EP1838851A1 - Polypeptide mutagenesis method - Google Patents

Polypeptide mutagenesis method

Info

Publication number
EP1838851A1
EP1838851A1 EP06703246A EP06703246A EP1838851A1 EP 1838851 A1 EP1838851 A1 EP 1838851A1 EP 06703246 A EP06703246 A EP 06703246A EP 06703246 A EP06703246 A EP 06703246A EP 1838851 A1 EP1838851 A1 EP 1838851A1
Authority
EP
European Patent Office
Prior art keywords
transposon
dna
sequence
amino acid
restriction enzyme
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP06703246A
Other languages
German (de)
French (fr)
Other versions
EP1838851B1 (en
Inventor
Dafydd School of Biosciences JONES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University College Cardiff Consultants Ltd
Cardiff University
Original Assignee
University College Cardiff Consultants Ltd
Cardiff University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=34259403&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=EP1838851(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by University College Cardiff Consultants Ltd, Cardiff University filed Critical University College Cardiff Consultants Ltd
Publication of EP1838851A1 publication Critical patent/EP1838851A1/en
Application granted granted Critical
Publication of EP1838851B1 publication Critical patent/EP1838851B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/102Mutagenizing nucleic acids

Definitions

  • the invention relates to a method for altering the amino acid sequence of a target polypeptide, by insertion, deletion or substitution of at least one amino acid in the target polypeptide.
  • the RID method has the potential to introduce single amino acid deletions but has currently been applied only to introduce amino acid substitutions or insertions. Furthermore, the procedure is complicated and prone to the introduction of unwanted secondary mutations (Murakami, H. et al. (2002)).
  • Transposons are mobile pieces of genetic information (Reznikoff et al. (1999) Biochem. Biophys. Res. Commun. 266 729-734) capable of inserting randomly into a DNA sequence. Most transposons follow a common general mechanism for this (Mizuuchi (1992) Amu. Rev. Biochem. 61 1011-1051; Craig (1995) Science 270 253- 254).
  • the transposon has a recognition sequence at each of its termini, which consists of an inverted repeat; that is the termini have identical sequences reading in opposite direction.
  • a transposase enzyme recognises and binds to these recognition sequences to form a protein-DNA complex, which then facilitates insertion of the transposon into the target DNA by catalysing DNA cleavage and joining reactions.
  • MuA acts as the transposase.
  • a 5 bp staggered cut is made in the target DNA before insertion of the Mu transposon.
  • the consequential 5 bp gap on the opposite DNA strand is filled by the host organism if required or, in vitro, by using the appropriate enzymes. The result is the insertion of the transposon plus the repetition of 5 bp of the target DNA either side of the transposon.
  • Restriction endonucleases are a class of enzymes that cleave DNA upon recognising a specific nucleotide sequence.
  • the type II enzymes are a specific class of restriction endonucleases. Their recognition sites are palindromic, partially palindromic or interrupted palindromes. Unlike the type I and III restriction endonucleases, which cleave DNA randomly, the type II enzymes cleave the DNA at specific sites, normally within the recognition sequence.
  • the type IIS enzymes are a subtype having some features atypical of common type II enzymes. They generally recognise non- palindromic or asymmetric nucleotide sequences with at least one strand cleaved outside the recognition sequence (i.e.
  • a type IIS restriction endonuclease is Mlyi, that recognises a specific, non- palindromic DNA sequence and cuts 5 bp away from the recognition sequence to generate a blunt end (5' GAGTCNNNNN4- 3'; the recognition sequence is underlined, N signifies either G, A, T or C is allowed and the arrow shows the cleavage position).
  • Other type II enzymes are the type IEB, HE, HG and ID? subtypes which share some characteristics with the type IIS, subclass. For example, some members of these subtypes are classed as outside cutters.
  • US Patent No. 5,843,772 relates to an artificial transposon known as AT-2. Restriction enzyme recognition sites were added in order to allow the liberation of the blunt-ended transposon from a DNA vector. The restriction enzyme recognition sites are recognised by restriction enzymes which cut within the recognition sequence themselves.
  • the patent primarily relates to methods of creating artificial transposons and inserting these into DNA sequences.
  • Vilen et al. (J. Virol. (2003) 77 123-134) relates to the use of transposons to map genes in a virus genome.
  • the transposons disclosed in Vilen et al. are not suitable for use in a method to alter the amino acid sequence of a target polypeptide.
  • US Patent No. 4,830,965 relates to the introduction of restriction enzyme recognition sites to allow DNA sequences to be inserted at points within a transposon.
  • the restriction enzyme recognition sites are not located at the termini of the transposon.
  • US Patent No. 5,728,551 relates to the pentapeptide scanning mutagenesis technique mentioned above and discussed in more detail below. There is mention of a proposed method of codon insertion mutagenesis, although no data is provided to indicate that the method was carried out. It is proposed to position a Srfl restriction enzyme recognition sequence near the termini of a transposon, the Srfl restriction enzyme cutting within its recognition sequence. The insertion of such a transposon into a target DNA and subsequent excision using Srfl. would result in the target DNA having a gap as the result of the transposon excision, the termini of the gap comprising some transposon-derived nucleotides, as the result of the position of the Srfl cleavage of the DNA. Therefore, the specific codons which could be inserted using a given transposon would be limited, since the sequence of the inserted codon would be partly determined by the sequence of the terminus of the transposon.
  • Hayes et al (Applied & Environmental Microbiology (1990) 56 202-209 relates to the use of transposons to generate gene knockouts and to use restriction enzyme sites within the transposon to map the position of gene critical to plasmid replication within a cell.
  • TEM-I is a clinically important protein as it is one of the main causes of bacterial resistance to ⁇ -lactam antibiotics.
  • TEM-I has also been the focus of many protein engineering studies (Matagne, A. et al. (1998) Biochem. J. 330 (Pt 2) 581-598), including the random substitution of every amino acid to determine which amino acid residues cannot tolerate mutation (Huang, W. et al. (1996) J. MoI. Biol. 258 688-703), directed evolution (for example Camps, M. et al. (2003) Proc. Natl. Acad. Sci. U.S.A 100 9727-9732; Stemmer, W.P. (1994) Nature 370 389-391) and pentapeptide scanning mutagenesis (Hayes, F. et al. (1997) J. Biol. Chem.
  • the pentapeptide scanning mutagenesis method concerns the insertion of a transposon and its removal with a standard, rare cutting type II restriction enzyme such as Notl (5' GCslGGCCGC 3') or Pmel (5' GTTTlAAC 3').
  • Notl 5' GCslGGCCGC 3'
  • Pmel 5' GTTTlAAC 3'
  • the main shortfall of this method is that it is limited in the sequence change which can be introduced.
  • the 5 bp duplicated region of the target DNA, together with the segment of the transposon containing the restriction site are always incorporated into the final, modified target DNA. Therefore, this results in the insertion of a defined set of amino acids, usually greater than 5 amino acids in length. Amino acid substitutions or deletions are not sampled, neither are less drastic insertions, such as a single amino acid.
  • transposon is inserted into a target DNA sequence, the transposon being excised using a non-Type IIS restriction enzyme, leaving the target DNA with a gap created by excision of the transposon.
  • Each terminus of the gap comprises some transposon-derived nucleotides and the duplicated nucleotides arising from transposon insertion.
  • the transposon used in this method is commercially available and has not been modified for use in the procedure.
  • the method requires several steps, involving the sequential insertion and deletion of further, non-transposable DNA sequences, with multiple restriction endonuclease digestion steps to eventually remove the transposon-derived nucleotides from the target DNA sequence. This lengthy process eventually allows insertion, deletion or substitution of a single codon within the target DNA sequence.
  • Natural allosteric proteins have spatially distinct regulation and active sites (Monod et al. (1963); Changeux & Edelstein (2005)). Binding of an effector molecule at the regulation site causes conformational changes that can rapidly and reversibly modulate protein activity directly. Ideally, any artificial allosteric protein will mimic this mechanism. Rather than re-engineer natural switches, a simpler and more effective strategy is to couple the functions of normally disparate proteins through linked conformational changes (Buskirk & Liu (2005) Chem. Biol. 338 633-641; Hahn & Muir (2005) Trends Biochem. Sci. 30 26-34; Ostermeier (2005) Prot. Eng. Des. SeI. 18 359-364).
  • Proteins are recruited that have the desired regulatory (e.g. small molecule-dependent conformational changes) and reporter (e.g. enzymatic activity) function.
  • the two proteins need to be linked in such a manner that the conformational events occurring in the regulation domain on binding the small molecule can be transmitted to the reporter domain to modulate the output signal.
  • One approach to link such conformational events is to use a strategy called domain insertion, in which one protein domain is inserted within another (Doi & Yanagawa (1999) FEBS Lett. 457 1-4; Ostermeier (2005) Protein Eng. Des. SeI. 18 359-364).
  • domain insertion in which one protein domain is inserted within another
  • the problem with using DNaseI is that it is notoriously difficult to generate single cuts in DNA and digestion with this non-specific endonuclease regularly produces tandem duplications and nested deletions of varying sizes. This will lead to frameshifts, large insertions and large deletions in the protein, so reducing the quality of the library and increasing the number of variants that need to be sampled.
  • the method of the current invention will not introduce such large deletions or insertions at the protein level, allowing the researcher to dictate the size of any linking sequence with the inserted domain.
  • There are only three possible reading frames for the inserted gene (depending on the transposon insertion point with respect to one codon), increasing the likelihood of a correct reading frame from 1 in 6, when using DNasel, to 1 in 3 when using the method of the invention.
  • the current invention relates to a new method that introduces triplet nucleotide deletions or nucleotide insertions at random positions throughout a target gene.
  • the technology can be altered to allow amino acid substitutions that cover the whole range of amino acid sequences at a particular position.
  • the technology can be adapted further to allow for the insertion of longer stretches of DNA that can encode epitopes, protein fragments or even whole protein domains.
  • the technology has been tested by determining the effects of amino acid indels on the TEM-I ⁇ -lactamase, encoded for by the bla gene.
  • the new technology outlined in this application will therefore complement existing knowledge by further exploring the sequence space open to TEM-I and the effect of such mutations on TEM-I structure and function. Furthermore, it will validate the technologies outlined in the application by providing a suitable example of the use of the technologies.
  • a method for altering the amino acid sequence of a target polypeptide by altering a target DNA sequence which encodes that polypeptide comprising the step of introducing a transposon into the target DNA sequence, in which the transposon comprises a first restriction enzyme recognition sequence towards each of its termini, the recognition sequence not being present in the remainder of the transposon, or in the target DNA sequence, or in a construct (for example, a plasmid or vector) comprising the target DNA sequence, the first restriction enzyme recognition sequence being recognised by a first restriction enzyme which is an outside cutter and being positioned such that the first restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon.
  • outside cutter is a term known in the art which indicates a restriction enzyme which cleaves DNA outside the restriction enzyme recognition sequence. Although the majority of restriction enzymes which are outside cutters belong to the type IIS subtype, members of the IEB, IIE, HG and IIP subtypes can also be classed as outside cutters.
  • the invention provides a simple tool for the investigation of the impact of insertions, deletions and substitutions of one or more amino acids at points throughout a polypeptide of interest.
  • the requirement for the first restriction enzyme recognition sequence to be recognised by an enzyme which is an outside cutter advantageously allows the insertion, deletion or substitution of a single amino acid in a target polypeptide by use of the method according to the invention.
  • the use of an enzyme which is an outside cutter, along with the positioning of the recognition sequence such that the cleavage site is beyond the end of the terminus of the transposon allows excision of the whole transposon DNA sequence from the target DNA sequence after insertion, including nucleotides located at the termini of the transposon, without the need for additional steps to allow removal of such nucleotides. Therefore, the method of the invention is simpler, quicker and hence more economical than known methods.
  • the method may exploit the properties of the mini-Mu transposon, a DNA element that can be accurately and efficiently inserted into a target DNA sequence in vitro using the MuA transposase (Haapa, S. et al. (1999) Nucleic Acids Res. 27. 2777- 2784).
  • the reaction has a very low target site preference allowing transposon insertion to occur essentially at any point in a given gene.
  • Other transposons may also be used as the basis for this technology, for example the AT-2 artificial transposon (Devine, S. E. & Boeke, J.D. (1994) Nucleic Acids Res. 22 3765-3772) or the Tn5 transposon (Goryshin & Reznikoff (1998) J. Biol.
  • the amino acid sequence may be altered by the deletion, insertion or substitution of at least one amino acid.
  • a single amino acid is deleted, inserted or substituted.
  • the method according to the first aspect of the invention preferably comprises the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intramolecular ligation reaction of the DNA from (c); and e) expression of protein from the DNA from (d).
  • a host organism may be transformed with the DNA from (d), the protein then being expressed in the host organism.
  • the protein may be expressed from the DNA from (d) using an artificial expression system, such as the Rapid Translation System available from Roche Diagnostics Ltd (Lewes, United Kingdom). The skilled person will be aware of the options available for the expression of protein
  • the method according to the first aspect of the invention preferably comprises the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intermolecular ligation of DNA from (c) with a second DNA sequence comprising at least two second restriction enzyme recognition sites located such that at least one of the cleavage sites is not at a terminus of the second DNA sequence; e) conducting the transformation of a host organism with DNA from (d) and selecting cells containing the second DNA sequence; f) isolating DNA from cells selected in (e) and digestion of that DNA with a second restriction enzyme which recognises the second restriction enzyme recognition site, the second restriction enzyme being an outside cutter;
  • a host organism may be transformed with the DNA from (g), the protein then being expressed in the host organism.
  • the protein may be expressed from the DNA from (g) using an artificial expression system, such as the Rapid Translation System available from Roche Diagnostics Ltd.
  • step (f) above is followed by an additional separation step (fl), such that DNA which does not comprise the second DNA sequence is separated from DNA which does comprise the second DNA sequence.
  • the DNA not comprising the second DNA sequence is then used in step (g).
  • the phrase "cleavage site is not at a terminus of the second DNA sequence" indicates that the second restriction enzyme recognition site is located such that the cleavage site is one or more nucleotides from a terminus of the second DNA sequence, i.e. the cleavage site is within the second DNA sequence.
  • the phrase "cleavage site is not at a terminus of the second DNA sequence” indicates that the second restriction enzyme recognition site is located such that the cleavage site is one or more nucleotides from a terminus of the second DNA sequence, i.e. the cleavage site is within the second DNA sequence.
  • the skilled person will readily appreciate the location of the second restriction enzyme recognition site which is required in order to gain a desired result of one or more amino acids being substituted.
  • the second restriction enzyme may be the same as the first restriction enzyme.
  • the second DNA sequence comprises a gene which gives a host cell containing the second DNA sequence a selectable characteristic compared to a cell not containing the second DNA sequence.
  • selectable characteristic may indicate, for example (where the cell is a bacterium), the ability to grow on an antibiotic-containing medium.
  • the method according to the first aspect of the invention preferably comprises the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intermolecular ligation of DNA from (c) with a third DNA sequence encoding for a further amino acid sequence; and e) expression of protein from the DNA from (d).
  • a host organism may be transformed with the DNA from (d), the protein then being expressed in the host organism.
  • the protein may be expressed from the DNA from (d) using an artificial expression system, such as the Rapid Translation System available from Roche Diagnostics Ltd.
  • the further amino acid sequence may be a full protein, a protein domain or a protein fragment.
  • the protein fragment may be (but is not limited to) an epitope, a binding domain, an allosteric site, a defined functional region such as a metal binding site, or an oligomerisation interface.
  • the third DNA sequence comprises a gene which gives a host cell containing the third DNA sequence a selectable characteristic compared to a cell not containing the third DNA sequence.
  • the third DNA sequence may have an open reading frame which is the same as that of the target DNA, so that when the DNA is translated into a protein, a single chimeric protein is created.
  • the third DNA sequence may contain a stop codon and/or an initiation codon.
  • the first restriction enzyme is a Type IIS enzyme and, most preferably, is MIyI.
  • the transposon has a low target site preference.
  • the transposon may be derived from one of: mini-Mu, AT-2 or Tn5.
  • the transposon preferably comprises a gene which gives a host cell containing the transposon a selectable characteristic compared to a cell not containing the transposon.
  • the transposon comprises the DNA sequence 5'-NGACTC-3' (SEQ ID NO:1) as the 5' terminal and 5'-GAGTCN-3' (SEQ ID NO:2) as the 3' terminal (preferably 5'-TGACTCGGCGCA- 3' (SEQ ID NO:3) as the 5' terminal and 5'-TGCGCCGAGTCA-3' (SEQ ID NO:4) as the 3' terminal), or alternatively comprises the DNA sequence 5'-NNNNGACTC-3' (SEQ ID NO:5) as the 5' terminal and 5'-GAGTCNNNN-3' (SEQ ID NO:6) as the 3' terminal (preferably 5'-TGAAGACTCGCA-S' (SEQ ID NO:7) as the 5' terminal and 5'-TGCGAGTCTTCA-S' (SEQ ID NO:8) as the 3' terminal), where N is any nucleotide.
  • the transposon comprises the DNA sequence 5'- TGTTGACTC-3' (SEQ ID NO:9) as the 5' terminal and 5'-GAGTCAACA-S' (SEQ ID NO: 10) as the 3' terminal, or in yet another alternative comprises the DNA sequence 5'-CTGACTC-3' (SEQ ID NO:11) as the 5' terminal and 5'-AAGAGTCAG- 3' (SEQ ID NO: 12) as the 3' terminal.
  • the target DNA may be carried in a construct such as a plasmid, preferably pNOM or a derivative thereof.
  • a transposon comprising a restriction enzyme recognition sequence towards each of its termini, the recognition sequence being recognised by a restriction enzyme which is an outside cutter, the recognition sequence not being present in the remainder of the transposon and being positioned such that the restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon.
  • each restriction enzyme recognition sequence is positioned one or more nucleotides from a terminus of the transposon, more preferably between 1 and 20 nucleotides from a terminus of the transposon, yet more preferably between 1 and 10 nucleotides from a terminus of the transposon and most preferably 1, 2, 3, 4 or 5 nucleotides from a terminus of the transposon.
  • this allows the transposon to be used as a tool in a method according to a first aspect of the invention, allowing the investigation of the impact of insertions, deletions and substitutions of one or more amino acids at points throughout a polypeptide of interest.
  • transposon it is possible to engineer a transposon to be suitable for use in a method according to the first aspect of the invention, by altering the termini of the transposon without disrupting the ability of a transposase enzyme to recognise the transposon.
  • mutations which change the termini of mini-Mu can have an adverse effect on the ability of MuA transposase to recognise the transposon (Goldhaber-Gordon et al. (2002) J. Biol. Chem. 277 7703-7712; Goldhaber-Gordon et al. (2003) Biochemistry 42 14633-14642).
  • the transposons used in the method of the invention surprisingly maintain a transposition efficiency similar to that of standard, unaltered mini-Mu.
  • the restriction enzyme is a Type IIS enzyme and, most preferably, is MIyI.
  • the transposon may comprise the DNA sequence 5'-NGACTC-3' as the 5' terminal and 5'-GAGTCN-3' as the 3' terminal (preferably 5'- TGACTCGGCGCA-3' as the 5' terminal and S'-TGCGCCGAGTCA-S' as the 3' terminal).
  • the transposon may comprise the DNA sequence 5'- NNNNGACTC-3' as the 5' terminal and 5'-GAGTCNNNN-3' as the 3' terminal (preferably 5'-TGAAGACTCGCA-S' as the 5' terminal and 5'-TGCGAGTCTTCA-S' as the 3' terminal).
  • the transposon may comprise the DNA sequence 5'-TGTTGACTC-S' as the 5' terminal and 5'-GAGTCAACA-S' as the 3' terminal.
  • the transposon may comprise the DNA sequence 5'- CTGACTC-3' as the 5' terminal and 5'-GAGTCAG-3' as the 3' terminal.
  • the mini-Mu transposon may be modified close to both its termini to incorporate the recognition sequences for the type IIS restriction enzyme MIyI.
  • the mini-Mu transposon includes the Cam R gene which allows E. coli cells containing the transposon to grow in the presence of chloramphenicol.
  • recognition sequences for restriction enzymes other than MIyI may be introduced into the transposon, providing that the appropriate routine modifications are made to the methods described herein and extra steps added if required. Such modifications are routine to the skilled person.
  • a plasmid having the DNA sequence shown in Figure 1 or a derivative of a plasmid having the DNA sequence shown in Figure 1.
  • the term "a derivative of a plasmid having the DNA sequence shown in Figure 1" means a plasmid which has been adapted from the plasmid shown in Figure 1, for example by silent mutations in the DNA sequence, substitution of the bla gene with an alternative selectable marker, or by alteration of non-essential elements of the DNA sequence, such as sequences which do not form one of the essential elements of the plasmid such as the ori regions, the Multiple Cloning Site, or the bla gene.
  • the term also includes the DNA sequence shown in Figure 1 with an additional DNA sequence of interest inserted at a point in the DNA sequence of Figure 1, preferably (but optionally) at the Multiple Cloning Site.
  • the DNA sequence of a derivative of a plasmid having the DNA sequence shown in Figure 1 does not comprise the recognition sequence for the first restriction enzyme to be used in the method according to the first aspect of the invention, the derivative being intended for use in that method.
  • the term "a derivative of a plasmid having the DNA sequence shown in Figure 1" is not intended to encompass the pUC18 plasmid.
  • a kit comprising a transposon according to a second aspect of the invention.
  • the kit further comprises a plasmid according to the third aspect of the invention.
  • the kit may yet further comprise a suitable transposase and/or buffers required for the enzymatic reactions and/or oligonucleotides suitable for use in screening and/or DNA sequencing procedures.
  • the kit is for use in the method according to the first aspect of the invention.
  • a method of determining whether the introduction of a mutation into a target polypeptide alters a detectable activity of that polypeptide comprising the method according to the first aspect of the invention and the further steps of: a) screening for a difference in the activity of the altered target polypeptide compared to the unaltered target polypeptide; and b) sequencing the altered target polypeptide to determine the location of the amino acid insertion, deletion or substitution.
  • Examples of a detectable activity include, where the protein is an enzyme, substrate binding activity; where the protein is an antibody, antigen binding activity; where the protein is a receptor, ligand binding activity.
  • a detectable activity include, where the protein is an enzyme, substrate binding activity; where the protein is an antibody, antigen binding activity; where the protein is a receptor, ligand binding activity.
  • Figure 1 shows the DNA sequence of pNOM (SEQ ID NO:100);
  • Figure 2 shows an outline of the triplet nucleotide deletion-insertion mutagenesis method
  • Figure 3A shows the sequences of the engineered MuDeI and Mulns transposon termini
  • Figure 3B shows the mechanism for the introduction of a three nucleotide base pair deletion
  • Figure 3C shows the mechanism for the introduction of a three nucleotide base pair insertion
  • Figure 4 shows an analysis of library BLA DEL with Mlyl to determine the randomness of transposon insertion:
  • A shows an illustration of the restriction analysis procedure;
  • B shows the restriction analysis of 15 of the 22 BLA DEL library members (the band labelled with an asterisk corresponds to the transposon); and
  • C shows the position of the transposon insertion points in the 22 members of the BLA DEL library as determined by DNA sequencing;
  • Figure 5 shows the determination of ampicillin MIC values for each selected member of library BLA DEL ;
  • Figure 6 shows the outline of the triplet nucleotide substitution mutagenesis method
  • Figure 7 A shows the basic features of the SubSeq DNA element for substitution mutagenesis and Figure 7B shows the mechanism for the introduction of a three nucleotide base pair substitution;
  • Figure 8 shows the outline of the creation of a library of variants containing insertions of whole proteins, protein domains or fragments (such as epitopes) of protein domains;
  • Figure 9 A shows the features of the AT-2 based transposon suitable as an alternative to Mums and Figure 9B shows the mechanism by which the modified AT-2 transposon can be used to create a library of target genes with triplet nucleotide insertions;
  • Figure 1OA shows the features of the Tn5InsOE and Tn5InsME transposons suitable as an alternative to Mulns and Figure 1OB shows the mechanism by which the Tn5InsOE and Tn5InsME transposons can be used to create a library of target gene with triplet nucleotide insertions.
  • Bacterial strains Escherichia coli DH5 ⁇ (supE44, ⁇ / ⁇ cL/169, ( ⁇ 80 / ⁇ cZ ⁇ M15), hsdRXl, recAl, endAl, gyrA96, thi-l, relAl).
  • Plasmids pUC18, pEntranceposon (Cam ⁇ ) (Finnzymes, Esboo, Finland) and pNOM.
  • Transposons The transposons used for insertion-deletion mutagenesis are based on mini-Mu (Cam R -3).
  • Antibiotics Ampicillin and chloramphenicol (both Melford Laboratories, Ipswich, UK).
  • DNA-related enzymes Taq DNA polymerase (Promega Corp., Madison, WI, USA), Extensor Hi-Fidelity PCR enzyme (Abgene, Epsom, UK), MyI, Xh ⁇ l, BgIR and Ndel restriction endonucleases (NE Biolabs, Beverly, MA, USA), T4 DNA ligase (Abgene), MuA transposase (Finnzymes), EZ-Tn5TM transposase (Epicentre, Madison, WI, USA).
  • DNA purification kits The isolation of plasmid DNA from cell cultures was performed using the Wizard ® Plus SV kit from Promega Corp. DNA was isolated from agarose gel or PCR reactions using the QiaquickTM Gel extraction or PCR purification kits, respectively, supplied by Qiagen Ltd, Crawley, UK.
  • Step 1 The MuDeI transposon is inserted into the target plasmid or target gene.
  • Step 2 Cells containing a plasmid-integrated MuDeI contain the Cam ⁇ gene and so can grow in the presence of chloramphenicol.
  • the plasmids are isolated and pooled, and the transposon is removed by MIyI digestion.
  • Step 3 Intramolecular ligation results in the reformation of the target gene, minus nucleotide base pairs.
  • Step 4 The resulting library is subjected to a selection or screen to select those variants with the required properties.
  • hatched blocks represent the transposon, solid blocks the bla gene, gaps the deletion point (for the purposes of this Example), grey blocks the deletion point (for the purposes of this Example) in the re-ligated target gene and the thick dashed lines the rest of the plasmid backbone.
  • the procedure can also be applied to a target gene other than the bla gene, provided that:
  • restriction endonuclease MIyI is critical to triplet nucleotide deletion but other restriction endonucleases with properties similar to that of MIyI can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
  • the target DNA or plasmid containing the target DNA must not contain any MIyI restriction sites.
  • the recognition sequence of MIyI is only 5 bp in length, so many plasmids have at least one if not more MIyI restriction sites.
  • pUC18 has four MIyI restriction sites, including one in the bla gene, one in the pMBl origin of replication (ori) and another in the multiple cloning site (MCS). Construction ofpNOM
  • MCS this new vector being called pNOM.
  • the majority of the plasmid was donated by pUC18, including the ori regions and bla gene.
  • the Mlyl sites present in the bla gene were removed by the introduction of a silent mutation so as not to disrupt the primary structure of the TEM-I ⁇ -lactamase. Removal of the MZyI site from the ori region was achieved by creating a library in which two of the nucleotides that form the Mlyl recognition sequences were randomised, as it was unknown how rational mutations may affect plasmid replication.
  • the MCS site was constructed to contain useful cloning sites.
  • PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and its supplied buffers (Abgene).
  • the pNOM plasmid was constructed from pUC18 and an artificial MCS.
  • the -1 to 1979 bp region of ⁇ UC18 was amplified by PCR in several stages, so as to remove any Mlyl restriction sites from the DNA sequences.
  • the PCR reaction mixture was composed of 1 ⁇ l of 0.1 ng/ ⁇ l of pUC18 as the template, 3 ⁇ l of 10 ⁇ M of suitable primer (see below for primer combinations), 3 ⁇ l of 2OmM dNTP mixture (composed of 5mM dATP, 5mM dTTP, 5mM dGTP and 5mM dCTP), 5 ⁇ l of the 10x Extensor buffer 1, 0.5 ⁇ l of 5 Units/ ⁇ l Extensor Hi-Fidelity PCR enzyme mix and made up to 50 ⁇ l with sterile molecular biology quality water. In each case, PCR was performed as shown below:
  • Step l 94°C for 2 min
  • Step 2 94°C for l0s
  • Step 3 55 0 C for 30s
  • Step 4 68°C for 90s
  • Step 5 68 0 C for 7 min
  • Fragment Fl consisted of -1 to 989 bp of ⁇ UC18 and was produced by PCR using single stranded DNA in the form of chemically synthesised oligonucleotides (referred to as 'primers') DDJdiOO ⁇ (5' GAAACtCGaGAGACGAAAGGGCCTCGTGATACG 3'; SEQ ID NO: 13) and DDM004 (5' CATCCATAGTTGCCTGACTgCCCGT CGTGTAGATAAC 3'; SEQ ID NO: 14), with lower case letters signifying nucleotides undergoing mutagenesis; DDJdiOO ⁇ introduced an Xh ⁇ l site and DDM004 removed the Mlyl site from the bla gene.
  • DDJdiOO ⁇ introduced an Xh ⁇ l site
  • DDM004 removed the Mlyl site from the bla gene.
  • Fragment F2 consisted of 972 to 1507 bp of ⁇ UC18 and was produced by PCR using primers DDJdi003 (5' GTTATCTACACGACGGGcAGTCAGGC AACT ATGGATG 3'; SEQ ID NO: 15) and DDJdiOO8 (5' CCAACCCGGTAAGACAC 3'; SEQ ID NO: 16).
  • DDJdi003 is complementary to DDJdi004 and the lower case letter signifies nucleotides undergoing mutagenesis.
  • Fragment F3 consisted of 1490 to 1979 bp of pUC18 and was produced by PCR using primers DDM007 (5' GTGTCTTACCGGGTTGGNNTCAAGACGATAGTT ACCGGA 3'; SEQ ID NO: 17) and DDM009 (5' cttcctcgctcatatgCTCGCTGC GCTCGGTCGTTCGGCTGC 3'; SEQ ID NO: 18).
  • DDM007 contained two randomised nucleotides (i.e. any nucleotide at each position indicated as "N") corresponding to the MIyI site in the pMBl Ori origin of replication region of pUC18.
  • DDM009 contained a Ndel recognition site towards its 5' end.
  • Fragments Fl, F2, and F3 were isolated and purified after agarose gel electrophoresis. Each of the fragments was spliced together in a single PCR reaction using DDJdiOO ⁇ and DDJdi009 as the terminal primers to create fragment F4. The extension temperature at 68 0 C was increased to 120 s in this PCR reaction. The 2005 bp product was isolated and purified after agarose gel electrophoresis.
  • the fragment F4 was digested with Ndel and Xl ⁇ ol endonuclease under the recommended conditions (50 mM NaCl, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl 2 , 1 mM dithiothreitol (DTT) in the presence of 0.1 mg/ml bovine serum albumin (BSA)) and the DNA was purified from the restriction digestion mixture using the Qiagen QiaquickTM PCR Purification kit.
  • BSA bovine serum albumin
  • Fragment F5 contained the new multiple cloning site (MCS) and is based on the MCS of pET22b. It was produced by PCR using primers pET-F (5' ATGCGTCCGGCGTAGAGGA 3'; SEQ ID NO: 19) and pET-R (5' GCTAG TTATTGCTCAGCGGTG 3'; SEQ ID NO:20) and pET24b as the template, using standard PCR conditions except that the extension time at 68°C was 60 s. The resulting 351 bp product was purified and was digested with Ndel an ⁇ Xhol followed by isolation and purification after gel electrophoresis.
  • MCS multiple cloning site
  • the NdeUXhoI digested F4 and F5 fragments were ligated together at 25°C using 1 ⁇ l of 3 U/ ⁇ l T4 DNA ligase (Promega Corp.) under the conditions recommended by the manufacturer (30 niM Tris-HCL (pH7.8), 10 mM MgCl 2 , 10 mM DTT and 1 mM ATP) and V 10 of the ligation mixture was used to transform 50 ⁇ l of E. coli DH5 ⁇ by electroporation using a Biorad Gene PulserTM (Bio-Rad Laboratories, Hemel Hempstead, UK).
  • T4 DNA ligase Promega Corp.
  • V 10 of the ligation mixture was used to transform 50 ⁇ l of E. coli DH5 ⁇ by electroporation using a Biorad Gene PulserTM (Bio-Rad Laboratories, Hemel Hempstead, UK).
  • the original Mu phage-derived transposon, mini-Mu (Cam R -3), was engineered for use in the creation of random triplet nucleotide deletions.
  • the Cam R gene is used as a selectable marker within the transposon. This can be exchanged for another gene that will provide a chosen strain of E. coli or any other suitable organism with a selection advantage under a particular condition so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence.
  • the ability to delete nucleotide triplets depends on the transposon insertion mechanism and the position of two introduced restriction sites, as outlined in Figure 3.
  • the mini- Mu transposon was engineered so as to act as a vehicle for the insertion of specific restriction sites into the target gene (Figure 3A).
  • the restriction endonuclease chosen was MIyI, a type IIS enzyme that cuts 5 bp outside its recognition sequence to generate a blunt end (cleavage profile 5' GAGTC(Ns)4- 3').
  • the MIyI recognition site is to be placed 1 bp away from the site of transposon insertion, so creating MuDeI ( Figure 3A).
  • the two required point mutations both lie outside the Rl region that is involved in MuA binding, so minimising disruption to the protein-DNA interactions that can potentially affect the efficiency of the transposition reaction.
  • Transposition of MuDeI will occur via a 5 bp staggered cut in the target DNA that, following E. coli gap repair, results in the duplication of these 5 bp ( Figure 3B).
  • Digestion of the DNA with MIyI removes the transposon along with four additional nucleotide base pairs from the target gene at both termini.
  • Intramolecular ligation of the two blunt ends results in the in- frame deletion of 3 nucleotides from the target gene ( Figure 3B).
  • PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and performed as described above.
  • the MuDeI transposon was constructed by PCR using the oligonucleotide DDJdi005 (5' GCTTAGATCTGActCGGCGCACGAAAAACGCGAAAG 3' (SEQ ID NO:21); lower case letters signify nucleotides undergoing mutagenesis) as both the forward and reverse primer with 0.1 ng of the original mini-Mu (Cam ⁇ -3) transposon acting as template.
  • the 1322 bp product was purified and digested with BgHI at 37°C (reaction conditions: 100 mM NaCl, 50 mM Tris HCl (pH 7.9), 10 mM MgCl 2 , 1 mM DTT).
  • the digested transposon was isolated and purified after agarose gel electrophoresis.
  • the DNA representing the new transposon MuDeI was recloned by ligation into BgHI digested pEntranceposon (Cam R ) using T4 DNA ligase, and Vi o of the ligation mixture was used to transform 50 ⁇ l of E. coli DH5 ⁇ by electroporation using a Biorad Gene PulserTM.
  • E. coli DH5 ⁇ cells 500 ⁇ l of SOC medium was added to the cells immediately after electroporation and the cells were incubated at 37 0 C for 1 hr. Approximately 50 and 500 ⁇ l of the recovering electroporated E. coli DH5 ⁇ cells were spread on LB agar plates containing 20 ⁇ g/ml chloramphenicol and incubated at 37°C overnight. Six individual E. coli DH5 ⁇ colonies capable of growth in the presence of 20 ⁇ g/ml chloramphenicol were replica plated on another LB agar plate containing 20 ⁇ g/ml chloramphenicol.
  • the PCR mixture contained 5 ⁇ l of 1Ox reaction buffer (100 rnM Tris-HCl (pH 9.0), 500 mM KCL, 1% Triton X-100), 3 ⁇ l 25 mM MgCl 2 , 3 ⁇ l 20 mM dNTPs, 1.5 ⁇ l 10 ⁇ M oligonucleotide primer, an appropriate E. coli colony and 0.5 ⁇ l of 5 U/ ⁇ l Taq DNA polymerase.
  • the reaction mixtures were made up to 50 ⁇ l with molecular biology quality water.
  • the reaction mixtures were subjected to the following thermocycling conditions:
  • Step 1 94°C for 3 min followed by addition of 0.5 ⁇ l Taq DNA polymerase
  • Step 2 94°C for 20s
  • Step 3 55 0 C for 20s
  • Step 4 72°C for 90s
  • Steps 2 to 4 repeated an additional 29 times Step 5: 72 0 C for 5 min.
  • the 1504 bp product was purified and digested with Mlyl at 37°C (reaction conditions: 50 mM potassium acetate, 2OmM Tris-acetate, 1OmM magnesium acetate, ImM DTT (pH 7.9), supplemented with 100 ⁇ g/ml BSA) and analysed by agarose gel electrophoresis to confirm the presence of the Mlyl recognition sequence.
  • the colonies containing the MuDeI transposon were transferred to 5 ml of LB broth containing 100 ⁇ g/ml ampicillin and the cultures incubated at 37°C overnight in a rotary shaker and the plasmid DNA was purified.
  • the plasmid DNA was sequenced using primers pUC-F and pUC-R to confirm the sequence of MuDeI.
  • the MuDeI transposon was released from the context of the plasmid by digestion with Bg ⁇ ll under the conditions stated above and purified after agarose gel electrophoresis. Transposition reaction and transformation into E. coli cells
  • reaction mixture was composed of 2 ⁇ l of reaction buffer (125 mM Tris-HCl, pH 8.0, 125 mM MgCl 2 , 50 mM NaCl, 0.25% Triton X-100 and 50% (v/v) glycerol), 1 ⁇ l of 0.22 ⁇ g/ml MuA transposase and varying quantities of target DNA and transposon as quoted below.
  • reaction buffer 125 mM Tris-HCl, pH 8.0, 125 mM MgCl 2 , 50 mM NaCl, 0.25% Triton X-100 and 50% (v/v) glycerol
  • the efficiency of the transposition reaction using MuDeI was tested using the control DNA template supplied by Finnzyrnes (pUC19 containing a 6.6 kbp HmdIII fragment of bacteriophage ⁇ DNA cloned into the HmdIII site) and pUC18.
  • the pNOM plasmid was used in the construction of libraries. Either 360 ng (control DNA) or 100 ng (pUC18 or pNOM) of target plasmid DNA and either mini-Mu (Cam R -3) (20 ng) or MuDeI (20 ng or 100 ng) were present in the reaction mixture. The reactions were left at 30°C for 3 hr followed by heat inactivation at 75 0 C for 10 min.
  • Either 1 ⁇ l or 2 ⁇ l were used to transform E. coli D ⁇ 5 ⁇ cells by electroporation and the cells were plated on LB agar containing 20 ⁇ g/ml chloramphenicol to select for cells containing the Cam R gene and hence the mini-Mu or MuDeI transposon.
  • pUC18 was used as the target DNA substrate.
  • the transposition reaction with mini-Mu transposon (20 ng) resulted in the growth of approximately 99 E. coli DH5 ⁇ colonies on 20 ⁇ g/ml chloramphenicol plates after transformation by electroporation with Vi o (2 ⁇ l) the transposition reaction mixture. Replacing the mini-Mu transposon with either 20 ng or
  • MuDeI still acts as an efficient substrate for the transposition reaction, despite the introduction of mutations at the termini of the transposon.
  • the general outline of the method for the creation of triplet nucleotide deletions at random positions within a target gene is shown in Figure 2.
  • the bla gene that encodes TEM-I ⁇ -lactamase was chosen as the target as it is a clinically important enzyme responsible for resistance to some ⁇ -lactam antibiotics and mutagenesis of the enzyme can lead to resistance to new ES ⁇ -lactams. It also provides an easy selection method, as active variants will confer resistance to ampicillin on E. coli so permitting cell growth.
  • the new vector, pNOM was used as the source of the bla gene and therefore acts as the target DNA for MuDeI insertion
  • the gene of interest independent of pNOM can be used as the target for transposon insertion.
  • the gene of interest can be cloned into pNOM or another suitable vector using standard techniques after transposon insertion.
  • the gaps present in the DNA strands formed as a result of the transposition reaction that are normally repaired in the organism can be repaired in vitro using the appropriate gap repair and ligation techniques.
  • MuDeI The place of insertion of MuDeI into pNOM should be distributed evenly throughout the plasmid and so a strategy is required that will select for cells containing MuDeI inserted into the bla gene region.
  • the transposition of the MuDeI transposon into the plasmid DNA confers resistance to chloramphenicol on E. coli, allowing for selection of cells containing MuDel-inserted pNOM. Those colonies that have MuDeI inserted within the bla gene region will disrupt T ⁇ M-1 expression and thus affect the cells' ability to grow in the presence of ampicillin.
  • E. coli DH5 ⁇ After transformation of E. coli DH5 ⁇ with the transposition mixture, 48 colonies were selected that grew on 20 ⁇ g/ml chloramphenicol and replated on both a 100 ⁇ g/ml ampicillin and a 20 ⁇ g/ml chloramphenicol LB agar plates. Of the 48 colonies, 22 grew only on the chloramphenicol plate and were deemed to have a disrupted bla gene due to transposon insertion in this region and therefore chosen as the members of the BLA D ⁇ L library.
  • PCR was performed on each of the 22 colonies using Taq DNA polymerase (method described above) and primers DDJdiOlO (5' TCCGCTCATGAGACAATAACCCTG 3'; SEQ ID NO:24) and DDJdiOll (5' CTACGGGGTCTGACGCTCAGTG 3'; SEQ ID NO.25) that flank the bla gene. Restriction analysis and selection of clones including inserted transposon The PCR products were purified and restriction analysis was performed with Mlyl (reaction conditions described previously) to confirm the diversity of transposon insertion positions ( Figure 4).
  • Mass analysis of the two smaller fragments from each lane confirmed that the cumulative size of the two fragments was approximately equal to that of the PCR product minus MuDeI.
  • the 22 PCR products were sequenced using DDJdiOlO and DDJdiOll as the primers to determine the position of the transposon within the bla gene. Sequence analysis confirmed the restriction analysis that the transposon insertion occurred at random positions within the bla gene, indicated by vertical lines in Figure 4C.
  • the MuDel-inserted pNOM plasmids were isolated from each of the 22 colonies and equal amounts of each plasmid were pooled and subjected to restriction digestion with Mlyl followed by agarose gel electrophoresis. The band corresponding to the linear pNOM minus MuDeI was isolated and purified after agarose gel electrophoresis. Intramolecular ligation was performed using T4 DNA ligase and approximately 10 ng of linear pNOM (reaction conditions described above). The reaction was left at 25 0 C for 10 min followed by 10 hr at 16°C. E. coli D ⁇ 5 ⁇ cells were transformed by electroporation with 1 ⁇ l of the ligation mixture.
  • the TEM-I ⁇ -lactamase activity of each colony was measured in vivo by determining the minimum inhibitory concentration (MIC) of ampicillin that prevents E. coli growth.
  • MIC minimum inhibitory concentration
  • Each colony in the 96 well plates was replica plated on LB agar in Nunc OmnitrayTM plates containing 50, 100, 500, 2500, 5000, 7500 or 10000 ⁇ g/ml Amp using a 96 prong replication fork and incubated at 37 0 C for 16 hr.
  • each original colony for ampicillin is shown in Figure 5, showing the determination of ampicillin MIC values for each selected member of library BLA DEL 5 with the 96 well microplate format used to label rows (A-H) and columns (1-12).
  • the values in the boxes represent ampicillin MIC values of 500, 2500, 5000 and 10,000 ⁇ g/ml or >10,000 ⁇ g/ml. Boxes marked with an X following the number indicates variants with bla gene sequence information. All the cells grew at both 50 and 100 ⁇ g/ml ampicillin. Fourteen had a MIC of 500 ⁇ g/ml indicating reduced TEM-I activity. Only six had a MIC of 2500 ⁇ g/ml and 30 had a MIC of 5000 ⁇ g/ml.
  • the P62 ⁇ -E63Q, R83 ⁇ and E177 ⁇ -R176D containing variants all had a MIC of 500 ⁇ g/ml.
  • the T114 ⁇ and T114 ⁇ -D115N variants spanned both the 2500 ⁇ g/ml and 5000 ⁇ g/ml values with multiple clones identified at each concentration.
  • the R275 ⁇ variant has a relatively high MIC for amp (5000 ⁇ g/ml) even though the deletion takes place within a helix.
  • Both A217 ⁇ and G196 ⁇ have very little effect on in vivo activity, with the Gl 96A still able confer resistance on E.
  • Example 2 This example illustrates how to create a library of variants containing triplet nucleotide insertions at random positions in the target gene of interest using the transposon-based technology as outlined in Example 1.
  • This example uses a modified mini-Mu transposon and the newly constructed pNOM plasmid or a suitable derivative of the pNQM plasmid.
  • the restriction endonuclease MIyI is critical to triplet nucleotide insertion but other restriction endonucleases with properties similar to that of Mlyl can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
  • the engineered transposon known as Mums, contains the Mlyi restriction site but its position was shifted to 4 nucleotide base pairs away from the site of transposon insertion (Figure 3A).
  • the mechanism for triplet nucleotide insertion follows a similar path to that in Example 1 and is outlined in Figure 3C.
  • Transposon insertion results in a five bp duplication after gap repair in E. coli (the 4 bp overhang from the transposon is removed).
  • the cleavage site of Mlyl is 5 bp away from the recognition sequence resulting in the removal of 1 bp of the target gene at both ends. Ligation of the two termini rejoins the gene but with the addition of 3 nucleotide base pairs.
  • the three nucleotide base pairs inserted are shown in bold in Figure 3C.
  • the point of insertion of Mulns with respect to a single codon will determine the nature of the insertion. The three possibilities are shown in columns 1, 2 and 3 of Table 1 above.
  • the transposon was used in the same manner as with the MuDeI and the same approach was taken: insertion of the transposon into the target gene; selection for the transposon- inserted target gene; removal of the transposon by restriction digestion; intramolecular ligation; transformation into a suitable organism; select or screen a library of target gene variants with a triplet nucleotide insertion.
  • This example illustrates how to create a library of variants containing triplet nucleotide substitutions at random positions in the target gene of interest using the transposon- based technology as outlined in Example 1.
  • This example uses the MuDeI transposon (as outlined in Example 1) and the newly constructed pNOM plasmid or a suitable derivative of the pNOM plasmid.
  • the restriction endonuclease Mlyl is critical to triplet nucleotide substitution but other restriction endonucleases with properties similar to that of Mlyl can be used providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
  • Example follows the procedure that is outlined in Figure 6 and is similar to the procedure outlined in Example 1. Both pNOM and MuDeI are as outlined in Example 1.
  • the MuDeI was used in the same manner as in Example 1 and the same approach was taken: insertion of the transposon into the target gene; selection for the transposon- inserted target gene; removal of the transposon by restriction digestion.
  • the next stage differs from Example 1 in that the intramolecular ligation was replaced by an intermolecular ligation, as outlined in Figure 6.
  • intramolecular ligation is replaced by the intermolecular ligation of an artificial DNA sequence (e.g. SubSeq; see Figure 7).
  • the target DNA sequence containing the artificial DNA sequence is selected for using a selectable marker present in the artificial DNA sequence and the plasmid DNA isolated and digested with Mlyl (Step 4 of Figure 6). Intramolecular ligation results in the reformation of the bla gene, with three nucleotide base pairs substituted (Step 5). The resulting library is subjected to a selection or screen to select those variants with the required properties.
  • hatched blocks represent the transposon, black blocks the target gene, speckled blocks the artificial DNA sequence, grey blocks the substitution point and the thick dashed lines the rest of the plasmid backbone.
  • a new DNA sequence was inserted using standard DNA ligation techniques to contain a DNA element with the properties as illustrated in Figure 7A.
  • the two different termini of the DNA sequence are marked TERM-I and TERM-2 in Figure 7 A.
  • the last three nucleotide base pairs of TERM-2 can be a defined triplet sequence, fully random (that is every position can have the four possible nucleotides) or semi-random (that is that some positions may have the nucleotide allowed restricted).
  • the gene that encodes the selectable marker is located between TERM-I and TERM-2.
  • the mechanism used is outlined in Figure 7B.
  • MuDeI transposon insertion results in a five bp duplication after gap repair in E. coli.
  • the cleavage site of Mlyl is 1 bp away from the recognition sequence resulting in the removal of 4 bp of the target gene at both ends, deleting the equivalent of 3 nucleotide base pairs from the target gene.
  • the SubSeq DNA is ligated into the target gene at the cleavage point and those target genes with SubSeq inserted within them are selected using the selectable marker after transformation.
  • the DNA element described in Figure 7 contains two Mlyl sites, but other restriction endonucleases with properties similar to that of Mlyl can be used providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
  • One Mlyl site was placed 5 bp from one terminal of the DNA sequence (from hereon known as TERM-I) and the other Mlyl site was placed 8 bp away from the other terminal (from hereon known as TERM-2).
  • Linking the two Mlyl sites is an appropriate selectable marker gene that provides a chosen strain of E.
  • the last three nucleotide base pairs of TERM-2 can be a defined triplet sequence, fully random (that is every position can have the four possible nucleotides) or semi-random (in that some positions may have the nucleotide allowed restricted).
  • the SubSeq DNA element was constructed by PCR using the oligonucleotide primers DDM017 (5' Phos- CGACCGACTCAAT ACCTGTGACGGAAGATC 3' (SEQ ID NO:47); "Phos” signifies a phosphorylated nucleotide) and DDJdiOl ⁇ (5' Phos-NNNAACTGGaC TCAGGCATTTGAGAAGCACAC 3' (SEQ ID NO.48); "Phos” signifies a phosphorylated nucleotide and "N” signifies any oligonucleotide) as the forward and reverse primers with 0.1 ng of the original mini-Mu (Cam R -3) transposon acting as template, to create SubSeq.
  • the 1095 bp PCR product was purified. Creation and sequencing of amino acid substitution library
  • Example 1 An expanded library based on that created in Example 1 was used in this example. This expanded library contained up to 176 clones with MuDeI inserted within the Ua gene. The colonies containing MuDeI within the bla gene of pNOM were pooled and plasmid DNA isolated as outlined in Example 1. The purified plasmid library was cut with MTyI and linear pNOM plasmid minus MuDeI was isolated and purified after agarose gel electrophoresis as outlined in the Example 1. Prior to agarose gel electrophoresis, the plasmid DNA was dephosphorylated using calf intestinal alkaline phosphatase (NE BioLabs).
  • the SubSeq DNA sequence (50 ng) created as outlined above was ligated into the M/yl-digested pNOM (approx. 30 ng) using T4 DNA ligase. Up to 2 ⁇ l of the ligation mix was used to transform E. coli DH5 ⁇ cells by electroporation and the cells plated on 20 ⁇ g/ml chloramphenicol LB agar plates to select for cells containing SubSeq inserted within the bla gene of pNOM. 192 colonies were selected at random from the chloramphenicol LB agar plates and grown in 96 deep-well culture plates containing 20 ⁇ g/ml chloramphenicol LB broth. Equal volumes were taken out of each well and pooled together.
  • the SubSeq-containing pNOM library was purified from cells as outlined in Example 1. Approximately 2 ⁇ g of the library was subjected to MIyI digestion as outlined above. That digestion removed SubSeq, resulting in the replacement of the 3 bp of the wild- type bla gene that were deleted on removal of MuDeI earlier in the procedure. The band corresponding to linear pNOM (2115 bp) was isolated and purified after agarose gel electrophoresis.
  • the library of linear pNOM plasmids (10 ng) was subjected to intramolecular ligation using T4 DNA ligase (as described above) to rejoin the ends of the plasmid and constituted the BLA SUB library.
  • T4 DNA ligase as described above
  • One tenth of the ligation mixture was used to transform DH5 ⁇ and the cells plated on 15 ⁇ g/ml ampicillin LB agar plates to select for active TEM-I ⁇ -lactamase variants. More than 1000 colonies grew on the plate.
  • PCR using Taq DNA polymerase was performed on several randomly chosen colonies capable of growth on 15 ⁇ g/ml ampicillin using primers DDJdiOlO and DDJdiOl l, as outlined in Example 1.
  • each of the products was 1070 bp, as expected.
  • the DNA produced by the PCR were purified and sequenced using the oligonucleotide DDJdiOlO as the primer. The exact nature of the mutations are shown in Table 4. This data shows that the amino acid substitutions can be incorporated at random positions in a protein using this transposon-based technology.
  • Example 4 is an expansion on example 3 and incorporates additional features into the SubSeq DNA sequence.
  • Example 4 follows the same steps as outlined in Example 3 except for the differences described. The main difference is the nature of the SubSeq DNA element.
  • This example illustrates how to create a library of variants containing insertions of amino acid sequences (e.g. whole proteins, protein domains or fragments (such as epitopes) of protein domains) at a random position in the target protein of interest using the transposon-based technology as outlined in Example 1.
  • This example uses the MuDeI transposon (Example 1) and the newly constructed pNOM plasmid, or a suitable derivative of the pNOM plasmid.
  • Other transposons described in this specification can also be used in the procedure, with suitable modifications to the procedure, as will be understood by the skilled person.
  • restriction endonuclease MIyI is critical to domain insertion but other restriction endonucleases with properties similar to that of MIyI can be used providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
  • Step 1 The MuDeI transposon (hatched blocks in Figure 8) is inserted into the target plasmid or target gene.
  • Step 2 Cells containing a plasmid-integrated MuDeI are selected using the properties of the selectable marker gene.
  • the plasmids are isolated and pooled, and the transposon is removed by MIyI digestion.
  • Step 3 The DNA sequence (clear blocks in Figure 8) is inserted into the target gene.
  • the DNA to be inserted is the gene cybC which encodes the protein cytochrome 6 562 (from hereon known as cyt b).
  • Step 4 The library is subjected to a selection or screening step that is suitable to identify proteins encoded by the chimeric gene with the desired properties.
  • Both pNOM and MuDeI are identical to that as outlined in previous examples.
  • MuDeI was used in the same manner as in Examples 1 and 3 and the same approach was taken: insertion of the transposon into the target gene; selection for the transposon-inserted target gene; removal of the transposon by restriction digestion.
  • the library of MuDeI inserted within the bla gene of pNOM used in this example is identical to that used in Example 3.
  • the production of linear, dephosphorylated pNOM minus MuDeI is exactly same as outlined in Example 3.
  • each ORF version of cybC was composed of four different sequences that encode cyt b with either no linker or a linker sequence encoded in the primer oligonucleotides listed below, at either one or both termini of the gene.
  • DDJlacB005 forward primers DDJlacB005 (5' GCAGATCTTGAAGACAATATGGA 3'; SEQ ID NO:69), DDJdiO23 (5' ggcggtagcGCAGATCTTGAAGACAATATGGA (SEQ ID NO:70); lowercase letters signify nucleotides encoding the linking regions) and reverse primers DDJlacBOO ⁇ (5' CCTATACTTCTGGTGATAGGCGT; SEQ ID NO:71) and DDM024 (5' gctgccaccCCTATACT TCTGGTGATAGGCGT (SEQ ID NO:72); lowercase letters signify nucleotides encoding the linking regions).
  • ORFII Forward primers DDJdiO19 (5' CGCAGATCTTGAAGACAATATGGA 3' (SEQ ID NO:73); underlined nucleotides are extra nucleotides used to maintain the ORF) and DDJdiO25 (5' CggcggtagcGCAGATCTTGAAGACAATATGGA 3' (SEQ ID NO: 74); underlined nucleotides are extra nucleotides used to maintain the ORF and lowercase letters signify nucleotides encoding the linking regions), and reverse primers DDJdi020 (5' CTATACTTCTGGTGATAGGCGT 3'; SEQ ID NO:75) and DDJdiO26 (5' ctgccaccCCTATACTTCTGGTGAT AGGCGT 3' (SEQ ID NO:76); lowercase letters signify nucleotides encoding the linking regions).
  • ORFIII Forward primers DDJdiO21 (5' CTGCAGATCTTGAAGAC AATATGGA 3' (SEQ ID NO: 77); underlined nucleotides are extra nucleotides used to maintain the ORF) and DDM027 (5' CJggcggtagcGCAGATCTTGAAGACAATATGGA 3' (SEQ ID NO:78); underlined nucleotides are extra nucleotides used to maintain the ORF and lowercase letters signify nucleotides encoding the linking regions) and reverse primers DDJdiO22 (5' TATACTTCTGGTGATAGGCGT 3'; SEQ ID NO:79) and DDJdiO28 (5' tgccaccCCTATACTTCTGGTGATAGGCGT 3' (SEQ ID NO:80); lowercase letters signify nucleotides encoding the linking regions).
  • the 318-336 bp products were purified and a 5' phosphate group added to the PCR product using 20 units of T4 polynucleotide kinase in the T4 DNA ligase (NE Biolabs) reaction buffer.
  • Example 3 differs from Example 1 and more closely follows Example 3, in that the intramolecular ligation is replaced by an intermolecular ligation, as outlined in Figure 8. Instead of SubSeq being inserted at random positions of the bla gene, as in Example 3, the ORF libraries of cybC are inserted. Although cybC is inserted in this case, any DNA element that encodes either a whole gene, gene segment equivalent to a protein domain, gene segment equivalent to partial amino acid sequence of a whole protein or domain of a protein (for example an epitope), or any other amino acid sequence could be used.
  • Example 3 An expanded library, based on that created in Example 1, that was used in Example 3 was also used in this example.
  • This expanded library contained up to 176 clones with MuDeI inserted within the bla gene.
  • the colonies containing MuDeI within the bla gene of pNOM were pooled and plasmid DNA isolated as outlined in Example 1.
  • the purified plasmid library was cut with MIyI and linear pNOM plasmid minus MuDeI was isolated and purified after agarose gel electrophoresis as outlined in the Example 1. Prior to agarose gel electrophoresis, the plasmid DNA was dephosphorylated using calf intestinal alkaline phosphatase.
  • the three ORF libraries of cybC (50 ng) created above were ligated separately into the Mfyl-digested pNOM (circa 30 ng) using T4 DNA ligase. Up to 2 ⁇ l of the ligation mix of each reaction was used to transform E. coli DH5 ⁇ cells by electroporation and the cells plated on 15 ⁇ g/ml ampicillin LB agar plates to select for cells containing active chimeric cyt b-TEM-1 proteins. Only 8 colonies grew on the control plate (cells transformed with a ligation containing no ORF library insert), whereas 45, 130 and 150 colonies grew on the plate representing ORFI, ORFII and ORFIII cybC libraries, respectively.
  • PCR using Taq DNA polymerase was performed on 10, 15 and 10 randomly chosen colonies from the plates representing ORFI, ORFII and ORFIII, respectively, using primers DDJdiOlO and DDJdiOl l, as outlined in Example 1.
  • the size of the products ranged from 1300 bp to 1600 bp.
  • the DNA produced by the PCR were purified and sequenced using the oligonucleotide DDJdiOlO as the primer.
  • the exact nature of the mutations are shown in Table 5.
  • Some of the chimeras contained two cybC genes inserted in tandem at the same position in the bla gene. This data shows that the domain insertions can be incorporated at random positions in a protein using this transposon based-technology.
  • the ORF columns refers to the ORF library from which the genes where isolated.
  • the 4 refers to the point of insertion in either the bla gene or TEM-I proteins.
  • the N- and C-terminal linker columns refer to the amino acid sequence that links TEM- 1 with cyt b.
  • Those ORFs marked with an * indicate genes with a tandem insertion of cybC within bla.
  • Several of the C-terminal linker sequences could not be determined due to poor sequence data at these regions as a result of low signal because of the distance away from the priming site.
  • Example 6 This example describes alternatives to the Mulns transposon in the previous examples.
  • the new transposon sequences described below replace Mulns in the scheme, together with the suitable changes in the procedure that will allow transposition to occur.
  • the AT-2 transposon described by Devine & Boeke (Nucleic Acid Res. (1994) 22 3765-3772) was modified, as shown in Figure 9A.
  • the AT-2 transposon shows similar characteristics to mini-Mu and efficient transposition can be performed in vitro.
  • the main difference is that the transposase recognition site consists of only the terminal four nucleotide base pairs. Placing the Mlyl recognition site directly after this sequence allows insertion mutagenesis to proceed by the mechanism outlined in Figure 9B, without disruption to the transposition efficiency (inserted nucleotides are shown in bold).
  • a selectable marker is present within the transposon between the two termini as illustrated in Figure 9A.
  • the U3 sequences identified by the TyI integrase are indicated.
  • a gene encoding a selectable marker will reside between the two terminal U3 and Mlyl recognition sequences.
  • the selectable marker is a gene that provides a chosen strain of E. coli, or any other suitable organism, with a selection advantage under a particular condition, so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence.
  • the Tn5 transposon described by Goryshin & Reznikoff (J. Biol. Chem. (1998) 273 7367-7374), was adapted to replace the Muftis transposon, as shown in Figure 1OA.
  • the Tn5InsO ⁇ contains the OE (outside end) element and the Tn5hisME transposon contains the ME (mosaic end) element. These elements can promote transposition of DNA sequences that lie between them.
  • a selectable marker gene lies between the two OE or ME elements.
  • the selectable marker is a gene that encodes a protein that provides a chosen strain of E.
  • OE or ME elements that contains changes in its nucleotide sequence can be utilised, providing the sequence still contains the Mlyl sequence at the required position and the DNA can still act as a transposon.
  • Tn5InsOE or Tn5InsME The mechanism by which triplet nucleotide insertion occurs when using Tn5InsOE or Tn5InsME is shown in Figure 1OB.
  • the inserted nucleotides are shown in bold.
  • Tn5 transposition occurs via a 9 nucleotide staggered cut.
  • the Mlyl recognition sequence is placed two nucleotide base pairs from each terminus and allows the precise insertion of three nucleotide base pairs upon Mlyl digestion followed by intramolecular ligation.
  • This example illustrates how to create a library of variants containing triplet nucleotide additions at random positions in the bla gene using a transposon based technology utilising a modified transposon that contains modified recognition sites based on the Tn5 transposon, as shown in Figure 10.
  • the chloramphenicol resistance gene is included as a selectable marker.
  • This example uses two new transposons, termed Tn5InsOE and Tn5InsME and the pNOM plasmid but other suitable derivatives of pNOM can be used.
  • restriction endonuclease MIyI is critical to triplet nucleotide insertion but other restriction endonucleases with properties similar to that of MIyI can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by a skilled person.
  • Step 1 The Tn5InsOE or Tn5hisME transposon is inserted into the target plasmid or gene.
  • Step 2 Cells containing a plasmid-integrated Tn5InsOE or Tn5InsME contain the Cam ⁇ gene and so can grow in the presence of chloramphenicol.
  • the plasmids are isolated and pooled, and the transposon removed by MIyI digestion.
  • Step 3 Intramolecular ligation results in the reformation of the target gene, plus nucleotide base pairs.
  • Step 4 The resulting library is subjected to a selection or screen to select those variants with the required properties.
  • the hatched blocks represent the transposon, solid blocks the bla gene, gaps and grey blocks the insertion point and the thick dashed lines the rest of the plasmid backbone.
  • the procedure can also be applied to a target gene other than the bla gene, provided that:
  • a modified mini-Mu transposon containing a Tn5-derived sequence is used, along with a newly constructed pNOM plasmid (see example 1).
  • the resultant transposon DNA is derived from mini-Mu apart from those sequences required for the transposition reaction (e.g. OE or ME sequences recognised by transposase enzymes) which is derived from Tn5.
  • the restriction endonuclease MIyI is critical to triplet nucleotide insertion but other restriction endonucleases with properties similar to that of MIyI can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
  • the DNA sequence between the OE or ME sequences can be altered, provided that it comprises a sequence for an appropriate selectable marker.
  • the Cam R gene is used as a selectable marker within the transposon. This can be exchanged for another gene that will provide a chosen strain of E. coli or any other suitable organism with a selection advantage under a particular condition so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence.
  • the ability to duplicate nucleotide triplets depends on the transposon insertion mechanism and the position of two introduced restriction sites, as outlined in Figure 10.
  • the mini-Mu transposon was engineered so as to act as a vehicle for the insertion of specific restriction sites into the target gene (Figure 3A).
  • the restriction endonuclease chosen was MIyI, a type IIS enzyme that cuts 5 bp outside its recognition sequence to generate a blunt end (cleavage profile 5' GAGTC(N 5 )J- 3').
  • the nucleotide sequences towards the two termini of the mini-Mu transposon were replaced by a sequence based on the Outside End (OE) or Mosaic End (ME) sequence from the Tn5 transposon.
  • Tn5 transposase This new nucleotide sequence now requires the Tn5 transposase for insertion into the target DNA.
  • Transposition of Tn5Ins will occur via a 9 bp staggered cut in the target DNA that, following E. coli gap repair, results in the duplication of these 9 bp ( Figure 10B).
  • Digestion of the DNA with Mlyl removes the transposon along with three additional nucleotide base pairs from the target gene at both termini. Intramolecular ligation of the two blunt ends results in the in-frame duplication of 3 nucleotides from the target gene ( Figure 10B).
  • the Tn5Ins transposon was constructed by PCR using the oligonucleotide primer ASl (5' CTGACTCTTATACACAAGTCGCGAAAGCGTTTCACGATA 3'; SEQ ID NO:89) or AS2 (5' CTGAGTCTTATACACATCTCGCGAAAGCGTTTCACGATAS'; SEQ ID NO:90) as both forward and reverse primer with 0.1 ng of the original mini-Mu (C ⁇ r ⁇ R -3) transposon acting as template, to create transposons Tn5InsOE and Tn5InsME, respectively.
  • the 1302 bp product was purified ready for use in a transposition reaction.
  • Tn5InsOE and Tn5InsME were performed at 37°C for 2 hr followed by heat inactivation for 10 min at 7O 0 C.
  • the reaction mixture was composed of 1 ⁇ l 10x reaction buffer (500 mM Tris-acetate (pH 7.5), 1.5 M potassium acetate, 100 mM magnesium acetate, 40 mM spermidine), 200 ng pNOM, 0.232 pmoles Tn5Ins and 1 unit of EZ-Tn5TM transposase (Epicentre, Madison USA) in a total volume 10 ⁇ l.
  • the reaction was stopped by the addition of 1 ⁇ l stop solution (1% SDS) prior to incubation at 7O 0 C for 10 min.
  • Either 1 ⁇ l or 2 ⁇ l of the reaction mixture was used to transform E. coli DH5 ⁇ cells by electroporation and the cells plated on LB agar containing 20 ⁇ g/ml chloramphenicol to select for cells containing the Can ⁇ R gene and hence the Tn5Ins gene.
  • a gene of interest independent of pNOM can be used as the target for transposon insertion.
  • the gene of interest can be cloned into pNOM or another suitable vector using standard techniques after transposon insertion.
  • the gaps present in the DNA strands formed as a result of the transposition reaction that are normally repaired in the organism can be repaired in vitro using the appropriate gap repair and ligation techniques.
  • Tn5InsOE or Tn5InsME The place of insertion of Tn5InsOE or Tn5InsME into pNOM should be distributed evenly throughout the plasmid and so a strategy is required that will select for cells containing the transposon inserted in to the bla gene region.
  • the transposition of the transposon into the plasmid DNA confers resistance to chloramphenicol on E. coli, allowing for selection of cells containing Tn5InsOE- or Tn5InsME-inserted pNOM. Those colonies that have Tn5InsOE or Tn5InsME inserted within the bla gene region will disrupt TEM-I expression and thus affect the cells' ability to grow in the presence of ampicillin.
  • the pNOM plasmid with TN5InsME inserted within the bla gene was purified individually from 10 of the 66 colonies. Each of the plasmids was subjected to digestion with MIyI, followed by agarose gel electrophoresis. The band corresponding to the linear pNOM minus Tn5InsME was isolated and purified after agarose gel electrophoresis. Intramolecular ligation was performed using T4 DNA ligase and approximately 10 ng of linear DNA. Up to 2 ⁇ l of the ligation mix was used to transform E.

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Organic Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Laminated Bodies (AREA)
  • Wrappers (AREA)
  • Polyoxymethylene Polymers And Polymers With Carbon-To-Carbon Bonds (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

There is provided a method for altering the amino acid sequence of a target polypeptide by altering a target DNA sequence which encodes that polypeptide, the method comprising the step of introducing a transposon into the target DNA sequence, in which the transposon comprises a first restriction enzyme recognition sequence towards each of its termini, the recognition sequence not being present in the remainder of the transposon, or in the target DNA sequence, or in a construct comprising the target DNA sequence, the first restriction enzyme recognition sequence being recognised by a first restriction enzyme which is an outside cutter and being positioned such that the first restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon.

Description

Polypeptide Mutagenesis Method
FIELD OF INVENTION The invention relates to a method for altering the amino acid sequence of a target polypeptide, by insertion, deletion or substitution of at least one amino acid in the target polypeptide.
BACKGROUND
Protein mutagenesis
Nature has evolved an impressive myriad of proteins to perform the functions for the fitness of an organism. Changes to gene sequences are translated into changes in the amino acid composition of the protein. Nucleotide substitution, deletion or insertion are utilised by nature during the evolutionary process (Chothia, C. et al. (2003) Science 300 1701-1703). Substitution of a single nucleotide can result in the change in character of the amino acid by altering the information that encodes the amino acid at that particular position. Selection pressure means that deletion or insertion of three nucleotides or multiples thereof are favoured as they maintain the reading frame of the gene (Taylor, M. et al. (2004) Genome Res. 14 555-566). During the process of divergent evolution, many substitution and insertion-deletion (indel) mutations result in the change in composition of the protein (Taylor, M. et al. (2004); Lesk, A.M. (2001) Introduction to protein architecture. Oxford University Press, Oxford; Pascarella, S. & Argos, P. (1992) J. MoI. Biol. 224 461-471). Many of these changes have profound effects on the properties of the protein especially folding, ligand or substrate binding, protein-protein interactions and temperature-dependent activity and stability. For example, the sequence variation of the immunoglobulin variable domains due to substitution mutagenesis is enhanced by amino acid deletions and insertions (de Wildt, R.M. et al. (1999) J. MoI. Biol. 294 701-710) and various substitution and indel events are observed between the structurally homologous subtilisin serine proteases, including in regions known to be important for catalysis, substrate recognition and calcium binding (Siezen, RJ. & Leunissen, J.A. (1997) Protein Sci. 6 501-523). The introduction of random mutations throughout a target gene is a powerful method for altering the properties of a protein (see Tao, H. & Cornish, V. W. (2002) Curr. Opin. Chem. Biol. 6 858-864 and Arnold, F.H. (2001) Nature 409 253-257 for reviews). Most of the current technologies have focused on the introduction of point mutations leading to an amino acid substitution (Dalby, P.A. (2003) Curr. Opin. Struct. Biol. 13 500-505; Lutz, S. & Patrick, W.M. (2004) Curr. Opin. Biotechnol. 15 291-297 and references therein). These methods are usually restricted to the changing of one nucleotide base pair per codon, restricting the amino acid type available at that position, or rely on naturally occurring genetic diversity. Some methods have been used to introduce amino acid insertions, for example pentapeptide scanning mutagenesis (Hallet, B. et al. (1997) Nucleic Acids Res. 25 1866-1867; discussed further below) and Random Insertion and Deletion (RTD) (Murakami, H. et al. (2002) Nat. Biotechnol. 20 76-81). The RID method has the potential to introduce single amino acid deletions but has currently been applied only to introduce amino acid substitutions or insertions. Furthermore, the procedure is complicated and prone to the introduction of unwanted secondary mutations (Murakami, H. et al. (2002)).
The insertion or deletion of a single codon is one of the most common forms of indel mutation observed in nature and illustrates its importance to the process of evolution (Taylor, M. et al. (2004)). Mimicking such an event in vitro would help our understanding of the influence of indel mutations on protein structure and function and enhance our ability to improve the properties of proteins for a particular application. Currently, the most common method of introducing indel mutations is by rational design and will thus be reliant on structural information to determine the residues to be deleted and require separate oligonucleotides for each mutation.
Transposons
Transposons are mobile pieces of genetic information (Reznikoff et al. (1999) Biochem. Biophys. Res. Commun. 266 729-734) capable of inserting randomly into a DNA sequence. Most transposons follow a common general mechanism for this (Mizuuchi (1992) Amu. Rev. Biochem. 61 1011-1051; Craig (1995) Science 270 253- 254). The transposon has a recognition sequence at each of its termini, which consists of an inverted repeat; that is the termini have identical sequences reading in opposite direction. A transposase enzyme recognises and binds to these recognition sequences to form a protein-DNA complex, which then facilitates insertion of the transposon into the target DNA by catalysing DNA cleavage and joining reactions. For example, in the case of the Mu transposon, MuA acts as the transposase. A 5 bp staggered cut is made in the target DNA before insertion of the Mu transposon. The consequential 5 bp gap on the opposite DNA strand is filled by the host organism if required or, in vitro, by using the appropriate enzymes. The result is the insertion of the transposon plus the repetition of 5 bp of the target DNA either side of the transposon. In the case of the Tn5 transposon, 9 bp staggered cut is made, resulting in the repetition of 9 bp of target DNA either side of the transposon (Reznikoff et al. (1999); Steiniger- White et al. (2004) Curr. Opin. Struct. Biol. 14 50-57). The mini-Mu and Tn5 transposition reactions have, amongst others, been adapted for use in vitro, with the reaction having a very low target site preference allowing transposon insertion to occur essentially at any point in a given gene (Goryshin & Reznikoff (1998) J. Biol. Chem. 273 7367-7374; Haapa et al. (1999) Nuc. Ac. Res. 272777-2784).
Restriction enzymes
Restriction endonucleases are a class of enzymes that cleave DNA upon recognising a specific nucleotide sequence. The type II enzymes are a specific class of restriction endonucleases. Their recognition sites are palindromic, partially palindromic or interrupted palindromes. Unlike the type I and III restriction endonucleases, which cleave DNA randomly, the type II enzymes cleave the DNA at specific sites, normally within the recognition sequence. The type IIS enzymes are a subtype having some features atypical of common type II enzymes. They generally recognise non- palindromic or asymmetric nucleotide sequences with at least one strand cleaved outside the recognition sequence (i.e. they are so-called "outside cutters"). One such example of a type IIS restriction endonuclease is Mlyi, that recognises a specific, non- palindromic DNA sequence and cuts 5 bp away from the recognition sequence to generate a blunt end (5' GAGTCNNNNN4- 3'; the recognition sequence is underlined, N signifies either G, A, T or C is allowed and the arrow shows the cleavage position). Other type II enzymes are the type IEB, HE, HG and ID? subtypes which share some characteristics with the type IIS, subclass. For example, some members of these subtypes are classed as outside cutters. Known protein mutagenesis techniques
US Patent No. 5,843,772 relates to an artificial transposon known as AT-2. Restriction enzyme recognition sites were added in order to allow the liberation of the blunt-ended transposon from a DNA vector. The restriction enzyme recognition sites are recognised by restriction enzymes which cut within the recognition sequence themselves. The patent primarily relates to methods of creating artificial transposons and inserting these into DNA sequences.
Vilen et al. (J. Virol. (2003) 77 123-134) relates to the use of transposons to map genes in a virus genome. The transposons disclosed in Vilen et al. are not suitable for use in a method to alter the amino acid sequence of a target polypeptide.
US Patent No. 4,830,965 relates to the introduction of restriction enzyme recognition sites to allow DNA sequences to be inserted at points within a transposon. The restriction enzyme recognition sites are not located at the termini of the transposon.
US Patent No. 5,728,551 relates to the pentapeptide scanning mutagenesis technique mentioned above and discussed in more detail below. There is mention of a proposed method of codon insertion mutagenesis, although no data is provided to indicate that the method was carried out. It is proposed to position a Srfl restriction enzyme recognition sequence near the termini of a transposon, the Srfl restriction enzyme cutting within its recognition sequence. The insertion of such a transposon into a target DNA and subsequent excision using Srfl. would result in the target DNA having a gap as the result of the transposon excision, the termini of the gap comprising some transposon-derived nucleotides, as the result of the position of the Srfl cleavage of the DNA. Therefore, the specific codons which could be inserted using a given transposon would be limited, since the sequence of the inserted codon would be partly determined by the sequence of the terminus of the transposon.
Hayes et al (Applied & Environmental Microbiology (1990) 56 202-209 relates to the use of transposons to generate gene knockouts and to use restriction enzyme sites within the transposon to map the position of gene critical to plasmid replication within a cell. TEM-I is a clinically important protein as it is one of the main causes of bacterial resistance to β-lactam antibiotics. Many natural variants of TEM-I exist that have evolved to confer resistance to new, extended spectrum (ES) β-lactam antibiotics (http://www.lahey.org/Studies/temtable.asp; example references are: Matthew, M. & R. W. Hedges (1976) J. Bacteriol. 125 713-718; Chanal, CM. et al. (1989) Antimicrob. Agents Chemother. 33 1915-1920; Goussard, S. & Courvalin, P. (1999) Antimicrob. Agents Chemother. 43 367-370). Although no naturally occurring deletion variants of TEM-I exist, amino acid deletions have been observed in homologous β-lactamases such as SHV-9 and SHV-IO (Prinarakis, E.E. et al. (1997) Antimicrob. Agents Chemother. 41 838-840) and S. aureus PCl ( Zawadzke, L.E. et al. (1995) Protein Eng. 8 1275-1285) that contribute to bacterial resistance to ES β-lactams. TEM-I has also been the focus of many protein engineering studies (Matagne, A. et al. (1998) Biochem. J. 330 (Pt 2) 581-598), including the random substitution of every amino acid to determine which amino acid residues cannot tolerate mutation (Huang, W. et al. (1996) J. MoI. Biol. 258 688-703), directed evolution (for example Camps, M. et al. (2003) Proc. Natl. Acad. Sci. U.S.A 100 9727-9732; Stemmer, W.P. (1994) Nature 370 389-391) and pentapeptide scanning mutagenesis (Hayes, F. et al. (1997) J. Biol. Chem. 272 28833-28836). The pentapeptide scanning mutagenesis method concerns the insertion of a transposon and its removal with a standard, rare cutting type II restriction enzyme such as Notl (5' GCslGGCCGC 3') or Pmel (5' GTTTlAAC 3'). The main shortfall of this method is that it is limited in the sequence change which can be introduced. Upon restriction digestion to remove the transposon, the 5 bp duplicated region of the target DNA, together with the segment of the transposon containing the restriction site, are always incorporated into the final, modified target DNA. Therefore, this results in the insertion of a defined set of amino acids, usually greater than 5 amino acids in length. Amino acid substitutions or deletions are not sampled, neither are less drastic insertions, such as a single amino acid.
An improvement on the above method is disclosed in US-A-2005/0074892. In the method described in that document, a transposon is inserted into a target DNA sequence, the transposon being excised using a non-Type IIS restriction enzyme, leaving the target DNA with a gap created by excision of the transposon. Each terminus of the gap comprises some transposon-derived nucleotides and the duplicated nucleotides arising from transposon insertion. The transposon used in this method is commercially available and has not been modified for use in the procedure. Furthermore, the method requires several steps, involving the sequential insertion and deletion of further, non-transposable DNA sequences, with multiple restriction endonuclease digestion steps to eventually remove the transposon-derived nucleotides from the target DNA sequence. This lengthy process eventually allows insertion, deletion or substitution of a single codon within the target DNA sequence.
Creation of "molecular switches" The ability to design and produce molecules that can change their properties in response to a desired input will allow significant new possibilities for creating novel sensing and transducing devices. The concept of the molecular switch is well established in nature, with proteins playing the lead roles in sensing chemical signals and converting them into the appropriate cellular response (Monod et al. (1963) J. MoI. Biol. 6 306-329; Changeux & Edelstein (2005) Science 308 1424-1428). Creating proteins whose output is coupled to a desired input has the potential for a wide variety of in vivo and in vitro applications, including the creation of tailored biosensors and novel intelligent materials. While it might appear simplest to use natural protein switches, these have evolved to fulfil specific functions within a defined biological context and may not have the requisite properties for a particular application. Therefore, as a general approach for creating molecular switches, functions of normally disparate proteins can be coupled.
Natural allosteric proteins have spatially distinct regulation and active sites (Monod et al. (1963); Changeux & Edelstein (2005)). Binding of an effector molecule at the regulation site causes conformational changes that can rapidly and reversibly modulate protein activity directly. Ideally, any artificial allosteric protein will mimic this mechanism. Rather than re-engineer natural switches, a simpler and more effective strategy is to couple the functions of normally disparate proteins through linked conformational changes (Buskirk & Liu (2005) Chem. Biol. 338 633-641; Hahn & Muir (2005) Trends Biochem. Sci. 30 26-34; Ostermeier (2005) Prot. Eng. Des. SeI. 18 359-364). Proteins are recruited that have the desired regulatory (e.g. small molecule- dependent conformational changes) and reporter (e.g. enzymatic activity) function. The two proteins need to be linked in such a manner that the conformational events occurring in the regulation domain on binding the small molecule can be transmitted to the reporter domain to modulate the output signal. One approach to link such conformational events is to use a strategy called domain insertion, in which one protein domain is inserted within another (Doi & Yanagawa (1999) FEBS Lett. 457 1-4; Ostermeier (2005) Protein Eng. Des. SeI. 18 359-364). Thus, two shared links are created, decreasing the degrees of freedom between the two domains and intimately linking their structure to promote the transmission of any conformational changes. Domains linked in the more traditional end-to-end fashion will generally act autonomously of each other, with no communication between the two.
The key to success of this strategy is the identification of sites within a protein that permit insertions of whole domains, while retaining the function of both proteins and allowing the transmission of conformational events. Analysis of natural multi-domain proteins suggests that domain insertion is a relatively common evolutionary event (Jones et a (1998) Protein Sci. 7 233-242; Aroul-Selvam et a (2004) J. MoI. Biol. 338 633-641). Several protein engineering studies have also shown that proteins can tolerate large insertions, including the whole domain of another protein. However, sites that permit an insertion and allow coupling may not be obvious. For example, insertions close to the active site of the reporter protein should enhance coupling by transmitting conformational changes directly to the catalytic centre yet may be considered too deleterious to enzyme activity.
Predicting sites within a target protein that permit the insertion of a whole protein domain so as to link the functions of the two proteins is currently very difficult. To overcome this obstacle, an evolutionary approach can be taken in which one protein is randomly inserted into another. To do this at the genetic level, a single break has to be introduced at random positions in the gene that encodes for the protein to be inserted into. One such method used to generate such breaks into DNA involves the use of the non-specific endonuclease, DNaseI (Guntas & Ostermeier (2004) J. MoI. Biol. 336 263-273). The problem with using DNaseI is that it is notoriously difficult to generate single cuts in DNA and digestion with this non-specific endonuclease regularly produces tandem duplications and nested deletions of varying sizes. This will lead to frameshifts, large insertions and large deletions in the protein, so reducing the quality of the library and increasing the number of variants that need to be sampled. The method of the current invention will not introduce such large deletions or insertions at the protein level, allowing the researcher to dictate the size of any linking sequence with the inserted domain. There are only three possible reading frames for the inserted gene (depending on the transposon insertion point with respect to one codon), increasing the likelihood of a correct reading frame from 1 in 6, when using DNasel, to 1 in 3 when using the method of the invention.
SUMMARY OF INVENTION
The current invention relates to a new method that introduces triplet nucleotide deletions or nucleotide insertions at random positions throughout a target gene. Furthermore, the technology can be altered to allow amino acid substitutions that cover the whole range of amino acid sequences at a particular position. Moreover, the technology can be adapted further to allow for the insertion of longer stretches of DNA that can encode epitopes, protein fragments or even whole protein domains.
The technology has been tested by determining the effects of amino acid indels on the TEM-I β -lactamase, encoded for by the bla gene.
The new technology outlined in this application will therefore complement existing knowledge by further exploring the sequence space open to TEM-I and the effect of such mutations on TEM-I structure and function. Furthermore, it will validate the technologies outlined in the application by providing a suitable example of the use of the technologies.
According to a first aspect of the invention, there is provided a method for altering the amino acid sequence of a target polypeptide by altering a target DNA sequence which encodes that polypeptide, the method comprising the step of introducing a transposon into the target DNA sequence, in which the transposon comprises a first restriction enzyme recognition sequence towards each of its termini, the recognition sequence not being present in the remainder of the transposon, or in the target DNA sequence, or in a construct (for example, a plasmid or vector) comprising the target DNA sequence, the first restriction enzyme recognition sequence being recognised by a first restriction enzyme which is an outside cutter and being positioned such that the first restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon.
The term "outside cutter", as used throughout this specification, is a term known in the art which indicates a restriction enzyme which cleaves DNA outside the restriction enzyme recognition sequence. Although the majority of restriction enzymes which are outside cutters belong to the type IIS subtype, members of the IEB, IIE, HG and IIP subtypes can also be classed as outside cutters.
The term "beyond the end of the terminus of the transposon", as used throughout this specification, indicates that the first restriction enzyme cleavage site is external to the transposon sequence, such that, when the transposon is incorporated into a target DNA sequence, the cleavage site is at a position within the target DNA sequence and not at a position within the transposon DNA sequence.
Advantageously, the invention provides a simple tool for the investigation of the impact of insertions, deletions and substitutions of one or more amino acids at points throughout a polypeptide of interest. The requirement for the first restriction enzyme recognition sequence to be recognised by an enzyme which is an outside cutter advantageously allows the insertion, deletion or substitution of a single amino acid in a target polypeptide by use of the method according to the invention. In a further advantage, the use of an enzyme which is an outside cutter, along with the positioning of the recognition sequence such that the cleavage site is beyond the end of the terminus of the transposon, allows excision of the whole transposon DNA sequence from the target DNA sequence after insertion, including nucleotides located at the termini of the transposon, without the need for additional steps to allow removal of such nucleotides. Therefore, the method of the invention is simpler, quicker and hence more economical than known methods.
For example, the method may exploit the properties of the mini-Mu transposon, a DNA element that can be accurately and efficiently inserted into a target DNA sequence in vitro using the MuA transposase (Haapa, S. et al. (1999) Nucleic Acids Res. 27. 2777- 2784). The reaction has a very low target site preference allowing transposon insertion to occur essentially at any point in a given gene. Other transposons may also be used as the basis for this technology, for example the AT-2 artificial transposon (Devine, S. E. & Boeke, J.D. (1994) Nucleic Acids Res. 22 3765-3772) or the Tn5 transposon (Goryshin & Reznikoff (1998) J. Biol. Chem. 273 7367-7374). Surprisingly, the inventor has found that it is possible to engineer a transposon to be suitable for use in a method according to the invention, by altering the termini of the transposon without disrupting the ability of the transposase enzyme to recognise the transposon. For example, it was previously shown that mutations which change the termini of mini-Mu can have an adverse effect on the ability of MuA transposase to recognise the transposon (Goldhaber-Gordon et al. (2002) J. Biol. Chem. 277 7703-7712; Goldhaber- Gordon et al. (2003) Biochemistry 42 14633-14642). The transposons used in the method of the invention surprisingly maintain a transposition efficiency similar to that of standard, unaltered mini-Mu.
The amino acid sequence may be altered by the deletion, insertion or substitution of at least one amino acid. Preferably, a single amino acid is deleted, inserted or substituted.
Where at least one amino acid is inserted into the amino acid sequence of the target polypeptide, or where at least one amino acid is deleted from the amino acid sequence of the target polypeptide, the method according to the first aspect of the invention preferably comprises the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intramolecular ligation reaction of the DNA from (c); and e) expression of protein from the DNA from (d).
For example, a host organism may be transformed with the DNA from (d), the protein then being expressed in the host organism. Alternatively, the protein may be expressed from the DNA from (d) using an artificial expression system, such as the Rapid Translation System available from Roche Diagnostics Ltd (Lewes, United Kingdom). The skilled person will be aware of the options available for the expression of protein
Where at least one amino acid of the amino acid sequence of the target polypeptide is substituted with a different amino acid, the method according to the first aspect of the invention preferably comprises the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intermolecular ligation of DNA from (c) with a second DNA sequence comprising at least two second restriction enzyme recognition sites located such that at least one of the cleavage sites is not at a terminus of the second DNA sequence; e) conducting the transformation of a host organism with DNA from (d) and selecting cells containing the second DNA sequence; f) isolating DNA from cells selected in (e) and digestion of that DNA with a second restriction enzyme which recognises the second restriction enzyme recognition site, the second restriction enzyme being an outside cutter; g) conducting an intramolecular ligation of DNA from (f); and h) expression of protein from the DNA from (g).
For example, a host organism may be transformed with the DNA from (g), the protein then being expressed in the host organism. Alternatively, the protein may be expressed from the DNA from (g) using an artificial expression system, such as the Rapid Translation System available from Roche Diagnostics Ltd.
Preferably, step (f) above is followed by an additional separation step (fl), such that DNA which does not comprise the second DNA sequence is separated from DNA which does comprise the second DNA sequence. The DNA not comprising the second DNA sequence is then used in step (g). In step (d) above, the phrase "cleavage site is not at a terminus of the second DNA sequence" indicates that the second restriction enzyme recognition site is located such that the cleavage site is one or more nucleotides from a terminus of the second DNA sequence, i.e. the cleavage site is within the second DNA sequence. The skilled person will readily appreciate the location of the second restriction enzyme recognition site which is required in order to gain a desired result of one or more amino acids being substituted.
The second restriction enzyme may be the same as the first restriction enzyme. Preferably, the second DNA sequence comprises a gene which gives a host cell containing the second DNA sequence a selectable characteristic compared to a cell not containing the second DNA sequence. The term "selectable characteristic", as used throughout this specification, may indicate, for example (where the cell is a bacterium), the ability to grow on an antibiotic-containing medium.
Where the amino acid sequence of the target polypeptide is altered by the insertion of a further amino acid sequence, the method according to the first aspect of the invention preferably comprises the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intermolecular ligation of DNA from (c) with a third DNA sequence encoding for a further amino acid sequence; and e) expression of protein from the DNA from (d).
For example, a host organism may be transformed with the DNA from (d), the protein then being expressed in the host organism. Alternatively, the protein may be expressed from the DNA from (d) using an artificial expression system, such as the Rapid Translation System available from Roche Diagnostics Ltd. The further amino acid sequence may be a full protein, a protein domain or a protein fragment. The protein fragment may be (but is not limited to) an epitope, a binding domain, an allosteric site, a defined functional region such as a metal binding site, or an oligomerisation interface. Preferably, the third DNA sequence comprises a gene which gives a host cell containing the third DNA sequence a selectable characteristic compared to a cell not containing the third DNA sequence.
The third DNA sequence may have an open reading frame which is the same as that of the target DNA, so that when the DNA is translated into a protein, a single chimeric protein is created. Alternatively or additionally, the third DNA sequence may contain a stop codon and/or an initiation codon.
In a preferred embodiment of the method according to the invention, the first restriction enzyme is a Type IIS enzyme and, most preferably, is MIyI.
Preferably, the transposon has a low target site preference. The transposon may be derived from one of: mini-Mu, AT-2 or Tn5. The transposon preferably comprises a gene which gives a host cell containing the transposon a selectable characteristic compared to a cell not containing the transposon. More preferably, the transposon comprises the DNA sequence 5'-NGACTC-3' (SEQ ID NO:1) as the 5' terminal and 5'-GAGTCN-3' (SEQ ID NO:2) as the 3' terminal (preferably 5'-TGACTCGGCGCA- 3' (SEQ ID NO:3) as the 5' terminal and 5'-TGCGCCGAGTCA-3' (SEQ ID NO:4) as the 3' terminal), or alternatively comprises the DNA sequence 5'-NNNNGACTC-3' (SEQ ID NO:5) as the 5' terminal and 5'-GAGTCNNNN-3' (SEQ ID NO:6) as the 3' terminal (preferably 5'-TGAAGACTCGCA-S' (SEQ ID NO:7) as the 5' terminal and 5'-TGCGAGTCTTCA-S' (SEQ ID NO:8) as the 3' terminal), where N is any nucleotide. In another alternative, the transposon comprises the DNA sequence 5'- TGTTGACTC-3' (SEQ ID NO:9) as the 5' terminal and 5'-GAGTCAACA-S' (SEQ ID NO: 10) as the 3' terminal, or in yet another alternative comprises the DNA sequence 5'-CTGACTC-3' (SEQ ID NO:11) as the 5' terminal and 5'-AAGAGTCAG- 3' (SEQ ID NO: 12) as the 3' terminal.
The target DNA may be carried in a construct such as a plasmid, preferably pNOM or a derivative thereof. According to a second aspect of the invention, there is provided a transposon comprising a restriction enzyme recognition sequence towards each of its termini, the recognition sequence being recognised by a restriction enzyme which is an outside cutter, the recognition sequence not being present in the remainder of the transposon and being positioned such that the restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon. Preferably, each restriction enzyme recognition sequence is positioned one or more nucleotides from a terminus of the transposon, more preferably between 1 and 20 nucleotides from a terminus of the transposon, yet more preferably between 1 and 10 nucleotides from a terminus of the transposon and most preferably 1, 2, 3, 4 or 5 nucleotides from a terminus of the transposon. Advantageously, this allows the transposon to be used as a tool in a method according to a first aspect of the invention, allowing the investigation of the impact of insertions, deletions and substitutions of one or more amino acids at points throughout a polypeptide of interest.
Surprisingly, the inventor has found that it is possible to engineer a transposon to be suitable for use in a method according to the first aspect of the invention, by altering the termini of the transposon without disrupting the ability of a transposase enzyme to recognise the transposon. For example, it was previously shown that mutations which change the termini of mini-Mu can have an adverse effect on the ability of MuA transposase to recognise the transposon (Goldhaber-Gordon et al. (2002) J. Biol. Chem. 277 7703-7712; Goldhaber-Gordon et al. (2003) Biochemistry 42 14633-14642). The transposons used in the method of the invention surprisingly maintain a transposition efficiency similar to that of standard, unaltered mini-Mu.
In a preferred embodiment, the restriction enzyme is a Type IIS enzyme and, most preferably, is MIyI. The transposon may comprise the DNA sequence 5'-NGACTC-3' as the 5' terminal and 5'-GAGTCN-3' as the 3' terminal (preferably 5'- TGACTCGGCGCA-3' as the 5' terminal and S'-TGCGCCGAGTCA-S' as the 3' terminal). Alternatively, the transposon may comprise the DNA sequence 5'- NNNNGACTC-3' as the 5' terminal and 5'-GAGTCNNNN-3' as the 3' terminal (preferably 5'-TGAAGACTCGCA-S' as the 5' terminal and 5'-TGCGAGTCTTCA-S' as the 3' terminal). In a further alternative, the transposon may comprise the DNA sequence 5'-TGTTGACTC-S' as the 5' terminal and 5'-GAGTCAACA-S' as the 3' terminal. In another alternative, the transposon may comprise the DNA sequence 5'- CTGACTC-3' as the 5' terminal and 5'-GAGTCAG-3' as the 3' terminal. These termini sequences may include variations provided that the transposon remains viable for transposition and that the restriction enzyme recognition sites are at the required positions.
For example, the mini-Mu transposon may be modified close to both its termini to incorporate the recognition sequences for the type IIS restriction enzyme MIyI. The mini-Mu transposon includes the CamR gene which allows E. coli cells containing the transposon to grow in the presence of chloramphenicol. The skilled person will understand that recognition sequences for restriction enzymes other than MIyI may be introduced into the transposon, providing that the appropriate routine modifications are made to the methods described herein and extra steps added if required. Such modifications are routine to the skilled person.
According to a third aspect of the invention, there is provided a plasmid having the DNA sequence shown in Figure 1, or a derivative of a plasmid having the DNA sequence shown in Figure 1. The term "a derivative of a plasmid having the DNA sequence shown in Figure 1" means a plasmid which has been adapted from the plasmid shown in Figure 1, for example by silent mutations in the DNA sequence, substitution of the bla gene with an alternative selectable marker, or by alteration of non-essential elements of the DNA sequence, such as sequences which do not form one of the essential elements of the plasmid such as the ori regions, the Multiple Cloning Site, or the bla gene. The term also includes the DNA sequence shown in Figure 1 with an additional DNA sequence of interest inserted at a point in the DNA sequence of Figure 1, preferably (but optionally) at the Multiple Cloning Site. The DNA sequence of a derivative of a plasmid having the DNA sequence shown in Figure 1 does not comprise the recognition sequence for the first restriction enzyme to be used in the method according to the first aspect of the invention, the derivative being intended for use in that method. The term "a derivative of a plasmid having the DNA sequence shown in Figure 1" is not intended to encompass the pUC18 plasmid. According to a fourth aspect of the invention, there is provided a kit comprising a transposon according to a second aspect of the invention. Preferably, the kit further comprises a plasmid according to the third aspect of the invention. The kit may yet further comprise a suitable transposase and/or buffers required for the enzymatic reactions and/or oligonucleotides suitable for use in screening and/or DNA sequencing procedures. Most preferably, the kit is for use in the method according to the first aspect of the invention.
According to a fifth aspect of the invention, there is provided a method of determining whether the introduction of a mutation into a target polypeptide alters a detectable activity of that polypeptide, comprising the method according to the first aspect of the invention and the further steps of: a) screening for a difference in the activity of the altered target polypeptide compared to the unaltered target polypeptide; and b) sequencing the altered target polypeptide to determine the location of the amino acid insertion, deletion or substitution.
Examples of a detectable activity include, where the protein is an enzyme, substrate binding activity; where the protein is an antibody, antigen binding activity; where the protein is a receptor, ligand binding activity. The skilled person will readily understand means by which the activity of other protein types can be assessed.
BRIEF DESCRIPTION OF THE DRAWINGS
Embodiments of the invention will now be described, by way of example only, with reference to Figures 1 - 10 in which:
Figure 1 shows the DNA sequence of pNOM (SEQ ID NO:100);
Figure 2 shows an outline of the triplet nucleotide deletion-insertion mutagenesis method;
Figure 3A shows the sequences of the engineered MuDeI and Mulns transposon termini, Figure 3B shows the mechanism for the introduction of a three nucleotide base pair deletion and Figure 3C shows the mechanism for the introduction of a three nucleotide base pair insertion;
Figure 4 shows an analysis of library BLADEL with Mlyl to determine the randomness of transposon insertion: (A) shows an illustration of the restriction analysis procedure; (B) shows the restriction analysis of 15 of the 22 BLADEL library members (the band labelled with an asterisk corresponds to the transposon); and (C) shows the position of the transposon insertion points in the 22 members of the BLADEL library as determined by DNA sequencing;
Figure 5 shows the determination of ampicillin MIC values for each selected member of library BLADEL;
Figure 6 shows the outline of the triplet nucleotide substitution mutagenesis method;
Figure 7 A shows the basic features of the SubSeq DNA element for substitution mutagenesis and Figure 7B shows the mechanism for the introduction of a three nucleotide base pair substitution;
Figure 8 shows the outline of the creation of a library of variants containing insertions of whole proteins, protein domains or fragments (such as epitopes) of protein domains;
Figure 9 A shows the features of the AT-2 based transposon suitable as an alternative to Mums and Figure 9B shows the mechanism by which the modified AT-2 transposon can be used to create a library of target genes with triplet nucleotide insertions; and
Figure 1OA shows the features of the Tn5InsOE and Tn5InsME transposons suitable as an alternative to Mulns and Figure 1OB shows the mechanism by which the Tn5InsOE and Tn5InsME transposons can be used to create a library of target gene with triplet nucleotide insertions. MODES OF CARRYING OUT THE INVENTION Materials
Bacterial strains: Escherichia coli DH5α (supE44, Δ/αcL/169, (φ80 /αcZΔM15), hsdRXl, recAl, endAl, gyrA96, thi-l, relAl).
Plasmids: pUC18, pEntranceposon (Camτ) (Finnzymes, Esboo, Finland) and pNOM.
Transposons: The transposons used for insertion-deletion mutagenesis are based on mini-Mu (CamR-3).
Antibiotics: Ampicillin and chloramphenicol (both Melford Laboratories, Ipswich, UK).
DNA-related enzymes: Taq DNA polymerase (Promega Corp., Madison, WI, USA), Extensor Hi-Fidelity PCR enzyme (Abgene, Epsom, UK), MyI, Xhόl, BgIR and Ndel restriction endonucleases (NE Biolabs, Beverly, MA, USA), T4 DNA ligase (Abgene), MuA transposase (Finnzymes), EZ-Tn5™ transposase (Epicentre, Madison, WI, USA).
Genes: BIa gene encoding TEM-I β-lactamase.
DNA purification kits: The isolation of plasmid DNA from cell cultures was performed using the Wizard® Plus SV kit from Promega Corp. DNA was isolated from agarose gel or PCR reactions using the Qiaquick™ Gel extraction or PCR purification kits, respectively, supplied by Qiagen Ltd, Crawley, UK.
Methods and Results
Example 1
This example illustrates how to create a library of variants containing triplet nucleotide deletions at random positions in the bla gene, as shown in Figure 2. In summary, the procedure consists of 4 main steps: Step 1 : The MuDeI transposon is inserted into the target plasmid or target gene. Step 2: Cells containing a plasmid-integrated MuDeI contain the Camκ gene and so can grow in the presence of chloramphenicol. The plasmids are isolated and pooled, and the transposon is removed by MIyI digestion. Step 3: Intramolecular ligation results in the reformation of the target gene, minus nucleotide base pairs.
Step 4: The resulting library is subjected to a selection or screen to select those variants with the required properties.
In Figure 2, hatched blocks represent the transposon, solid blocks the bla gene, gaps the deletion point (for the purposes of this Example), grey blocks the deletion point (for the purposes of this Example) in the re-ligated target gene and the thick dashed lines the rest of the plasmid backbone.
The procedure can also be applied to a target gene other than the bla gene, provided that:
1. there are suitable modifications to the selection or screening step at step 4 in Figure 2 that are suitable to the protein encoded by the target gene; and
2. any undesirable restriction sites are either not present or removed from the target gene.
Describing this example now in detail, a modified mini-Mu transposon and a newly constructed pNOM plasmid are used. In this example, the restriction endonuclease MIyI is critical to triplet nucleotide deletion but other restriction endonucleases with properties similar to that of MIyI can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
For the procedure to work, the target DNA or plasmid containing the target DNA must not contain any MIyI restriction sites. The recognition sequence of MIyI is only 5 bp in length, so many plasmids have at least one if not more MIyI restriction sites. For example, pUC18 has four MIyI restriction sites, including one in the bla gene, one in the pMBl origin of replication (ori) and another in the multiple cloning site (MCS). Construction ofpNOM
Therefore, a suitable plasmid was constructed that contained no Mlyl sites and a useful
MCS, this new vector being called pNOM. The majority of the plasmid was donated by pUC18, including the ori regions and bla gene. The Mlyl sites present in the bla gene were removed by the introduction of a silent mutation so as not to disrupt the primary structure of the TEM-I β-lactamase. Removal of the MZyI site from the ori region was achieved by creating a library in which two of the nucleotides that form the Mlyl recognition sequences were randomised, as it was unknown how rational mutations may affect plasmid replication. The MCS site was constructed to contain useful cloning sites.
Unless otherwise stated, all PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and its supplied buffers (Abgene). The pNOM plasmid was constructed from pUC18 and an artificial MCS. The -1 to 1979 bp region of ρUC18 was amplified by PCR in several stages, so as to remove any Mlyl restriction sites from the DNA sequences. The PCR reaction mixture was composed of 1 μl of 0.1 ng/μl of pUC18 as the template, 3 μl of 10 μM of suitable primer (see below for primer combinations), 3 μl of 2OmM dNTP mixture (composed of 5mM dATP, 5mM dTTP, 5mM dGTP and 5mM dCTP), 5 μl of the 10x Extensor buffer 1, 0.5 μl of 5 Units/μl Extensor Hi-Fidelity PCR enzyme mix and made up to 50 μl with sterile molecular biology quality water. In each case, PCR was performed as shown below:
Step l: 94°C for 2 min Step 2: 94°C for l0s Step 3: 550C for 30s Step 4: 68°C for 90s
Repeat steps 2 to 4 an additional 29 times Step 5: 680C for 7 min
Fragment Fl consisted of -1 to 989 bp of ρUC18 and was produced by PCR using single stranded DNA in the form of chemically synthesised oligonucleotides (referred to as 'primers') DDJdiOOό (5' GAAACtCGaGAGACGAAAGGGCCTCGTGATACG 3'; SEQ ID NO: 13) and DDM004 (5' CATCCATAGTTGCCTGACTgCCCGT CGTGTAGATAAC 3'; SEQ ID NO: 14), with lower case letters signifying nucleotides undergoing mutagenesis; DDJdiOOβ introduced an Xhόl site and DDM004 removed the Mlyl site from the bla gene.
Fragment F2 consisted of 972 to 1507 bp of ρUC18 and was produced by PCR using primers DDJdi003 (5' GTTATCTACACGACGGGcAGTCAGGC AACT ATGGATG 3'; SEQ ID NO: 15) and DDJdiOO8 (5' CCAACCCGGTAAGACAC 3'; SEQ ID NO: 16). DDJdi003 is complementary to DDJdi004 and the lower case letter signifies nucleotides undergoing mutagenesis.
Fragment F3 consisted of 1490 to 1979 bp of pUC18 and was produced by PCR using primers DDM007 (5' GTGTCTTACCGGGTTGGNNTCAAGACGATAGTT ACCGGA 3'; SEQ ID NO: 17) and DDM009 (5' cttcctcgctcatatgCTCGCTGC GCTCGGTCGTTCGGCTGC 3'; SEQ ID NO: 18). DDM007 contained two randomised nucleotides (i.e. any nucleotide at each position indicated as "N") corresponding to the MIyI site in the pMBl Ori origin of replication region of pUC18. DDM009 contained a Ndel recognition site towards its 5' end.
Fragments Fl, F2, and F3 were isolated and purified after agarose gel electrophoresis. Each of the fragments was spliced together in a single PCR reaction using DDJdiOOβ and DDJdi009 as the terminal primers to create fragment F4. The extension temperature at 680C was increased to 120 s in this PCR reaction. The 2005 bp product was isolated and purified after agarose gel electrophoresis. The fragment F4 was digested with Ndel and Xlτol endonuclease under the recommended conditions (50 mM NaCl, 10 mM Tris-HCl (pH 7.9), 10 mM MgCl2, 1 mM dithiothreitol (DTT) in the presence of 0.1 mg/ml bovine serum albumin (BSA)) and the DNA was purified from the restriction digestion mixture using the Qiagen Qiaquick™ PCR Purification kit.
Fragment F5 contained the new multiple cloning site (MCS) and is based on the MCS of pET22b. It was produced by PCR using primers pET-F (5' ATGCGTCCGGCGTAGAGGA 3'; SEQ ID NO: 19) and pET-R (5' GCTAG TTATTGCTCAGCGGTG 3'; SEQ ID NO:20) and pET24b as the template, using standard PCR conditions except that the extension time at 68°C was 60 s. The resulting 351 bp product was purified and was digested with Ndel anάXhol followed by isolation and purification after gel electrophoresis.
The NdeUXhoI digested F4 and F5 fragments were ligated together at 25°C using 1 μl of 3 U/μl T4 DNA ligase (Promega Corp.) under the conditions recommended by the manufacturer (30 niM Tris-HCL (pH7.8), 10 mM MgCl2, 10 mM DTT and 1 mM ATP) and V10 of the ligation mixture was used to transform 50 μl of E. coli DH5α by electroporation using a Biorad Gene Pulser™ (Bio-Rad Laboratories, Hemel Hempstead, UK). 500 μl of SOC medium was added to the cells immediately after electroporation and the cells were incubated at 37°C for 1 hr. Approximately 50 and 500 μl of the recovering electroporated E. coli DH5α cells were spread on LB agar plates containing 100 μg/ml ampicillin and incubated at 370C overnight. The correct ligation of fragments F4 and F5 represent the creation of the pNOM plasmid.
Five individual E. coli DH5α colonies capable of growth in the presence of 100 μg/ml ampicillin were picked and transferred to 5 ml of LB broth containing 100 μg/ml ampicillin and the cultures incubated at 37°C overnight in a rotary shaker. The plasmid DNA from three of the five cultures was purified. The plasmid DNA was subjected to restriction analysis with either Ndel or MIyI to confirm the nature of the plasmid and that all the MIyI sites had been removed. One clone was selected to act as the source of pNOM and DDJdiOO3 and DDJdi009 were used to amplify the On region by PCR to confirm the mutations due to the NN nucleotides in DDJdi007. Sequencing of this region was not possible but restriction analysis with MIyI reconfirmed that this region did not have a MIyI site. The DNA sequence of pNOM is shown in Figure 1.
Construction of MuDeI
The original Mu phage-derived transposon, mini-Mu (CamR-3), was engineered for use in the creation of random triplet nucleotide deletions. In this case, the CamR gene is used as a selectable marker within the transposon. This can be exchanged for another gene that will provide a chosen strain of E. coli or any other suitable organism with a selection advantage under a particular condition so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence. The ability to delete nucleotide triplets depends on the transposon insertion mechanism and the position of two introduced restriction sites, as outlined in Figure 3. The mini- Mu transposon was engineered so as to act as a vehicle for the insertion of specific restriction sites into the target gene (Figure 3A). The restriction endonuclease chosen was MIyI, a type IIS enzyme that cuts 5 bp outside its recognition sequence to generate a blunt end (cleavage profile 5' GAGTC(Ns)4- 3'). The MIyI recognition site is to be placed 1 bp away from the site of transposon insertion, so creating MuDeI (Figure 3A). The two required point mutations both lie outside the Rl region that is involved in MuA binding, so minimising disruption to the protein-DNA interactions that can potentially affect the efficiency of the transposition reaction. Transposition of MuDeI will occur via a 5 bp staggered cut in the target DNA that, following E. coli gap repair, results in the duplication of these 5 bp (Figure 3B). Digestion of the DNA with MIyI removes the transposon along with four additional nucleotide base pairs from the target gene at both termini. Intramolecular ligation of the two blunt ends results in the in- frame deletion of 3 nucleotides from the target gene (Figure 3B).
Unless otherwise stated, all PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and performed as described above. The MuDeI transposon was constructed by PCR using the oligonucleotide DDJdi005 (5' GCTTAGATCTGActCGGCGCACGAAAAACGCGAAAG 3' (SEQ ID NO:21); lower case letters signify nucleotides undergoing mutagenesis) as both the forward and reverse primer with 0.1 ng of the original mini-Mu (Camκ-3) transposon acting as template. The 1322 bp product was purified and digested with BgHI at 37°C (reaction conditions: 100 mM NaCl, 50 mM Tris HCl (pH 7.9), 10 mM MgCl2, 1 mM DTT). The digested transposon was isolated and purified after agarose gel electrophoresis. The DNA representing the new transposon MuDeI was recloned by ligation into BgHI digested pEntranceposon (CamR) using T4 DNA ligase, and Vi o of the ligation mixture was used to transform 50 μl of E. coli DH5α by electroporation using a Biorad Gene Pulser™. 500 μl of SOC medium was added to the cells immediately after electroporation and the cells were incubated at 370C for 1 hr. Approximately 50 and 500 μl of the recovering electroporated E. coli DH5α cells were spread on LB agar plates containing 20 μg/ml chloramphenicol and incubated at 37°C overnight. Six individual E. coli DH5α colonies capable of growth in the presence of 20 μg/ml chloramphenicol were replica plated on another LB agar plate containing 20 μg/ml chloramphenicol. Part of the original colony was used as the source of template DNA in a PCR reaction using Taq DNA polymerase as the thermostable enzyme, and pUC-F (5' AGCTGGCGAAAGGGGGATGTG 3'; SEQ ID NO:22) and pUC-R (5' TTATGCTTCCGGCTCGTATGTTGTGT 3'; SEQ ID NO:23) as the primers. PCR was performed using the conditions stated above for Taq DNA polymerase. The PCR mixture contained 5 μl of 1Ox reaction buffer (100 rnM Tris-HCl (pH 9.0), 500 mM KCL, 1% Triton X-100), 3 μl 25 mM MgCl2, 3 μl 20 mM dNTPs, 1.5 μl 10 μM oligonucleotide primer, an appropriate E. coli colony and 0.5 μl of 5 U/μl Taq DNA polymerase. The reaction mixtures were made up to 50 μl with molecular biology quality water. The reaction mixtures were subjected to the following thermocycling conditions:
Step 1 : 94°C for 3 min followed by addition of 0.5 μl Taq DNA polymerase Step 2: 94°C for 20s Step 3: 550C for 20s Step 4: 72°C for 90s
Steps 2 to 4 repeated an additional 29 times Step 5: 720C for 5 min.
The 1504 bp product was purified and digested with Mlyl at 37°C (reaction conditions: 50 mM potassium acetate, 2OmM Tris-acetate, 1OmM magnesium acetate, ImM DTT (pH 7.9), supplemented with 100 μg/ml BSA) and analysed by agarose gel electrophoresis to confirm the presence of the Mlyl recognition sequence. The colonies containing the MuDeI transposon were transferred to 5 ml of LB broth containing 100 μg/ml ampicillin and the cultures incubated at 37°C overnight in a rotary shaker and the plasmid DNA was purified. The plasmid DNA was sequenced using primers pUC-F and pUC-R to confirm the sequence of MuDeI. The MuDeI transposon was released from the context of the plasmid by digestion with Bgϊll under the conditions stated above and purified after agarose gel electrophoresis. Transposition reaction and transformation into E. coli cells
Transposition with mini-Mu and the MuDeI transposon was performed at 30°C for 3 hr followed by heat inactivation at 75°C for 10 min. The reaction mixture was composed of 2 μl of reaction buffer (125 mM Tris-HCl, pH 8.0, 125 mM MgCl2, 50 mM NaCl, 0.25% Triton X-100 and 50% (v/v) glycerol), 1 μl of 0.22 μg/ml MuA transposase and varying quantities of target DNA and transposon as quoted below. The efficiency of the transposition reaction using MuDeI was tested using the control DNA template supplied by Finnzyrnes (pUC19 containing a 6.6 kbp HmdIII fragment of bacteriophage λ DNA cloned into the HmdIII site) and pUC18. The pNOM plasmid was used in the construction of libraries. Either 360 ng (control DNA) or 100 ng (pUC18 or pNOM) of target plasmid DNA and either mini-Mu (CamR-3) (20 ng) or MuDeI (20 ng or 100 ng) were present in the reaction mixture. The reactions were left at 30°C for 3 hr followed by heat inactivation at 750C for 10 min. Either 1 μl or 2 μl were used to transform E. coli DΗ5α cells by electroporation and the cells were plated on LB agar containing 20 μg/ml chloramphenicol to select for cells containing the CamR gene and hence the mini-Mu or MuDeI transposon.
To test if the introduced mutations disrupted transposition efficiency, pUC18 was used as the target DNA substrate. The transposition reaction with mini-Mu transposon (20 ng) resulted in the growth of approximately 99 E. coli DH5α colonies on 20 μg/ml chloramphenicol plates after transformation by electroporation with Vi o (2 μl) the transposition reaction mixture. Replacing the mini-Mu transposon with either 20 ng or
100 ng of MuDeI resulted in the growth of approximately 100 and 430 colonies, respectively. Surprisingly, therefore, MuDeI still acts as an efficient substrate for the transposition reaction, despite the introduction of mutations at the termini of the transposon.
As mentioned, the general outline of the method for the creation of triplet nucleotide deletions at random positions within a target gene is shown in Figure 2. The bla gene that encodes TEM-I β-lactamase was chosen as the target as it is a clinically important enzyme responsible for resistance to some β-lactam antibiotics and mutagenesis of the enzyme can lead to resistance to new ES β-lactams. It also provides an easy selection method, as active variants will confer resistance to ampicillin on E. coli so permitting cell growth. The new vector, pNOM, was used as the source of the bla gene and therefore acts as the target DNA for MuDeI insertion
As an alternative to the above description, the gene of interest independent of pNOM can be used as the target for transposon insertion. If required, the gene of interest can be cloned into pNOM or another suitable vector using standard techniques after transposon insertion. Alternatively, after transposon insertion into the gene of interest, the gaps present in the DNA strands formed as a result of the transposition reaction that are normally repaired in the organism can be repaired in vitro using the appropriate gap repair and ligation techniques.
The place of insertion of MuDeI into pNOM should be distributed evenly throughout the plasmid and so a strategy is required that will select for cells containing MuDeI inserted into the bla gene region. The transposition of the MuDeI transposon into the plasmid DNA confers resistance to chloramphenicol on E. coli, allowing for selection of cells containing MuDel-inserted pNOM. Those colonies that have MuDeI inserted within the bla gene region will disrupt TΕM-1 expression and thus affect the cells' ability to grow in the presence of ampicillin.
Selection of colonies with transposon-disrupted bla gene
After transformation of E. coli DH5α with the transposition mixture, 48 colonies were selected that grew on 20 μg/ml chloramphenicol and replated on both a 100 μg/ml ampicillin and a 20 μg/ml chloramphenicol LB agar plates. Of the 48 colonies, 22 grew only on the chloramphenicol plate and were deemed to have a disrupted bla gene due to transposon insertion in this region and therefore chosen as the members of the BLADΕL library. To confirm the presence of the MuDeI transposon, PCR was performed on each of the 22 colonies using Taq DNA polymerase (method described above) and primers DDJdiOlO (5' TCCGCTCATGAGACAATAACCCTG 3'; SEQ ID NO:24) and DDJdiOll (5' CTACGGGGTCTGACGCTCAGTG 3'; SEQ ID NO.25) that flank the bla gene. Restriction analysis and selection of clones including inserted transposon The PCR products were purified and restriction analysis was performed with Mlyl (reaction conditions described previously) to confirm the diversity of transposon insertion positions (Figure 4). Digestion of the linear PCR fragment (containing only the bla gene regions of pNOM) with Mlyl results in the removal of the MuDeI transposon and 8 bp of the bla gene (1310 bp), generating two fragments of varying length, depending on the MuDeI insertion point (Figure 4A). The restriction analysis revealed that the insertion of MuDeI occurred randomly and only one transposon was inserted in this region (Figure 4B - lanes 1 to 8 and 10 to 16 represent different members of the BLADEL library and lane 9 is the φl74 DNA-HαeIII molecular weight ladder. The band labelled with an asterisk corresponds to the transposon). Mass analysis of the two smaller fragments from each lane confirmed that the cumulative size of the two fragments was approximately equal to that of the PCR product minus MuDeI. The 22 PCR products were sequenced using DDJdiOlO and DDJdiOll as the primers to determine the position of the transposon within the bla gene. Sequence analysis confirmed the restriction analysis that the transposon insertion occurred at random positions within the bla gene, indicated by vertical lines in Figure 4C.
The MuDel-inserted pNOM plasmids were isolated from each of the 22 colonies and equal amounts of each plasmid were pooled and subjected to restriction digestion with Mlyl followed by agarose gel electrophoresis. The band corresponding to the linear pNOM minus MuDeI was isolated and purified after agarose gel electrophoresis. Intramolecular ligation was performed using T4 DNA ligase and approximately 10 ng of linear pNOM (reaction conditions described above). The reaction was left at 250C for 10 min followed by 10 hr at 16°C. E. coli DΗ5α cells were transformed by electroporation with 1 μl of the ligation mixture. 500 μl of SOC medium was added to the cells immediately after electroporation and the cells were incubated at 370C for 1 hr. 50 μl and 500 μl of the recovering transformed cell cultures were plated on LB agar plates containing 15 μg/ml ampicillin. The plates were left overnight at 37°C and 94 BLADEL library and two pNOM-containing colonies were selected and transferred to 96 deep-well culture plates containing 200 μl LB medium and 15 μg/ml ampicillin. The cells were grown for 16 hr at 37°C with vigorous shaking. Sterile glycerol was added to 10% (v/v) for storage at -800C. Effect of mutations on TEM-I β-lactamase activity
The TEM-I β-lactamase activity of each colony was measured in vivo by determining the minimum inhibitory concentration (MIC) of ampicillin that prevents E. coli growth. Each colony in the 96 well plates was replica plated on LB agar in Nunc Omnitray™ plates containing 50, 100, 500, 2500, 5000, 7500 or 10000 μg/ml Amp using a 96 prong replication fork and incubated at 370C for 16 hr.
The MIC of each original colony for ampicillin is shown in Figure 5, showing the determination of ampicillin MIC values for each selected member of library BLADEL 5 with the 96 well microplate format used to label rows (A-H) and columns (1-12). The values in the boxes represent ampicillin MIC values of 500, 2500, 5000 and 10,000 μg/ml or >10,000 μg/ml. Boxes marked with an X following the number indicates variants with bla gene sequence information. All the cells grew at both 50 and 100 μg/ml ampicillin. Fourteen had a MIC of 500 μg/ml indicating reduced TEM-I activity. Only six had a MIC of 2500 μg/ml and 30 had a MIC of 5000 μg/ml. No variants had a MIC at 7500 μg/ml ampicillin and the growth of 15 variants was inhibited at 10000 μg/ml Amp. The remaining 31 colonies were still viable at 10000 μg/ml Amp, including the two wild-type pNOM controls. Such a spread of MIC values indicates that various 3 nucleotide base pair deletion mutations have been incorporated into the bla gene and have had a profound effect on the in vivo activity of TEM-I.
Several clones that exhibited MIC at each Amp concentration were subjected to PCR with primers DDJdiOlO and DDJdiOl l and Taq DNA polymerase. The 1067 bp PCR products were sequenced with DDJdiOlO and DDJdiOll as sequencing primers to confirm the position of triplet nucleotide deletion.
The point of insertion of MuDeI with respect to a single codon will determine the nature of the deletion. The three possibilities are shown in columns 1, 4 and 5 of Table 1. One third of all insertions will create a true deletion of a codon. In the other two thirds, the 3 nucleotide base pairs removed will overlap two codons that may result in a secondary point mutation. The nature of the secondary mutation will vary depending on the surrounding DNA sequence. Due to the degeneracy of the genetic code, some of the point mutations will be silent while others will result in amino acid substitutions.
Table 1. The potential outcomes with respect to the insertion of MuDeI at the three different positions within a codon (columns 4 & 5) and insertion of Mulns at the three different positions within a codon (columns 2 & 3 - see Example 2 below).
Several hla genes were isolated from clones exhibiting specific ampicillin MICs and sequenced to confirm the position of the amino acid deletion and if any secondary mutations have occurred. Table 2 shows all the different sequences isolated from active TEM-I variants of library BLADEL.
Table 2. The determined 3 base pair deletions. The 5 bp duplicated in during transposon insertion are shown in bold. The amino acid sequences are numbered using the recommended numbering systems (Ambler, R.P. et al. (1991) Biochem J. 276 ( Pt 1) 269-270). The new codons generated after deletion are underlined. Δ after an amino acid residue number signifies that the residue has been deleted. Of the 22 potentially different mutations, 8 were identified under this selection criterion as being tolerated by TEM-I. Two of the eight (R83Δ and R275Δ; Δ denotes the residue deleted) were true codon deletions. Three of the sequences (T114Δ, G196Δ and A217Δ) did not generate true deletions at the genetic level but, due to the degeneracy of the genetic code, no amino acid substitutions resulted. Three of the sequences (P62Δ-E63Q, T114Δ-D115N and E177Δ-R178D) contained a secondary mutation. The MuDeI insertion point with respect to a single codon is evenly distributed (2:3:3) as expected (Table 2). No other mutations were observed for any of the sequenced variants and no wild-type TEM-I was detected.
The sequences were spread across the whole length of the primary structure of TEM-I with varying affects on the in vivo activity. Two mutations, T114Δ and T114Δ-D115N were only separated by a transposon insertion position of 2 nucleotide base pairs (Table
2).
There was a good correlation between the sequences and the ampicillin MIC (Table 3). The P62Δ-E63Q, R83Δ and E177Δ-R176D containing variants all had a MIC of 500 μg/ml. The T114Δ and T114Δ-D115N variants spanned both the 2500 μg/ml and 5000 μg/ml values with multiple clones identified at each concentration. The R275Δ variant has a relatively high MIC for amp (5000 μg/ml) even though the deletion takes place within a helix. Both A217Δ and G196Δ have very little effect on in vivo activity, with the Gl 96A still able confer resistance on E. coli to Amp at 10000 μg/ml. One clone with the G196Δ TEM-I variant did exhibit a MIC of 10000 μg/ml ampicillin but it is unknown why, as the general trend for the G196Δ variant (6 out of 7 sequenced; Table 3) indicated that cells with this variant could grow at ampicillin concentrations of 10000 μg/ml.
Table 3. The relationship between Amp MIC and the nature of the deletion mutation. No cell had a MIC at 100 or 7500 μg/ml. The frequency refers to the number of sequenced bla genes with that mutation at that particular Amp MIC value. The location of the mutation with regards to the secondary structure (see Jelsch, C, et al. (Proteins (1993) 16 364-383) for nomenclature) is also shown. The residues are numbered using the recommended numbering systems (Ambler, R.P. et al. (1991)).
Example 2 This example illustrates how to create a library of variants containing triplet nucleotide insertions at random positions in the target gene of interest using the transposon-based technology as outlined in Example 1. This example uses a modified mini-Mu transposon and the newly constructed pNOM plasmid or a suitable derivative of the pNQM plasmid. In this example, the restriction endonuclease MIyI is critical to triplet nucleotide insertion but other restriction endonucleases with properties similar to that of Mlyl can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
This example follows the procedure outlined in Example 1 and Figure 2. In Figure 2, for the purposes of this Example, gaps and grey blocks represent the insertion point. The main difference is with respect to the mini-Mu transposon. The original Mu phage- derived transposon, mini-Mu (Camκ-3), is engineered for the creation of random triplet nucleotide insertions. In this case, the CamR gene is used as a selectable marker within the engineered Mu transposon. Providing the correct elements are present at the termini of the transposon to allow transposition, the Cam^ gene may be exchanged for another gene that will provide a chosen strain of E. coli or any other suitable organism with a selection advantage under a particular condition so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence.
The engineered transposon, known as Mums, contains the Mlyi restriction site but its position was shifted to 4 nucleotide base pairs away from the site of transposon insertion (Figure 3A). The mechanism for triplet nucleotide insertion follows a similar path to that in Example 1 and is outlined in Figure 3C. Transposon insertion results in a five bp duplication after gap repair in E. coli (the 4 bp overhang from the transposon is removed). The cleavage site of Mlyl is 5 bp away from the recognition sequence resulting in the removal of 1 bp of the target gene at both ends. Ligation of the two termini rejoins the gene but with the addition of 3 nucleotide base pairs. The three nucleotide base pairs inserted are shown in bold in Figure 3C. The point of insertion of Mulns with respect to a single codon will determine the nature of the insertion. The three possibilities are shown in columns 1, 2 and 3 of Table 1 above.
The transposon was used in the same manner as with the MuDeI and the same approach was taken: insertion of the transposon into the target gene; selection for the transposon- inserted target gene; removal of the transposon by restriction digestion; intramolecular ligation; transformation into a suitable organism; select or screen a library of target gene variants with a triplet nucleotide insertion.
Example 3
This example illustrates how to create a library of variants containing triplet nucleotide substitutions at random positions in the target gene of interest using the transposon- based technology as outlined in Example 1. This example uses the MuDeI transposon (as outlined in Example 1) and the newly constructed pNOM plasmid or a suitable derivative of the pNOM plasmid. In this example, the restriction endonuclease Mlyl is critical to triplet nucleotide substitution but other restriction endonucleases with properties similar to that of Mlyl can be used providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
The example follows the procedure that is outlined in Figure 6 and is similar to the procedure outlined in Example 1. Both pNOM and MuDeI are as outlined in Example 1. The MuDeI was used in the same manner as in Example 1 and the same approach was taken: insertion of the transposon into the target gene; selection for the transposon- inserted target gene; removal of the transposon by restriction digestion. The next stage differs from Example 1 in that the intramolecular ligation was replaced by an intermolecular ligation, as outlined in Figure 6. At Step 3, intramolecular ligation is replaced by the intermolecular ligation of an artificial DNA sequence (e.g. SubSeq; see Figure 7). The target DNA sequence containing the artificial DNA sequence is selected for using a selectable marker present in the artificial DNA sequence and the plasmid DNA isolated and digested with Mlyl (Step 4 of Figure 6). Intramolecular ligation results in the reformation of the bla gene, with three nucleotide base pairs substituted (Step 5). The resulting library is subjected to a selection or screen to select those variants with the required properties.
In Figure 6, hatched blocks represent the transposon, black blocks the target gene, speckled blocks the artificial DNA sequence, grey blocks the substitution point and the thick dashed lines the rest of the plasmid backbone. A new DNA sequence was inserted using standard DNA ligation techniques to contain a DNA element with the properties as illustrated in Figure 7A. The two different termini of the DNA sequence are marked TERM-I and TERM-2 in Figure 7 A. The last three nucleotide base pairs of TERM-2 can be a defined triplet sequence, fully random (that is every position can have the four possible nucleotides) or semi-random (that is that some positions may have the nucleotide allowed restricted). The gene that encodes the selectable marker is located between TERM-I and TERM-2. The mechanism used is outlined in Figure 7B. MuDeI transposon insertion results in a five bp duplication after gap repair in E. coli. The cleavage site of Mlyl is 1 bp away from the recognition sequence resulting in the removal of 4 bp of the target gene at both ends, deleting the equivalent of 3 nucleotide base pairs from the target gene. The SubSeq DNA is ligated into the target gene at the cleavage point and those target genes with SubSeq inserted within them are selected using the selectable marker after transformation. Digestion of the SubSeq inserted target gene with Mlyl results in the removal of SubSeq DNA except for the last three nucleotide base pairs at TERM-2. Intramolecular ligation results the reformation of the target gene but with three nucleotide base pairs replaced. The three substituted nucleotide base pairs are shown in bold.
Creation of SubSeq
The DNA element described in Figure 7 (from hereon known as SubSeq) contains two Mlyl sites, but other restriction endonucleases with properties similar to that of Mlyl can be used providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person. One Mlyl site was placed 5 bp from one terminal of the DNA sequence (from hereon known as TERM-I) and the other Mlyl site was placed 8 bp away from the other terminal (from hereon known as TERM-2). Linking the two Mlyl sites is an appropriate selectable marker gene that provides a chosen strain of E. coli or any other suitable organism with a selection advantage under a particular condition, so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the SubSeq DNA element. The last three nucleotide base pairs of TERM-2 can be a defined triplet sequence, fully random (that is every position can have the four possible nucleotides) or semi-random (in that some positions may have the nucleotide allowed restricted).
Unless otherwise stated, all PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and performed as described above. The SubSeq DNA element was constructed by PCR using the oligonucleotide primers DDM017 (5' Phos- CGACCGACTCAAT ACCTGTGACGGAAGATC 3' (SEQ ID NO:47); "Phos" signifies a phosphorylated nucleotide) and DDJdiOlδ (5' Phos-NNNAACTGGaC TCAGGCATTTGAGAAGCACAC 3' (SEQ ID NO.48); "Phos" signifies a phosphorylated nucleotide and "N" signifies any oligonucleotide) as the forward and reverse primers with 0.1 ng of the original mini-Mu (CamR-3) transposon acting as template, to create SubSeq. The 1095 bp PCR product was purified. Creation and sequencing of amino acid substitution library
An expanded library based on that created in Example 1 was used in this example. This expanded library contained up to 176 clones with MuDeI inserted within the Ua gene. The colonies containing MuDeI within the bla gene of pNOM were pooled and plasmid DNA isolated as outlined in Example 1. The purified plasmid library was cut with MTyI and linear pNOM plasmid minus MuDeI was isolated and purified after agarose gel electrophoresis as outlined in the Example 1. Prior to agarose gel electrophoresis, the plasmid DNA was dephosphorylated using calf intestinal alkaline phosphatase (NE BioLabs).
The SubSeq DNA sequence (50 ng) created as outlined above was ligated into the M/yl-digested pNOM (approx. 30 ng) using T4 DNA ligase. Up to 2 μl of the ligation mix was used to transform E. coli DH5α cells by electroporation and the cells plated on 20 μg/ml chloramphenicol LB agar plates to select for cells containing SubSeq inserted within the bla gene of pNOM. 192 colonies were selected at random from the chloramphenicol LB agar plates and grown in 96 deep-well culture plates containing 20 μg/ml chloramphenicol LB broth. Equal volumes were taken out of each well and pooled together.
The SubSeq-containing pNOM library was purified from cells as outlined in Example 1. Approximately 2 μg of the library was subjected to MIyI digestion as outlined above. That digestion removed SubSeq, resulting in the replacement of the 3 bp of the wild- type bla gene that were deleted on removal of MuDeI earlier in the procedure. The band corresponding to linear pNOM (2115 bp) was isolated and purified after agarose gel electrophoresis.
The library of linear pNOM plasmids (10 ng) was subjected to intramolecular ligation using T4 DNA ligase (as described above) to rejoin the ends of the plasmid and constituted the BLASUB library. One tenth of the ligation mixture was used to transform DH5α and the cells plated on 15 μg/ml ampicillin LB agar plates to select for active TEM-I β-lactamase variants. More than 1000 colonies grew on the plate. PCR using Taq DNA polymerase was performed on several randomly chosen colonies capable of growth on 15 μg/ml ampicillin using primers DDJdiOlO and DDJdiOl l, as outlined in Example 1. The size of each of the products was 1070 bp, as expected. The DNA produced by the PCR were purified and sequenced using the oligonucleotide DDJdiOlO as the primer. The exact nature of the mutations are shown in Table 4. This data shows that the amino acid substitutions can be incorporated at random positions in a protein using this transposon-based technology.
Table 4. Sequence analysis of the bla gene with 3 bp substitution at random positions. The nucleotide base pairs exchanged are shown in bold. The change with relation to the amino acid sequence is also shown, with the amino acid sequences numbered using the recommended numbering systems (Ambler, R.P. et at (1991) Biochem J. 276 ( Pt 1) 269-270).
Example 4
This example is an expansion on example 3 and incorporates additional features into the SubSeq DNA sequence. Example 4 follows the same steps as outlined in Example 3 except for the differences described. The main difference is the nature of the SubSeq DNA element.
In this alternative to Example 3, the MIyI sites at TERM-I and/or TERM-2 were shifted within the SubSeq sequence. Shifting the Mlyl sequences to the appropriate positions can result in:
(i) Further deletion of another triplet or multiple triplet nucleotides; (ii) Substitution of a triplet (3) nucleotide sequence with a quadruplet (4) nucleotide sequence; (iii) Further insertion of another triplet or multiple triplet nucleotides.
Example 5
This example illustrates how to create a library of variants containing insertions of amino acid sequences (e.g. whole proteins, protein domains or fragments (such as epitopes) of protein domains) at a random position in the target protein of interest using the transposon-based technology as outlined in Example 1. This example uses the MuDeI transposon (Example 1) and the newly constructed pNOM plasmid, or a suitable derivative of the pNOM plasmid. Other transposons described in this specification can also be used in the procedure, with suitable modifications to the procedure, as will be understood by the skilled person. In this example, the restriction endonuclease MIyI is critical to domain insertion but other restriction endonucleases with properties similar to that of MIyI can be used providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person.
The example follows the procedure outlined in Figure 8 and is similar to the procedure outlined in Example 1. As before, the procedure comprises 4 main steps: Step 1 : The MuDeI transposon (hatched blocks in Figure 8) is inserted into the target plasmid or target gene.
Step 2: Cells containing a plasmid-integrated MuDeI are selected using the properties of the selectable marker gene. The plasmids are isolated and pooled, and the transposon is removed by MIyI digestion. Step 3: The DNA sequence (clear blocks in Figure 8) is inserted into the target gene. In this case, the DNA to be inserted is the gene cybC which encodes the protein cytochrome 6562 (from hereon known as cyt b).
Step 4: The library is subjected to a selection or screening step that is suitable to identify proteins encoded by the chimeric gene with the desired properties.
Both pNOM and MuDeI are identical to that as outlined in previous examples. MuDeI was used in the same manner as in Examples 1 and 3 and the same approach was taken: insertion of the transposon into the target gene; selection for the transposon-inserted target gene; removal of the transposon by restriction digestion. The library of MuDeI inserted within the bla gene of pNOM used in this example is identical to that used in Example 3. The production of linear, dephosphorylated pNOM minus MuDeI is exactly same as outlined in Example 3.
Construction of the Cyt b insert.
Three different versions of the cybC gene that encode cyt b were created. As outlined in Example 1, the transposon can insert at three different positions with respect to one codon. As the introduced single break after transposon removal can occur at three different positions with respect to a single codon, the use of only a single open reading frame (ORF) for the cybC gene insert would make 2/3 of the library redundant due to frameshifts. Therefore, two further versions of cybC were used with additional bases added to both ends to allow the sampling of all three ORFs. These constituted three separate libraries. Furthermore, for TEM-I to tolerate the insertion of cyt b, a short linker may be required at one or both connection points. Therefore, each ORF version of cybC was composed of four different sequences that encode cyt b with either no linker or a linker sequence encoded in the primer oligonucleotides listed below, at either one or both termini of the gene.
Unless otherwise stated, all PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and its supplied buffers, as outlined above. Each ORF library of the cybC gene (ORFI, ORFII and ORFIII) was constructed using PCR using the cybC gene as the template as follows:
ORFI: Forward primers DDJlacB005 (5' GCAGATCTTGAAGACAATATGGA 3'; SEQ ID NO:69), DDJdiO23 (5' ggcggtagcGCAGATCTTGAAGACAATATGGA (SEQ ID NO:70); lowercase letters signify nucleotides encoding the linking regions) and reverse primers DDJlacBOOβ (5' CCTATACTTCTGGTGATAGGCGT; SEQ ID NO:71) and DDM024 (5' gctgccaccCCTATACT TCTGGTGATAGGCGT (SEQ ID NO:72); lowercase letters signify nucleotides encoding the linking regions).
ORFII: Forward primers DDJdiO19 (5' CGCAGATCTTGAAGACAATATGGA 3' (SEQ ID NO:73); underlined nucleotides are extra nucleotides used to maintain the ORF) and DDJdiO25 (5' CggcggtagcGCAGATCTTGAAGACAATATGGA 3' (SEQ ID NO: 74); underlined nucleotides are extra nucleotides used to maintain the ORF and lowercase letters signify nucleotides encoding the linking regions), and reverse primers DDJdi020 (5' CTATACTTCTGGTGATAGGCGT 3'; SEQ ID NO:75) and DDJdiO26 (5' ctgccaccCCTATACTTCTGGTGAT AGGCGT 3' (SEQ ID NO:76); lowercase letters signify nucleotides encoding the linking regions).
ORFIII: Forward primers DDJdiO21 (5' CTGCAGATCTTGAAGAC AATATGGA 3' (SEQ ID NO: 77); underlined nucleotides are extra nucleotides used to maintain the ORF) and DDM027 (5' CJggcggtagcGCAGATCTTGAAGACAATATGGA 3' (SEQ ID NO:78); underlined nucleotides are extra nucleotides used to maintain the ORF and lowercase letters signify nucleotides encoding the linking regions) and reverse primers DDJdiO22 (5' TATACTTCTGGTGATAGGCGT 3'; SEQ ID NO:79) and DDJdiO28 (5' tgccaccCCTATACTTCTGGTGATAGGCGT 3' (SEQ ID NO:80); lowercase letters signify nucleotides encoding the linking regions).
The 318-336 bp products were purified and a 5' phosphate group added to the PCR product using 20 units of T4 polynucleotide kinase in the T4 DNA ligase (NE Biolabs) reaction buffer.
Creation and sequencing ofcybC insertion libraries.
The next stage differs from Example 1 and more closely follows Example 3, in that the intramolecular ligation is replaced by an intermolecular ligation, as outlined in Figure 8. Instead of SubSeq being inserted at random positions of the bla gene, as in Example 3, the ORF libraries of cybC are inserted. Although cybC is inserted in this case, any DNA element that encodes either a whole gene, gene segment equivalent to a protein domain, gene segment equivalent to partial amino acid sequence of a whole protein or domain of a protein (for example an epitope), or any other amino acid sequence could be used.
An expanded library, based on that created in Example 1, that was used in Example 3 was also used in this example. This expanded library contained up to 176 clones with MuDeI inserted within the bla gene. The colonies containing MuDeI within the bla gene of pNOM were pooled and plasmid DNA isolated as outlined in Example 1. The purified plasmid library was cut with MIyI and linear pNOM plasmid minus MuDeI was isolated and purified after agarose gel electrophoresis as outlined in the Example 1. Prior to agarose gel electrophoresis, the plasmid DNA was dephosphorylated using calf intestinal alkaline phosphatase.
The three ORF libraries of cybC (50 ng) created above were ligated separately into the Mfyl-digested pNOM (circa 30 ng) using T4 DNA ligase. Up to 2 μl of the ligation mix of each reaction was used to transform E. coli DH5α cells by electroporation and the cells plated on 15 μg/ml ampicillin LB agar plates to select for cells containing active chimeric cyt b-TEM-1 proteins. Only 8 colonies grew on the control plate (cells transformed with a ligation containing no ORF library insert), whereas 45, 130 and 150 colonies grew on the plate representing ORFI, ORFII and ORFIII cybC libraries, respectively.
PCR using Taq DNA polymerase was performed on 10, 15 and 10 randomly chosen colonies from the plates representing ORFI, ORFII and ORFIII, respectively, using primers DDJdiOlO and DDJdiOl l, as outlined in Example 1. The size of the products ranged from 1300 bp to 1600 bp. The DNA produced by the PCR were purified and sequenced using the oligonucleotide DDJdiOlO as the primer. The exact nature of the mutations are shown in Table 5. Some of the chimeras contained two cybC genes inserted in tandem at the same position in the bla gene. This data shows that the domain insertions can be incorporated at random positions in a protein using this transposon based-technology.
Table 5. Sequence analysis of the bla-cybC gene chimeras. The ORF columns refers to the ORF library from which the genes where isolated. The 4 refers to the point of insertion in either the bla gene or TEM-I proteins. The N- and C-terminal linker columns refer to the amino acid sequence that links TEM- 1 with cyt b. Those ORFs marked with an * indicate genes with a tandem insertion of cybC within bla. Several of the C-terminal linker sequences could not be determined due to poor sequence data at these regions as a result of low signal because of the distance away from the priming site.
The skilled person will understand that the method outlined in this Example can be used as a tool to create domain insertion so as to generate a molecular switch, as outlined in the "Background" section above.
Example 6 This example describes alternatives to the Mulns transposon in the previous examples. In every previous example containing Mulns, the new transposon sequences described below replace Mulns in the scheme, together with the suitable changes in the procedure that will allow transposition to occur.
In the first instance, the AT-2 transposon, described by Devine & Boeke (Nucleic Acid Res. (1994) 22 3765-3772) was modified, as shown in Figure 9A. The AT-2 transposon shows similar characteristics to mini-Mu and efficient transposition can be performed in vitro. The main difference is that the transposase recognition site consists of only the terminal four nucleotide base pairs. Placing the Mlyl recognition site directly after this sequence allows insertion mutagenesis to proceed by the mechanism outlined in Figure 9B, without disruption to the transposition efficiency (inserted nucleotides are shown in bold). A selectable marker is present within the transposon between the two termini as illustrated in Figure 9A. The U3 sequences identified by the TyI integrase are indicated. A gene encoding a selectable marker will reside between the two terminal U3 and Mlyl recognition sequences. The selectable marker is a gene that provides a chosen strain of E. coli, or any other suitable organism, with a selection advantage under a particular condition, so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence.
In the second instance, the Tn5 transposon, described by Goryshin & Reznikoff (J. Biol. Chem. (1998) 273 7367-7374), was adapted to replace the Muftis transposon, as shown in Figure 1OA. The Tn5InsOΕ contains the OE (outside end) element and the Tn5hisME transposon contains the ME (mosaic end) element. These elements can promote transposition of DNA sequences that lie between them. In each case, a selectable marker gene lies between the two OE or ME elements. The selectable marker is a gene that encodes a protein that provides a chosen strain of E. coli, or any other suitable organism, with a selection advantage under a particular condition, so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence. Any modified version of the OE or ME elements that contains changes in its nucleotide sequence can be utilised, providing the sequence still contains the Mlyl sequence at the required position and the DNA can still act as a transposon.
The mechanism by which triplet nucleotide insertion occurs when using Tn5InsOE or Tn5InsME is shown in Figure 1OB. The inserted nucleotides are shown in bold. Unlike Mu and AT-2, Tn5 transposition occurs via a 9 nucleotide staggered cut. The Mlyl recognition sequence is placed two nucleotide base pairs from each terminus and allows the precise insertion of three nucleotide base pairs upon Mlyl digestion followed by intramolecular ligation. Example 7
This example illustrates how to create a library of variants containing triplet nucleotide additions at random positions in the bla gene using a transposon based technology utilising a modified transposon that contains modified recognition sites based on the Tn5 transposon, as shown in Figure 10. The chloramphenicol resistance gene is included as a selectable marker. This example uses two new transposons, termed Tn5InsOE and Tn5InsME and the pNOM plasmid but other suitable derivatives of pNOM can be used. In this example, the restriction endonuclease MIyI is critical to triplet nucleotide insertion but other restriction endonucleases with properties similar to that of MIyI can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by a skilled person.
This example follows the procedure outlined in Example 1 and Figure 2. The main difference is with respect to the transposon used. In summary, the procedure consists of 4 main steps:
Step 1 : The Tn5InsOE or Tn5hisME transposon is inserted into the target plasmid or gene.
Step 2: Cells containing a plasmid-integrated Tn5InsOE or Tn5InsME contain the Camκ gene and so can grow in the presence of chloramphenicol. The plasmids are isolated and pooled, and the transposon removed by MIyI digestion.
Step 3: Intramolecular ligation results in the reformation of the target gene, plus nucleotide base pairs.
Step 4: The resulting library is subjected to a selection or screen to select those variants with the required properties.
In Figure 2, the hatched blocks represent the transposon, solid blocks the bla gene, gaps and grey blocks the insertion point and the thick dashed lines the rest of the plasmid backbone.
The procedure can also be applied to a target gene other than the bla gene, provided that:
1. there are suitable modifications to the selection or screening step at step 4 in Figure 2 that are suitable to the protein encoded by the target gene; and 2. any undesirable restriction sites are either not present or removed from the target gene.
Describing this example now in detail, a modified mini-Mu transposon containing a Tn5-derived sequence is used, along with a newly constructed pNOM plasmid (see example 1). The resultant transposon DNA is derived from mini-Mu apart from those sequences required for the transposition reaction (e.g. OE or ME sequences recognised by transposase enzymes) which is derived from Tn5. In this example, the restriction endonuclease MIyI is critical to triplet nucleotide insertion but other restriction endonucleases with properties similar to that of MIyI can be used, providing the appropriate steps are modified and extra steps added if required, as will be understood by the skilled person. Similarly, the DNA sequence between the OE or ME sequences can be altered, provided that it comprises a sequence for an appropriate selectable marker.
Construction of TnSInsOE and TnδlnsME
The original Mu phage-derived transposon, mini-Mu (CαmR), was engineered for use in the creation of the random triplet nucleotide addition. In this case, the CamR gene is used as a selectable marker within the transposon. This can be exchanged for another gene that will provide a chosen strain of E. coli or any other suitable organism with a selection advantage under a particular condition so making the organism viable or displaying a characteristic that will differentiate it from other cells that do not contain the transposon sequence.
The ability to duplicate nucleotide triplets depends on the transposon insertion mechanism and the position of two introduced restriction sites, as outlined in Figure 10. The mini-Mu transposon was engineered so as to act as a vehicle for the insertion of specific restriction sites into the target gene (Figure 3A). The restriction endonuclease chosen was MIyI, a type IIS enzyme that cuts 5 bp outside its recognition sequence to generate a blunt end (cleavage profile 5' GAGTC(N5)J- 3'). The nucleotide sequences towards the two termini of the mini-Mu transposon were replaced by a sequence based on the Outside End (OE) or Mosaic End (ME) sequence from the Tn5 transposon. This new nucleotide sequence now requires the Tn5 transposase for insertion into the target DNA. Transposition of Tn5Ins will occur via a 9 bp staggered cut in the target DNA that, following E. coli gap repair, results in the duplication of these 9 bp (Figure 10B). Digestion of the DNA with Mlyl removes the transposon along with three additional nucleotide base pairs from the target gene at both termini. Intramolecular ligation of the two blunt ends results in the in-frame duplication of 3 nucleotides from the target gene (Figure 10B).
Unless otherwise stated, all PCR reactions were performed with the Extensor Hi- Fidelity PCR Enzyme mix and performed as described above. The Tn5Ins transposon was constructed by PCR using the oligonucleotide primer ASl (5' CTGACTCTTATACACAAGTCGCGAAAGCGTTTCACGATA 3'; SEQ ID NO:89) or AS2 (5' CTGAGTCTTATACACATCTCGCGAAAGCGTTTCACGATAS'; SEQ ID NO:90) as both forward and reverse primer with 0.1 ng of the original mini-Mu (CαrøR-3) transposon acting as template, to create transposons Tn5InsOE and Tn5InsME, respectively. The 1302 bp product was purified ready for use in a transposition reaction.
Transposition reaction and transformation into E. coli cells.
Transposition with Tn5InsOE and Tn5InsME was performed at 37°C for 2 hr followed by heat inactivation for 10 min at 7O0C. The reaction mixture was composed of 1 μl 10x reaction buffer (500 mM Tris-acetate (pH 7.5), 1.5 M potassium acetate, 100 mM magnesium acetate, 40 mM spermidine), 200 ng pNOM, 0.232 pmoles Tn5Ins and 1 unit of EZ-Tn5™ transposase (Epicentre, Madison USA) in a total volume 10 μl. The reaction was stopped by the addition of 1 μl stop solution (1% SDS) prior to incubation at 7O0C for 10 min.
Either 1 μl or 2 μl of the reaction mixture was used to transform E. coli DH5α cells by electroporation and the cells plated on LB agar containing 20 μg/ml chloramphenicol to select for cells containing the CanιR gene and hence the Tn5Ins gene.
As mentioned above, the general outline of the method for the creation of triplet nucleotide insertions at random positions within a target gene is shown in Figure 2. The bla gene that encodes TEM-I β-lactamase was chosen as the target, as before. The new vector, pNOM, was used as the source of the bla gene and therefore acts as the target DNA for Tn5Ins insertion
As an alternative to the above description, a gene of interest independent of pNOM can be used as the target for transposon insertion. If required, the gene of interest can be cloned into pNOM or another suitable vector using standard techniques after transposon insertion. Alternatively, after transposon insertion into the gene of interest, the gaps present in the DNA strands formed as a result of the transposition reaction that are normally repaired in the organism can be repaired in vitro using the appropriate gap repair and ligation techniques.
The place of insertion of Tn5InsOE or Tn5InsME into pNOM should be distributed evenly throughout the plasmid and so a strategy is required that will select for cells containing the transposon inserted in to the bla gene region. The transposition of the transposon into the plasmid DNA confers resistance to chloramphenicol on E. coli, allowing for selection of cells containing Tn5InsOE- or Tn5InsME-inserted pNOM. Those colonies that have Tn5InsOE or Tn5InsME inserted within the bla gene region will disrupt TEM-I expression and thus affect the cells' ability to grow in the presence of ampicillin.
Selection of colonies with transposon-disrupted bla gene
After transformation of E. coli DH5α with 1 μl of the transposition reaction and plating V2 of the transformation mix on 20 μg/ml chloramphenicol, over 200 colonies were observed when Tn5InsME was used and 20 colonies when Tn5InsOE used. From this point onwards, the library created with Tn5InsME was utilised. To select for Tn5InsME transposons inserted with the bla gene, 96 colonies were selected that grew on 20 μg/ml chloramphenicol and replated on both a 100 μg/ml ampicillin and a 20 μg/ml chloramphenicol LB agar plates. Of the 96 colonies, 66 grew only on the chloramphenicol plate and were deemed to have a disrupted bla gene due to transposon insertion in this region.
The pNOM plasmid with TN5InsME inserted within the bla gene was purified individually from 10 of the 66 colonies. Each of the plasmids was subjected to digestion with MIyI, followed by agarose gel electrophoresis. The band corresponding to the linear pNOM minus Tn5InsME was isolated and purified after agarose gel electrophoresis. Intramolecular ligation was performed using T4 DNA ligase and approximately 10 ng of linear DNA. Up to 2 μl of the ligation mix was used to transform E. coli DH5α cells by electroporation and the cells plated on 15 μg/ml ampicillin LB agar plates to select for cells containing an active TEM-I β-lactamase. The bla gene in each of the individual plasmids were also sequenced to determine the nature of insertion, using the primer DDJdiOlO. These sequences are shown in Table 6 below. The amino acid duplications were found to be present throughout TEM-I. Only one sequence was present twice in more than clone. This successfully demonstrates the use of the transposon-based method to incorporate amino acid insertions into a target gene of interest.
Table 6. Sequence analysis of the TEM-I amino acid insertion library. The residue that is inserted is underlined in the mutation column. The mutation labelled with * was found in two different clones. The ability of the TEM-I insertion variant to confer resistance to 15 μg/ml ampicillin on E. coli was used as the criteria as to whether the variant was active or not. The Amp MIC refers the ampicillin minimum inhibitory concentration that prevents cell growth.

Claims

Claims
1. Method for altering the amino acid sequence of a target polypeptide by altering a target DNA sequence which encodes that polypeptide, the method comprising the step of introducing a transposon into the target DNA sequence, in which the transposon comprises a first restriction enzyme recognition sequence towards each of its termini, the recognition sequence not being present in the remainder of the transposon, or in the target DNA sequence, or in a construct comprising the target DNA sequence, the first restriction enzyme recognition sequence being recognised by a first restriction enzyme which is an outside cutter and being positioned such that the first restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon.
2. Method according to claim 1 wherein the amino acid sequence is altered by the deletion, insertion or substitution of at least one amino acid.
3. Method according to any preceding claim wherein at least one amino acid is inserted into the amino acid sequence of the target polypeptide.
4. Method according to claim 3 wherein a single amino acid is inserted into the amino acid sequence of the target polypeptide.
5. Method according to claim 1 or 2 wherein at least one amino acid is deleted from the amino acid sequence of the target polypeptide.
6. Method according to claim 5 wherein a single amino acid is deleted from the amino acid sequence of the target polypeptide.
7. Method according to any of claims 3 to 6 comprising the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intramolecular ligation reaction of the DNA from (c); and e) expression of protein from the DNA from (d).
8. Method according to claim 1 or 2 wherein at least one amino acid of the amino acid sequence of the target polypeptide is substituted with a different amino acid.
9. Method according to claim 8 wherein a single amino acid of the amino acid sequence of the target polypeptide is substituted with a different amino acid.
10. Method according to claim 8 or 9 comprising the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intermolecular ligation of DNA from (c) with a second DNA sequence comprising at least two second restriction enzyme recognition sites located such that at least one of the cleavage sites is not at a terminus of the second DNA sequence; e) conducting the transformation of a host organism with DNA from (d) and selecting cells containing the second DNA sequence; f) isolating DNA from cells selected in (e) and digestion of that DNA with a second restriction enzyme which recognises the second restriction enzyme recognition sites, the second restriction enzyme being an outside cutter; g) conducting an intramolecular ligation of DNA from (f); and h) expression of protein from the DNA from (g).
11. Method according to claim 10 wherein the second restriction enzyme is the same as the first restriction enzyme.
12. Method according to claim 10 or 11 wherein the second DNA sequence comprises a gene which gives a host cell containing the second DNA sequence a selectable characteristic compared to a cell not containing the second DNA sequence.
13. Method according to claim 1 or 2 wherein the amino acid sequence of the target polypeptide is altered by the insertion of a further amino acid sequence.
14. Method according to claim 13 comprising the following steps: a) conducting a transposition reaction comprising mixing the transposon, the target DNA and a transposase enzyme; b) digestion of DNA resulting from (a) with a first restriction enzyme which recognises the first restriction enzyme recognition sequence contained in the transposon; c) separation of DNA which does not comprise the transposon; d) conducting an intermolecular ligation of DNA from (c) with a third DNA sequence encoding for a further amino acid sequence; and e) expression of protein from the DNA from (d).
15. Method according to claim 13 or 14 wherein the further amino acid sequence is a full protein, a protein domain or a protein fragment.
16. Method according to claim 15 wherein the protein fragment is an epitope.
17. Method according to claim 15 wherein the protein fragment is a binding domain.
18. Method according to claim 15 wherein the protein fragment is an allosteric site.
19. Method according to claim 15 wherein the protein fragment is a defined functional region.
20. Method according to claim 15 wherein the protein fragment is an oligomerisation interface.
21. Method according to any of claims 14-20 wherein the third DNA sequence comprises a gene which gives a host cell containing the third DNA sequence a selectable characteristic compared to a cell not containing the third DNA sequence.
22. Method according to any of claims 14-21 wherein the third DNA sequence has an open reading frame which is the same as that of the target DNA.
23. Method according to any of claims 14-22 wherein the third DNA sequence contains a stop codon.
24. Method according to any of claims 14-23 wherein the third DNA sequence contains an initiation codon.
25. Method according to any preceding claim wherein the first restriction enzyme is a Type IIS enzyme.
26. Method according to claim 25 wherein the first restriction enzyme is Mlyl.
27. Method according to any preceding claim wherein the transposon has a low target site preference.
28. Method according to claim 27 wherein the transposon is derived from one of: mini-Mu, AT-2 or Tn5.
29. Method according to any preceding claim wherein the transposon comprises a gene which gives a host cell containing the transposon a selectable characteristic compared to a cell not containing the transposon.
30. Method according to claim 27 wherein the transposon comprises the DNA sequence 5'-NGACTC-3' as the 5' terminal and 5'-GAGTCN-3' as the 3' terminal, or comprises the DNA sequence 5'-NNNNGACTC-3' as the 5' terminal and 5'- GAGTCNNNN-3' as the 3' terminal, or comprises the DNA sequence 5'- TGTTGACTC-3' as the 5' terminal and 5'-GAGTCAACA-S' as the 3' terminal, or comprises the DNA sequence 5'-CTGACTC-S' as the 5' terminal and 5'-GAGTCAG- 3' as the 3' terminal.
31. Method according to any preceding claim wherein the target DNA is carried in a plasmid.
32. Method according to claim 31 wherein the plasmid is pNOM or a derivative thereof.
33. Transposon comprising a restriction enzyme recognition sequence towards each of its termini, the recognition sequence not being present in the remainder of the transposon, being a recognition sequence for a restriction enzyme which is an outside cutter and being positioned such that the restriction enzyme has a DNA cleavage site positioned beyond the end of the terminus of the transposon.
34. Transposon according to claim 33 suitable for use in a method according to any of claims 1-32.
35. Transposon according to claims 33 or 34 wherein each restriction enzyme recognition sequence is located between 1 and 20 nucleotides from a transposon terminus.
36. Transposon according to claim 35 wherein each restriction enzyme recognition sequence is located at 1, 2, 3, 4 or 5 nucleotides from a transposon terminus
37. Transposon according to any of claims 33 to 36 wherein the restriction enzyme is MIyL
38. Transposon according to claim 37 comprising the DNA sequence 5'-NGACTC-3' as the 5' terminal and 5'-GAGTCN-3' as the 3' terminal.
39. Transposon according to claim 37 comprising the DNA sequence 5'- NNNNGACTC-3' as the 5' terminal and 5'-GAGTCNNNN-3' as the 3' terminal.
40. Transposon according to claim 37 comprising the DNA sequence 5'- TGTTGACTC-3' as the 5' terminal and 5'-GAGTCAACA-S' as the 3' terminal.
41. Transposon according to claim 37 comprising the DNA sequence 5'-CTGACTC-3' as the 5' terminal and 5'-GAGTCAG-S' as the 3' terminal.
42. Transposon according to claim 40 or 41 comprising at least one variation in the 5' terminal and/or 3' terminal DNA sequence, wherein the transposon is viable for transposition.
43. Plasmid having the DNA sequence shown in Figure 1.
44. Plasmid which is a derivative of the plasmid claimed in claim 43.
45. Kit comprising a transposon according to any of claims 33-42.
46. Kit according to claim 45 further comprising a plasmid according to claim 43 or 44.
47. Kit according to claim 45 or 46 further comprising a transposase.
48. Kit according to any of claims 45-47 further comprising at least one buffer.
49. Kit according to any of claims 45-48 further comprising at least one oligonucleotide.
50. Kit according to any of claims 45-49 for use in the method according to any of claims 1 to 32.
51. Method of determining whether the introduction of a mutation into a target polypeptide alters a detectable activity of that polypeptide, comprising the method of any of claims 1 to 32 and the further steps of: a) screening for a difference in the activity of the altered target polypeptide compared to the unaltered target polypeptide; and b) sequencing the altered target polypeptide to determine the location of the amino acid insertion, deletion or substitution.
EP06703246A 2005-01-20 2006-01-19 Polypeptide mutagenesis method Expired - Lifetime EP1838851B1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GBGB0501189.5A GB0501189D0 (en) 2005-01-20 2005-01-20 Polypeptide mutagenesis method
PCT/GB2006/000187 WO2006077411A1 (en) 2005-01-20 2006-01-19 Polypeptide mutagenesis method

Publications (2)

Publication Number Publication Date
EP1838851A1 true EP1838851A1 (en) 2007-10-03
EP1838851B1 EP1838851B1 (en) 2009-09-16

Family

ID=34259403

Family Applications (1)

Application Number Title Priority Date Filing Date
EP06703246A Expired - Lifetime EP1838851B1 (en) 2005-01-20 2006-01-19 Polypeptide mutagenesis method

Country Status (10)

Country Link
US (1) US20090053761A1 (en)
EP (1) EP1838851B1 (en)
JP (1) JP2008527987A (en)
AT (1) ATE443137T1 (en)
AU (1) AU2006207308A1 (en)
CA (1) CA2601324A1 (en)
DE (1) DE602006009217D1 (en)
DK (1) DK1838851T3 (en)
GB (1) GB0501189D0 (en)
WO (1) WO2006077411A1 (en)

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB0515131D0 (en) * 2005-07-22 2005-08-31 Univ Aston Oligonucleotide library encoding randomised peptides
WO2014039662A1 (en) * 2012-09-07 2014-03-13 Alexander Gubin Methods and products for mutating nucleotide sequences
EP3027771B1 (en) * 2013-07-30 2019-01-16 Gen9, Inc. Methods for the production of long length clonal sequence verified nucleic acid constructs

Family Cites Families (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US4830965A (en) * 1983-12-12 1989-05-16 Canadian Patents And Development Ltd. Transposable linkers to transfer genetic information
US5677170A (en) * 1994-03-02 1997-10-14 The Johns Hopkins University In vitro transposition of artificial transposons
DE10109517A1 (en) * 2001-02-28 2002-08-29 Volker Sieber Process for the production of gene libraries
US20020119573A1 (en) 2001-02-28 2002-08-29 Shaw Karen J. Footprinting plasmid
JP2002253255A (en) * 2001-03-01 2002-09-10 Japan Science & Technology Corp DNA insertion and deletion DNA mutation method
FI20020746A7 (en) * 2002-04-18 2003-10-19 Finnzymes Oy Method and materials for producing deletion derivatives of polypeptides
KR100391884B1 (en) * 2002-07-04 2003-09-06 Amicogen Co Ltd Random codon based mutagenesis using transposon

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2006077411A1 *

Also Published As

Publication number Publication date
WO2006077411A1 (en) 2006-07-27
GB0501189D0 (en) 2005-03-02
JP2008527987A (en) 2008-07-31
DK1838851T3 (en) 2010-01-25
CA2601324A1 (en) 2006-07-27
EP1838851B1 (en) 2009-09-16
US20090053761A1 (en) 2009-02-26
AU2006207308A1 (en) 2006-07-27
DE602006009217D1 (en) 2009-10-29
ATE443137T1 (en) 2009-10-15

Similar Documents

Publication Publication Date Title
JP7187435B2 (en) genome editing
AU2017280353B2 (en) Methods for generating barcoded combinatorial libraries
US10138476B2 (en) Using RNA-guided FokI nucleases (RFNs) to increase specificity for RNA-guided genome editing
JP4020429B2 (en) Recombination cloning using engineered recombination sites
Ruff et al. To get what we aim for–progress in diversity generation methods
WO2011053957A2 (en) Compositions and methods for the regulation of multiple genes of interest in a cell
WO2014204578A1 (en) Using rna-guided foki nucleases (rfns) to increase specificity for rna-guided genome editing
EP1348028A2 (en) Substrate linked directed evolution (slide)
EP1838851B1 (en) Polypeptide mutagenesis method
JP2024543216A (en) CRISPR-associated transposases and methods of use thereof
Tee et al. Back to basics: Creating genetic diversity
Zimmermann et al. CoMuTER–a Cas3-base editing tool for targetable in vivo mutagenesis
Vidal A broadly applicable artificial selection system for biomolecule evolution
Haydaychuk Characterizing SaCas9 and SaCas9 [D10E] tolerance to mismatches using Directed Evolution Using Fluorescence Activated Cell Sorting (DEUFACS)
Boneza A Strain-Specific Mechanism Drives Cytosine to Guanine Conversion During Cytidine Base Editing in Streptomyces
Finger-Bou Not so giant steps on tuning protein production and diminished genomes
US20090263851A1 (en) In vivo selection system for enzyme activity
WO2004011608A2 (en) Methods and nucleic acid vectors for rapid expression and screening of cdna clones
Gustavsson Cloning of an aldolase mutant
Rasila Functional Mapping of Mu Transposition Machinery: MuA Protein Modification and Engineering for Hyperactivity
Solomon ONE DAY CLONING
Krause et al. Toward New Nonnatural TIM-Barrel Enzymes Using Computational Design and Directed Evolution Approaches
Cavaleiro Improvement of Synthetic Biology Tools for DNA Editing
NZ516384A (en) Composition comprising a nucleic acid molecule
HK40002080A (en) Genome editing

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20070727

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20071119

DAX Request for extension of the european patent (deleted)
GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU LV MC NL PL PT RO SE SI SK TR

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REG Reference to a national code

Ref country code: CH

Ref legal event code: EP

REG Reference to a national code

Ref country code: IE

Ref legal event code: FG4D

REF Corresponds to:

Ref document number: 602006009217

Country of ref document: DE

Date of ref document: 20091029

Kind code of ref document: P

REG Reference to a national code

Ref country code: CH

Ref legal event code: NV

Representative=s name: SCHNEIDER FELDMANN AG PATENT- UND MARKENANWAELTE

REG Reference to a national code

Ref country code: SE

Ref legal event code: TRGR

REG Reference to a national code

Ref country code: DK

Ref legal event code: T3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: FI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: LT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

LTIE Lt: invalidation of european patent or patent extension

Effective date: 20090916

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: LV

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: SI

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: NL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: PL

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

NLV1 Nl: lapsed or annulled due to failure to fulfill the requirements of art. 29p and 29m of the patents act
PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: CY

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: PT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20100118

Ref country code: EE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: RO

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: CZ

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: IS

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20100116

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20091227

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SK

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

PLBI Opposition filed

Free format text: ORIGINAL CODE: 0009260

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: AT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: BE

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

PLAX Notice of opposition and request to file observation + time limit sent

Free format text: ORIGINAL CODE: EPIDOSNOBS2

26 Opposition filed

Opponent name: NOVOZYMES A/S

Effective date: 20100611

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: MC

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20100131

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20091217

PLBB Reply of patent proprietor to notice(s) of opposition received

Free format text: ORIGINAL CODE: EPIDOSNOBS3

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20100119

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

PLBP Opposition withdrawn

Free format text: ORIGINAL CODE: 0009264

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: CH

Payment date: 20120125

Year of fee payment: 7

Ref country code: FR

Payment date: 20120130

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20120127

Year of fee payment: 7

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20120126

Year of fee payment: 7

Ref country code: DK

Payment date: 20120125

Year of fee payment: 7

Ref country code: SE

Payment date: 20120127

Year of fee payment: 7

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: BG

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

Ref country code: HU

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20100317

Ref country code: LU

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20100119

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: TR

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090916

REG Reference to a national code

Ref country code: DK

Ref legal event code: EBP

REG Reference to a national code

Ref country code: CH

Ref legal event code: PL

REG Reference to a national code

Ref country code: SE

Ref legal event code: EUG

GBPC Gb: european patent ceased through non-payment of renewal fee

Effective date: 20130119

PLBD Termination of opposition procedure: decision despatched

Free format text: ORIGINAL CODE: EPIDOSNOPC1

PLBM Termination of opposition procedure: date of legal effect published

Free format text: ORIGINAL CODE: 0009276

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: OPPOSITION PROCEDURE CLOSED

REG Reference to a national code

Ref country code: FR

Ref legal event code: ST

Effective date: 20130930

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: SE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130120

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130801

Ref country code: LI

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130131

Ref country code: CH

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130131

27C Opposition proceedings terminated

Effective date: 20110910

REG Reference to a national code

Ref country code: DE

Ref legal event code: R119

Ref document number: 602006009217

Country of ref document: DE

Effective date: 20130801

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130119

Ref country code: FR

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130131

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DK

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20130131