EP1906999A1

EP1906999A1 - Frizzled 9 as tumour marker

Info

Publication number: EP1906999A1
Application number: EP06762784A
Authority: EP
Inventors: Hermann Schluesener; Hans-Joerg Buehring; Sigrid Hojak; Ingrid Albert
Original assignee: Eberhard Karls Universitaet Tuebingen; Universitaetsklinikum Tuebingen
Current assignee: Eberhard Karls Universitaet Tuebingen; Universitaetsklinikum Tuebingen
Priority date: 2005-07-25
Filing date: 2006-07-24
Publication date: 2008-04-09
Also published as: US20080267955A1; DE102005035568A1; WO2007012449A1

Abstract

The invention relates to the use of an agent binding to Frizzled 9 for the production of a therapeutic or diagnostic means for the treatment or identification of a tumour, a method for identification of tumours and a method for treatment of a human or animal being with a tumour.

Description

Frizzled 9 as a tumor marker

The present invention relates to the use of a Frizzled 9 binding agent for the manufacture of a therapeutic or diagnostic agent for the treatment or identification of a tumor, a method for the preparation of a therapeutic or diagnostic agent for the treatment or identification of a tumor, methods for the identification of tumors and a method for the treatment of a human or animal animal having a tumor.

Detection of tissue-specific expression of a so-called biomarker or marker protein allows a histologist to identify specific tissues or organs of an organism. In addition, an abnormal expression pattern of a biomarker often allows conclusions about a pathological change in the affected tissue or organ or on a disease of the entire organism. Thus, for example, due to the overexpression of a proliferation-activating factor, for example certain cyclin-dependent kinases, a neoplastic transformation of the cells affected by it or, for example, a corresponding predisposition for this can be concluded. The same applies to a sub-expression or the complete failure of the synthesis of tumor suppressor proteins, such as the p53 protein. Thus, biomarkers, especially in the field of diagnostics and therapy of tumor diseases, play a decisive role. By means of a qualitative or quantitative analysis of such biomarkers, which are also referred to as tumor markers in this context, the tumor can often be identified and classified with regard to its origin or its occurrence.

A comprehensive knowledge of such biomarkers or tumor markers and their expression patterns not only allows the development of diagnostic methods, but also of cell-targeted diagnostics or therapeutics.

The assignment of defined biomarkers to specific tissues also allows a better understanding of the regulation of physiological processes. For example, the expression of a key protein in proliferating endothelial signaling suggests a role for the latter in the regulation of angiogenesis.

Against this background, the object of the present invention is to provide a biomarker or tumor marker by means of which, in particular, neuro tumors / CNS tumors, prostate carcinomas and hemangiomas can be identified and optionally treated therapeutically. In particular, an agent is to be provided which binds to such a biomarker and is useful as an effective component of a therapeutic or diagnostic agent.

This object is achieved by the use of a Frizzled 9 (FZD9) binding agent for the preparation of a therapeutic or diagnostic agent for the treatment and / or identification of a tumor, wherein the tumor is selected from the group consisting of: neurotumor (CNS tumor), Prostate cancer and breast cancer. The suitability of Frizzled 9 for the identification and / or therapeutic treatment of these tumors was therefore surprising, since the Frizzled proteins are generally described in the prior art in a different context so far.

The proteins of the Frizzled (FZD) family belong to a group of receptors that have seven transmembrane sections. The FZD proteins are activated by so-called Wnt factors, which form a family of extracellularly secreted signaling molecules. The N-terminal extracellular cysteine-rich domain of FZD was identified as a Wnt binding domain.

Wnt / FZD proteins play an important role in the embryonic development of metazoans. They regulate various development processes, such as the specification, proliferation, migration and polarity of the cell. Coupled with the low-density lipoprotein Ike receptors 5 and 6, FZD proteins mediate at least three Wnt / FZD signaling pathways, one of which is the protein β-catenin, the so-called ß-catenin signaling pathway induces the regulation of transcription of various target genes, including c-myc, cyclin D1, matrix metalloproteinase-7 (MMP-7), immunoglobulin transcription factor 2 (ITF-2) .The planar cell polarity regulatory signaling pathway is characterized by Wnt binding via GTPase and activation c-Jun amino-terminal kinase QNK), which leads to the control of morphogenetic cell movement The Ca ²⁺ signaling pathway activates the Cß phospholipase and increases the intracellular Ca ²⁺ level, resulting in the activation of protein kinase C, the Ca ²⁺ -calmodulin-dependent protein kinase II and calcineurin result, which influences the cellular fate and adhesion process, and a review of Wnt / FZD signaling pathways can be found in Huang HC Klein Klein, "The Frizzled Family: Receptors for Multiple Signaling Transduction Pathways", Genome Biol. 2004; 5: 234-241 and in FIG. 1.

The human FZD 9 gene, originally designated FZD 3, resides in the genetically defined 1.4 Mb region on chromosome 7qll.23. The human FZD 9 protein consists of 591 amino acids. Recently published experiments in which mice with a FZD 9 knock-out mutation were made suggest a role for FZD 9 in the hematopoietic system; see. Ranheim EA et al., "Frizzled 9 knock-out mice have abnormal B-cell development", Blood. 2005; 105: 2487-2494.

Wang et al. describe in "A novel human homologue of the Drosophila frizzled wnt receptor gene binds wingless protein and is in the Williams syndrome deletion at 7qll.23", Hum. Mol. Genet. 1997; 6: 465-472, however, that FZD 9 is expressed in a variety of human tissues, such as the brain but also skeletal muscle, kidneys, eyes and testes.

In addition, Zhao C and Pleasure J, Genesis 2004; 40: 32-39, describe the expression widely distributed over the brain, "Frizzled-9 promoter drives expression of transgenes in the medial wall of the cortex and its chief derivative of the hippocampus" of FZD 9, for example in the medial wall of the cortex, the telencephalon, the hippocampus and other areas of the mouse brain.

In the unpublished German patent application DE 10 204 059 620 data are presented, according to which FZD 9 is expressed by a variety of different cell types, such as, for example, leukemia cells, retinoblastoma cells or embryonal carcinoma cells.

It has therefore previously been assumed that FZD 9 is a ubiquitous protein that is wholly unsuitable as a biomarker and, in particular, as a tumor marker for the identification and / or therapeutic treatment of neurotumor / CNS tumors, prostate carcinomas and breast cancers.

Neurotumor / CNS tumors are subdivided according to the invention into (1) primary brain brain tumors, (2) spinally growing tumors, and (3) tumors of peripheral nerves. The primary brain brain tumors in turn include the neuroepithelial tumors such as gliomas including astrocytomas, the embryonic tumors including medulloblastomas, cranial nerve tumors including schwannomas, and meningitis tumors including meningiomas. The spinally growing tumors can be differentiated into intramedullary and extra-medial tumors, and among the extramedullary tumors, those which simultaneously represent primary brain tumors, such as the meningiomas or schwannomas, may also fall. The extramedullary tumors also include hemangioblastoma, a benign tumor of the brain consisting of numerous smaller vessels (capillaries) and an intermediate soft tissue (stroma). In 25% of cases, hemangioblastoma is associated with Hippel-Lindau syndrome (VHL) and can also occur multiple times in the cerebellum and in the retina of the eye (here referred to as retinoblastoma). To the tumors of the peripheral nerves can also be counted those already mentioned in connection with the two classes described above, such as schwannomas. Tumors of the peripheral nerves also include neurofibromatoses.

Prostate carcinoma according to the invention is understood to mean a tumorous degeneration of the prostate. Breast cancer is synonymous with breast cancer.

The inventors have recognized for the first time that FZD 9 is a biomarker or tumor marker by means of which the identification and / or therapeutic treatment of neurotumor / CNS tumors, prostate carcinomas and breast cancer is possible.

According to the invention, an agent binding to FZD 9 is understood as meaning any agent which can selectively or specifically interact with FZD 9. This interaction may preferably be direct, although indirect interaction with, in turn, those factors which interact with FZD 9, such as the Wnt protein etc. (see above and FIG. 1) is possible. For the purposes of the invention, a binding agent to FZD 9 therefore includes binding proteins, such as polyclonal or monoclonal antibodies and antibody fragments which have the binding properties of the antibodies. Such antibody fragments include so-called Fab fragments and so-called scFv fragments. A Fab fragment contains the heavy and light chain variable domain and the contiguous constant domains CHI and CL linked by a disulfide bridge that naturally binds these two chains together. An scFv fragment consists of an Fv fragment, ie the smallest antibody domain which is responsible for the affinity of the whole antibody for the antigen, and a stabilizing linker polypeptide. The specificities and selectivities of such Fab and scFv fragments are identical to those of the entire antibody. However, antibody fragments can be prepared much simpler and thus more cost-effectively, for example in microbial expression systems.

A suitable polyclonal antibody against human FZD 9, which is preferably used in immunostaining at a dilution of 1: 500, is marketed, for example, by Acris Antibodies GmbH, Hiddenhausen, Germany (catalog no. SP4153P). According to the invention, however, a nucleic acid molecule binding to FZD 9 can also be a nucleic acid molecule which can bind directly or indirectly and selectively or specifically to FZD 9 or to the factors mentioned, for example an aptamer.

In the use according to the invention, it is particularly preferred if a monoclonal antibody which is produced by the hybridoma cell W3C4E11 deposited under the number DSMZ under the number DSMZ under the number DSMZ under the number DSMZ on 15 July 2004 under the number DSM ACC2668 is used as an agent binding to FZD 9.

This measure has the particular advantage that an agent is used which binds highly specifically to FZD 9, the identification or therapeutic treatment of said tumors then being carried out via established immunological or molecular techniques. The inventors have recognized for the first time that the monoclonal α-FZD9 antibody, which is fundamentally known from the unpublished German patent application DE 10 2004 050 620, is suitable as such an agent with which the tumors in question can be identified and optionally treated. This suitability was not to be expected in particular, since the patent application presented data that binds this antibody to a variety of cell types.

The inventors have also found that the isotype IgM monoclonal antibody produced by the deposited hybridoma cells W3C4E11 not only binds to native tissue, for example, of the human brain, but unexpectedly also to frozen, i. so-called cryo tissue. Furthermore, this monoclonal antibody is surprisingly not only suitable for the identification of said tumors, but can exert a direct effect on the tumors, for example on the astocytomas, for example, or inhibit their growth. The deposited monoclonal antibody therefore also has therapeutic potential.

It is preferred if the neurotumor / CNS tumor is selected from the group consisting of glioblastornen including astrocytomas, medulloblastomas including Primitive Neuroectodermal Tumors (PNET), schwannomas, hemangioblastomas, meningiomas and neurofibromatomas.

This measure has the advantage of providing an agent for the identification or therapeutic treatment of particularly important tumors. Thus, PNET, for example, is a tumor of embryonic origin, which usually arises in the cerebellum as a medulloblastoma and is one of the most frequently occurring malignant tumors in children.

In the use according to the invention it is preferred if the antibody is a humanized antibody or a humanized antibody fragment.

Humanized antibodies, also referred to as recombinant antibodies or in the English-speaking world referred to as "CDR grafted antibodies", are those antibodies in which the sequences for the hypervariable regions (CDRs) in the human immunoglobulin genes against the CDRs of im- munglobolin genes of other organisms, eg. The mouse, are replaced. By this humanization, the antigen specificity of an antibody, preferably a mouse monoclonal antibody, is transferred to a human antibody, thereby producing - in the recipient organism - complete tolerance to these molecules and a so-called HAMA response (human anti-mouse antibody antibody). Answer) by which a pure mouse antibody would be neutralized in humans due to the immune response is avoided even after repeated administration.

In the context of the use according to the invention, it is preferred if the agent or the antibody or the antibody fragment is coupled to a detectable marker and / or a therapeutic agent.

According to the invention, a marker means any compound by means of which a localization and identification of the substructures of the human brain in vitro, in vivo or in situ is possible. These include color indicators, such as dyes with fluorescent, phosphorescent or chemiluminescent properties, AMPPD, CSPD, radioactive indicators, such as ³² P, ³⁵ S, ¹²⁵ I, ¹³¹ I, ¹⁴ C, ³ H, non-radioactive indicators, such as biotin or digoxigenin, alkaline Phophatase, horseradish peroxidase, etc. The detection of such labeled antibodies then takes place using imaging techniques known in the art, such as autoradiography, blotting, hybridization or microscopy techniques.

As a result of this measure, the use according to the invention is advantageously developed in such a way that treatment or identification of the tumor becomes even more reliable and simplified.

In principle, any active substance which induces a specific biological reaction in an organism or in a biological cell is considered a therapeutic agent. Examples of particularly suitable therapeutic agents are drugs or toxins which inhibit the growth of the tumors, such as therapeutics, chemotherapeutic agents or activators of the complement system or apoptosis. Such a coupled antibody can advantageously transport the active ingredient in a targeted manner into a tumor, such as an astrocytoma, or in its blood-supplying system and there induce the destruction of the tumor or the pathological blood vessels. It is also possible to transport psychotropic drugs via the hippocampus into the limbic system via such an antibody and to mediate there a targeted effect of psychotropic drugs. Side effects of therapeutic agents that are supposed to act selectively in the human brain are thus reduced.

Against this background, another aspect of the present invention relates to a method for the preparation of a therapeutic and / or diagnostic agent for the treatment or identification of a tumor comprising the steps of: (1) providing an agent that binds to FZ.D 9, (2) formulating the Agent in a diagnostically or pharmaceutically acceptable carrier with optionally further additives, wherein the tumor is selected from the group consisting of: neurotumor / CNS tumor, prostate cancer and breast cancer.

With regard to the agent binding to FZD 9, all the features previously described for the use according to the invention of the latter apply to the abovementioned method. For the tumors also apply the statements that have been set out above for the use of the invention.

Diagnostically and pharmaceutically acceptable carriers, optionally with further additives, are well known in the art and are described, for example, in the paper by Kibbe A., "Handbook of Pharmaceutical Excipients", Third Edition, American Pharmaceutical Associated and Pharmaceutical Press 2000. Additives According to the invention, any compound or composition which is advantageous for a diagnostic or therapeutic use of the agent, including salts, binders, but also other active ingredients. A further subject matter of the present invention relates to a method for the identification of tumors in a living being, comprising the following steps: (1) providing a biological sample originating from the subject to be examined; (2) determination of expression level of FZD 9 in the biological sample; (3) comparing the expression level of FZD 9 found in step (2) with the level of expression in a biological sample from a healthy animal; and (4) identifying a tumor if it is determined in step (3) that the expression level of FZD 9 in the biological sample of the subject to be examined is higher than the expression level of FZD 9 in the biological sample of the healthy animal.

According to the invention, the identification is understood to be the detection or the detection as well as possibly the classification of the tumors. For this purpose, the expression level of FZD 9 in a biological sample originating from the potentially tumorous area of the living being is compared with the level of expression of FZD 9 in a reference sample derived from the corresponding area of a healthy animal. By methods known in the art, such as immunological, histological, imaging or microscopic procedures, it is determined to what extent FZD 9 is synthesized in the biological sample.

As the inventors have surprisingly found, the expression level of FZD 9 in tissues of a neuroturn / CNS tumor, prostate carcinoma or mammary carcinoma is significantly increased compared to the level of expression of FZD 9 in corresponding non-tumorous tissues of a healthy animal, such as healthy Brain / nerve tissue, healthy prostate tissue, healthy breast tissue etc.

Consequently, according to the invention, such biological cells may be cells or tissues which are to be examined for the presence of a tumor. If the presence of a neuroturn / CNS tumor is to be investigated, then a biological sample is provided which comprises neurons, glial cells, meninges, or in general neuronal tissue or brain tissue. Should be on the presence of a Prostate carcinoma are examined, so a biological sample is provided, the prostate tissue or cells thereof. When examining for the presence of breast cancer, a biological sample comprising breast tissue or cells thereof is provided. The reference sample used is in each case one such sample which originates from corresponding anatomical regions of a healthy animal.

Whether the increase in the expression level in the biological sample of the living organism to be examined is significantly increased can readily be determined by means of statistical methods known to the person skilled in the art. Thus, a significant increase can already be assumed if the expression level of FZD 9 in the biological sample of the subject to be examined by 5%, preferably 10%, more preferably by 50% compared to the expression level of FZD 9 in the biological sample of the healthy Living thing is elevated.

The level of expression can be determined both at the level of the FZD 9-encoding mRNA and at the level of the FZD 9 protein. In this case, the determination of the expression level at mRNA level by means known in the art, such as, for example, the Northern Blot technique. At the protein level, the expression level is preferably determined by immunological techniques, for example using the FZD 9 binding agent described above in connection with the use according to the invention, for example a polyclonal or monoclonal antibody or a corresponding antibody fragment which binds to FZD 9.

Another object of the present invention relates to methods of identifying tumors in a subject comprising the steps of: (1) administering an agent comprising an FZD 9 binding agent having a detectable marker into which animals, and (2 ) Representation of the accumulation of the agent in the subject by means of suitable methods, wherein the tumor is selected from the group consisting of: neurotumor / CNS tumors, prostate carcinoma and breast carcinoma. As detectable markers come the above mentioned detectable marker, which is preferably realized by a radioactive marker and the method in step (2) is 3D preferably radiography.

By this imaging method, the tumor can be displayed in three dimensions, which helps the surgeon in an advantageous manner in its removal.

A further subject of the present invention relates to a method of treating a human or animal having a tumor comprising the steps of: (1) administering an agent to the subject containing an FZD 9 binding agent, and (2) optionally Repeating step (1) several times, wherein the tumor is selected from the group consisting of: neurotomy / CNS tumor, prostate carcinoma and breast carcinoma.

The inventors have also found that FZD 9 can be used to identify and / or therapeutically treat substructures of the human brain, preferably the substructures are proliferating cells, tumor cells, and astrocytoma cells, respectively. Preferably, angiogenesis, more preferably tumor angiogenesis, is detected and / or treated therapeutically via the identification and / or therapeutic treatment of the substructures. The identification and / or therapeutic treatment of the substructures is preferably carried out by means of an antibody, preferably a monoclonal antibody, most preferably by means of one produced by the hybridoma cell W3C4E11 deposited under DSMZ under DSMZ under DSMZ under the number DSM ACC2668, or by means of a corresponding antibody fragment. The antibody may preferably be a humanized antibody. The antibody or antibody fragment is preferably coupled to a marker or / and a therapeutic agent.

The inventors have further developed a method for identifying and / or isolating substructures of the human brain in a biological sample, comprising the steps of: (1) providing the biological sample; (2) In-contact Bringing the biological sample with an agent that binds selectively or / and specifically to FZD 9; (3) determining whether selective / specific binding of the agent to the substructure has occurred; and (4) correlating a positive determination in step (3) with the identification of human brain substructures and / or (5) isolating the human substructures Brain on a positive finding in step (3). The substructures of the human brain are preferably proliferating cells, tumor cells, most preferably astrocytoma cells.

The inventors have further developed a method of identifying angiogenesis, preferably tumor angiogenesis, in a biological sample comprising the steps of: (1) providing the biological sample, preferably having tumor cells, (2) contacting the biological Sample with an agent that selectively or / and specifically binds to FZD 9, (3) determining if selective / specific binding of the agent to the biological sample has occurred, and (4) correlating a positive determination in step (3) with the identification of angiogenesis in the biological sample. For the agent, the above applies to the binding to FZD 9 agent in connection with the use according to the invention accordingly.

The inventors have further recognized that an agent directed against FZD 9, preferably an antibody, is useful for the preparation of a therapeutic or diagnostic agent for the treatment or diagnosis of a tumor, preferably a brain tumor, most preferably an astrocytoma.

The inventors have further surprisingly found that FZD 9 is expressed more strongly in the pes hippocampi or the hippocampal neurons of the healthy, in particular human, brain and that the deposited monoclonal antibody via FZD 9 is suitable for the identification and / or therapeutic treatment of hippocampus tissue , This measure therefore provides a use and a method which can provide a simple and reliable identification of allow, treatment and possibly isolation of human hippocampal tissue. This measure also has the advantage that the inventors for the first time provide information about the expression pattern of FZD 9, in particular in the human adult brain, and thus reveal important information about possible signaling mechanisms in the hippocampus. The inventors therefore provide an important tool for the identification of this area of the cerebral cortex not only for the clinician but also for the cell biologist and basic researcher.

It is understood that the features mentioned above and those yet to be explained below can be used not only in the particular combination given, but also in other combinations or in isolation, without departing from the scope of the present invention.

The present invention will now be explained in more detail with reference to exemplary embodiments, which have purely exemplary character and limit the scope of the present invention in any way. Reference is made to the attached figures, in which it can be seen:

Fig. 1 Wnt / FZD signal path

Fig. 2 Preparation of specifically directed against human FZD 9 and derived from the hybridoma W3C4E1 antibody. A: Diagram schematically showing the plasmid pIRES which has the human FZD 9 gene and at the N-terminus a flag tag. B: FACS analysis of the specificity of the antibody derived from cells W3C4E11. The monoclonal antibody (right partial image) derived from the cells W3C4E11 and its non-specific IgM isotype (left partial image) were incubated with HEK-293 cells which were transfected with the pIRES plasmid shown in (A). After washing, the cellular fluorescence intensity was analyzed by flow cytometry. Fig. 3 Immunohistochemistry for FZD 9 in human normal brains (A, B) and in human astrocytomas of WHO grade II (C), grade III (D) and grade IV (EH). In normal brains, FZD 9 was mainly localized in hippocampal neurons (A + B). The FZD 9 immunostaining could be clearly detected in the microvessels and the tumor cells of the astrocytomas with WHO grade II (C), grade III (D) and grade IV (E). In the microvessels, FZD 9 was expressed in the endothelial cells (F). In the glioblastoma, the multilayered microvessel proliferates ('Glomeroid tufts') (G) and necroses with pseudopalisades ('Pseudopalisading Necrosis') (H), which are histopathological hallmarks of glioblastomas, were strongly stained for FZD 9. Original magnifications: x40 (A); x400 (BE, G); x100 (F); X200 (H).

Fig. 4 Statistical analysis (Pearson's correlation coefficient analysis) of

Correlation between immunoreactivity FZD 9 with astrocyte classification, microvessel density, and astrocytoma Ki67 labeling index. The density of FZD 9 ⁺ microvessels correlated positively with the astrocytoma WHO classification (A) and the astrocytoma MVD (B) in human astrocytomas. Total FZD 9 immunostaining intensity correlated strongly with the astrocytoma WHO classification (C) and the KI67 labeling index (D) in human astrocytomas.

Figure 5 Changes in FZD 9 mRNA expression after

Cobalt chloride treatment in HCEC cells. The cells were incubated with cobalt chloride (100 μmol) for the indicated time periods. FZD 9 expression was quantified using real-time PCR. FZD 9 expression was increased 15 hours after incubation with cobalt chloride and increased significantly 24 hours after incubation. FIG. 6 Intensity of immunohistochemical staining for FZD 9 in 23 samples of medulloblastomas compared to 10 samples of neuropathologically normal human brains.

Fig. 7 Correlation of the intensity of FZD 9 staining with the MIB-1 (Ki67) -

Labeling index.

Fig. 8 Combined real-time reverse transcription PCR analysis on four

Tissue samples representing FZD 9 mRNA expression in medulloblastomas compared to normal brain samples. Values are expressed in terms of relative expression to 18S rRNA, which was used as the internal reference standard.

Fig. 9 Immunohistochemical expression of FZD 9. Cerebellar expression is limited to the endothelium of fewer vessels (a, 100X magnification). In the telencephalon, FZD 9 is mainly localized in hip pocampal neurons (d, 200X magnification). FZD 9 expression in the tumor vasculature is indicated by arrows (c, 400X magnification). Exemplified is the strong expression (intensity value = 3) in a medulloblastoma (d, lOOX magnification) and in supratentorial PNETs (e, 400X magnification). Weak (value = 1) staining (f, 100X magnification) and moderate (value = 2) staining (g, 400X magnification) in medulloblastomas. An overview of the same as the tumor shown in partial imaging g, illustrates an uneven distribution pattern of FZD 9 expression (h, lOOX magnification).

10 intensity of immunohistochemical staining for FZD 9 in one

Schwannoma sample. FIG. 11 Intensity of immunohistochemical staining for FZD 9 in one

Meningioma sample.

Fig. 12 Intensity of immunohistochemical staining for FZD 9 in one

Neurofibromatom sample.

Fig. 13 Intensity of immunohistochemical staining for FZD 9 in one

Prostate carcinoma sample.

Fig. 14 Intensity of immunohistochemical staining for FZD 9 in one

Breast carcinoma sample.

Fig. 15 Intensity of immunohistochemical staining for FZD 9 in one

Hemangioblastoma sample.

embodiment

1. The Wnt / FZD signal path

Fig. 1 shows schematically the Wnt / FZD signaling pathway according to the publication by Huelsken J. and Behrens J., "The Wnt Signaling Pathway", Journal of Cell Science 2002; 115: 3977-3978 The content of this publication is by reference The three branches of the Wnt / FZD signaling pathway, namely the β-catenin pathway ("middle branch"), the Ca ²⁺ signaling pathway ("Ca ²⁺ pathway "right branch) and the planar cell polarity regulating signal path (" left cell branch "). In addition to the Frizzled receptor shown above in the schematic cell membrane, indirectly the individual factors of the three signal paths, which are represented schematically as circular or oval-shaped symbols, for example Dsh, Frodo, β-Arrl, PLC, PKC, JNK, etc., as well as the Wnt protein to identify the substructures of the human brain.

2 _± _ Material and methods

2.1 patients

(a) astrocytomas

Twenty-five adults were studied, including ten normal brain controls, seven WHO grade II astrocytomas, nine WHO grade III astrocytomas, and nine WHO grade IV astrocytomas. Details of these pathologies are given in Tables 1 and 2. Histological diagnosis and classification were performed by two experienced neuropathologists according to the WHO classification system. The tissue procurement was carried out according to the ethical guidelines of the University of Tübingen.

(b) Further brain tumors

For the examination of the other brain tumors 29 samples were taken from the Institute for Brain Research (Tübingen) and the Pathological Institute (Katharinen-Krankenhaus Stuttgart). The specimens contained 23 classical medulloblastomas, three desmoplastic medulloblastomas, two supratentorial PNETs and one medullomyoblastoma (17 male and 12 female patients ranging in age from 2 to 64 years, mean age 15.3 years). Histological diagnosis and classification were performed according to the WHO classification system. Other specimens included meningiomas, schwannomas, hemangioblastomas and neurofibromatomas. Review of the clinical data showed recurrence of the tumor after surgery in six patients (Table 3). No cases of Turcot or Gorlins syndromes were recorded. Samples of ten normal brains served as Control. The regions of interest included the frontal lobe, the motor cortex, the hippocampus, the occipital lobe, and the cerebellum. Frozen tissue from the frontal lobe and the cerebellar hemispheres was prepared for the PCR. The tissue procurement was carried out according to the ethical guidelines of the University of Tübingen.

(c) non-brain tumors

For the investigation of prostate cancer and breast cancer, samples were obtained from institutes of the University Hospital Tübingen in accordance with the ethical guidelines of the University of Tübingen.

2.2 α-FZD 9 antibody

2.2.1 Monoclonal α-FZD 9 antibody

The specific monoclonal antibody directed against human FZD 9, produced by hybridoma cells W3C4E11, was obtained by immunization of four to eight week old Balb / c male mice with an FZD 9-expressing retinoblastoma cell line WERI-RB-I from the German Collection of Microorganisms and Cell Cultures, DSMZ, Braunschweig, Germany) cultured in RPMI1640 medium supplemented with 10% fetal calf serum. Mice were injected intraperitoneally with 10 ⁷ cells at 2-week intervals five times. Four days after the last boost, the spleen was removed for fusion with the SP2-0 myeloma cell line. The resulting hybridomas were maintained in RPMI1640 medium (GIBCO) containing 10% fetal calf serum and hypoxanthine-aminopterin-thymidine (HT, Sigma-Aldrich, Munich, Germany). Culture supernatants positive for WERI-RB-I cells were screened on peripheral blood (B) and bone marrow (BM) cells. Hybridoma cells that secrete antibodies that are responsible for these cells were non-reactive, were selected, cloned twice by limiting dilution, and cultured in the presence of hypoxanthine-thymidine (HT, Sigma). Clone W3C4E11 met these criteria and was selected. The InM isotype of the resulting monoclonal antibody of cell line W3C4E11 was determined by ELISA (Boehringer Mannheim, Mannheim, Germany). The specificity of W3C4E11 antibodies to human FZD 9 was confirmed by the selective recognition of human embryonic kidney cells (HEK-293) transfected with the entire human FZD 9 gene. W3C4E11 recognizes untransfected HEK-293 cells or HEK-293 cells transformed with FZD 1, 2, 4, 5, 7 or 10.

The W3C4E11 cell line was deposited on June 15, 2004 with the German Collection of Microorganisms and Cell Cultures (DSMZ), Mascheroer Weg Ib, 38124 Braunschweig under the number ACC2668.

2.2.2 Polyclonal α-FZD 9 antibody

For the examination of the other brain tumors (non-astrocytomas) and the non-brain tumors, a polyclonal rabbit antibody against human FZD 9 (Acris Antibodies GmbH, Hiddenhausen, Germany, dilution 1: 500) was used. The commercially available antibody clone SP4153P is directed against the first extracellular loop of human FZD 9. 2.3 Immunohistochemistry

(a) astrocytomas

Brain samples were surgically removed, immediately fixed in buffered paraformaldehyde and embedded in paraffin. For immunostaining, representative serial sections of 3 μm were prepared. After deparaffinization, sections were taken in a 600 Watt microwave oven for 15 min. in citrat buffer (2.1 g sodium citrate per liter, pH 6). The endogenous peroxidase was treated with 1% H2O2 in methanol for 15 min. inhibited. The sections were incubated in 10% normal porcine serum (Biochrom, Berlin, Germany) to block non-specific binding of the immunoglobulins and then incubated with the primary antibody. For FZD 9 staining, the monoclonal antibody derived from W3C4E11 described above was used. In addition, another polyclonal rabbit antibody against human FZD 9 was used (Acris Antibodies GmbH, supra, diluted 1: 500). Microvascular endothelial cells were stained with anti-CD34 monoclonal antibody (diluted 1:50, Biomedicals, Augst, Switzerland) and Ki67 stained with MIB-I to demonstrate cell proliferation (1: 100, DAKO, Hamburg, Germany).

Antibody binding to the tissue sections was visualized with a biotinylated porcine anti-rabbit (DAKO, Hamburg, Germany) or rabbit anti-mouse IgG F (ab) 2 antibody fragment. Subsequently, the sections were incubated with a streptavidin-avidin-biotin complex (DAKO, Hamburg, Germany), followed by development with 3,3'-diaminobenzidine (DAB) as chromogen (Fluka, Neu-Ulm, Germany). Finally, the sections were counterstained with hematoxylin.

After immunostaining, the expression level of FZD 9 was quantitated by two methods. The total immunoreactivity of FZD 9 of each The sample was graded using a semi-quantitative evaluation reported by Sinicrope FA et al., "Bcl-2 and p53 oncoprotein expression during coral tumorigenesis". Cancer Res. 1995; 55: 237-241, was introduced. In short, four categories have been defined as follows: 0, completely negative; 1, slightly positive; 2, moderately positive; and 3, strong positive. The density of FZD 9 ⁺ microvessels was examined under light microscopy using a procedure described by Weidner N. et al., "Tumor angiogenesis and metastasis-correlation in invasive breast carcinoma". N. Engl. J. Med. 1991; 324: 1-8, was introduced. In short, the total cut was at 40-fold magnification to the areas of highest FZD 9 ⁺ -vaskulären density (hot spot) scanned, followed by a count of the number of FZD 9 ⁺ - vessels within a single field at a magnification of 200X (high power field, HPF) in every hot spot. Three hot spots were counted and the mean calculated. The final results are expressed as the arithmetic mean of the FZD 9 ⁺ positive vessels per HPF with standard mean error (SEM). The intensity of FZD 9 expression and the density of FZD 9 ⁺ microvessels were carefully determined by independent persons.

Microvessel density (MVD) counts were determined by determining the mean number of vesicular vessels stained by CD34 in 3 HPF by the same method used to count the density of the FZD 9 ⁺ microvessels. The density of the Ki67 ⁺ microvessels was determined by the same method used to count the density of FZD 9 ⁺ microvessels.

(b) Further brain tumors

For the detection of FZD 9 in immunohistochemistry, optimization of the polyclonal rabbit antibody was performed on both cryostat and paraffin sections with identical results. Consequently, all further studies were performed on paraffin-embedded tissue samples. After deparaffinization, sections were taken in a 600 Watt microwave oven cooked for 15 minutes in citrate buffer (see above). The endogenous peroxidase was inhibited with 1% H2O2 in methanol for 15 minutes. The sections were incubated in 10% normal pig serum (see above) to block non-specific binding of immunoglobulins. For the FZD 9 staining, the polyclonal rabbit antibody against human FZD 9 (Acris Antibodies GmbH, loc. Cit., Dilution 1: 500) was used. Antibody binding to the tissue sections was visualized with a biotinylated anti-rabbit porcine antibody (DAKO, Hamburg, Germany) followed by incubation with a streptavidin-avidin-biotin complex (DACO, Hamburg, Germany). The chromogen used was 3,3'-diaminobenzidine (DAB) (Fluka, Neu-Ulm, Germany). Finally, the sections were counterstained with hematoxylin and embedded. In controls, the primary antibody was omitted.

Immunohistochemical tissue staining for MIB-I was performed on 4 μm thick, formalin-fixed and paraffin-embedded samples using the Benchmark Immunohistochemistry System (Ventana, Tasken, AZ, USA). The automated protocol is based on an indirect biotin-avidin system. Optimization of the MIB-1 antibody (1: 100, DAKO, Hamburg, Germany) included pretreatment for cell conditioning for 6 minutes. After incubation of the primary antibody for 2 minutes, an avidin and a biotin blocker was added for 4 minutes, followed by a non-specific biotinylated immunoglobulin secondary antibody and a diaminobenzidine substrate for visualization. The sections were then washed, counterstained with hematoxylin and embedded. The negative control sections were processed in parallel with each batch of staining. All histological examinations and photo documentation were done using an Olympus AX 70 microscope; The photographs were digitized and optimized in terms of brightness and contrast in the print. (c) non-brain tumors

Immunohistochemical detection of non-brain tumors was performed from paraffin sections as described in (b).

2.4 Cell culture and treatment

(a) astrocytomas

Human cerebral microvascular endothelial cells (HCEC), which have been kindly provided by Prof. A. Muruganandam, are described in the prior art; see. Muruganandam A. et al., "Development of immortalized human cerebral microvascular endothelial cell line as an in vitro model of the human blood-brain barrier." FASEB 1997; 11: 1187-1197. These HCEC cells were identified in RPMI-1640 Medium with 10% heat-inactivated fetal calf serum (FCS) cultured with penicillin and streptomycin at 100 U / ml (Gibco Grand Island, NY) at 37 ° C in 5% CO 2 In the cobalt chloride experiments, HCEC cells were approximately 80% confluent CoJ ₂ (100 μmol) exposed for the indicated time periods, see Cho J, et al., "Cobalt chloride-induced estrogen receptor alpha down-regulation involves hypoxia-inducible factor-lalpha in MCF-7 human breast cancer cells ". Mol. Endocrinol. 2005; 19: 1191 to 1199. The medium was renewed 24 hours before exposure to CoCl ₂ . For each time parallel samples were prepared in triplicate.

(b) Further brain tumors

A representative human medulloblastoma cell line, DAOY, showing the expression of neuronal and glial elements, cf. Karasawa et al. (2002) J. Biol. Chem. 277; Pages 37479-37486, was kindly provided by dr. Mittelbronn provided. These cells were expressed in minimal essential The medium (Eagle) with 10% heat-inactivated fetal serum (FCS) was cultured with penicillin and streptomycin at 100 U / ml (Gibco, Grand Island, NY) at 37 ° C in 5% CO ₂ . The harvest took place at about 80% confluency.

2.5 Real-Time Reverse Transcription PCR Analysis

(a) astrocytomas

Total RNA from cultured cells was prepared using the RNeasy Mini Kit (QIAGEN GmbH, Hilden, Germany) according to the manufacturer's instructions. 2 μg of RNA was reverse transcribed into cDNA using randomized primers. Subsequently, mRNA expression of FZD 9 was quantified by HCEC cells using a real-time PCR using SYBR-Green as detection reagent and 18 S-iibosornal RNA as intermediate reference standard. Subsequent primers were used: human 18S ribosomal RNA (sense, CGGCTACCACATCCAAGGAA, antisense, GCTGGAATTACCGCGGCT), and human FZD 9 (sense, GCAGTAGTTTCCTCCTGACCG, antisense, TCTCTGTGTTGGTGCCGCC). The PCR was performed in a real time iCycler (Biorad, Munich, Germany). All reactions were performed in a total volume of 15 μl, containing SYBR® Green PCR Master Mix twice and optimized primer concentrations. Cycling was started at 95 ° C for 15 minutes followed by 35 cycles of: 94 ° C for 45 seconds, 52 ° C for 30 seconds. and 72 ⁰ C for 45 sec. with fluorescence detection at 72 ° C. The melting curve analysis was carried out between 50 and 100 ⁰ C at 0.5 ° C intervals. Each sample was measured in triplicate and the arithmetic mean calculated. (b) Further brain tumors

Using the peqGold-TriFastKit (Peqlab Biotechnologie GmbH, Erlangen, Germany) total RNA from cultured cells and frozen tissue samples was prepared according to the manufacturer's instructions. For each sample, 2 μg RNA was reverse transcribed into cDNA using randomized primers. Real-time PCR was used to quantify mRNA expression of FZD 9 in DAOY cells. SYBR® green was used for detection. Human ribosomal 18S RNA served as internal reference standard (forward: CGGCTACCACATCCAAGGAA; reverse: GCTGGAATTACCGCGGCT). The following primer pair was used for FZD 9: forward: GCAGTAGTTTCCTCCTGACCG; backwards: TCTCTGTGTTGGTGCCGCC. All reactions were used in a real-time cycler (Biorad, Munich, Germany) using a SYBR® Green PCR master mix and an optimized cycle protocol: 95 ° C for 15 minutes, then 35 cycles of: 94 ° C for 45 seconds, 52 ° C for 30 seconds and 72 ° C for 45 seconds with fluorescence detection at 72 ° C. The melting curve analysis was carried out between 50 and 100 ⁰ C with 0.5 ⁰ C intervals.

2.6 Evaluation and Statistics

(a) astrocytomas

The numbers of FZD 9 ⁺ microvessels / HPF, MVD and Ki67 ⁺ microvessels / HPF are given as arithmetic means with standard errors of means (SEM). Statistical analysis of quantitative FZD 9 expression was performed by one-way ANOVA followed by Dunnett's Multiple Comparison Tests (Grap Päd Prism 4.0 software). The correction analysis was evaluated by controlling Pearson's correlation coefficient. For all statistical analyzes, significant levels were set to p <0.05.

(b) Further brain tumors

Total immunoreactivity for FZD 9 of each sample was assessed using a semiquantitative rating introduced by Sinicrop; see. Sinicrop et al. (1995), Cancer Res. 55, pages 237-241. The four categories were defined as follows: 0 completely negative; 1 weak positive; 2 moderately positive; and 3 strongly positive. The MIB-1 / Ki67 labeling index, as the percentage of cells in a tissue stained for Ki67, was evaluated by averaging the percentage of Ki67 ⁺ cores counted in three "high power fields." For these Averaging, spots were selected after counting the entire sample, counted and the mean value determined All the studies were performed independently of two persons The FZD 9 staining value and the Ki67 labeling index are given as arithmetic mean with standard deviations (SEM) Quantitative FZD 9 expression was analyzed by one-way ANOVA followed by Dunnett's Multiple Comparison Test (Grap Päd Prism 4.0 software) The correction analysis was evaluated by controlling the Pearson's correlation coefficient and for all statistical analyzes the significance levels were p <0.05 set.

3. Results

3.1 Preparation of human FZD 9-directed W3C4E11 cell-derived specific monoclonal antibody

In order to analyze human FZD 9 protein expression, a monoclonal antibody against membrane-bound FZD 9 was obtained by immunization of a a mouse with the FZD 9-expressing cell line WERI-RB-I won. To select potential FZD 9-reactive antibodies, a transfected cell was prepared. For this purpose, HEK-293 cells were transfected with a pIRES plasmid which contained the human FZD 9 gene and a flag tag at the N-terminus (FIG. 2A "start of transcription" = transcription start, "signal sequence") signal sequence). After three rounds of selection of cells with a cell sorter stainable with an anti-Flag antibody, most of the cells stably expressed the flag-tag on the cell surface. Figure 2B shows that the W3C4E11 antibody reacted with the transfected cell while wild-type HEK-293 cells were non-reactive (not shown).

3.2 Expression of FZD 9 in neuropathologically normal adult human brains

3.2.1 Although it has been reported that FZD 9 is expressed in the brain, its pattern of expression in the adult human brain is still unknown. Immunohistochemical studies were therefore performed on ten sections of paraffin-embedded adult normal human brains to determine the level of expression and localization of FZD9. In most sections, FZD 9 expression was low (Table 1) and only occasional FZD 9 ⁺ neurons or glia were observed. However, in sections containing hippocampal tissue, strong FZD 9 expression was observed in the hippocampal neurons (Figures 3A and B).

In some cases, FZD 9 has been expressed on the endothelial cells of the large vessels located in the leptomeninx outside the brain parenchyma. In normal brains few FZD 9 ⁺ microvessels were observed (Table 1). Case GeNeuropathological FZD9 Ki67- FZD9 ⁺ - MVD poor / Age Diagnosis / Pathology Mark- Microbial Diagnosis Index of Infec- tion Index / HPF ^B sity ³ (%)

F ^d / 82 Normal brain / <0.01 4 ± 0.6 5 ± 1.5

Intrabdominal haemorrhage, bypass M 773 Normal brain <0.01 0.7 ± 0.3 l ± 0

/ Pulmonary

Embolism M / 21 Normal brain <0.01 1 ± 0 l ± 0

/ Collarbone fracture F / 49 Normal brain with 0 <0.01 0.7 ± 0.3 l ± 0

Sign of

Arteriosclerosis/

Cyst kidney, cyst liver

F / 92 Normal brain <0.01 1 ± 0 1.3 ± 0.3

/ Fulminant colitis F / 75 Starting edema <0.01 1.7 ± 0.3 8.3 ± 3 of brain / cirrhosis

F / 39 Normal brain <0.01 l ± 0 13 ± 1

/ Pulmonary

Embolism M / 25 Normal brain <0.01 l ± 0 1.3 ± 0.3

/ Aortaruptur

M / 51 Normal brain <0.01 l ± 0 1.7 ± 0.3

/ Stenosis of the femoral

arteries

10 F / 36 Normal brain with <0.01 4.3 ± 0.3 19.3 ± 2.4 signs of anemia / carcinoma of the pleural cavity Table 1: Clinical and histological data from control patients with normal

Brain ^a : The color intensity was divided into four categories: 0, completely negative; 1, slightly positive; 2, moderately positive; and 3, strongly positive; ^b : HPF = high power field; ^c : MVD = microvessel density; ^d : F = female; ^e : M = male.

3.2.2 Samples from various areas of 10 adult normal human brains were stained in a further approach, also to determine expression levels for FZD 9 and localization of FZD 9. In most areas, FZD 9 expression was low; occasionally few FZD 9 ⁺ neurons or glia have been observed. FZD 9 expression in the cerebellum was limited to the endothelial cells of the microvessels (Figure 9A).

In contrast, strong FZD 9 expression was observed in the pyramidal layers of the hippocampal neurons (Figure 9B). In the leptomeningids FZD 9 was expressed on the endothelial cells of the large vessels. All negative controls showed no staining.

3.3 Expression of FZD 9 in human tumors

3.3.1 Astrocytomas

In parallel to normal and healthy brains, FZD 9 expression in WHO grade II to IV astrocytomas was studied. FZD 9 expression was observed in both microvascular endothelial cells and neoplastic cells (Figures 3C-E).

Expression of FZD 9 in microvessel endothelial cells was observed in human astrocytomas (Figures 3C-F). The density of FZD 9 ⁺ microvessels was high in malignant astrocytomas (40.1 ± 21.3 for WHO Grade III and 91.37 ± 17.79 for WHO Grade IV) and low in low grade astrocytomas (2.1 ± 1.0 for WHO grade II) (Table 2). The density of FZD 9 ⁺ microvessels in glioblastomas was significantly higher than in WHO grade II astrocytomas (p <0.001) and in normal brains (p <0.001) (Figure 4A and Table 2; "microvessels" £ microvessels; "Normal brain"& normal brain; "grading"&grading;"astrocytomas" * astrocytomas.) Multilayered microvascular proliferates ('glomeroid tufts') of proliferating capillaries are a characteristic feature of the microvasculature of glioblastomas Microvessel proliferates contain vascular channels formed from layers of endothelial cells separated by incomplete layers of pericytes, see Kleinhues P. et al., The WHO Classification of tumors of the nervous system. J. Neuropathol. Exp. Neurol. 2002; 61: 215-225. The multilayered microvessel proliferates also showed strong expression of FZD 9 (Figure 3G).

FZD 9 expression in tumor cells was found to be one in seven in WHO grade II astrocytes, five out of nine in WHO grade III astrocytomas, and nine out of nine in WHO grade IV astrocytomas observed, indicating that FZD 9 is significantly more expressed in tumor cells of malignant astrocytomas than in those of low-grade astrocytomas. The overall level of FZD 9 immunoreactivity was semiquantified. FZD 9 expression was high in WHO grade III (p <0.01, compared to normal brains) and WHO grade IV astrocytomas (p <0.001, compared to normal brains) and low in WHO grade II astrocytomas (p> 0.05, compared to normal brains) (Figure 4 A and Table 2). FZD 9 was strongly heterogeneously expressed in human glioblastomas. Another histopathological characteristic of the presence of glioblastomas necrosis with pseudo-palisades ( 'pseudopalisading necroses ^1), ie tomzellen a central necrosis with perinekrotischen Astrozy-, often occupy a pseudo palisades pattern; see. Kleinhues P. et al., (Supra). In the present investigations was strong expression of FZD 9 was observed in the astrocytoma cells in necroses with pseudopalisads (FIG. 3H).

Case Diagnosis FZD9 Ki67- FZD9 ⁺ -Micro- MVD ^c bad / Age - Marking vessels / HPF ^b

Colouration index in (%) tensi fi ed

11 F ^d / 49 Branch ^f Grade II 1 1 l ± 0 33.3 ± 3.3

12 M 765 Branch Grade II O 1 l ± 0 4 ± 0.6

13 F / 25 Branch Grade II O 4 O 18.7 ± 0.9

14 M / 43 Branch Grade II 2 3 8 ± 1.2 53.5 ± 24.5

15 M / 39 Branch Grade II 1 1 0.3 ± 0.3 22.3 ± 3.4

16 F / 36 Branch Grade II 2 2 3.3 ± 0.3 32 ± 7.1

17 M / 37 Branch Grade II 1 1 1.3 ± 0.3 6.5 ± 0.5

18 M / 49 Branch Grade III 3 4 121.7 ± 5.8 151 ± 11.5

19 M / 67 Branch Grade III i 5 5.7 ± 1.8 16 ± 1.5

20 F / 49 Branch Grade III 2 20 14.67 ± 2.3 46 ± 8.6

21 F / 23 Branch Grade III 2 20 15 ± 1.7 74.7 ± 9.3

22 M / 48 Branch Grade III 2 10 7.5 ± 0.5 15.7 ± 1.2

23 F / 44 Branch Grade III 1 2 1.3 ± 0.3 40.7 ± 4.9

24 F / 69 Branch Grade III 1 7 3 ± 0.6 34.7 ± 2.6

25 F / 40 Branch Grade III 1 5 11 ± 0.6 46.3 ± 8.1

26 M / 58 Branch Grade III 3 15 181 ± 8.1 315 ± 13.2

27 M / 50 GB «Grade IV 3 20 125.7 ± 8.1 133.7 ± 5.4

28 M / 58 GB Grade IV 3 8 80.67 ± 1.4 181.7 ± 38.3

29 F / 68 GB Grade IV 2 8 32 ± 2.6 44.3 ± 2.8

30 F / 93 GB Grade IV 2 10 15 ± 3 192 ± 9.2

31 F / 61 GB Grade IV 3 20 49.3 ± 1.4 65 ± 2.9

32 M / 68 GB Grade IV 3 5 107 ± 4 131 ± 6.4

33 F / 49 GB Grade IV 3 10 147 ± 3.2 215.3 ± 3.4

34 F / 51 GB Grade IV 3 15 90.3 ± 5.8 112 ± 19.6

35 M / 52 GB Grade IV 3 8 175 ± 5.1 187.3 ± 5.6

Table 2 Clinical and histopathological data from astrocyte patients ^a : Color intensity was divided into four categories: 0, completely negative; 1, slightly positive; 2, moderately positive; and 3, strongly positive; ^b : HPF = high power field; ^c : MVD = microvessel density; ^d : F = female; ^e : M = male; ^f : branch = astrocytoma; «: GB = glioblastoma. 3.3.2 Correlation between the immunoreactivity of FZD 9 with the degree of astrocytoma, microvessel density and cell proliferation

Since the density of FZD 9 ⁺ microvessels was high in malignant astrocytomas and low in low-grade astrocytomas, the correlation of density of FZD 9 ⁺ microvessels with WHO astrocytoma classification and astrocytoma microvessel density (MVD) was used as a measure of angiogenesis analyzed. As shown in Figure 3A, the density of FZD 9 ⁺ microvessels correlates positively with the astrocytoma WHO classification (p = 0.03, r = 0.98). Correlations between the density of FZD 9 ⁺ microvessels and MVD in astrocytomas were evaluated using Pearson's correlation coefficient. MVD was measured by a commonly used method using CD34 immunostaining. In human astrocytomas, a close correlation was observed between the density of FZD 9 ⁺ microvessels and the MVD (Figure 4B, p <0.0001, r = 0.84).

Furthermore, total FZD 9 immunoreactivity was analyzed with astrocytoma WHO classification and astrocytoma proliferation activity. The FZD 9 color intensity correlated positively with the astrocytoma WHO classification with statistical difference (Figure 4C, p = 0.005, r = 0.98; "staining intensity"& color intensity.) One of the main characteristics of neoplasms is a high level of Cell proliferation: Ki67 is the most commonly used antigen to immunoprecipitate cell proliferation and Ki67 is a core protein present in all non-GO phases of the cell cycle. index, the percentage of cells in a tissue stain for Ki67, used to study astrocytoma proliferation. In human astrocytomas, significant correlations were found between the Ki67 marker index and the intensity of the FZD 9- Immunostaining detected (Figure 4D, p <0.0001, r = 0.69; labeling index).

3.3.3 Expression of FZD 9 in Medulloblastomas, Primitive Neuroectodermal Tumors (PNETs) and Medullomyoblastomas

FZD 9 expression in the endothelium of tumor microvessels and large vessels was observed in 21 (72.4%) of the 29 brain tumors examined (Figure 9C, the vessels are marked with arrows). Evaluation of cytoplasmic expression using semiquantitative scoring revealed 5 strong (score 3), 15 moderate (score 2) and 10 weakly positive tumors (score 1, lanes 9D to G).

In 26 (89.6%) brain tumors, a diffuse pattern of expression was observed over the entire tissue sample without "hot spots." In four tumors an uneven distribution pattern was observed which showed stronger FZD 9 expression in some areas of high cell density (Fig. 9H), no tumor sample remained unlabelled (value 0).

Consistent with its function as a transmembrane protein, FZD 9 expression was also detected on the cell membrane, which was often indistinguishable from the small cytoplasm. In comparison with the normal brain, the FZD was 9-staining intensity, i. the FZD 9 expression pattern, significantly higher (Figure 6, p <0.01).

The one-way analysis of the variance of means between the classic desmoplastic and supratentorial variants showed no significant differences in expression. The evaluated expression levels were also independent of tumor recurrence. ten, age or sex of the patient (p <0.05, data not shown).

The MIB-1 / Ki67 index is a common size to evaluate cell proliferation in tumors. As a core protein, MIB-1 / Ki67 is present in all non-GO phases of the cell cycle. An average Ki67 index of 93.6 was observed, ranging from 42.7 to 8.8 in the 29 patients studied (Table 3). Controls from the normal brain showed few proliferating cells. A comparative analysis of the Ki67 and FZD 9 results revealed a significant correlation between the FZD 9 immunostaining value and the Ki67 labeling index in meduloblastomas (Figure 7, p <0.0001, R = 0.61).

Ll Diagnosis age reMIB-I (%) FZD 9- bad traffic staining intensity ^c

1 ^* classic W 2 28,6 1

2 classic W 4 20.4 3

3 classic M 5 18,8 1

4 classic W 5 19,1 2

5 classic M 6 21,6 2

6 classic M 7 21.4 2

7 classic M 8 22.4 2

8 classic M 8 33.2 2

9 classic W 9 9,7 2

10 classic W 90 8,8 1

11 classic M 11 12.2 2

12 classic M 12 yes 32.7 1

13 classic M 13 26.3 2

14 classic M 15 27,7 2

15 classic M 15 20,7 2

16 classic W 20 17.5 1 17 classic W 20 27.7 3

18 classic W 20 20.2 2

19 classic W 20 yes 38.3 3

20 classic M 33 yes 29.6 2

21 classic M 37 yes 28.3 3

22 classic M 64 42.7 1

23 classic W 39 yes 11,8 1

24 desmoplastic M 20 15,1 2

25 desmoplastic W 20 22.4 1

26 desmoplastic M 33 Yes 31.0 1

27 medullo-M 3 40.3 2 myoblastoma

28 PNET M 4 31,0 1

29 PNET W 6 9,9 3

Table 3: Results for the value of FZD 9 staining intensity and MIB-1 (Ki67) labeling index. The star-labeled tumors were selected for real-time PCR. W = female, M = male

- Real-time PCR

To confirm the immunohistochemical results, FZD 9 mRNA expression was analyzed using real-time PCR in selected native tissue samples of medulloblastomas (Table 3). These results were compared to samples from normal human brain. As in Figure 8, the average expression of FZD 9 in classical medulloblastomas was 2-fold higher than in normal brains. In addition, FZD 9 mRNA expression was analyzed in a known medulloblastoma cell line, in DAOY cells. In the DAOY cells cultured under normal conditions, relative FZD 9 mRNA expression was up to seven-fold increased compared to the internal reference standard.

3.5 Expression of FZD 9 in Schwannomas, Hemangioblastomas, Meningiomas, Neurofibromatomas, Prostate Carcinomas, and Breast Cancer

In the tumors mentioned, a significantly stronger immunohistochemical staining for FZD 9 was found than in controls with healthy tissue. It is concluded that FZD 9 is also clearly overexpressed in these tumors.

3.6 Up-regulation of FZD 9 expression in cobalt chloride-treated HCEC cells

During immunohistochemical studies, FZD 9 expression in microvascular endothelial cells was observed, with the density of FZD 9 ⁺ microvessels positively correlating with astrocytoma grade and MVD. The inventors have recognized that FZD 9 plays a role in astrocytoma angiogenesis. Hypoxia is a major inducer of angiogenesis. The inventors postulate that hypoxic stimulation stimulates FZD 9 expression in endothelial cells. To address these effects of hypoxia on the FZD 9- HCEC brain endothelial cells were incubated with cobalt chloride, which is known to be used as a hypoxia mimic in cell cultures and is known to activate the hypoxic signaling pathway by stabilizing the hypoxia-inducible transcription factor Iα; see. Vengellur A., LaPres JJ. "The role of hypoxia inducible factor lalpha in cobalt chloride cell induced cell death in mouse embryonic fibroblasts." Toxic Col., 2004; 82: 638-646., After incubation, FZD 9 expression was monitored using real-time PCR FZD 9 expression was enhanced 15 hours after incubation with cobalt chloride (Figure 5, two times higher than untreated cells; relative level of human FZD 9 in RNA expression) relative level the expression of the human FZD 9 mRNA "ineubation time / hours" incubation time (hours)) and was greatly increased 24 hours after incubation (FIG. 5: three times higher than in untreated cells. p <0, .05) , These results verify the findings previously obtained on tissue sections by the inventors that FZD 9 is an important factor of (tumor) angiogenesis.

3. Conclusion

The inventors have surprisingly found that FZD 9 different tumors can be identified and possibly treated. They thus provide valuable diagnostic and therapeutic uses or procedures.

Claims

claims

1. Use of a Frizzled 9 (FZD 9) binding agent for the preparation of a therapeutic or diagnostic agent for the treatment and / or identification of a tumor, characterized in that the tumor is selected from the group consisting of: neurotumor / CNS tumor, prostate carcinoma and breast cancer.

2. Use according to claim 1, characterized in that the neurotumor / CNS tumor is selected from the group consisting of: glioblastomas including astrocytomas, medulloblastomas including Primitive Neurodectal Tumors (PNET), schwannomas, hemangioblastomas, meningiomas and neurofibromatomas.

3. Use according to claim 1 or 2, characterized in that the agent used is a polyclonal or a monoclonal antibody or an antibody fragment which has the binding properties of the antibody.

4. Use according to claim 3, characterized in that one such monoclonal antibody is used, which is produced by the according to the Budapest Treaty on July 15, 2004 at the DSMZ under the number DSM ACC2668 deposited hybridoma cell W3C4E11.

5. Use according to claim 3 or 4, characterized in that the antibody or the antibody fragment is a humanized antibody or a humanized antibody fragment.

6. Use according to any one of claims 1 to 5, characterized in that the antibody or the antibody fragment is coupled to a detectable marker or to a therapeutic agent.

7. Use according to claim 5, characterized in that the therapeutic agent is an anti-tumor agent.

8. A method of making a therapeutic or diagnostic agent for treating and / or identifying a tumor comprising the steps of:

(1) providing a FZD 9 binding agent, and

(2) formulation of the agent in a diagnostically and / or pharmaceutically acceptable carrier with optionally further additives, characterized in that the tumor is selected from the group consisting of: neurotumor / CNS tumor, prostate carcinoma and breast cancer.

9. A method of identifying tumors in a subject comprising the steps of:

(1) providing a biological sample derived from the subject to be examined;

(2) determination of expression level of FZD 9 in the biological sample;

(3) comparison of the expression level of FZD 9 detected in step (2) with the expression level of FZD 9 in a biological sample from a healthy animal, and

(4) Identification of a tumor when it is determined in step (3) that the expression level of FZD 9 in the biological sample of the subject to be examined is significantly higher than the expression level of FZD 9 in the biological sample of the healthy subject.

10. The method according to claim 9, characterized in that the tumors are neurotumor / CNS tumors, and that the biological samples comprise neuronal tissue.

11. The method according to claim 10, characterized in that the neurotumor / CNS tumors are selected from the group consisting of: glioblastomas including astrocytomas, medulloblastomas including primitive neuroectodermal tumors (PNET), schwannomas, hemangioblastomas, meningiomas and neurofibromatomes.

12. The method according to claim 9, characterized in that the tumors are selected from the group consisting of: prostate carcinomas and breast cancers; and that the biological samples are selected from the group consisting of: prostate tissue and mammalian tissue.

13. The method according to any one of claims 9 to 12, characterized in that the expression level is detected at the level of FZD 9-coding mRNA.

14. The method according to any one of claims 9 to 12, characterized in that the expression level is detected at the level of FZD 9 protein.

15. The method according to claim 14, characterized in that is used to determine the level of expression of an FZD 9-binding polyclonal or monoclonal antibody or antibody fragment thereof, which has the binding properties of the antibody.

16. The method according to claim 15, characterized in that the antibody used is the monoclonal antibody which is produced by the hybridoma cell W3C4E11 deposited with the DSMZ under the number DSMZZ on July 15, 2004 under the number DSM ACC2668.

17. The method according to claim 15 or 16, characterized in that the antibody is coupled to a detectable marker.

18. A method of identifying tumors in a subject, comprising the steps of:

(1) administering an agent comprising an FZD 9 binding agent having a detectable marker into the subject, and

(2) depiction of the accumulation of the agent in the animal by means of suitable methods,

wherein the tumor is selected from the group consisting of: neurotumor / CNS tumors, prostate carcinoma and breast carcinoma.

19. The method according to claim 18, characterized in that the detectable marker is a radioactive marker and the method in step (2) is 3D radiography.

20. A method of treating a human or animal animal having a tumor, comprising the steps of:

(1) administering an agent containing an FZD 9-binding agent to the subject, and

(2) if necessary repeated repetition of step (1), wherein the tumor is selected from the group consisting of: neurotumor / CNS tumors, prostate carcinoma and breast carcinoma.