EP1937640A2 - 1,2,3,5-tetrahydro-cyclopental[c]quinolin-4-one derivatives as rxr agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes - Google Patents

1,2,3,5-tetrahydro-cyclopental[c]quinolin-4-one derivatives as rxr agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes

Info

Publication number
EP1937640A2
EP1937640A2 EP06815371A EP06815371A EP1937640A2 EP 1937640 A2 EP1937640 A2 EP 1937640A2 EP 06815371 A EP06815371 A EP 06815371A EP 06815371 A EP06815371 A EP 06815371A EP 1937640 A2 EP1937640 A2 EP 1937640A2
Authority
EP
European Patent Office
Prior art keywords
compound
optionally substituted
rxr
alkyl
alkylene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP06815371A
Other languages
German (de)
French (fr)
Inventor
Lagu Bharat
Barbara Pio
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Janssen Pharmaceutica NV
Original Assignee
Janssen Pharmaceutica NV
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Janssen Pharmaceutica NV filed Critical Janssen Pharmaceutica NV
Publication of EP1937640A2 publication Critical patent/EP1937640A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D215/00Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems
    • C07D215/02Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom
    • C07D215/16Heterocyclic compounds containing quinoline or hydrogenated quinoline ring systems having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen atoms or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
    • C07D215/20Oxygen atoms
    • C07D215/22Oxygen atoms attached in position 2 or 4
    • C07D215/233Oxygen atoms attached in position 2 or 4 only one oxygen atom which is attached in position 4
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00Drugs for disorders of the senses
    • A61P27/02Ophthalmic agents
    • A61P27/12Ophthalmic agents for cataracts
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/02Nutrients, e.g. vitamins, minerals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/08Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P5/00Drugs for disorders of the endocrine system
    • A61P5/48Drugs for disorders of the endocrine system of the pancreatic hormones
    • A61P5/50Drugs for disorders of the endocrine system of the pancreatic hormones for increasing or potentiating the activity of insulin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00Drugs for disorders of the blood or the extracellular fluid
    • A61P7/02Antithrombotic agents; Anticoagulants; Platelet aggregation inhibitors
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives

Definitions

  • the present invention relates to certain novel compounds, methods for preparing compounds, compositions, intermediates and derivatives thereof and for treating cancer and metabolic disorders. More particularly, the compounds of the present invention are Retinoid X Receptor (RXR) agonists useful for treating, ameliorating or inhibiting the onset of cancer and metabolic disorders such as diabetes, dyslipidemia, and hypercholesterolemia.
  • RXR Retinoid X Receptor
  • Diabetes is a chronic disorder affecting carbohydrate, fat and protein metabolism in animals.
  • Type I diabetes mellitus which comprises approximately 10% of all diabetes cases, was previously referred to as insulin-dependent diabetes mellitus ("IDDM”) or juvenile-onset diabetes.
  • IDDM insulin-dependent diabetes mellitus
  • This disease is characterized by a progressive loss of insulin secretory function by beta cells of the pancreas. This characteristic is also shared by non-idiopathic, or "secondary,” diabetes having its origins in pancreatic disease.
  • Type I diabetes mellitus is associated with the following clinical signs or symptoms: persistently elevated plasma glucose concentration or hyperglycemia; polyuria; polydipsia and/or hyperphagia; chronic microvascular complications such as retinopathy, nephropathy and neuropathy; and macrovascular complications such as hyperlipidemia and hypertension which can lead to blindness, end-stage renal disease, limb amputation and myocardial infarction.
  • Type Il diabetes mellitus is a metabolic disorder involving the dysregulation of glucose metabolism and impaired insulin sensitivity.
  • Type Il diabetes mellitus usually develops in adulthood and is associated with the body's inability to utilize or make sufficient insulin.
  • patients suffering from type Il diabetes mellitus have a relative insulin deficiency -- that is, patients have lower than predicted insulin levels for a given plasma glucose concentration.
  • Type Il diabetes mellitus is characterized by the following clinical signs or symptoms: persistently elevated plasma glucose concentration or hyperglycemia; polyuria; polydipsia and/or hyperphagia; chronic microvascular complications such as retinopathy, nephropathy and neuropathy; and macrovascular complications such as hyperlipidemia and hypertension which can lead to blindness, end-stage renal disease, limb amputation and myocardial infarction.
  • Dyslipidemia includes lipoprotein overproduction or deficiency; sometimes associated with diabetes, it is a common cause of lipidemia. For example, it is recommended for adults with diabetes to have their levels of LDL, HDL, total cholesterol, and triglyceride measured regularly. The desirable levels for such adults can be: LDL - less than 1O0 mg/dL (2.60 mmol/L), HDL - no less than 40 mg/dL (1.02 mmol/L), and triglyceride - less than 150 mg/dL (1.7 mmol/L). When blood cholesterol is too high, the condition is referred to as hypercholesterolemia. In one instance, dyslipidemia can include hypertriglyceridemia, and mixed hyperlipidemia.
  • dyslipidemia may be one or more of the following conditions: low HDL ( ⁇ 35 or 40 mg/dl), high triglycerides (> 200 mg/dl), and high LDL (> 150 mg/dl).
  • RXRs Retinoid X Receptors
  • RARs Retinoic Acid Receptors
  • Retinoid receptor modulators are useful in a variety of conditions including, but not limited to, metabolic disorders, such as type Il diabetes, dyslipidemia, hypercholesterolemia, and atherosclerosis, and various cancerous and precancerous conditions in the breast, skin, prostate, cervix, uterus, colon, bladder, esophagus, stomach, lung, larynx, oral cavity, blood and/or lymphatic systems.
  • metabolic disorders such as type Il diabetes, dyslipidemia, hypercholesterolemia, and atherosclerosis
  • RXRs belong to the nuclear receptor superfamily and consist of a large number of ligand-regulated transcription factors that mediate the diverse physiological functions of steroid hormones, retinoids, thyroid hormone, and vitamin D in embryonic development, growth, differentiation, a
  • RXR modulators have been identified as insulin sensitizing drugs. All diabetics, regardless of their genetic and environmental backgrounds, have in common an apparent lack of insulin or inadequate insulin function. Because transfer of glucose from the blood into muscle and fatty tissue is insulin dependent, diabetics lack the ability to utilize glucose adequately, which leads to undesired accumulation of glucose in the blood, or hyperglycemia. Chronic hyperglycemia leads to decrease in insulin secretion and contributes to increased insulin resistance, and as a result, the blood glucose concentration is increased so that diabetes is self-exacerbated (Diabetologia, 1985, "Hyperglycaemia as an inducer as well as a consequence of impaired isle cell function and insulin resistance: implications for the management of diabetes", Vol. 28, p.
  • the aforementioned self-exacerbating cycle can be interrupted so that prophylaxis or treatment of diabetes is made possible.
  • US Patent No. 6048873 to Vasudevan et al. is directed to novel compounds having retinoid-like biological activity. More specifically, it is directed to compounds that include a substituted tetrahydroquinoline moiety and a 2,4- pentadienoic acid moiety and have selective activity for retinoid X receptors.
  • US Patent No. 5739338 to Beard et al. is directed to novel compounds having retinoid-like, retinoid antagonist and/or retinoid inverse-agonist-like biological activity. More specifically, it is directed to aryl substituted tetrahydroquinoline derivatives which bind to retinoid receptors and have retinoid- like, retinoid antagonist or retinoid inverse agonist-like biological activity.
  • RXR agonists useful for the treatment of conditions including but not limited to cancer and metabolic disorders such as diabetes, dyslipidemia, and hypercholesterolemia.
  • One aspect of the present invention features a compound of Formula (I)
  • Ri is H or Ci- 3 alkyl
  • R 2 is 1 wherein
  • X is selected from a bond, optionally su stituted. -O-Ci -5 alkylene, and optionally substituted Ci.ealkylene; R a is H or optionally substituted Ci -3 alkoxy; and n is 1 , 2, or 3; or alternatively R2 is H or optionally substituted Ci- 3 alkyl; with the proviso
  • Z-X-C(O)OH 1 provided further that when R 2 is H or optionally substituted Ci- 3 alkyl, then R 3 cannot be H or optionally substituted Ci- 3 alkyl;
  • R 3 is Z-X-C(O)OH 1 wherein
  • Z is selected from , , and ;
  • X is selected from a bond, optionally substituted -O-Ci -5 alkylene, and optionally substituted Ci -6 alkylene;
  • R a is H or optionally substituted Ci -3 alkoxy; and n is 1 , 2, or 3; or alternatively R 3 is H or optionally substituted Ci -3 alkyl;
  • Another aspect of the present invention features a pharmaceutical composition
  • a pharmaceutical composition comprising at least one compound of Formula (I) and at least one pharmaceutically acceptable carrier.
  • One embodiment of the invention is a method for treating, preventing or ameliorating a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I).
  • the additional agent is a RXR agonist.
  • Another embodiment of the invention is a method for inhibiting the onset of a RXR condition in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of (a) at least one compound of Formula (I); and (b) at least one additional agent selected from a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an anti-thrombotic agent, and a blood pressure lowering agent, said co-administration being in any order and the combined amounts providing the desired prophylactic effect.
  • the additional agent is a RXR agonist.
  • It is a further embodiment of the invention to provide a process for making a pharmaceutical composition comprising admixing any of the compounds according to Formula (I) and a pharmaceutically acceptable carrier.
  • the diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof can be selected, for example, from IDDM, NIDDM, IGT (Impaired Glucose Tolerance), IFG (Impaired Fasting Glucose), Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST- segment elevation myocardial infarctions), irritable bowel disorder, inflammation
  • IDDM
  • Another aspect of the invention relates to treating hypertriglyceridemia, raising levels of HDL, lowering levels of LDL, and/or lowering total cholesterol.
  • This invention relates to novel RXR agonists and compositions thereof for treatment or prophylaxis of conditions such as diabetes, dyslipidemia, and hypercholesterolemia, and associated symptoms or complications thereof.
  • One aspect of the present invention features a compound of Formula (I)
  • R 1 is H or Ci -3 alkyl
  • R 2 is independently z X-C(O)OH 1 wn erein Z is selected from V-/ ,
  • X is selected from a bond, optionally substituted -O-Ci -5 alkylene, and optionally substituted Ci -6 alkylene; R 3 is H or optionally substituted Ci- 3 alkoxy; and n is 1 , 2, or 3; or alternatively R 2 is H or optionally substituted Ci -3 alkyl; with the proviso
  • R 2 is H or optionally substituted Ci- 3 alkyl
  • R 3 cannot be H or optionally substituted Ci- 3 alkyl
  • R 3 is independently wriere j n
  • Z is selected from , , and ;
  • X is selected from a bond, optionally substituted -O-C 1-5 alkylene, and optionally substituted Ci -6 alkylene;
  • R a is H or optionally substituted Ci -3 alkoxy; and n is 1 , 2, or 3; or alternatively R 3 is H or optionally substituted Ci -3 alkyl;
  • the present invention features a compound of Formula (I) wherein R 1 is H or C 1-3 alkyl. More particularly, Ri is Ci -3 alkyl.
  • the present invention features a compound of Formula (I)
  • the present invention features a compound of Formula (I)
  • R I 22 o ⁇ rt R ⁇ 33 w herein Z is * — " or * — " .
  • the present invention features a compound of Formula (1)
  • R 2 or R 3 is wne rein X is a bond.
  • the present invention features a compound of Formula (I)
  • R 2 or R 3 wne rein X is optionally substituted -0-Ci- 5 alkylene. More particularly, the Ci -5 alkylene is saturated. More particularly, the
  • C 1-5 alkylene is . More particularly, 1 , 2, 3, 4, or 5 of the hydrogen atoms in the Ci-salkylene is further substituted with halo. Preferably, 1 , 2 or 3 of the hydrogen atoms in the Ct- 5 alkylene is further substituted with halo. Particularly, the halo is F.
  • the present invention features a compound of Formula (I)
  • R 2 or R 3 is Z-X-C(O)OH wherein X is optionally substituted Ci- 6 alkylene. More particularly, the Ci -6 alkylene is saturated. More particularly, the
  • 1 , 2, or 3 of the hydrogen atoms in the d- ⁇ alkylene is further substituted with halo.
  • the halo is F.
  • the present invention features a compound of Formula (I)
  • R 2 or R 3 is optionally substituted -O- Ci -5 alkylene or optionally substituted Ci -6 alkylene, wherein the alkylene is unsaturated. More particularly, the alkylene contains a double or triple bond.
  • the present invention features a compound of Formula (I) wherein
  • Ri is -CH 2 CH 3 ;
  • R 2 is Z-X-C(O)OH 1 wherein
  • compositions comprising at least one compound of Formula (I) and at least one pharmaceutically acceptable carrier.
  • the pharmaceutical composition further comprises at least one additional agent, drug, medicament, antibody and/or inhibitor for treating, ameliorating and/or preventing a RXR mediated disease. More particularly, at least one compound
  • At least one compound of Formula (I) is either
  • a method for treating, preventing or ameliorating a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I).
  • An embodiment of the invention includes a method for treating, preventing or ameliorating a RXR mediated condition selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound of Formula (I).
  • a further embodiment of the invention is a method for treating, preventing or ameliorating a RXR mediated condition selected from IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts in a subject in need thereof, comprising administering to said subject a
  • One embodiment of the invention is a method of treating hypertriglyceridemia, raising levels of HDL, lowering levels of LDL, and/or lowering total cholesterol.
  • RXR agonists can be co-administered with a second agent other than a retinoid receptor agonist; such second agent can be, for example, an anti-diabetic agent, a lipid lowering agent, a blood pressure lowering agent, and an anti-thrombotic agent (e.g., aspirin, heparins, glycoprotein llb-llla inhibitors, or Factor Xa inhibitors).
  • a second agent can be, for example, an anti-diabetic agent, a lipid lowering agent, a blood pressure lowering agent, and an anti-thrombotic agent (e.g., aspirin, heparins, glycoprotein llb-llla inhibitors, or Factor Xa inhibitors).
  • the additional agent is a second RXR agonist.
  • the additional agent is an anti-diabetic agent.
  • the additional agent is a lipid lowering agent.
  • the additional agent is an anti-thrombotic agent.
  • the additional agent is a blood pressure lowering agent.
  • Another embodiment of the invention is a method for inhibiting the onset of a condition selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of (a) at least one compound of Formula (I); and (b) at least one compound selected from the group consisting of a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an anti-thrombotic agent, and a blood pressure lowering agent, said co-administration being in any order and the combined amounts providing the desired prophylactic effect.
  • a further embodiment of the invention is a method for inhibiting the onset of a RXR condition selected from IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts in a subject in need thereof, comprising administering to said subject a therapeutically effective
  • the additional agent is a second RXR agonist, in a further embodiment, the additional agent is an anti-diabetic agent. In another embodiment, the additional agent is a lipid lowering agent. In still another embodiment, the additional agent is an anti-thrombotic agent. In yet another embodiment, the additional agent is a blood pressure lowering agent. In another emobodiment, the additional agent is a RAR agonist. It is a further embodiment of the invention to provide a process for making a pharmaceutical composition comprising admixing any of the compounds according to Formula (I) and a pharmaceutically acceptable carrier.
  • a method for treating, preventing or ameliorating a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I), wherein the therapeutically effective amount of the compound of Formula (I) is from about 0.001 mg/kg/day to about 5 mg/kg/day.
  • a method for inhibiting the onset of a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I), wherein the therapeutically effective amount of the compound of Formula (I) is from about 0.001 mg/kg/day to about 5 mg/kg/day.
  • alkyl as used herein, whether used alone or as part of a substituent group, includes straight, cyclic, and branched-chain alkyl having 1 to 6 carbon atoms, or any number within this range.
  • alkyl radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t- butyl, 2-butenyI, 2-butynyl, n-pentyl, 3-(2-methyl)butyl, 2-pentyl, 2-methylbutyl, neopentyl, n-hexyl, 2-hexyl and 2-methylpentyl.
  • Alkoxy radicals are oxygen ethers formed from the previously described straight, branched, or cyclic chain alkyl groups.
  • alkylene denotes straight, branched, or cyclic alkyl, or straight or branched alkenyl, or straight or branched alkynyl, optionally substituted with one to five, preferably one to three groups including, but not limited to, optionally substituted Ci -3 alkyl and F.
  • phthalimide and saccharin are examples of compounds with oxo substituents.
  • substituted refers to a radical in which one or more hydrogen atoms are each independently replaced with the same or different substituent(s).
  • Preferred substituents include hydroxy, halogen, oxo, amino, carboxyl, and alkoxy.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts.
  • subject refers to an animal, preferably a mammal, most preferably a human, who is the object of treatment, observation or experiment.
  • RXR Retinoid-X Receptors
  • Diabetes and associated symptoms or complications include such conditions as IDDM, NIDDM, Syndrome X, IGT (Impaired Glucose Tolerance), IFG (Impaired Fasting Glucose), obesity, nephropathy, neuropathy, retinopathy, atherosclerosis, polycystic ovary syndrome, polycystic ovarian syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataracts.
  • IGT and IFG are also known as "prediabetic state.”
  • the term "therapeutically effective amount” as used herein means that amount of each active compound or pharmaceutical agent, alone or in combination, that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the disease or disorder being treated.
  • the term "therapeutically effective amount” refers to that amount of each active compound or pharmaceutical agent, alone or in combination, that treats or inhibits in a subject the onset or progression of a disorder as being sought by a researcher, veterinarian, medical doctor or other clinician.
  • the present invention provides combinations of two or more drugs wherein, for example, (a) each drug is administered in an independently therapeutically or prophylactically effective amount; (b) at least one drug in the combination is administered in an amount that is sub-therapeutic or sub-prophylactic if administered alone, but is therapeutic or prophylactic when administered in combination with the second or additional drugs according to the invention; or (c) both (or more) drugs are administered in an amount that is sub-therapeutic or sub-prophylactic if administered alone, but are therapeutic or prophylactic when administered together.
  • protecting groups refer to those moieties known in the art that are used to mask functional groups; protecting groups may be removed during subsequent synthetic transformations or by metabolic or other in vivo administration conditions.
  • any of the processes for preparation of the compounds of the present invention it may be necessary and/or desirable to protect sensitive or reactive groups on any of the molecules concerned. This may be achieved by means of conventional protecting groups, such as those described in Protective Groups in Organic Chemistry, ed. J.F.W. McOmie, Plenum Press, 1973; and T.W. Greene & P.G.M. Wuts, Protective Groups in Organic Synthesis, Third Edition, John Wiley & Sons, 1999.
  • the protecting groups may be removed at a convenient subsequent stage using methods known in the art. Examples of hydroxy! and diol protecting groups are provided below.
  • Protection for the hydroxyl group includes methyl ethers, substituted methyl ethers, substituted ethyl ethers, substitute benzyl ethers, and silyl ethers.
  • substituted methyl ethers include methyoxymethyl, methylthiomethyl, ?-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl, benzyloxymethyl, p-methoxybenzyloxymethyl, (4-methoxyphenoxy)methyl, guaiacolmethyl, f-butoxymethyl, 4-pentenyloxymethyl, siloxymethyl, 2- methoxyethoxy methyl, 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2- (trimethylsilyl)ethoxymethyl, tetrahydropyranyl, 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl, 4- methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxido, 1 -[-(2- chloride
  • substituted ethyl ethers include 1-ethoxyethyl, 1 - ⁇ 2- chloroethoxy)ethyl, 1 -methyl-1-methoxyethyl, 1 -methyl-1 -benzyloxyethyl, 1- methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2- (phenylselenyl)ethyl, f-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4- dinitrophenyl, benzyl, and polyethyleneglycol ethers.
  • substituted benzyl ethers include p-methoxybenzyl, 3,4- dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2- and 4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl, p, p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, ⁇ - naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, d ⁇ (p- methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'- bromophenacyloxy)phenyldiphenylmethyl, 4,4',4"-tris(4,5- dichlorophthalimidophenyl)methyl, 4 > 4
  • silyl ethers examples include trimethylsilyl, triethylsilyl, triisopropylsilyl, dimethylisopropylsilyl, diethylisopropylsilyl, dimethylthexylsilyl, f-butyldimethylsilyl, f-butyldiphenylsilyl, tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl, and f-butylmethoxyphenylsilyl.
  • esters include formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, p-P- phenylacetate, 3-phenylpropionate, 4-oxopentanoate(levulinate), 4,4- (ethylenedithio)pentanoate, pivaloate, adamantoate, crotonate, A- methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6- trimethylbenzoate(mesitoate), and polyethyleneglycol esters.
  • Carbonates include formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxy
  • carbonates include methyl, 9-fluorenylmethyl, ethyl, 2,2,2- trichloroethyl, 2-(trimethylsilyl)ethyl, 2-(phenylsulfonyl)ethyl, 2- (triphenylphosphonio)ethyl, isobutyl, vinyl, allyl, p-nitrophenyl, benzyl, p- methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, S-benzyl thiocarbonate, 4-ethoxy-1 -naphthyl, methyl dithiocarbonate, and polyethyleneglycol carbonates.
  • assisted cleavage examples include 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2- formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl carbonate, 4- (methylthiomethoxy)butyrate, and 2-(methyIthiomethoxymethyl)benzoate.
  • miscellaneous esters examples include 2,6-dichloro-4- methylphenoxyacetate, 2,6-dichloro-4-(1 ,1 ,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1 ,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate(tigloate), o-
  • sulfonates include sulfate, methanesulfonate(mesylate), benzylsulfonate, and tosylate.
  • cyclic acetals and ketals examples include methylene, ethylidene, 1 -t- butylethylidene, 1-phenylethyiidene, (4-methoxyphenyl)ethylidene, 2,2,2- trichloroethylidene, acetonide (isopropylidene), cyclopentylidene, cyclohexylidene, cycloheptylidene, benzylidene, p-methoxybenzylidene, 2,4- dimethoxybenzylidene, 3,4-dimethoxybenzylidene, and 2-nitrobenzylidene.
  • Cyclic Ortho Esters examples include methoxymethylene, ethoxymethylene, dimethoxymethylene, 1 -methoxyethylidene, 1 -ethoxyethylidine, 1 ,2- dimethoxyethylidene, ⁇ -methoxybenzylidene, 1 -(N,N-dimethylamino)ethylidene derivative, ⁇ -(N,N-dimethylamino)benzylidene derivative, and 2-oxacyclopentylidene.
  • silyl derivatives include di- f-butylsilylene group, and 1 ,3- (1 ,1 ,3,3-tetraisopropyldisiloxanylidene) derivative.
  • the invention provides methods of making the disclosed compounds according to traditional organic synthetic methods as well as matrix or combinatorial synthetic methods.
  • Schemes 1 through 5 describe suggested synthetic routes. Using these Schemes, the guidelines below, and the examples, a person of skill in the art may develop analogous or similar methods for a given compound that is within the invention. These methods are representative of the synthetic schemes, but are not to be construed as limiting the scope of the invention.
  • the present invention includes within its scope prodrugs of the compounds of this invention.
  • prodrugs will be functional derivatives of the compounds which are readily convertible in vivo into the required compound.
  • the term “administering” shall encompass the treatment of the various disorders described with the compound specifically disclosed or with a compound which may not be specifically disclosed, but which converts to the specified compound in vivo after administration to the subject.
  • Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in "Design of Prodrugs", ed. H. Bundgaard, Elsevier, 1985.
  • the compounds according to this invention may accordingly exist as enantiomers. Where the compounds possess two or more chiral centers, they may additionally exist as diastereomers. Where the processes for the preparation of the compounds according to the invention give rise to mixtures of stereoisomers, these isomers may be separated by conventional techniques such as preparative chromatography. The compounds may be prepared in racemic form or as individual enantiomers or diasteromers by either stereospecific synthesis or by resolution. The compounds may, for example, be resolved into their component enantiomers or diastereomers by standard techniques, such as the formation of stereoisomeric pairs by salt formation with an optically active base, followed by fractional crystallization and regeneration of the free acid.
  • the compounds may also be resolved by formation of stereoisomeric esters or amides, followed by chromatographic separation and removal of the chiral auxiliary. Alternatively, the compounds may be resolved using a chiral HPLC column. It is to be understood that all stereoisomers, racemic mixtures, diastereomers and enantiomers thereof are encompassed within the scope of the present invention.
  • any of the processes for preparation of the compounds of the present invention it may be necessary and/or desirable to protect sensitive or reactive groups on any of the molecules concerned. This may be achieved by means of conventional protecting groups, such as those described in Protective Groups in Organic Chemistry, ed. J.F.W. McOmie, Plenum Press, 1973; and T.W. Greene & P. G. M. Wuts, Protective Groups in Organic Synthesis. John Wiley & Sons, 1991.
  • the protecting groups may be removed at a convenient subsequent stage using methods known in the art.
  • crystalline forms for the compounds may exist as polymorphs and as such are intended to be included in the present invention.
  • some of the compounds may form solvates with water (i.e., hydrates) or common organic solvents, and such solvates are also intended to be encompassed within the scope of this invention.
  • Examples of the described synthetic routes include Examples 1 through 4 and Schemes 1 -5. Compounds analogous to the target compounds of these examples can be made according to similar routes. The disclosed compounds are useful as pharmaceutical agents as described in the next section. Abbreviations or acronyms useful herein include:
  • TFA trifluoroacetic acid
  • the aniline nitrogen of (i) can be treated with an alkyl iodide resultant aryl bromide (ii) can undergo a Suzuki reaction with an aryl boronic acid (iii) containing a carbonyl functionality to yield intermediate (iv).
  • the intermediate (iv), where A is Ci -6 alkoxy, can be directly hydrolyzed to give benzoic acid derivatives (Ia).
  • the cyclopropyl carboxylic acid (xiv) can be synthesized by a 1 ,4-addition of the ylide generated from trimethylsulfoxonium iodide and sodium hydride into the phenylacrylate ester (xii).
  • the cyclopropyl ester (xiii) is then hydrolyzed to give the corresponding carboxylic acid (Ie).
  • Scheme 5 Several other methods have been reported for the conversion of an acrylate ester into a cyclopropyl carboxylate ester such as the reaction of (xii) with diazomethane in the presence of a Palladium or Copper catalyst.
  • the benzaldehyde (iv) can be converted into a corresponding ketone (xv) by addition of an alkyl or aryl Grignard reagent or an aikyl or aryllithium reagent into the aldehyde followed by oxidation of the corresponding secondary alcohol.
  • R 2 is H or optionally substituted Ci- 3 alkyl and R 3
  • the present compounds are RXR agonists and are therefore useful in treating, preventing, or inhibiting the progression of RXR mediated conditions, such as metabolic disorders including diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof, as well as various cancerous and precancerous conditions in the breast, skin, prostate, cervix, uterus, colon, bladder, esophagus, stomach, lung, larynx, oral cavity, blood and/or lymphatic systems.
  • metabolic disorders including diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof
  • various cancerous and precancerous conditions in the breast, skin, prostate, cervix, uterus, colon, bladder, esophagus, stomach, lung, larynx, oral cavity, blood and/or lymphatic systems.
  • the invention features a method for treating a subject with a RXR mediated disease, said method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a compound of the invention.
  • the invention also provides a method for treating or inhibiting the progression of diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a compound of the invention.
  • Pharmaceutically acceptable salts include the therapeutically active nontoxic salts of disclosed compounds.
  • the latter can conveniently be obtained by treating the base form with an appropriate acid.
  • Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g. hydrochloric or hydrobromic acid; sulfuric; nitric; phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic, malonic, succinic, maleic, fumaric, malic, tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cydamic, salicylic, p-aminosalicylic, palmoic and the like acids.
  • the term salt also comprises the solvates which the disclosed compounds, as well as the salts thereof, are able to form.
  • Such solvates are for example hydrates, alcoholates and the like.
  • the salt form can be converted by treatment with alkali into the free base form.
  • Stereoisomeric forms define all the possible isomeric forms which the compounds of the invention may possess. Unless otherwise mentioned or indicated, the chemical designation of compounds denotes the mixture of all possible stereochemical ⁇ isomeric forms, said mixtures containing all diastereomers and enantiomers of the basic molecular structure. More in particular, stereogenic centers may have the (R)- or (S)-configuration; substituents on bivalent cyclic saturated radicals may have either the cis- or trans-configuration.
  • the invention encompasses stereochemical ⁇ isomeric forms including diastereoisomers, as well as mixtures thereof in any proportion of the disclosed compounds.
  • the disclosed compounds may also exist in their tautomeric forms. Such forms although not explicitly indicated in the above and following formulae are intended to be included within the scope of the present invention.
  • the next section includes detailed information relating to the use of the disclosed compounds and compositions.
  • the compounds of the present invention are pharmaceutically active, for example, as RXR agonists. According to one aspect of the invention, the compounds are preferably selective RXR agonists.
  • RXR-mediated diseases include IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts.
  • hyperlipidemia including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia
  • hypercholesteremia hypertrig
  • the disclosed compounds and compositions are useful for the amelioration of symptoms associated with, the treatment of, and the prevention of, the following conditions and diseases: phase I hyperlipidemia, pre-clinical hyperlipidemia, phase Il hyperlipidemia, hypercholesteremia, hypertriglyceridemia, diabetes, insulin resistance, impaired glucose tolerance, dyslipidemia, and cardiovascular disorders.
  • Preferred compounds of the invention are useful in lowering serum levels of low-density lipoproteins (LDL), intermediate density lipoprotein (IDL), and/or small LDL and other atherogenic molecules, or molecules that cause atherosclerotic complications, thereby reducing cardiovascular disorders and/or complications thereof.
  • Preferred compounds are also useful in elevating serum levels of high- density lipoproteins (HDL), as well as in lowering serum levels of triglycerides and/or free fatty acids.
  • HDL high- density lipoproteins
  • the disclosed compounds may be used in a method for treating or inhibiting the progression of an RXR mediated condition and, optionally, an additional Retinoid A Receptor mediated condition, said method comprising administering to a patient in need of treatment a pharmaceutically effective amount of a composition of the invention.
  • RXR mediated condition is acute coronary syndromes such as non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions.
  • a further aspect of the invention is a method for treating at least one RXR mediated condition and at least one Retinoid A Receptor mediated condition in a patient, said method comprising administering to a patient in need of treatment a pharmaceutically effective amount of a composition of the invention.
  • the invention also features pharmaceutical compositions which include, without limitation, one or more of the disclosed compounds, and pharmaceutically acceptable carriers or excipients.
  • the pharmaceutical compositions herein will contain, per dosage unit, e.g., tablet, capsule, powder, injection, teaspoonful and the like, an amount of the active ingredient necessary to deliver an effective dose as described above.
  • the pharmaceutical compositions herein will contain, per unit dosage unit, e.g., tablet, capsule, powder, injection, suppository, teaspoonful and the like, of from about 0.01 mg/kg to about 300 mg/kg (preferably from about 0.01 mg/kg to about 100 mg/kg; and, more preferably, from about 0.01 mg/kg to about 30 mg/kg) and may be given at a dosage of from about 0.01 mg/kg/day to about 300 mg/kg/day (preferably from about 0.01 mg/kg/day to about 100 mg/kg/day and more preferably from about 0.01 mg/kg/day to about 30 mg/kg/day).
  • the dosage form will contain a pharmaceutically acceptable carrier containing between from about 0.01 mg to about 100 mg; and, more preferably, from about 5 mg to about 50 mg of the compound, and may be constituted into any form suitable for the mode of administration selected.
  • the dosages may be varied depending upon the requirement of the subjects, the severity of the condition being treated and the compound being employed. The use of either daily administration or post- periodic dosing may be employed.
  • compositions are in unit dosage forms from such as tablets, pills, capsules, dry powders for reconstitution or inhalation, granules, lozenges, sterile parenteral solutions or suspensions, metered aerosol or liquid sprays, drops, ampoules, autoinjector devices or suppositories for administration by oral, intranasal, sublingual, intraocular, transdermal, parenteral, rectal, vaginal, dry powder inhaler or other inhalation or insufflation means.
  • the composition may be presented in a form suitable for once- weekly or once-monthly administration; for example, an insoluble salt of the active compound, such as the decanoate salt, may be adapted to provide a depot preparation for intramuscular injection.
  • the principal active ingredient is mixed with a pharmaceutical carrier, e.g. conventional tableting ingredients such as diluents, binders, adhesives, disintegrants, lubricants, antiadherents and gildants.
  • a pharmaceutical carrier e.g. conventional tableting ingredients such as diluents, binders, adhesives, disintegrants, lubricants, antiadherents and gildants.
  • Suitable diluents include, but are not limited to, starch (i.e.
  • corn, wheat, or potato starch which may be hydrolized), lactose (granulated, spray dried or anhydrous), sucrose, sucrose- based diluents (confectioner's sugar; sucrose plus about 7 to 10 weight percent invert sugar; sucrose plus about 3 weight percent modified dextrins; sucrose plus invert sugar, about 4 weight percent invert sugar, about 0.1 to 0.2 weight percent cornstarch and magnesium stearate), dextrose, inositol, mannitol, sorbitol, microcrystalline cellulose (i.e. AVICEL TM microcrystalline cellulose available from FMC Corp.), dicalcium phosphate, calcium sulfate dihydrate, calcium lactate trihydrate and the like.
  • sucrose sucrose- based diluents
  • sucrose plus about 7 to 10 weight percent invert sugar sucrose plus about 3 weight percent modified dextrins
  • sucrose plus invert sugar about 4 weight percent invert sugar, about 0.1 to 0.2 weight percent
  • Suitable binders and adhesives include, but are not limited to acacia gum, guar gum, tragacanth gum, sucrose, gelatin, glucose, starch, and cellulosics (i.e. methylceilulose, sodium carboxymethylcellulose, ethylcellulose, hydroxypropylmethylcellulose, hydroxypropylcellulose, and the like), water soluble or dispersible binders (i.e. alginic acid and salts thereof, magnesium aluminum silicate, hydroxyethylcellulose [i.e.
  • Suitable disintegrants include, but are not limited to, starches (corn, potato, etc.), sodium starch glycolates, pregelatinized starches, clays (magnesium aluminum silicate), celluloses (such as crosslinked sodium carboxymethylcellulose and microcrystalline cellulose), alginates, pregelatinized starches (i.e. com starch, etc.), gums (i.e.
  • Suitable lubricants and antiadherents include, but are not limited to, stearates (magnesium, calcium and sodium), stearic acid, talc waxes, stearowet, boric acid, sodium chloride, DL- leucine, carbowax 4000, carbowax 6000, sodium oleate, sodium benzoate, sodium acetate, sodium lauryl sulfate, magnesium lauryl sulfate and the like.
  • Suitable gildants include, but are not limited to, talc, cornstarch, silica (i.e. CAB- O-SIL TMsilica available from Cabot, SYLOID TM silica available from W. R. Grace/Davison, and AEROSIL TM silica available from Degussa) and the like.
  • silica i.e. CAB- O-SIL TMsilica available from Cabot, SYLOID TM silica available from W. R. Grace/Davison, and AEROSIL TM silica available from Degussa
  • Sweeteners and flavorants may be added to chewable solid dosage forms to improve the palatability of the oral dosage form. Additionally, colorants and coatings may be added or applied to the solid dosage form for ease of identification of the drug or for aesthetic purposes.
  • These carriers are formulated with the pharmaceutical active to provide an accurate, appropriate dose of the pharmaceutical active with a therapeutic release profile.
  • these carriers are mixed with the pharmaceutical active to form a solid preformulation composition containing a homogeneous mixture of the pharmaceutical active of the present invention, or a pharmaceutically acceptable salt thereof.
  • the preformulation will be formed by one of three common methods: (a) wet granulation, (b) dry granulation and (c) dry blending.
  • wet granulation dry granulation
  • dry blending dry blending.
  • the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective dosage forms such as tablets, pills and capsules.
  • This solid preformulation composition is then subdivided into unit dosage forms of the type described above containing from about 0.1 mg to about 500 mg of the active ingredient of the present invention.
  • the tablets or pills containing the novel compositions may also be formulated in multilayer tablets or pills to provide a sustained or provide dual-release products.
  • a dual release tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former.
  • the two components can be separated by an enteric layer, which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release.
  • enteric layers or coatings such materials including a number of polymeric materials such as shellac, cellulose acetate (i.e.
  • Sustained release tablets may also be made by film coating or wet granulation using slightly soluble or insoluble substances in solution (which for a wet granulation acts as the binding agents) or low melting solids a molten form (which in a wet granulation may incorporate the active ingredient).
  • These materials include natural and synthetic polymers waxes, hydrogenated oils, fatty acids and alcohols (i.e.
  • esters of fatty acids metallic soaps and other acceptable materials that can be used to granulate, coat, entrap or otherwise limit the solubility of an active ingredient to achieve a prolonged or sustained release product.
  • liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include, but are not limited to aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
  • Suitable suspending agents for aqueous suspensions include synthetic and natural gums such as, acacia, agar, alginate (i.e.
  • cellulosics such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose and hydroxypropyl methylcellulose, and combinations thereof
  • synthetic polymers such as polyvinyl pyrrolidone,
  • Suitable surfactants include but are not limited to sodium docusate, sodium lauryl sulfate, polysorbate, octoxynol-9, nonoxynol-10, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, polyoxamer 188, polyoxamer 235 and combinations thereof.
  • Suitable deflocculating or dispersing agent include pharmaceutical grade lecithins.
  • Suitable flocculating agent include but are not limited to simple neutral electrolytes (i.e. sodium chloride, potassium, chloride, and the like), highly charged insoluble polymers and polyelectrolyte species, water soluble divalent or trivalent ions (i.e.
  • Suitable preservatives include but are not limited to parabens (i.e. methyl, ethyl, n-propyl and n-butyl), sorbic acid, thimerosal, quaternary ammonium salts, benzyl alcohol, benzoic acid, chlorhexidine gluconate, phenylethanol and the like.
  • parabens i.e. methyl, ethyl, n-propyl and n-butyl
  • sorbic acid thimerosal, quaternary ammonium salts
  • benzyl alcohol benzoic acid
  • chlorhexidine gluconate phenylethanol and the like.
  • the liquid vehicle that is used in a particular dosage form must be compatible with the suspending agent(s).
  • nonpolar liquid vehicles such as fatty esters and oils liquid vehicles are best used with suspending agents such as low HLB (Hydrophile-Lipophile Balance) surfactants, stearalkonium hectorite, water insoluble resins, water insoluble film forming polymers and the like.
  • suspending agents such as low HLB (Hydrophile-Lipophile Balance) surfactants, stearalkonium hectorite, water insoluble resins, water insoluble film forming polymers and the like.
  • polar liquids such as water, alcohols, polyols and glycols are best used with suspending agents such as higher HLB surfactants, clays silicates, gums, water soluble cellulosics, water soluble polymers and the like.
  • sterile suspensions and solutions are desired. Liquid forms useful for parenteral administration include sterile solutions, emulsions and suspensions.
  • Isotonic preparations which generally contain suitable preservatives are employed when intravenous administration is desired.
  • compounds of the present invention can be administered in an intranasal dosage form via topical use of suitable intranasal vehicles or via transdermal skin patches, the composition of which are well known to those of ordinary skill in that art.
  • transdermal delivery system the administration of a therapeutic dose will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • Liposome delivery systems such as small unilamellar vesicles, large unilamellar vesicles, multilamellar vesicles and the like.
  • Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, phosphatidylcholines and the like.
  • Compounds of this invention may be administered in any of the foregoing compositions and dosage regimens or by means of those compositions and dosage regimens established in the art whenever treatment of RXR mediated disorders is required for a subject in need thereof.
  • the daily dose of a pharmaceutical composition of the present invention may be varied over a wide range from about 0.7 mg to about 500 mg per adult human per day; preferably, the dose will be in the range of from about 0.7 mg to about 100 mg per adult human per day; most preferably the dose will be in the range of from about 0.7 mg to about 50 mg per adult human per day.
  • the compositions are preferably provided in the form of tablets containing, 0.01 , 0.05, 0.1 , 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 150, 200, 250 and 500 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated.
  • an effective amount of the drug is ordinarily supplied at a dosage level of from about 0.01 mg/kg to about 300 mg/kg of body weight per day.
  • a compound of the present invention may be administered in a single daily dose or the total daily dosage may be administered in divided doses of two, three or four times daily.
  • Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular compound used, the mode of administration, the strength of the preparation, and the advancement of the disease condition. In addition, factors associated with the particular subject being treated, including subject age, weight, diet and time of administration, will result in the need to adjust the dose to an appropriate therapeutic level.
  • one or more compounds of Formula (I) or salt thereof as the active ingredient is intimately admixed with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques, which carrier may take a wide variety of forms depending of the form of preparation desired for administration (e.g. oral or parenteral).
  • a pharmaceutical carrier may take a wide variety of forms depending of the form of preparation desired for administration (e.g. oral or parenteral).
  • Suitable pharmaceutically acceptable carriers are well known in the art. Descriptions of some of these pharmaceutically acceptable carriers may be found in The Handbook of Pharmaceutical Excipients, published by the American Pharmaceutical Association and the Pharmaceutical Society of Great Britain.
  • the compounds of the present invention may be formulated into various pharmaceutical forms for administration purposes. Methods of formulating pharmaceutical compositions have been described in numerous publications such as Pharmaceutical Dosage Forms: Tablets. Second Edition. Revised and Expanded, Volumes 1 -3, edited by Lieberman et al; Pharmaceutical Dosage Forms: Parenteral Medications, Volumes 1-2, edited by Avis et al; and
  • the compounds of the present invention may be used in combination with one or more pharmaceutically active agents.
  • agents include other RXR modulators, other RAR modulators, other anti-diabetic agents, other lipid lowering agents, as well as blood pressure lowering agents such as statin drugs and the fibrates.
  • RXR modulators include, but are not limited to: (1) bexarotene (4 - (1 - (3,5,5,8,8 - pentamethyl - 5,6,7,8 - tetrahydro - 2 - naphthalenyl) ethenyl) benzoic acid, known as TARGRETIN, TARGRETYN, TARGREXIN; also known as LGD 1069, LG 100069, LG 1069, LDG 1069, LG 69, RO 264455); (2) 9-cis-retinoic acid; (3) AGN-4326 (also known as ALRT -4204, AGN -4204, ALRT -326,
  • LGD 1268 (6 - (1 ,1 ,4,4,6 - pentamethyl - 1 ,2,3,4 - tetrahydro - naphth -
  • substituted heterocycles is MX-6054, which is 2,4-thiazolidinedione, 5-[[3-(5,6,7,8-tetrahydro-3,5,5,8,8-pentamethyl-2- naphthalenyl)-4-(trifluoromethoxy)phenyl]methylene]-, (52)-, also named 3- (3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-4- trifluoromethoxybenzylidene-2,4-thiazolidinedione, reperesented by the following formula:
  • substituted heterocycles is 2,4- thiazolidinedione, 5-[[3-(1 -ethyl-1 ,2,3,4-tetrahydro-4,4,6-trimethyl-2-oxo-7- quinolinyl)-4-(trifluoromethoxy)phenyl]methylene]-, (5Z)-, reperesented by the following formula:
  • Prefered substituted heterocycles are selected from:
  • anti-diabetic agents include thiazolidinedione and non- thiazolidinedione insulin sensitizers, which decrease peripheral insulin resistance by enhancing the effects of insulin at target organs and tissues.
  • PPAR ⁇ nuclear receptor peroxisome proliferator-activated receptor-gamma
  • PPAR-gamma agonists are thiazolidinediones such as:
  • non-thiazolidinediones that act as insulin sensitizing agents include, but are not limited to: (1 ) JT-501 (JTT 501 , PNU-1827, PNU-716-MET-0096, or PNU 182716: isoxazolidine - 3, 5 - dione, 4 - ((4 - (2 - phenyl - 5 - methyl) - 1 ,3 - oxazolyl) ethylphenyl - 4) methyl -);
  • anti-diabetic agents have also been shown to have PPAR modulator activity such as PPAR gamma, SPPAR gamma, and/or PPAR delta/gamma agonist activity. Examples are listed below: (1) AD 5075;
  • R 119702 ((+ - ) - 5 - (4 - (5 - Methoxy - 1 H - benzimidazol - 2 - ylmethoxy) benzyl) thiazolin - 2, 4 - dione hydrochloride, or Cl 1037 or CS 011); (3) CLX-0940 (peroxisome proliferator-activated receptor alpha agonist / peroxisome proliferator-activated receptor gamma agonist);
  • LG-101280 (PPAR agonist);
  • LM-4156 PPAR agonist
  • Risarestat CT-112
  • YM 440 PPAR agonist
  • AR-H049020 PPAR agonist
  • GW 409544 (GW-544 or GW-409544);
  • LY-300512 (PPAR ⁇ agonist); (31) NID525-209 (NID-525); (32) VDO-52 (VDO-52);
  • LY-510929 peroxisome proliferator-activated receptor agonist
  • bexarotene (4 - (1 - (3,5,5,8,8 - pentamethyl - 5,6,7,8 - tetrahydro - 2 naphthalenyl) ethenyl) benzoic acid, known as TARGRETIN, TARGRETYN, TARGREXIN; also known as LGD 1069, LG 100069,
  • insulin sensitizing agents include, but are not limited to: (1) INS-1 (D-chiro inositol or D - 1 , 2, 3, 4, 5, 6 - hexahyd roxycyclohexane) ;
  • PTP-1 B protein tyrosine phosphatase 1 B
  • GSK3 glycogen synthase kinase-3
  • beta 3 adrenoceptor agonists such as ZD 2079 ((R) - N - (2 - (4 - (carboxymethyl) phenoxy) ethyl) - N - (2 - hydroxy - 2 - phenethyl) ammonium chloride, also known as ICI D 2079) or AZ 40140;
  • glycogen phosphorylase inhibitors (5) glycogen phosphorylase inhibitors
  • NC 2100 (5 - ((7 - (phenylmethoxy) - 3 - quinolinyl) methyl) - 2,4 - thiazolidinedione;
  • BM 152054 (5 - (4 - (2 - (5 - methyl - 2 - (2 - thienyl) oxazol - 4 - yl) ethoxy) benzothien - 7 - ylmethyl) thiazolidine - 2, 4 - dione);
  • BM 131258 (5 - (4 - (2 - (5 - methyl - 2 - phenyloxazol - 4 - yl) ethoxy) benzothien - 7 - ylmethyl) thiazolidine - 2, 4 - dione); (31) CRE 16336 (EML 16336); (32) HQL 975 (3 - (4 - (2 - (5 - methyl - 2 - phenyloxazol - 4 - yl) ethoxy) phenyl) - 2 (S) - (propylamino) propionic acid);
  • MAPK mitogen-activated protein kinase
  • TNF- ⁇ antagonists (42) TNF- ⁇ antagonists (43) plasma cell differentiation antigen-1 (PC-1) Antagonists
  • adipocyte lipid-binding protein (ALBP / aP2) inhibitors (44) adipocyte lipid-binding protein (ALBP / aP2) inhibitors
  • insulin potentiating factor IPF or insulin potentiating factor-1
  • somatomedin C coupled with binding protein also known as IGF- BP3, IGF-BP3, SomatoKine
  • Diab Il (known as V-411) or Glucanin, produced by Biotech Holdings Ltd. or Volque Pharmaceutical;
  • Anti-diabetic agents also include biguanides, which decreases liver glucose production and increases the uptake of glucose.
  • biguanides include metformin such as:
  • 1 , 1 - dimethylbiguanide e.g., Metformin - DepoMed, Metformin - Biovail Corporation, or METFORMIN GR (metformin gastric retention polymer)
  • Metformin - DepoMed Metformin - Biovail Corporation
  • METFORMIN GR metalformin gastric retention polymer
  • metformin hydrochloride N, N -dimethylimidodicarbonimidic diamide monohydrochloride, also known as LA 6023, BMS 207150, GLUCOPHAGE, or GLUCOPHAGE XR.
  • Anti-diabetic agents also include alpha-glucosidase inhibitors, which inhibit alpha-glucosidase.
  • Alpha-glucosidase converts fructose to glucose, thereby delaying the digestion of carbohydrates. The undigested carbohydrates are subsequently broken down in the gut, reducing the post-prandial glucose peak.
  • alpha-glucosidase inhibitors include, but are not limited to:
  • Anti-diabetic agents also include insulins such as regular or short-acting, intermediate-acting, and long-acting insulins, non-injectable or inhaled insulin, tissue selective insulin, glucophosphokinin (D-chiroinositol), insulin analogues such as insulin molecules with minor differences in the natural amino acid sequence and small molecule mimics of insulin (insulin mimetics), and endosome modulators. Examples include, but are not limited to:
  • insulin aspart human insulin (28B - L - aspartic acid) or B28-Asp- insulin, also known as insulin X14, INA-X14, NOVORAPID, NOVOMIX, or NOVOLOG);
  • insulin detemir Human 29B - (N6 - (1 - oxotetradecyl) - L - lysine) - (1 A - 21 A), (1 B - 29B) - Insulin or NN 304);
  • insulin lispro ("28B - L - lysine - 29B - L - proline human insulin, or Lys(B28), Pro(B29) human insulin analog, also known as lys-pro insulin, LY 275585, HUMALOG, HUMALOG MIX 75/25, or HUMALOG MIX 50/50);
  • insulin glargine human (A21 - glycine, B31 - arginine, B32 - arginine) insulin HOE 901 , also known as LANTUS, OPTISULIN
  • Insulin Zinc Suspension, extended (Ultralente) also known as
  • Insulin Zinc suspension (Lente), a 70% crystalline and 30% amorphous insulin suspension, also known as LENTE ILETIN II, HUMULIN L, or NOVOLIN L;
  • HUMULIN 50/50 (50% isophane insulin and 50% insulin injection);
  • HUMULIN 70/30 (70% isophane insulin NPH and 30% insulin injection), also known as NOVOLIN 70/30, NOVOLIN 70/30 PenFill, NOVOLIN 70/30 Prefilled;
  • insulin isophane suspension such as NPH ILETIN II, NOVOLIN N,
  • Anti-diabetic agents also include insulin secretion modulators such as: (1) glucagon-like peptide-1 (GLP-1) and its mimetics; (2) glucose-insulinotropic peptide (GIP) and its mimetics;
  • GLP-1 glucagon-like peptide-1
  • GIP glucose-insulinotropic peptide
  • DPP or DPPIV dipeptyl protease inhibitors
  • DPP-728 or LAF 237 (2 - pyrrolidinecarbonitrile, 1 - (((2 - ((5 - cyano - 2 - pyridinyl) amino) ethyl) amino) acetyl), known as NVP - DPP - 728, DPP - 728A, LAF - 237);
  • TSL 225 (tryptophyl - 1 ,2,3,4 - tetrahydroisoquinoline - 3 - carboxylic acid); (4d) Valine pyrrolidide (valpyr);
  • glucagon antagonists such as AY-279955
  • amylin agonists which include, but are not limited to, pramlintide (AC-
  • Known anti-diabetic agents include insulin, sulfonylureas, biguanides, meglitinides, AGI's (Alpha-Glucosidase Inhibitors; e.g., Glyset), PPAR alpha agonists, and PPAR gamma agonists, and dual PPAR alpha/gamma agonists.
  • lipid lowering agents examples include bile acid sequestrants, fibric acid derivatives, nicotinic acid, and HMGCoA reductase inhibitors.
  • statins such as LIPITOR ® , ZOCOR ® , PRAVACHOL ® , LESCOL ® , and MEVACOR ®
  • pitavastatin nisvastatin
  • ADX-159 extended release lovastatin
  • blood pressure lowering agents include anti-hypertensive agents, such as angiotensin-converting enzyme (ACE) inhibitors (Accupril, Altace, Captopril, Lotensin ,Mavik, Monopril, Prinivil, Univasc, Vasotec, and Zestril), adrenergic blockers (such as Cardura, Dibenzyline, Hylorel, Hytrin, Minipress, and Minizide) alpha/beta adrenergic blockers (such as Coreg, Normodyne, and Trandate), calcium channel blockers (such as Adalat, Calan, Cardene, Cardizem, Covera-HS, Dilacor, DynaCirc, Isoptin, Nimotop, Norvace, Plendil, Procardia, Procardia XL, SuIa, Tiazac, Vascor, and Verelan), diuretics, angiotensin Il receptor antagonists (such as Atacand, Avapro, Cozaar,
  • a second RXR or RAR modulator may also be utilized as a third antidiabetic agent, provided that it is different from the first RXR or RAR modulator.
  • THP-1 cells a human monocytic cell line, were obtained from ATCC and maintained in RPMI (Gibco) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine and 1% antibiotic-antimycotic in 5% CO 2 at 37°C.
  • RPMI Gibco
  • fetal bovine serum Gibco
  • 2mM L-glutamine fetal bovine serum
  • 1% antibiotic-antimycotic 5% CO 2 at 37°C.
  • ABCA1 mRNA induction assays the cells were pelleted and resuspended in RPMI supplemented with 0.5% charcoal treated serum (Hyclone), 2mM glutamine and 1 % antibiotic-antimycotic.
  • the cells were plated at a density of 40,000 cells/90 ⁇ l and incubated as above for at least 4 hours before the initiation of treatments. Compounds were prepared as 1OmM stocks in DMSO.
  • the compounds were diluted in medium and 10 ⁇ l of 1OX stocks were added to the cells at a final concentration 0.1% DMSO.
  • the cells were incubated for the desired amount of time (usually 18-24 hrs) and then lyzed with 50 ⁇ l of Quantigene HV bDNA lysis buffer which also contained the ABCA1 bDNA probes (probe sequences shown below):
  • ABCA1 bDNA probe sequences Primer Name Sequence hABClOOl CGGGTAACGGAAACAGGGGTTGTTTTTCTCTTGGAAAGAAAGT hABC1002 TCCGGGAGCCTCCCCAGGAGTTTTTTCTCTTGGAAAGAAAGT hABC1003 GCCAGTTTCTCCCTTGGTAGTTTTTCTCTTGGAAAGAAAGT hABC1004 CTCCTTGCTCGGGAAGGGTTTTTCTCTTGGAAAGAAAGT hABCl005 AACAGCTCCTGGGCCAGAGTTTTTCTCTTGGAAAGAAAGT hABC1006 TTCAGCCCCCCTCCCTCGGGATTTTTTCTCTTGGAAAGAAAGT hABC1007 ATGCGGGAAAGAGGACTAGTTTTTCTCTTGGAAAGAAAGT hABCl008 GTTCACCTCAGCCATGACCTTTTTTCTCTTGGAAAGAAAGT hABC1009 CATGCCTTCCAGATCATGGAACTTTTTCTCTTG
  • HEK293 cells were cultured in DMEM/F12 medium supplemented with 10% FBS and 1% l-glutamine (growth medium). Cells were seeded at a density of 5-10x10 6 cells in 50 ml of growth medium and left overnight. The medium was removed and the cells were washed with 15 ml of OptiMEM serum free medium (Invitrogen Corp).
  • the cells were transfected using OptiMEM serum free medium and DMRIE transfection reagent (Invitrogen Corp). Approximately 10-30 ng of DNA for the different receptors and 5-10 ng of the luciferase reporter (1 :1 ratio for RAR and 4:1 ratio for RXR of receptor DNA:reporter DNA) were gently mixed with 51 ⁇ l of DMRIE reagent in a total volume of 17 ml of OptiMEM medium. Eighteen hours after transfection, the cells were washed once with growth medium and then incubated for 6 hrs in 30 ml of growth medium. The cells were then trypsinized, and reseeded at a density of 50,000 per well in 96 well plates and left overnight.
  • the medium was replaced with 90 ⁇ l of medium containing DMEM/F12 supplemented with 0.5% charcoal- treated FBS (HyClone; Logan, UT) and 1% glutamine.
  • Compounds or vehicle were added in 10 ⁇ l of 10X concentration of compound or vehicle (0.1% dimethyl sulfoxide).
  • the cells were treated for 16-18 hours, lysed and assayed for luciferase activity using the Steady GIo luciferase assay kit (Promega, Madison, Wl).

Landscapes

  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Diabetes (AREA)
  • Hematology (AREA)
  • Obesity (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Cardiology (AREA)
  • Endocrinology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Urology & Nephrology (AREA)
  • Child & Adolescent Psychology (AREA)
  • Pain & Pain Management (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Vascular Medicine (AREA)
  • Emergency Medicine (AREA)
  • Nutrition Science (AREA)
  • Biomedical Technology (AREA)
  • Rheumatology (AREA)
  • Reproductive Health (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Other In-Based Heterocyclic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

The present invention relates to compounds of Formula (I), methods for preparing these compounds, compositions, intermediates and derivatives thereof and for treating RXR mediated disorders. More particularly, the compounds of the present invention are RXR agonists useful for treating RXR mediated disorders.

Description

1 ,2,3,5-TETRAHYDRO-CYCLOPENTA[C]QUINOLIN-^ONE DERIVATIVES AS
RXR AGONISTS FOR THE TREATMENT OF DYSLIPIDEMIA,
HYPERCHOLESTEROLEMIA AND DIABETES
FIELD OF THE INVENTION
The present invention relates to certain novel compounds, methods for preparing compounds, compositions, intermediates and derivatives thereof and for treating cancer and metabolic disorders. More particularly, the compounds of the present invention are Retinoid X Receptor (RXR) agonists useful for treating, ameliorating or inhibiting the onset of cancer and metabolic disorders such as diabetes, dyslipidemia, and hypercholesterolemia.
BACKGROUND OF THE INVENTION
Diabetes is a chronic disorder affecting carbohydrate, fat and protein metabolism in animals.
Type I diabetes mellitus, which comprises approximately 10% of all diabetes cases, was previously referred to as insulin-dependent diabetes mellitus ("IDDM") or juvenile-onset diabetes. This disease is characterized by a progressive loss of insulin secretory function by beta cells of the pancreas. This characteristic is also shared by non-idiopathic, or "secondary," diabetes having its origins in pancreatic disease. Type I diabetes mellitus is associated with the following clinical signs or symptoms: persistently elevated plasma glucose concentration or hyperglycemia; polyuria; polydipsia and/or hyperphagia; chronic microvascular complications such as retinopathy, nephropathy and neuropathy; and macrovascular complications such as hyperlipidemia and hypertension which can lead to blindness, end-stage renal disease, limb amputation and myocardial infarction.
Type Il diabetes mellitus (non-insulin-dependent diabetes mellitus or NIDDM) is a metabolic disorder involving the dysregulation of glucose metabolism and impaired insulin sensitivity. Type Il diabetes mellitus usually develops in adulthood and is associated with the body's inability to utilize or make sufficient insulin. In addition to the insulin resistance observed in the target tissues, patients suffering from type Il diabetes mellitus have a relative insulin deficiency -- that is, patients have lower than predicted insulin levels for a given plasma glucose concentration. Type Il diabetes mellitus is characterized by the following clinical signs or symptoms: persistently elevated plasma glucose concentration or hyperglycemia; polyuria; polydipsia and/or hyperphagia; chronic microvascular complications such as retinopathy, nephropathy and neuropathy; and macrovascular complications such as hyperlipidemia and hypertension which can lead to blindness, end-stage renal disease, limb amputation and myocardial infarction.
Dyslipidemia, or dislipidemia, includes lipoprotein overproduction or deficiency; sometimes associated with diabetes, it is a common cause of lipidemia. For example, it is recommended for adults with diabetes to have their levels of LDL, HDL, total cholesterol, and triglyceride measured regularly. The desirable levels for such adults can be: LDL - less than 1O0 mg/dL (2.60 mmol/L), HDL - no less than 40 mg/dL (1.02 mmol/L), and triglyceride - less than 150 mg/dL (1.7 mmol/L). When blood cholesterol is too high, the condition is referred to as hypercholesterolemia. In one instance, dyslipidemia can include hypertriglyceridemia, and mixed hyperlipidemia. In terms of the above indices, dyslipidemia (including hyperlipidemia) may be one or more of the following conditions: low HDL (< 35 or 40 mg/dl), high triglycerides (> 200 mg/dl), and high LDL (> 150 mg/dl).
Compounds having retinoid-like activity are useful for preventing, treating or at least alleviating the symptoms and conditions of numerous diseases and conditions. There are two main types of retinoid receptors: the Retinoid X Receptors (RXRs) including their subtypes RXRα, β, Y, and the Retinoic Acid Receptors (RARs), also including their subtypes RARα, β, y. Retinoid receptor modulators are useful in a variety of conditions including, but not limited to, metabolic disorders, such as type Il diabetes, dyslipidemia, hypercholesterolemia, and atherosclerosis, and various cancerous and precancerous conditions in the breast, skin, prostate, cervix, uterus, colon, bladder, esophagus, stomach, lung, larynx, oral cavity, blood and/or lymphatic systems. For example, RXRs belong to the nuclear receptor superfamily and consist of a large number of ligand-regulated transcription factors that mediate the diverse physiological functions of steroid hormones, retinoids, thyroid hormone, and vitamin D in embryonic development, growth, differentiation, apoptosis, and homeostasis (Mangelsdorf, D. J., et al., Cell 83, 841-850 (1995); Kastner, P., et al., Cell 83, 859-869 (1995)).
RXR modulators have been identified as insulin sensitizing drugs. All diabetics, regardless of their genetic and environmental backgrounds, have in common an apparent lack of insulin or inadequate insulin function. Because transfer of glucose from the blood into muscle and fatty tissue is insulin dependent, diabetics lack the ability to utilize glucose adequately, which leads to undesired accumulation of glucose in the blood, or hyperglycemia. Chronic hyperglycemia leads to decrease in insulin secretion and contributes to increased insulin resistance, and as a result, the blood glucose concentration is increased so that diabetes is self-exacerbated (Diabetologia, 1985, "Hyperglycaemia as an inducer as well as a consequence of impaired isle cell function and insulin resistance: implications for the management of diabetes", Vol. 28, p. 119); Diabetes Cares, 1990, Vol. 13, No. 6, "Glucose Toxicity", pp. 610-630). Therefore, by treating hyperglycemia, the aforementioned self-exacerbating cycle can be interrupted so that prophylaxis or treatment of diabetes is made possible.
US Patent No. 6048873 to Vasudevan et al. is directed to novel compounds having retinoid-like biological activity. More specifically, it is directed to compounds that include a substituted tetrahydroquinoline moiety and a 2,4- pentadienoic acid moiety and have selective activity for retinoid X receptors.
US Patent No. 5739338 to Beard et al. is directed to novel compounds having retinoid-like, retinoid antagonist and/or retinoid inverse-agonist-like biological activity. More specifically, it is directed to aryl substituted tetrahydroquinoline derivatives which bind to retinoid receptors and have retinoid- like, retinoid antagonist or retinoid inverse agonist-like biological activity.
There is a continuing need for new RXR agonists. There is also a need for RXR agonists useful for the treatment of conditions including but not limited to cancer and metabolic disorders such as diabetes, dyslipidemia, and hypercholesterolemia.
SUMMARY OF THE INVENTION
One aspect of the present invention features a compound of Formula (I)
(I) wherein
Ri is H or Ci-3alkyl;
R2 is 1 wherein
2 is selected from
X is selected from a bond, optionally su stituted. -O-Ci-5alkylene, and optionally substituted Ci.ealkylene; Ra is H or optionally substituted Ci-3alkoxy; and n is 1 , 2, or 3; or alternatively R2 is H or optionally substituted Ci-3alkyl; with the proviso
(Ra)n that when R2 is Z— X-C(O)OH j then R3 cannot be
(Ra)n
Z-X-C(O)OH1 provided further that when R2 is H or optionally substituted Ci-3alkyl, then R3 cannot be H or optionally substituted Ci- 3alkyl; and
(Ra)n R3 is Z-X-C(O)OH1 wherein
Z is selected from , , and ; X is selected from a bond, optionally substituted -O-Ci-5alkylene, and optionally substituted Ci-6alkylene;
Ra is H or optionally substituted Ci-3alkoxy; and n is 1 , 2, or 3; or alternatively R3 is H or optionally substituted Ci-3alkyl;
with the proviso that when R3 is ^ tnen R2 cannot be
(Ra)n Z— X-C(O)OH j provided further that when R3 is H or optionally substituted Ci-3alkyl, then R2 cannot be H or optionally substituted Ci- 3alkyl;
or an optical isomer, enantiomer, diastereomer, racemate, or pharmaceutically acceptable salt thereof.
Another aspect of the present invention features a pharmaceutical composition comprising at least one compound of Formula (I) and at least one pharmaceutically acceptable carrier. One embodiment of the invention is a method for treating, preventing or ameliorating a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I). Particularly, it is an embodiment of the invention to provide a method for treating, preventing or ameliorating a condition selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of (a) at least one compound of Formula (I); and (b) at least one additional agent selected from a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an antithrombotic agent, and a blood pressure lowering agent, said co-administration being in any order. In one embodiment the additional agent is a RXR agonist.
Another embodiment of the invention is a method for inhibiting the onset of a RXR condition in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of (a) at least one compound of Formula (I); and (b) at least one additional agent selected from a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an anti-thrombotic agent, and a blood pressure lowering agent, said co-administration being in any order and the combined amounts providing the desired prophylactic effect. In one embodiment the additional agent is a RXR agonist.
It is a further embodiment of the invention to provide a process for making a pharmaceutical composition comprising admixing any of the compounds according to Formula (I) and a pharmaceutically acceptable carrier.
In the disclosed methods, the diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof can be selected, for example, from IDDM, NIDDM, IGT (Impaired Glucose Tolerance), IFG (Impaired Fasting Glucose), Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST- segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts.
Another aspect of the invention relates to treating hypertriglyceridemia, raising levels of HDL, lowering levels of LDL, and/or lowering total cholesterol.
Additional embodiments and advantages of the invention will become apparent from the detailed discussion, examples, and claims below.
DETAILED DESCRIPTION OF THE INVENTION
This invention relates to novel RXR agonists and compositions thereof for treatment or prophylaxis of conditions such as diabetes, dyslipidemia, and hypercholesterolemia, and associated symptoms or complications thereof.
One aspect of the present invention features a compound of Formula (I)
(I) wherein
R1 is H or Ci-3alkyl;
(Ra)n
R2 is independently z X-C(O)OH1 wnerein Z is selected from V-/ ,
X is selected from a bond, optionally substituted -O-Ci-5alkylene, and optionally substituted Ci-6alkylene; R3 is H or optionally substituted Ci-3alkoxy; and n is 1 , 2, or 3; or alternatively R2 is H or optionally substituted Ci-3alkyl; with the proviso
that when R2 is then R3 canr,ot be
provided further that when R2 is H or optionally substituted Ci-3alkyl, then R3 cannot be H or optionally substituted Ci- 3alkyl; and
R3 is independently wrierejn
Z is selected from , , and ; X is selected from a bond, optionally substituted -O-C1-5alkylene, and optionally substituted Ci-6alkylene;
Ra is H or optionally substituted Ci-3alkoxy; and n is 1 , 2, or 3; or alternatively R3 is H or optionally substituted Ci-3alkyl;
with the proviso that when R3 is R2 cannot be
(Ra)n Z-X-C(O)OH1 provided further that when R3 is H or optionally substituted C1-3alkyl, then R2 cannot be H or optionally substituted Ci- 3alkyl;
or an optical isomer, enantiomer, diastereomer, racemate, or pharmaceutically acceptable salt thereof. Particularly, the present invention features a compound of Formula (I) wherein R1 is H or C1-3alkyl. More particularly, Ri is Ci-3alkyl.
Particularly, the present invention features a compound of Formula (I)
wherein R2 or R3 wherein Z . More particularly, Z
Particularly, the present invention features a compound of Formula (I)
wherein R I22 o υrt R π33 wherein Z is * — " or * — " . More
particularly, Z is
Particularly, the present invention features a compound of Formula (1)
wherein R2 or R3 is wnerein X is a bond.
Particularly, the present invention features a compound of Formula (I)
wherein R2 or R3 wnerein X is optionally substituted -0-Ci- 5alkylene. More particularly, the Ci-5alkylene is saturated. More particularly, the
C1-5alkylene is . More particularly, 1 , 2, 3, 4, or 5 of the hydrogen atoms in the Ci-salkylene is further substituted with halo. Preferably, 1 , 2 or 3 of the hydrogen atoms in the Ct- 5alkylene is further substituted with halo. Particularly, the halo is F.
Particularly, the present invention features a compound of Formula (I)
(Ra)n wherein R2 or R3 is Z-X-C(O)OH wherein X is optionally substituted Ci- 6alkylene. More particularly, the Ci-6alkylene is saturated. More particularly, the
or More particularly, 1 , 2, or 3 of the hydrogen atoms in the d-βalkylene is further substituted with halo. Particularly, the halo is F.
Particularly, the present invention features a compound of Formula (I)
wherein R2 or R3 is optionally substituted -O- Ci-5alkylene or optionally substituted Ci-6alkylene, wherein the alkylene is unsaturated. More particularly, the alkylene contains a double or triple bond.
Particularly, the present invention features a compound of Formula (I) wherein Ra is -OCF3, -OCH3, -OCH2CF3, or -CH=CH-C(O)OH.
Particularly, the present invention features a compound of Formula (I) wherein
Ri is -CH2CH3;
(Ra)n
R2 is Z-X-C(O)OH1 wherein
X is -CH2CH2- or -CH=CH-; and Ra is -OCF3; and n is 1 ; or alternatively R2 is H;
with the proviso that when R2 is p3 cannot be
(Ra)π
Z— X-C(O)OH f provided further that when R2 is H, then R3 cannot be H; and
(Ra)π R3 is Z-X-C(O)OH j wherein
X is -CH2CH2- or -CH=CH-; and R3 is -OCF3; and n is 1 ; or alternatively R3 is H,
with the proviso that when R3 is ^ trien R2 cannot be
(Ra)n
Z— X-C(O)OH ( provided further that when R3 is H, then R2 cannot be H.
Another aspect of the present invention features a pharmaceutical composition comprising at least one compound of Formula (I) and at least one pharmaceutically acceptable carrier. In another aspect of the invention, the pharmaceutical composition further comprises at least one additional agent, drug, medicament, antibody and/or inhibitor for treating, ameliorating and/or preventing a RXR mediated disease. More particularly, at least one compound
of Formula (I) is selected fr
In another embodiment, at least one compound of Formula (I) is either
In another embodiment of the invention a method is disclosed for treating, preventing or ameliorating a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I). An embodiment of the invention includes a method for treating, preventing or ameliorating a RXR mediated condition selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound of Formula (I).
A further embodiment of the invention is a method for treating, preventing or ameliorating a RXR mediated condition selected from IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound of Formula (I).
One embodiment of the invention is a method of treating hypertriglyceridemia, raising levels of HDL, lowering levels of LDL, and/or lowering total cholesterol.
Furthermore, RXR agonists can be co-administered with a second agent other than a retinoid receptor agonist; such second agent can be, for example, an anti-diabetic agent, a lipid lowering agent, a blood pressure lowering agent, and an anti-thrombotic agent (e.g., aspirin, heparins, glycoprotein llb-llla inhibitors, or Factor Xa inhibitors).
Particularly, it is an embodiment of the invention to provide a method for treating, preventing or ameliorating a condition selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject in need thereof, comprising administering to said subject a thereapeuctically effective amount of (a) at least one compound of Formula (I); and (b) at least one adittional agent selected from a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an anti-thrombotic agent, and a blood pressure lowering agent, said administration being in any order. In one embodiment, the additional agent is a second RXR agonist. In a further embodiment, the additional agent is an anti-diabetic agent. In another embodiment, the additional agent is a lipid lowering agent. In still another embodiment, the additional agent is an anti-thrombotic agent. In yet another embodiment, the additional agent is a blood pressure lowering agent. In another emobodiment, the additional agent is a RAR agonist. Another embodiment of the invention is a method for inhibiting the onset of a RXR condition in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound of Formula (I). Another embodiment of the invention is a method for inhibiting the onset of a condition selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of (a) at least one compound of Formula (I); and (b) at least one compound selected from the group consisting of a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an anti-thrombotic agent, and a blood pressure lowering agent, said co-administration being in any order and the combined amounts providing the desired prophylactic effect.
A further embodiment of the invention is a method for inhibiting the onset of a RXR condition selected from IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound of Formula (I). In one embodiment, the additional agent is a second RXR agonist, in a further embodiment, the additional agent is an anti-diabetic agent. In another embodiment, the additional agent is a lipid lowering agent. In still another embodiment, the additional agent is an anti-thrombotic agent. In yet another embodiment, the additional agent is a blood pressure lowering agent. In another emobodiment, the additional agent is a RAR agonist. It is a further embodiment of the invention to provide a process for making a pharmaceutical composition comprising admixing any of the compounds according to Formula (I) and a pharmaceutically acceptable carrier.
In a further embodiment of the invention, a method for treating, preventing or ameliorating a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I), wherein the therapeutically effective amount of the compound of Formula (I) is from about 0.001 mg/kg/day to about 5 mg/kg/day.
In a further embodiment of the invention, a method for inhibiting the onset of a RXR mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of Formula (I), wherein the therapeutically effective amount of the compound of Formula (I) is from about 0.001 mg/kg/day to about 5 mg/kg/day.
The invention is further described below.
A) Terms
Some terms are defined below and by their usage throughout this disclosure.
Unless otherwise noted, "alkyl" as used herein, whether used alone or as part of a substituent group, includes straight, cyclic, and branched-chain alkyl having 1 to 6 carbon atoms, or any number within this range. For example, alkyl radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t- butyl, 2-butenyI, 2-butynyl, n-pentyl, 3-(2-methyl)butyl, 2-pentyl, 2-methylbutyl, neopentyl, n-hexyl, 2-hexyl and 2-methylpentyl. "Alkoxy" radicals are oxygen ethers formed from the previously described straight, branched, or cyclic chain alkyl groups. The term "alkylene" denotes straight, branched, or cyclic alkyl, or straight or branched alkenyl, or straight or branched alkynyl, optionally substituted with one to five, preferably one to three groups including, but not limited to, optionally substituted Ci-3alkyl and F.
The term "oxo" whether used alone or as part of a substituent group refers to an O= to either a carbon or a sulfur atom. For example, phthalimide and saccharin are examples of compounds with oxo substituents.
The term "substituted" refers to a radical in which one or more hydrogen atoms are each independently replaced with the same or different substituent(s).
Preferred substituents include hydroxy, halogen, oxo, amino, carboxyl, and alkoxy.
With reference to substituents, the term "independently" means that when more than one of such substituent is possible, such substituents may be the same or different from each other.
The term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts.
The term "subject" as used herein, refers to an animal, preferably a mammal, most preferably a human, who is the object of treatment, observation or experiment.
The term "RXR" as used herein refers to Retinoid-X Receptors.
It is intended that the definition of any substituent or variable at a particular location in a molecule be independent of its definitions elsewhere in that molecule. It is understood that substituents and substitution patterns on the compounds of this invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art as well as those methods set forth herein.
Diabetes and associated symptoms or complications include such conditions as IDDM, NIDDM, Syndrome X, IGT (Impaired Glucose Tolerance), IFG (Impaired Fasting Glucose), obesity, nephropathy, neuropathy, retinopathy, atherosclerosis, polycystic ovary syndrome, polycystic ovarian syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataracts. IGT and IFG are also known as "prediabetic state."
Methods are known in the art for determining effective doses for therapeutic and prophylactic purposes for the disclosed pharmaceutical compositions or the disclosed drug combinations, whether or not formulated in the same composition. For therapeutic purposes, the term "therapeutically effective amount" as used herein, means that amount of each active compound or pharmaceutical agent, alone or in combination, that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the disease or disorder being treated. For prophylactic purposes (i.e., inhibiting the onset or progression of a disorder), the term "therapeutically effective amount" refers to that amount of each active compound or pharmaceutical agent, alone or in combination, that treats or inhibits in a subject the onset or progression of a disorder as being sought by a researcher, veterinarian, medical doctor or other clinician. Thus, the present invention provides combinations of two or more drugs wherein, for example, (a) each drug is administered in an independently therapeutically or prophylactically effective amount; (b) at least one drug in the combination is administered in an amount that is sub-therapeutic or sub-prophylactic if administered alone, but is therapeutic or prophylactic when administered in combination with the second or additional drugs according to the invention; or (c) both (or more) drugs are administered in an amount that is sub-therapeutic or sub-prophylactic if administered alone, but are therapeutic or prophylactic when administered together. The term "protecting groups" refer to those moieties known in the art that are used to mask functional groups; protecting groups may be removed during subsequent synthetic transformations or by metabolic or other in vivo administration conditions. During any of the processes for preparation of the compounds of the present invention, it may be necessary and/or desirable to protect sensitive or reactive groups on any of the molecules concerned. This may be achieved by means of conventional protecting groups, such as those described in Protective Groups in Organic Chemistry, ed. J.F.W. McOmie, Plenum Press, 1973; and T.W. Greene & P.G.M. Wuts, Protective Groups in Organic Synthesis, Third Edition, John Wiley & Sons, 1999. The protecting groups may be removed at a convenient subsequent stage using methods known in the art. Examples of hydroxy! and diol protecting groups are provided below.
Protection for the hydroxyl group includes methyl ethers, substituted methyl ethers, substituted ethyl ethers, substitute benzyl ethers, and silyl ethers.
Substituted Methyl Ethers
Examples of substituted methyl ethers include methyoxymethyl, methylthiomethyl, ?-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl, benzyloxymethyl, p-methoxybenzyloxymethyl, (4-methoxyphenoxy)methyl, guaiacolmethyl, f-butoxymethyl, 4-pentenyloxymethyl, siloxymethyl, 2- methoxyethoxy methyl, 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2- (trimethylsilyl)ethoxymethyl, tetrahydropyranyl, 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, 1-methoxycyclohexyl, 4-methoxytetrahydropyranyl, 4- methoxytetrahydrothiopyranyl, 4-methoxytetrahydrothiopyranyl S,S-dioxido, 1 -[-(2- chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yl, 1 ,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl and 2,3,3a,4,5,6,7,7a-octahydro-7,8,8- trimethyl-4,7-methanobenzofuran-2-yl.
Substituted Ethyl Ethers
Examples of substituted ethyl ethers include 1-ethoxyethyl, 1 -{2- chloroethoxy)ethyl, 1 -methyl-1-methoxyethyl, 1 -methyl-1 -benzyloxyethyl, 1- methyl-1-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethylsilylethyl, 2- (phenylselenyl)ethyl, f-butyl, allyl, p-chlorophenyl, p-methoxyphenyl, 2,4- dinitrophenyl, benzyl, and polyethyleneglycol ethers.
Substituted Benzyl Ethers
Examples of substituted benzyl ethers include p-methoxybenzyl, 3,4- dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl, p-phenylbenzyl, 2- and 4-picolyl, 3-methyl-2-picolyl N-oxido, diphenylmethyl, p, p'-dinitrobenzhydryl, 5-dibenzosuberyl, triphenylmethyl, α- naphthyldiphenylmethyl, p-methoxyphenyldiphenylmethyl, d\(p- methoxyphenyl)phenylmethyl, tri(p-methoxyphenyl)methyl, 4-(4'- bromophenacyloxy)phenyldiphenylmethyl, 4,4',4"-tris(4,5- dichlorophthalimidophenyl)methyl, 4>4/,4//-tris(levulinoyloxyphenyl)methyl, 4,4',4"-tris(benzoyloxyphenyl)methyl, 3-(/midazol-1 -ylmethyl)bis(4 ',4"- dimethoxyphenyl)methyl, 1 ,1 -bis{4-methoxyphenyl)-1'-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl, 9-(9-phenyl-10-oxo)anthryl, 1 ,3-benzodithiolan-2-yl, and benzisothiazolyl S,S-dioxido.
SiIyI Ethers Examples of silyl ethers include trimethylsilyl, triethylsilyl, triisopropylsilyl, dimethylisopropylsilyl, diethylisopropylsilyl, dimethylthexylsilyl, f-butyldimethylsilyl, f-butyldiphenylsilyl, tribenzylsilyl, tri-p-xylylsilyl, triphenylsilyl, diphenylmethylsilyl, and f-butylmethoxyphenylsilyl.
Esters
In addition to ethers, a hydroxyl group may be protected as an ester. Examples of esters include formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p-chlorophenoxyacetate, p-P- phenylacetate, 3-phenylpropionate, 4-oxopentanoate(levulinate), 4,4- (ethylenedithio)pentanoate, pivaloate, adamantoate, crotonate, A- methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6- trimethylbenzoate(mesitoate), and polyethyleneglycol esters. Carbonates
Examples of carbonates include methyl, 9-fluorenylmethyl, ethyl, 2,2,2- trichloroethyl, 2-(trimethylsilyl)ethyl, 2-(phenylsulfonyl)ethyl, 2- (triphenylphosphonio)ethyl, isobutyl, vinyl, allyl, p-nitrophenyl, benzyl, p- methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl, S-benzyl thiocarbonate, 4-ethoxy-1 -naphthyl, methyl dithiocarbonate, and polyethyleneglycol carbonates.
Assisted Cleavage
Examples of assisted cleavage include 2-iodobenzoate, 4-azidobutyrate, 4-nitro-4-methylpentanoate, o-(dibromomethyl)benzoate, 2- formylbenzenesulfonate, 2-(methylthiomethoxy)ethyl carbonate, 4- (methylthiomethoxy)butyrate, and 2-(methyIthiomethoxymethyl)benzoate.
Miscellaneous Esters
Examples of miscellaneous esters include 2,6-dichloro-4- methylphenoxyacetate, 2,6-dichloro-4-(1 ,1 ,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis(1 ,1-dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyl-2-butenoate(tigloate), o-
(methoxycarbonyl)benzoate, p-P-benzoate, α-naphthoate, nitrate, alkyl N.NjN'X-tetramethylphosphorodiamidate, N-phenylcarbamate, borate, dimethylphosphinothioyl, and 2,4-dinitrophenylsulfenate
Sulfonates
Examples of sulfonates include sulfate, methanesulfonate(mesylate), benzylsulfonate, and tosylate.
PROTECTION FOR 1 ,2- AND 1 ,3-DIOLS
Cyclic Acetals and Ketals
Examples of cyclic acetals and ketals include methylene, ethylidene, 1 -t- butylethylidene, 1-phenylethyiidene, (4-methoxyphenyl)ethylidene, 2,2,2- trichloroethylidene, acetonide (isopropylidene), cyclopentylidene, cyclohexylidene, cycloheptylidene, benzylidene, p-methoxybenzylidene, 2,4- dimethoxybenzylidene, 3,4-dimethoxybenzylidene, and 2-nitrobenzylidene.
Cyclic Ortho Esters Examples of cyclic ortho esters include methoxymethylene, ethoxymethylene, dimethoxymethylene, 1 -methoxyethylidene, 1 -ethoxyethylidine, 1 ,2- dimethoxyethylidene, α-methoxybenzylidene, 1 -(N,N-dimethylamino)ethylidene derivative, α-(N,N-dimethylamino)benzylidene derivative, and 2-oxacyclopentylidene.
SiIyI Derivatives
Examples of silyl derivatives include di- f-butylsilylene group, and 1 ,3- (1 ,1 ,3,3-tetraisopropyldisiloxanylidene) derivative.
B) Compounds
C) Synthesis
The invention provides methods of making the disclosed compounds according to traditional organic synthetic methods as well as matrix or combinatorial synthetic methods. Schemes 1 through 5 describe suggested synthetic routes. Using these Schemes, the guidelines below, and the examples, a person of skill in the art may develop analogous or similar methods for a given compound that is within the invention. These methods are representative of the synthetic schemes, but are not to be construed as limiting the scope of the invention.
The present invention includes within its scope prodrugs of the compounds of this invention. In general, such prodrugs will be functional derivatives of the compounds which are readily convertible in vivo into the required compound. Thus, in the methods of treatment of the present invention, the term "administering" shall encompass the treatment of the various disorders described with the compound specifically disclosed or with a compound which may not be specifically disclosed, but which converts to the specified compound in vivo after administration to the subject. Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in "Design of Prodrugs", ed. H. Bundgaard, Elsevier, 1985.
Where the compounds according to this invention have at least one chiral center, they may accordingly exist as enantiomers. Where the compounds possess two or more chiral centers, they may additionally exist as diastereomers. Where the processes for the preparation of the compounds according to the invention give rise to mixtures of stereoisomers, these isomers may be separated by conventional techniques such as preparative chromatography. The compounds may be prepared in racemic form or as individual enantiomers or diasteromers by either stereospecific synthesis or by resolution. The compounds may, for example, be resolved into their component enantiomers or diastereomers by standard techniques, such as the formation of stereoisomeric pairs by salt formation with an optically active base, followed by fractional crystallization and regeneration of the free acid. The compounds may also be resolved by formation of stereoisomeric esters or amides, followed by chromatographic separation and removal of the chiral auxiliary. Alternatively, the compounds may be resolved using a chiral HPLC column. It is to be understood that all stereoisomers, racemic mixtures, diastereomers and enantiomers thereof are encompassed within the scope of the present invention.
During any of the processes for preparation of the compounds of the present invention, it may be necessary and/or desirable to protect sensitive or reactive groups on any of the molecules concerned. This may be achieved by means of conventional protecting groups, such as those described in Protective Groups in Organic Chemistry, ed. J.F.W. McOmie, Plenum Press, 1973; and T.W. Greene & P. G. M. Wuts, Protective Groups in Organic Synthesis. John Wiley & Sons, 1991. The protecting groups may be removed at a convenient subsequent stage using methods known in the art.
Furthermore, some of the crystalline forms for the compounds may exist as polymorphs and as such are intended to be included in the present invention. In addition, some of the compounds may form solvates with water (i.e., hydrates) or common organic solvents, and such solvates are also intended to be encompassed within the scope of this invention.
Examples of the described synthetic routes include Examples 1 through 4 and Schemes 1 -5. Compounds analogous to the target compounds of these examples can be made according to similar routes. The disclosed compounds are useful as pharmaceutical agents as described in the next section. Abbreviations or acronyms useful herein include:
Boc (tert butyl carbamate)
BuLi (butyllithium) DMAP (4-(dimethylamino)pyridine)
DMF (dimethylformamide)
DMPU (1 ,3-Dimethyl-3,4,5,6-tetrahydro-2(1 H)-pyrimidinone)
DMSO (methyl sulfoxide)
EDCI (1 -(3-Dimethylaminopropyl)-3-ethylcarbodiimide hydrochloride) EtOAc (ethyl acetate)
LCMS (high pressure liquid chroatography with mass spectrometer)
LHMDS (lithium hexamethyl disilazide)
NaHMDS (sodium hexamethyl disilazide)
NaO1Bu (sodium tert-butoxide) NBS (N-Bromosuccinimide)
NMP (N-Methyl Pyrroidinone)
TEMPO (2,2,6,6-tetramethyl-1 -piperdinyloxy, free radical)
TFA (trifluoroacetic acid);
SPE (solid phase extraction) THF (tetrahydrofuran)
TLC (thin layer chromatography)
General Guidance
Scheme 1a
As demonstrated in Scheme 1a above, wherein A represents hydrogen (H), Ci-6alkyl, or Ci-6alkoxy, and R represents Ci-6alkyl, and Ri and R3 are as described hereinabove, the aniline nitrogen of (i) can be treated with an alkyl iodide resultant aryl bromide (ii) can undergo a Suzuki reaction with an aryl boronic acid (iii) containing a carbonyl functionality to yield intermediate (iv). The intermediate (iv), where A is Ci-6alkoxy, can be directly hydrolyzed to give benzoic acid derivatives (Ia).
Scheme 1 b below, wherein A represents H, Ci-6alkyl, or aryl, and Rx and Ry represent straight or branched C-i^alkyl, Ai, A2, and A3 represent independently H, straight or branched Ci-4alkyl optionally substituted by halo, or halo, and Rx and Ry represent independently straight or branched Ci-4alkyl, and Ri and R3 are as described hereinabove, shows the intermediate (iv) can be treated with a Wadsworth-Emmon's reagent (modified Witting reagent) to yield substituted phenylacrylic esters or phenyldienoic esters, either of which can be hydrolyzed to the corresponding substituted acids (Ib and Ic) under either acidic or basic conditions. Scheme 1 b
Scheme 2
(viϋ) ("X) (X)
As demonstrated in Scheme 2 wherein Y is Cl, Br, or I, desired quinolone intermediates (x) can be made using a published procedure, Bioorg. Med. Chem. Lett. 2002, 12, 2561. Eneamine addition to substituted aryl isocyanates (viii) followed by acid mediated cyclization gives quinolones (x). The quinolone intermediates (x) can be used as the aryl bromide component (i) in the synthetic sequence demonstrated in Scheme 1a. Scheme 3
In accordance with Scheme 3 wherein A, Ai, R, Ri, and R3 are as described hereinabove, the double bonds of the phenylacrylic acids and phenyl dienoic acids, such as (vi) and (vii) synthesized by a sequence similar to the one shown in Scheme 1a and 1 b, can be reduced by hydrogenation with metal catalysts such as palladium on carbon to give corresponding carboxylic acids (Id). The same acids can also be synthesized from the corresponding esters by hydrogenation followed by hydrolysis of the ester functionality.
Scheme 4
Hydrolysis
In accordance with Scheme 4 wherein A, A1, R, R1, and R3 are as described hereinabove, the cyclopropyl carboxylic acid (xiv) can be synthesized by a 1 ,4-addition of the ylide generated from trimethylsulfoxonium iodide and sodium hydride into the phenylacrylate ester (xii). The cyclopropyl ester (xiii) is then hydrolyzed to give the corresponding carboxylic acid (Ie). Several other methods have been reported for the conversion of an acrylate ester into a cyclopropyl carboxylate ester such as the reaction of (xii) with diazomethane in the presence of a Palladium or Copper catalyst. Scheme 5
In accordance with Scheme 5 wherein R, R1, and R3 are as described hereinabove, the benzaldehyde (iv) can be converted into a corresponding ketone (xv) by addition of an alkyl or aryl Grignard reagent or an aikyl or aryllithium reagent into the aldehyde followed by oxidation of the corresponding secondary alcohol.
When R2 is H or optionally substituted Ci-3alkyl and R3
is wnerejn z, R3, X are as described hereinabove, compounds of Formula I can be made in a similar fashion.
Examples
Example 1
S-rS-fδ-Ethyl-^oxo-a.S^^-tetrahvdro-IH-cvclopentarciquinolin-δ-ylM- trifluoromethoxy-phenyli-acrylic acid (Compound 1) A. 8-Bromo-1 ^.S.δ-tetrahvdro-cvclopentarciquinolin^-one (Compound 1A)
This was made made from 4-bromophenyl isocyanate according to Jaroch et al, Bioorg. Med. Chem. Lett. 2002, 12, 2561. MS (electrospray): mass calculated for Ci2Hi0BrNO1 262.99; m/z found 264, [M+H]+.
B1 δ-Bromo-δ-ethyl-I ^.S.δ-tetrahvdro-cvclopentarclquinolin^-one (Compound M
A solution of Compound 1 A (2.3 g, 8.7 mmol) was dissolved in 35 mL of DMSO and added to a prestirred 2.0 M solution of potassium hydroxide (730 mg, 13.1 mmol) in DMSO. Next, ethyl iodide (01.45 mL, 17.4 mmol) was added and the reaction stirred at room temperature overnight. The reaction was quenched with 100 mL of water and extracted with dichloromethane. The combined organic extracts were dried over magnesium sulfate, filtered and excess solvent removed to yield 2.13 g (84%) of desired product. MS (electrospray): mass calculated for Ci4H14BrNO, 291.03; m/z found 292, [M+H]+.
C. S-fδ-EthvM-oxo^SAδ-tetrahydro-I H-cvclopentarciquinolin-δ-vIM- trifluoromethoxy-benzaldehvde (Compound 1C)
A round bottom flask was charged with Compound 1 B (200 mg, 0.69 mmol), 2-trifluoromethoxy-5-formylphenylboronic acid (200 mg, 0.86 mmol) and tetrakis(triphenylphosphine)palladium(0), (40 mg, 0.035 mmol). The flask was sealed and 3mL of toluene and 1 mL of ethanol was added. The resulting solution was stirred to dissolve the reactants and then 1 mL of a 2 M K2CO3 solution was added via syringe. The reaction mixture was heated to 8O0C for 4 hours. After cooling, the reaction mixture was partitioned between ethyl acetate (50 mL) and water (25 mL). The water layer was further extracted (2 x 25 mL) and the combined organic layers were washed with water followed by brine, dried over magnesium sulfate, filtered and excess solvent removed on the rotary evaporator. The crude product was purified by flash chromatography (EtOAc/Hexanes; gradient 10% to 25%) to give 185 mg (67%) of Compound 1C, an off white solid. MS (electrospray): mass calculated for C22Hi8F3NO3, 401.1 ; m/z found 402.1 , [M+H]+.
D1 3-r3-(5-Ethyl-4-oxo-2,3.4.5-tetrahvdro-1 H-cvclopentarclquinolin-8-yl)-4- trifluoromethoxy-phenyll-acrylic acid tert-butyl ester (Compound 1 D)
A flask charged with dimethyl f-butoxycarbonyl-methylphosphonate (0.21 mL, 1.06 mmol) in 2 mL of dry THF/DMPU (10:1) was cooled to -780C where 0.52 mL of n-butyl lithium (2.5 M hexane solution, 32mmol) was added slowly via syringe. The reaction mixture was stirred at -780C for 10 minutes and then a solution of Compound 1 C (185 mg, 0.48 mmol) in 2 mL of dry THF was added. After warming to room temperature and an additional 20 minutes of stirring, the reaction was quenched with 5 mL of water and passed through a solid phase extraction column (SPE). The column was washed with EtOAc (50 mL) and the collected eluant was evaporated to give crude product which was purified by flash chromatography (EtOAc/Hexanes; gradient 15% to 30%) to give 205 mg (86%) of Compound 1 D as a foamy white solid. MS (electrospray): mass calculated for C28H28F3NO4, 499.2; m/z found 500.2, [M+H]+.
E. S-rS-fδ-Ethyl^-oxo^.S^.S-tetrahvdro-I H-cvclopentarclquinolin-δ-yl)^- trifluoromethoxy-phenyli-acrylic acid (Compound 1)
A solution of Compound 1 D (50 mg, 0.1 mmol) in 2mL of dichloromethane and 1 mL of trifluoroacetic acid was stirred at room temperature overnight. The reaction mixture was then concentrated on the rotary evaporator and redissolved in 5 mL of diethyl ether. To this solution, hexanes were added to give a cloudy solution from which 43 mg (100%) of Compound 1 precipitated out as a white solid. MS (electrospray): mass calculated for C24H20F3NO4, 443.1 ; m/z found 444.1 , [M+H]+.
Example 2
S-rS-fδΕthvM-oxo^^^.S-tetrahvdro-I H-cyclopentarciquinolin-y-ylM- trifluoromethoxy-phenyli-acrylic acid (Compound 2) This was prepared using a procedure similar to that described to make Compound 1 , except using 3-bromophenyl isocyanate in Step 1A. MS (electrospray): mass calculated for C24H2OFsNO4, 443.1 ; m/z found 444.1 , [M+H]+.
Example 3
3-r3-(5-Ethyl-4-oxo-2,3,4,5-tetrahvdro-1 H-cvclopentarc1quinolin-8-vπ-4- trifluoromethoxy-phenyli-propionic acid (Compound 3) Compound 1 (25 mg, 0.056 mmol) was dissolved in 5 ml_ of EtOAc and hydrogenated with a catalytic amount (5 mg) of 10 % Pd/C and H2 balloon for 4 hours. Pd/C was then filtered off and solvent was evaporated to afford product as colorless oil. Evaporation from hexane or ether afforded 23 mg of Compound 3 (100%) as white sticky foam. MS (electrospray): mass calculated for C24H22F3NO4, 445.2; m/z found 446.2, [M+H]+.
Example 4
S-rS-fS-Ethyl^-oxo-Σ^^.S-tetrahvdro-I H-cvclopentaMquinolin-T-vIM- trifluoromethoxy-phenyli-propionic acid (Compound 4)
This was prepared from Compound 2 using the procedure described to make Compound 3. MS (electrospray): mass calculated for C24H22FsNO4, 445.2; m/z found 446.2, [M+H]+. D) General Administration, Formulation, and Dosages
The present compounds are RXR agonists and are therefore useful in treating, preventing, or inhibiting the progression of RXR mediated conditions, such as metabolic disorders including diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof, as well as various cancerous and precancerous conditions in the breast, skin, prostate, cervix, uterus, colon, bladder, esophagus, stomach, lung, larynx, oral cavity, blood and/or lymphatic systems.
The invention features a method for treating a subject with a RXR mediated disease, said method comprising administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a compound of the invention. The invention also provides a method for treating or inhibiting the progression of diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof in a subject, wherein the method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising a compound of the invention.
Pharmaceutically acceptable salts include the therapeutically active nontoxic salts of disclosed compounds. The latter can conveniently be obtained by treating the base form with an appropriate acid. Appropriate acids comprise, for example, inorganic acids such as hydrohalic acids, e.g. hydrochloric or hydrobromic acid; sulfuric; nitric; phosphoric and the like acids; or organic acids such as, for example, acetic, propanoic, hydroxyacetic, lactic, pyruvic, oxalic, malonic, succinic, maleic, fumaric, malic, tartaric, citric, methanesulfonic, ethanesulfonic, benzenesulfonic, p-toluenesulfonic, cydamic, salicylic, p-aminosalicylic, palmoic and the like acids. The term salt also comprises the solvates which the disclosed compounds, as well as the salts thereof, are able to form. Such solvates are for example hydrates, alcoholates and the like. Conversely the salt form can be converted by treatment with alkali into the free base form. Stereoisomeric forms define all the possible isomeric forms which the compounds of the invention may possess. Unless otherwise mentioned or indicated, the chemical designation of compounds denotes the mixture of all possible stereochemical^ isomeric forms, said mixtures containing all diastereomers and enantiomers of the basic molecular structure. More in particular, stereogenic centers may have the (R)- or (S)-configuration; substituents on bivalent cyclic saturated radicals may have either the cis- or trans-configuration. The invention encompasses stereochemical^ isomeric forms including diastereoisomers, as well as mixtures thereof in any proportion of the disclosed compounds. The disclosed compounds may also exist in their tautomeric forms. Such forms although not explicitly indicated in the above and following formulae are intended to be included within the scope of the present invention. The next section includes detailed information relating to the use of the disclosed compounds and compositions.
E) Use
The compounds of the present invention are pharmaceutically active, for example, as RXR agonists. According to one aspect of the invention, the compounds are preferably selective RXR agonists.
Examples of RXR-mediated diseases include IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease (e.g., acute coronary syndromes or ACS, including but not limited to, non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions), irritable bowel disorder, inflammation, cardiovascular disorders and cataracts.
According to one aspect of the invention, the disclosed compounds and compositions are useful for the amelioration of symptoms associated with, the treatment of, and the prevention of, the following conditions and diseases: phase I hyperlipidemia, pre-clinical hyperlipidemia, phase Il hyperlipidemia, hypercholesteremia, hypertriglyceridemia, diabetes, insulin resistance, impaired glucose tolerance, dyslipidemia, and cardiovascular disorders. Preferred compounds of the invention are useful in lowering serum levels of low-density lipoproteins (LDL), intermediate density lipoprotein (IDL), and/or small LDL and other atherogenic molecules, or molecules that cause atherosclerotic complications, thereby reducing cardiovascular disorders and/or complications thereof. Preferred compounds are also useful in elevating serum levels of high- density lipoproteins (HDL), as well as in lowering serum levels of triglycerides and/or free fatty acids.
According to one aspect of the invention, the disclosed compounds may be used in a method for treating or inhibiting the progression of an RXR mediated condition and, optionally, an additional Retinoid A Receptor mediated condition, said method comprising administering to a patient in need of treatment a pharmaceutically effective amount of a composition of the invention.
Another aspect of the invention is a method of use wherein the RXR mediated condition is acute coronary syndromes such as non-ST segment myocardial infarction and ST-segment elevation myocardial infarctions.
A further aspect of the invention is a method for treating at least one RXR mediated condition and at least one Retinoid A Receptor mediated condition in a patient, said method comprising administering to a patient in need of treatment a pharmaceutically effective amount of a composition of the invention. The invention also features pharmaceutical compositions which include, without limitation, one or more of the disclosed compounds, and pharmaceutically acceptable carriers or excipients.
1. Dosages
Those of skill in the treatment of disorders or conditions mediated by RXR could easily determine the effective daily amount from the test results presented hereinafter and other information. The exact dosage and frequency of administration depends on the particular compound of invention used, the particular condition being treated, the severity of the condition being treated, the age, weight and general physical condition of the particular patient as well as other medication the patient may be taking, as is well known to those skilled in the art. Furthermore, it is evident that said effective daily amount may be lowered or increased depending on the response of the treated patient and/or depending on the evaluation of the physician prescribing the compounds of the instant invention. The effective daily amount ranges mentioned herein are therefore only guidelines in practicing the present invention.
The pharmaceutical compositions herein will contain, per dosage unit, e.g., tablet, capsule, powder, injection, teaspoonful and the like, an amount of the active ingredient necessary to deliver an effective dose as described above. The pharmaceutical compositions herein will contain, per unit dosage unit, e.g., tablet, capsule, powder, injection, suppository, teaspoonful and the like, of from about 0.01 mg/kg to about 300 mg/kg (preferably from about 0.01 mg/kg to about 100 mg/kg; and, more preferably, from about 0.01 mg/kg to about 30 mg/kg) and may be given at a dosage of from about 0.01 mg/kg/day to about 300 mg/kg/day (preferably from about 0.01 mg/kg/day to about 100 mg/kg/day and more preferably from about 0.01 mg/kg/day to about 30 mg/kg/day). Preferably, the method for the treatment of metabolic disorders described in the present invention using any of the compounds as defined herein, the dosage form will contain a pharmaceutically acceptable carrier containing between from about 0.01 mg to about 100 mg; and, more preferably, from about 5 mg to about 50 mg of the compound, and may be constituted into any form suitable for the mode of administration selected. The dosages, however, may be varied depending upon the requirement of the subjects, the severity of the condition being treated and the compound being employed. The use of either daily administration or post- periodic dosing may be employed.
Preferably these compositions are in unit dosage forms from such as tablets, pills, capsules, dry powders for reconstitution or inhalation, granules, lozenges, sterile parenteral solutions or suspensions, metered aerosol or liquid sprays, drops, ampoules, autoinjector devices or suppositories for administration by oral, intranasal, sublingual, intraocular, transdermal, parenteral, rectal, vaginal, dry powder inhaler or other inhalation or insufflation means. Alternatively, the composition may be presented in a form suitable for once- weekly or once-monthly administration; for example, an insoluble salt of the active compound, such as the decanoate salt, may be adapted to provide a depot preparation for intramuscular injection.
For preparing solid pharmaceutical compositions such as tablets, the principal active ingredient is mixed with a pharmaceutical carrier, e.g. conventional tableting ingredients such as diluents, binders, adhesives, disintegrants, lubricants, antiadherents and gildants. Suitable diluents include, but are not limited to, starch (i.e. corn, wheat, or potato starch, which may be hydrolized), lactose (granulated, spray dried or anhydrous), sucrose, sucrose- based diluents (confectioner's sugar; sucrose plus about 7 to 10 weight percent invert sugar; sucrose plus about 3 weight percent modified dextrins; sucrose plus invert sugar, about 4 weight percent invert sugar, about 0.1 to 0.2 weight percent cornstarch and magnesium stearate), dextrose, inositol, mannitol, sorbitol, microcrystalline cellulose (i.e. AVICEL ™ microcrystalline cellulose available from FMC Corp.), dicalcium phosphate, calcium sulfate dihydrate, calcium lactate trihydrate and the like. Suitable binders and adhesives include, but are not limited to acacia gum, guar gum, tragacanth gum, sucrose, gelatin, glucose, starch, and cellulosics (i.e. methylceilulose, sodium carboxymethylcellulose, ethylcellulose, hydroxypropylmethylcellulose, hydroxypropylcellulose, and the like), water soluble or dispersible binders (i.e. alginic acid and salts thereof, magnesium aluminum silicate, hydroxyethylcellulose [i.e. TYLOSE ™available from Hoechst Celanese], polyethylene glycol, polysaccharide acids, bentonites, polyvinylpyrrolidone, polymethacrylates and pregelatinized starch) and the like. Suitable disintegrants include, but are not limited to, starches (corn, potato, etc.), sodium starch glycolates, pregelatinized starches, clays (magnesium aluminum silicate), celluloses (such as crosslinked sodium carboxymethylcellulose and microcrystalline cellulose), alginates, pregelatinized starches (i.e. com starch, etc.), gums (i.e. agar, guar, locust bean, karaya, pectin, and tragacanth gum), cross-linked polyvinylpyrrolidone and the like. Suitable lubricants and antiadherents include, but are not limited to, stearates (magnesium, calcium and sodium), stearic acid, talc waxes, stearowet, boric acid, sodium chloride, DL- leucine, carbowax 4000, carbowax 6000, sodium oleate, sodium benzoate, sodium acetate, sodium lauryl sulfate, magnesium lauryl sulfate and the like. Suitable gildants include, but are not limited to, talc, cornstarch, silica (i.e. CAB- O-SIL ™silica available from Cabot, SYLOID ™ silica available from W. R. Grace/Davison, and AEROSIL ™ silica available from Degussa) and the like. Sweeteners and flavorants may be added to chewable solid dosage forms to improve the palatability of the oral dosage form. Additionally, colorants and coatings may be added or applied to the solid dosage form for ease of identification of the drug or for aesthetic purposes. These carriers are formulated with the pharmaceutical active to provide an accurate, appropriate dose of the pharmaceutical active with a therapeutic release profile.
Generally these carriers are mixed with the pharmaceutical active to form a solid preformulation composition containing a homogeneous mixture of the pharmaceutical active of the present invention, or a pharmaceutically acceptable salt thereof. Generally the preformulation will be formed by one of three common methods: (a) wet granulation, (b) dry granulation and (c) dry blending. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective dosage forms such as tablets, pills and capsules. This solid preformulation composition is then subdivided into unit dosage forms of the type described above containing from about 0.1 mg to about 500 mg of the active ingredient of the present invention. The tablets or pills containing the novel compositions may also be formulated in multilayer tablets or pills to provide a sustained or provide dual-release products. For example, a dual release tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer, which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric materials such as shellac, cellulose acetate (i.e. cellulose acetate phthalate, cellulose acetate trimetllitate), polyvinyl acetate phthalate, hydroxypropyl methylcellulose phthalate, hydroxypropyl methylcellulose acetate succinate, methacrylate and ethylacrylate copolymers, methacrylate and methyl methacrylate copolymers and the like. Sustained release tablets may also be made by film coating or wet granulation using slightly soluble or insoluble substances in solution (which for a wet granulation acts as the binding agents) or low melting solids a molten form (which in a wet granulation may incorporate the active ingredient). These materials include natural and synthetic polymers waxes, hydrogenated oils, fatty acids and alcohols (i.e. beeswax, carnauba wax, cetyl alcohol, cetylstearyl alcohol, and the like), esters of fatty acids metallic soaps, and other acceptable materials that can be used to granulate, coat, entrap or otherwise limit the solubility of an active ingredient to achieve a prolonged or sustained release product.
The liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include, but are not limited to aqueous solutions, suitably flavored syrups, aqueous or oil suspensions, and flavored emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil or peanut oil, as well as elixirs and similar pharmaceutical vehicles. Suitable suspending agents for aqueous suspensions, include synthetic and natural gums such as, acacia, agar, alginate (i.e. propylene alginate, sodium alginate and the like), guar, karaya, locust bean, pectin, tragacanth, and xanthan gum, cellulosics such as sodium carboxymethylcellulose, methylcellulose, hydroxymethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose and hydroxypropyl methylcellulose, and combinations thereof, synthetic polymers such as polyvinyl pyrrolidone, carbomer (i.e. carboxypolymethylene), and polyethylene glycol; clays such as bentonite, hectorite, attapulgite or sepiolite; and other pharmaceutically acceptable suspending agents such as lecithin, gelatin or the like. Suitable surfactants include but are not limited to sodium docusate, sodium lauryl sulfate, polysorbate, octoxynol-9, nonoxynol-10, polysorbate 20, polysorbate 40, polysorbate 60, polysorbate 80, polyoxamer 188, polyoxamer 235 and combinations thereof. Suitable deflocculating or dispersing agent include pharmaceutical grade lecithins. Suitable flocculating agent include but are not limited to simple neutral electrolytes (i.e. sodium chloride, potassium, chloride, and the like), highly charged insoluble polymers and polyelectrolyte species, water soluble divalent or trivalent ions (i.e. calcium salts, alums or sulfates, citrates and phosphates (which can be used jointly in formulations as pH buffers and flocculating agents). Suitable preservatives include but are not limited to parabens (i.e. methyl, ethyl, n-propyl and n-butyl), sorbic acid, thimerosal, quaternary ammonium salts, benzyl alcohol, benzoic acid, chlorhexidine gluconate, phenylethanol and the like. There are many liquid vehicles that may be used in liquid pharmaceutical dosage forms, however, the liquid vehicle that is used in a particular dosage form must be compatible with the suspending agent(s). For example, nonpolar liquid vehicles such as fatty esters and oils liquid vehicles are best used with suspending agents such as low HLB (Hydrophile-Lipophile Balance) surfactants, stearalkonium hectorite, water insoluble resins, water insoluble film forming polymers and the like. Conversely, polar liquids such as water, alcohols, polyols and glycols are best used with suspending agents such as higher HLB surfactants, clays silicates, gums, water soluble cellulosics, water soluble polymers and the like. For parenteral administration, sterile suspensions and solutions are desired. Liquid forms useful for parenteral administration include sterile solutions, emulsions and suspensions. Isotonic preparations which generally contain suitable preservatives are employed when intravenous administration is desired. Furthermore, compounds of the present invention can be administered in an intranasal dosage form via topical use of suitable intranasal vehicles or via transdermal skin patches, the composition of which are well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the administration of a therapeutic dose will, of course, be continuous rather than intermittent throughout the dosage regimen.
Compounds of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, multilamellar vesicles and the like. Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, phosphatidylcholines and the like.
Compounds of this invention may be administered in any of the foregoing compositions and dosage regimens or by means of those compositions and dosage regimens established in the art whenever treatment of RXR mediated disorders is required for a subject in need thereof.
The daily dose of a pharmaceutical composition of the present invention may be varied over a wide range from about 0.7 mg to about 500 mg per adult human per day; preferably, the dose will be in the range of from about 0.7 mg to about 100 mg per adult human per day; most preferably the dose will be in the range of from about 0.7 mg to about 50 mg per adult human per day. For oral administration, the compositions are preferably provided in the form of tablets containing, 0.01 , 0.05, 0.1 , 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 150, 200, 250 and 500 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.01 mg/kg to about 300 mg/kg of body weight per day. Advantageously, a compound of the present invention may be administered in a single daily dose or the total daily dosage may be administered in divided doses of two, three or four times daily. Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular compound used, the mode of administration, the strength of the preparation, and the advancement of the disease condition. In addition, factors associated with the particular subject being treated, including subject age, weight, diet and time of administration, will result in the need to adjust the dose to an appropriate therapeutic level.
2. Formulations
To prepare the pharmaceutical compositions of this invention, one or more compounds of Formula (I) or salt thereof as the active ingredient, is intimately admixed with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques, which carrier may take a wide variety of forms depending of the form of preparation desired for administration (e.g. oral or parenteral). Suitable pharmaceutically acceptable carriers are well known in the art. Descriptions of some of these pharmaceutically acceptable carriers may be found in The Handbook of Pharmaceutical Excipients, published by the American Pharmaceutical Association and the Pharmaceutical Society of Great Britain.
The compounds of the present invention may be formulated into various pharmaceutical forms for administration purposes. Methods of formulating pharmaceutical compositions have been described in numerous publications such as Pharmaceutical Dosage Forms: Tablets. Second Edition. Revised and Expanded, Volumes 1 -3, edited by Lieberman et al; Pharmaceutical Dosage Forms: Parenteral Medications, Volumes 1-2, edited by Avis et al; and
Pharmaceutical Dosage Forms: Disperse Systems, Volumes 1-2, edited by Lieberman et al; published by Marcel Dekker, Inc.
3. Combination Therapy
The compounds of the present invention may be used in combination with one or more pharmaceutically active agents. These agents include other RXR modulators, other RAR modulators, other anti-diabetic agents, other lipid lowering agents, as well as blood pressure lowering agents such as statin drugs and the fibrates.
Other RXR modulators include, but are not limited to: (1) bexarotene (4 - (1 - (3,5,5,8,8 - pentamethyl - 5,6,7,8 - tetrahydro - 2 - naphthalenyl) ethenyl) benzoic acid, known as TARGRETIN, TARGRETYN, TARGREXIN; also known as LGD 1069, LG 100069, LG 1069, LDG 1069, LG 69, RO 264455); (2) 9-cis-retinoic acid; (3) AGN-4326 (also known as ALRT -4204, AGN -4204, ALRT -326,
ALRT-324, or LGD 1324);
(4) LGD 1324 (ALRT 324);
(5) LG 100754;
(6) LY-510929; (7) LGD 1268 (6 - (1 ,1 ,4,4,6 - pentamethyl - 1 ,2,3,4 - tetrahydro - naphth -
7 - ylcycloprop - 1 - yl) nicotinic acid, known as ALRT 268 or LG 100268);
(8) LG 100264; and
(9) substituted heterocycles as disclosed in PCT publications WO 01/16122 and WO 01/16123 by Maxia.
One preferred example of substituted heterocycles is MX-6054, which is 2,4-thiazolidinedione, 5-[[3-(5,6,7,8-tetrahydro-3,5,5,8,8-pentamethyl-2- naphthalenyl)-4-(trifluoromethoxy)phenyl]methylene]-, (52)-, also named 3- (3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-4- trifluoromethoxybenzylidene-2,4-thiazolidinedione, reperesented by the following formula:
Another preferred example of substituted heterocycles is 2,4- thiazolidinedione, 5-[[3-(1 -ethyl-1 ,2,3,4-tetrahydro-4,4,6-trimethyl-2-oxo-7- quinolinyl)-4-(trifluoromethoxy)phenyl]methylene]-, (5Z)-, reperesented by the following formula:
Prefered substituted heterocycles are selected from:
3-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-4- trifluoromethoxybenzylidene-2,4-thiazolidinedione; 4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzylidene-2,4-thiazolidinedione;
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2- propyl]benzylidene-2,4-thiazolidinedione;
4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzylidene-2-thioxo-2,4-thiazolidinedione;
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2- propyl]benzyIidene-2-thioxo-2,4-thiazolidinedione;
4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzylidene-2-thioxo-2,4-imidazolidinedione; 4-[2-(5,5)8,8-tetramethyl-5,6,7)8-tetrahydro-2-naphthyl)-2-propyl] benzylidene-2-thioxo-2,4-imidazolidinedione;
4-[2-(3)5,5,8,8-pentamethyl-5,6,7>8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzylidene-2,4-imidazolidinedione;
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2-propyl] benzylidene-2,4-imidazolidinedione;
4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzyl-2,4-thiazolidinedione;
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2-propyl]benzyl- 2,4-thiazolidinedione; 4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzyl-2-thioxo-2,4-thiazolidinedione;
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2-propyl]benzyl-2- thioxo-2,4-thiazolidinedione; 4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzyl-2-thioxo-2,4-imidazolidinedione;
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2-propyl]benzyl-2- thioxo-2,4-imidazolidinedione;
4-[2-(3,5,5,8,8-pentamethyl-5,6,7,8-tetrahydro-2-naphthyl)-1 ,3- dioxolane]benzyl-2,4-imidazolidinedione; and
4-[2-(5,5,8,8-tetramethyl-5,6,7,8-tetrahydro-2-naphthyl)-2-propyI]benzyl- 2,4-imidazolidinedione.
Other anti-diabetic agents include thiazolidinedione and non- thiazolidinedione insulin sensitizers, which decrease peripheral insulin resistance by enhancing the effects of insulin at target organs and tissues.
The following agents are known to bind and activate the nuclear receptor peroxisome proliferator-activated receptor-gamma (PPARγ) which increases transcription of specific insulin-responsive genes. Examples of PPAR-gamma agonists are thiazolidinediones such as:
(1) rosiglitazone (2,4 - thiazolidinedione,5 - ((4 - (2 - (methyl - 2 - pyridinylamino) ethoxy) phenyl) methyl) -, (Z) - 2 - butenedioate (1 :1) or 5 - ((4 - (2 - (methyl - 2 - pyridinylamino) ethoxy) phenyl) methyl) - 2,4 - thiazolidinedione, known as AVANDIA; also known as BRL 49653,
BRL 49653C, BRL 49653c, SB 210232, or rosiglitazone maleate);
(2) pioglitazone (2,4 - thiazolidinedione, 5 - ((4 - {2 - (5 - ethyl - 2 - pyridinyl) ethoxy) phenyl) methyl) -, monohydrochloride, (+ - ) - or 5 - ((4 - (2 - (5 - ethyl - 2 - pyridyl) ethoxy) phenyl) methy) - 2,4 - thiazolidinedione, known as ACTOS, ZACTOS, or GLUSTIN; also known as AD 4833, U 72107, U 72107A, U 72107E, pioglitazone hydrochloride (USAN)); (3) troglitazone (5 - ((4 - ((3,4 - dihydro - 6 - hydroxy - 2,5,7,8 - tetramethyl
- 2H - 1 - benzopyran - 2 - yl) methoxy) phenyl) methyl) - 2,4 - thiazolidinedione, known as NOSCAL, REZULIN, ROMOZIN, or PRELAY; also known as Cl 991 , CS 045, GR 92132, GR 92132X); (4) isaglitazone ((+)-5-[[6-[(2-fluorophenyl)methoxy]-2- naphthalenyl]methyl]-2,4-thiazolidinedione or 5 - ((6 - ((2 - fluorophenyl) methoxy) - 2 - naphthalenyl) methyl - 2,4 - thiazolidinedione or 5 - (6 - (2 - fluorobenzyloxy) naphthalen - 2 - ylmethyl) thiazolidine - 2,4 - dione, also known as MCC-555 or neoglitazone); and
(5) 5-BTZD.
Additionally, the non-thiazolidinediones that act as insulin sensitizing agents include, but are not limited to: (1 ) JT-501 (JTT 501 , PNU-1827, PNU-716-MET-0096, or PNU 182716: isoxazolidine - 3, 5 - dione, 4 - ((4 - (2 - phenyl - 5 - methyl) - 1 ,3 - oxazolyl) ethylphenyl - 4) methyl -);
(2) KRP-297 (5 - (2, 4 - dioxothiazolidin - 5 - ylmethyl) - 2 - methoxy - N - (4 - (trifluoromethyl) benzyl) benzamide or 5 - ((2,4 - dioxo - 5 - thiazolidinyl) methyl) - 2 - methoxy - N - ((4 - (trifluoromethyl) phenyl) m ethyl) benzamide); and
(3) Farglitazar (L - tyrosine, N - (2 - benzoylphenyl) - o - (2 - (5 - methyl - 2
- phenyl - 4 - oxazolyl) ethyl) - or N - (2 - benzoylphenyl) - O - (2 - (5 - methyl - 2 - phenyl - 4 - oxazolyl) ethyl) - L - tyrosine, or GW2570 or GI-262570).
Other anti-diabetic agents have also been shown to have PPAR modulator activity such as PPAR gamma, SPPAR gamma, and/or PPAR delta/gamma agonist activity. Examples are listed below: (1) AD 5075;
(2) R 119702 ((+ - ) - 5 - (4 - (5 - Methoxy - 1 H - benzimidazol - 2 - ylmethoxy) benzyl) thiazolin - 2, 4 - dione hydrochloride, or Cl 1037 or CS 011); (3) CLX-0940 (peroxisome proliferator-activated receptor alpha agonist / peroxisome proliferator-activated receptor gamma agonist);
(4) LR-90 (2,5,5 - tris (4 - chlorophenyl) - 1 ,3 - dioxane - 2 - carboxylic acid, PPARdelta/γ agonist); (5) Tularik (PPARγ agonist);
(6) CLX-0921 (PPARγ agonist);
(7) CGP-52608 (PPAR agonist);
(8) GW-409890 (PPAR agonist);
(9) GW-7845 (PPAR agonist); (10) L-764406 (PPAR agonist);
(11 ) LG-101280 (PPAR agonist);
(12) LM-4156 (PPAR agonist); (13) Risarestat (CT-112); (14) YM 440 (PPAR agonist); (15) AR-H049020 (PPAR agonist);
(16) GW 0072 (4 - (4 - ((2S.5S) - 5 - (2 - (bis (phenylmethyl) amino) - 2 - oxoethyl) - 2 - heptyl - 4 - oxo - 3 - thiazo lidinyl) butyl) benzoic acid);
(17) GW 409544 (GW-544 or GW-409544);
(18) NN 2344 (DRF 2593); (19) NN 622 (DRF 2725);
(20) AR-H039242 (AZ-242); (21 ) GW 9820 (fibrate);
(22) GW 1929 (N - (2 - benzoylphenyl) - O - (2 - (methyl - 2 - pyridinylamino) ethyl) - L - tyrosine, known as GW 2331 , PPAR alpha/γ agonist);
(23) SB 219994 ((S) - 4 - (2 - (2 - benzoxazolylmethylamino) ethoxy) - alpha - (2,2,2 - trifluoroethoxy) benzen epropanoic acid or 3 - (4 - - .(2 - (N - (2 - benzoxazolyl) - N - methylamino) ethoxy) phenyl) - 2 (S) - (2, 2, 2 - trifluoroethoxy) propionic acid or benzenepropanoic acid,4 - (2 - (2 - benzoxazolylmethylamino) ethoxy) - alpha - (2,2,2 - trifluoroethoxy)
-, (alphaS) -, PPARalpha/γ agonist);
(24) L-796449 (PPAR alpha/γ agonist); (25) Fenofibrate (Propanoic acid, 2-[4-(4-chlorobenzoyl)phenoxy]-2- methyl-, 1-methylethyl ester, known as TRICOR, LIPCOR, LIPANTIL, LIPIDIL MICRO PPAR alpha agonist);
(26) GW-9578 (PPAR alpha agonist); (27) GW-2433 (PPAR alpha/γ agonist);
(28) GW-0207 (PPARγ agonist);
(29) LG-100641 (PPARγ agonist);
(30) LY-300512 (PPARγ agonist); (31) NID525-209 (NID-525); (32) VDO-52 (VDO-52);
(33) LG 100754 (peroxisome proliferator-activated receptor agonist);
(34) LY-510929 (peroxisome proliferator-activated receptor agonist);
(35) bexarotene (4 - (1 - (3,5,5,8,8 - pentamethyl - 5,6,7,8 - tetrahydro - 2 naphthalenyl) ethenyl) benzoic acid, known as TARGRETIN, TARGRETYN, TARGREXIN; also known as LGD 1069, LG 100069,
LG 1069, LDG 1069, LG 69, RO 264455); and
(36) GW-1536 (PPAR alpha/γ agonist).
Other insulin sensitizing agents include, but are not limited to: (1) INS-1 (D-chiro inositol or D - 1 , 2, 3, 4, 5, 6 - hexahyd roxycyclohexane) ;
(2) protein tyrosine phosphatase 1 B (PTP-1 B) inhibitors; {3) glycogen synthase kinase-3 (GSK3) inhibitors;
(4) beta 3 adrenoceptor agonists such as ZD 2079 ((R) - N - (2 - (4 - (carboxymethyl) phenoxy) ethyl) - N - (2 - hydroxy - 2 - phenethyl) ammonium chloride, also known as ICI D 2079) or AZ 40140;
(5) glycogen phosphorylase inhibitors;
(6) fructose-1 ,6-bisphosphatase inhibitors;
(7) chromic picolinate, vanadyl sulfate (vanadium oxysulfate); (8) KP 102 (organo-vanadium compound);
(9) chromic polynicotinate;
(10) potassium channel agonist NN 414; (11) YM 268 (5, 51 - methylene - bis (1 , 4 - phenylene) bismethylenebis (thiazolidine - 2, 4 - dione);
(12) TS 971 ;
(13) T 174 ((+ - ) - 5 - (2, 4 - dioxothiazolidin - 5 - ylmethyl) - 2 - (2 - naphthylmethyl) benzoxazole);
(14) SDZ PGU 693 ((+) - trans - 2 (S - ((4 - chlorophenoxy) methyl) - 7alpha - (3, 4 - dichlorophenyl) tetrahydropyrrolo (2,1 - b) oxazol - 5 (6H) - one);
(15) S 15261 (( - ) - 4 - (2 - ((9H - fluoren - 9 - ylacetyl) amino) ethyl) benzoic acid 2 - ((2 - methoxy - 2 - (3 - (trifluoromethyl) phenyl) ethyl) amino) ethyl ester);
(16) AZM 134 (Alizyme);
(17) ARIAD;
(18) R 102380; (19) PNU 140975 (1 - (hydrazinoiminomethyl) hydrazino) acetic acid;
(20) PNU 106817 (2 - (hydrazinoiminomethyl) hydrazino) acetic acid;
(21) NC 2100 (5 - ((7 - (phenylmethoxy) - 3 - quinolinyl) methyl) - 2,4 - thiazolidinedione;
(22) MXC 3255; (23) MBX 102;
(24) ALT 4037;
(25) AM 454;
(26) JTP 20993 (2 - (4 - (2 - (5 - methyl - 2 - phenyl - 4 - oxazolyl) ethoxy) benzyl) - malonic acid dimethyl diester); (27) Dexlipotam (5 (R) - (1 , 2 - dithiolan - 3 - yl) pentanoic acid, also known as (R)-alpha lipoic acid or (R)-thioctic acid);
(28) BM 170744 (2, 2 - Dichloro - 12 - (p - chlorophenyl) dodecanoic acid);
(29) BM 152054 (5 - (4 - (2 - (5 - methyl - 2 - (2 - thienyl) oxazol - 4 - yl) ethoxy) benzothien - 7 - ylmethyl) thiazolidine - 2, 4 - dione); (30) BM 131258 (5 - (4 - (2 - (5 - methyl - 2 - phenyloxazol - 4 - yl) ethoxy) benzothien - 7 - ylmethyl) thiazolidine - 2, 4 - dione); (31) CRE 16336 (EML 16336); (32) HQL 975 (3 - (4 - (2 - (5 - methyl - 2 - phenyloxazol - 4 - yl) ethoxy) phenyl) - 2 (S) - (propylamino) propionic acid);
(33) DRF 2189 (5 - ((4 - (2 - (1 - Indolyl) ethoxy) phenyl) methyl) thiazolidine - 2, 4 - dione); (34) DRF 554158;
(35) DRF-NPCC;
(36) CLX 0100, CLX 0101 , CLX 0900, or CLX 0901 ;
(37) IkappaB Kinase (IKK B) Inhibitors
(38) mitogen-activated protein kinase (MAPK) inhibitors p38 MAPK Stimulators
(39) phosphatidyl-inositide triphosphate
(40) insulin recycling receptor inhibitors
(41 ) glucose transporter 4 modulators
(42) TNF-α antagonists (43) plasma cell differentiation antigen-1 (PC-1) Antagonists
(44) adipocyte lipid-binding protein (ALBP / aP2) inhibitors
(45) phosphoglycans
(46) Galparan;
(47) Receptron; (48) islet cell maturation factor;
(49) insulin potentiating factor (IPF or insulin potentiating factor-1);
(50) somatomedin C coupled with binding protein (also known as IGF- BP3, IGF-BP3, SomatoKine);
(51) Diab Il (known as V-411) or Glucanin, produced by Biotech Holdings Ltd. or Volque Pharmaceutical;
(52) glucose-6 phosphatase inhibitors;
(53) fatty acid glucose transport protein;
(54) glucocorticoid receptor antagonists; and
(55) glutamine:fructose-6-phosphate amidotransferase (GFAT) modulators. Anti-diabetic agents also include biguanides, which decreases liver glucose production and increases the uptake of glucose. Examples of biguanides include metformin such as:
(1) 1 , 1 - dimethylbiguanide (e.g., Metformin - DepoMed, Metformin - Biovail Corporation, or METFORMIN GR (metformin gastric retention polymer)); and
(2) metformin hydrochloride (N, N -dimethylimidodicarbonimidic diamide monohydrochloride, also known as LA 6023, BMS 207150, GLUCOPHAGE, or GLUCOPHAGE XR.
Anti-diabetic agents also include alpha-glucosidase inhibitors, which inhibit alpha-glucosidase. Alpha-glucosidase converts fructose to glucose, thereby delaying the digestion of carbohydrates. The undigested carbohydrates are subsequently broken down in the gut, reducing the post-prandial glucose peak. Examples of alpha-glucosidase inhibitors include, but are not limited to:
(1) acarbose (D - glucose, O - 4,6 - dideoxy - 4 - (((1 S - (1 alpha,4alpha,5beta,6alpha)) - 4,5,6 - trihydroxy - 3 - (hydroxymethyl)
- 2 - cyclohexen - 1 - yl) amino) - alpha - D - glucopyranosyl - (1 - 4) - O
- alpha - D - glucopyranosyl - (1 - 4) -, also known as AG - 5421 , Bay - g-542, BAY-g-542, GLUCOBAY, PRECOSE, GLUCOR, PRANDASE,
GLUMIDA, or ASCAROSE);
(2) Miglitol (3,4,5 - piperidinetriol, 1 - (2 - hydroxyethyl) - 2 - (hydroxymethyl) -, (2R (2alpha, 3beta, 4alpha, 5beta)) - or (2R,3R,4R,5S) - 1 - (2 - hydroxyethyl) - 2 - (hydroxymethyl - 3,4,5 - piperidinetriol, also known as BAY 1099, BAY M 1099, BAY-m-1099,
BAYGLITOL, DIASTABOL, GLYSET, MIGLIBAY, MITOLBAY, PLUMAROL);
(3) CKD-711 (0 - 4 - deoxy - 4 - ((2,3 - epoxy - 3 - hydroxymethyl - 4,5,6 - trihydroxycyclohexane - 1 - yl) amino) - alpha - b - glucopyranosyl - (1 - 4) - alpha - D - glucopyranosyl - (1 - 4) - D - glucopyranose);
(4) emiglitate (4 - (2 - ((2R,3R,4R,5S) - 3,4,5 - trihydroxy - 2 - (hydroxymethyl) - 1 - piperidinyl) ethoxy) benzoic acid ethyl ester, also known as BAY o 1248 or MKC 542); (5) MOR 14 (3,4,5 - piperidinetriol, 2 - (hydroxymethyl) - 1 - methyl -, (2R - (2alpha,3beta,4alpha,5beta)) -, also known as N- methyldeoxynojirimycin or N-methylmoranoline); and
(6) Voglibose (3,4 - dideoxy - 4 - ((2 - hydroxy - 1 - (hydroxymethyl) ethyl) amino) - 2 - C - (hydroxymethyl) - D - epi - inositol or D - epi - lnositol,3,4 - dideoxy - 4 - ((2 - hydroxy - 1 - (hydroxymethyl) ethyl) amino) - 2 - C - (hydroxymethyl) -, also known as A 71100, AO 128, BASEN, GLUSTAT, VOGLISTAT.
Anti-diabetic agents also include insulins such as regular or short-acting, intermediate-acting, and long-acting insulins, non-injectable or inhaled insulin, tissue selective insulin, glucophosphokinin (D-chiroinositol), insulin analogues such as insulin molecules with minor differences in the natural amino acid sequence and small molecule mimics of insulin (insulin mimetics), and endosome modulators. Examples include, but are not limited to:
(1) Biota;
(2) LP 100;
(3) (SP - 5 - 21) - oxobis (1 - pyrrolidinecarbodithioato - S, S') vanadium,
(4) insulin aspart (human insulin (28B - L - aspartic acid) or B28-Asp- insulin, also known as insulin X14, INA-X14, NOVORAPID, NOVOMIX, or NOVOLOG);
(5) insulin detemir (Human 29B - (N6 - (1 - oxotetradecyl) - L - lysine) - (1 A - 21 A), (1 B - 29B) - Insulin or NN 304);
(6) insulin lispro ("28B - L - lysine - 29B - L - proline human insulin, or Lys(B28), Pro(B29) human insulin analog, also known as lys-pro insulin, LY 275585, HUMALOG, HUMALOG MIX 75/25, or HUMALOG MIX 50/50);
(7) insulin glargine (human (A21 - glycine, B31 - arginine, B32 - arginine) insulin HOE 901 , also known as LANTUS, OPTISULIN); (8) Insulin Zinc Suspension, extended (Ultralente), also known as
HUMULIN U or ULTRALENTE; (9) Insulin Zinc suspension (Lente), a 70% crystalline and 30% amorphous insulin suspension, also known as LENTE ILETIN II, HUMULIN L, or NOVOLIN L;
(10) HUMULIN 50/50 (50% isophane insulin and 50% insulin injection); (11) HUMULIN 70/30 (70% isophane insulin NPH and 30% insulin injection), also known as NOVOLIN 70/30, NOVOLIN 70/30 PenFill, NOVOLIN 70/30 Prefilled; (12) insulin isophane suspension such as NPH ILETIN II, NOVOLIN N,
NOVOLIN N PenFill, NOVOLIN N Prefilled, HUMULIN N; (13) regular insulin injection such as ILETIN Il Regular, NOVOLIN R,
VELOSULIN BR, NOVOLIN R PenFill, NOVOLIN R Prefilled, HUMULIN R, or Regular U-500 (Concentrated);
(14) ARIAD;
(15) LY 197535; (16) L-783281 ; and
(17) TE-17411.
Anti-diabetic agents also include insulin secretion modulators such as: (1) glucagon-like peptide-1 (GLP-1) and its mimetics; (2) glucose-insulinotropic peptide (GIP) and its mimetics;
(3) exendin and its mimetics;
(4) dipeptyl protease (DPP or DPPIV) inhibitors such as
(4a) DPP-728 or LAF 237 (2 - pyrrolidinecarbonitrile, 1 - (((2 - ((5 - cyano - 2 - pyridinyl) amino) ethyl) amino) acetyl), known as NVP - DPP - 728, DPP - 728A, LAF - 237);
(4b) P 3298 or P32/98 (di - (3N - ((2S, 3S) - 2 - amino - 3 - methyl - pentanoyl) - 1 , 3 - thiazolidine) fumarate);
(4c) TSL 225 (tryptophyl - 1 ,2,3,4 - tetrahydroisoquinoline - 3 - carboxylic acid); (4d) Valine pyrrolidide (valpyr);
(4e) 1-aminoalkylisoquinolinone-4-carboxylates and analogues thereof;
(4f) SDZ 272-070 (1 - (L - VaIyI) pyrrolidine);
(4g) TMC-2A, TMC-2B, or TMC-2C; (4h) Dipeptide nitriles (2-cyanopyrrolodides); (4i) CD26 inhibitors; and (4j) SDZ 274-444;
(5) glucagon antagonists such as AY-279955; and (6) amylin agonists which include, but are not limited to, pramlintide (AC-
137, Symlin, tripro-amylin or pramlintide acetate).
Known anti-diabetic agents include insulin, sulfonylureas, biguanides, meglitinides, AGI's (Alpha-Glucosidase Inhibitors; e.g., Glyset), PPAR alpha agonists, and PPAR gamma agonists, and dual PPAR alpha/gamma agonists.
Examples of lipid lowering agents include bile acid sequestrants, fibric acid derivatives, nicotinic acid, and HMGCoA reductase inhibitors. Specific examples include statins such as LIPITOR®, ZOCOR®, PRAVACHOL®, LESCOL®, and MEVACOR®, and pitavastatin (nisvastatin) (Nissan, Kowa Kogyo, Sankyo, Novartis) and extended release forms thereof, such as ADX-159 (extended release lovastatin), as well as Colestid, Locholest, Questran, Atromid, Lopid, and Tricor.
Examples of blood pressure lowering agents include anti-hypertensive agents, such as angiotensin-converting enzyme (ACE) inhibitors (Accupril, Altace, Captopril, Lotensin ,Mavik, Monopril, Prinivil, Univasc, Vasotec, and Zestril), adrenergic blockers (such as Cardura, Dibenzyline, Hylorel, Hytrin, Minipress, and Minizide) alpha/beta adrenergic blockers (such as Coreg, Normodyne, and Trandate), calcium channel blockers (such as Adalat, Calan, Cardene, Cardizem, Covera-HS, Dilacor, DynaCirc, Isoptin, Nimotop, Norvace, Plendil, Procardia, Procardia XL, SuIa, Tiazac, Vascor, and Verelan), diuretics, angiotensin Il receptor antagonists (such as Atacand, Avapro, Cozaar, and Diovan), beta adrenergic blockers (such as Betapace, Blocadren, Brevibloc, Cartrol, Inderal, Kerlone, Lavatol, Lopressor, Sectral, Tenormin, Toprol-XL, and Zebeta), vasodilators (such as Deponit, Dilatrate, SR, Imdur, Ismo, Isordil, lsordil Titradose, Monoket, Nitro-Bid, Nitro-Dur, Nitrolingual Spray, Nitrostat, and Sorbitrate), and combinations thereof (such as Lexxel, Lotrel, Tarka, Teczem, Lotensin HCT, Prinzide, Uniretic, Vaseretic, Zestoretic).
In addition, a second RXR or RAR modulator, as described above in Section B), may also be utilized as a third antidiabetic agent, provided that it is different from the first RXR or RAR modulator.
F) Biological Examples
ABCA1 bDNA Assay
THP-1 cells, a human monocytic cell line, were obtained from ATCC and maintained in RPMI (Gibco) supplemented with 10% fetal bovine serum (Gibco), 2mM L-glutamine and 1% antibiotic-antimycotic in 5% CO2 at 37°C. For ABCA1 mRNA induction assays, the cells were pelleted and resuspended in RPMI supplemented with 0.5% charcoal treated serum (Hyclone), 2mM glutamine and 1 % antibiotic-antimycotic. The cells were plated at a density of 40,000 cells/90μl and incubated as above for at least 4 hours before the initiation of treatments. Compounds were prepared as 1OmM stocks in DMSO. For treatments, the compounds were diluted in medium and 10μl of 1OX stocks were added to the cells at a final concentration 0.1% DMSO. The cells were incubated for the desired amount of time (usually 18-24 hrs) and then lyzed with 50 μl of Quantigene HV bDNA lysis buffer which also contained the ABCA1 bDNA probes (probe sequences shown below):
ABCA1 bDNA probe sequences Primer Name Sequence hABClOOl CGGGTAACGGAAACAGGGGTTGTTTTTCTCTTGGAAAGAAAGT hABC1002 TCCGGGAGCCTCCCCAGGAGTTTTTTCTCTTGGAAAGAAAGT hABC1003 GCCAGTTTCTCCCTTGGTAGTTTTTCTCTTGGAAAGAAAGT hABC1004 CTCCTTGCTCGGGAAGGGTTTTTCTCTTGGAAAGAAAGT hABCl005 AACAGCTCCTGGGCCAGAGTTTTTCTCTTGGAAAGAAAGT hABC1006 TTCAGCCCCCCTCCCTCGGGATTTTTTCTCTTGGAAAGAAAGT hABC1007 ATGCGGGAAAGAGGACTAGTTTTTCTCTTGGAAAGAAAGT hABCl008 GTTCACCTCAGCCATGACCTTTTTTCTCTTGGAAAGAAAGT hABC1009 CATGCCTTCCAGATCATGGAACTTTTTCTCTTGGAAAGAAAGT hABC1010 GCGAGCCACAATGGATTTTTTTTAGGCATAGGACCCGTGTCT hABClOil CTCCGAGCATCTGAGAACAGTTTTTAGGCATAGGACCCGTGTCT hABCl012 TCAGAACTTTGCGCATGTCCTTTTTTAGGCATAGGACCCGTGTCT hABCl013 GGATTTCTTGATCTGCTGTAATGTTCTTTTTAGGCATAGGACCCGTGTCT hABClO14 AAGGTTTCATTGTCCACCAGGAATTTTTAGGCATAGGACCCGTGTCT hABC1015 GGTTGTGATACAGGAACCCAGAGTTTTTAGGCATAGGACCCGTGTCT hABClOl6 GTCCACAGTAGACTTTGGGAGAGAGATTTTTAGGCATAGGACCCGTGTCT hABClO17 TGACATCAGCCCTCAGCATCTTTTTTTAGGCATAGGACCCGTGTCT hABC1018 CTTGTCAAATGTAACTGGTAGCCTTTTTTTAGGCATAGGACCCGTGTCT hABC1019 CTGATTTTGATCCATTGCACAGATTTTTAGGCATAGGACCCGTGTCT hABCl02O GGCTTCAGGATGTCCATGTTGTTTTTAGGCATAGGACCCGTGTCT hABCl021 AGATGTAGAGTTTAGTGTTCTCAGGATTTTTTTAGGCATAGGACCCGTGTCT hABC1022 TTTTGTGGCTTCGGCCAGTTTTTAGGCATAGGACCCGTGTCT hABCl023 TCCCAAGACTATGCAGCAATGTTTTTTAGGCATAGGACCCGTGTCT hABCl024 GTCACTCCAGCTTCTCATGCTGTTTTTAGGCATAGGACCCGTGTCT hABCl025 GAAACATCACCTCCTGTCGCATTTTTTAGGCATAGGACCCGTGTCT hABCl026 GCCTGGTAGATTTGGGTGGTTTTTAGGCATAGGACCCGTGTCT hABCl027 GCCCGCAGACAATACGAGACACATTTTTAGGCATAGGACCCGTGTCT hABC1028 GGCTTTGTAGTTGTTGTCCTCTTTTTAGGCATAGGACCCGTGTCT hABC1029 TGCCATTGCCTCCAAAGAGTTTTTAGGCATAGGACCCGTGTCT hABCl03O AAGGTTTCAGCATCTTCCTCAGTTTTTAGGCATAGGACCCGTGTCT hABC1031 TGCAGTAAGGAGTTGTAGAGTTGTCATAGTTTTTAGGCATAGGACCCGTGTCT hABCl032 ACTCCAAATTCTTCATCAAATCATTTTTTAGGCATAGGACCCGTGTCT hABC1033 CGGCTTCAGAGCTTTCCAGATATTTTTAGGCATAGGACCCGTGTCT hABC1034 GTTAAAGTTTCCAACAAC hABC1035 TGTATAAAAGAAGC hABCl036 TCATGCTGGTGTCTTTCTGGC hABC1037 ATCTTGAAGCTTCAAGTTTGAGCT hABC1038 GCAAAAATACCTTGTGGAGAA hABCl039 GGTCACCAAGTTGAATCATCTCTT hABCl04O GCCACAAAGCTCAGAAACTTCTT hABClO41 GAACGAAGTACTCGCTCTGCTGCA hABC1042 AGGAGCTGGAGCTGTTCACATTGGTCA hABC1043 ATACCAGTTGAGAGACTTGATC
Ϊ1ABC1044 ATACAGGATCTTCCCAACGAGCAG hABC1045 GCCTTGTGGCTGGAGTGTCAGGTGT hABCl046 ACAGCCAGTTCCTGGAAGGTCTT
RXR Co-transfection Assay The nucleic acid sequence from 676-1464bp (accession number X52773) encoding the ligand binding domains was subcloned into the pM vector (BD Biosciences Clontech, Palo Alto, CA) and were fused with the DNA binding domain of yeast GAL4. HEK293 cells were cultured in DMEM/F12 medium supplemented with 10% FBS and 1% l-glutamine (growth medium). Cells were seeded at a density of 5-10x106 cells in 50 ml of growth medium and left overnight. The medium was removed and the cells were washed with 15 ml of OptiMEM serum free medium (Invitrogen Corp). The cells were transfected using OptiMEM serum free medium and DMRIE transfection reagent (Invitrogen Corp). Approximately 10-30 ng of DNA for the different receptors and 5-10 ng of the luciferase reporter (1 :1 ratio for RAR and 4:1 ratio for RXR of receptor DNA:reporter DNA) were gently mixed with 51 μl of DMRIE reagent in a total volume of 17 ml of OptiMEM medium. Eighteen hours after transfection, the cells were washed once with growth medium and then incubated for 6 hrs in 30 ml of growth medium. The cells were then trypsinized, and reseeded at a density of 50,000 per well in 96 well plates and left overnight. The medium was replaced with 90μl of medium containing DMEM/F12 supplemented with 0.5% charcoal- treated FBS (HyClone; Logan, UT) and 1% glutamine. Compounds or vehicle were added in 10 μl of 10X concentration of compound or vehicle (0.1% dimethyl sulfoxide). The cells were treated for 16-18 hours, lysed and assayed for luciferase activity using the Steady GIo luciferase assay kit (Promega, Madison, Wl).
Compounds listed in Table Il below were tested in the above assay(s):
Table Il
While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be understood that the practice of the invention encompasses all of the usual variations, adaptations and/or modifications as come within the scope of the following claims and their equivalents.

Claims

CLAIMS:
1. A compound of Formula I
(I) wherein
Ri is H or Ci-3alkyl;
R2 is independently wherein
Z is selected from , , and
X is selected from a bond, optionally substituted -O-Ci-5alkyl-, and optionally substituted Ci-6alkylene; Ra is optionally substituted Ci-3alkoxy; and n is O, 1 , 2, or 3; or alternatively R2 is H or optionally substituted Ci-3alkyl; with the proviso
that when R2 is ^ then Rg cannot be
prOvided further that when R2 is H or optionally substituted Ci-3alkyl, then R3 cannot be H or optionally substituted Ci- 3alkyl;
and R3 is 1 wherein
Z is selected from , V_i i anc| V_J .
X is selected from a bond, optionally substituted -O-C-|.εaikyl-, and optionally substituted d-βalkylene; Ra is optionally substituted Ci-3alkoxy; and n is O, 1 , 2, or 3; or alternatively R3 is H or optionally substituted Ci.3alkyl;
with the proviso that when R3 is ( tnen R2 cannot be
(Ra)n z X-C(O)OH1 provided further that when R3 is H or optionally substituted Ci-3alkyl, then R2 cannot be H or optionally substituted Ci- 3alkyl; or pharmaceutically acceptable salts, amides, esters, hydrates, or solvates thereof.
2. The compound of claim 1 wherein Ri is H or Ci-3alkyl.
3. The compound of claim 2 wherein R1 is Ci-3alkyl.
4. The compound of claim 1 wherein
R2 or R3 is wherein Z is
5. The compound of claim 1 wherein
R2 or R3 is wnerein Z is
6. The compound of claim 1 wherein (Ra)π
R2 or R3 is Z-X-C(O)OH wherein X is a bond.
7. The compound of claim 1 wherein
R2 or R3 wherein X is optionally substituted -0-Ci- 5alkylene.
8. The compound of claim 7 wherein the Ci-5alkylene is saturated.
9. The compound of claim 8 wherein the
10. The compound of claim 9 wherein 1 , 2, or 3 of the hydrogen atoms in the C1- 5alkylene is further substituted with halo.
1 1. The compound of claim 1 wherein
R2 or R3 is wherein X is optionally substituted Ci- 6alkylene.
12. The compound of claim 11 wherein the C-i-βalkylene is saturated.
13. The compound of claim 12 wherein the C1-6alkylene is
14. The compound of claim 13 wherein 1 , 2, or 3 of the hydrogen atoms in the Ci-6alkylene is further substituted with halo.
15. The compound of claim 7 wherein the alkylene is unsaturated.
16. The compound of claim 15 wherein the alkylene contains a double or triple bond.
17. The compound of claim 11 wherein the alkylene is unsaturated.
18. The compound of claim 16 wherein the alkylene contains a double or triple bond.
19. The compound of claim 1 wherein Ra is H.
20. The compound of claim 1 wherein Ra is -OCF3, -OCH3, -OCH2CF3, or - CH=CH-C(O)OH.
21. The compound of claim 1 , wherein R1 is -CH2CH3; ,
(Ra)n
R2 is Z-X-C(O)OH1 wherein
X is -CH2CH2- or -CH=CH-; and
R3 is -OCF3; and n is 1 ; or alternatively R2 is H;
(Ra)n with the proviso that when R2 is Z-X-C(O)OH^ tnen R3 cannot be
provided further that when R2 is H, then R3 cannot be H;
and
R3 wherein
X is -CH2CH2- or -CH=CH-; and R3 is -OCF3; and n is 1 ; or alternatively R3 is H.
(Ra)π with the proviso that when R3 is Z-X-C(O)OH1 tnen R2 carmot be
provided further that when R3 is H, then R2 cannot be H.
22. A pharmaceutical composition comprising at least one compound of claim 1 and at least one pharmaceutically acceptable carrier.
23. A pharmaceutical composition of claim 22, further comprising at least one additional agent, drug, medicament, antibody and/or inhibitor for treating, ameliorating or preventing a RXR mediated disease.
24. The pharmaceutical composition of claim 22 comprising at least one compound selected from
25. The pharmaceutical composition of claim 22 comprising at least one
compound selected from or
26. A method for treating, preventing or ameliorating a retinoid x receptor (RXR) mediated condition in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one compound of claim 1.
27. The method of claim 26 wherein the RXR condition is selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof.
28. The method of claim 26 wherein the RXR condition is selected from IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease, irritable bowel disorder, inflammation, cardiovascular disorders and cataracts.
29. The method of claim 27 comprising admistering to the subject a therapeutically effective amount of (a) at least one compound of claim 1 ; and (b) at least one adittional agent selected from a retinoid receptor agonist, an antidiabetic agent, a lipid lowering agent, an anti-thrombotic agent, and a blood pressure lowering agent, said administration being in any order.
30. The method of claim 27 wherein the additional agent is a RXR agonist.
31. A method for inhibiting the onset of a RXR mediated condition in a subject in need thereof, comprising administering to said subject a therapeutically effective amount of at least one compound according to claim 1.
32. The method of claim 31 wherein the RXR condition is selected from cancer, diabetes, dyslipidemia, hypercholesterolemia, and associated symptoms or complications thereof.
33. The method of claim 31 wherein the RXR condition is selected from IDDM, NIDDM, IGT, IFG, Syndrome X (or Metabolic Syndrome), insulin resistance, obesity, hyperlipidemia (including, phase I hyperlipidemia, pre-clinical hyperlipidemia, and phase Il hyperlipidemia), hypercholesteremia, hypertriglyceridemia, insulin resistance, dyslipidemia, nephropathy, neuropathy, retinopathy, atherosclerosis, low HDL, non-alcoholic steatohepatitis, polycystic ovary syndrome or polycystic ovarian syndrome, hypertension, ischemia, stroke, high blood pressure, heart disease, irritable bowel disorder, inflammation, cardiovascular disorders and cataracts.
34. The method of claim 31 comprising administering to said subject a therapeutically effective amount of (a) at least one compound according to claim 1 ; and (b) at least one additional agent selected from the group consisting of a retinoid receptor agonist, an anti-diabetic agent, a lipid lowering agent, an anti- thrombotic agent, and a blood pressure lowering agent, said co-administration being in any order and the combined amounts providing the desired prophylactic effect.
35. The method of claim 34 wherein the additional agent is a RXR agonist.
36. A process for making a pharmaceutical composition comprising admixing any of the compounds according to claim 1 and a pharmaceutically acceptable carrier.
37. The method of claim 26 wherein the therapeutically effective amount of the compound of claim 1 is from about 0.001 mg/kg/day to about 5 mg/kg/day.
38. The method of claim 31 wherein the therapeutically effective amount of the compound of claim 1 is from about 0.001 mg/kg/day to about 5 mg/kg/day.
EP06815371A 2005-09-30 2006-09-25 1,2,3,5-tetrahydro-cyclopental[c]quinolin-4-one derivatives as rxr agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes Withdrawn EP1937640A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US72250705P 2005-09-30 2005-09-30
PCT/US2006/037321 WO2007041076A2 (en) 2005-09-30 2006-09-25 1,2,3,5-tetrahydro-cyclopental[c]quinolin-4-one derivatives as rxr agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes

Publications (1)

Publication Number Publication Date
EP1937640A2 true EP1937640A2 (en) 2008-07-02

Family

ID=37625109

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06815371A Withdrawn EP1937640A2 (en) 2005-09-30 2006-09-25 1,2,3,5-tetrahydro-cyclopental[c]quinolin-4-one derivatives as rxr agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes

Country Status (5)

Country Link
EP (1) EP1937640A2 (en)
JP (1) JP2009510071A (en)
CN (1) CN101316822A (en)
CA (1) CA2624345A1 (en)
WO (1) WO2007041076A2 (en)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2009510114A (en) 2005-09-30 2009-03-12 ビテ ファーマシューティカルズ, インコーポレイテッド Cancer treatment with specific RXR agonists
JP5492183B2 (en) * 2008-03-27 2014-05-14 ジヤンセン・フアーマシユーチカ・ナームローゼ・フエンノートシヤツプ Tetrahydrophenanthridinone and tetrahydrocyclopentaquinolinone as PARP and tubulin polymerization inhibitors
US20130190395A1 (en) 2011-12-13 2013-07-25 Dartmouth College Autoimmune disorder treatment using rxr agonists
US10653650B2 (en) 2011-12-13 2020-05-19 Io Therapeutics, Inc. Treatment of diseases by concurrently eliciting remyelination effects and immunomodulatory effects using selective RXR agonists
CN107074800B (en) * 2014-01-14 2019-11-12 康内克斯生命科学私人有限公司 Substituted bicyclic heteroaryl compounds as RXR agonists
GB201406486D0 (en) 2014-04-10 2014-05-28 Redx Pharma Ltd Antibacterial compounds
PL3368080T3 (en) 2015-10-31 2023-09-11 Io Therapeutics, Inc. Treatment of nervous system disorders using combinations of rxr agonists and thyroid hormones
CN115227826A (en) 2016-03-10 2022-10-25 Io治疗公司 Application of RXR agonist and thyroid hormone in preparation of medicine for treating autoimmune diseases
SG11201807250PA (en) 2016-03-10 2018-09-27 Io Therapeutics Inc Treatment of muscular disorders with combinations of rxr agonists and thyroid hormones
AU2018335393A1 (en) 2017-09-20 2020-04-02 Io Therapeutics, Inc. Treatment of disease with esters of selective RXR agonists
US10966950B2 (en) 2019-06-11 2021-04-06 Io Therapeutics, Inc. Use of an RXR agonist in treating HER2+ cancers
JP2024543621A (en) 2021-12-07 2024-11-21 アイオー セラピューティクス インコーポレイテッド Use of RXR agonists and taxanes in the treatment of HER2+ cancers
JP2024544223A (en) 2021-12-07 2024-11-28 アイオー セラピューティクス インコーポレイテッド Use of RXR agonists in the treatment of HER2+ cancers

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6048873A (en) * 1998-10-01 2000-04-11 Allergan Sales, Inc. Tetrahdroquinolin-2-one 6 or 7-yl, tetrahdroquinilin-2-thione 6 or 7-yl pentadienoic acid and related derivatives having retinoid-like biological activity

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2007041076A2 *

Also Published As

Publication number Publication date
CN101316822A (en) 2008-12-03
CA2624345A1 (en) 2007-04-12
JP2009510071A (en) 2009-03-12
WO2007041076A2 (en) 2007-04-12
WO2007041076A3 (en) 2007-06-07

Similar Documents

Publication Publication Date Title
US8236819B2 (en) Dihydro-[1H]-quinolin-2-one derivatives as RXR agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes
US7723326B2 (en) Heterocyclic amide derivatives as RXR agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes
US7928246B2 (en) Dihydroisoindolones as allosteric modulators of glucokinase
JP5467770B2 (en) Novel lysine salt of 4-((phenoxyalkyl) thio) -phenoxyacetic acid derivative
US20070117808A1 (en) Substituted Cycloalkylpyrrolones As Allosteric Modulators Of Glucokinase
WO2007041076A2 (en) 1,2,3,5-tetrahydro-cyclopental[c]quinolin-4-one derivatives as rxr agonists for the treatment of dyslipidemia, hypercholesterolemia and diabetes
US8796313B2 (en) Substituted dihydroisoindolones as allosteric modulators of glucokinase
DE602004006529T2 (en) PHENOXY ACETIC DERIVATIVES AS PEROXISOM PROLIFERATOR ACTIVATED RECEPTOR (PPAR) DUAL AGONISTS
KR101224449B1 (en) 4-((phenoxyalkyl)thio)-phenoxyacetic acids and analogs
US8680122B2 (en) Substituted pyrrolones as allosteric modulators of glucokinase
KR20050071597A (en) Substituted tetralins and indanes and their use
HK1104523B (en) 4-((phenoxyalkyl)thio)-phenoxyacetic acids and analogs

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20080430

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20090730

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091210