EP1899478A2 - Improving antibody expression using vectors containing insulator elements - Google Patents
Improving antibody expression using vectors containing insulator elementsInfo
- Publication number
- EP1899478A2 EP1899478A2 EP06813200A EP06813200A EP1899478A2 EP 1899478 A2 EP1899478 A2 EP 1899478A2 EP 06813200 A EP06813200 A EP 06813200A EP 06813200 A EP06813200 A EP 06813200A EP 1899478 A2 EP1899478 A2 EP 1899478A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- vector
- mar
- insulator
- cell
- light chain
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- Chromatin domains can consist of groups of genes that are expressed in a strictly tissue specific manner such as the human ⁇ -globin family (Grosveld et al., (1993) Baillieres Clin. Haematol. 6: 31-55), genes that are expressed ubiquitously such as the human TBP/C5 locus (Trachtulec, Z. et al., (1997) Genomics 44: 1-7), or a mixture of tissue specific and ubiquitously expressed genes such as murine ⁇ / ⁇ TCR/dad-1 locus, (Ortiz et al., (1997) EMBO J.
- Chromatin domains are believed to exist in either a closed, “condensed”, transcriptionally silent state or in a "de-condensed”, open and transcriptionally active configuration.
- the establishment of an open chromatin structure characterized by DNase I sensitivity, DNA hypomethylation and histone hyperacetylation, is seen as a pre-requisite to the commencement of gene expression.
- insulators include such elements as boundary elements (BEs), matrix attachment regions (MARs), locus control regions (LCRs), and universal chromatin opening elements (UCOEs). When inserted into the host cell chromosome, these elements have been shown to exert an effect on gene expression of an associated heterologous gene. These elements are potentially capable of overcoming position effects, and hence are of interest for the development of stable cell lines.
- BEs boundary elements
- MARs matrix attachment regions
- LCRs locus control regions
- UCOEs universal chromatin opening elements
- Boundary elements define boundaries in chromatin (Bell and Felsenfeld, 1999; Udvardy, 1999) and may play a role in defining a transcriptional domain in vivo. BEs lack intrinsic promoter/enhancer activity, but rather are thought to protect genes from the transcriptional influence of regulatory elements in the surrounding chromatin, thus preventing unwanted enhancer-promoter communication.
- An enhancer-block assay is commonly used to identify such insulator elements. In this assay, the insulator is placed between an enhancer and a promoter, and enhancer-activated transcription is measured.
- Boundary elements have been shown to be able to protect stably transfected reporter genes against position effects in Drosophila, yeast and in mammalian cells (Bi and Broach, 1999; Cuvier et al., 1998; Walters et al., 1999). They have also been shown to increase the proportion of transgenic mice with inducible transgene expression (Wang et al., 1997).
- Matrix Attachment Regions (“MARs”), also known as Scaffold Attachment Regions or Scaffold/Matrix Attachment Regions (“S/MARs”), are DNA sequences that bind isolated nuclear scaffolds or nuclear matrices in vitro with high affinity (Hart and Laemmli, 1998).
- MAR sequences have been shown to interact with enhancers to increase local chromatin accessibility (Jenuwein et al., 1997). Specifically, MAR elements can enhance expression of heterologous genes in cell culture lines (Kalos and Fouraier, 1995; Klehr et al., 1991; Phi-Van et al., 1990; Poljak et al., 1994), transgenic mice (Castilla et al., 1998) and plants (Allen et al., 1996). Another class of MARs has been localized near the boundary of active chromatin domains, defining them as insulators. The most characterized MAR of this type was found at the boundary of the chicken lysozyme locus.
- the 5'MAR was shown to shield a transgene from position effects and block enhancer action in a position-dependent manner (Stief et al. (1989) Nature 341:343-345.) It has also been shown that the matrix-associating sequence may be separated from the protection effect sequence (Phi-Van et al (1996) Biochem. 35:10735-10742). [0006]
- the chicken lysozyme 5' MAR element is able to significantly improve stable transgene expression in CHO cells, a cell line commonly used in recombinant protein production.
- the chicken lysozyme 5' MAR element is also able to significantly improve transient transfections, particularly when the transfected cells are contacted with butyrate.
- This chicken MAR element has previously been shown to enhance transcription from a heterologous promoter in heterologous cells (Phi- Van et al., 1990), and to confer position- independent hormonal and developmental regulation of the expression of the whey acidic protein gene in transgenic mice (McKnight et al., 1992).
- Locus control regions are cis-regulatory elements required for the initial chromatin activation of a locus and subsequent gene transcription in their native locations (reviewed in Grosveld, 1999).
- the activating function of LCRs also allows the expression of a coupled transgene in the appropriate tissue in transgenic mice, irrespective of the site of integration in the host genome. While LCRs generally confer tissue-specific levels of expression on linked genes, efficient expression in nearly all tissues in transgenic mice has been reported for a truncated human T-cell receptor LCR (Ortiz et al., 1997) and a rat LAP LCR (Talbot et al., 1994).
- One extensively characterized LCR is that of the globin locus.
- Ubiquitous chromatin opening elements have been reported (See WO00/05393).
- a simple and rapid approach to overcome position effects is to make use of chromatin elements that prevent the neighboring chromatin from affecting transgene expression.
- chromatin elements that prevent the neighboring chromatin from affecting transgene expression.
- An antibody gene of interest is flanked by an element cloned from chicken DNA either at the 5' end, the 3' end or both.
- the element can be any one of the insulator elements discussed including Boundary Elements, Locus Control Regions, Ubiquitous chromatin opening elements, or Matrix (or Scaffold) Attachment Regions.
- One embodiment of this invention is a vector comprising a chicken MAR element of approximately 1.5 Kb selected from the upstream region of the chicken lysozyme gene. Other MAR elements may be used interchangeably with this particular MAR.
- the expression vectors of the invention comprise a nucleic acid encoding a heavy and/or light chain of the desired antibody to be expressed in a form suitable for expression in a host cell.
- the vectors include one or more regulatory sequences, selected on the basis of the host cells to be used for expression, and may be operatively-linked to the heterologous gene sequence to be expressed.
- the antibody may be a single-chain antibody, a single domain antibody, or fragments of the heavy or light chain sequences, including Fab.
- Another aspect of the invention is the improved expression and production of the recombinant antibody.
- the insulator element's ability to prevent silencing of the transcription of the encoded antibody improves the production of the recombinant product.
- Another aspect of the present invention is the improved survival of the cell due to the presence of the MAR element. Improved cell survival will also improve the amount of production of the recombinant product because more cells survive longer during the culturing and production process.
- Figure 1 depicts vectors encoding either the heavy chain or light chain immunoglobulin flanked by two MAR elements.
- Figure 2 depicts vectors encoding either the heavy chain or light chain immunoglobulin having a single MAR element.
- Figure 3 shows the increased cell survival rate of cells containing a vector encoding an antibody that contained (1) No MAR element (2) One MAR element, or (3)
- Figure 4 shows the increased antibody expression level in NSO cells containing a vector encoding an antibody that contained (1) No MAR element (2) One MAR element, or (3) Two MAR elements.
- Figure 5 shows the increased antibody expression level in CHO-S cells containing a vector encoding an antibody that contained (1) No MAR element (2) One MAR element, or (3) Two MAR elements.
- FIG. 6 shows alternative structures useful in the present invention. DETAILED DESCRIPTION OF THE INVENTION
- antibody is used in the broadest sense, and specifically covers monoclonal antibodies (including full length monoclonal antibodies), polyclonal antibodies, single-chain antibodies, single-domain antibodies and multispecific antibodies (e.g., bispecific antibodies).
- Antibodies (Abs) and immunoglobulins (Igs) are glycoproteins having the same structural characteristics. While antibodies exhibit binding specificity to a specific target, immunoglobulins include both antibodies and other antibody-like molecules which lack target specificity.
- Native antibodies and immunoglobulins are usually heterotetrameric glycoproteins of about 150,000 daltons, composed of two identical light (L) chains and two identical heavy (H) chains.
- the present invention includes other constructs wherein the heavy and light chain are linked to generate a single chain antibody; the heavy and light chain are expressed from a single promoter with an internal IRES for ribosome binding; single-domain antibodies in which the functional antibody comprises only a heavy chain or light chain, such as those described in WO04081026 and WO04041865, and any other constructs that are capable of expressing a functional antibody or fragment thereof.
- the terms “cell”, “cell line” and “cell culture” include progeny. It is also understood that all progeny may not be precisely identical in DNA content, due to deliberate or inadvertent mutations. Variant progeny that have the same function or biological property, as screened for in the originally transformed cell, are included.
- the "host cells” used in the present invention generally are prokaryotic or eukaryotic hosts.
- "Transformation" of a cellular organism with DNA means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integration.
- Transfection of a cellular organism with DNA refers to the taking up of DNA, e.g., an expression vector, by the cell or organism whether or not any coding sequences are in fact expressed.
- the terms "transfected host cell” and “transformed” refer to a cell in which DNA was introduced.
- the cell is termed “host cell” and it may be either prokaryotic or eukaryotic.
- Typical prokaryotic host cells include various strains of E. coli.
- Typical eukaryotic host cells are mammalian, such as Chinese hamster ovary or cells of human origin.
- the introduced DNA sequence may be from the same species as the host cell of a different species from the host cell, or it may be a hybrid DNA sequence, containing some foreign and some homologous DNA.
- the term "vector” means a DNA construct containing a DNA sequence operably linked to a suitable control sequence capable of effecting the expression of the DNA in a suitable host.
- control sequences may include a promoter to effect transcription, an optional operator sequence to control such transcription, a sequence encoding suitable mRNA ribosome binding sites, and sequences which control the termination of transcription and translation.
- the vector may be a plasmid, a phage particle, or simply a potential genomic insert. Once incorporated into a suitable host, the vector may replicate and function independently of the host genome, or may in some instances, integrate into the genome itself.
- "plasmid” and “vector” are sometimes used interchangeably, as the plasmid is the most commonly used form of vector. However, the invention is intended to include such other forms of vectors which serve equivalent function as and which are, or become, known in the art.
- regulatory sequences refers to DNA sequences necessary for the expression of the heterologous gene of interest in a particular host organism. Regulatory sequences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a ribosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
- DNA for a presequence or secretory leader may also be used for a polypeptide to be secreted, such as an antibody; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence
- a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- Regulatory sequences include those that direct constitutive expression of a nucleotide sequence in many types of host cell and those that direct expression of the nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). It will be appreciated by those skilled in the art that the design of the expression vector can depend on such factors as the choice of the host cell to be transfected, the level of expression of protein desired, etc.
- operably-linked is intended to mean that the nucleotide sequence of interest is linked to a regulatory sequence(s) in a manner that allows for expression of the nucleotide sequence (e.g., in an in vitro transcription/translation system or in a host cell when the vector is incorporated into the host cell).
- variable domains refers to the fact that certain portions of the variable domains differ extensively in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular target. However, the variability is not evenly distributed through the variable domains of antibodies. It is concentrated in three segments called complementarity determining regions (CDRs) also known as hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of variable domains are called the framework (FR).
- CDRs complementarity determining regions
- FR framework
- the variable domains of native heavy and light chains each comprise four FR regions, largely a adopting a ⁇ -sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the ⁇ -sheet structure.
- the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the target binding site of antibodies (see Kabat et al.)
- numbering of immunoglobulin amino acid residues is done according to the immunoglobulin amino acid residue numbering system of Kabat et al., (Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, Md. 1987), unless otherwise indicated.
- the term "single-domain antibody” refers to a single immunoglobulin variable domain (V H , V HH or V L ) polypeptide that specifically binds antigen.
- the antigen binding unit of a naturally-occurring antibody (e.g., in humans and most other mammals) is generally known to be comprised of a pair of V regions (V I /V H )
- camelid species express a large proportion of fully functional, highly specific antibodies that are devoid of light chain sequences.
- the camelid heavy chain antibodies are found as homodimers of a single heavy chain, dimerized via their constant regions.
- variable domains of these camelid heavy chain antibodies are referred to as V HH domains and retain the ability, when isolated as fragments of the V H chain, to bind antigen with high specificity ((Hamers- Casterman et al., 1993, Nature 363: 446-448; Gahroudi et al., 1997, FEBS Lett. 414: 521- 526).
- Antigen binding single V H domains have also been identified from, for example, a library of murine V H genes amplified from genomic DNA from the spleens of immunized mice and expressed in E. coli (Ward et al., 1989, Nature 341: 544-546). Ward et al. named the isolated single V H domains "dAbs," for "domain antibodies.” INSULATOR ELEMENTS
- the present invention involves compositions and methods that can modulate the efficiency of cell transfection, the level of expression of a recombinant protein and the survival of the cell using insulator elements (e.g., MAR elements, Bes, LCRs, and UCOEs).
- insulator elements e.g., MAR elements, Bes, LCRs, and UCOEs.
- one embodiment comprises a MAR element used in eukaryotic cell transfection methods.
- a MAR element suitable for use in the present invention includes chicken lysozyme MAR element, which is shown in SEQ ID NO: 1, or a fragment thereof. Additional insulator elements to be used in accordance with the invention may be identified, isolated, and cloned using a variety of techniques well known to those of ordinary skill in the art. VECTORS
- the invention provides isolated nucleic acid encoding an antibody or fragment thereof as disclosed herein, vectors and host cells comprising the nucleic acid, and recombinant techniques for the production of the antibody.
- the nucleic acid encoding it is isolated and inserted into a replicable vector for further cloning (amplification of the DNA) or for expression.
- DNA encoding the antibody is readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of the antibody variant).
- the vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence.
- Figure 1 depicts one embodiment of a vector useful in the present invention.
- the vector comprises two MAR elements, one located upstream of the promoter and one located downstream of the gene.
- Figure 2 depicts the same vectors, but with a single MAR element located upstream of the promoter on each vector. Although not depicted in Figure 2, the MAR element may also be located downstream.
- the antibodies or their fragments could be independently expressed from separate promoters or that the secretion signal need not be the viral sequence depicted, but could be any prokaryotic or eukaryotic signal sequence suitable for the secretion of the antibody fragments from the chosen host cell.
- the heavy chain and light chain depicted in these figures may also be expressed from a single vector under the control of individual expression cassettes or as one expression cassette with an internal ribosome site (IRES).
- IRS internal ribosome site
- the vectors in Figures 1 and 2 also provide different selection markers, e.g., gpt and neo. These vectors may also contain, e.g., a His tag or a myc tag for easy purification, as well as detection.
- selection markers e.g., gpt and neo.
- These vectors may also contain, e.g., a His tag or a myc tag for easy purification, as well as detection.
- the antibody may be expressed as a fusion polypeptide fused with a heterologous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
- a heterologous polypeptide which may be a signal sequence or other polypeptide having a specific cleavage site at the N-terminus of the mature protein or polypeptide.
- the heterologous signal sequence selected preferably is one that is recognized and processed (i.e., cleaved by signal peptidase) by the host cell.
- the signal sequence may be substituted by a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, penicillinase, lpp, or heat-stable enterotoxin II leaders.
- the signal sequence depicted is a viral signal sequence from gene III.
- the native signal sequence may be substituted by, e.g., the yeast invertase leader, ⁇ -factor leader (including Saccharomyces and Kluyveromyces ⁇ -factor leaders), or acid phosphatase leader, the C. albicans glucoamylase leader, or a signal described in e.g., WO 90/13646.
- mammalian signal sequences as well as viral secretory leaders for example, the herpes simplex gD signal, are available.
- the DNA for such precursor region is ligated in reading frame to DNA encoding the antibody variant.
- Vectors usually contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells.
- this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins of replication or autonomously replicating sequences.
- origins of replication or autonomously replicating sequences are well known for a variety of bacteria, yeast, and viruses.
- the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, polyoma, adenovirus, VSV or BPV) are useful for vectors in mammalian cells.
- the origin of replication component is not needed for mammalian expression vectors (the SV40 origin may typically be used only because it contains the early promoter).
- Vectors may contain a selection gene, also termed a selectable marker.
- Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillin, neomycin, methotrexate, or tetracycline, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanine racemase for Bacilli.
- One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs neomycin, mycophenolic acid and hygromycin.
- Another example of suitable selectable markers for mammalian cells are those that enable the identification of cells competent to take up the antibody nucleic acid, such as DHFR, thymidine kinase, metallothionein-I and -II, preferably primate metallothionein genes, adenosine deaminase, ornithine decarboxylase, etc.
- cells transformed with the DHFR selection gene are first identified by culturing all of the transformants in a culture medium that contain methotrexate (Mtx), a competitive antagonist of DHFR.
- Mtx methotrexate
- An appropriate host cell when wild-type DHFR is employed is the Chinese hamster ovary (CHO) cell line deficient in DHFR activity.
- host cells particularly wild-type hosts that contain endogenous DHFR transformed or co-transformed with DNA sequences encoding antibody, wild-type DHFR protein, and another selectable marker such as aminoglycoside 3'- phosphotransferase (APH) can be selected by cell growth in medium containing a selection agent for the selectable marker such as an aminoglycosidic antibiotic, e.g., kanamycin, neomycin, or G418. (U.S. Pat. No. 4,965,199).
- APH aminoglycoside 3'- phosphotransferase
- a suitable selection gene for use in yeast is the trpl gene present in the yeast plasmid Yrp7 (Stinchcomb et al., Nature 282: 39 (1979)).
- the trpl gene provides a selection marker for a variant strain of yeast lacking the ability to grow in tryptophan, for example, ATCC No. 44076 or PEP4-1. Jones, Genetics 85: 12 (1977).
- the presence of the trpl lesion in the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
- Leu2-deficient yeast strains (ATCC 20,622 or 38,626) are complemented by known plasmids bearing the Leu2 gene.
- Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the nucleic acid to be expressed.
- Regulatable gene expression promoters are well known in the art, and include, by way of non-limiting example, any promoter that modulates expression of a gene encoding a desired protein by binding an exogenous molecule, such as the CRE/LOX system, the TET system, the NFkappaB/UV light system, the Leu3p/isopropylmalate system, and the GLVPc/GAL4 system (See e.g., Sauer, 1998, Methods 14(4): 381-92).
- suitable promoter sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kinase or other glycolytic enzymes, such as enolase, glyceraldehyde-3 -phosphate dehydrogenase, hexokinase, pyruvate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kinase, triosephosphate isomerase, phosphoglucose isomerase, and glucokinase.
- suitable vectors and promoters for use in yeast expression are further described in EP 73,657.
- Yeast enhancers also are advantageously used with yeast promoters.
- Antibody transcription from vectors in mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian virus 40 (SV40), from heterologous mammalian promoters, e.g., the actin promoter or an immunoglobulin promoter, from heat-shock promoters—provided such promoters are compatible with the host cell systems.
- viruses such as polyoma virus, fowlpox virus, adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, he
- the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication.
- the immediate early promoter of the human cytomegalovirus is conveniently obtained as a HindIII E restriction fragment.
- a system for expressing DNA in mammalian hosts using the bovine papilloma virus as a vector is disclosed in U.S. Pat. No. 4,419,446. A modification of this system is described in U.S. Pat. No. 4,601,978.
- a thymidine kinase promoter from herpes simplex virus may be used or the Rous sarcoma virus long terminal repeat may be used as the promoter.
- Enhancer sequences are now known from mammalian genes (globin, elastase, albumin, ⁇ - fetoprotein, and insulin). Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
- the enhancer may be spliced into the vector at a position 5' or 3' to the antibody-encoding sequence, but is preferably located at a site 5' from the promoter.
- Expression vectors used in eukaryotic host cells may also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs. These regions contain nucleotide segments transcribed as polyadenylated fragments in the untranslated portion of the mRNA encoding the antibody.
- One useful transcription termination component is the bovine growth hormone polyadenylation region. See e.g., WO94/11026. SELECTION AND TRANSFORMATION OF HOST CELLS
- Suitable host cells for cloning or expressing the DNA in the vectors herein are prokaryotic, yeast, or higher eukaryotic cells.
- Suitable prokaryotes for this purpose include both Gram-negative and Gram-positive organisms, for example, Enterobacteria such as E. coli, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, Serratia, and Shigella, as well as Bacilli, Pseudomonas, and Streptomyces.
- E. coli cloning host is E. coli 294 (ATCC 31,446), although other strains such as E. coli B, E. coli X1776 (ATCC 31,537), and E. coli W3110 (ATCC 27,325) are suitable. These examples are illustrative rather than limiting.
- eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for antibody-encoding vectors.
- Saccharomyces cerevisiae is the most commonly used among lower eukaryotic host microorganisms.
- a number of other genera, species, and strains are commonly available and useful herein, such as Schizosaccharotnyces pombe; Pichia pastoris, Kluyveromyces; Candida; Trichoderma; Neurospora crassa; and filamentous fungi such as e.g., Neurospora, Penicillium, Tolypocladium, and Aspergillus hosts, such as A. nidulans and A. niger.
- Suitable host cells for the expression of glycosylated antibodies are derived from multicellular organisms. In principal, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture. Examples of invertebrate cells include plant and insect cells, Luckow et al., Bio/Technology 6, 47-55 (1988); Miller et al, Genetic Engineering, Setlow et al. eds. Vol. 8, pp. 277-279 (Plenam publishing 1986); Mseda et al., Nature 315, 592-594 (1985).
- baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar), Aedes (mosquito), Drosophila melanogaster (fruitfly), and Bombyx mori have been identified.
- a variety of viral strains for transfection are publicly available, e.g., the L-I variant of Autographa californica NPV and the Bm-5 strain of Bombyx mori NPV, and such viruses may be used as the virus herein according to the present invention, particularly for transfection of Spodoptera frugiperda cells.
- plant cells cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco and also be utilized as hosts.
- Vertebrate cells, and propagation of vertebrate cells, in culture have become a routine procedure. See Tissue Culture, Academic Press, Kruse and Patterson, eds. (1973).
- useful mammalian host cell lines are monkey kidney; human embryonic kidney line; baby hamster kidney cells; Chinese hamster ovary cells/-DHFR (CHO, Urlaub et al., Proc. Natl. Acad. Sci. USA 77: 4216 (1980)); mouse Sertoli cells; human cervical carcinoma cells (HELA); canine kidney cells; human lung cells; human liver cells; mouse mammary tumor; and NSO cells.
- Host cells are transformed with the above-described vectors for antibody production and cultured in conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
- the host cells used to produce the antibody of this invention may be cultured in a variety of media.
- Commercially available media such as Ham's FlO (Sigma), Minimal Essential Medium (MEM, Sigma), RPMI- 1640 (Sigma), and Dulbecco's Modified Eagle's Medium (DMEM, Sigma) are suitable for culturing host cells.
- 4,767,704; 4,657,866; 4,560,655; 5,122,469; 5,712,163; or 6,048,728 may be used as culture media for the host cells. Any of these media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as X-chlorides, where X is sodium, calcium, magnesium; and phosphates), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as GENTAMYCIN.TM. drug), trace elements (defined as inorganic compounds usually present at final concentrations in the micromolar range), and glucose or an equivalent energy source.
- hormones and/or other growth factors such as insulin, transferrin, or epidermal growth factor
- salts such as X-chlorides, where X is sodium, calcium, magnesium; and phosphates
- buffers such as HEPES
- EXAMPLE 1 Isolation of Chicken MAR (1.46kfr) from Chicken Genomic DNA [0055] Two primers were synthesized based on the chicken genomic sequence of the chicken lysozyme MAR.
- MAR-F 5' - GCTGCTggatccTGCCGCCTTCTTTGATATTC- 3' SEQ ID NO: 2
- MAR-R 5' - GTAAGATGAAGAGTGCTGTGC - 3' SEQ ID NO: 3
- the PCR conditions used were 94 0 C for 30s, 50 0 C for 30s, and 72 0 C for 2.5min for 5 cycles; followed by 94 0 C for 30s, 55°C for 30s, and 72 0 C for 2.5min for 25cycles (using 50ng of chicken genomic DNA as template).
- the resulting PCR fragment was used to generate a second PCR fragment using two oligo nucleotide primers:
- the PCR conditions used for this second round were: 94 0 C for 30s, 55 0 C for 30s, and 72 ° C for 1.5min for 30 cycles using IuI of first round PCR as template.
- This second PCR fragment was then cleaved at BamHI (5') and Xhol (3') and ligated into the commercially available vector pcDNA3.1.
- the second round PCR fragment was gel purified and digested with BamHI and Xhol, followed by ligation into a pcDNA3.1(+) vector (from Invitrogen, catalog@invitrogen.com ). The resulting construct was sequenced using vector sequences
- T7 and BGH as primers.
- the verified sequence was identical to that of SEQ ID NO 1.
- Example 1 The MAR fragment isolated in Example 1 was cloned into a vector containing the heavy chain of an anti-IgE antibody and a vector containing the corresponding light chain.
- the MAR was inserted upstream of a CMV promoter in the same orientation as the antibody gene. (See Figure 2)
- the MAR fragment isolated in Example 1 was also cloned into a vector containing the heavy chain of an anti-IgE antibody and a vector containing the corresponding light chain.
- the MAR was inserted upstream of a CMV promoter in the same orientation as the antibody gene and downstream of the antibody gene in the opposite orientation. (See Figure 1)
- Three sets of vectors were linearized: (1) one set with a light chain vector and a heavy chain vector but no MAR element; (2) one set with a light chain vector and a heavy chain vector each containing one MAR element as depicted in Figure 2; and (3) one set with a light chain vector and a heavy chain vector each containing two MAR elements as depicted in Figure 1.
- NSO host cells were grown to a density of IxIO 6 cells/ml in typical growth medium, keeping the cells in exponential growth by providing fresh medium until the day before transfection. A volume of cells equaling 40 x 10 6 cells was then washed with 15 ml Dl 5 +
- Transfection was performed by adding lOug of linearized light chain DNA and lOug of linearized heavy chain DNA of each set to the cell suspension (total DNA volume was less than 5OuI) and the cells were held on ice for 15min. Cells were transferred into pre-chilled cuvette (0.4cm) and an electric pulse (200 volts, 96OuF) was applied. The cuvette was immediately returned to the ice after the electric pulse and held for 15min.
- ELISA was performed to test for the level of expression.
- the results in Figure 3 show not only that the MAR element increased cell survival, but that two MAR elements improve cell survival over a single MAR.
- the level of antibody production was also greatly improved as depicted in Figure 4.
- one MAR element increased the level of production from less than 0.2 ug/ml with no MAR element present, to 9ug/ml with one MAR element present and 12ug/ml with two MAR elements present.
- the level of expression was increased 45 fold with one MAR and 60 fold with two MAR elements.
- EXAMPLE 4 Transfection of CHO-S cells using Lipofectamine 2000 [0064] A similar experiment as that described in Example 3 was carried out in a different cell line to show the versatility of the invention. Three sets of vectors were linearized: (1) one set with a light chain vector and a heavy chain vector but no MAR element; (2) one set with a light chain vector and a heavy chain vector each containing one MAR element as depicted in Figure 2; and (3) one set with a light chain vector and a heavy chain vector each containing two MAR elements as depicted in Figure 1.
- a suspension cell line CHO-S was converted back to adhering cells in DMEM + 10% FBS medium before transfection. Prior to transfection, the cells were aliquoted at 1.3 x 1O 6 cells/ml in a six well plate (2ml/well). Transfection was carried out according to the manufacturer's instructions (Invitrogen, Lipofectamine 2000 Transfection System). [0066] The results depicted in Figure 5 show an increased level of production of antibody for each MAR element incorporated into the vector.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US68962305P | 2005-06-10 | 2005-06-10 | |
| PCT/US2006/022131 WO2007021353A2 (en) | 2005-06-10 | 2006-06-07 | Improving antibody expression using vectors containing insulator elements |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1899478A2 true EP1899478A2 (en) | 2008-03-19 |
Family
ID=37758005
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP06813200A Withdrawn EP1899478A2 (en) | 2005-06-10 | 2006-06-07 | Improving antibody expression using vectors containing insulator elements |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1899478A2 (en) |
| JP (1) | JP2008543283A (en) |
| AU (1) | AU2006280428A1 (en) |
| CA (1) | CA2611465A1 (en) |
| MX (1) | MX2007015540A (en) |
| WO (1) | WO2007021353A2 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FI3536797T3 (en) * | 2013-02-01 | 2023-03-23 | Selexis Sa | Enhanced transgene expression and processing |
| MY189674A (en) | 2015-10-28 | 2022-02-24 | Sangamo Therapeutics Inc | Liver-specific constructs, factor viii expression cassettes and methods of use thereof |
| US12497632B2 (en) | 2018-08-03 | 2025-12-16 | Sangamo Therapeutics, Inc. | Clinical parameters by expression of factor VIII |
| JP6823791B2 (en) * | 2018-09-25 | 2021-02-03 | 国立研究開発法人産業技術総合研究所 | Artificial chromosome vector and transformed mammalian cell |
| US20230193341A1 (en) * | 2018-10-24 | 2023-06-22 | Selexis Sa | Expression systems, recombinant cells and uses thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002048379A1 (en) * | 2000-12-15 | 2002-06-20 | Pangen Biotech Inc. | Expression vector for animal cell containing nuclear matrix attachment region fo interferon beta |
| DK1395669T3 (en) * | 2001-01-26 | 2009-11-16 | Selexis Sa | Matrix binding regions and methods for using them |
| US7326567B2 (en) * | 2003-11-12 | 2008-02-05 | Schering Corporation | Plasmid system for multigene expression |
-
2006
- 2006-06-07 JP JP2008515874A patent/JP2008543283A/en active Pending
- 2006-06-07 MX MX2007015540A patent/MX2007015540A/en not_active Application Discontinuation
- 2006-06-07 AU AU2006280428A patent/AU2006280428A1/en not_active Abandoned
- 2006-06-07 EP EP06813200A patent/EP1899478A2/en not_active Withdrawn
- 2006-06-07 CA CA002611465A patent/CA2611465A1/en not_active Abandoned
- 2006-06-07 WO PCT/US2006/022131 patent/WO2007021353A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO2007021353A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2006280428A1 (en) | 2007-02-22 |
| JP2008543283A (en) | 2008-12-04 |
| WO2007021353A2 (en) | 2007-02-22 |
| MX2007015540A (en) | 2008-03-07 |
| CA2611465A1 (en) | 2007-02-22 |
| WO2007021353A3 (en) | 2007-08-30 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5270544B2 (en) | Regulatory nucleic acid sequence elements | |
| JP4307079B2 (en) | Matrix attachment region and method of use | |
| WO2017215619A1 (en) | Fusion protein producing point mutation in cell, and preparation and use thereof | |
| JP2010536396A (en) | Method to increase protein titer | |
| CA2910877A1 (en) | Expression process | |
| CN104718296B (en) | Expression vector comprising chimeric cytomegalovirus promoter and enhancer sequence | |
| CN101263158B (en) | Inhibition of B cell apoptosis in transgenic animals expressing humanized immunoglobulins | |
| JP2020022514A (en) | Production cell line enhancer | |
| JP7450647B2 (en) | Mammalian cell line with SIRT-1 gene knockout | |
| JP7572977B2 (en) | Method for generating multivalent, multispecific antibody-expressing cells by targeted integration of multiple expression cassettes of defined configuration - Patent Application 20070123333 | |
| MX2012005117A (en) | Sorf constructs and multiple gene expression. | |
| EP1899478A2 (en) | Improving antibody expression using vectors containing insulator elements | |
| JP2011504741A (en) | New recombinant sequence | |
| US20260117258A1 (en) | Novel Transposase System | |
| EP1957660B1 (en) | Materials and methods to increase peptide chain expression | |
| HK40061338A (en) | Mammalian cell lines with sirt-1 gene knockout | |
| ES2372703T3 (en) | DNA FRAGMENTS THAT INCREASE EXPRESSION, USE OF THE SAME AND PROCEDURES TO FIND THEM. | |
| CA2486464A1 (en) | Chimeric ige polypeptides and host cells | |
| HK40109435A (en) | Method for the generation of a protein expressing cell by targeted integration using cre mrna | |
| HK40105447A (en) | Mammalian cell lines with sirt-1 gene knockout | |
| HK40060851B (en) | Method for the generation of a protein expressing cell by targeted integration using cre mrna | |
| HK1125028A (en) | Methods and compositions for improving recombinant protein production |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20080107 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL BA HR MK YU |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| RAX | Requested extension states of the european patent have changed |
Extension state: RS Payment date: 20080107 Extension state: MK Payment date: 20080107 Extension state: HR Payment date: 20080107 Extension state: BA Payment date: 20080107 Extension state: AL Payment date: 20080107 |
|
| 18W | Application withdrawn |
Effective date: 20080320 |