (such as kanamycin, G 418, bleomycin, hygromycin or phosphinotricin etc.) capable of imparting (see above). Transformed cells which express such a marker gene are capable of surviving in the presence of concentrations of a corresponding antibiotic or herbicide which kill an untransformed wild type. Examples are mentioned above and preferably comprise the bar gene, which confers resistance to the herbicide phosphinothricin (Rathore KS et al (1993) Plant Mol Biol 21 (5):. 871- 884), which that nptII gene confers resistance to kanamycin, the hpt gene, which confers resistance to hygromycin, or the EPSP gene, which confers resistance to the herbicide glyphosate. The selection marker permits the selection of transformed cells from untransformed cells (McCormick et al (1986) Plant Cell Reports 5:. 81- 84). The resulting plants can be bred in a conventional manner and crossed. Two or more generations should be cultivated preferred to ensure that the genomic integration is stable and hereditary.

The above methods are described for example in Jenes B et al (1993) Techniques for Gene Transfer, in:. Transgenic Plants, Vol 1, Engineering and Utilization, edited by SD Kung and R Wu, Academic Press, p.128. -143 and in Potrykus (1991) Annu Rev Plant Physiol Plant Molec Biol 42: 205-225). Preferably, the construct to be expressed is cloned into a vector suitable to transform Agrobac- tumefaciens, for example pBin19 (Bevan et al (1984) Nucl Acids Res. 12: 87111).

Once a transformed plant cell has been, a complete

Plant are obtained using methods known to the skilled worker. These entail an example from callus cultures. From these still undifferentiated cell masses the formation of shoot and root can be induced in a known manner. The shoots obtained can be planted and grown.

The skilled worker processes are also known to regenerate from plant cells, plant parts and whole plants. For example, methods are described for this purpose by Fennell et al. . (1992) Plant Cell Rep 1 1: 567-570; Stoeger et al (1995) Plant Cell Rep 14: 273-278;. Jahne et al. (1994) Theor Appl Genet 89: 525-533 verwen- det. The inventive method can advantageously be combined with further methods which bring about pathogen resistance (for example to insects, fungi, bacteria, nematodes and the like), stress resistance or another improvement of the plant properties. Examples include known in Dunwell JM, Transgenic ap- proaches to crop improvement, J Exp Bot 2000. 51 Spec No; Page 487-96.

In a preferred embodiment, the reduction in the function of an armadillo repeat ARM1 protein in a plant is combined with increasing the activity of a Bax inhibitor 1 protein is carried out. This can be done, for example, by expression of a gene encoding a Bax inhibitor-1 protein nucleic acid sequence, for example in the mesophyll tissue and / or root tissue.

In the inventive method, the Bax inhibitor-1 protein from Hordeum vulgare gare or Nicotiana tabacum are particularly preferred.

Another object of the invention relates to nucleic acid molecules, the nucleic acid molecules coding for armadillo repeat ARM1 proteins from barley according to the polynucleotides of SEQ. ID NO: 1, as well as the complementary nucleic acid sequences, and obtained by degeneration (degeneracy) of the genetic code to lock led sequences and for functional equivalents of the polypeptides according to SEQ. ID No .: 1 encoding nucleic acid molecules, wherein the nucleic acid molecules are not of SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 exist.

Another object of the invention relates to the Armadillo repeat ARM1 protein from barley as shown in SEQ. ID No .: 2, or one comprising these sequences as well as functional equivalents thereof that are not one of the sequences of SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 42, or 44, respectively.

Another object of the invention relates to double-stranded RNA nucleic acid molecule (dsRNA molecule) which, when introduced into a plant (or a cell derived therefrom, tissue, organ or seed) effecting the reduction of a Armadillo repeat ARM1 protein, where the sense strand of said dsRNA molecule has at least a homology of 30%, preferably at least 40%, 50%, 60%, 70% or 80%, more preferably at least 90%, most preferably 100% to a nucleic acid molecule according to SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 comprising, or a fragment of at least 17 base pairs, preferably at least 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 base pairs, especially preferably at least 40, 50, 60, 70, 80 or 90 base pairs, very more preferably at least 100, 200, 300 or 400 base pairs, most preferably at least 500, 600, 700, 800, 900 at least 1000 base pairs n comprises, and comprising at least 50%, 60%, 70% or 80%, more preferably at least 90%, most preferably 100% homology to a nucleic acid molecule of SEQ ID NO: 1, 3, 5, 7, 9 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 comprising, but not the SEQ ID nO: 3, 5, 7, 9 , 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, respectively.

The double-stranded structure may be formed from two complementary strands from a single self-complementary strand or starting. In a particularly preferred embodiment, "sense" - and "antisense" sequence by a linking sequence ( "linker") linked and may for example form a hairpin structure. Very particularly preferably, the linking sequence may be an intron, which is spliced ​​out after the dsRNA synthesis.

The nucleic acid sequence coding for a dsRNA can comprise further elements such as transcription termination signals or polyadenylation signals.

Another object of the invention relates to transgenic expression cassettes comprising one of the nucleic acid sequences of the invention. In the present invention transgenic expression cassettes of the nucleic acid sequence ARM1 proteins from barley, wheat and corn is encoding associated with at least one genetic control element as defined above in such a way for the Armadillo repeat, that the expression (transcription and, if appropriate, translation) in any organism - preferably in can be realized - monocotyledonous plants. To suitable genetic control elements described above. The transgenic expression cassettes can also contain other functional elements defined above.

Such expression cassettes include, for example, a nucleic acid sequence of the invention, including one that is substantially identical to a nucleic acid molecule of SEQ ID NO: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25 27, 29, 31, 33, 35, 37, 39, 41, or 43, or a fragment thereof of the invention, wherein said nucleic acid sequence is preferably present to a promoter in sense orientation or in antisense orientation, and thus for the expression of sense or antisense may result in RNA, it is a promoter active in plants, preferably a promoter inducible by pathogen attack at said promoter. According to the invention, also transgenic vectors are included, which contain the said transgenic expression cassettes.

Another object of the invention relates to plants that contain by natural processes or artificially induced one or more mutations in a nucleic acid molecule comprising the nucleic acid sequence according to SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43, wherein said mutation is a reduction in the activity, function or polypeptide quantity of by the nucleic acid molecules according SEQ ID No: 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 causes the encoded polypeptide. For example, a mutation produced by Tilling and identified.

Preference is given to plants belonging to the family Poaceae, particularly preferably plants selected from the plant genera Hordeum, Avena, Secale, Triticum, Sorghum, Zea, Saccharum and Oryza, most preferably from plants selected from the species Hordeum vulgare (barley) Triticum aestivum (wheat), Triticum aestivum subsp.spelta (spelled), triticale, Avena sativa (oats), Se cale cereale (rye), sorghum bicolor (sorghum), Zea mays (maize), Saccharum officina- rum (sugar cane) and Oryza sativa (rice).

Consequently, containing the invention, in one embodiment a monocotyledonous organism a nucleic acid sequence of the invention containing a Mutati- on, which causes a reduction in the activity of the protein encoded by the nucleic acid molecules according to the invention proteins in the organisms or parts thereof. For example, the mutation concerns one or more amino acid residues that is highlighted in the consensus sequence as shown in Fiquren conserved or highly conserved.

Consequently, a further subject of the invention relates to transgenic plants transformed with at least

a) a nucleic acid sequence, the nucleic acid molecules as shown in SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37 , 39, 41, or 43 includes fully contained, the complementary nucleic acid sequences and for functional equivalents of the polypeptides according to SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 encoding nucleic acid molecules 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or 62

b) a double-stranded RNA nucleic acid molecule (dsRNA molecule) which causes a reduction of an armadillo repeat ARM1 protein, where the sense strand of said dsRNA molecule minds least a homology of 30%, preferably at least 40%, 50%, 60 %, 70% or 80%, more preferably at least 90%, most preferably 100% to a nucleic acid molecule of S SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17 , 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 comprising, or a fragment of at least 17 base pairs, preferably at least 18, 19, 20, 21, 22, 23 , 24, 25, 26, 27, 28, 29 or 30 base pairs, especially preferably at least 40, 50, 60, 70, 80 or 90 base pairs, very especially preferably at least 100, 200, 300 or 400

Base pairs, most preferably at least 500, 600, 700, 800, 900 or more base pairs, which has at least a 50%, 60%, 70% or 80%, more preferably at least 90%, most preferably 100% homology to a nucleic acid molecule according to SEQ ID No: 1, 3, 5, 7, 9, 1 1, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 having,

c) a transgenic expression cassette comprising nucleic acid sequences one of the invention, or a vector of the invention, as well as cells, cell cultures, tissues, parts - such as the case of plant organisms, leaves, roots or propagation material derived from such organisms,

wherein the nucleic acid molecules not to of SEQ ID No, in one embodiment: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35 are 37, 39, 41, or shown 43 nucleic acid molecules and in one embodiment not shown in SEQ ID no: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28 consist polypeptide molecules shown 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or 62 and

In one embodiment, the plant of the invention or the plant used in the invention is not thaliana Arabidopsis.

As "transgenic organisms" preferred host or starting organisms which are mainly plants in accordance with the above definition. In one embodiment, the transgenic organism is a mature plant, seed, shoots and seedlings and their derived parts, propagation material and cultures, for example cell cultures. "Mature plants" means plants at any developmental stage beyond the seedling. "Seedling" refers to a young immature plant in an early development stage. Particularly preferred as host organisms plants are plants to which the method of the invention for obtaining pathogen resistance above criteria according can be used. In one embodiment, the plant is a monocot such as wheat, oats, millet, barley, rye, corn, rice, buckwheat, sorghum, triticale, spelled or sugar, in particular selected from the species Hordeum vulgare (barley), Triticum aestivum (wheat), Triticum aestivum subsp.spelta (spelled ), triticale, Avena sativa (oats), Secale cereale (rye), sorghum bicolor (sorghum), Zea mays (maize), Saccharum officinarum (sugar cane), or Oryza sativa (rice).

The transgenic organisms can be realized with the above-described methods for the transformation or transfection of organisms.

Another object of the invention relates to the transgenic plants described in the invention, the gene additionally verfü- 1 activity via increased Bax inhibitor, preferred are plants which have an increased Bax inhibitor 1 activity in mesophyll cells or root cells, especially preferably transgenic plants are to be the family Poaceae include and an increased Bax inhibitor 1 activity in mesophyll cells or root cells, most preferably are transgenic plants selected from the plant genera Hordeum, Avena, Secale, Triticum, sorghum, Zea, Saccharum and Oryza, most preferably of the plant species Hordeum vulgare (barley), Triticum aestivum (wheat), Triticum aestivum subsp.spelta (spelled), triticale, Avena sativa (oats), Secale cereale (rye), sorghum bicolor (sorghum), Zea mays (maize), Saccharum officinarum ( sugar cane) and Oryza sativa (rice).

Another object of the invention relates to the use of erfindungsgemä- SEN transgenic organisms and the cells, cell cultures, parts derived from them - such as the case of transgenic plant organisms, roots, leaves, and transgenic propagation material such as seeds or fruits, for the manufacture of of food or feedstuffs, pharmaceuticals or fine chemicals.

In one embodiment, the invention also relates to a method for the recombinant production of pharmaceuticals or fine chemicals in host organisms, where a host organism or a part thereof with one of the nucleic acid described above molecules expression cassette is transformed and this expression cassette contains one or more structural genes which encode the desired fine chemical encode or catalyze the biosynthesis of the desired fine chemical, the transformed host organism is cultured and the desired fine chemical is isolated from the growth medium. This method is broadly applicable for fine chemicals such as enzymes, vitamins, amino acids, sugars, fatty acids, natural and synthetic flavorings, aroma substances and colorants. Particularly preferred is the production of tocopherols and tocotrienols and carotenoids. Culturing the transformed host organisms, and isolation from the host organisms or the culture medium will be within the skill in the art known methods. The production of pharmaceuticals such as antibodies or vaccines is described in Hood EE, Jilka JM (1999). Curr Opin Biotechnol.10 (4): 382-6; Ma JK, Vine ND (1999). Curr Top Microbiol Immunol. 236: 275-92.

According to the invention the expression of a structural gene can also be done independently of the execution of the inventive method or use of the articles of the invention, or be influenced.

sequences

1. SEQ ID NO: 1 and 2: HvArm

Second SEQ ID NO: 3 and 4: OS_1_XM_479734.1 3. SEQ ID NO: 5 and 6 Os_2_XM_463544

4th SEQ ID NO: 7 and 8 Os_3_AP003561

5. SEQ ID NO: 9 and 10 Os_4_XM_506432 6. SEQ ID NO: 11 and 12 NTJ _AY219234

7. SEQ ID No: 13 and 14 ATJ _NM_127878

8. SEQ ID NO: 15 and 16 At_2_AC004401

9. SEQ ID No: 17 and 18 At_3_BT020206 10. SEQ ID No: 19und20At_4_AB007645

11. SEQ ID NO: 21 and 22 At_5_NMJ 15336 (At3g54790)

12. SEQ ID No: 23und24At_6_AK118613

13. SEQ ID No: 25und26At_7_AL138650

14. SEQ ID No: 15, SEQ ID No 27und28At_8_AL133314: 29und30At_9_AC010870

16, SEQ ID NO: 31 and 32. At J 0_AY125543 (At3g01400)

17, SEQ ID NO: 33 and 34 ATJ 1_AY087360

18, SEQ ID NO: 35 and 36 ATJ 2_AB016888

19, SEQ ID NO: 37 and 38 SEQ ID No 20 At J 3_AK175585: 39und40AtJ4_AL049655

21, SEQ ID NO: 41 and 42. At J 5_AY096530 (At3g54850)

22, SEQ ID NO: 43 and 44 ATJ 6_AK118730 (At4g 16490)

23, SEQ ID NO: 45 and 59: Primer

24, SEQ ID NO: 60, 61, 63: consensus sequences of the polynucleotide of SEQ ID NO. from 1st to 22nd

The figures show:

Figure 1 (12 pages): Nucleic acid sequences of ARM1 from barley, rice, and Ara bidopsis thaliana. Figure 2 (6 pages): polypeptide sequences of ARM1 from barley, rice, and Arab dopsis thaliana.

3 (20 pages): sequence comparison of ARM1 protein sequences polypeptides from barley, rice, and Arabidopsis thaliana.

Figure 4 (1 page): increase in the resistance to powdery mildew of barley by RNAi of ARM repeat proteins

Figure 5 (2 pages): consensus sequences of the sequence comparison of protein sequences ARM1 polypeptides from barley, rice and Arabidopsis thaliana. Examples:

General Methods:

The chemical synthesis of oligonucleotides can, for example, in a known manner by the phosphoramidite method (Voet, Voet, 2nd edition, Wiley Press New York, pages 896-897). The operations performed in the context of the present invention, cloning for example, restriction cleavages, agarose gel electrophoresis, purification of DNA fragments, transfer of nucleic acids to nitrocellulose and nylon membranes, linking DNA fragments, transformation of E. coli cells, growing bacteria, multiplying phages and sequence analysis of recombinant DNA as described by Sambrook et al. (1989) Cold Spring Harbor Laboratory Press; ISBN 0-87969-309-6 carried out as described. The sequencing of recombinant DNA molecules is carried out using a laser fluorescence DNA sequencer from MWG-Licor by the method of Sanger (Sanger et al (1977) Proc Natl Acad Sci USA. 74: 5463-5467).

Example 1 Plants, pathogens and inoculation

The barley variety Golden Promise comes from Patrick Schweizer, Institute of Plant Genetics and Crop Plant Research. The variety Pallas and the backcrossed line BCIngrid- / 77 / σ5wurde by Lisa Munk, Department of Plant Pathology, Royal Veterinary and Agriculturai University, Copenhagen, Denmark provided. Their production is described (Kølster P et al (1986) Crop Sei. 26: 903-907).

For 12 to 36 h in the dark on moist filter paper pre-germinated seed is, if not stated otherwise, each with 5 grains at the edge of a square pot (8x8cm) in Fruhstorfer soil type P, poured tung water covered with soil and regularly with tap. All plants are μmols- in environment cabinets or chambers at 16 to 18 ° C, 50 to 60% relative humidity and a 16 hour light / 8-hour dark cycle at 3000 and 5000 lux (50 and 60 1 2 photons m- - flux density) cultured 5 to 8 days and used in the seedling stage in the experiments. In experiments in which applications are carried out on primary leaves, they are fully developed.

Before the transient transfection experiments, the plants are cultured in the environment cabinets or chambers at a daytime temperature of 24 ° C, nighttime temperature of 20 ° C, 50 to 60% relative humidity and a 16 / δstündigen dark cycle with 30000 lux. For the inoculation of barley plants True barley powdery mildew Blumeria graminis (DC) Speer f.sp. is hordeiEm. Marchai the race A6 (Wiberg A (1974) Hereditas 77: 89- 148) (BghA6) was used. This was provided by the Department of Biometry, JLU Giessen. The inoculum is in climatic chambers under the same loading conditions, as described above for the plants by transferring the conidia from infected plant material to grown 7-day-old barley plants cv. Golden Promise at a density of 100 conidia / mm 2.

The inoculation with BghA6 carried out using 7-day-old seedlings by shaking off the conidia of already infected plants in an inoculation with 100 conidia / mm 2 (unless otherwise stated).

Example 2: RNA extraction

Total RNA (5 cm length) using "RNA Extraction Buffer" (AGS, Heidelberg, Germany) extracted from 8 to 10 primary leaf segments.

For this central primary leaf segments are harvested from 5 cm length and homogenized in liquid nitrogen in a mortar. The homogenate is stored at -70 ° C until RNA extraction.

(AGS, Heidelberg) Total RNA is extracted using an RNA extraction kit from the deep-frozen leaf material. For this purpose, 200 mg of the deep-frozen leaf material into a microcentrifuge tube (2 mL) with 1, 7 mL of RNA extraction buffer (AGS) and immediately mixed well. After the addition of 200 ul of chloroform is mixed well and again at room temperature for 45 minutes shaken on an orbital shaker at 200 rev / min. the upper phase wäsige min for phase separation is then centrifuged at 20,000 g for 15 and 4 ° C, transferred to a new microcentrifuge tube and discard the bottom. The aqueous phase is repurified with 900 ul of chloroform by times centrifuged for 10 sec and homogenized again (see above) and is lifted. 3 For the precipitation of the RNA 850 ul 2-propanol is then added, homogenized for 30 to 60 minutes, placed on ice. Following this is centrifuged for 20 minutes (see above), the supernatant carefully decanted, 2 mL of 70% ethanol (-20 ° C) were pipetted in, mixed and centrifuged again for 10 min. The supernatant is decanted and then in turn frees the Pelet carefully with a pipette from residual fluid before it is dried in a clean bench in the clean air flow. The RNA is then dissolved in 50 L of DEPC water on ice, mixed and centrifuged for 5 minutes (see above). 40 .mu.l of the supernatant are transferred as RNA solution into a fresh microcentrifuge tube and stored at -70 ° C.

The RNA concentration is determined photometrically. To this end, the RNA solution is 1: 99 (v / v) diluted with distilled water and the absorbance (Photometer DU 7400, Beckman) was measured at 260 nm (E260 = 1 πm at 40 iϊg RNA / mL). According to the calculated RNA contents, the concentrations of the RNA solutions are then aligned with DEPC water at 1 ug / ul and tested in the agarose gel.

To verify the RNA concentrations in a horizontal agarose gel (1% agarose in 1 x MOPS buffer with 0.2 ug / mL ethidium bromide) is 1 μl_ RNA solution containing 1 ul of 10 x MOPS, 1 μl_ color marker and 7 μl_ DEPC water separated offset, according to size at a voltage of 120 V in the gel in 1 x MOPS running buffer for 1, 5 hours and photographed under UV light. Any differences in concentration of the RNA extracts wrden balanced with DEPC water and re-checked the adjustment in the gel.

Example 3 Cloning of HvARM cDNA sequence from barley

The cDNA fragments required for isolation of the cDNA Armadillo, its cloning, sequencing were obtained mittles RT-PCR using the Gene Racer Kit (Fa. Invitrogen Life Technologies). For this purpose total RNA from Gerstenepider- mis was used as a template. The RNA was isolated from epidermal cells of barley Ingrid + Bgt 12h and 24h after infection.

The cDNA sequence of HvArm was extended by means of the RACE-technology using the "Gene Racer Kit" (INVITROGENE Life Technologies). By 4000 ng of total mRNA, 1 ul 10xCIP buffer, 10 units were RNAse inhibitor, 10 units of CIP ( "calf intestinal phosphatase") and DEPC-treated water-treated up to a total volume of 10 ul for 1 hour at 50 ° C , To precipitate the RNA, an additional 90 ul of DEPC water and 100 ul Phenokchloroform were added and mixed thoroughly for about 30 seconds. After 5 min centrifugation at 20,000 g, the upper phase was treated with 2 .mu.l 10 mg / ml Mussei glycogen, 10 ul 3 M sodium acetate (pH 5.2) in a new micro-reaction vessel. 220 .mu.l 95% ethanol was added and the mixture incubated on ice. Subsequently, the RNA was precipitated by centrifugation for 20 min at 20,000 g and 4 ° C. The supernatant was discarded, added 500 ul 75% ethanol, vortexed briefly and then centrifuged for 2 min (20,000 g). The supernatant was again discarded, the precipitate for 2 min air dried and then suspended in 6 ul DEPC water at room temperature. mRNA CAP structures were removed by adding 1 ul 1OxTAP buffer, 10 units of RNAsin, and 1 unit of TAP ( "tobacco acid pyrophosphatase") removed. The mixture was incubated for 1 h at 37 ° C and then chilled on ice. The RNA was wiederum- as described above - is precipitated and transferred to a reaction vessel with 0.25 ug Gene Racer Oligonukleo- tid primer. The oligonucleotide primer was resuspended in the RNA solution, the mixture incubated for 5 min and then cooled on ice at 70 ° C. 1 ul 10xLigasepuffer, 10 mM ATP, 1 unit of RNAsin and 5 units of T4 RNA ligase were added and the reaction mixture incubated for 1 h at 37 ° C. The RNA was again - as described above - is precipitated and resuspended in 7 ul DEPC-water. 10 pmol GeneRacer Oligo dT primer and 2 μl_ each dNTP solution (25 mM) were added to the RNA, for 10 min, heated to 70 ° C and cooled again on ice. Subsequently, a mixture of 2 μl_ 1OxRT the reaction solution was buffer, 4μl 25mM MgCl 2, 2μl 0.1 M DTT, 5LJ (1 ul) Su- perscriptlll transcriptase (200U / ul) and 1 ul added RNAse Out (40U / ul), 50 min and then inactivated incubated for 5 min at 85 ° C at 50 ° C. After incubation for 20 min at 37 ° C with 1 ul of RNase H (2U / ul) the first strand cDNA thus prepared was stored at -20 ° C.

For the RT-PCR the following primers were used:

Gene Racer oligo dT primer (Invitrogen Life Technologies.):

GCTGTCAACGATACGCTACGTAACGGCATGACAGTG (T) 18 (SEQ ID NO .: 45)

For the reaction (20 ul) approach ever 4000 ng total RNA, 10 mM dNTPs, 50 .mu.M GeneRacer Oligo dT primer (Fa. Invitrogen Life Technologies), 1 ul RNase inhibitor, and 1 ul enzyme mix in 1x RT buffer {Gene Racer Kit Invitrogen) was used.

The reaction was incubated for 50 minutes at 50 ° C.

For the amplification of 5'-cDNA ends following primers were used:

MWG 1:

5 'GCAGACATGACCCAATCTTGGCAGG 3' (Seq ID No .: 46)

GR 5 'primer (Invitrogen): 5' cgactggagcacgaggacactga 3 '(Seq ID No .: 47)

MWG 2: 5 'CCACGGTCAGCAACCTCTCCAGACG 3' (Seq ID No .: 48)

Gene Racer 5 'nested primer (Invitrogen): 5' ggacactgacatggactgaaggagta 3 '(Seq ID No .: 49)

MWG 3:

5 'cagatgatagttattgttgttgactgg 3' (Seq ID No .: 50)

GR 3 'primer (Invitrogen):

5 'GCTGTCAACGATACGCTACGTAACG 3' (Seq ID No .: 51)

MWG 4:

5 'ctcatcttctcaagctactggtgg 3' (SEQ ID NO .: 52) Gene Racer 3 'nested primer (Invitrogen): 5' CGCTACGTAACGGCATGACAGTG 3 '(Seq ID No .: 53)

The mixture (total 50μl_) had the following composition:

4μl MWG1 (10 pmol/μL) 4,5μl 5 'Gene Racer (10 pmol/μL) 5μl 1 Ox buffer Roche 1, 5μl dNTPs 1 Omm i ul cDNA 1 ul Taq (Roche) 33μl H2O

The following temperature program was used (GeneAmp PCR System 9700; Applied Biosystems):

94 ° C 2 min denaturation

5 cycles of 94 ° C 30 sec (denaturation)

72 ° C 2 min (extension)

5 cycles of 94 ° C 30 sec (denaturation)

70 ° C 2 min (extension)

30 cycles of 94 ° C 30 sec (denaturation)

65 ° C 30 sec (annealing)

68 ° C 2 min (extension)

68 ° C 7 min final extension

4 ° C cooling until further processing

The PCR yielded a product. Assuming a "nested" RACE with MWG2, the armadillo-specific oligonucleotide primers and the "GeneRacer Nested 5 'Primer" has been used:

94 ° C 2 min denaturation

30 cycles of 94 ° C 30 sec (denaturation) 65 ° C 30 sec (annealing)

68 ° C 2 min (Extension) 68 ° C 7 min final extension 4 ° C cooling until further processing

The PCR yielded a product of approximately 850bp. The PCR product obtained was isolated via a 1% agarose gel, extracted from the gel and cloned into pCR4-Topo (Fa. Invitrogen Life Technologies) by means of T-overhang ligation and sequenced. In SEQ ID NO: reproduced sequence is identical to the Armadillo sequence from barley.

To amplify the full-length sequence HvArm following primers were used:

MWG 29:

5 'atatgcaaatggctctgctag 3' (Seq ID No .: 54)

MWG 30:

5TATCATCTCCTTCCCGAGTTC 3 '(SEQ ID No .: 55)

The mixture (total 50μl_) had the following composition:

4μl MWG29 (10 pmol/μL)

4μl MWG30 (10 pmol/μL)

5μl Ultra Pfu 1 Ox buffer (Stratagene)

1, 1 Omm 5μl dNTPs i ul cDNA

1 ul Pfu Ultra (Stratagene)

33μl H2O

The following temperature program was used (GeneAmp PCR System 9700; Applied Biosystems):

94 ° C 2 min denaturation

30 cycles of 94 ° C 30 sec (denaturation) 55 ° C 30 sec (annealing)

72 ° C 1 5 min (extension)

72 ° C 7 min final extension 4 ° C cooling until further processing

The PCR resulted in a product of 1326 bp. The PCR product obtained was isolated via a 1% agarose gel, extracted from the gel and cloned into pCR4-Topo (Fa. Invitrogen Life Technologies) by means of T-overhang ligation and sequenced. In SEQ ID NO: reproduced sequence is identical to the Armadillo sequence from barley.

Example 4: Cloning of the full-length cDNA sequence of AtARM (At2g23140) in Arabidopsis thaliana.

To amplify the full-length sequence of AtArm following primers were used:

MWG 31:

5 'cccgggatgattttgcggttttggcgg 3' (Seq ID No .: 56)

MWG 32: 5 'CCCGGGTCACAAGACAAAACATAAAAATAGG 3' (Seq ID No .: 57)

MWG 32b:

5 'gactcacactactctaatacc 3' (Seq ID No .: 58)

MWG 33:

5 'GACATCGTTTGTCTCACACC 3' (Seq ID No .: 59)

The mixture (total volume 50μl_) had the following composition (the gene was due to its size of 2775bp for the PCR divided into two parts):

4μl MWG31 (10 pmol/μL)

4μl MWG34 (10 pmol/μL)

5μl Ultra Pfu 1 Ox buffer (Stratagene)

1, 1 Omm 5μl dNTPs i ul cDNA

1 ul Pfu Ultra (Stratagene)

33μl H2O

or.

4μl MWG32 (10 pmol/μL)

4μl MWG33 (10 pmol/μL)

5μl Ultra Pfu 1 Ox buffer (Stratagene)

1, 1 Omm 5μl dNTPs I ul cDNA

1 ul Pfu Ultra (Stratagene)

33μl H2O following temperature program was used (GeneAmp PCR System 9700; Applied Biosystems):

94 ° C 2 min denaturation

30 cycles of 94 ° C 30 sec (denaturation)

59 ° C 30 sec (annealing)

72 ° C 1 5 min (extension)

72 ° C 7 min final extension 4 ° C cooling until further processing

The PCR results in a product of 1143bp and 1705 bp. The PCR product obtained is isolated on a 1% agarose gel, extracted from the gel and cloned into pCR4-Topo (Fa. Gen Invitrogen Life Technologies) by means of T-overhang ligation and sequenced. In SEQ ID NO: reproduced sequence is identical to the Armadillo sequence from Arabidopsis thaliana.

In order to assemble the gene PCR product of 1705 bp into pUC18 is cloned. Hereinafter, the cloning of AtArm 1 143bp in pUC18 AtArm 1705 bp occurs.

For constitutive expression, a Antsensekonstrukt is generated. For this purpose HvArm is antisense cloned by HvArm is cut out on Smal from pUC18 and via said interfaces in the most 5 'in the binary vector bxSuperGus 1 - cloned geblunteten end 1 bxSuperGus (SacI / SmaI). The orientation is checked by means of test digest.

Example 5: implementation of transient single-cell RNAi analysis

biological material

Barley near-isogenic lines (NILs) of the cultivars cv Ingrid (MIO) and BC Ingrid 7 m / oδbzw. Barley cv Golden Promise were grown in pots with compost soil (IPK Gatersleben) grown in climate chambers (16 h light of metal halide lamps;. 8 h dark, 70% relative humidity, 18 ° C constant temperature). Blumeria graminis DC Speer f.sp. hordei (Bgl) (4.8 isolates containing AvrMlaθ) at 22 ° C and 16 hours light by weekly transfer to fresh barley leaves of the cultivar cv. Golden Promise grown. Blumeria graminis f.sp. OC Speer tritici İM Marchai (Bgt) of the pivoting ornamental lsoltes FAL (Reckenholz-) at 22 ° C and 16 hours light by wöcnetlichen transfer to fresh leaves of wheat of the cultivar cv. Chancellor propagated. plasmid vectors

The vector was plPKTA38 (vitrogen Germany) as entry vector for the Gateway ™ Cloning System uses. The vector is a Pentri a derivative in which the ccd B gene was removed and a new multiple cloning site was inserted. As a destination vector plPKTA30N served based on a pUC18 background and comprises a constitutive promoter, terminator and two Gateway cassette containing attR sites, ccdB gene and a chloramphenicol resistance gene contains. The two cassettes are arranged in alignment and umgekhrter by a spacer of wheat RGA2 gene (accessions number AF326781) separated from each other. DIE ses vector system allows a single-step transfer of two copies of a PCR

Fragment via Entry vector in the dsRNAi vector by Gateway LR clonase reaction (Invitrogen).

PCR primer design and EST sequences of the target gene were amplified by PCR. Purified DNA of the selected cDNA clones was used as a template for the PCR reaction. The primers were derived using the software package "Primer3" in the batch file mode using the 5 'EST sequences. Typical way were amplified the EST sequences with a universal forward primer and a reverse primer specifischen EST. the amplified product had a size of 400-700 bp. the primers were 20-22 bp in length and had a T m of about 65 ° C. the PCR reactions were performed in 96-well microtiter plates using a DNA polymerase which produces blunt ends, is performed (ThermalAce; Invitrogen) the PCR products were purified using the MinElute UF kit (Qiagen, Hilden, Germany) and eluted with 25 μl_ water..

Ligation into the entry vector

The PCR fragments were cloned into the Swal interface dese vector plPKTA38.

The ligation was performed at 25 ° C in the presence of NU T4 DNA ligase (MBI Fermentas) and 5 U of Swa \ per reaction. In order to optimize the reaction conditions for Swa I, the buffer was supplemented with NaCl to a final concentration of 0.05M. After 1 h the reaction by heating at 65 ° C for 15 min was terminated. It was added to suppress a re-Iigation of plasmid additional 5 U of Swa I. The Swa I buffer was supplemented with additional NaCl to a final concentration of 0.1 M. The Reaktionanasätze were further incubated for 1 h at 25 ° C.

The resulting recombinant plPKTA38 EST clones were used for the transformation of chemically-competent E.cσ // DH10B cells in 96-well PCR microtiter plates (5μL ligation mixture per 20 ul of competent cells) and plated on LB-Ag arplatten with kana mycin plated. A colony was picked and every cloning reaction was added to liquid culture in 1.2 mL LB + kanamycin, distributed in 96-deep-well plates. Decoding plates were covered with an air-permeable film and incubated at 37 ° C for 18 h incubated on a shaker. The deep-well plates were then used at 750 g for 10 min and the pellets zentrifugert for plasmid isolation using NucleoSpin Robot-96 plasmid kit (Macherey-Nagel). The presence of the plPKTA38 plasmid was detected by restriction digest with eccr \. The positive plPKTA38 clones were used as a donor vector in the LR reaction.

LR reaction and preparation of RNAi constructs

EST fragments in plPKTA38 were cloned into the RNAi destination Vekor plPKTA30N as inverted repeats a single LR recombination reaction. The reaction volume was reduced to 6 μl_ and contained 1 μl_ of plPKTA38 donor clone 1 ul plPKTA30N destination vector (150 ng / ul), 0.8 μl_ LR Clonase Enzyme Mix and 3.2 ul H2O. The reaction was incubated übrer overnight at room temperature, and 5 ul of them were transformed plates in 20 .mu.l chemically-competent E. colhZe \\ ev \ in 96-well PCR. Two 96-deep-well plates with LB + ampicillin were half-filled with half the volume of the transformation approach, concluded off with an air-permeable film and incubated at 37 ° C for 24 h incubated on a plate shaker. Thereafter, the deep-well plates were zentrifgueiert at 750 g for 10 min and the pellets combined of two duplicates of each clone and subjected to Plasmind preparation. For this, the NucleoSpin Robot-96 Plasmid Kit (Macherey-Nagel) was used. The amount of DNA was on average 20 to 30 micrograms of DNA per clone.

Particle bombardment and inoculation with fungal spores

Segments of primary leaves of 7-day-old barley seedlings were at 0.5% w / v Phytoagar (Ducheva) in water containing 20 ppm of benzimidazole and bombarded with gold particles (diameter 1 micron) in a PDS-1000 / He System (Bio-Rad , Munich, Germany) using the Hepta adapter with a helium pressure of 900 psi. Seven leaf segments were used per bombardment. The particle coating with 0.5 M Ca (NOs) 2 was prepared according to Schweizer et al., Durchgerführt 1999th However, the stock solution contained 25 mg ml "1 Gold. The supernatant was completely removed after the coating, and the particles were resuspended in 30 ul pu rem ethanol. 2.18 mg of gold microcarriers were used per bombardment. Four hours after bombardment, the leaf segments were placed on 1% w / v Phytoagar (Ducheva) in water containing 20 ppm benzimidazole, stored in 20 x 20 cm plates and fixed at both ends with weights.

The leaf segments were treated with Sporenb BGT and Bgh 48 h and 96 h after bombardment inoculated particle. As a reporter construct for transformed epidermal cells, the plasmid pUbiGUS containing the ß-glucuronidase (GUS) gene under control of the maize ubiquitin promoter, is used. The leaf segments were 40 h post inoculation for GUS activity and destained with 7.5% w / v trichloroacetic acid and 50% methanol for 5 minutes. The GUS staining solution is in Schweizer et al. described 1999th To evaluate the Interaktionsphänotypen GUS-stained cells were microscopically counted and the number of haustoria in these transformed cells is determined, resulting in the haustorial index is derived. Alternatively, the number of GUS-stained cells that contained a mindestans haustorium determined and used to calculate the susceptibility index.

Results: Increased resistance to powdery mildew of barley by RNAi of ARM repeat proteins

Susceptibility spores / mm 2

0.07 200 0.13 0.01 0.02 0.01 0.07 0.07

Susceptibility spores / mm 2

0.1 200 0.06 0.01 0.05 0.06 0.08

See also Figure 4

Claims

claims
1. A method for increasing the resistance to pathogens in a plant or in a part of a plant, characterized in that the activity of egg nes Armadillo repeat ARM1 protein in a plant or in a part of the
Plant is reduced.
2. The method of claim 1, wherein the activity in mesophyll and / or epidermis is reduced Miszellen.
3. The method according to claim 1 or 2, wherein the polypeptide is encoded by a polynucleotide comprising at least one nucleic acid molecule selected from the group consisting of:
a) nucleic acid molecule encoding at least one polypeptide comprising the SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, sequence shown 36, 38, 40, 42, 44, 60, 61 or 62; b) nucleic acid molecule which comprises at least one polynucleotide of the sequence shown in SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 comprising; c) nucleic acid molecule encoding a polypeptide whose sequence has an identity of at least 50% to the sequences of SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, or 44, comprising; d) nucleic acid molecule of (a) to (c) encoding a fragment or an epitope of the sequences according to SEQ. ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24,
26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or 62 coded; e) nucleic acid molecule encoding a polypeptide which is recognized by a monoclonal antibody directed against a polypeptide which by the nucleic acid molecules according to (a) encoding to (c), is detected; f) nucleic acid molecule that hybridizes under stringent conditions with a nucleic acid molecule according to (a) to (c); and g) nucleic acid molecule according to (from a DNA library using a nucleic acid molecule a) to (c) or their part-fragments of at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt as probe can be isolated under stringent hybridization conditions;
or comprises a complementary sequence thereof.
4. The method according to any one of claims 1 to 3, wherein the activity in lemma (lemma), palea (palea), Glume (anther) is reduced.
1 Seq / 41 pages Rg.
5. The method according to any one of claims 1 to 4, wherein the resistance by reducing the expression of a polypeptide, the Armadillo re- peats contains two or more, is achieved.
6. The method according to any one of claims 1 to 4, wherein the endogenous sequence of a nucleic acid encoding mutated for a Armadillo repeat ARM1 polypeptide.
7. The method according to any one of claims 1 to 6, wherein the pathogens are selected from the families of ceae Pucciniaceae, Mycosphaerellaceae and Hypocrea-.
8. A method according to any one of claims 1 to 7 wherein
a) reducing the expression of the characterized in the claims 1 to 7 polypeptide; b) the stability of the characterized in the claims 1 to 7 or the polypeptide is reduced to that corresponding mRNA molecules; c) reducing the activity of the characterized in the claims 1 to 7 polypeptide; d) transcription of a gene for the kodierendend in claims 1 to
7-characterized polypeptide by expression of an endogenous or ar- tifiziellen transcription factor is reduced; or e) the activity of an exogenous characterized in the claims 1 to 7 polypeptide reducing factor to the food or the medium hinzu- is given.
9. A method according to any one of claims 1 to 8, characterized in that the reduction of the activity of the characterized in the claims 1 to 7 polypeptide is achieved by using at least one method selected from the group consisting of:
a) introducing a nucleic acid molecule coding for ribonucleic acid molecules suitable for forming double-stranded ribonucleic acid (dsRNA), wherein the sense strand of the dsRNA molecule has a homology of at least 30% a characterized in claim 2 nucleic acid molecule or a fragment of at least 17 base pairs having at least 50% homology to an in claim 2 (a) or (b) characterized nucleic acid molecule, b) introducing a nucleic acid molecule coding for an antisense ribonucleic acid molecule which has at least a homology of 30% to the non-coding strand a characterized in claim 2 nucleic acid molecule has or comprises a fragment of at least 15 pairs base-, which has at least 50% homology to characterized a non-coding strand of a in claim 2 (a) or (b) nucleic acid molecule, c) introducing of a ribozyme which specifically of a m encoded the notified in demanding 2 nucleic acid molecules of ribonucleic acid cleaves or a specified whose ensuring expression expression cassette, d) introducing an antisense nucleic acid molecule as shown in (b), combined with a ribozyme or an ensuring expression expression cassette, e) introducing nucleic acid molecules coding for sense ribonucleic acid molecules coding for a polypeptide which is encoded by an uncharacterized in claim 2 Nukleinsäuremolekϋl, in particular of the proteins according to the sequences SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20 , 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or 62, or for
Polypeptides having at least 40% homology to the amino acid sequence of a polypeptide encoded by the designated in claim 2 nucleic acid molecules, f) introducing a Nukleiπsäuremoleküls encoding a dominant-negative polypeptide suitable for suppressing the activity of the
Claims 1 to 7 characterized polypeptide or an ensuring their expression expression cassette, g) introducing a factor, or that can bind coding for this polypeptide DNA or RNA molecules specifically the polypeptide characterized in the claims 1 to 7 or guaranteeing a whose expression expression cassette ,) introducing a viral nucleic acid molecule, which causes a degradation of mRNA molecules coding for the characterized in the claims 1 to 7 polypeptide, or of an expression ensuring expression cassette, i) introducing a nucleic acid construct suitable encoding for inducing a homologous recombination on genes h for the characterized in the claims 1 to 7 polypeptide; and j) introducing one or more inactivating mutations in one or more genes coding for the characterized in the claims 1 to 7 polypeptide.
10. The method according to any one of claims 1 to 9, comprising
a) the introduction of a recombinant expression cassette comprising, in functional linkage with a promoter active in plants, a nucleic acid sequence as characterized in claim 9 (ai) into a plant cell; b) regeneration of the plant from the plant cell, and c) expression of said nucleic acid sequence in an amount and for a time sufficient to produce a pathogen resistance in said plant, or to increase.
11. The method according to claim 10, characterized in that it is in the active in plant promoter is a pathogen-inducible promoter.
12. The method of claim 10 or 11, characterized in that it is in the active in plant promoter is an epidermal or mesophyll-specific promoter.
13. The method according to any one of claims 1 to 12, characterized in that in the plant, the plant organ, plant tissue or plant cell, the activity of a polypeptide coding for Bax inhibitor 1, ROR2, SNAP34 and / or lumenal binding protein BiP is increased.
14. A method according to any one of claims 1 to 13, characterized in that the activity of a polypeptide is coding for RacB, CSL1, HvNaOX and / or MLO is reduced in the plant, the plant organ, plant tissue or plant cell.
15. The method according to claim 13, characterized in that the Bax inhibitor 1-specific promoter is expressed under control of a mesophyll and / or root.
16. The method according to any one of claims 1 to 15, characterized in that the pathogen is selected from the species Puccinia triticina, Puccinia striiformis,
Mycosphaerella graminicola, Stagonospora nodorum, Fusarium graminearum, Fusarium culmorum, Fusarium avenaceum, poae Fusarium or Microdochium nivale.
17. The method according to any one of claims 1 to 16, characterized in that the plant from the plant genera Hordeum, Avena, Secale, Triticum, Sorghum, Zea, Saccharum and Oryza selected.
18. A nucleic acid molecule encoding a protein Armadillo repeat ARM1 comprising at least one nucleic acid molecule selected from the group consisting of: a) nucleic acid molecule encoding at least one polypeptide comprising the SEQ ID No: 2 sequence shown; b) nucleic acid molecule which comprises at least one polynucleotide of the sequence shown in SEQ ID No: 1; c) nucleic acid molecule encoding a polypeptide whose sequence has an identity of at least 50% to the sequences of SEQ ID No: 2; d) nucleic acid molecule of (a) to (c) encoding a fragment or an epitope of the sequences according to SEQ. ID No .: coded 2; e) nucleic acid molecule encoding a polypeptide which by a state-noklonalen antibody directed against a polypeptide which by
Nucleic acid molecules according to (a) is encoded to (c), is detected; f) nucleic acid molecule that hybridizes under stringent conditions with a nucleic acid molecule according to (a) to (c); and g) nucleic acid molecule according to (from a DNA library using a nucleic acid molecule a) to (c) or their part-fragments of at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt as probe can be isolated under stringent hybridization conditions;
or comprises a complementary sequence thereof; or a polypeptide comprising an amino acid sequence encoded by the nucleic acid molecule;
wherein the nucleic acid molecule is not shown from the sequence in SEQ ID NO .: 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 is sawn;
19. Nucleic acid construct containing a nucleic acid molecule comprising at least a fragment of an antisense or sense nucleic acid molecule to a nucleic acid molecule coding for Armadillo repeat ARM1 polypeptide operably linked to a pathogen-inducible promoter or epidermis and / or mesophyll-specific promoter.
20. The construct of claim 19, wherein the repeat Aramdillo ARM1 polypeptide encoded by a nucleic acid molecule comprising a nucleic acid molecule selected from the group consisting of
a) nucleic acid molecule encoding a polypeptide comprising the in
SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, sequence shown 61 or 62; b) nucleic acid molecule which comprises at least one polynucleotide of the sequence according to SEQ ID No: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21, 23, 25, 27, 29, 31, 33, 35, 37, 39, 41, or 43 comprising; c) nucleic acid molecule encoding a polypeptide whose sequence has I- DENTITY of at least 40% to the sequences of SEQ ID No: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, or 44, comprising; d) nucleic acid molecule of (a) to (c) encoding a fragment or an epitope of the sequences according to SEQ. ID No .: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 60, 61 or 62 encoding; e) nucleic acid molecule which encodes a polypeptide which is recognized by a monoclonal antibody directed against a polypeptide which by the nucleic acid molecules according to (a) encoding to (c), is detected; and) a nucleic acid molecule that hybridizes under stringent conditions f with a nucleic acid molecule according to (a) to (c); or g) a nucleic acid molecule consisting of a DNA library using a nucleic acid molecule according to (a) to (c) or their part-fragments of at least 15 nt, preferably 20 nt, 30 nt, 50 nt, 100 nt, 200 nt or 500 nt as probe can be isolated under stringent hybridization conditions;
or is complementary thereto.
21 double-stranded RNA nucleic acid molecule (dsRNA molecule), where the sense strand of said dsRNA molecule has characterizes at least a homology of 30% to the nucleic acid molecule molecule as claimed in claim 3, or comprises a fragment of at least 50 base pairs, which at least has to characterize the nucleic acid molecule as claimed in claim 3, a 50% homology.
22. dsRNA molecule according to claim 21, characterized in that the two RNA strands are covalently joined together.
23. DNA expression cassette comprising a nucleic acid molecule which is substantially identical to a nucleic acid molecule as defined in claim 3, wherein said nucleic acid molecule in the sense orientation to a promoter is present.
24. A DNA expression cassette comprising a nucleic acid molecule which is substantially identical to a nucleic acid molecule as defined in claim 3, wherein said nucleic acid molecule in the antisense orientation to a promoter is present.
25. A DNA expression cassette comprising a nucleic acid sequence coding for a dsRNA molecule of claim 21 or 22, wherein said nucleic acid sequence is linked to a promoter.
26. A DNA expression cassette according to any one of claims 23 to 25, wherein the nucleic acid sequence to be expressed is linked to a functional promoter in plants.
27. DNA expression cassette of claim 26, wherein the functional in plants is a pathogen-inducible promoter or an epidermal and / or Mesophyllspezifischer promoter.
28. A vector comprising an expression cassette according to any one of claims 23 to 27th
29. A cell comprising a nucleic acid molecule as characterized in claim 3, a dsRNA molecule according to any one of claims 21 or 22, a DNA expression cassette according to any one of claims 23 to 26, a nucleic acid molecule or a polypeptide according to claim 18, or a vector according demanding or 28 wherein the endogenous activity of a polypeptide encoded by a
nucleic acid molecule is characterized reduced as in claim 3 or turned off.
30. The transgenic nonhuman organism comprising a nucleic acid molecule as characterized in claim 3, a nucleic acid molecule or a polypeptide according
Claim 18, a dsRNA molecule according to any one of claims 21 or 22, a DNA expression cassette according to any one of claims 23 to 26, a cell according to claim 29 or a vector according to claim 28th
31. A transgenic non-human organism of claim 30 which is a monokotyle- doner organism.
32. The transgenic nonhuman organism comprising a nucleic acid molecule as characterized in claim 3, a nucleic acid molecule or a polypeptide according to claim 18, a dsRNA molecule according to any one of claims 21 or 22,
DNA expression cassette according to any one of claims 23 to 26, a cell according to claim 29 or a vector according to claim 28, which has an increased Bax inhibitor 1 -Protein-, a ROR2-, and / or SnAP34- activity and / or decreased RacB, CSL1-, and / or HvRBOHF activity.
33. Non-humander organism comprising a nucleic acid molecule as characterized in claim 3, a nucleic acid molecule or a polypeptide according to claim 18, a dsRNA molecule according to any one of claims 21 or 22, a DNA expression cassette according to any one of claims 23 to 26, a cell according to claim 29 or a vector according to claim 28, of an increased Bax inhibitor 1, a ROR2-, and / or SnAP34- activity and / or a reduced RacB, CSL1-, and / or activity in mesophyll cells and HvRBOHF / or root cells possesses.
34. Organism according to one of claims 30 to 33, selected from the species Hordeum vulgare (barley), Triticum aestivum (wheat), Triticum aestivum subsp.spelta (spelled), Triticale, Avena sativa (oats), Secale cereale (rye),
Sorghum bicolor (sorghum), Zea mays (maize), Saccharum officinarum sative (sugar cane) and Oryza (rice).
35. Use of a nucleic acid molecule as characterized in claim 3, a nucleic acid molecule or a polypeptide according to claim 18, of a dsRNA
Molecule according to any one of claims 21 or 22, a DNA expression cassette according to any one of claims 23 to 26, a cell according to claim 29 or a vector according to claim 28 for producing a plant, which is resistant to mesophyll-penetrating pathogens.
36. Harvest, propagation material or composition comprising d a nucleic acid molecule as characterized in claim 3, a nucleic acid molecule or a polypeptide according to claim 18, a dsRNA molecule according to any one of claims 21 or 22, a DNA expression cassette according to any one of claims 23 to 26, a cell according to claim 29 or a vector according to claim 28th
EP06819167A 2005-11-08 2006-10-27 Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants Withdrawn EP1948806A2 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
EP05110468 2005-11-08
EP06819167A EP1948806A2 (en) 2005-11-08 2006-10-27 Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants
PCT/EP2006/067865 WO2007054441A2 (en) 2005-11-08 2006-10-27 Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
EP06819167A EP1948806A2 (en) 2005-11-08 2006-10-27 Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants

Publications (1)

Publication Number Publication Date
EP1948806A2 true EP1948806A2 (en) 2008-07-30

Family

ID=37820815

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06819167A Withdrawn EP1948806A2 (en) 2005-11-08 2006-10-27 Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants

Country Status (6)

Country Link
US (2) US8362323B2 (en)
EP (1) EP1948806A2 (en)
AR (1) AR056782A1 (en)
AU (1) AU2006311089C1 (en)
CA (1) CA2628505A1 (en)
WO (1) WO2007054441A2 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1948806A2 (en) 2005-11-08 2008-07-30 BASF Plant Science GmbH Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants
AU2007306345B2 (en) * 2006-10-12 2013-05-23 Basf Plant Science Gmbh Method for increasing pathogen resistance in transgenic plants

Family Cites Families (69)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1984002913A1 (en) 1983-01-17 1984-08-02 Monsanto Co Chimeric genes suitable for expression in plant cells
US5352605A (en) 1983-01-17 1994-10-04 Monsanto Company Chimeric genes for transforming plant cells using viral promoters
NL8300698A (en) 1983-02-24 1984-09-17 Univ Leiden A process for the incorporation of foreign DNA into the genome of dicotyledonous plants; Agrobacterium tumefaciens bacteria and a method for producing the same; plants and plant cells with modified genetic traits; process for the preparation of chemical and / or pharmaceutical products.
US5504200A (en) 1983-04-15 1996-04-02 Mycogen Plant Science, Inc. Plant gene expression
JPS62291904A (en) 1986-06-12 1987-12-18 Namiki Precision Jewel Co Ltd Mafufacture of permanent magnet
US4962028A (en) 1986-07-09 1990-10-09 Dna Plant Technology Corporation Plant promotors
US5420034A (en) 1986-07-31 1995-05-30 Calgene, Inc. Seed-specific transcriptional regulation
US4987071A (en) 1986-12-03 1991-01-22 University Patents, Inc. RNA ribozyme polymerases, dephosphorylases, restriction endoribonucleases and methods
US5116742A (en) 1986-12-03 1992-05-26 University Patents, Inc. RNA ribozyme restriction endoribonucleases and methods
WO1989005852A1 (en) 1987-12-15 1989-06-29 Macphillamy Cummins & Gibson Ribozymes
AR242987A1 (en) 1988-03-08 1993-06-30 Ciba Geigy Chemically regulatable dna sequences and genes and uses thereof
US5789214A (en) 1988-03-08 1998-08-04 Novartis Finance Corporation Method of inducing gene transcription in a plant
US5614395A (en) 1988-03-08 1997-03-25 Ciba-Geigy Corporation Chemically regulatable and anti-pathogenic DNA sequences and uses thereof
NZ228320A (en) 1988-03-29 1991-06-25 Du Pont Nucleic acid promoter fragments of the promoter region homologous to the em gene of wheat, dna constructs therefrom and plants thereof
CA1340323C (en) 1988-09-20 1999-01-19 Arnold E. Hampel Rna catalyst for cleaving specific rna sequences
DE3843628A1 (en) 1988-12-21 1990-07-05 Inst Genbiologische Forschung Wound and potato tuber-specific transcriptional regulation
HU218717B (en) 1989-03-17 2000-11-28 E. I. Du Pont De Nemours And Co. gene fragment and a method of nucleic acid preparation that enhance the production of plant origin
US5034323A (en) 1989-03-30 1991-07-23 Dna Plant Technology Corporation Genetic engineering of novel plant phenotypes
EP0409625A1 (en) 1989-07-19 1991-01-23 Calgene, Inc. Fruit-specific transcriptional factors
GB9005772D0 (en) 1990-03-14 1990-05-09 Cambridge Advanced Tech Plant promoter
DE69132725T2 (en) 1990-03-16 2002-07-11 Calgene Llc Davis New sequences preferentially expressed during early germ development and for related methods
US5187267A (en) 1990-06-19 1993-02-16 Calgene, Inc. Plant proteins, promoters, coding sequences and use
US5639949A (en) 1990-08-20 1997-06-17 Ciba-Geigy Corporation Genes for the synthesis of antipathogenic substances
DE69132124T2 (en) 1990-11-23 2000-11-23 Aventis Cropscience Nv A method for transforming monocotyledonous plants
GB9105420D0 (en) 1991-03-14 1991-05-01 Ici Plc Expression of genes in transgenic plants
US5593874A (en) 1992-03-19 1997-01-14 Monsanto Company Enhanced expression in plants
DK0637339T3 (en) 1992-04-13 2001-12-03 Syngenta Ltd DNA constructs and plants incorporating them
US5428148A (en) 1992-04-24 1995-06-27 Beckman Instruments, Inc. N4 - acylated cytidinyl compounds useful in oligonucleotide synthesis
US5908973A (en) 1993-03-22 1999-06-01 Zeneca Limited DNA encoding fruit-ripening-related proteins, DNA constructs, cells and plants derived therefrom
US5470353A (en) 1993-10-20 1995-11-28 Hollister Incorporated Post-operative thermal blanket
GB9324707D0 (en) 1993-12-02 1994-01-19 Olsen Odd Arne Promoter
KR100386337B1 (en) 1993-12-09 2004-03-24 토마스 제퍼슨 대학교 Compounds and a method for the specific mutation-sites in eukaryotic cells
GB9403512D0 (en) 1994-02-24 1994-04-13 Olsen Odd Arne Promoter
GB9421286D0 (en) 1994-10-21 1994-12-07 Danisco Promoter
US5750868A (en) 1994-12-08 1998-05-12 Pioneer Hi-Bred International, Inc. Reversible nuclear genetic system for male sterility in transgenic plants
EP0759085A1 (en) 1995-03-09 1997-02-26 Max-Planck-Gesellschaft zur Förderung der Wissenschaften e.V. Chimeric genes comprising a fungus-responsive element
AUPN283495A0 (en) 1995-05-05 1995-06-01 Australian National University, The Plant promoter activated by fungal infection
US6100451A (en) 1995-05-18 2000-08-08 Board Of Trustees Of The University Of Kentucky Pathogen-inducible regulatory element
AU6632496A (en) 1995-08-03 1997-03-05 Rijksuniversiteit Te Leiden Cell derived antigen presenting vesicles
US5693512A (en) 1996-03-01 1997-12-02 The Ohio State Research Foundation Method for transforming plant tissue by sonication
AR006928A1 (en) 1996-05-01 1999-09-29 Pioneer Hi Bred Int An isolated DNA molecule encoding a green fluorescent protein as screenable marker for plant transformation, a method for album counts of transgenic plants, an expression vector, a transgenic plant and cells of said plants.
CA2232741A1 (en) 1996-07-23 1998-01-29 Novartis Ag Chemically-inducible arabidopsis pr-1 promoter
JP4324656B2 (en) 1996-07-29 2009-09-02 ケイヘン ナームロゼ フェンノートシャップ Polynucleotides and uses thereof for modulating the defense responses of plants
US5955361A (en) 1996-11-20 1999-09-21 Pioneer Hi-Bred International, Inc. P gene promoter constructs for floral-tissue preferred gene expression
EP0870836A1 (en) 1997-04-09 1998-10-14 IPK Gatersleben 2-Deoxyglucose-6-Phosphate (2-DOG-6-P) Phosphatase DNA sequences for use as selectionmarker in plants
US5977436A (en) 1997-04-09 1999-11-02 Rhone Poulenc Agrochimie Oleosin 5' regulatory region for the modification of plant seed lipid composition
WO1999016890A2 (en) 1997-09-30 1999-04-08 The Regents Of The University Of California Production of proteins in plant seeds
US6072103A (en) 1997-11-21 2000-06-06 Calgene Llc Pathogen and stress-responsive promoter for gene expression
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
TR200002537T2 (en) 1998-03-17 2000-11-21 Novartis Ag. genes which encode fungal resistance on Mlo protein and plant
PL343636A1 (en) 1998-04-01 2001-08-27 Mogen Internat Nv Pathogen-inducible promoter
EP3214177A3 (en) 1998-04-08 2017-11-22 Commonwealth Scientific and Industrial Research Organisation Methods and means for obtaining modified phenotypes
KR20010112952A (en) 1999-05-10 2001-12-22 릴리 엠 씨즐러 스피허, 아네뜨 워너 Regulation of viral gene expression
GB9813345D0 (en) 1998-06-19 1998-08-19 Nickerson Biocem Ltd Promoters
DE19882583D2 (en) 1998-07-01 2000-10-12 Kws Saat Ag Promoters and promoter elements for increasing the pathogen inducibility of genes in plants
US6211433B1 (en) 1998-07-07 2001-04-03 Pioneer Hi-Bred International, Inc. Manipulation of Mlo genes to enhance disease resistance in plants
US6555732B1 (en) 1998-09-14 2003-04-29 Pioneer Hi-Bred International, Inc. Rac-like genes and methods of use
DE19852195C2 (en) 1998-11-04 2000-11-02 Inst Pflanzengenetik & Kultur New expression cassette for expression of arbitrary genes in plant seeds
AU776150B2 (en) 1999-01-28 2004-08-26 Medical College Of Georgia Research Institute, Inc. Composition and method for (in vivo) and (in vitro) attenuation of gene expression using double stranded RNA
DE19956568A1 (en) 1999-01-30 2000-08-17 Roland Kreutzer Method and medicament for the inhibition of expression of a given gene
AU3369900A (en) 1999-02-19 2000-09-04 General Hospital Corporation, The Gene silencing
EP1041148A1 (en) 1999-04-02 2000-10-04 Mogen International N.V. Pathogen inducible promoter
WO2000063364A2 (en) 1999-04-21 2000-10-26 American Home Products Corporation Methods and compositions for inhibiting the function of polynucleotide sequences
EP1264887A4 (en) * 2000-02-25 2004-05-19 Chugai Pharmaceutical Co Ltd Novel armadillo repeat-containing protein alex1
AU2002246585A1 (en) 2000-11-09 2002-07-30 Washington State University Research Foundation Plant promoters, and methods of use
US7456335B2 (en) 2001-09-03 2008-11-25 Basf Plant Science Gmbh Nucleic acid sequences and their use in methods for achieving pathogen resistance in plants
JP2005185101A (en) 2002-05-30 2005-07-14 Bio Oriented Technol Res Advancement Inst VEGETABLE FULL-LENGTH cDNA AND UTILIZATION THEREOF
DE10233327A1 (en) 2002-07-22 2004-02-05 Basf Ag A method for obtaining a pathogen resistance in plants
EP1948806A2 (en) 2005-11-08 2008-07-30 BASF Plant Science GmbH Use of armadillo repeat (arm1) polynucleotides for obtaining pathogen resistance in plants

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007054441A2 *

Also Published As

Publication number Publication date
US8735654B2 (en) 2014-05-27
US8362323B2 (en) 2013-01-29
AU2006311089A1 (en) 2007-05-18
AU2006311089C1 (en) 2012-11-08
CA2628505A1 (en) 2007-05-18
US20130104260A1 (en) 2013-04-25
WO2007054441A2 (en) 2007-05-18
US20090241215A1 (en) 2009-09-24
WO2007054441A3 (en) 2007-07-26
AR056782A1 (en) 2007-10-24
AU2006311089B2 (en) 2012-06-07

Similar Documents

Publication Publication Date Title
Sharoni et al. Gene structures, classification and expression models of the AP2/EREBP transcription factor family in rice
Akhtar et al. DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants
Wang et al. Overexpression of a rice OsDREB1F gene increases salt, drought, and low temperature tolerance in both Arabidopsis and rice
Dezar et al. Hahb-4, a sunflower homeobox-leucine zipper gene, is a developmental regulator and confers drought tolerance to Arabidopsis thaliana plants
CA2325344C (en) Methods and means for obtaining modified phenotypes
Sakuma et al. DNA-binding specificity of the ERF/AP2 domain of Arabidopsis DREBs, transcription factors involved in dehydration-and cold-inducible gene expression
Oh et al. Overexpression of the transcription factor AP37 in rice improves grain yield under drought conditions
Xiang et al. Characterization of stress-responsive CIPK genes in rice for stress tolerance improvement
EP1682668B1 (en) Plant transcriptional regulators
EP2298918B1 (en) Regulation of Plant Biomass and Stress Tolerance
Su et al. A novel MYBS3-dependent pathway confers cold tolerance in rice
Hussain et al. Transcription factors as tools to engineer enhanced drought stress tolerance in plants
US20060272060A1 (en) Plant transcriptional regulators
EP2436771B1 (en) Plants having enhanced yield-related traits and a method for making the same
Quilis et al. The Arabidopsis AtNPR1 inversely modulates defense responses against fungal, bacterial, or viral pathogens while conferring hypersensitivity to abiotic stresses in transgenic rice
EP2505652B1 (en) Plants having enhanced yield-related traits and a method for making the same
EP2465933B1 (en) Disease-inducible promoters
Isabel‐LaMoneda et al. SAD: a new DOF protein from barley that activates transcription of a cathepsin B‐like thiol protease gene in the aleurone of germinating seeds
EP1546336A2 (en) Polynucleotides and polypeptides in plants
US20060015972A1 (en) Plant transcriptional regulators of drought stress
US20060162018A1 (en) Plant transcriptional regulators of disease resistance
EP1402037A1 (en) Plant genes involved in defense against pathogens
Shen et al. The stress-and abscisic acid-induced barley gene HVA22: developmental regulation and homologues in diverse organisms
CA2640076C (en) Genes for enhancing nitrogen utilization efficiency in crop plants
EP2064233B1 (en) Method of increasing resistance against soybean rust in transgenic plants

Legal Events

Date Code Title Description
17P Request for examination filed

Effective date: 20080609

AK Designated contracting states:

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

17Q First examination report

Effective date: 20090312

DAX Request for extension of the european patent (to any country) deleted
INTG Announcement of intention to grant

Effective date: 20140806

18D Deemed to be withdrawn

Effective date: 20141217