EP1766066A2 - Screening for compounds that affect the pathophysiologic mechanisms of neurological disorders - Google Patents

Abstract

Disclosed is a method of identifying compounds that effect the pathophysiologic mechanisms underlying movement disorders, ions channels, HCN3, and pain.

Description

SCREENING FOR COMPOUNDS THAT AFFECT THE PATHOPHYS1OLOG 1C MECHANISMS OF NEUROLOGICAL DISORDERS

TECHNICAL FIELD AND INDUSTRIAL APPIICABILITY OF INVENTION The present invention relates generally to methods for screening compound for their effect on neurological disorders through gene expression analyses. The present invention also relates to identifying pathophysiologic mechanisms underlyi ήg the development of motor symptoms in movement disorders through gene expressi on analyses of the basal ganglia circuitry.

BACKGROUND OF THE INVENTION Many neurological disorders affect the normal function of neurons. More specifically, they result in changes in RNA expression and ultimately protein production. A number of neurological disorders have been well studied in the art 1 nd can be attributed to particular areas in the brain. One such example is the group ol movement disorders that affect the basal ganglia circuitry. Different diseases in this group can result in either an up- or down-regulati ω of the basal gϊinglia circuitry. Prototypes of these dysfunctional conditions are Huntington's disease (HD) and Parkinson's disease (PD), respectively. Their symptoms represent opposite ends of the entire spectrum of motor behavior. HD i si characterized by involuntary hyperkmetic movements first starting in fingers and t ^eε and later extending to more proximal limb muscles. Adam et al., Principles of Neurology, 6"¹ ed, McGraw-Hill, New York, pl061-2 (1997). In contrast, PD is characterized by a hypokinetic syndrome consisting of an expressionless face, pov arty and slowness of voluntary movements, stooped posture, and rigidity. Adam et al., Principles of Neurology, 6^th ed, McGraw-Hill, New York, pl068-71 (1997). Other neurodegenerative diseases falling into the hypokinetic category are the multiple system atrophies (MSA), cortical-basal ganglionio degeneration and progressive supranuclear palsy. Paridnsonian syndromes can also occur secondar to toxic, drug induced, and infectious or traumatic lesion of the central nervous syste n. Hyper etic syndromes can manifest themselves with choreatic, athetotic or yto tic features. The group of primarily choreatic disorders is comprised of Huntmgton's chorea, benign hereditary chorea, neuroacanthocytosis and chorea associated with rheumatic diseases or ischemic lesions of the subthalamic nucleus. Dystonic syndromes can either be generalized or focal; etiologic factors range from single gene defects as in dystonia musculorum deformans to metabolic disorders such as Wilson and Hallervorder-Spatz disease. Common to all these diseases is a dysfunction of the basal ganglia circuitry, which is a group of nuclei in the central nervous system that regulates motor behavior. Core structures of the circuitry are the striatum (STR), the internal and external segments of the globus pallidus (GPI and GPE), the subthalamic nucleus (STN) and the substantianigra pars compacta (SNC), and pars reticulata (SNR). In humans and non-human primates the striatum is comprised of two separate structures, the caudate nucleus and putamen. Heimer et al., Basal Ganglia, The Rat Nervous System, 2^nd ed., Academic Press, San Diego, p. 579-628 (1995); Alheid et al., Basal Ganglia, The Human Nervous System, Academic Press, San Diego, p. 483-582 (1990). The connections between these areas, which represent the anatomical correlate of the various functions such as motor learning and motor memory or coordination of agonist and antagonist muscle activity have been well described. The current model of basal ganglia function predicts that cortical information is processed by two independent parallel pathways with opposing effects on motor output. The direct pathway projects from the STR, which is generally thought to be the input stage of the basal ganglia, to the GPI and SNR. These two nuclei, which are very similar in structure and function, are regarded as the output station of the basal ganglia. In the indirect pathway the striatal information reaches the output station via the GPE and STN. Activation of the direct pathway causes an inhibition of GPI SNR neurons and activation of the indirect pathway results in an increased activity of these cells. The overall net effect on the motor system is an increased or decreased output, respectively. Alexander et al., Functional architecture of the basal ganglia circuits: neural substrates of parallel processing, Trends Neurosci. 13:266-271 (1990); Smith et al., The neuronal network in the basal ganglia as revealed by the study of synaptic connections of identified neurons, Trends Neurosci. 13: 259-65 (1990); Smith et al., Microcircuitry of the direct and indirect pathways of the basal ganglia, Neuroscience 86:353-87 (1998). Although recent results have demonstrated that the anatomical connections within the basal ganglia are far more complicated, the model known in the art has served well in predicting the functional changes occurring with different diseases of the basal ganglia and the effects of surgical interventions targeted at different areas in the circuit. Parent et al., Organization of the basal ganglia: the importance of axonal collateralization, Trends Neurosci. 23(10 Suρρl.):S20-7 (2000); Albin et al., The functional anatomy of basal ganglia disorders, Trends Neurosci. 12:366-75 (1989); Chesselet et al., Basal ganglia and movement disorders: an update, Trends Neurosci. 19:417-22 (1996); Bergman et al., Reversal of experimental parkinsonism by lesions of the subthalamic nucleus, Science 249:1438-6 (1990); Kumar et al., Pallidotomy and deep brain stimulation of the pallidum and subthalamic nucleus in advanced Parkinson's disease, Movement Disorders 13(Suppl.l):73-82 (1998). The primary lesions of the diseases mentioned above occur in different structures of the basal ganglia. In PD the pathological hallmark is a loss of dopaminergic cells predominantly in the ventrolateral part of the SNC. Tretiakoff, Contribution a l'etude d'anatomie pathologic du locus niger, Thesis, University of Paris (1919); Hassler, Zur Pathologie der Pralysis agitans und des postencephalitischen Parkinsonismus, Journal fuer Psychologie und Neurologie 48:387 (1938); Gibb et al., Anatomy, pigmentation, ventral and dorsal subpopulations of the substantia nigra, and differential cell death in Parkinson's disease, JNeurol. Neurosurg. Psychiatry 54:388- 96 (1991). The loss of dopaminergic input, which occurs mainly at the level of the STR results in widespread functional changes throughout the basal ganglia. Obeso et al., Pathophysiology of the basal ganglia in Parkinson's disease, Trends Neurosci. 23:S8-19 (2000). The increased activation of the indirect pathway results in an augmented inhibition of the GPE and consequently in a disinhibition of the STN.

Together with the decreased activity of the direct pathway this results in an increased activation of the GPI/SNR and a decreased motor output. Albin et al., The functional anatomy of basal ganglia disorders, Trends Neurosci. 12:366-75 (1989). At the cellular level the model of the basal ganglia circuitry known in the art predicts an augmented activity of neurons in these two areas. This could be confirmed by in vivo electrophysiologic recordings from the GPI in PD patients and in various animal models of the disease. In situ hybridization experiments demonstrated an up- regulation of cytochrome oxidase I and glutamic acid decarboxylase mRNA in both GPI and SNR indicating an augmented cellular metabolism and neurotransmitter turnover. Vila et al., Consequences of nigrostriatal denervation on the ga ma- aminobutyric acidic neurons of substantia nigra pars reticulata and superior colliculus in parkinsonian syndromes, Neurology 46:802-9 (1996); Herrero et al., Consequences of nigrostriatal denervation and L-do a therapy on the expression of glutamic acid decarboxylase messenger RNA in the pallidum, Neurology 47:219-24 (1996); Filion et al., Abnormal spontaneous activity of globus pallidus neurons in monkeys with MPTP- induced parkinsonism, Brain Res. 547:142-51 (1991). The increased activity of neurons in the basal ganglia output neurons could also be confirmed in in vivo electrophysiological experiments. Extracellular single unit recordings from the GPI revealed both increased firing rates as well as altered firing patterns with burst firing, regular oscillations and an increased percentage of synchronized neuronal activity. Filion et al., Abnormal spontaneous activity of globus pallidus neurons in monkeys with MPTP-induced parkinsonism, Brain Res. 547: 142-51 (1991); Bergman et al., The primate subthalamic nucleus. II. Neuronal activity in the MPTP model of parkinsonism, J Neurophysiol. 72:507-20 (1994); Ruskin et al., Nigrostriatal lesions and dopamine agonists affect firing patterns of rodent entopeduncular nucleus neurons, J Neurophysiol. 88:487-96 (2002). These changes are completely or partially reversible by Dl or D2 dopamine receptor agonists. Ruskin et al., Nigrostriatal lesions and dopamine agonists affect firing patterns of rodent entopeduncular nucleus neurons, J Neurophysiol. 88:487-96 (2002); Heimer et al., Dopamine replacement therapy reverses abnormal synchronization of pallidal neurons in the l-methyl-4-phenyl- 1,2,3,6-tetrahydropyridine primate model of parkinsonism, J Neurosci. 22:7850-5 (2002). In MPTP lesioned primates that had developed dyskinesias after prolonged treatment with L-dopa the firing frequency of neurons in the GPI was drastically reduced and clearly different from normal control animals and MPTP and L-dopa treated animals that had not developed dyskinesias. Papa et al., Internal globus pallidus discharge is nearly suppressed during levodopa-induced dyskinesias, Ann Neurol. 46:732-8 (1999). A similar down-regulation of GPI neurons was also found in a rodent genetic model of dystonia, which also represents a hyperkinetic dysfunction of the basal ganglia system. Gernert et al., Deficit of striatal parvalbumin-reactive GABAergic interneurons and decreased basal ganglia output in a genetic rodent model of idiopathic paroxysmal dystonia, J Neurosci. 20:7052-8 (2000). Taken together these results indicate in accordance with the current model of the basal ganglia circuitry known in the art that the GPI/SNR represent the part of the circuit where the output and therefore the activity level of the motor system is determined. Hypokinetic syndromes are characterized by an increased activity of the output nuclei and hyperkinetic conditions correlate with a decreased activity.

A. Background of Cation Channels Cation channels are a diverse group of proteins that regulate the flow of cations across cellular membranes. The selectivity of a cation channel for particular cations typically varies with the valency of the cations, as well as the specificity of a given channel for a particular cation. Some cation channels display almost no selectivity for cations with the same valence. Saitow et al., Biochem Biophys Ada. 1327(l):52-60 (1997). Other channels are clearly selective for particular cations but are permeable to other cations to varying degrees. Park & MacKinnon, Biochemistry 34(41): 13328-33 (1995); Gauss et al., Nature 393(6685):583-7 (1998). Cation channels are involved in a number of physiological processes, including regulation of heartbeat, dilation of arteries, release of insulin, excitability of nerve cells, transduction of sensory stimuli, and regulation of renal electrolyte transport. Cation channels are thus found in a wide variety of animal cells such a nervous, muscular, glandular, immune, reproductive, sensory, and epithelial tissue. These channels allow the flow of various cations in and/or out of the cell under certain conditions. For example, the inward flow of cations upon opening of these channels makes the interior of the cell more positive, thus depolarizing the cell. These channels are regulated, e.g., by calcium sensitivity, voltage-gating, cyclic nucleotides or other secondary messengers, extracellular ligands, and ATP-sensitivity.

B. Hyperpolarization-Activated Cyclic Nucleotide-Gated Cation Channels Hyperpolarization-activated cyclic nucleotide-gated cation channels (HCN) underlie the I_h current (termed also I in the heart and I_q in the brain). The most prominent function proposed for this current is the generation of spontaneous rhythmic activity in the heart and brain. Thus, I_h has been called "pacemaker current" and HCN channels have been designated "pacemaker channels". Pacemaker channels are activated by hyperpolarization and regulated directly by cyclic nucleotides. There has been increasing evidence that intrinsic membrane properties of neurons play a crucial role in pathophysiological processes like Parkinson's disease. I_h currents that were first described in motoneurons of the cat in 1962 have been identified in many different cell types of the mammalian body including the peripheral and central nervous system. Araki et al., Potential changes produced by application of current steps in motoneurons, Nature 191 :1104-5 (1962). The current is typically seen as a slowly developing inward current activated by hyperpolarizing membrane potentials. The activation kinetics are voltage dependent and exhibit a sigmoidal curve. The current is carried by both Na⁺- and K⁺ ions with a higher permeability for K⁺. Extracellular Cs⁺ at concentrations between 0.1 and 5 mM have been shown to block the channel. Pape, H.C., Queer current and pacemaker: The hyperpolarization-activated cation current in neurons, Ann Rev Physiol. 58 :299-327 (1996). The Ij, current is inactive at depolarized potentials where action potentials are firing but is turned on by hyperpolarization to the pacing range of potentials (-80 to - 30 mV). Thus, negative to its equilibrium voltage at -30mV the current passes cations into the cell, slowly depolarizing the membrane potential and deactivating upon continued depolarization. DiFrancesco, Annu. Rev. Physiol. 55:455-472 (1993).; Clapham, Neuron 21:5-7 (1998). The genes encoding for Ih channels have been discovered and functional I channels have been cloned. Gauss et al., Nature 393(6685):583-7 (1998); Ludwig et al., Nature 393:587-591 (1998); Santoro et al., Cell 93:717-729 (1998). A family of hyperpolarization-activated channels, given the acronym HAC, was isolated from mouse. Ludwig et al., Nature 393:587-591 (1998). Ludwig et al. reported isolating three different ion channels (mHACl, mHAC2 and mHAC3). The mouse HAC proteins are members of the voltage-gated cation channel super family and also have a cyclic nucleotide-binding domain capable of binding cAMP and cGMP. Mouse HACl exhibits the general properties of I and may be responsible for pacemaker activity. Another group also identified the same gene family, in this instance identified by the acronym BCΝG. For instance, the BCΝG-1 (HAC2) ion channel was isolated from mouse cells and is expressed in the brain. Santoro et al., Proc. Natl. Sci. USA 94- 14815-20 (1997). The human BCNG-2/HAC1 and BCNG-1/HAC2 have also been cloned. Santoro et al., Cell 93:717-729 (1998). Since then, several related mouse genes (e.g., BCNG-1/HAC2, partial BCNG2/HAC1 , partial BCNG3/HAC4, and partial BCNG4/HAC3) with expression in various tissues including heart and brain, have been isolated. Santoro et al., Cell 93:717-729 (1998). Pharmacological inhibitors of I_h have also been described. The most specific and widely used antagonist is ZD7288. BoSmith et al., Inhibitory actions of ZENECA ZD7288 on whole cell hyperpolarization activated inward currents (If) in guinea-pig dissociated sinoartrial node cells, Br J Pharmacol. 110:343-9 (1993). So far four I channel encoding subunits, generally termed HCN 1 - 4, have been cloned and are differentially distributed throughout the brain. Ludwig et al., Nature 393:587-591 (1998); Santoro et al., Cell 93:717-729 (1998). As discussed above, the HCN channels are also known by the acronyms HAC1-4 and BCNGl -4. More specifically, HCNl is also known as HAC2 and BCNGl ; HCN2 is also known as HAC1 and BCNG2; HCN3 is also known as HAC3 and BCNG4; and HCN4 is also known as HAC4 and BCNG3. The genes constitute a subfamily of the voltage-gated cation channels, which is characterized by six membrane-spanning segments (SI - S6) with the voltage-dependent component in segment S4 and a pore-loop between segments S5 and S6. The cAMP-binding region is located close to segment S6 at the c-terminus of the protein. Heterologous expression experiments revealed that the individual subunits have different biophysical properties such as activation kinetics and responsiveness to cAMP. Moosmang et al., Cellular expression and functional characterization of four hyperpolarization-activated pacemaker channels in cardiac and neuronal tissues, Eur J Biochem. 268:1646-52 (2001); Santoro et al., Molecular and functional heterogeneity of hyperpolarization-activated pacemaker channels in the mouse brain, JNeursoci. 20:5264-75 (2000). The subunits exhibit cell type and tissue specific expression patterns thus generating cell specific phenotypes. Moosmang et al., Differential distribution of four hyperpolarization-activated cation channels in mouse brain, Biol Chem. 380:975-80 (1999); Franz et al., Single cell mRNA expression of HCNl correlates with a fast gating phenotype of hyperpolarization-activated cyclic nucleotide-gated ion channels (Ih) in central neurons, Eur J Neurosci. 12:2685-93 (2000). In the nervous system I_h currents have been shown to regulate the resting membrane potential and membrane conductance of neurons, to determine the response to hyperpolarizing stimuli and to contribute to pacemaker functions of individual cells and neuronal networks. Pape, Queer current and pacemaker: The hyperpolarization- activated cation current in neurons, Ann Rev Physiol. 58:299-327 (1996); Lϋthi et al., H-current: Properties of a neuronal and network pacemaker, Neuron 21:9-12 (1998). The value of the membrane potential is a critical component in the determination of a cell's reaction to incoming stimuli with more depolarized potentials resulting in an increased excitabiUty. McCormick et al., Properties of a hyperpolarization-activated cation current and its role in rhythmic oscillations in thalamic relay neurons, J Physiol. 431:291-3180 (1990). Increasing the I_h currents will therefore result in increased firing rates and altered firing patterns with synchronization of neurons as has been demonstrated in in vivo experiments in animals models of PD. Filion et al., Abnormal spontaneous activity of globus pallidus neurons in monkeys with MPTP-induced parkinsonism, Brain Res. 547:142-51 (1991); Bergman et al., The primate subthalamic nucleus. II. Neuronal activity in the MPTP model of parkinsonism, J Neurophysiol. 72:507-20 (1994); Ruskin et al., Nigrostriatal lesions and dopamine agonists affect firing patterns of rodent entopeduncular nucleus neurons, J Neurophysiol. 88:487-96 (2002). There has been a need to understand the underlying mechanisms of movement disorders such as Parkinson's disease. More specifically, there has been a need to understand the role of HCN3 in movement disorders. Further, there has been a need for a method of screening compounds for the treatment of neurological disorders, like Parkinson's disease.

SUMMARY OF THE INVENTION The present invention provides a method for screening compounds that affect the pathophysiologic mechanisms of neurological disorders. To determine whether a compound affects the expression of genes in the brain affected by a neurological disorder, it requires identification of the location in the brain that is affected by the disorder and an animal model of the disorder. Examples of the type of disorders that have been characterized in such a way relate to movement disorders, pain, ion channels, and HCN3. The present invention further provides methods for identifying compounds that affect the pathophysiologic mechanisms of HCN3 channels, ion channels, movement disorders, and pain. An animal model of a disorder is administered a test compound. Tissue samples are collected from the models and prepared. Laser capture microdissection is then performed on the tissue samples to isolate select cells. The RNA from the selected cells is isolated from the cells, amplified, and labeled. The labeled RNA is then hybridized to a microarray to detect the expressed genes.

BRIEF DESCRIPTION OF THE DRAWINGS

Fig. 1: Design of the microarray experiment. Samples were generated in duplicates from 3 animals in the lesioned and control groups and each of these samples was hybridized to two arrays. Each array contained the cDNA spots in duplicates on the left and right panels resulting in a total number of 24 data points per gene and treatment group.

Fig. 2: Ratios of RNA content for aldehyde reductase (♦) and cyclophilin A (■) between the individual samples. These genes were used for normalization of qPCR data. For each gene the sample with the lowest content was set to one. The two genes show a very high correlation confirming the validity of this approach as a normalization method. The average of both values (X) was used for normalization of the differentially expressed genes.

Fig. 3: RT-PCR expression profile of HCN 1 - 4 in the rat EPN. The amplified fragments are 336 (HCNl), 298 (HCN2), 258 (HCN3) and 417 (HCN4) base pairs long. Adjacent to each amplicon are the no-RT controls of the respective genes.

Fig. 4 A, B, C, D: HCN current amplitudes and activation kinetics in EPN neurons. Examples of individual recordings are given in A (control) and B (lesion). C: quantitative comparison of the currents between the two groups. D: Activation kinetics of the currents in both groups.

Fig. 5: Effect of 50 μM ZD 7288 on I-h currents in EPN neurons. I-h currents in untreated neurons (A) are completely blocked by ZD7288 (B).

Fig. 6: Mean values of ZD7288 sensitive I-h currents in EPN neurons of control and lesioned animals.

Fig. 7 A, B, C: Current clamp recordings in EPN neurons. I-h sag amplitudes in post- lesion EPN (B) were significantly increased compared to neurons from control animals (A). Mean amplitudes in control and lesioned animals are given in C.

Fig. 8: Effect of 50 μM ZD7288 on I-h sag amplitudes in EPN neurons. Sag components (A) are completely blocked by ZD7288 treatment of the slices (B).

Fig. 9: Mean values of ZD7288-sensitive sag amplitudes in EPN neurons of control and 6-OHDA lesioned animals.

Fig. 10 A, B: Rebound excitability in EPN neurons. In normal control animals (A) ZD7288 does not affect the rebound excitability defined as the time elapsing between the cessation of the hyperpolarizing current and the first rebound spike. In 6-OHDA lesioned animals (B) the rebound period is shorter than in control ammals and sensitive to ZD7288.

Fig. 11: Mean values of rebound excitability in EPN neurons of control and lesioned animals. The rebound excitability, which is significantly increased in 6-OHDA lesioned animals (** p<0.01) is reverted to normal control values by ZD7288. In normal control animals the drug has no effect on this parameter. DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS OF THE INVENTION This invention provides a method for screening compounds that affect the pathophysiologic mechanisms of movement disorders, ion channels, HCN3, and pain. A compound is administered to an animal model of the disorder. Tissue samples are taken from the part of the brain that is affected by the disorder and prepared. Using laser capture microdissection, cells are selected from the tissue samples and the RNA is extracted from the cells. The RNA is then amplified, i.e. by T7 RNA polymerase, labeled, and hybridized to a microarray. See Erlander et al. U.S Patent Application 2002/015949, which is hereby incorporated by reference. These techniques are described in more detail below. The RNA taken from the treated diseased tissue is compared to the RNA from the untreated tissue. This method is applicable to such disorders as Parkinson's disease as discussed below and the management of pain, the circuitry of which is well known in the art. Pain is defined as an unpleasant sensory and emotional experience associated with actual or potential tissue damage. Merskey et al., Pain terms: a list with definitions and notes on usage. Recommended by the IASP Subcommittee on Taxonomy, Pain 6: 249-252 (1979). The characteristics of pain are species specific. For example, in humans, acute pain is characteristically associated with behavioral arousal and a stress response consisting of increased blood pressure, heart rate, pupil diameter, and plasma cortisol levels. Isselbacher, Harrison 's Principles of Internal Medicine, 13^th ed, McGraw-Hill, New York, p. 49-55 (1994). In animals, pain is determined by observing the behavior of the animals. One of ordinary skill in the art would understand the species specific behaviors when determining whether a particular animal or animals are experiencing pain. For example, in mice, rats and rabbits, potential signs associated with pain or distress are: decreased food and water consumption, weight loss, self-imposed isolation/hiding, self-mutilation, rapid breathing, opened-mouth breathing, abdominal breathing, grinding teeth, biting/growling aggression, increased/decreased movement, etc. French et al.,

Assessment of Pain in Laboratory Animals (abstract P50), Contemporary Topics 39:85 (2000). A pain defined state is determined based upon the particular species being examined and the behavioral characteristics known in the art to indicate that the particular species is experiencing pain. This invention also provides for the identification of pathophysiologic mechanisms underlying the development of motor symptoms in movement disorders through gene expression analyses of the basal ganglia circuitry. More specifically, the present invention provides a method for identifying compounds that affect the pathophysiologic mechanisms of the HCN3 channel. Animal models of a movement disorder are created by administering 6-hydroxydopamine into the medial forebrain bundle of an animal, such as a rat, and selecting the animals that exhibit at least 90% contralateral forelimb akinesia. Schwarting et al., Unilateral 6-hydroxydopamine lesions of meso-striatal dopamine neurons and their physiological sequelae, Prog Neurobiol. 49(3):215-66 (1996); Schwarting et al., The unilateral 6-hydroxydopamine lesion model in behavioral brain research. Analysis of functional deficits, recovery and treatments., Prog Neurobiol. 50(2-3):275-331 (1996). A test compound is administered to an animal. Tissue samples are collected from the animals after they are deeply anesthetized and perfused with cold phosphate buffered saline. The brains are quickly removed, immediately frozen and stored. The tissue samples are prepared by being cut into consecutive sections, mounted on glass slides, immediately refrozen and stored. The sections are then stained after the fixation sections are rehydrated. Laser capture microdissection is then performed on the tissue samples to isolate select cells. The RNA from the selected cells are isolated from the cells, amplified using T7 RNA amplification, and labeled. The labeled RNA is then hybridized to a cDNA microarray to detect the expressed genes. Gene expression analyses of the animal models is conducted on the isolated RNA and the gene expression of the animal models and control models are compared to determine the affect the test compound had on the HCN3 channel. Using the combination of laser capture microdissection and cDNA microarrays, an increased expression of the HCN3 pacemaker channel in neurons of the entopeduncular nucleus (EPN) and the SNR in a rat model of Parkinson's disease was identified. Whole cell voltage and current clamp recordings from brain slices demonstrated an increased Ih current in lesioned animals confirming the increased mRNA expression (up-regulation) at the functional level. Quantitative PCR analyses showed that the differential expression is exclusively affecting HCN3. The other members of the family, which are also expressed in the EPN do not change their mRNA levels. These results are corroborated by the electrophysiological finding that the activation kinetics of the I_h current do not change indicating that there is no alteration in the subtype composition of the HCN channels. The functional impact of the increased Ih activity is as expected in a change of the excitability of the neurons. In current clamp experiments the rebound excitability, defined as the time between the end of the hyperpolarizing current injection and the first rebound action potential, was significantly shorter in neurons from lesioned animals. In the presence of 50 μM ZD7288 this effect was reversed and rebound delays were not significantly different from normal control animals. These results demonstrate that the increased rebound excitability in EPN neurons from dopamine-depleted rats is mediated by ZD7288-sensitive HCN channels. BoSmith et al., Inhibitory actions of ZENECA ZD7288 on whole cell hyperpolarization activated inward currents (If) in guinea-pig dissociated sinoartrial node cells, BR J Pharmacol. 110:343-0 (1993). In contrast to these findings in lesioned animals ZD7288 does not alter the rebound delay in control animals. Blockade of HCN channels also did not change the regular spontaneous firing behavior of I_h positive type I neurons in the EPN. Taken together these data provide evidence for a postsynaptic mechanism of the altered in vivo firing pattern in basal ganglia output neurons after dopamine depletion of the system. Therefore, HCN3 is a target for the symptomatic treatment of PD. The fact that these changes in the EPN are directly related to the development of parkinsonian symptoms and that diseases with an increased motor output such as dyskinesias and dystonias are associated with opposite changes in neuronal activity in the EPN demonstrate that HCN3 is useful as a target for the symptomatic treatment of a broad range of movement disorders. These disorders include idiopathic Parkinson's disease and parkinsonian syndromes of various etiologies such as infectious, metabolic, toxic, posttraumatic and drug induced parkinsonism, multiple system atrophies, cortical-basal ganglionic atrophy, progressive supranuclear palsy, Chorea Huntington, dystonia musculorus deformans, torticollis, and drug induced tardive dyskinesia. Example The invention will now be illustrated in more detail by the following example.

6-OHDA lesion as a model of Parkinson's disease

Surgical Procedure: A rat model of PD was generated by unilateral stereotaxic administration of 6- hydroxydopamine (6-OHDA) into the medial forebrain bundle (MFB). Adult male Sprague Dawley rats weighing approximately 275g at the time of surgery were anesthetized with a mixture of ketamine (44mg/kg), xylazine (5mg/kg) and acepromazine (0.8mg/kg) i.m. and located on a stereotaxic frame with the tooth bar set at -3.4mm. 6-OHDA hydrobromide was dissolved at a concentration of 6mg/ml with ascorbic acid (0.02%) in normal saline. 1.5ul of the 6-OHDA solution were injected into the right MFB at 4.3mm caudal, 1.5mm lateral and 7.5mm ventral from Bregma over 5 minutes using a lOμl Hamilton syringe with a blunt 28 gauge needle. After 5 minutes the syringe was raised 0.2mm dorsally and another 1.5μl of 6-OHDA were injected over 5 minutes. Again the syringe was left in place for 5 minutes and then withdrawn. The animals were pretreated with desipramine (15mg/kg) i.p. 30 to 45 minutes prior to the administration of 6-OHDA to protect norepinephrine terminals. Control animals were treated accordingly but only received a burr-hole without any injections into the brain.

Behavioral evaluation of the nigrostriatal lesion: Animals were tested for forelimb akinesia (stepping test) either twice at 2 and 4 weeks or once at 4 weeks after induction of the lesion as described by Olsson et al. Olsson et al., Forelimb akinesia in the rat Parkinson model: differential effects of dopamine agonists and nigral transplants as assessed by a new stepping test, J Neurosci. 15:3863-75 (1995); Kirik et al., Characterization of behavioral and neurodegenerative changes following partial lesions of the nigrostriatal dopamine system induced by intrastriatal 6-hydroxydopamine in the rat, Exp Neurol. 152:259-77 (1998); Chang et al., Biochemical and anatomical characterization of forepaw adjusting steps in rat models of Parkinson's disease: studies of medial forebrain bundle and striatal lesions, Neurosci. 88:617-28 (1999). Briefly rats were held with one hand at the rear part of the torso with their hind limbs lifted and one of the forelimbs gently immobilized with the other hand. Thus the free forelimb, which was bearing some weight, was moved across a bench surface at a speed of 9cm/sec in the forehand direction over a total distance of lm. During this interval the number of adjusting steps of the weight bearing free forepaw was counted. This procedure was carried out for both forelimbs. On 1 or 2 days preceding the actual testing the animals were handled in order to become familiar with the test procedure. The results obtained on the third day constituted the actual behavioral test results, on which the selection of the animals was based. The test consisted of 5 trials for each forepaw, alternating between the right and left side. The average of the 5 trials for each paw was calculated. The results were transformed to percentage of impairment of the confralateral (lesioned) compared to the ipsilateral (normal) paw. Animals exhibiting more than 90% confralateral forelimb akinesia during the second test were regarded as having a severe lesion of the nigrostriatal system and were included in the study.

Collection of tissue samples: Five weeks after the lesion animals were deeply anesthetized with pentobarbial (lOOmg/kg) and perfused with 150 - 200ml of cold phosphate buffered saline (PBS). Brains were quickly removed, immediately frozen in isopentane at -70°C and stored at -80°C.

Tissue preparation: 1 Oμm consecutive sections were cut on a Leica Jung CM 1800 cryostat (Leica,

Nussloch, Germany), mounted on pre-cleaned plain glass slides, immediately refrozen on dry ice and stored in a sealed box at -80°C. For staining, sections were taken out of the -80°C freezer and immediately fixed in 100% ethanol for 1 minute at room temperature. After fixation sections were rehydrated in decreasing concentrations of ethanol (95%, 70% and 50% 15 seconds each), briefly rinsed in RNase free water and stained in 1% cresylviolet for 30 seconds. Subsequently sections were washed three times in RNase free water and dehydrated in increasing concentrations of ethanol (50%, 70%, 95%o and 100% 15 seconds each) and delipidated in Xylene for 1 minute. The method is described in detail in Luo et al. Luo et al., Gene expression profiles of laser-captured adjacent neuronal subtypes, Nature Medicine 5:117-22 (1999).

Laser Capture Microdissection: Fifteen minutes after staining, neurons were captured from the STR, EPN and the SNR of the right (lesioned) side using the Arcturus PixCell II microscope according to the manufacturer's instruction. For each animal 2 sets of 150 cells were collected from each area. In the STR these duplicate sets originated from adjacent sections. For the EPN and the SNR that contain less than 150 cells per section cells for each set were collected from adjacent sections. After capturing the cells were refrozen and stored at -80°C until further processing.

RNA extraction and T7 RNA amplification Total RNA was extracted from the cell samples using the Micro RNA isolation kit from Stratagene (San Diego, CA) following the manufacturer's instructions. In addition to the Stratagene protocol the denaturing solution contained 300ng of polyinosinic acid (potassium salt) from Sigma (St Louis, MO) per sample. The samples were incubated in 42°C for 10 minutes and subsequently purified on Microcon 100 columns (Millipore, Bedford, MA) following the manufacturer's instruction. The RNA samples were then subjected to two rounds of T7 RNA amplification as described in Salunga et al., DNA Microarrays, Oxford University Press, 121-137 (1999), except for two modifications: purification steps of RNA and DNA samples in each round were carried out using the RNeasy - and QIAquick PCR Purification kits, respectively (Qiagen, Valencia, CA). Two negative control samples that contained water instead of RNA were taken through the entire protocol. The details of the T7 RNA amplification protocol used on the extracted RNA samples are set forth below: Amplifying RNA from total RNA-first and second strand syntheses: 1. Added 1 μl 0.5 mg/ml T7 oligo(dT) primer to 10 μl of the extracted RNA sample. 2. Heated the samples at 70^°C for 10 min. Immediately chilled them on ice and spun down each sample by centrifugation in a microcentrifuge. 3. Equilibrated each tube at 42° C for 5 min.

4. Added 4 μl 5 X first strand buffer (250mM Tris-HCl pH 8.3, 375 mM KCl, 15 mM MgCl₂), 2 μl 0.1 M DTT, 1 μl 10 mM dNTPs, 1 μl RNasin, and 1 μl Superscript RT Π. 5. Incubated the tubes at 42°C for 60 min.

6. Removed 1 μl and performed PCR.

7. To the remainder of the first strand reaction, added 30 μl second strand synthesis buffer (100 mM Tris-HCl pH 6.9, 450 mM KCl, 23 mM MgCl₂, 0.75 mM βNAD⁺, 50 mM (NH )₂SO₄), 3 μl 10 mM dNTPs, 4 μl DNA polymerase 1, 1 μl E. coli RNase H, 1 μl E. coli DNA ligase, and 92 μl RNase-free H₂O.

8. Mixed the contents gently by pipetting and incubating at 16° C for 2 h.

9. Added 2 μl T4 DNA polymerase. Incubated at 16° C for 10 min.

10. Extracted samples once with pheno chloroform (1:1, v/v) and collected aqueous layer. 11. Purification was carried out using the RNeasy - and QIAquick PCR Purification kits, respectively (Qiagen, Valencia, CA). 12. Reduced the sample volume to 8 μl by vacuum centrifugation. In vitro transcription and purification:

1. Obtained the cDNA from the previous procedure and made sure the cDNA was in an total volume of 8 μl.

2. Added 2 μl 10 X Ampliscribe T7 buffer.

3. Added 1.5 μl ATP, 1.5 μl CTP, 1.5 μl GTP, and 1.5 μl UTP in that order.

4. Added 2 μl 0.1 M DTT and mixed.

5. Added 2 μl T7 RNA polymerase. 6. Incubated samples at 42° C for 3 h.

7. Added 1 μl RNase-free DNase (from the kit).

8. Incubated the samples at 37° C for 15 min.

9. Purification was carried out using the RNeasy - and QIAquick PCR Purification kits, respectively (Qiagen, Valencia, CA). 10. Froze the aRNA at -70° C.

Re-amplifying RNA from aRNA; first and second strand synthesis: 1. Added 1 μl lmg/ml random hexamers to the aRNA obtained from the previous procedure.

2. Heated the samples at 70° C for 10 min. Chilled the tubes on ice. Spun them briefly in a microcentrifuge. 3. Equilibrated the samples for 10 min. at room temperature.

4. Added 4 μl 5 X first strand buffer, 2 μl 0.1 M DTT, 1 μl 10 mM dNTPs, 1 μl RNasin, and 1 μl Superscript RT II.

5. Incubated the samples at room temperature for 5 min.

6. Incubate the samples at 37° C for 1 h. 7. Add 1 μl RNase H to each tube. Mixed gently.

8. Incubated the samples at 37° C for 20 min.

9. Heated the samples at 95° C for 2 min. to denature the hybrids.

10. Chilled the samples on ice. Spun the samples briefly, and on ice added lμl 0.5 mg/ml T7 oligo(dT) primer. 11. Heated the samples to 70° C for 5 min., spun them very briefly in a microcentrifuge, and then incubated them directly at 42° C for 10 min. to anneal the T7 oligo(dT) primer. Chilled the samples on ice. Spun the samples briefly. 12. Added 30 μl second strand synthesis buffer, 3 μl 10 mM dNTPs, 4 μl DNA polymerase 1, 1 μl RNase H, and 90 μl RNase-free H₂O. 13. Incubated the samples at 16° C for 2 h.

14. Added 2 μl T4 DNA polymerase. Mixed gently. Incubated the samples at 16° C for 10 min.

15. Added 150 μl phenolxhloroform. Vortexed the samples for about 10 sec.

16. Spun the samples at 12,000 g in a microcentrifuge. Took the aqueous layer and transfer it to a new tube.

17. Purification was carried out using the RNeasy - and QIAquick PCR Purification kits, respectively (Qiagen, Valencia, CA).

18. Performed in vitro transcription as outlined above.

RNA labeling 8.5ug of aRNA from each sample were random primed (random hexamers from Amersham Pharmacia (Amersham Pharmacia Biotech, Piscataway, NJ) and labeled with Cy3-dCTP using the Superscriptll system (hivitrogen, Carlsbad, CA). Nucleotide concentrations were 25mM for dATP, dGTP and dTTP, respectively and lmM for non-labeled dCTP. Cy3-dCTP was added in a concentration of ImM. All nucleotides were purchased from Amersham Pharmacia. Template aRNA was removed by addition of RNaseA and the labeled cDNA was purified using the QIAquick PCR Purification kit. The purified cDNAs were vacuum-dried and resuspended in 50μl of hybridization buffer (Version 2 hybridization buffer from Amersham Pharmacia) containing 50% formamide and human Cotl DNA (Invitrogen).

Microarray hybridization and data analysis: For hybridization a cDNA microarray containing 2145 cDNA clones was used. Each clone was spotted in duplicates on the chip (left and right panel). Clones were obtained from Research Genetics (Huntsville, AL) and ϊncyte Genomics (Palo Alto, CA) or generated through in house sequencing efforts. All clones were sequence verified before spotting. Each array contained 30 plant genes for determination of non-specific background hybridization. These clones were a gift of Mark Schena, Stanford University (Stanford, CA). PCR amplicons of each clone were spotted in duplicates on each chip using a Generation III Array Spotter (Molecular Dynamics, Sunnyvale, CA). For hybridization the cDNA probes were denatured at 94°C for 5 minutes, cooled to room temperature for 5 minutes and applied to the slides. Slides were covered with glass cover slips, sealed with DPX (Fluka, Milwaukee, WJ) and hybridized at 40°C overnight. Each probe generated from 8.5μg of aRNA was put on duplicate chips. Microarrays were scanned with a confocal laser scanner (Array Scanner, Molecular Dynamics). Autogene software (Biodiscovery, Los Angeles, CA) was used for image analysis.

Statistical Analysis of Microarray Data: Raw data from microarray experiments were normalized to the 75^th percentile of each array, which was arbitrarily set at 100. Expression of individual genes was determined by comparison with plant gene signal intensities that were regarded as background hybridization. Mean signal intensities of each gene were compared to the group of plant genes in a one-tail t-test. P-values of 0.01 were used as a cutoff, i.e. genes with p-values < 0.01 were regarded as being expressed. Difference in gene expression between biological groups (control and 6-OHDA lesion) was evaluated for each area (STR, EPN, and SNR) by a nested ANOVA, which compares variations between biological groups to variations between rats. Genes with significant treatment-dependent differences, as indicated by p-values <0.05, have bigger variations between treatment groups (specific effects) than between rats (random effects).

Quantitative RT-PCR analysis of HCN expression in the rat EPN Quantitative PCR (qPCR) experiments were carried out on a Smart Cycler (Cepheid, Sunnyvale, CA) in 25ul volumes. AccuPrime Taq DNA polymerase and AccuPrime SuperMixI were purchased from Invifrogen (Carlsbad, CA) and ExTaq DNA polymerase and buffer were purchased from TaKaRa Biomedicals (Otsu, Shiga, Japan). Both systems were supplemented with 200μM TrisCl, pH 8.0, BSA 200μg/ml, Trehalose 150mM and Tween-20 0.2% (final concentrations). All three chemicals were purchased from Sigma-Aldrich, St. Louis, MO. SYBR green I nucleic acid gel stain (Molecular Probes, Eugene, OR) was added at a 26.6x10^"6 -fold dilution (final concentration) of the original 10,000x stock solution provided by the manufacturer. Primers were added at a final concentration of 400nM. The same 2-round amplified RNA (aRNA) that had been used for the array hybridizations served as template in the RT-PCR experiments. 2μg/sample aRNA were reverse transcribed using the Superscriptll (Invifrogen) and random hexamers (Amersham Pharmacia) as described in the second round of the T7 amplification protocol. After cDNA synthesis samples were purified with the QIAquick PCR purification kit. 2μl of a 1 : 100 dilution was used for each reaction. In addition to the analyses of amplified material for 6 of the 12 genes presented in Table 5 non-amplified cDNA was used as a template. For this purpose 2000 cells were captured from the STR. RNA extraction and cDNA sysnthesis were performed as described above. Primer sequences were as follows: neuromedin U: TCTGTTGCATTGAGGAAGCTTTGCC (SEQ ID NO: 1) and

TCTCATGCAGTTGAGGAACGAGCTG (SEQ ID NO: 2), cholecystokinin:

CATGGGCTGGATGGATTTCG (SEQ LD NO:3) and CCACCAGAGGGAAACATTGC (SEQ ID NO: 4), follistatin:

TGCTTGAAGTGAAGCACTCC (SEQ LD no: 5) and

AGCTGTAGTCCTGGTCTTCC (SEQ ID NO: 6), beta-tachykinin:

TTCATCTCCATCTGTGTCCG (SEQ ID NO: 7) and AGCAGCCTTTCTGTCTTTGG (SEQ LD NO: 8), cannabinoid receptor 1 :

ATGCATCTAGAGTGGCCTGG (SEQ ID NO: 9) and

AACGGTGCTCTTGATGCAGC (SEQ ID NO: 10), c-fos:

GTAGTTAGTAGCATGTGAGC (SEQ ID NO: 11) and

ACATGTCGAAAGACCTCAGG (SEQ ID NO: 12), glutamate/aspartate transporter (EAAT1): TGGTGTTGTCCTTGGGTTCC (SEQ ID NO: 13) and

GGCGTTTAAGAGAAGTGACG (SEQ LD NO: 14), glypican 3:

AGAACTGGCATATGATCTGG (SEQ ID NO: 15) and

GGCTCCCTTTATGTAGGAGG (SEQ ID NO: 16), somatostatin receptor 2:

TTGCCCGCTATGTAATCTCG (SEQ ID NO: 17) and GAACATACTGCTCATGCTCC (SEQ ID NO: 18), TGF-alpha:

CCTCTCCATAGTGTGATAAG (SEQ ID NO: 19) and

GTTCATTCCTTCATCCTTCC (SEQ ID NO: 20), NGFI-A:

ATGTTCGGGAGTTGGAATGC (SEQ ID NO: 21) and

ACACACCACATATCCCATGG (SEQ ID NO: 22), HCNl: AGTTCCACACCGAAAAATGAAGTGC (SEQ ID NO: 23) and

GGATGCGGTCTGGAGATCATAGTGG (SEQ ID NO: 24); HCN2:

CGGTGGCCTCCGAGGAAGAATATGG (SEQ ID NO: 25) and

GCGGAATGGGGTTGTGGGTTAATGG (SEQ ID NO: 26); HCN3:

GTACAATGTGTAGCCACTGC (SEQ ID NO: 27) and ATTGACAGTACCCAGCTACG (SEQ ID NO: 28); HCN4:

TGTCACTTTGCCTCGGAAGACATCC (SEQ LD NO: 29) and GCCAG

TACGCTCCAAACTGCCGTCT (SEQ ID NO:30). Aldehyde reductase (aldred) and cyclophilin A (cycA), which both did not change their levels of expression in the microarray experiments were chosen for normalization of RNA content. Primer sequences for aldehyde reductase were: ATCTCCAGCTCAGATCTTGC (SEQ LD

NO: 31) and AACTACGGGCC TCAGTATGG (SEQ ID NO: 32) and for cyclophilin

A: TGGTGGCAAGTCCATCTACG (SEQ ID NO: 33) and GGAGATGGTGATCTTCTTGC (SEQ ID NO: 34). PCR reactions for each sample were carried out in triplicates for the differentially expressed genes and in duplicates for the normalization genes. For all genes, standard curves generated from serial dilutions of plasmids containing the respective sequences were used to calculate template amounts in the starting materials. Average expression levels of aldehyde reductase and cyclophilin A were calculated for each sample and served as normalization factors for the differentially expressed genes. A one-tail t-test was used to determine whether there were statistically significant differences between the two groups of animals. A probability value of p < 0.05 was chosen as an index for statistical significance.

Qualitative PCR expression profiling of HCN genes in the rat EPN RT-PCR from laser-captured cells was used to determine which members of the HCN family of genes are expressed in the EPN of the rat. Two samples of 60 EPN neurons were generated from a normal control rat. The RNA was extracted and reverse transcribed as described above. In the second sample addition of the reverse transcriptase was omitted to control for amplification of genomic material. After reverse transcription the samples were purified using the QIAquick PCR purification kit and eluted with 60μl of water (2x30μl). lOμl of each sample were used as template for subsequent PCR amplifications of the individual HCN genes resulting in a total number of 10 cells per gene. PCR experiments were carried out in a PTC 200 Peltier Thermal Cycler from MJ Research in a nested design with 30 cycles in each amplification. Following an initial denaturation step of 5 minutes at 95°C, cycling conditions consisted of 95°C for 20 seconds, 60°C for 20 seconds and 72°C for 1 minute in the first PCR experiment. Conditions in the second PCR were identical except for a shorter 72°C extension step (40 seconds). Primers were as follows: HCNl : CGGAGACTATATCATTCGAGAAGGA (forward l.PCR) (SEQ ID NO: 35), TCATTTGAGGATAGTTGATTGGAGG (reverse 1.PCR) (SEQ ID NO: 36), GTGTGGCTGGTGTCATCACCAAGTC (forward 2.PCR) (SEQ ID NO: 37), TGTCATGCTTCACAATCTGCTTCAG (reverse 2.PCR) (SEQ LD NO: 38), HCN2: CTTCATCCAGCACGGGGTGGTGAGC (forward 1.PCR) (SEQ ID NO: 39), TGCAGCGTGGCGATGGCCGACGTGA (reverse l.PCR) (SEQ ID NO: 40), TTGGGGAGAT CTGCCTGCTCACGAG (forward 2.PCR) (SEQ ID NO: 41), TCTGCCTGCTGCACCATCTCACGGT (reverse 2.PCR) (SEQ ID NO: 42), HCN3: CATGGGCTGCTCAGTGTGTTGGCAC (forward 1.PCR) (SEQ ID NO: 43), GGTTCCCACAGCACTGGCTTTCCAC (reverse 1.PCR) (SEQ ID NO: 44), ATCTGCCTGCTGACTCG AGGTCGGA (forward 2.PCR) (SEQ LD NO: 45),

GTCGTGTTGTACCAAATGCTGCTCC (reverse 2.PCR) (SEQ LD NO: 46), HCN4: GCTCACTAAGGGCAACAAGGAGACC (forward l.PCR) (SEQ ID NO: 47), ATCAAGGACTGCAACCTCCTTGGGT (reverse l.PCR) (SEQ LD NO: 48), TTTGGAGAGATCTGCTTGCTGACCC (forward 2.PCR) (SEQ LD NO: 49), TGTGAGGGCTATGGCCACCGAAGTA (reverse 2. PCR) (SEQ ID NO: 50). In addition to size analyses on a 1% agarose gel, amplification fragments were also sequence verified.

In vitro whole cell recordings of HCN currents Control and lesioned rats were deeply anaesthetized with pentobarbital

(lOOmg/kg) and intra-cardially perfused with an ice-cold sucrose-artificial cerebrospinal fluid (ACSF) solution for brain tissue protection. Animals were decapitated and brains dissected and immersed in ice- cold sucrose-ACSF solution. Coronal 200 μm sections containing the right EPN (ipsilateral to the lesions) were cut on a Leica VTIOOOS vibrating blade microtome (Leica, Nussloch, Germany) in ice- cold sucrose-ACSF solution. Slices recovered for lh in a standard ACSF solution at 35°C and subsequently for lh at room temperature. Slices were transferred to a recording chamber and were continuously superfused with ACSF containing 25 μM picrotoxin and 50μM kynureic acid or alternatively 50 μM DNQX and 10 μM DL- APV (Tocris, EUisville, MO) to inhibit fast glutamatergic and GABAergic synaptic transmission. Whole-cell recordings were performed with patch-clamp pipettes (3-5 MΩ) filled with an internal K⁺-gluconate solution using an Axopatch 200B Amplifier and P-Clamp data acquisition software. Series resistance varied between 6-15 MΩ and was electronically compensated. For analysis of HCN whole-cell currents, 2s hyperpolarizing voltage steps from -60 to -120 mV in 10 mV increments were elicited from a holding potential of -40mV. For analysis of HCN-channel mediated sag- components hyperpolarizing Is current steps of increasing amplitudes (-10pA - - 25 Op A) were injected in current-clamp mode. Spontaneous firing was observed in current-clamp. For analysis of cellular excitability currents were injected to hyperpolarize neurons to -80mV and subsequently depolarizing Is currents steps of increasing amplitude (10-250pA) were injected to elicit action potential firing. ZD7288 (Tocris, EUisville, MO) was prepared as a 50 mM stock solution in DMSO and diluted 1 :1000 in a 10 mM HEPES buffered Ringer solution. Control solution and ZD7288 were locally applied via a quartz buffer pipette that was placed close (< 100 μm) to the recorded neuron under visual control. Flow rate of the application system was pump controlled to 100 μl/min. Data were imported to and analyzed with the IGOR software package. Results are expressed as mean ± S.E.M. (n = x) and statistical significance was tested by students t-test in Microsoft Excel.

Solutions:

1. Sucrose-ACSF (in mM): 50 sucrose, 2.5 glucose, 125 NaCl, 25 NaHCO₃, 2.5 KCl, 1.25 NaH₂PO₄, 0.1 CaCl₂, 6 MgCl₂, 3 kynureic acid (95% O₂/5% CO₂)

2. Recovery/Recording-ACSF (in mM): 25 glucose, 125 NaCl, 25 NaHCO₃, 2.5 KCl, 1.25 NaH₂PO₄, 2 CaCl₂, 2 MgCl₂ (95% O₂/5% CO₂)

3. Internal patch-clamp solution (in mM): 140 K-gluconate, 10 HEPES, 0.1 EGTA, 2.5 MgCl₂ (pH=7.3 with KOH) 4. Application solution: 25 glucose, 150 NaCl, 2.5 KCl, 10 HEPES, 2 CaCL₂, 2 MgCl₂, (pH = 7.4 with NaOH) AU chemicals were purchased from Sigma, St Louis, MO.

Results 1. Results of behavioral testing of 6-OHDA lesioned animals The foot stepping test was used to quantify the degree of the striatonigral lesion in vivo. All animals had a greater than 90% difference between the lesioned and the non-lesioned sides as shown in Table 1.

Table 1 : Results of foot stepping tests in 6-OHDA lesioned animals. The numbers represent percentages of impairment of the lesioned compared with the non-lesioned side. AU animals used in this study had a >90% reduction of adjusting steps. Ammals 1-3 were used in the LCM-array experiments and the remaining animals were analyzed in the in vitro electrophysiological experiments.

2. Results of T7 RNA amplification Results of two rounds of T7 amplification are given in Table 2A - C. Total yields were very similar for all areas. Values varied between 46.7 μg and 74.1 μg in the STR, 62.7 μg and 117.1 μg in the EPN and 68.6 μg and 102.2 μg in the SNR. This clearly demonstrates the efficacy and reproducibility of the method. Yields for the negative control samples were considerably lower. Table 2A

Table 2B

Table 2C

Table 2 A, B and C: Results of two rounds of T7 RNA amplification for STR (A), EPN (B) and SNR (C) samples. The control and lesion groups consisted of 3 animals each: Cl - C3 and LI - L3, respectively. From each animal samples were captured in duplicates from adjacent sections. Control samples for amplification contained no RNA and were either extracted or not extracted before the initial reverse transcription.

3. Microarray results Comparisons of the gene expression profiles from control and 6-OHDA lesioned animals revealed a total number of 363 genes that are either up- or down- regulated in the 3 areas examined. Individual numbers of differentially expressed genes for the STR, EPN and SNR are 152, 145 and 166, respectively. The cut-off was set at a ratio of 1.4-fold. Changes are as high as 10.4-fold (beta-tachykinin in the EPN) with the majority being around 2-fold or below. The p-values indicate that even 1.4-fold alterations in gene expression levels are highly significant. Overall 196 genes are up- and 267 genes are down-regulated, representing 42.3% and 57.6%, respectively. Expression values, ratios and fold-changes including the results of statistical analyses for each area are given in Table 3 A - C.

Table 3A

Table 3A

( >

Table 3A

Table 3B

'Jl tsi

Table 3C

Table 3C

Table 3C

Table 3C

Os -4

Table 3C

Table 3C

-4

©

Table 3C

Table 3C

-4

Table 3C

-4 i

Table 3C

Table 3C

-4

Table 3C

-4

0

Table 3C

-4 -4

Table 3 A, B, C: Differentially expressed genes in the STR (A), EPN (B) and SNR (C). The columns represent the consecutive number of genes with a greater than 1.4- fold change, the mean normalized expression values of the control and 6-OHDA lesioned groups, the ratios (control/ lesion) of the mean expression values, the fold changes, p-values for the mean intensities being within plant gene background levels for both groups, p-values for the mean intensities of both biological groups (control and lesion) being identical, the gene annotations and the GenBank accession numbers. Where available the reference sequence numbers are given to represent the sequence ID of the actual cDNA fragments on the arrays. Among the biggest changes in all areas are neuropeptides such as tachykinin, cholecystokinin, neuromedin U, somatostatin and prepronociceptin. Differential regulation also occurs in many of the classical neurotransmitter systems as indicated by changes in receptor expression. Besides dopamine changes also affected signaling of glutamate, GABA, noradrenaline, serotonine, adenosine, histamine. Many of these receptors are members of the G-protein coupled receptor (GPCR) family, which coincides with altered expression of downstream mediators such as the alpha subunit of the guanine nucleotide-binding protein G-s (Gnas), beta 2 polypeptide of the guanine nucleotide binding protein, the regulator of G-protein signaling 2 (RGS2) and 4 (RGP4), and the rho guanine nucleotide exchange factor (GEF7). Major alterations could also be identified in energy metabolism and structural proteins. A non- comprehensive list of gene families and pathway affected by the lesion is given in Table 4.

Differentially Expressed Gene Families ion channels receptors (GPCRs and ligand gated ion channels) neurotransmitter transporters neuropeptides neuropeptide processing proteins neurotransmitter synthesis proteins G-proteins and G-protein regulators growth factors energy metabolism proteins transcription factors and immediate early genes structural proteins myelin associated proteins novel proteins

Table 4: Gene families and functional pathways affected by dopamine depletion in the STR, SNR and EPN The data demonstrates that a wide range of gene families and cellular functions is affected by the lesion.

4. Validation of array data In order to determine the validity of the approach we conducted quantitative PCR experiments for 12 genes that were found to be differentially regulated in the three areas studied. The family of hyperpolarization activated non-selective cation channels (HCN 1-4) was analyzed in more detail. In addition to HCN3 which shows a 2-fold increase of the RNA message in the EPN, the mRNA levels of HCNl, HCN2 and HCN4 were also determined in this area. The results confirmed the exclusive up- regulation of the HCN3 expression. The mRNA levels for HCNl , HCN2 and HCN4 did not change. The data were further complemented with in vitro electrophysiological recordings from EPN neurons that reveal an increased I-h current in lesioned animals and thus demonstrate the functional relevance of the increased mRNA expression. These results are given in more detail in the following sections.

4.1 qPCR experiments in STR, EPN and SNR A total number of 12 genes found to be differentially expressed in the array results were chosen for qPCR analyses. The genes represent examples at different fold-changes and are both up- and down-regulated. All 12 genes confirmed the array results. As starting material in the PCR experiments both amplified and non-amplified cDNA was used. For six genes data from amplified and non-amplified material is available. The similarities between these experiments demonstrate that using the T7 amplified material in qPCR analyses is a valid approach. The results are summarized in Table 5. Table 5

Table 5: Results of qPCR analyses in the STR, EPN and SNR (first column). The gene name is given in the second column. The ratios of the of the control and lesion groups in array experiments are listed in the third column and ratios of qPCR experiments using amplified and non-amplified RNA are shown in columns 4 and 5. The last column indicates whether the gene is up- or down-regulated.

4.2 Validation of HCN results

Quantitative PCR results The EPN microarray experiments showed a 1.97-fold up-regulation of the HCN3 channel with a p-value < 0.05 for the probability of the two groups being identical. In both groups the expression level of HCN3 is significantly (p < 0.01) above plant gene background (mean signal intensity for plant gene hybridization varied between 18.9 and 48.2). The 1.54-fold up-regulation in the SNR also reached statistical significance (p < 0.05). Results are summarized in Table 5. In order to test whether HCN3 is the only member of the HCN family of genes with an altered mRNA level in the EPN qPCR experiments were also conducted for HCNl, HCN2 and HCN4. These experiments revealed that HCN3 is in fact the only hyperpolarization activated cation channel whose expression is regulated by a loss of dopamine input into the basal ganglia circuitry. The adjusted calculated amounts of template for all four HCN genes in the control and lesioned samples are given in Table 6. The data clearly show that the differential expression exclusively affects HCN3; HCNl, HCN2 and HCN4 do not change their mRNA levels following a lesion of the nigrostriatal system. Normalization ratios were calculated from average values of amounts for aldehyde reductase and cyclophilin A. Fig. 2 gives a graphic representation of the ratios of these two genes. The graphs demonstrate that there is good correlation between the two genes in individual samples but that the content between different samples differs up to 2.3-fold.

Table 6: Quantitative PCR results of HCNl - 4 in EPN neurons of control and lesioned animals. Normalized mean values (in atograms) for each of the genes are given in columns 2 and 3. A difference larger than 1.4 -fold between the two groups was only found for HCN3. Qualitative PCR expression profiling in the EPN Conventional PCR was used to examine the expression of the HCN family of genes in the EPN. The data demonstrate that all four HCNs are expressed in this area of the rat brain. No-RT controls did not result in a PCR product as demonstrated in Fig. 3.

Results of in vitro electrophysiological experiments A first series of experiments were set up to determine the basic amplitude of I_h currents as well as basic electrophysiological properties and possible alterations in the firing pattern of EPN neurons in adult control and 6-OHDA lesioned animals. A total number of 57 neurons in brain slices from 3 control and 4 lesioned rats were recorded in voltage-clamp and current-clamp configurations. A second set of experiments focused on the effects of I_h inhibition by ZD7288. 52 neurons in brain slices form 6 control and 4 lesioned rats were also recorded in voltage-clamp and current-clamp configurations.

Voltage clamp recordings: To quantify the whole-cell HCN currents in EPN neurons voltage-clamp recordings were performed. HCN channels were activated by hyperpolarizing voltage- steps from -60 to -120 mV from a holding potential of -40 mV. The dominant components of HCN current activation kinetics at -120 mV were not significantly different between neurons from control (control: 269±30ms, n=13; post-lesion: 283±32ms, n=25, p>0.05) and lesioned animals. This indicated the presence of similar HCN channels with comparable voltage-dependencies. Thus, the HCN current amplitudes at -120 mV could be directly compared between the two groups. HCN whole cell currents were of small amplitude in control EPN type I neurons (15.8±2.4 pA, n=13). In contrast, HCN whole cell currents in EPN neurons from lesioned animals showed significantly (1.94-fold) larger amplitudes (30.8±3.8 pA, n=22, pO.Ol, Fig. 4A, 4B, 4C₅ and 4D). In ZD7288 experiments HCN channels were also activated by hyperpolarizing voltage steps from -60 to -120 mV from a holding potential of -40 mV in EPN cells from control and lesioned animals. When HCN currents were detected (type I EPN cells), the application solution was switched from control to ZD7288 (50μM) for 5 min. After 5 min in ZD7288, the voltage protocol was repeated and subsequently the application solution was switched back to control. After a 15 min. washout, the voltage protocol was repeated to study the reversibility of the ZD7288 effect. In accordance with the previous results HCN currents were elicited in type I EPN cells from control and lesioned animals. 50μM ZD7288 completely and irreversibly blocked the HCN whole cell currents in type I EPN cells both from control (n=6) and from lesioned (n=6) animals (Fig. 5 and Fig. 6). The ZD7288-sensitive HCN currents were 1.8-fold larger in neurons from lesioned animals compared to controls (ZD7288- sensitive HCN currents at -120mV: controls: 10.4 ± 1.5 pA, n=6; post-lesion: 18.2 ± 3.0 pA, n =6). These data demonstrate that the increased Ih currents recorded in type I EPN cells from lesioned animals are mediated by ZD7288-sensitive HCN channels.

Current clamp recordings: Two main cell-types were observed in the EPN, both in slices from control and lesioned animals. Similar to a previous report by Nakanishi et al., Intracellular study of rat entopeduncular nucleus neurons in an in vitro slice preparation: electrical membrane properties, Brain Res. 527:81-8 (1990), a dominant type I EPN population (controls: 67% (14/21) and post-lesion: 83% (30/36)) was recorded that possessed a HCN-mediated sag component upon membrane hyperpolarization. Type II neurons without sag were the minority in control and lesioned animals. To address the question whether altered HCN channel activity was present in EPN type I neurons, hyperpolarizing current steps of increasing amplitude were injected to evoke HCN channel-mediated time-dependent anomalous rectifications i.e. sag components. In comparison to EPN type I neurons from control animals, the amplitude of sag components after initial hyperpolarizations to -120mV were significantly (1.93-fold) larger in EPN type I neurons from lesioned animals (controls: 5.4±0.9 mV, n=12; post-lesion: 10.4±l.lmV, n=21; pO.OOl; see Fig. 7A, 7B, and 7C). In accordance with the first study, the I_h -mediated time-dependent anomalous rectifications, i.e., the ZD7288-sensitive sag components, were increased in type I EPN neurons from lesioned animals compared to those from controls (ZD-sensitive sag amplitudes at -120mV: controls: 2.1 ± 0.6 mV, n=8; post-lesion: 6.4 ± 1.2 mV, n=12; pO.OOl; Fig. 8 and Fig. 9). Rebound excitability of EPN neurons, defined as the delay between the cessation of the hyperpolarizing current injection and the first rebound spike, was shorter in post-lesion animals compared to controls (controls: 148 ± 18 ms, n=8, post- lesion: 101 ± 10 ms, n=9). The shorter delay of rebound firing in EPN neurons from lesioned animals was sensitive to 50μM ZD7288, which significantly slowed the rebound delay (x 1.78/ +78%, post-lesion: 101 ± 9.8 mV, n=9; post-lesion + ZD7288: 180 ± 13 mV, n=9, ρ .01; see Fig. 10 and Fig. 11). In contrast, the rebound delay was not significantly altered by application of ZD7288 in EPN neurons from control animals (+6%, control: 148 ± 25 ms, n=8; control + ZD7288: 158 ± 19 ms, n=8, p>0.05) despite the fact that the Ih -mediated time-dependent anomalous rectifications, i.e., sag components, were completely inhibited. The presence of a ZD7288-sensitive increase in post-inhibition rebound excitability in EPN neurons from lesioned animals demonstrates that increased HCN3 expression and the subsequent increase of ZD7288- sensitive HCN whole cell currents contributes to the altered excitability of EPN neurons in 6-OHDA-lesioned animals. Hype olarization-activated cyclic nucleotide-gated cation channel HCN3 plays a crucial role in the pathophysiology of parkinsonian disorders. The initial microarray experiments revealed an up-regulation of the mRNA levels in the EPN and to a lesser degree in the SNR of a rat model of PD. The 2-fold increase in the EPN could be confirmed by quantitative PCR analyses, which showed an equivalent up- regulation. These data also demonstrate that the two methods have a similar sensitivity for detecting differences in gene expression. To test the biological relevance of the up-regulated expression we conducted whole cell patch clamp recordings from in vitro slice preparations. A comparison of type I EPN neurons from control and 6-OHDA lesioned animals revealed an approximately 2-fold increase in I_h current. The fact that almost identical results could be obtained in two independent experiments with different sets of animals stresses the robustness of the differential regulation. In current clamp mode the typical HCN channel-mediated time-dependent anomalous rectifications (sag) were also significantly augmented in lesioned animals. Although in both voltage and current clamp modes the measured currents and changes in voltage display HCN-typical features we verified their specificity by applying the HCN selective antagonist ZD7288. The drug completely abolished both sag and current. Overall these data demonstrate that the regulatory control of the HCN3 gene in the central nervous system involves transcriptional mechanisms and that the functional up-regulation of the channel is accurately reflected in the increased mRNA levels. In the current experiments, the question of whether the lesion of the striatonigral system specifically affects the HCN3 gene or whether other members of the HCN family are also differentially regulated was addressed. Quantitative PCR analyses revealed that HCN3 is the only gene changing its level of expression and that therefore the increase in I current is exclusively due to the up-regulation of HCN3. This assumption is further confirmed by the fact that the dominant component of the activation kinetics of the I current does not differ between control and lesioned animals. A change in subtype composition would result in different activation kinetics as has been shown by Santoro et al. for different cell types in the central nervous system. Santoro et al., Molecular and functional heterogeneity of hyperpolarization-activated pacemaker channels in the mouse brain, JNeursoci. 20:5264-75 (2000). So the increase in I_h in the EPN after dopamine depletion of the basal ganglia is exclusively caused by an up- regulation of HCN3. At the level of cellular function the up-regulation causes an increased excitability as would be expected from an augmented inward rectifying current. In vitro neurons of lesioned animals show a significant shortening of the time period between hyperpolarizing stimuli and the appearance of the first action potential. The cells might also have a more positive resting membrane potential but because they were spontaneously active this could not be determined. These results are in accordance with what is known about the behavior of EPN neurons in vivo. In rat and primate models of PD in vivo recordings from this area revealed both increased firing rates as well as altered firing patterns with burst firing, regular oscillations and an increased percentage of synchronized neuronal activity. Filion et al., Abnormal spontaneous activity of globus pallidus neurons in monkeys with MPTP-induced parkinsonism, Brain Res. 547:142-51 (1991); Bergman et al., The primate subthalamic nucleus. II. Neuronal activity in the MPTP model of parkinsonism, J Neurophysiol. 72:507-20 (1994); Ruskin et al., Nigrostriatal lesions and dopamine agonists affect firing patterns of rodent entopeduncular nucleus neurons, J Neurophysiol. 88:487-96 (2002). The HCN3 channel seems to be a crucial link in the chain of cellular and behavioral changes that are caused by the loss of dopamine input into the system. The increase in I current and excitability result in an increased activity and firing frequency of the affected neurons, which at the behavioral level causes a decreased output of the motor system. Blocking the I current in 6-OHDA lesioned animals reversed the cellular excitability to a normal level providing evidence for the potential therapeutic value of HCN3 antagonists in the treatment of parkinsonian movement disorders. The fact that I_h inhibition does not alter the excitability of EPN neurons in normal control animals supports the hypothesis that HCN3 does not regulate the firing behavior of these cells under physiological conditions. In terms of potential side effects of selective HCN3 antagonists this predicts a lack of system specific adverse reactions. The results described above demonstrate that the HCN3 channel is a crucial component in the pathophysiology of PD and that inhibiting the current reduced the increased excitability of EPN neurons to normal levels. Therefore, HCN3 specific drugs will have a beneficial effect in parkinsonian disorders. HCN3 related compounds would also be effective in the treatment of hyperkinetic disorders because the basal ganglia output nuclei show a reduced excitability in syndromes that are clinically characterized by an increased motor output such as in Huntington's disease. Although the invention has been described above in reference to illustrative examples and preferred embodiments, its scope is intended to not be limited by the foregoing description, but defined by the following claims as properly interpreted under principles of patent law.

Claims

WHAT IS CLAIMED IS:

1. A method for screening compounds that affect the pathophysiologic mechanisms of neurological disorders comprising: a. administering a compound to animals having a neurological disorder; b. collecting and preparing tissue samples from said animals and controls; c. performing laser capture microdissection on said tissue samples to isolate select cells; d. extracting the RNA from said cells; e. amplifying said RNA; f. labeling said RNA; g. hybridizing said labeled RNA to a microarray; h. detecting said hybridized RNA; and i. comparing the expression of said RNA from said animals and said controls.

2. The method in claim 1, wherein said RNA is amplified using T7 RNA amplification.

3. A method for detecting a change in gene expression in cells affected by neurological disorders and treated with a compound comprising: a. collecting and preparing tissue samples from the section affected by the neurological disorder and treated with a compound; b. performing laser capture microdissection on said tissue samples to isolate select cells; c. extracting the RNA from said cells; d. amplifying said RNA; e. labeling said RNA; f. hybridizing said labeled RNA to a microarray; g. detecting said hybridized RNA.

4. The method in claim 3, wherein said RNA is amplified using T7 RNA amplification.

5. A method for identifying compounds that affect the pathophysiologic mechanisms of hyperpolarization-activated cyclic nucleotide-gated cation channel 3 (HCN3) comprising: a. administering a composition to animals having a neurological disorder; b. collecting and preparing tissue samples from said animals; c. performing laser capture microdissection on said tissue samples; d. isolating RNA from the cells collected from said tissue samples; e. amplifying said RNA; f. labeling said RNA; g. hybridizing said labeled RNA to a microarray; and h. detecting expression of said RNA.

6. The method in claim 5, wherein said RNA is amplified using T7 RNA amplification.

7. A method for identifying compounds that affect the pathophysiologic mechanisms of hyperpolarization-activated cyclic nucleotide-gated cation channel 3 (HCN3) comprising: a. inducing a movement disorder in an animal; b. administering a test composition to said animals; c. collecting and preparing tissue samples from said animals and controls; d. performing laser capture microdissection on said tissue samples to isolate select cells; e. isolating RNA from said cells collected from said tissue samples; f. amplifying said RNA; g. labeling said RNA; h. hybridizing said labeled RNA to a cDNA microarray; i. detecting said hybridized RNA; and j. comparing the expression of said RNA from said ammals and said controls.

8. The method in claim 7, wherein inducing a movement disorder in an animal is achieved by administering 6-hydroxydopamine into the medial forebrain bundle of said animal.

9. The method in claim 7, wherein said animals exhibiting at least 90% confralateral forelimb akinesia are selected for having a movement disorder.

10. The method in claim 7, wherein said tissue samples are taken from the endopiriform nucleus and substantia nigrapars reticulata of the brain in said animals and said controls.

11. The method in claim 7, wherein said RNA is amplified using T7 RNA amplification.

12. A method for regulating hyperpolarization-activated cyclic nucleotide-gated cation channel 3 (HCN3) activity for the symptomatic treatment of movement disorders comprising administering a compound to normalize said HCN3 activity.

13. A method for screening the affect of a compound on an ion channel comprising: a. administering a compound to animals having an ion channel disorder; b. collecting and preparing tissue samples from said animals and controls; c. performing laser capture microdissection on said tissue samples to isolate select cells; d. extracting the RNA from said cells; e. amplifying said RNA; f. labeling said RNA; g. hybridizing said labeled RNA to a microarray; h. detecting said labeled RNA hybridized to said microarray; and i. comparing the expression of said RNA from said animals and said controls.

14. The method in claim 13, wherein said RNA is amplified using T7 RNA amplification.

15. A method for screening the affect of a compound on the regulation of pain comprising: a. administering a compound to animals in a pain defined state; b. collecting and preparing tissue samples from said animals and controls; c. performing laser capture microdissection on said tissue samples to isolate select cells; d. extracting the RNA from said cells; e. amplifying said RNA; f. labeling said RNA; g. hybridizing said labeled RNA to a microarray; h. detecting said labeled RNA hybridized to said microarray; and i. comparing the expression of said RNA from said animals and said controls.

16. The method in claim 15, wherein said RNA is amplified using T7 RNA amplification.

17. A method for screening the affect of a compound on movement disorders comprising: a. administering a compound to animals with a movement disorder; b. collecting and preparing tissue samples from said animals and controls; c. performing laser capture microdissection on said tissue samples to isolate select cells; d. extracting the RNA from said cells; e. amplifying said RNA; f. labeling said RNA; g. hybridizing said labeled RNA to a microarray; h. detecting said labeled RNA hybridized to said microarray; and i. comparing the expression of said RNA from said animals and said controls.

18. The method in claiml7, wherein said RNA is amplified using T7 RNA amplification.