EP1776481A2 - Diagnosis and treatment of kawasaki disease and coronavirus infection - Google Patents

Abstract

In certain embodiments, the present invention relates to a novel coronavirus designed HCoV-NH. Also disclosed are isolated HCoV-NH nucleic acids, proteins encoded by the HCoV-NH nucleic acids, related expression vectors, related host cells, related antibodies, and related compositions. Methods of diagnosing infection with a coronavirus, methods of diagnosing Kawasaki disease, methods of identifying a therapeutic compound, and methods for treating coronavirus infection and for treating Kawasaki disease are also disclosed.

Description

DIAGNOSIS AND TREATMENT OF KAWASAKI DISEASE AND CORONAVIRUS INFECTION

CROSS REFERENCE TO RELATED APPLICATIONS This application claims the benefit of U.S. Provisional Application No.

60/601,036, filed August 11, 2004, the teachings of which are incorporated herein by reference in their entirety.

FUNDING

Work described herein was funded, in whole or in part, by National Institutes of Health, Grant Numbers T32 AI07210-20 and K24 AI01703. The United States government has certain rights in the invention.

BACKGROUHD OF THE INVENTION

Kawasaki disease (KD) is a multi-system vasculitis of childhood that may result in aneurysms of the coronary arteries. In the developed world, KD is the most common cause of acquired heart disease in children. The diagnosis of KD is based entirely on clinical features. For classic KD, individuals must have a fever for > 5 days and at least 4 of 5 of the following manifestations: (1) bilateral conjunctivitis; (2) erythema of the mouth or pharynx, strawberry tongue or stomatitis; (3) polymorphous rash; (4) erythema or edema of the hands or feet; and (5) non-suppurative cervical lymphadenopathy or fever with 3 features and evidence of coronary artery abnormalities. Incomplete or atypical KD, in which not all of the criteria are met, can occur and can also result in aneurysms of the coronary arteries. Laboratory findings are non-specific and there are no diagnostic tests for KD. Therefore, the diagnosis of KD often presents a significant challenge. Many patients with KD may not be recognized. Those patients not treated with intravenous immunoglobulin in a timely fashion are prone to develop coronary aneurysms. Thus, there is a need to develop novel diagnostic compositions and tests for KD.

SUMMARY OF THE INVENTION

In certain embodiments, the present invention provides an isolated nucleic acid comprising a nucleotide sequence that is at least 99% identical to SEQ ID NO: 1.

- 1 -

9791411 1 In certain embodiments, the present invention provides an isolated or recombinant human coronavirus designated HCoV-NH which contains a nucleic acid comprising a nucleotide sequence at least 99% identical to SEQ ID NO: 1.

In certain embodiments, the present invention provides a vaccine which comprises an effective immunizing amount of the human coronavirus designed HCoV- NH and a suitable carrier. Optionally, the HCoV-NH coronavirus is inactivated or alive.

In certain embodiments, the present invention provides an isolated nucleic acid probe that specifically hybridizes to a target region of a HCoV-NH nucleic acid or a complement thereof under a highly stringent condition. For example, the nucleic acid probe comprises at least 15 nucleotides. For example, the replicase IA gene is the target region for the probes (e.g., a nucleotide sequence selected from SEQ ID NOs: 4- 69 and 95-99). As another example, the spike gene is the target gene for the probes (e.g., a nucleotide sequence selected from SEQ ID NOs: 70-94 and 100-103). Optionally, the probes specifically hybridizes to a HCoV-NH nucleic acid derived from a KD patient, for example, a nucleotide sequence selected from SEQ ID NOs: SEQ ID NOs: 56, 74, 78, 80, 82, 86, 87, 88, 94, and 95. In certain cases, the nucleic acid probe is labeled.

In certain embodiments, the present invention provides a method of characterizing a human coronavirus by type or species. Such method comprises: 1) contacting a sample containing a HCoV-NH nucleic acid with a nucleic acid probe that specifically hybridizes to a target region of a HCoV-NH nucleic acid or a complement thereof under a highly stringent condition; 2) detecting the probe-HCoV-NH nucleic acid hybrid; and 3) characterizing the type or species of the human coronavirus based on the presence or absence of said hybrids. Optionally, the nucleic acid probe binds to a target region selected from the replicase IA gene, the spike gene, and the nucleocapsid (N) gene. Examples of the nucleic acid probes may comprise a sequence selected from SEQ ID NOs: 4-103 or fragments thereof.

In certain embodiments, the present invention provides a method of diagnosing or aiding in the diagnosis of Kawasaki disease (KD) in a subject. Such method comprises detecting a human coronavirus in a sample from the subject, wherein the presence of the human coronavirus indicates that the subject has or is at increased risk

- 2 -

97914! 1 1 of having KD. For example, the human coronavirus is HCoV-NH. Optionally, the presence of the human coronavirus is determined by detecting a human coronavirus nucleic acid, for example, by using a nucleic acid probe that hybridizes to a target region of the human coronavirus nucleic acid or a complement thereof under a stringent condition. In certain cases, the nucleic acid probe is not species-specific, which hybridizes to a consensus region of the coronavirus. In other cases, the nucleic acid probe is species-specific, which specifically hybridizes to a human coronavirus such as HCoV-NH. For example, the nucleic acid probe specifically hybridizes to a target region of a HCoV-NH nucleic acid or a complement thereof under a highly stringent condition. Optionally, the presence of the human coronavirus is determined by detecting a protein encoded by a human coronavirus nucleic acid, such as a protein encoded by the replicase IA gene, the spike gene, or the nucleocapsid (N) gene.

In certain embodiments, the present invention provides a method of inducing an immune response in a subject against a coronavirus. Such method comprises administering to the subject a HCoV-NH nucleic acid or a polypeptide encoded by the HCoV-NH nucleic acid.

In certain embodiments, the present invention provides a method of identifying a compound for treating a coronavirus infection. Such method comprises identifying compound that specifically binds to a HCoV-NH coronavirus. Optionally, the compound specifically binds to a HCoV-NH coronavirus nucleic acid. Examples of such compound may be an antisense nucleic acid and an siRNA. Alternatively, the compound specifically binds to a polypeptide encoded by the HCoV-NH coronavirus nucleic acid. Examples of such compound may be an antibody and a small molecule inhibitor of HCoV-NH coronavirus. BRIEF DESCRIPTION OF THE DRAWINGS

Figure 1 shows age distribution of HCoV-NH positive children. Nosocomially- acquired HCoV-NH in children in the Newborn Intensive Care Unit (NICU) are represented with the hatched lines.

Figure 2 shows weekly distribution of HCoV-NH positive individuals from January 2002 to mid-February 2003. The first day of every other week is labeled for figure clarity. Nosocomially-acquired HCoV-NH in children in the Newborn Intensive Care Unit (NICU) are represented with the hatched lines.

- 3 -

9791411 1 Figure 3 shows phylogenetic analysis of HCoV-NH. Sequences of a 126 base portion of the replicase Ia gene of a representative sample of HCoV-NH amplicons (NH), the coronavirus recently identified in the Netherlands (NL63), human coronavirus 229E (HCOV 229E) and transmissible gastroenteritis virus (TGEV) were used in the construction of the phylogenetic tree.

Figure 4 shows clinical and laboratory features of children with Kawasaki Disease.

Figure 5 shows electron micrograph of HCoV-NH isolated from a patient with KD. The virus was propagated in cell culture. Magnification is 30,00Ox. Figure 6 shows phylogenetic analysis of HCoV-NH strains based on the spike gene. Triangles indicate strains identified in the Netherlands. HCoV-NH isolated from KD patients are indicated with an arrow. NH₅ New Haven. Bootstrap values (100%) are indicated.

Figures 7A-7D show a partial sequence alignment of HCoV-NH (SEQ ID NO: 1), HCoV-NL (SEQ ID NO: 2), and HCoV-NL-63 (SEQ ID NO: 3).

Figures 8A-8F show various nucleotide sequences derived from the replicase Ia gene of HCoV-NH (SEQ ID NOs: 4-69). These sequences were deposited in GenBank and the GenBank Accession Nos of these sequences are shown. The nucleotide sequence having the Accession No. AY870995 ((SEQ ID NO: 56) was derived from a KD patient.

Figures 9A-9E show various nucleotide sequences derived from the spike gene of HCoV-NH (SEQ ID NOs: 70-93). Sequences derived from KD patients are indicated.

DETAILED DESCRIPTION OF THE INVENTION The present invention is based on, at least in part, the discovery of a novel coronavirus (designed HCoV-NH) and the association between HCoV-NH and Kawasaki Disease. Genetic sequences of HCoV-NH were originally identified in children with respiratory tract infections in New Haven, Connecticut. Applicants also conducted case-control studies to show that Kawasaki disease is associated with infection with HCoV-NH.

- 4 -

9791411 1 Coronavirases are large enveloped plus strand RNA viruses and belong Io a genus in the family of Coronaviridae. The genomic RNA is normally 27 to 32 kb in size, capped and polyadenylated. Three serologically distinct groups of coronavirases were identified. Within each group, viruses are identified by hosts range and genome sequence. Coronavirases have been identified in mice rats, chickens, turkeys, swine, dogs, cats, rabbits, horses, cattle and humans. In humans, three coronavirases were found, including HCoV-229E, HCoV-OC43, and SARS-CoV. HCoV-229E and HCoV- OC43 are known to cause common cold as well as a more serious disease in infants such as lower respiratory tract disease. SARS-CoV was recently identified to be able to cause a life threatening pneumonia and thus is the most pathogenic human coronavirus.

The genome of coronavirases encodes four structural proteins: the spike protein (S), the membrane protein (M), the envelope protein (E), and the nucleocapsid protein (N). Several non-structural proteins are involved in replication and transcription, which are encoded by two long overlapping open reading frames (ORFs) at the 5' end of the genome (called Ia and Ib). These two ORFs are connected via a ribosomal frame shift. The polypeptides encoded by ORF Ia and Ib are post-translationally processed by viral encoded proteases. Furthermore, additional non-structural proteins are encoded between the S and E gene, or between the M and N gene or downstream of the N gene. The coronaviras gene products of Ia and Ib are translated from the genomic RNA but the remaining viral proteins are translated from subgenomic mRNAs (sg mRNA), each with a Bend derived from the 5' part of the genome. See, e.g., Sawicki and Sawicki, 1995, Adv Exp Med Biol 380:499-506; van Marie et al., 1999, PNAS USA 96:12056- 12061). I. Nucleic acids relating to HCoV-NH coronaviras

In certain embodiments, the present invention provides nucleic acid sequences of HCoV-NH coronaviras, including nucleic acid probes that target regions of the HCoV-NH coronaviras. A HCoV-NH genomic sequence was partially sequenced. An exemplary nucleic acid sequence of HCoV-NH (SEQ ID NO: 1) is provided in figure 7 which shows a partial sequence alignment of HCoV-NH, HCoV-NL, and HCoV-NL-63. The HCoV-NH partial sequence is about 98.5% and 98.3% identical to the corresponding regions of HCoV-NL-63 and HCoV-NL, respectively. Using the partial

- 5 -

9791411 1 sequence, the full-length HCoV-NH nucleic acid sequence can be readily identified by standard molecular biology approaches.

In one aspect, the present invention provides an isolated or recombinant nucleic acid comprising a nucleotide sequence that is at least 99% identical to SEQ ID NO: 1, or a functional fragment thereof. In a related aspect, the present invention provides a recombinant infectious human coronavirus designated HCoV-NH. For example, the subject HCoV-NH coronavirus has a genomic sequence which comprises a nucleotide sequence that is at least 90%, 95%, 99%, or 100% identical to SEQ ID NO: 1.

The present invention discloses that many natural variants exist (e.g., the sequences shown in Figures 8-9) for polymorphisms in certain regions of HCoV-NH such as Ia gene and spike gene. Thus, a nucleic acid sequence that is slightly divergent from the subject nucleic acid sequence and a HCoV-NH virus having such a slightly divergent nucleic acid sequence are also within the scope of the present invention. The variant nucleic acid sequence does not necessarily have to be a natural variant. It is routine to generate variants by recombinant means. For instance, many regions of the virus can be altered through nucleotide substitution by using the redundancy in the triplet genetic code for particular amino acids, without altering the amino acid sequence of the encoded proteins. On the other hand, neutral amino acid alterations can be introduced without affecting the activity of an encoded viral protein and the virus expressing such protein. To illustrate, conservative amino acid substitutions are often tolerated. Alterations in the prototype virus may be up to 80%, 90%, 95% or 99% of the nucleic acid sequence without altering the replicating potential of the virus. Thus, one aspect of the invention provides an isolated and/or recombinant nucleic acid that is at least 90%, 95% or 99% identical to a HCoV-NH nucleic acid sequence such as SEQ ID NO: 1.

In a specific embodiment, the present invention provides an isolated or recombinant HCoV-NH nucleic acid which was isolated from patients having Kawasaki disease (KD). For example, the HCoV-NH nucleic acid comprises a nucleotide sequence selected from SEQ ID NOs: SEQ ID NOs: 56, 74, 78, 80, 82, 86, 87, 88, 94, and 95.

In anther aspect, the present invention provides an isolated and/or recombinant nucleic acid that hybridizes under high stringency conditions to a nucleic acid sequence

- 6 -

9791411 1 that comprises SEQ ID NO: 1, or a complement thereof. The term "hybridizes under stringent conditions" refers to conditions for hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45°C, followed by one or more washes in 0.2 X SSC, 0.1% SDS at 50-65⁰C. In certain aspects, the nucleic acids of the subject HCoV-NH or fragments thereof can be used as nucleic acid probes for detecting the HCoV-NH virus in samples. For example, the subject nucleic acid probes comprise at least 15 nucleotides, and optionally comprise a stretch of about 100-500 consecutive nucleotides of a HCoV-NH nucleic acid sequence. Optionally, the probes target certain regions of the HCoV-NH coronavirus, such as replicase Ia gene and spike gene. In certain cases, the probes target regions that are conserved among genetically diverse human and animal coronaviruses. These probes are referred to herein as "consensus" or "non species- specific." Examples of such consensus probes include, but are not limited to, the forward primer, 5'GCGCAAAATAATGAATTAATGCC and the reverse primer, 5'GACGCACCACCATATGAATCCTG (see, e.g., Example 1). Alternatively, the probes specifically hybridize to HCoV-NH coronavirus. These probes are referred to herein as "species-specific." Examples of such species-specific probes include, but are not limited to, the forward primer 5' GCGCTATGAGGGTGGTTGTAAC and reverse primer 5' CGCGCAGTTAAAAGTCCAGAATTAAC; the forward primer, 5 'CCGCGTTAAGAGTGGTTCACC and reverse primer,

5'CAGCGGTCATGGCACC; nested primer forward primer, 5' CCGCTTGAAGCCACCTGGC and nested reverse primer 5' GCGCGGTTGGTTACATGGTGTCAC (see, e.g., Examples 1-2).

In certain aspects, the invention provides a vector comprising a HCoV-NH nucleic acid or a fragment thereof. Further provided is a cell containing said vector.

For example, the sequence of HCoV-NH or a fragment thereof can be used to generate a primer that is specific for HCoV-NH and thus capable of specifically replicating HCoV- NH nucleic acid. Similarly, a probe can be generated that specifically hybridizes to a HCoV-NH nucleic acid under stringent conditions. Thus the invention further provides a primer or probe, which is capable of specifically hybridizing to a HCoV-NH nucleic acid or fragments thereof under stringent conditions. In specific embodiments, the subject nucleic acid probes include, but are not limited to, the sequences as depicted in figures 8-9.

- 7 -

9791411 1 In certain embodiments, the present invention provides an isolated cell, or recombinant or cell line which contains a HCoV-NH virus, or a vector comprising a a HCoV-NH nucleic acid or a fragment thereof. Optionally, such cell is a eukaryotic cell, such as a mammalian cell. For example, the subject cell is a cell that replicates the HCoV-NH virus. In certain cases, the cell can be used to produce the HCoV-NH virus or to attenuate HCoV-NH such that it becomes less pathogenic. Virus attenuation is spontaneous upon continued culture of the virus on the mentioned preferred cell lines. Attenuated HCoV-NH virus can be used as a vaccine.

In certain aspects, the invention provides a vaccine which comprises a HCoV- NH nucleic acid or a virus containing a HCoV-NH nucleic acid. For example, the nucleic acid may be used in a DNA vaccine approach. As carrier for the DNA vaccine, it is possible to incorporate an expressible HCoV-NH nucleic acid in a viral replicon allowing replication of the HCoV-NH nucleic acid in the target cell and thereby allowing boosting of the provided immune response. Vaccines may be generated in a variety of ways. For example, HCoV-NH virus can be cultured in the cells, and inactivated virus is then harvested from the culture for use as vaccines. Alternatively, attenuated virus may be used either inactivated or as a live vaccine. Further, the available methods for generating coronavirus vaccines may be adapted to produce vaccines for the HCoV-NH of the invention. II. Proteins and antibodies relating to HCoV-NH coronavirus

In certain embodiments, the present invention provides various proteins encoded by the subject HCoV-NH nucleic acids, referred to herein as HCoV-NH proteins. For example, a HCoV-NH protein of this invention contains the sequence of the S protein, the E protein, the M protein, the N protein, or the replicase IA or IB protein. Optionally, the HCoV-NH proteins are expressed in cells producing the HCoV-NH virus. Thus, the invention further provides an isolated or recombinant protein encoded by the subject HCoV-NH nucleic acids, as well as fragments or variants of the encoded proteins. Optionally, the fragments or variants of the HCoV-NH proteins have the same or similar functions relative to the wildtype proteins. Optionally, the variant protein is at least 90%, 95% or 99% identical to a wildtype HCoV-NH protein. For example, fragments and variants of HCoV-NH proteins can be generated by standard recombinant approaches.

9791411 1 In certain embodiments, a HCoV-NH protein of the invention can be obtained as a synthetic polypeptide or a recombinant polypeptide. To prepare a recombinant polypeptide, a nucleic acid encoding it can be linked to another nucleic acid encoding a fusion partner, e.g., Glutathione-S-Transferase (GST), 6x-His epitope tag₃ or Ml 3 Gene 3 protein. The resultant fusion nucleic acid expresses in suitable host cells a fusion protein that can be isolated by methods known in the art. The isolated fusion protein can be further treated, e.g., by enzymatic digestion, to remove the fusion partner and obtain the recombinant polypeptide of this invention.

In certain embodiments, a HCoV-NH protein of the invention can be used to generate antibodies in animals (for production of antibodies) or humans (for treatment of diseases). Optionally, the subject antibodies specifically bind to a HCoV-NH protein or a virus containing a HCoV-NH protein. Methods of making monoclonal and polyclonal antibodies and fragments thereof in animals are known in the art. See, for example, Harlow and Lane, (1988) Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, New York. The term "antibody" includes intact molecules as well as fragments thereof, such as Fab, F(ab')2, Fv, scFv (single chain antibody), dAb (domain antibody; Ward, et. al. (1989) Nature, 341, 544), and chimeric antibodies. These antibodies can be used for detecting a HCoV-NH protein, e.g., in determining whether a test sample from a subject contains coronavirus or in identifying a compound that binds to the HCoV-NH protein. These antibodies may interfere with the cell binding and entry of the coronavirus, and are thus useful for treating coronavirus infection and Kasawaki disease that is associated with HCoV-NH infection.

In general, to produce antibodies against a polypeptide, the polypeptide is coupled to a carrier protein, such as KLH, mixed with an adjuvant, and injected into a host animal. Antibodies produced in the animal can then be purified by peptide affinity chromatography. Commonly employed host animals include rabbits, mice, guinea pigs, and rats. Various adjuvants that can be used to increase the immunological response depend on the host species and include Freund's adjuvant (complete and incomplete), mineral gels such as aluminum hydroxide, CpG, surface-active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, and dinitrophenol. Useful human adjuvants include BCG (bacille Calmette-Guerin) and Corynebacterium parvum.

- 9 -

9791411 1 Polyclonal antibodies, heterogeneous populations of antibody molecules, are present in the sera of the immunized subjects. Monoclonal antibodies, homogeneous populations of antibodies to a polypeptide of this invention, can be prepared using standard hybridoma technology (see, for example, Kohler et al. (1975) Nature 256, 495; Kohler et al. (1976) Eur. J. Immunol. 6, 511; Kohler et al. (1976) Eur J Immunol 6, 292; and Hammerling et al. (1981) Monoclonal Antibodies and T Cell Hybridomas, Elsevier, N. Y.). In particular, monoclonal antibodies can be obtained by any technique that provides for the production of antibody molecules by continuous cell lines in culture such as described in Kohler et al. (1975) Nature 256, 495 and U.S. Patent No. 4,376,110; the human B-cell hybridoma technique (Kosbor et al. (1983) Immunol Today 4, 72; Cole et al. (1983) Proc. Natl. Acad. Sci. USA 80, 2026, and the EBV hybridoma technique (Cole et al. (1983) Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96). Such antibodies can be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD, and any subclass thereof. The hybridoma producing the monoclonal antibodies of the invention may be cultivated in vitro or in vivo. The ability to produce high titers of monoclonal antibodies in vivo makes it a particularly useful method of production.

In certain embodiments, a HCoV-NH protein of the invention can be used to prepare an immunogenic composition (e.g., a vaccine) for generating antibodies against HCoV-NH coronavirus in a subject susceptible to the coronavirus. Such compositions can be prepared by any standard methods known in the art. For example, the composition contains an effective amount of a HCoV-NH protein of the invention, and a pharmaceutically acceptable carrier such as phosphate buffered saline or a bicarbonate solution. The carrier is selected on the basis of the mode and route of administration, and standard pharmaceutical practice. Suitable pharmaceutical carriers and diluents, as well as pharmaceutical necessities for their use, are described in Remington's Pharmaceutical Sciences. An adjuvant, e.g., a cholera toxin, Escherichia coli heat-labile enterotoxin (LT), liposome, immune-stimulating complex (ISCOM), or immunostimulatory sequences oligodeoxynucleotides (ISS-ODN), can also be included in a composition of the invention, if necessary. The HCoV-NH protein, fragments or analogs thereof may be components of a multivalent composition of vaccine against respiratory diseases or Kawasaki disease. Optionally, this multivalent composition contains at least one immunogenic fragment of a HCoV-NH protein as described above,

- 10 -

9791411 1 along with at least one protective antigen isolated from influenza virus, para-influenza virus 3, Strentococcus pneumoniae, Branliamella (Moroxella) gatarhalis, Staphylococcus aureus, or respiratory syncytial virus, in the presence or absence of adjuvant. Methods for preparing vaccines are generally well known in the art, as exemplified by U.S. Patent Nos. 4,601,903; 4,599,231; 4,599,230; and 4,596,792. Vaccines may be prepared as injectables, as liquid solutions or emulsions. The HCoV- NH proteins, fragments or analogs thereof may be mixed with physiologically acceptable and excipients compatible. Excipients may include, water, saline, dextrose, glycerol, ethanol, and combinations thereof. The vaccine may further contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, or adjuvants to enhance the effectiveness of the vaccines. Methods of achieving adjuvant effect for the vaccine include use of agents, such as aluminum hydroxide or phosphate (alum), commonly used as 0.05 to 0.1 percent solutions in phosphate buffered saline.

III. Diagnostic methods and tools

In certain embodiments, the present invention provides compositions and methods for diagnosing HCoV-NH virus infection and diseases associated with HCoV- NH virus infection, in particular, Kawasaki disease (KD). For example, the subject methods allow for determining whether a subject is suffering from an HCoV-NH viral infection, whether a subject has been exposed to an HCoV-NH virus infection, whether a subject has or is at increased risk of having KD. Many different diagnostic applications can be envisioned. The diagnostic tools of the invention typically contain an identifying component allowing the typing of the virus that is or was present in the subject.

In certain aspects, the diagnostic methods of the invention comprise assaying a sample taken from a patient suspected of having KD, to determine at least one of : 1) the presence of a HCoV-NH virus; 2) the presence of a HCoV-NH virus nucleic acid; 3) the presence of a HCoV-NH virus protein; or ) the presence of an antibody against HCoV-NH virus. The presence of any of these "indicators" may be indicative of KD in the subject. For example, a subject in the methods may be a child, such as a child of oriental descent (e.g., Japanese), which is known to be associated with KD. Optionally,

- 11 -

9791411 1 the sample can be a clinical sample, including exudates, body fluids (e.g., serum, amniotic fluid, middle ear effusion, sputum, bronchoalveolar lavage fluid) and tissues.

As HCoV-NH virus is associated with other conditions such as viral infections, the presence of any of these above "indicators" may be indicative of HCoV-NH virus associated conditions in the subject.

The manner in which the KD indicator is determined may vary, depending upon the wishes of the investigator. In the case of assays for HCoV-NH proteins, immunoassays are preferred. Any standard immunoassay using an antibody (polyclonal or monoclonal) against a HCoV-NH protein may be used, including immunoblots, ELISAs, RIAs, and sandwich assays. The targeted HCoV-NH protein may be the S protein, the M protein, the E protein, the N protein, or the IA or IB protein. If culturing of a sample for the virus is desired, the sample can be cultured in any of the standard media used for culturing viruses.

In certain aspects, the present invention relates to assays for HCoV-NH nucleic acids. For example, KD can also be diagnosed via carrying out a nucleic acid based assay, such as Southern blotting. Other assays within this ambit include assaying with labeled probes, such as oligonucleotides which carry radiolabels, biotin, or other labels, polymerase chain reactions (PCRs) using oligonucleotides corresponding to the certain regions of HCoV-NH virus. In certain aspects, the present invention also contemplates systems for carrying out the assays, such as kits. In the case of DNA assays, for example, such kits include a support means for immobilizing the nucleic acids of the sample, such as nitrocellulose, and at least one probe for hybridizing to the target. Other optional buffers, hybridization solutions (e.g., SSC, wash buffers) may be included in the kit. Where immunoassays are involved, the kits may also contain a solid support, such as a membrane (e.g., nitrocellulose), a bead, sphere, test tube, and rod, to which a receptor such as an antibody or antibody fragment specific for the target molecule will bind. The kits can also include a second receptor, such as a labeled antibody or labeled binding antibody fragment. The kits can be used for sandwich assays to detect one or more HCoV-NH proteins or viruses presenting the HCoV-NH proteins. Kits for competitive assays are also envisioned. Such kits include, e.g., a solid phase to which a sample of a HCoV-NH protein to be detected is bound, as well as a portion of HCoV-NH specific

- 12 -

9791411 1 antibody or antibody fragment. The binding receptor portion of the kits may be presented in a separate portion within the kit, or may be already bound to the solid, phase bound HCoV-NH protein. For example, such a system may be used in a displacement assay. In any such kit, the essentially elements are a moiety capable of detecting an agent indicative of the presence of a HCoV-NH virus, and a solid phase to which the agent binds, directly or indirectly.

For example, the present invention relates to a method of detecting an HCoV- NH virus in a sample. Such method comprises hybridizing and/or amplifying a nucleic acid of said virus or fragments thereof with a primer or probe and through detecting hybridized and/or amplified product. Optionally, the nucleic acid of this invention is useful as a hybridization probe for identifying coronavirus (e.g., HCoV-NH) in a sample. Such method can be similarly carried out for diagnosing or aiding in the diagnosis of KD in a subject.

A variety of hybridization conditions may be employed to achieve varying degrees of selectivity of the probe toward the target sequences. A high degree of selectivity/specificity requires stringent conditions. For example, the present invention contemplates diagnostic methods that involve differentially detecting HCoV-NH virus, but not HCoV-NL or HCoV-NL63. A hybridization reaction can be performed in a solution or on a solid phrase. In a solid phase, a test sequence from a sample is affixed to a selected matrix or surface. The fixed nucleic acid is then subjected to specific hybridization with selected probes comprising the nucleic acid of the present invention under desired conditions. The selected conditions will depend on the particular circumstances based on the particular criteria required depending on, for example, on the G+C contents, type of target nucleic acid, source of nucleic acid, size of hybridization probe etc. Following washing of the hybridization surface to remove non- specifically bound probe molecules, specific hybridization is detected or quantified, by means of the label. Optionally, the selected probe is at least 18 bp and may be in the range of 30 bp to 90 bp long.

Also within the scope of this invention is a diagnosing method using the above- described polypeptides or antibodies relating to the HCoV-NH virus. The presence of the polypeptides or antibodies in a subject indicates that the subject is infected with a coronavirus. Similarly, the presence of the polypeptides or antibodies in a subject

- 13 -

9791411 1 indicates that the subject has or is at risk of having KD. One can obtain a test sample from a subject and detect the presence or absence of the antibodies or polypeptides using standard techniques, including ELISAs, immunoprecipitations, immunofluorescence, EIA, RIA, and Western blotting analysis. In certain embodiments, the present invention relates to use of the HCoV-NH nucleic acid and protein sequences derived from KD patients.

IV. Drug screening methods

In certain embodiments, the present invention provides a method of identifying a compound for treating an infection with a HCoV-NH coronavirus. Such method comprises identifying compound that specifically binds to a HCoV-NH coronavirus nucleic acid. In other embodiments, the present invention provides a method of identifying a compound for treating an infection with a HCoV-NH coronavirus. Such method comprises identifying compound that specifically binds to a HCoV-NH coronavirus. For example, these screening methods allow for identifying a compound that specifically binds to a HCoV-NH coronavirus nucleic acid. Alternatively, these screening methods allow for identifying a compound that specifically binds to a polypeptide encoded by the HCoV-NH coronavirus nucleic acid.

In certain specific aspects, a polypeptide of this invention can be used in screening methods of identifying a compound for treating an infection with a coronavirus (e.g, HCoV-NH) or for treating KD. For example, the methods include (1) contacting a polypeptide of this invention with a suitable cell, to which the coronavirus binds to; and (2) determining a binding level between the polypeptide and the cell the presence or absence of a test compound. The binding level in the presence of the test compound, if lower than that in the absence of the test compound, indicates that the test compound can be used to treat an infection with the coronavirus. Examples of the cell include VERO E6 cells, NIH3T3 cells, HeLa cells, BHK-21 cells, and COS-7 cells. One can also use other cells that are capable of binding to a coronavirus.

It is understood that test compounds, such as drugs, chemical compounds, ionic compounds, organic compounds, organic ligands, including cofactors, saccharides, recombinant and synthetic peptides, proteins, peptoids, and other molecules and compositions, can be individually screened or one or more agents can be tested simultaneously for the ability to bind to a HCoV-NH coronavirus (e.g., a HCoV-NH

- 14 -

9791411 1 nucleic acid or protein) in accordance with the methods described herein. Where a mixture of agents is tested, the agents selected by the methods described can be separated and identified by suitable methods (e.g., PCR, sequencing, chromatography).

Large combinatorial libraries of agents (e.g., organic compounds, recombinant or synthetic peptides, peptoids, nucleic acids) produced by combinatorial chemical synthesis or other methods can be tested (see e.g., Zuckerman, R.N. et al., J. Med. Chβm., 37:2678-2685 (1994) and references cited therein; see also, Ohlmeyer, M.HJ. et al., Proc. Natl. Acad. Sci. USA 90:10922-10926 (1993) and DeWitt, S.H. et al., Proc. Natl. Acad. Sci. USA 90:6909-6913 (1993), relating to tagged compounds; Rutter, WJ. et al. U.S. Patent No. 5,010,175; Huebner, V.D. et al., U.S. Patent No. 5,182,366; and Geysen, H.M., U.S. Patent No. 4,833,092). The teachings of these references are incorporated herein by reference. Where agents selected from a combinatorial library carry unique tags, identification of individual agents by chromatographic methods is possible. In addition, chemical libraries, microbial broths and phage display libraries can be tested (screened) in accordance with the methods herein.

V. Therapeutic methods and tools

In certain embodiments, the above-described nucleic acids, proteins, antibodies, and compounds relating to the HCoV-NH coronavirus can be used for preventing or treating an infection with HCoV-NH coronavirus (optionally SARS). The currently known coronaviruses are associated with a variety of diseases of humans and domestic animals, including gastroenteritis and upper and lower respiratory tract disease. For example, the human coronaviruses HCoV- 229E and HCoV OC43 are associated with mild disease (the common cold), but more severe disease is observed in young children. Several coronaviruses cause a severe disease in animals and SARS-CoV is the first example of a coronavirus that causes severe disease in humans.

In other embodiments, the above-described nucleic acids, proteins, antibodies, and compounds relating to the HCoV-NH coronavirus can be used for preventing or treating Kawasaki disease (KD). Kawasaki disease is usually liable to attack infants of four years and downward, and shows symptoms that a patient is suddenly attacked by a high fever which lasts for 5 days or longer, the conjunctiva is congested, lips and a tongue turn crimson, the cervical lymph node is swollen, and a rash appears on the whole body. Although the mortality rate of Kawasaki disease is of the order of 1-2%,

- 15 -

9791411 1 the greatest problem thereof is that coronary lesions remain as sequelae in 10-20% of the patients.

As used herein, a therapeutic that "prevents" a disorder or condition refers to a compound that, in a statistical sample, reduces the occurrence of the disorder or condition in the treated sample relative to an untreated control sample, or delays the onset or reduces the severity of one or more symptoms of the disorder or condition relative to the untreated control sample. The term "treating" as used herein includes prophylaxis of the named condition or amelioration or elimination of the condition once it has been established. Optionally, subjects to be treated can be identified as having, or being at risk for acquiring, a condition characterized by coronavirus infection or KD. This method can be performed alone or in conjunction with other drugs or therapy. In cases of coronavirus infection, the subject method can be combined with any known anti-viral or anti-infection compouond. In cases of KD, the subject method may be combined with other treatments for KD such as asteroid hormone therapy and globulin therapy (e.g., an intravenous drip of a human immunoglobulin preparation).

In certain specific embodiments, the present invention provides a method of inducing an immune response in a subject against a coronavirus for treating KD or coronavirus infection. As described above, the method may comprise administering to the subject a HCoV-NH nucleic acid or a polypeptide encoded by the HCoV-NH nucleic acid.

In certain specific embodiments, the present invention provides a small interference RNA (siRNA) corresponding to the HCoV-NH nucleic acid sequences of the present invention. Such siRNA can be useful for blocking HCoV-NH viral replication in vivo, and for treating KD in patients.

VI. Pharmaceutical Compositions

In certain embodiments, this invention provides a pharmaceutical composition that contains a pharmaceutically acceptable carrier and an effective amount of a nucleic acid, a polypeptide, an antibody, or a compound of the invention. The pharmaceutical composition can be used to treat coronavirus infection (e.g., SARS) and to treat KD. The pharmaceutically acceptable carrier includes a solvent, a dispersion medium, a

- 16 -

9791411 1 coating, an antibacterial and antifungal agent, and an isotonic and absorption delaying agent.

In one in vivo approach, a composition of this invention is administered to a subject. Generally, the antibody or the compound is suspended in a pharmaceutically- acceptable carrier (e.g., physiological saline) and administered orally or by intravenous infusion, or injected or implanted subcutaneously, intramuscularly, intrathecally, intraperitoneally, intrarectally, intravaginally, intranasally, intragastrically, intratracheally, or intrapulmonarily.

The dosage required depends on the choice of the route of administration; the nature of the formulation; the nature of the subject's illness; the subject's size, weight, surface area, age, and sex; other drugs being administered; and the judgment of the attending physician. Suitable dosages are in the range of 0.01-100.0 mg/kg. Wide variations in the needed dosage are to be expected in view of the variety of compositions available and the different efficiencies of various routes of administration. For example, oral administration would be expected to require higher dosages than administration by intravenous injection. Variations in these dosage levels can be adjusted using standard empirical routines for optimization as is well understood in the art. Encapsulation of the composition in a suitable delivery vehicle (e.g., polymeric microparticles or implantable devices) may increase the efficiency of delivery, particularly for oral delivery.

In certain specific embodiments, vaccines of the present invention may be administered parenterally, by injection subcutaneously or intramuscularly. Alternatively, other modes of administration including suppositories and oral formulations may be desirable. The vaccines are administered in a manner compatible with the dosage formulation, and in an amount that is therapeutically effective, protective and immunogenic. The quantity to be administered depends on the subject to be treated, including, for example, the capacity of the individual's immune system to synthesize antibodies, and if needed, to produce a cell-mediated immune response. Precise amounts of active ingredient required to be administered depend on the judgment of the practitioner. However, suitable dosage ranges are readily determinable by one skilled in the art and may be of the order of micrograms of the polypeptide of this invention. Suitable regimes for initial administration and booster doses are also

- 17 -

9791411 1 variable, but may include an initial administration followed by subsequent administrations. The dosage of the vaccine may also depend on the route of administration and varies according to the size of the host.

A pharmaceutical composition of the invention can be formulated into dosage forms for different administration routes utilizing conventional methods. For example, it can be formulated in a capsule, a gel seal, or a tablet for oral administration. Capsules can contain any standard pharmaceutically acceptable materials such as gelatin or cellulose. Tablets can be formulated in accordance with conventional procedures by compressing mixtures of the composition with a solid carrier and a lubricant. Examples of solid carriers include starch and sugar bentonite. The composition can also be administered in a form of a hard shell tablet or a capsule containing a binder, e.g., lactose or mannitol, conventional filler, and a tableting agent. The pharmaceutical composition can be administered via the parenteral route. Examples of parenteral dosage forms include aqueous solutions, isotonic saline or 5% glucose of the active agent, or other well-known pharmaceutically acceptable excipient. Cyclodextrins, or other solubilizing agents well known to those familiar with the art, can be utilized as pharmaceutical excipients for delivery of the therapeutic agent.

The efficacy of a composition of this invention can be evaluated both in vitro and in vivo. For example, the composition can be tested for its ability to inhibit the binding between a coronavirus and its target cell in vitro. For in vivo studies, the composition can be injected into an animal (e.g., a mouse model) and its therapeutic effects are then accessed. Based on the results, an appropriate dosage range and administration route can be determined.

EXEMPLIFICATION The specific examples below are to be construed as merely illustrative, and not limitative of the remainder of the disclosure in any way whatsoever. Without further elaboration, it is believed that one skilled in the art can, based on the description herein, utilize the present invention to its fullest extent. All publications cited herein are hereby incorporated by reference in their entirety. Example 1. Evidence of a Novel Coronavirus Associated with Respiratory Tract Disease in Infants and Children.

- 18 -

9791411 1 1. Introduction

To investigate whether novel coronaviruses are circulating and potentially responsible for respiratory tract disease in children, we developed a strategy to screen for previously unknown coronaviruses. Our initial assumption was that all coronaviruses must have conserved functions and that these conserved functions are reflected in the genome. The replicase of coronaviruses is an RNA-dependent RNA polymerase the function of which is not provided by the host cell and therefore must be evolutionarily maintained by all coronaviruses. Therefore, we designed PCR probes that target regions of the coronavirus replicase Ia gene that are conserved among diverse mammalian coronaviruses. Using this approach, we identified genetic evidence of a novel coronavirus circulating in New Haven, Connecticut. Probes specific for this coronavirus, designated the New Haven coronavirus (HCoV-NH), were then used to screen specimens from the respiratory tracts of symptomatic patients. During our screening of specimens for this coronavirus, 2 studies from the Netherlands reported the identification of a novel coronavirus (Fouchier RA, et al., PNAS. 2004; 101:6212-6; van der Hoek L, et al., Nature Med 2004;10:368-373). This virus is a group 1 coronavirus and is most closely related to the human coronavirus 229E and transmissible gastroenteritis virus, a virus of pigs. Sequence comparisons between the virus identified in the Netherlands and the coronavirus identified in New Haven, Connecticut revealed that these viruses were closely related and likely represent the same species of virus. Here we describe the seasonal distribution and clinical manifestation of disease associated with this novel human coronavirus.

2. Methods

1) Primer design and RT-PCR screening. Primers for the detection of coronaviruses were based on conserved regions of the replicase Ia gene of group I, group II and group III coronaviruses and the SARS coronavirus. The replicase Ia genes from avian infectious bronchitis virus (GenBank accession number AJ311317), bovine coronavirus strain LUN (GenBank accession number AF391542), bovine coronavirus strain Quebec (Genbank accession number AF220295), bovine coronavirus isolate BCoV-ENT (Genbank accession number AF391541), human coronavirus 229E

(Genbank accession number NC_002645), transmissible gastroenteritis virus (Genbank accession number NC_002306) and SARS-CoV TOR2 (Genbank accession number

- 19 -

9791411 1 AY274119) were aligned using Clustal W in the Lasergene software package (DNASTAR, Madison, WI). Two conserved regions were identified and primers corresponding to these regions were synthesized (Yale Oligonucleotide Laboratory, Department of Pathology). The forward primer, 5'GCGCAAAATAATGAATTAATGCC (G/C clamp is underlined, SEQ ID NO: 96), and the reverse primer, 5'GACGCACCACCATATGAATCCTG (SEQ ID NO: 97), represent consensus sequences of conserved regions within the 3' 1,000 bases of the replicase Ia gene of all the coronaviruses listed above (relative to sequences 11781 to 12285 of HCoV 229E). The predicted length of the amplicons produced by theses primers is approximately 550 base pairs. RNA from respiratory specimens obtained from the Clinical Virology Laboratory was extracted with the QiaAmp Viral RNA Mini Kit (Qiagen Inc., Valencia, CA) according to the manufacturer's protocol. cDNA for each respiratory specimen was synthesized with random hβxamer primers and MuMLV RT (New England Biolabs, Beverly, MA) according to the manufacturer's specification. cDNAs were subsequently screened by PCR with HotStar Taq polymerase (Qiagen) according to the manufacturer's specification using the following amplification program: 95° C for 15 minutes followed by 40 cycles of 94° C for 1 minute, 50° C for 1 minute, 72° C for 1 minute and completed with a 10 minute 72° cycle. For the initial screening of respiratory specimens, RNA was extracted from human coronavirus 229E (ATCC VR-740, Manassas, VA) infected MRC-5 cells as a positive control. Each set of RT and PCR reactions had appropriate negative controls. PCR reaction products were analyzed by agarose gel electrophoresis. Following the initial screening of respiratory specimens, amplicons of the predicted molecular weight were isolated and sequenced. Sequencing was performed on Applied Biosystems 377 DNA automated sequencers at the W.M. Keck Biotechnology Resource Lab, Yale University School of Medicine. Sequences corresponding to a potential novel human coronavirus were identified and primers specific for this agent were synthesized. The forward primer 5' GCGCTATGAGGGTGGTTGTAAC (SEQ ID NO: 98) and reverse primer 5' CGCGCAGTTAAAAGTCCAGAATTAAC (SEQ ID NO: 99) amplify a 215 base region of the novel coronavirus genome (G/C clamps are underlined). These primers target regions of the novel coronavirus genome that are distinct from the corresponding region in the human coronavirus 229E genome. PCR screening with these primers was performed using the following amplification program: 95° C for 15 minutes followed by

- 20 -

9791411 1 40 cycles of 94° C for 1 minute, 55° C for 1 minute, 72° C for 1 minute and completed with a 10 minute 72° cycle. These primers were used to screen a bank of respiratory specimens.

2) Specimens. We chose to screen specimens collected from the respiratory tract of symptomatic children < 5 years of age that tested negative for respiratory syncytial virus (RSV), influenza A and B, human parainfluenza viruses 1-3 and adenovirus by direct fluorescent antibody assay. These samples were screened for presence of the human metapneumovirus (hMPV) using a RT-PCR approach previously described (Esper F, et al., J Infect Dis 2004;189:1388-96; Esper F, et al., 2003 ; 111 : 1407-10) . These samples were submitted for diagnostic testing to the Clinical Virology Laboratory, Yale-New Haven Hospital from both ambulatory and hospitalized patients. Specimens were collected from January 1, 2002 to February 14, 2003. Individuals can be counted more than once if specimens were collected > 30 days apart. Clinical data from individuals who tested positive for this virus were collected by extracting information from the medical records on a standardized form. Children with evidence of infection with another viral respiratory pathogen were excluded when tabulating the clinical features associated with HCoV-NH. Co-morbidity was defined as prematurity (< 35 weeks gestational age), underlying pulmonary disease, genetic syndromes, acquired immunosuppression, malignancies and congenital heart disease. The Yale University Human Investigations Committee approved collection and screening of respiratory specimens.

3) Sequencing and phylogenetic analysis. The amplicon of each sample that tested positive by RT-PCR was sequenced to confirm the presence of the novel coronavirus. Phylogenetic analysis was performed using Lasergene software (above). 3. Results

1) Identification of novel coronavirus sequence. Using the primers that target the conserved regions of the coronavirus replicase Ia gene, we screened 601 specimens for coronaviruses. The screening reaction was performed on pooled RNA; each pooled reaction included 5-10 individual samples. Of the 80 pooled amplification reactions, 17 yielded an amplicon of approximately 550 base pairs (data not shown). Following sequencing of these amplicons a nucleotide BLAST search was performed. Human coronavirus OC43 was identified in eight pooled reaction products and human

- 21 -

9791411 1 coronavirus 229E was identified in 1 pooled reaction. Six amplicons were either human DNA or did not yield an interpretable sequence. The 2 remaining amplicons were similar and represented novel sequences most closely related to group 1 coronaviruses. These sequences were approximately 69-71% identical to human coronavirus 229E and transmissible gastroenteritis virus on the nucleotide level and 68% identical to human coronavirus 229E and transmissible gastroenteritis virus on the amino acid level. Thereafter, PCR primers were synthesized that were specific for these novel sequences of HCoV-NH and these primers were used to screen all respiratory specimens.

2) Screening respiratory specimens for HCoV-NH. Overall, 1,265 respiratory specimens from 895 individuals were screened by RT-PCR using primers specific for

HCoV-NH (the 601 specimens in the initial screening were re-screened using this primer set). Screening reactions were again pooled with 5-10 individual samples within each pool. If a pooled reaction produced an appropriate sized amplicon, the samples within that pool would be individually tested. Seventy-nine (8.8%) of these individual had a positive test result for HCoV-NH. Two individuals each had 2 positive specimens, collected 5 days and 7 days apart, respectively. In both instances, these were considered to be due to a single episode of infection with HCoV-NH. The median age of the children who tested positive for the novel coronavirus was 6.5 months. Fifty of the 79 children with a positive test result (63.3%) were < 1 year of age and 27 (34.2%) were 0-3 months old. Forty-nine (62.0%) were males. Eleven HCoV-NH infected children were hospitalized since birth in the Newborn Intensive Care Unit. The age distribution of HCoV-NH-positive individuals is shown in figure 1.

3) Clinical features associated with HCoV-NH. Clinical data were available for 76 of the 79 individuals who tested positive for HCoV-NH. Of these, 9 (11.8%) children had evidence of recent infection with another respiratory virus. Two children were co-infected with hMPV. Seven children had other respiratory specimens collected during the same hospitalization or illness that tested positive for a respiratory virus by DFA (one child had a parainfluenza infection and 6 children had RSV infection). Of the 67 children who only tested positive for HCoV-NH, cough, rhinorrhea, tachypnea, fever, abnormal breath sounds and hypoxia were the most common findings (Table 1). Thirty-five of 67 (52.2%) had an underlying co-morbidity (19 [28.4%] had been premature births). Of those children who had a chest radiograph obtained, 66.0% (25 of

- 22 -

9791411 1 38) had abnormal findings characterized by peribronchial cuffing, atelectasis and/or infiltrates.

Table 1. Clinical features associated with HCoV-NH in children < 5 years old.

Clinical Feature NIClT Non-NICU Total Number of

(n=11 ) (n=56) Individuals (%)^b

Cough 0 (0%) 43 (76.8%) 43 (64.2%)

Rhinorrhea 3 (27.3%) 38 (67.9%) 41 (61.2%)

Tachypnea⁰ 9 (81,8%) 30 (53.6%) 39 (58.2%)

Fever^d 2 (18.2%) 30 (53.6%) 32 (47.8%)

Rhonchi, rales, 6 (54.5%) 24 (42.9%) 30 (44.8%) coarse breath sounds

Hypoxia⁶ 9 (81.8) 16 (28.6%) 24 (35.8%)

Chest retractions 3 (27.3) 19 (33.9%) 22 (32.8%)

Wheezing 1 (9.1%) 20 (35.7%) 21(31.3%)

Stridor 0 (0.0%) 4 (7.1 %) 4 (6.0%)

Abnormal chest 5 of 7 (71.45) 20 of 31 (64.5%) 25 of 38 radiograph^f (65.8%) ^a NICU, Newborn Intensive Care Unit ^b based on 67 HCoV-NH positive individuals unless otherwise noted ^c based on normal values for age-specific respiratory rates ^d temperature >38°C ^e oxygen saturation < 90% ^f base on the number of chest radiographs obtained

Eleven of the positive children had been hospitalized since birth in the Newborn Intensive Care Unit. The clinical features associated with HCoV-NH infection in the Newborn Intensive Care Unit are shown in table 1. The median age of these children at the time of the collection of HCoV-NH positive specimen was 26 days (range 1-151 days). The age distribution and time of infection of the children with HCoV-NH infection in the Newborn Intensive Care Unit is shown in figures 1 and 2 respectively. Five of these 11 children were infected in February 2002. The hospitalization of all of these children overlapped. Three of the 11 eleven children tested positive for HCoV- NH in a 3-week period spanning late January and early February 2003. Each child was present in the Newborn Intensive Care Unit at the same time.

Overall, 2 of the 79 children who tested positive for HCoV-NH died; both had been hospitalized in the Newborn Intensive Care Unit. One child was diagnosed with hydrops fetalis in utero and died on the second day of life, a day after a respiratory

- 23 -

9791411 1 specimen was collected that tested positive for HCoV-NH. The second child, who had been born at 28 weeks gestation died on day of life 170; a specimen collected on day of life 151 was positive for HCoV-NH. This child also had a history of necrotizing enterocolitis and liver failure prior to day of life 151 and ultimately died of multi-organ system failure.

4) Seasonal distribution of HCoV-NH. The weekly distribution of HCoV-NH positive specimens is shown in figure 2 and the percentage of positive specimens detected per month is shown in table 2. For specimens collected between January 1, 2002 and December 31, 2002, a majority (42/67, 62.7%) specimens that tested positive had been collected in the first 10 weeks of the year. Relatively few positive samples (13/67, 19.4%) were identified from June to late November.

Table 2. Respiratory specimens tested for HCoV-NH from January 2002 to mid- February 2003 in children < 5 years old.

Number tested

Month Specimens Individuals HCoV-NH positive individuals (%)

January 2002 148 99 8 (8.1 )

February 117 81 27(33.3%)

March 123 98 8(8.2%)

April 74 51 3(5.9%)

May 48 32 4(12.5%)

June 19 15 4(26.7%)

July 42 17 0(0%)

August 29 19 5(26.3%)

September 38 22 4(18.2%)

October 89 61 0(0%)

November 137 105 0(0%)

December 144 104 4(3.8%)

January 2003 177 129 4(3.1 %)

February 80 62 8(12.9%)

Total 1 ,265 895 79(8.8%)

5) Phylogenetic analysis of HCoV-NH. Sequencing analysis was performed on the amplicon derived from each positive sample. Phylogenetic analysis of 126 bp of the HCoV-NH specific primer region, containing representative sequences of HCoV-NH is shown in figure 3. Overall, the amplified region of the putative replicase Ia gene of HCoV-NH was highly conserved. These sequences closely matched the sequences of the replicase Ia gene of NL-63, the coronavirus recently identified in the Netherlands. Several distinct polymorphisms were identified in the isolates of HCoV-NH. These

- 24 -

9791411 1 polymorphisms were not present in NL-63. Most of the polymorphisms in the replicase Ia gene in HCoV-NH isolates did not change the putative amino acid sequence.

Example 2. Association of a New Coronavirus with Kawasaki Disease. 1. Introduction

S There is evidence that suggests that Kawasaki disease may be triggered by a response to an infectious agent. Epidemics of Kawasaki disease, with wave-like spread, have been observed in many countries (Yanagawa H, et al., Lancet. 1986;2:1138-9). Epidemics generally occur in the winter and spring. Kawasaki disease is rare in children < 3 months of age, which suggests the possibility that they are protected from infection 0 by antibodies that are passively acquired from the mother. Likewise, widespread immunity to a common infectious agent may explain the rarity of Kawasaki disease observed in adults. A history of an antecedent respiratory illness prior to disease onset has been reported (Bell DM, et al. New Engl J Med. 1981 ;304: 1568-75). Although many infectious agents have been proposed as the cause of Kawasaki disease, none has 5 been consistently associated with the disease. Rowley et al. recently identified an antigen in respiratory epithelial cells and macrophages obtained from children with Kawasaki disease by using synthetic antibodies (Rowley AH, et al., J Infect Dis 2004;190:856-865). The origin of this antigen remains unknown.

To determine whether previously unknown coronaviruses circulate in the human population, we developed genetic probes that target regions of the Ia gene that are conserved among human, avian and mammalian coronaviruses. Screening of stored samples of respiratory secretions from children < 5 years old revealed evidence of a novel coronavirus, designated the New Haven coronavirus (HCoV-NH) (See Example 1 above). Based on sequence and phylogenetic analysis of the Ia gene, the HCoV-NH is closely related to a human coronavirus recently identified in the Netherlands. One child in our study, a 6-month old infant from whom 2 respiratory specimens tested positive for HCoV-NH, was diagnosed with Kawasaki disease. To further assess the possible association between Kawasaki disease and infection with HCoV-NH, we expanded the time frame to the entire period during which we had obtained samples and we conducted a case-control study to assess this association.

- 25 -

9791411 1 2. Methods

1) Study design. Cases of Kawasaki disease were identified from hospital discharge records. As part of an ongoing epidemiological investigation of respiratory viruses, we have archived samples of respiratory secretions between November 2001 and May 2004 from children <5 years of age that tested negative for respiratory syncytial virus (RSV), influenza virus, parainfluenza viruses and adenovirus by a direct fluorescent antibody test. For each case subject with Kawasaki disease we identified two matched controls — the first two children (from whom we had a sample) who were within 6 months of age of the case subject and whose sample was obtained within one week of that of the matched case subject.

2) Primer design and RT-PCR screening. Samples were screened for HCoV-NH by RT-PCR with probes specific for the HCoV-NH Ia gene (forward primer, 5' GCGCTATGAGGGTGGTTGTAAC (SEQ ID NO: 98), reverse primer, 5' CGCGCAGTTAAAAGTCCAGAATTAAC (SEQ ID NO: 99), G/C clamps are underlined) and the spike gene (Fouchier RA, et al., PNAS. 2004;101 :6212-6; van der Hoek L, et al., Nature Med 2004; 10:368-373) (forward primer, 5 'CCGCGTTAAGAGTGGTTCACC (SEQ ID NO: 100), reverse primer, 5 'CAGCGGTCATGGCACC (SEQ ID NO: 101), nested primer forward primer, 5' CCGCTTGAAGCCACCTGGC (SEQ ID NO: 102), nested reverse primer 5' GCGCGGTTGGTTACATGGTGTCAC (SEQ ID NO: 103), GenBank accession numbers NC_005831 and AY518894). PCR amplification cycles were as follows: 95°C for 15 minutes to activate the HotStar polymerase (Qiagen), followed by 40 cycles of 45 seconds at 95⁰C, 60 seconds at 55⁰C, and 30 seconds at 72⁰C, followed by a final extension of 10 minutes at 72°C. Each set of RT and PCR reactions included appropriate negative controls. PCR reactions were analyzed by agarose gel electrophoresis. For a sample to be considered positive for HCoV-NH, it must have tested positive by RT-PCR for both the Ia gene and the spike gene. Amplicons from each positive specimen were sequenced to confirm that HCoV-NH was in the sample.

3) Statistical analysis. The magnitude of the association (and the associated 95% confidence interval) as well as the statistical significance of the association was calculated with the Mantel-Haenszel test for matched data with multiple controls using

- 26 -

9791411 1 True Epistat Gustafson TL (True Epistat. 5th Edition ed. Richardson, TX: Epistat Services, 1994).

3. Results

From the hospital discharge records, we identified 53 children with a diagnosis of Kawasaki disease from October 2001 to April 2004. We had samples of respiratory secretions from 11 (20.8%) of these patients. The mean age of the cases was 24.4 months and mean age of the controls was 23.7 months (P=O.34). Eight of the 11 children with Kawasaki disease (72.7%) and 1 of 22 controls (4.5%) tested positive for HCoV-NH by RT-PCR (Mantel-Haenszel matched odds ratio = 16.0; 95% CI: 3.4 - 74.4; Mantel-Haenszel χ2 = 10.1; P = 0.0015). Multiple genetic polymorphisms were observed in HCoV-NH sequences amplified from individuals with Kawasaki disease.

The clinical features of the cases of Kawasaki disease are shown in the table. Of the 11 children with Kawasaki disease, criteria for classic Kawasaki disease were fulfilled by 10, 8 of whom tested positive for HCoV-NH. The one child who met three criteria for Kawasaki disease and had a normal echocardiogram tested negative for

HCoV-NH. Nosocomial acquisition of HCoV-NH in children admitted with Kawasaki disease was unlikely. The respiratory specimens for 10 of 11 children with Kawasaki disease were collected either before or during the first day of hospitalization. The respiratory specimen for one child, patient 10, was collected on day 11 of hospitalization. This child tested negative for HCoV-NH. The median time between onset of fever and the acquisition of the respiratory specimen that was tested for HCoV- NH was 5 days (range 4-13 days) (Figure 4). Seven of the 11 children (63.6%) who were diagnosed with KD and 19 of the 22 controls (86.4%) had respiratory symptoms consistent with an upper respiratory tract infection (P=O.19). Of the 7 children with Kawasaki disease who had respiratory symptoms, 6 tested positive for HCoV-NH. Samples for both cases and controls without respiratory symptoms recorded in the medical records were obtained as part of a diagnostic work-up for fever. All of the children in the study presented from November to April.

Example 3. Evidence that HCoV-NH is the cause of KD. As described above, distinct genetic polymorphisms were observed in the

HCoV-NH Ia gene sequences amplified from individuals with KD (see, e.g., SEQ ID NOs: 4-69). Further phylogenetic analysis, based on a potential variable region of the

- 27 -

9791411 1 spike (S) gene, of HCoV-NH strains isolated from KD and non-KD patients, HCoV-NH infected patients (figure 5) demonstrated that HCoV-NH identified from most KD patients cluster into a distinct genotype (see, e.g., SEQ ID NOs: 70-93). We have recently obtained additional phylogenetic data of the viral isolates from a KD patient (Strain 2865) below. Sequence 1 targets the spike gene, while Sequence 2 targets the IA gene.

Sequence 1 (SEQ ID NO: 94):

TTTTAAATAA TTGTACCAAA TATAATATTT ATGATTATGT TGGTACTGGAATTATACGTT CTTCAAACCA GTCACTTGCT GGTGGTATTA CATATGTTTCTAACTCTGGT AATTTACTTG GTTTTAAAAA TGTTTCCACT GGTAACATTTTTATT

Sequence 2 (SEQ ID NO: 95):

AAAAATTTAAATACCTTACGTAGAGGTGCCGTTCTTGGTTTTATAGGT GCCCACAATTCGTCTACAAGCTGGTAAACAAACTGAATTGGCTGTTAATTC These intriguing observations suggest the possibility that there may be a specific viral genotype associated with KD. One hypothesis is that specific viral polymorphisms or functions present in HCoV-NH strains isolated from KD patients, and not present in HCoV-NH isolated from non-KD, HCoV-NH infected patients, are responsible for the clinical manifestation of KD. HCoV-NH was propagated in cell culture from a number of children with KD. A representative electron micrograph of the HCoV-NH viral particle, initially isolated from a patient with KD and propagated in cell culture, is shown in the figure 6. The demonstration of in vitro propagation of HCoV-NH is an essential component of the proposed studies. We hypothesize that the nature of viral infection differs between KD and non-

KD, HCoV-NH infected patients. To explore this hypothesis, we can determine the extent and duration of viral shedding, assay for viremia and determine whether HCoV- NH strains differ between KD and non-KD, HCoV-NH infected patients.

We also hypothesize that there is a qualitative and quantitative difference in the immune response to infection with HCoV-NH between KD and non-KD, HCoV-NH infected patients. To explore this hypothesis, we can determine whether KD patients have a) higher antibody titer response to HCoV-NH; b) respond to HCoV-NH with

- 28 -

9791411 1 different immunoglobulin classes; and c) develop antibodies to different viral HCoV- NH proteins vs. non-KD, HCoV-NH infected patient controls.

We further hypothesize that diseased tissue in KD patients contains HCoV-NH, which is responsible for the pathology observed in KD. To investigate this, we can develop the tools to detect HCoV-NH antigens in tissue. Antibodies developed against whole virus and the major antigenic proteins of HCoV-NH are to be used for in immunohistochemical studies. We can also determine by ELISA and western blot analyses whether the synthetic antibody developed by Rowley et al., which bound to an unknown antigen in respiratory epithelial cells and macrophages from children with KD, is specific for HCoV-NH.

INCORPORATION BY REFERENCE

All publications and patents mentioned herein are hereby incorporated by reference in their entirety as if each individual publication or patent was specifically and individually indicated to be incorporated by reference. While specific embodiments of the subject invention have been discussed, the above specification is illustrative and not restrictive. Many variations of the invention will become apparent to those skilled in the art upon review of this specification and the claims below. The full scope of the invention should be determined by reference to the claims, along with their full scope of equivalents, and the specification, along with such variations.

- 29 -

9791411 1

Claims

We Claim:

1. An isolated nucleic acid comprising a nucleotide sequence that is at least 99% identical to SEQ ID NO: 1.

2. An isolated human coronavirus designated HCoV-NH, comprising the nucleic acid of claim 1.

3. A vaccine which comprises an effective immunizing amount of the recombinant infectious human coronavirus of claim 2 and a suitable carrier.

4. The vaccine of claim 3, wherein the recombinant infectious human coronavirus is inactivated.

5. An isolated nucleic acid probe that specifically hybridizes to a target region of a HCoV-NH nucleic acid or a complement thereof under a highly stringent condition.

6. The isolated nucleic acid probe of claim 5, wherein the nucleic acid probe comprises at least 15 nucleotides.

7. The isolated nucleic acid probe of claim 5, wherein the target region is in the replicase IA gene.

8. The isolated nucleic acid probe of claim 6, comprising a nucleotide sequence selected from SEQ ID NOs: 4-69 and 95-99.

9. The isolated nucleic acid of claim 5, wherein the target region is in the spike gene.

10. The isolated nucleic acid probe of claim 9, comprising a nucleotide sequence selected from SEQ ID NOs: 70-94 and 100-103.

11. The isolated nucleic acid probe of claim 5, wherein the HCoV-NH nucleic acid is derived from a patient having Kawasaki disease (KD).

12. The isolated nucleic acid probe of claim 11, comprising a nucleotide sequence selected from SEQ ID NOs: 56, 74, 78, 80, 82, 86, 87, 88, 94, and 95.

13. The isolated nucleic acid probe of claim 3, wherein the nucleic acid probe is labeled.

14. A method of characterizing a human coronavirus by type, comprising:

- 30 -

9791411 1 1) contacting a sample containing a HCoV-NH nucleic acid with a nucleic acid probe that specifically hybridizes to a target region of a HCoV-NH nucleic acid or a complement thereof under a highly stringent condition;

2) detecting the probe-HCoV-NH nucleic acid hybrid; and 3) characterizing the type of the human coronavirus by the presence or absence of said hybrids.

15. The method of claim 14, wherein the nucleic acid probe binds to a target region selected from the replicase IA gene, the spike gene, and the nucleocapsid (N) gene.

16. The method of claim 14, wherein the nucleic acid probe comprises a sequence selected from SEQ ID NOs: 4-103.

17. A method of diagnosing or aiding in the diagnosis of Kawasaki disease (KD) in a subject, comprising detecting a human coronavirus in a sample from the subject, wherein the presence of the human coronavirus indicates that the subject has or is at increased risk of having KD.

18. The method of the claim 17, wherein the human coronavirus is HCoV-NH.

19. The method of claim 17, wherein the method comprises detecting a human coronavirus nucleic acid.

20. The method of claim 19, wherein the human coronavirus nucleic acid is detected by a nucleic acid probe that hybridizes to a target region of the human coronavirus nucleic acid or a complement thereof under a stringent condition.

21. The method of claim 20, wherein the nucleic acid probe is non species-specific.

22. The method of claim 20, wherein the nucleic acid probe is species-specific.

23. The method of claim 20, wherein the nucleic acid probe specifically hybridizes to a target region of a HCoV-NH nucleic acid or a complement thereof under a highly stringent condition.

24. The method of claim 17, wherein the method comprises detecting a protein encoded by a human coronavirus nucleic acid.

25. The method of claim 17, wherein the protein is encoded by a target region

- 31 -

9791411 1 selected from the replicase IA gene, the spike gene, and the nucleocapsid (N) gene.

26. A method of inducing an immune response in a subject against a coronavirus, the method comprising administering to the subject a HCoV-NH nucleic acid or

S a polypeptide encoded by the HCoV-NH nucleic acid.

27. A method of identifying a compound for treating a coronavirus infection, comprising identifying compound that specifically binds to a HCoV-NH coronavirus.

28. The method of claim 27, wherein the compound specifically binds to a HCoV- 0 NH coronavirus nucleic acid.

29. The method of claim 27, wherein the compound specifically binds to a polypeptide encoded by the HCoV-NH coronavirus nucleic acid.

30. A method of identifying a compound for treating a coronavirus infection, comprising identifying compound that specifically binds to a HCoV-NH 5 coronavirus nucleic acid.

- 32 -

9791411 1