EP1735442A2 - Compositions and methods for treating pancreatic cancer - Google Patents

Compositions and methods for treating pancreatic cancer

Info

Publication number
EP1735442A2
EP1735442A2 EP05721546A EP05721546A EP1735442A2 EP 1735442 A2 EP1735442 A2 EP 1735442A2 EP 05721546 A EP05721546 A EP 05721546A EP 05721546 A EP05721546 A EP 05721546A EP 1735442 A2 EP1735442 A2 EP 1735442A2
Authority
EP
European Patent Office
Prior art keywords
sequence
double
sirna
cdh3
pcdhl
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05721546A
Other languages
German (de)
French (fr)
Inventor
Yusuke Nakamura
Hidewaki Nakagawa
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc filed Critical Oncotherapy Science Inc
Publication of EP1735442A2 publication Critical patent/EP1735442A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed

Definitions

  • the present invention relates to the field of biological science, more specifically to the field of cancer research.
  • the present invention relates a composition comprising a nucleic acid capable of inhibiting expression ofthe genes encoding PCDHl, CDH3 or GPR107.
  • the compound is a small interfering RNA (siRNA) corresponding to a subsequence from these genes.
  • Pancreatic ductal adenocarcinoma is the fifth leading cause of cancer death in the western world and has one ofthe highest mortality rates of any malignancy, with a 5-year survival rate only 4%.
  • PDACa pancreatic ductal adenocarcinoma
  • RNA small interfering RNA
  • the invention also provides methods for inhibiting tumor cell growth in a subject. Such methods include administering to a subject a composition comprising a small interfering RNA (siRNA) that hybridizes specifically to a sequence from PCDHl, CDH3 or GPRl 07.
  • siRNA small interfering RNA
  • Another aspect ofthe invention provides methods for inhibiting the expression ofthe PCDHl, CDH3 or GPRl 07 gene in a cell of a biological sample.
  • RNA double stranded ribonucleic acid
  • Another aspect ofthe invention relates to products including nucleic acid sequences and vectors as well as to compositions comprising them, useful, for example, in the provided methods.
  • siRNA molecules having the property to inhibit expression ofthe PCDHl, CDH3 or GPRl 07 gene when introduced into a cell expressing said gene.
  • Such molecules are those that comprise a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a PCDHl, CDH3 or GPRl 07 target sequence, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand.
  • the sense and the antisense strands ofthe molecule hybridize to each other to form a double-stranded molecule.
  • the term "organism" refers to any living entity comprised of at least one cell.
  • a living organism can be as simple as, for example, a single eukaryotic cell or as complex as a mammal, including a human being.
  • biological sample refers to a whole organism or a subset of its tissues, cells or component parts (e.g. bodily fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, arnniotic fluid, amniotic cord blood, urine, vaginal fluid and semen).
  • bodily fluids including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, arnniotic fluid, amniotic cord blood, urine, vaginal fluid and semen.
  • Biological sample further refers to a homogenate, lysate, extract, cell culture or tissue culture prepared from a whole organism or a subset of its cells, tissues or component parts, or a fraction or portion thereof.
  • biological sample refers to a medium, such as a nutrient broth or gel in which an organism has been propagated, which contains cellular components, such as proteins or nucleic acid molecules.
  • the invention features methods of inhibiting cell growth.
  • Cell growth is inhibited by contacting a cell with a composition of a small interfering RNA (siRNA) of PCDHl, CDH3 or GPRl 07.
  • the cell is further contacted with a transfection-enhancing agent.
  • the cell is provided in vitro, in vivo or ex vivo.
  • the subject is a mammal, e.g., a human, non- human primate, mouse, rat, dog, cat, horse, or cow.
  • the cell is a pancreatic ductal cell.
  • the cell is a tumor cell ( t ' .e., cancer cell) such as a carcinoma cell or an adenocarcinoma cell.
  • the cell is a pancreatic ductal adenocarcinoma cell.
  • siRNA is meant a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell are used, including those in which DNA is a template from which RNA is transcribed.
  • the siRNA includes a sense PCDHl, CDH3 or GPRl 07 nucleic acid sequence, an anti-sense PCDHl, CDH3 or GPRl 07 nucleic acid sequence or both.
  • the siRNA may comprise two complementary molecules or may be constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin, which, in some embodiments, leads to production of micro RNA (miRNA).
  • the method is used to alter gene expression in a cell in which expression of PCDHl, CDH3 or GPRl 07 is up-regulated, e.g., as a result of malignant transformation of the cells.
  • the length ofthe oligonucleotide is at least about 10 nucleotides and may be as long as the naturally- occurring PCDHl, CDH3 or GPRl 07 transcript.
  • the oligonucleotide is about 19 to about 25 nucleotides in length.
  • the oligonucleotide is less than about 75, about 50, or about 25 nucleotides in length.
  • siRNA oligonucleotides of PCDHl, CDH3 or GPRl 07 which inhibit PCDHl, CDH3 or GPRl 07 expression in mammalian cells include oligonucleotides containing target sequences, for example, nucleotides of SEQ ID NOs: 22, 23 or 24, respectively.
  • Methods for designing double stranded RNA having the ability to inhibit gene expression in a target cell are known. (See for example, US Patent No. 6,506,559, herein incorporated by reference in its entirety). For example, a computer program for designing siRNAs is available from the Ambion website
  • siRNA Target Sites 1. Beginning with the AUG start codon ofthe transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl et al.,Targeted mRNA degradation by double-stranded RNA in vitro.
  • BLAST can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/ 3. Select qualifying target sequences for synthesis. Selecting several target sequences along the length ofthe gene to evaluate is typical.
  • isolated nucleic acid molecules that include the nucleic acid sequence of target sequences, for example, nucleotides of SEQ ID NOs: 22, 23 and 24 or a nucleic acid molecule that is complementary to the nucleic acid sequence of nucleotides of SEQ ID NOs: 22, 23 and 24.
  • an "isolated nucleic acid” is a nucleic acid removed from its original environment (e.g., the natural environment if naturally occurring) and thus, synthetically altered from its natural state.
  • isolated nucleic acid includes DNA, RNA, and derivatives thereof. hen the isolated nucleic acid is RNA or derivatives thereof, base "t" should be replaced with "u” in the nucleotide sequences.
  • complementary refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule
  • binding means the physical or chemical interaction between two nucleic acids or compounds or associated nucleic acids or compounds or combinations thereof.
  • Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches. For the purposes of this invention, two sequences having 5 or fewer mismatches are considered to be complementary.
  • the sense strand and antisense strand ofthe isolated nucleotide ofthe present invention can form double stranded nucleotide or hairpin loop structure by the hybridization.
  • such duplexes contain no more than 1 mismatch for every 10 matches.
  • where the strands ofthe duplex are fully complementary such duplexes contain no mismatches.
  • the nucleic acid molecule is less than 3851, 3205, or 6840 nucleotides in length for PCDHl, CDH3 or GPRl 07, respectively.
  • the nucleic acid molecule is less than about 500, about 200, or about 75 nucleotides in length.
  • a vector containing one or more ofthe nucleic acids described herein is included in the invention, and a cell containing the vectors.
  • the isolated nucleic acids ofthe present invention are useful for siRNA against PCDHl, CDH3 or GPR107, or DNA encoding the siRNA,
  • the sense strand is preferably longer than about 19 nucleotides, and more preferably longer than 21 nucleotides.
  • the invention is based in part on the discovery that the gene encoding PCDHl, CDH3 or GPRl 07 is over-expressed in pancreatic ductal adenocarcinoma (PDACa) compared to non-cancerous pancreatic tissue.
  • PDACa pancreatic ductal adenocarcinoma
  • the cDNA of PCDHl, CDH3 or GPRl 07 is 3851, 3205 or 6840 nucleotides in length.
  • the nucleic acid and polypeptide sequences of PCDHl, CDH3 or GPR107 are shown in SEQ ID NO: 1 and 2, 3 and 4 or 5 and 6, respectively.
  • the sequence data are also available via following accession numbers.
  • GPRl 07 NM_032925, NM_020960, (KIAA1624: R39794)
  • AB046844 Transfection of siRNAs comprising SEQ ID NOs: 22, 23 and 24 resulted in a growth inhibition of PDACa cell lines.
  • PCDHl belongs to the protocadherin family, the largest subgroup of cadherin superfamily of calcium-dependent cell-cell adhesion molecules. Many ofthe protocadherin are highly expressed in the central nervous system and they are likely to play roles in neuronal circuit development and the modulation of synaptic transmission (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin- related molecules in central nervous system. EMBOJ., 12:2249-56, 1993.Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol, 14:557-62, 2002).
  • CDH3 is also a classical member ofthe cadherin family (Shimoyama Y, Yoshida T, Terada M, Shimosato Y, Abe O, Hirohashi S. Molecular cloning of a human Ca2+- dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues. JCell Biol, 109:1787-94. 1989) and they link to catenins and cytoskeletons through its conserved intracellular domain, mediating signal- transduction that control cell polarity, differentiation, motility and cell growth (Christofori G.
  • GPRl 07 (KIAA1624) is one ofthe G protein-coupled receptors (GPCR) with seven transmembranes. A large percentage of today's prescription drugs target one or more GPCRs with most major therapeutic area being served to some extent by several GPCR- based drugs. Clearly, GPCRs are in the highest rank in the terms of drug discovery potential. GPRl 07 is expressed without restriction in normal heart, placenta, skeletal muscle, prostate, testis, ovary, spinal cord as shown in Northern blot analysis ( Figure 3C). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
  • the present invention relates to inhibiting cell growth, i.e, cancer cell growth by inhibiting expression of PCDHl, CDH3 or GPRl 07. Expression of PCDHl, CDH3 or
  • GPRl 07 is inhibited, for example, by small interfering RNA (siRNA) that specifically target the PCDHl, CDH3 or GPRl 07 gene.
  • PCDHl, CDH3 or GPRl 07 targets include, - for example, nucleotides of SEQ ID NOs: 22, 23 and 24.
  • dsRNA double-stranded RNA
  • RNAi RNA interference
  • dsRNA is processed into 20-23 nucleotides dsRNA called small interfering RNA (siRNA) by an enzyme containing RNase III motif.
  • siRNA specifically targets complementary mRNA with a multicomponent nuclease complex (Hammond SM, Bernstein E, Beach D, Hannon GJ.
  • An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. 2000 Mar 16;404(6775):293- 6; Hannon GJ. RNA interference. Nature. 2002 Jul 11;418(6894):244- 51.).
  • siRNA composed of 20 or 21-mer dsRNA with 19 complementary nucleotides and 3' terminal noncomplementary dimmers of thymidine or uridine, have been shown to have a gene specific knock-down effect without inducing global changes in gene expression (Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24;411(6836):494-8.).
  • plasmids containing small nuclear RNA (snRNA) U6 or polymerase III HI -RNA promoter effectively produce such short RNA recruiting type III class of RNA polymerase III and thus can constitutively suppress its target mRNA Miyagishi M, Taira K.
  • U6 promoter- driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells.Nat Biotechnol. 2002 May;20(5):497-500. ; Brummelkamp TR, Bernards R, Agami R. A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science. 296(5567):550-553, April 19, 2002.).
  • the growth of cells are inhibited by contacting a cell, with a composition containing a siRNA of PCDHl, CDH3 or GPRl 07.
  • the cell is further contacted with a transfection agent. Suitable transfection agents are known in the art.
  • inhibition of cell growth is meant the cell proliferates at a lower rate or has decreased viability compared to a cell not exposed to the composition.
  • Cell growth is measured by methods known in the art such as, the MTT cell proliferation assay.
  • the siRNA of PCDHl, CDH3 or GPRl 07 is directed to a single target of PCDHl, CDH3 or GPRl 07 gene sequence. Alternatively, the siRNA is directed to multiple target of PCDHl, CDH3 or GPRl 07 gene sequences.
  • the composition contains siRNA of PCDHl, CDH3 or GPRl 07 directed to two, three, four, or five or more target sequences of PCDHl, CDH3 or GPRl 07.
  • PCDHl, CDH3 or GPRl 07 target sequence is meant a nucleotide sequence that is identical to a portion ofthe PCDHl, CDH3 or GPRl 07 gene.
  • the target sequence can include the 5' untranslated (UT) region, the open reading frame (ORF) or the 3' untranslated region ofthe human PCDHl, CDH3 or GPRl 07 gene.
  • the siRNA is a nucleic acid sequence complementary to an upstream or downstream modulator of PCDHl, CDH3 or GPRl 07 gene expression.
  • upstream and downstream modulators include, a transcription factor that binds the PCDHl, CDH3 or GPRl 07 gene promoter, a kinase or phosphatase that interacts with the PCDHl, CDH3 or GPRl 07 polypeptide, a PCDHl, CDH3 or GPRl 07 promoter or enhancer.
  • siRNA of PCDHl , CDH3 or GPRl 07 which hybridize to target mRNA decrease or inhibit production ofthe PCDHl, CDH3 or GPRl 07 polypeptide product encoded by the PCDHl, CDH3 or GPRl 07 gene by associating with the normally single- stranded mRNA transcript, thereby interfering with translation and thus, expression ofthe protein.
  • siRNA molecules ofthe invention can be defined by their ability to hybridize specifically to mRNA or cDNA from a PCDHl , CDH3 or GPRl 07 gene under stringent conditions.
  • hybridize or “hybridize specifically” are used to refer the ability of two nucleic acid molecules to hybridize under “stringent hybridization conditions.”
  • stringent hybridization conditions refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures.
  • T m thermal melting point
  • Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
  • a positive signal is at least two times background, preferably 10 times background hybridization.
  • Exemplary stringent hybridization conditions can be as following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 50°C.
  • the siRNA ofthe invention is less than about 500, about 200, about 100, about 50, or about 25 nucleotides in length. Preferably the siRNA is about 19 to about 25 nucleotides in length.
  • nucleic acid sequence for the production of PCDHl, CDH3 or GPR107 siRNA include the sequences of nucleotides of SEQ ID NOs: 22, 23 or 24 as the target sequence, respectively.
  • nucleotide "u” can be added to 3 'end ofthe antisense strand ofthe target sequence.
  • the number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5.
  • the added "u”s form single strand at the 3'end of the antisense strand ofthe siRNA.
  • the cell is any cell that expresses or over-expresses PCDHl, CDH3 or GPRl 07.
  • the cell is an epithelial cell such as a pancreatic ductal cell.
  • the cell is a tumor cell such as a carcinoma, adenocarcinoma, blastoma, leukemia, myeloma, or sarcoma.
  • the cell is a pancreatic ductal adenocarcinoma.
  • An siRNA of PCDHl, CDH3 or GPRl 07 is directly introduced into the cells in a form, that is capable of binding to the mRNA transcripts.
  • the DNA encoding the siRNA of PCDHl, CDH3 or GPRl 07 is in a vector.
  • Vectors are produced for example by cloning a PCDHl, CDH3 or GPRl 07 target sequence into an expression vector operatively-linked regulatory sequences flanking the PCDH1, CDH3 or GPRl 07 sequence in a manner that allows for expression (by transcription ofthe DNA molecule) of both strands (Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505.).
  • RNA molecule that is antisense to PCDHl, CDH3 or GPR107 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3 ' of the cloned DNA) and an RNA molecule that is the sense strand for the PCDHl, CDH3 or GPRl 07 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' ofthe cloned DNA).
  • the sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing of the PCDHl, CDH3 or GPRl 07 gene.
  • two constructs are utilized to create the sense and anti-sense strands of a siRNA construct.
  • Cloned PCDHl, CDH3 or GPRl 07 can encode a construct having secondary structure, e.g., hairpins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene.
  • a loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure.
  • the present invention also provides siRNA having the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA from PCDHl, CDH3 or GPRl 07.
  • [A] is a ribonucleotide sequence corresponding to a sequence selected from the group consisting of nucleotides of SEQ ID NOs: 22, 23 and 24, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A]
  • the region [A] hybridizes to [A'j, and then a loop consisting of region [B] is formed.
  • the loop sequence may be preferably about 3 to about 23 nucleotide in length.
  • the loop sequence for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb_506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-1 replication by RNA interference. Nature 418 : 435-438.). CCC, CCACC or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M (2002)
  • the loop sequence can be selected from group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
  • Preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA (SEQ ID NO:35)).
  • siRNAs are transcribed intracellularly by cloning the PCDHl, CDH3 or GPRl 07 gene templates into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter.
  • transfection-enhancing agent can be used. FuGENE (Roche Diagnostices), Lipofectamine 2000 (Invitrogen),
  • Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical) are useful as the transfection-enhancing agent.
  • Oligonucleotides and oligonucleotides complementary to various portions of PCDHl, CDH3 or GPRl 07 mRNA were tested in vitro for their ability to decrease production of PCDHl, CDH3 or GPR107 in tumor cells (e.g., using the pancreatic cell line such as pancreatic ductal adenocarcinoma(PDACa) cell line) according to standard methods.
  • a reduction in PCDHl, CDH3 or GPRl 07 gene product in cells contacted with the candidate siRNA composition compared to cells cultured in the absence ofthe candidate composition is detected using specific antibodies of PCDHl, CDH3 or GPRl 07 or other detection strategies. Sequences which decrease production of PCDHl, CDH3 or GPRl 07 in in vitro cell-based or cell-free assays are then tested for there inhibitory effects on cell growth. Sequences which inhibit cell growth in vifro cell-based assay are test in vivo in rats or mice to confirm decreased PCDHl, CDH3 or GPRl 07 production and decreased tumor cell growth in animals with malignant neoplasms.
  • PDACa pancreatic ductal adenocarcinoma
  • Such patients are identified by standard methods ofthe particular tumor type.
  • Pancreatic ductal adenocarcinoma (PDACa) is diagnosed for example, by CT, MRI, ERCP, MRCP, computer tomography, or ultrasound.
  • Treatment is efficacious if the treatment leads to clinical benefit such as, a reduction in expression of PCDHl, CDH3 or GPRl 07, or a decrease in size, prevalence, or metastatic potential ofthe tumor in the subject.
  • "efficacious" means that the treatment retards or prevents tumors from forming or prevents or alleviates a symptom of clinical symptom of the tumor. Efficaciousness is determined in association with any known method for diagnosing or treating the particular tumor type.
  • siRNA therapy is carried out by administering to a patient a siRNA by standard vectors encoding the siRNAs ofthe invention and/or gene delivery systems such as by delivering the synthetic siRNA molecules.
  • siRNA molecules are chemically stabilized to prevent nuclease degradation in vivo.
  • Methods for preparing chemically stabilized RNA molecules are well known in the art.
  • such molecules comprise modified backbones and nucleotides to prevent the action of ribonucleases.
  • Other modifications are also possible, for example, cholesterol-conjugated siRNAs have shown improved pharmacological properties. (Song et al. Nature Med. 9:347-351 (2003)).
  • Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, or viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses, among others.
  • a therapeutic nucleic acid composition is formulated in a pharmaceutically acceptable carrier.
  • the therapeutic composition may also include a gene delivery system as described above.
  • Pharmaceutically acceptable carriers are biologically compatible vehicles which are suitable for administration to an animal, e.g., physiological saline.
  • a therapeutically effective amount of a compound is an amount which is capable of producing a medically desirable result such as reduced production of a PCDHl, CDH3 or GPRl 07 gene product, reduction of cell growth, e.g., proliferation, or a reduction in tumor growth in a treated animal.
  • Parenteral administration such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, may be used to deliver siRNA compositions of PCDHl, CDH3 or GPRl 07.
  • splenic artery For treatment of pancreatic tumors, direct infusion the celiac artery, splenic artery, or common hepatic artery, is useful. Dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular nucleic acid to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Dosage for intravenous administration of nucleic acids is from approximately 10 6 to 10 22 copies ofthe nucleic acid molecule.
  • the polynucleotides are administered by standard methods, such as by injection into the interstitial space of tissues such as muscles or skin, introduction into the circulation or into body cavities or by inhalation or insufflation.
  • Polynucleotides are injected or otherwise delivered to the animal with a pharmaceutically acceptable liquid carrier, e.g., a liquid carrier, which is'aqueous or partly aqueous.
  • a pharmaceutically acceptable liquid carrier e.g., a liquid carrier, which is'aqueous or partly aqueous.
  • the polynucleotides are associated with a liposome (e.g., a cationic or anionic liposome).
  • the polynucleotide includes genetic information necessary for expression by a target cell, such as a promoters.
  • Figure 1 depicts photographs showing the results of validation of over expression of PCDHl (A) and CDH3 (B) in the PDACa cells by RT-PCR.
  • Figure 2 depicts photographs showing the result of immunohistochemistry in PDACa tissues. Over-expression of CDH3 protein was observed in pancreatic ductal adenocarcinoma, but not in normal pancreatic duct.
  • Figure 3 depicts photographs of Northern blot analysis showing the expression pattern in normal adult tissues of each target genes for pancreatic cancer.
  • A PCDHl
  • B CDH3
  • C GPR107.
  • Figure 4 depicts photographs showing the effect of Knocking-down endogenous PCDHl in PDACa cell, PK-45P, by siRNA.
  • Figure 4 (A) shows the results of RT-PCR. It validated knockdown effect of PCDHl mRNA by transfection of siRNA expression vector 410si, but not by EGFPsi. The 410si was designed specifically for PCDHl mRNA sequence, and EGFP was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA.
  • Figure 4 (B) is a photograph showing the results of Colony formation assay.
  • Figure 4 (C) is a bar chart showing the results MTT assay. It also showed drastic decreased number ofthe grown cells transfected with 410si but not by EGFPsi.
  • Figure 5 depicts photographs showing the effect of Knocking-down endogenous CDH3 in PDACa cell, KLM-1, by siRNA.
  • Figure 5 (A) shows the results of RT-PCR. It validated knockdown effect of CDH3 mRNA by transfection of siRNA expression vectors si24 but not by EGFPsi. The si24 was designed specifically for CDH3 mRNA sequence, and EGFPsi was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA.
  • Figure 5 (B) is a photograph showing the results of Colony formation assay.
  • Figure 5 (C) is a bar chart showing the results MTT assay. It also showed drastic decreased number ofthe grown cells transfected with si24, but not by EGFPsi.
  • Figure 6 depicts photographs showing the effect of Knocking-down endogenous GPRl 07 in PDACa cell, KLM-1, by siRNA.
  • Figure 6 (A) shows the results of RT-PCR. It validated knockdown effect of GPRl 07 mRNA by transfection of siRNA expression vectors 1003 si, but not by and EGFPsi. The 1003 si was designed specifically for GPRl 07 mRNA sequence, and EGFPsi was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA.
  • Figure 6 (B) is a photograph showing the results of Colony formation assay.
  • Figure 6 (C) is a bar chart showing the results MTT assay. It also showed decreased number ofthe grown cells transfected with 1003si, but not by EGFPsi.
  • RNA samples from PDACa cells and normal duct epithelium were labeled by reverse transcription with Cy5-dCTP and Cy3-dCTP, respectively (Amersham Biosciences). Hybridization, washing, and detection were carried out as described previously (Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, and Nakamura Y. Cancer Res., 60: 5007-5011, 2000).
  • the primer sequences the present inventors used were 5 '-AGAAGGAGACCAAGGACCTGTAT-3 ' (SEQ.ID.NO.7) and 5'-AGAACTTTATTGTCAGGGTCAAGG-3' (SEQ.ID.NO.8) for PCDHl, 5'-CTGAAGGCGGCTAACACAGAC-3' (SEQ.ID.NO.9) and 5'-TACACGATTGTCCTCACCCTTC-3' (SEQ.ID.NO.10) for CDH3, and ' 5'-CATCCACGAAACTACCTTCAACT-3' (SEQ.ID.NO.il) and 5'-TCTCCTTAGAGAGAAGTGGGGTG-3 ' (SEQ.ID.NO.12) for ACTB.
  • Immunohistochemistry Formalin-fixed and paraffin-embedded PDACa sections were immunostained using a mouse anti-CDH3 monoclonal antibody (BD Transduction Laboratories) for CDH3 expression.
  • Deparaffinized tissue sections were placed in 10 mM citrate buffer, pH 6.0, and heated to 108°C in an autoclave for 15 minutes for antigen retrieval. Sections were incubated with a 1:10 dilution or a 1:100 dilution of primary antibody for CDH3, respectively, in a humidity chamber for an hour at room temperature, and developed with peroxidase labeled-dextran polymer followed by diaminobenzidine (DAKO Envision Plus System; DAKO Corporation, Carpinteria, CA). Sections were counterstainedwith hematoxylin. For negative controls, primary antibody was omitted.
  • Northern blot analysis 32 Human multiple-tissue Northern blots (Clontech) were hybridized with a [ ⁇ P] dCTP-labeled PCR product amplified by the primers described above. Pre-hybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were auto-radiographed with intensifying screens at -80°C for 5 days.
  • the genomic fragment ofthe snRNA U6 gene containing the promoter region was amplified by PCR using a set of primers, 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No: 27), and 5'-TAGGCCCCACCTCCTTCTAT-3' (SEQ ID No: 28) and human placental DNA as a template.
  • the product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen).
  • the BamRl, Xhol fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' (SEQ ID No: 29) and 5'- CTCTATCTCGAGTGAGGCGGAAAGAACCA-3' (SEQ ID No: 30).
  • the ligated DNA was used for a template of PCR with primers,
  • psiU6BX-EGFP was prepared by cloning double-stranded oligonucleotides of 5'-CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCT
  • GCTTC-3' (SEQ IDNo: 33) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCT
  • siRNA-expressing constructs The nucleotide sequences ofthe siRNAs were designed using an siRNA design computer program available from the Ambion website. (http://www.ambion.com/techlib/misc/siRNA_finder.html). Briefly, nucleotide sequences for siRNA synthesis are selected using the following protocol.
  • siRNA Target Sites 1. Starting with the AUG start codon ofthe each gene transcript, scan downstream for an AA dinucleotide sequences. The occurrence of each AA and the 3' adjacent 19 nucleotides are recorded as potential siRNA target sites. Tuschl et al. don't recommend against designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75bases) as these may be richer in regulatory protein binding sites.
  • UTRs untranslated regions
  • start codon within 75bases
  • UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex. 2.
  • the potential target sites are compared to the appropriate genome database
  • target sequences with significant homology to other coding sequences. 3. Qualifying target sequences are selected for synthesis. Several target sequences along the length ofthe gene are selected for evaluation.
  • oligonucleotides used for siRNAs of PCDHl, CDH3 or GPRl 07 are shown below.
  • Each oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence ofthe target sequence.
  • the nucleotide sequences ofthe hairpin loop structure and target sequence are shown in SEQ ID NO:19 to SEQ ID NO:21 and SEQ ID NO:22 to SEQ ID NO:24, respectively (endonuclease recognition cites are eliminated from each hairpin loop structure sequence).
  • Example 2 Reduction ofthe expression ofthe genes PCDHl, CDH3 or GPRl 07 and growth suppression of cancer cells by siRNA
  • PDACa cells comparing with the expression pattern of normal pancreatic ductal epithelium that was thought to be the origin of PDACa (Nakamura T, Furukawa Y, Nakagawa H, Tsunoda T, Ohigashi H, Murata K, Ishikawa O, Ohgaki, Kashimura N, Miyamoto M, Hirano S, Kondo S, Katoh H, Nakamura Y, and Katagiri T. Genome-wide cDNA microarray analysis of gene-expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelium cells selected for purity by laser microdissection. Oncogene, 2004 Feb 9, Epub ahead of print).
  • the present inventors selected three over-expressing genes, and PCDHl and CDH3 were validated their overexpression in PDACa by RT-PCR using the cDNA from microdissected PDACa cells ( Figure 1 A, B) or immunohistochemistry ( Figure 2).
  • PCDHl Protocadherin 1 (Genbank Accession No.NM_002587; SEQ ID No.l, 2)
  • RNAi mammalian vector-based RNA interference
  • PCDHl is expressed inrestrictedly in normal heart, placenta, prostate as shown in Northern blot analysis ( Figure 3A). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
  • PCDHl and other protocadherins are supported to have homophilic interaction on the cell surface by means of their cadherin domains and modulate intercellular signal transduction for cytoskeleton conformation, cell motility or cell growth (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system. EMBO J. , 12:2249-56, 1993, Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol, 14:557-62, 2002.). According to our data, PCDHl is likely to modulate positive signal for pancreatic cancer cell growth through its homophilic interaction in cell-cell adhesion.
  • CDH3 P-cadherin (Genbank Accession No.NM_001793; SEQ ID No.3, 4)
  • the present inventors validated CDH3 over-expression in PDACa cells by RT-PCR
  • CDH3 over-expression was one ofthe most predominant patterns among more than 200 up-regulated genes in our PDACa profiles.
  • CDH3 is expressed inrestrictedly in normal thymus, prostate, ovary, trachea as shown in Northern blot analysis ( Figure 3B). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
  • RNAi mammalian vector-based RNA interference
  • GPRl 07 G protein-coupled receptor 107) (Genbank Accession No. AB046844; SEQ ID No.5, 6)
  • the present inventors identified this orphan GPCR as a target for pancreas cancer, which function and ligands are unknown.
  • GPRl 07 is expressed inrestrictedly in normal heart, placenta, skeletal muscle, testis, ovary, spinal cord as shown in Northern blot analysis ( Figure 3C).
  • Figure 3C Northern blot analysis
  • the present inventors knocked down their endogenous expression of GPRl 07 specifically by siRNA in PDACa cell line.
  • siRNA small interfering RNA
  • PDACa pancreatic ductal adenocarcinoma

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Plant Pathology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Veterinary Medicine (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention features a method for inhibiting growth of a cancer cell by contacting the cell with a composition of a siRNA that inhibits expression of PCDH1, CDH3 or GPR107. Methods of treating cancer are also within the invention. The invention also features products, including nucleic acid sequences and vectors as well as to compositions comprising them, useful in the provided methods. The invention also provides a method for inhibiting of tumor cell, for example pancreatic cancer cell, particularly pancreatic ductal adenocarcinoma (PDACa).

Description

DESCRIPTION
COMPOSITIONS AND METHODS FOR TREATING PANCREATIC CANCER This application claims the benefit of U.S. Provisional Application Serial No.60/
555,809 filed March 24, 2004, the contents of which are hereby incorporated by reference in its entirety.
Technical Field The present invention relates to the field of biological science, more specifically to the field of cancer research. In particular, the present invention relates a composition comprising a nucleic acid capable of inhibiting expression ofthe genes encoding PCDHl, CDH3 or GPR107. In some embodiments, the compound is a small interfering RNA (siRNA) corresponding to a subsequence from these genes.
Background Art Pancreatic ductal adenocarcinoma (PDACa) is the fifth leading cause of cancer death in the western world and has one ofthe highest mortality rates of any malignancy, with a 5-year survival rate only 4%. In USA, each year, estimated 30,700 patients are diagnosed with pancreatic cancer and nearly 30,000 will die of these diseases. The vast majority of patients are diagnosed at an advanced stage of disease at which it has no response to current therapies and the patients can survive for few months. Only surgical resection can offer the possibility of cure, but only 10-20% of patients with PDACa can undergo potentially curative resection and even after curative surgery, 80-90% ofthe patients relapse and die ofthe disease. Some improvements in surgical outcome or quality of life occur in patients who also receive chemotherapy including gemcitabine and/or radiation, although the impact on long-term survival has been minimal due to the intense resistance of PDACa to any treatment. At this point, management of most patients focuses on palliation. Therefore, establishment of a novel molecular therapy for PDACa and identification of novel therapeutic molecular targets for PDACa are urgent issues for pancreatic cancer treatment now. Disclosure ofthe Invention The present invention based on the surprising discovery that inhibiting expression of PCDHl, CDH3 or GPRl 07 is effective in inhibiting the cellular growth of various cancer cells, including those involved in PDACa. The inventions described in this application are based in part on this discovery. The invention provides methods for inhibiting cell growth. Among the methods provided are those comprising contacting a cell with a composition comprising a small interfering RNA (siRNA) that inhibits expression of PCDHl , CDH3 or GPRl 07. The invention also provides methods for inhibiting tumor cell growth in a subject. Such methods include administering to a subject a composition comprising a small interfering RNA (siRNA) that hybridizes specifically to a sequence from PCDHl, CDH3 or GPRl 07. Another aspect ofthe invention provides methods for inhibiting the expression ofthe PCDHl, CDH3 or GPRl 07 gene in a cell of a biological sample. Expression ofthe gene may be inhibited by introduction of a double stranded ribonucleic acid (RNA) molecule into the cell in an amount sufficient to inhibit expression ofthe PCDHl, CDH3 or GPR107 gene. Another aspect ofthe invention relates to products including nucleic acid sequences and vectors as well as to compositions comprising them, useful, for example, in the provided methods. Among the products provided are siRNA molecules having the property to inhibit expression ofthe PCDHl, CDH3 or GPRl 07 gene when introduced into a cell expressing said gene. Among such molecules are those that comprise a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a PCDHl, CDH3 or GPRl 07 target sequence, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand. The sense and the antisense strands ofthe molecule hybridize to each other to form a double-stranded molecule. As used herein, the term "organism" refers to any living entity comprised of at least one cell. A living organism can be as simple as, for example, a single eukaryotic cell or as complex as a mammal, including a human being. As used herein, the term "biological sample" refers to a whole organism or a subset of its tissues, cells or component parts (e.g. bodily fluids, including but not limited to blood, mucus, lymphatic fluid, synovial fluid, cerebrospinal fluid, saliva, arnniotic fluid, amniotic cord blood, urine, vaginal fluid and semen). "Biological sample" further refers to a homogenate, lysate, extract, cell culture or tissue culture prepared from a whole organism or a subset of its cells, tissues or component parts, or a fraction or portion thereof. Lastly, "biological sample" refers to a medium, such as a nutrient broth or gel in which an organism has been propagated, which contains cellular components, such as proteins or nucleic acid molecules. The invention features methods of inhibiting cell growth. Cell growth is inhibited by contacting a cell with a composition of a small interfering RNA (siRNA) of PCDHl, CDH3 or GPRl 07. The cell is further contacted with a transfection-enhancing agent. The cell is provided in vitro, in vivo or ex vivo. The subject is a mammal, e.g., a human, non- human primate, mouse, rat, dog, cat, horse, or cow. The cell is a pancreatic ductal cell. Alternatively, the cell is a tumor cell ( t'.e., cancer cell) such as a carcinoma cell or an adenocarcinoma cell. For example, the cell is a pancreatic ductal adenocarcinoma cell. By inhibiting cell growth is meant that the treated cell proliferates at a lower rate or has decreased viability than an untreated cell. Cell growth is measured by proliferation assays known in the art. By the term "siRNA" is meant a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques of introducing siRNA into the cell are used, including those in which DNA is a template from which RNA is transcribed. The siRNA includes a sense PCDHl, CDH3 or GPRl 07 nucleic acid sequence, an anti-sense PCDHl, CDH3 or GPRl 07 nucleic acid sequence or both. The siRNA may comprise two complementary molecules or may be constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hairpin, which, in some embodiments, leads to production of micro RNA (miRNA). The method is used to alter gene expression in a cell in which expression of PCDHl, CDH3 or GPRl 07 is up-regulated, e.g., as a result of malignant transformation of the cells. Binding ofthe siRNA to an PCDHl, CDH3 or GPRl 07 transcript in the target cell results in a reduction in PCDHl, CDH3 or GPRl 07 production by the cell. The length ofthe oligonucleotide is at least about 10 nucleotides and may be as long as the naturally- occurring PCDHl, CDH3 or GPRl 07 transcript. Preferably, the oligonucleotide is about 19 to about 25 nucleotides in length. Most preferably, the oligonucleotide is less than about 75, about 50, or about 25 nucleotides in length. Examples of siRNA oligonucleotides of PCDHl, CDH3 or GPRl 07 which inhibit PCDHl, CDH3 or GPRl 07 expression in mammalian cells include oligonucleotides containing target sequences, for example, nucleotides of SEQ ID NOs: 22, 23 or 24, respectively. Methods for designing double stranded RNA having the ability to inhibit gene expression in a target cell are known. (See for example, US Patent No. 6,506,559, herein incorporated by reference in its entirety). For example, a computer program for designing siRNAs is available from the Ambion website
(http://www.ambion.com/tecMib/misc/siRNA_fmder.html). The computer program available from Ambion, Inc. selects nucleotide sequences for siRNA synthesis based on the following protocol. Selection of siRNA Target Sites 1. Beginning with the AUG start codon ofthe transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl et al.,Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev 13(24): 3191-7 (1999), don't recommend designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75bases) as these may be richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with binding ofthe siRNA endonuclease complex.
2. Compare the potential target sites to the appropriate genome database (human, mouse, rat, etc.) and eliminate from consideration any target sequences with significant homology to other coding sequences. It is suggested to use BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/ 3. Select qualifying target sequences for synthesis. Selecting several target sequences along the length ofthe gene to evaluate is typical.
Also included in the invention are isolated nucleic acid molecules that include the nucleic acid sequence of target sequences, for example, nucleotides of SEQ ID NOs: 22, 23 and 24 or a nucleic acid molecule that is complementary to the nucleic acid sequence of nucleotides of SEQ ID NOs: 22, 23 and 24. As used herein, an "isolated nucleic acid" is a nucleic acid removed from its original environment (e.g., the natural environment if naturally occurring) and thus, synthetically altered from its natural state. In the present invention, isolated nucleic acid includes DNA, RNA, and derivatives thereof. hen the isolated nucleic acid is RNA or derivatives thereof, base "t" should be replaced with "u" in the nucleotide sequences. As used herein, the term "complementary" refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule, and the term "binding" means the physical or chemical interaction between two nucleic acids or compounds or associated nucleic acids or compounds or combinations thereof. Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches. For the purposes of this invention, two sequences having 5 or fewer mismatches are considered to be complementary.
Furthermore, the sense strand and antisense strand ofthe isolated nucleotide ofthe present invention, can form double stranded nucleotide or hairpin loop structure by the hybridization. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 matches. In an especially preferred embodiment, where the strands ofthe duplex are fully complementary, such duplexes contain no mismatches. The nucleic acid molecule is less than 3851, 3205, or 6840 nucleotides in length for PCDHl, CDH3 or GPRl 07, respectively. For example, the nucleic acid molecule is less than about 500, about 200, or about 75 nucleotides in length. Also included in the invention is a vector containing one or more ofthe nucleic acids described herein, and a cell containing the vectors. The isolated nucleic acids ofthe present invention are useful for siRNA against PCDHl, CDH3 or GPR107, or DNA encoding the siRNA, When the nucleic acids are used for siRNA or coding DNA thereof, the sense strand is preferably longer than about 19 nucleotides, and more preferably longer than 21 nucleotides. The invention is based in part on the discovery that the gene encoding PCDHl, CDH3 or GPRl 07 is over-expressed in pancreatic ductal adenocarcinoma (PDACa) compared to non-cancerous pancreatic tissue. The cDNA of PCDHl, CDH3 or GPRl 07 is 3851, 3205 or 6840 nucleotides in length. The nucleic acid and polypeptide sequences of PCDHl, CDH3 or GPR107 are shown in SEQ ID NO: 1 and 2, 3 and 4 or 5 and 6, respectively. The sequence data are also available via following accession numbers. PCDHl(CFUPC): LI 1370, NM_002587 CDH3: X63629, NM_001793 GPRl 07: NM_032925, NM_020960, (KIAA1624: R39794) AB046844 Transfection of siRNAs comprising SEQ ID NOs: 22, 23 and 24 resulted in a growth inhibition of PDACa cell lines. PCDHl (CFUPC) belongs to the protocadherin family, the largest subgroup of cadherin superfamily of calcium-dependent cell-cell adhesion molecules. Many ofthe protocadherin are highly expressed in the central nervous system and they are likely to play roles in neuronal circuit development and the modulation of synaptic transmission (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin- related molecules in central nervous system. EMBOJ., 12:2249-56, 1993.Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol, 14:557-62, 2002). However, PCDHl is abundant in pancreatic cancer cells, but not in central nervous system (Figure 3 A), and its function remains unknown. CDH3 is also a classical member ofthe cadherin family (Shimoyama Y, Yoshida T, Terada M, Shimosato Y, Abe O, Hirohashi S. Molecular cloning of a human Ca2+- dependent cell-cell adhesion molecule homologous to mouse placental cadherin: its low expression in human placental tissues. JCell Biol, 109:1787-94. 1989) and they link to catenins and cytoskeletons through its conserved intracellular domain, mediating signal- transduction that control cell polarity, differentiation, motility and cell growth (Christofori G. Changing neighbors, changing behavior: cell adhesion molecules-mediated signaling during tumor progression. EMBO J., 22, 2318-2323, 2003). However, different form E- cadherin or N-cadherin, the function of CDH3 still remains unclear. Its expression is observed in mammary glands and ovary, and loss of expression was reported in breast cancer and prostate cancer, although the expression of P-cadherin in breast cancer correlates with poor prognosis (Peralta Soler A, Knudsen KA, Salazar H, Han AC, Keshgegian AA. P-cadherin expression in breast carcinoma indicates poor survival. Cancer, 86:1263-1272. 1999). GPRl 07 (KIAA1624) is one ofthe G protein-coupled receptors (GPCR) with seven transmembranes. A large percentage of today's prescription drugs target one or more GPCRs with most major therapeutic area being served to some extent by several GPCR- based drugs. Clearly, GPCRs are in the highest rank in the terms of drug discovery potential. GPRl 07 is expressed without restriction in normal heart, placenta, skeletal muscle, prostate, testis, ovary, spinal cord as shown in Northern blot analysis (Figure 3C). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body.
Methods of inhibiting cell growth The present invention relates to inhibiting cell growth, i.e, cancer cell growth by inhibiting expression of PCDHl, CDH3 or GPRl 07. Expression of PCDHl, CDH3 or
GPRl 07 is inhibited, for example, by small interfering RNA (siRNA) that specifically target the PCDHl, CDH3 or GPRl 07 gene. PCDHl, CDH3 or GPRl 07 targets include, - for example, nucleotides of SEQ ID NOs: 22, 23 and 24. In non-mammalian cells, double-stranded RNA (dsRNA) has been shown to exert a strong and specific silencing effect on gene expression, which is referred as RNA interference (RNAi) (Sharp PA. RNAi and double-strand RNA. Genes Dev. 1999 Jan 15;13(2):139-41.). dsRNA is processed into 20-23 nucleotides dsRNA called small interfering RNA (siRNA) by an enzyme containing RNase III motif. The siRNA specifically targets complementary mRNA with a multicomponent nuclease complex (Hammond SM, Bernstein E, Beach D, Hannon GJ. An RNA-directed nuclease mediates post-transcriptional gene silencing in Drosophila cells. Nature. 2000 Mar 16;404(6775):293- 6; Hannon GJ. RNA interference. Nature. 2002 Jul 11;418(6894):244- 51.). In mammalian cells, siRNA composed of 20 or 21-mer dsRNA with 19 complementary nucleotides and 3' terminal noncomplementary dimmers of thymidine or uridine, have been shown to have a gene specific knock-down effect without inducing global changes in gene expression (Elbashir SM, Harborth J, Lendeckel W, Yalcin A, Weber K, Tuschl T. Duplexes of 21 -nucleotide RNAs mediate RNA interference in cultured mammalian cells. Nature. 2001 May 24;411(6836):494-8.). In addition, plasmids containing small nuclear RNA (snRNA) U6 or polymerase III HI -RNA promoter effectively produce such short RNA recruiting type III class of RNA polymerase III and thus can constitutively suppress its target mRNA Miyagishi M, Taira K. U6 promoter- driven siRNAs with four uridine 3' overhangs efficiently suppress targeted gene expression in mammalian cells.Nat Biotechnol. 2002 May;20(5):497-500. ; Brummelkamp TR, Bernards R, Agami R. A System for Stable Expression of Short Interfering RNAs in Mammalian Cells Science. 296(5567):550-553, April 19, 2002.). The growth of cells are inhibited by contacting a cell, with a composition containing a siRNA of PCDHl, CDH3 or GPRl 07. The cell is further contacted with a transfection agent. Suitable transfection agents are known in the art. By inhibition of cell growth is meant the cell proliferates at a lower rate or has decreased viability compared to a cell not exposed to the composition. Cell growth is measured by methods known in the art such as, the MTT cell proliferation assay. The siRNA of PCDHl, CDH3 or GPRl 07 is directed to a single target of PCDHl, CDH3 or GPRl 07 gene sequence. Alternatively, the siRNA is directed to multiple target of PCDHl, CDH3 or GPRl 07 gene sequences. For example, the composition contains siRNA of PCDHl, CDH3 or GPRl 07 directed to two, three, four, or five or more target sequences of PCDHl, CDH3 or GPRl 07. By PCDHl, CDH3 or GPRl 07 target sequence is meant a nucleotide sequence that is identical to a portion ofthe PCDHl, CDH3 or GPRl 07 gene. The target sequence can include the 5' untranslated (UT) region, the open reading frame (ORF) or the 3' untranslated region ofthe human PCDHl, CDH3 or GPRl 07 gene. Alternatively, the siRNA is a nucleic acid sequence complementary to an upstream or downstream modulator of PCDHl, CDH3 or GPRl 07 gene expression. Examples of upstream and downstream modulators include, a transcription factor that binds the PCDHl, CDH3 or GPRl 07 gene promoter, a kinase or phosphatase that interacts with the PCDHl, CDH3 or GPRl 07 polypeptide, a PCDHl, CDH3 or GPRl 07 promoter or enhancer. siRNA of PCDHl , CDH3 or GPRl 07 which hybridize to target mRNA decrease or inhibit production ofthe PCDHl, CDH3 or GPRl 07 polypeptide product encoded by the PCDHl, CDH3 or GPRl 07 gene by associating with the normally single- stranded mRNA transcript, thereby interfering with translation and thus, expression ofthe protein. Thus, siRNA molecules ofthe invention can be defined by their ability to hybridize specifically to mRNA or cDNA from a PCDHl , CDH3 or GPRl 07 gene under stringent conditions. For the purposes of this invention the terms "hybridize" or "hybridize specifically" are used to refer the ability of two nucleic acid molecules to hybridize under "stringent hybridization conditions." The phrase "stringent hybridization conditions" refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology— Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength pH. The Tm is the temperature (under defined ionic strength, pH, and nucleic concentration) at which 50% ofthe probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% ofthe probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably 10 times background hybridization. Exemplary stringent hybridization conditions can be as following: 50% formamide, 5x SSC, and 1% SDS, incubating at 42°C, or, 5x SSC, 1% SDS, incubating at 65°C, with wash in 0.2x SSC, and 0.1% SDS at 50°C. The siRNA ofthe invention is less than about 500, about 200, about 100, about 50, or about 25 nucleotides in length. Preferably the siRNA is about 19 to about 25 nucleotides in length. Exemplary nucleic acid sequence for the production of PCDHl, CDH3 or GPR107 siRNA include the sequences of nucleotides of SEQ ID NOs: 22, 23 or 24 as the target sequence, respectively. Furthermore, in order to enhance the inhibition activity ofthe siRNA, nucleotide "u" can be added to 3 'end ofthe antisense strand ofthe target sequence. The number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. The added "u"s form single strand at the 3'end of the antisense strand ofthe siRNA. ' The cell is any cell that expresses or over-expresses PCDHl, CDH3 or GPRl 07. The cell is an epithelial cell such as a pancreatic ductal cell. Alternatively, the cell is a tumor cell such as a carcinoma, adenocarcinoma, blastoma, leukemia, myeloma, or sarcoma. The cell is a pancreatic ductal adenocarcinoma. An siRNA of PCDHl, CDH3 or GPRl 07 is directly introduced into the cells in a form, that is capable of binding to the mRNA transcripts. Alternatively, the DNA encoding the siRNA of PCDHl, CDH3 or GPRl 07 is in a vector. Vectors are produced for example by cloning a PCDHl, CDH3 or GPRl 07 target sequence into an expression vector operatively-linked regulatory sequences flanking the PCDH1, CDH3 or GPRl 07 sequence in a manner that allows for expression (by transcription ofthe DNA molecule) of both strands (Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505.). An RNA molecule that is antisense to PCDHl, CDH3 or GPR107 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3 ' of the cloned DNA) and an RNA molecule that is the sense strand for the PCDHl, CDH3 or GPRl 07 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' ofthe cloned DNA). The sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing of the PCDHl, CDH3 or GPRl 07 gene. Alternatively, two constructs are utilized to create the sense and anti-sense strands of a siRNA construct. Cloned PCDHl, CDH3 or GPRl 07 can encode a construct having secondary structure, e.g., hairpins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene. A loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hairpin loop structure. Thus, the present invention also provides siRNA having the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA from PCDHl, CDH3 or GPRl 07. In preferred embodiments, [A] is a ribonucleotide sequence corresponding to a sequence selected from the group consisting of nucleotides of SEQ ID NOs: 22, 23 and 24, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A] The region [A] hybridizes to [A'j, and then a loop consisting of region [B] is formed. The loop sequence may be preferably about 3 to about 23 nucleotide in length. The loop sequence, for example, can be selected from group consisting of following sequences (http://www.ambion.com/techlib/tb/tb_506.html). Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV-1 replication by RNA interference. Nature 418 : 435-438.). CCC, CCACC or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M (2002)
Modulation of HIV-1 replication by RNA interference. Nature, Vol. 418: 435-438. UUCG: Lee, N.S., Dohjima, T., Bauer, G., Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIN-1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505. Fruscoloni, P., Zamboni, M., and Tocchini-Valentini, G. P. (2003) Exonucleolytic degradation of double-stranded RNA by an activity in Xenopus laevis germinal vesicles. Proc. Natl. Acad. Sci. USA 100(4): 1639-1644. UUCAAGAGA: Dykxhoorn, D. M., Novina, C. D., and Sharp, P. A. (2002) Killing the messenger: Short RNAs that silence gene expression. Nature Reviews Molecular Cell Biology 4: 457-467. For example, preferable siRNAs having hairpin loop structure ofthe present invention are shown below. In the following structure, the loop sequence can be selected from group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. Preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA (SEQ ID NO:35)). GACAUCAAUGACAACACAC-[B]-GUGUGUUGUCAUUGAUGUC (for target sequence of SEQ ID NO:22) GGAGACAGGCUGGUUGUUG-[B]-CAACAACCAGCCUGUCUCC (for target sequence of SEQ ID NO:23) GUGGCUCUACCAGCUCCUG-[B]-CAGGAGCUGGUAGAGCCAC (for target sequence of SEQ ID NO:24) The regulatory sequences flanking the PCDHl, CDH3 or GPRl 07 sequence are identical or are different, such that their expression can be modulated independently, or in a temporal or spatial manner. siRNAs are transcribed intracellularly by cloning the PCDHl, CDH3 or GPRl 07 gene templates into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter. For introducing the vector into the cell, transfection-enhancing agent can be used. FuGENE (Roche Diagnostices), Lipofectamine 2000 (Invitrogen),
Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical) are useful as the transfection-enhancing agent. Oligonucleotides and oligonucleotides complementary to various portions of PCDHl, CDH3 or GPRl 07 mRNA were tested in vitro for their ability to decrease production of PCDHl, CDH3 or GPR107 in tumor cells (e.g., using the pancreatic cell line such as pancreatic ductal adenocarcinoma(PDACa) cell line) according to standard methods. A reduction in PCDHl, CDH3 or GPRl 07 gene product in cells contacted with the candidate siRNA composition compared to cells cultured in the absence ofthe candidate composition is detected using specific antibodies of PCDHl, CDH3 or GPRl 07 or other detection strategies. Sequences which decrease production of PCDHl, CDH3 or GPRl 07 in in vitro cell-based or cell-free assays are then tested for there inhibitory effects on cell growth. Sequences which inhibit cell growth in vifro cell-based assay are test in vivo in rats or mice to confirm decreased PCDHl, CDH3 or GPRl 07 production and decreased tumor cell growth in animals with malignant neoplasms.
Methods of treating malignant tumors Patients with tumors characterized as over-expressing PCDHl, CDH3 or GPRl 07 are treated by administering siRNA of PCDHl, CDH3 or GPRl 07. siRNA therapy is used to inhibit expression of PCDHl, CDH3 or GPRl 07 in patients suffering from or at risk of developing, for example, pancreatic ductal adenocarcinoma (PDACa). Such patients are identified by standard methods ofthe particular tumor type. Pancreatic ductal adenocarcinoma (PDACa) is diagnosed for example, by CT, MRI, ERCP, MRCP, computer tomography, or ultrasound. Treatment is efficacious if the treatment leads to clinical benefit such as, a reduction in expression of PCDHl, CDH3 or GPRl 07, or a decrease in size, prevalence, or metastatic potential ofthe tumor in the subject. When treatment is applied prophylactically, "efficacious" means that the treatment retards or prevents tumors from forming or prevents or alleviates a symptom of clinical symptom of the tumor. Efficaciousness is determined in association with any known method for diagnosing or treating the particular tumor type. siRNA therapy is carried out by administering to a patient a siRNA by standard vectors encoding the siRNAs ofthe invention and/or gene delivery systems such as by delivering the synthetic siRNA molecules. Typically, synthetic siRNA molecules are chemically stabilized to prevent nuclease degradation in vivo. Methods for preparing chemically stabilized RNA molecules are well known in the art. Typically, such molecules comprise modified backbones and nucleotides to prevent the action of ribonucleases. Other modifications are also possible, for example, cholesterol-conjugated siRNAs have shown improved pharmacological properties. (Song et al. Nature Med. 9:347-351 (2003)). Suitable gene delivery systems may include liposomes, receptor-mediated delivery systems, or viral vectors such as herpes viruses, retroviruses, adenoviruses and adeno-associated viruses, among others. A therapeutic nucleic acid composition is formulated in a pharmaceutically acceptable carrier. The therapeutic composition may also include a gene delivery system as described above. Pharmaceutically acceptable carriers are biologically compatible vehicles which are suitable for administration to an animal, e.g., physiological saline. A therapeutically effective amount of a compound is an amount which is capable of producing a medically desirable result such as reduced production of a PCDHl, CDH3 or GPRl 07 gene product, reduction of cell growth, e.g., proliferation, or a reduction in tumor growth in a treated animal. Parenteral administration, such as intravenous, subcutaneous, intramuscular, and intraperitoneal delivery routes, may be used to deliver siRNA compositions of PCDHl, CDH3 or GPRl 07. For treatment of pancreatic tumors, direct infusion the celiac artery, splenic artery, or common hepatic artery, is useful. Dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular nucleic acid to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. Dosage for intravenous administration of nucleic acids is from approximately 106 to 1022 copies ofthe nucleic acid molecule. The polynucleotides are administered by standard methods, such as by injection into the interstitial space of tissues such as muscles or skin, introduction into the circulation or into body cavities or by inhalation or insufflation. Polynucleotides are injected or otherwise delivered to the animal with a pharmaceutically acceptable liquid carrier, e.g., a liquid carrier, which is'aqueous or partly aqueous. The polynucleotides are associated with a liposome (e.g., a cationic or anionic liposome). The polynucleotide includes genetic information necessary for expression by a target cell, such as a promoters. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing ofthe present invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Brief Description ofthe Drawings Figure 1 depicts photographs showing the results of validation of over expression of PCDHl (A) and CDH3 (B) in the PDACa cells by RT-PCR. The microdissected normal pancreatic ductal epithelial cells (Normal) and vital organs (lung, heart, liver, kidney and bone marrow) form the same individual were compared by semiquantitative RT-PCR. Figure 2 depicts photographs showing the result of immunohistochemistry in PDACa tissues. Over-expression of CDH3 protein was observed in pancreatic ductal adenocarcinoma, but not in normal pancreatic duct.
Figure 3 depicts photographs of Northern blot analysis showing the expression pattern in normal adult tissues of each target genes for pancreatic cancer. (A) PCDHl, (B) CDH3 and (C) GPR107.
Figure 4 depicts photographs showing the effect of Knocking-down endogenous PCDHl in PDACa cell, PK-45P, by siRNA. Figure 4 (A) shows the results of RT-PCR. It validated knockdown effect of PCDHl mRNA by transfection of siRNA expression vector 410si, but not by EGFPsi. The 410si was designed specifically for PCDHl mRNA sequence, and EGFP was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA. Figure 4 (B) is a photograph showing the results of Colony formation assay. It showed drastic decrease of colony numbers in the cells one week after transfection with 410si that was validated to knock down PCDHl effectively by RT-PCR. Figure 4 (C) is a bar chart showing the results MTT assay. It also showed drastic decreased number ofthe grown cells transfected with 410si but not by EGFPsi.
Figure 5 depicts photographs showing the effect of Knocking-down endogenous CDH3 in PDACa cell, KLM-1, by siRNA. Figure 5 (A) shows the results of RT-PCR. It validated knockdown effect of CDH3 mRNA by transfection of siRNA expression vectors si24 but not by EGFPsi. The si24 was designed specifically for CDH3 mRNA sequence, and EGFPsi was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA. Figure 5 (B) is a photograph showing the results of Colony formation assay. It showed drastic decrease of colony numbers in the cells one week after transfection with si24 that was validated to knock down CDH3 effectively by RT-PCR. Figure 5 (C) is a bar chart showing the results MTT assay. It also showed drastic decreased number ofthe grown cells transfected with si24, but not by EGFPsi.
Figure 6 depicts photographs showing the effect of Knocking-down endogenous GPRl 07 in PDACa cell, KLM-1, by siRNA. Figure 6 (A) shows the results of RT-PCR. It validated knockdown effect of GPRl 07 mRNA by transfection of siRNA expression vectors 1003 si, but not by and EGFPsi. The 1003 si was designed specifically for GPRl 07 mRNA sequence, and EGFPsi was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA. Figure 6 (B) is a photograph showing the results of Colony formation assay. It showed decrease of colony numbers in the cells one week after transfection with 1003 si that was validated to knock down GPRl 07 effectively by RT-PCR. Figure 6 (C) is a bar chart showing the results MTT assay. It also showed decreased number ofthe grown cells transfected with 1003si, but not by EGFPsi.
Best Mode for Carrying out the Invention The invention will be further described in the following examples, which do not limit the scope ofthe invention described in the claims. [Example 1] General Methods Cell lines and tissue specimens Human Pancreatic cell lines PK45P, KLM1 and MIA-PaCa2 (ATCC Number: CRL-1420) were obtained from the Cell Resource Center for Biomedical Research, Institute of Development, Aging and Cancer, Tohoku University. All these cells are publicly available. Isolation of over-expressing genes in PDACa cells by using cDNA microarray Fabrication ofthe cDNA microarray slides has been described (Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, and Nakamura Y. Cancer Res., 60: 5007-5011, 2000). For each analysis of expression profiles it was prepared duplicate sets of cDNA microarray slides containing approximately 23,040 DNA spots, to reduce experimental fluctuation. Briefly, total RNA was purified from PDACa cells and normal pancreatic duct epithelium microdissected from 18 pancreatic cancer tissues. T7-based RNA amplification was carried out to obtain adequate RNA for microarray experiments. Aliquots of amplified RNA from PDACa cells and normal duct epithelium were labeled by reverse transcription with Cy5-dCTP and Cy3-dCTP, respectively (Amersham Biosciences). Hybridization, washing, and detection were carried out as described previously (Ono K, Tanaka T, Tsunoda T, Kitahara O, Kihara C, Okamoto A, Ochiai K, Takagi T, and Nakamura Y. Cancer Res., 60: 5007-5011, 2000). Subsequently, among the up-regulated genes, it was focused three genes, PCDHl, CDH3 and GPR107 because its expression ratio was greater than 5.0 in more than 50% of informative cancers and their expression level in normal vital major organs was relatively low according to the our previous data of gene expression in 29 normal human tissues (Saito-Hisaminato A, Katagiri T, Kakiuchi S, Nakamura T, Tsunoda T, Nakamura Y. Genome- wide profiling of gene expression in 29 normal human tissues with a cDNA microarray. DNA Res., 9: 35-45, 2002).
Semiquantitative RT-PCR for PCDHl and CDH3 RNA from the microdissected PDACa cells and normal pancreatic ductal epithelial cells were subject to two-round amplification by T7-based in vitro transcription (Epicentre Technologies) and synthesized to single-strand cDNA. It was prepared appropriate dilutions of each single-stranded cDNA for subsequent PCR amplification by monitoring β-actin (ACTB) as a quantitative control. The primer sequences the present inventors used were 5 '-AGAAGGAGACCAAGGACCTGTAT-3 ' (SEQ.ID.NO.7) and 5'-AGAACTTTATTGTCAGGGTCAAGG-3' (SEQ.ID.NO.8) for PCDHl, 5'-CTGAAGGCGGCTAACACAGAC-3' (SEQ.ID.NO.9) and 5'-TACACGATTGTCCTCACCCTTC-3' (SEQ.ID.NO.10) for CDH3, and ' 5'-CATCCACGAAACTACCTTCAACT-3' (SEQ.ID.NO.il) and 5'-TCTCCTTAGAGAGAAGTGGGGTG-3 ' (SEQ.ID.NO.12) for ACTB. All reactions involved initial denaturation at 94°C for 2 min followed by 21 cycles (for ACTB) or 28-32 cycles (for PCDHl and CDH3) at 94°C for 30 s, 58°C for 30 s, and 72°C for 1 min, on a GeneAmp PCR system 9700 (PE Applied Biosystems).
Immunohistochemistry Formalin-fixed and paraffin-embedded PDACa sections were immunostained using a mouse anti-CDH3 monoclonal antibody (BD Transduction Laboratories) for CDH3 expression. Deparaffinized tissue sections were placed in 10 mM citrate buffer, pH 6.0, and heated to 108°C in an autoclave for 15 minutes for antigen retrieval. Sections were incubated with a 1:10 dilution or a 1:100 dilution of primary antibody for CDH3, respectively, in a humidity chamber for an hour at room temperature, and developed with peroxidase labeled-dextran polymer followed by diaminobenzidine (DAKO Envision Plus System; DAKO Corporation, Carpinteria, CA). Sections were counterstainedwith hematoxylin. For negative controls, primary antibody was omitted.
Northern blot analysis -32 Human multiple-tissue Northern blots (Clontech) were hybridized with a [α P] dCTP-labeled PCR product amplified by the primers described above. Pre-hybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were auto-radiographed with intensifying screens at -80°C for 5 days.
Construction of psiU6BX Plasmid The DNA flagment encoding siRNA was inserted into the GAP at nucleotide 485-
490 as indicated (-) in the following plasmid sequence (SEQ ID No: 26). GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCΑGTACAATCTGCTCTGGAT CCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTTGGGGATCΑGCGTTTGAGTAAGA GCCCGCGTCTGAACCCTCCGCGCCGCCCCGGCCCCAGTGGAAAGACGCGCAGGCAAAACG CACCACGTGACGGAGCGTGACCGCGCGCCGAGCGCGCGCCAAGGTCGGGCAGGAAGAGGG CCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAAT TAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTA ATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCT TACCGTAAC.TGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAA CACC TTTTTACATCAGGTTGTTTTTCTGTTTGGTTTTTTTTTTACACCACGTTT ATACGCCGGTGCACGGTTTACCACTGAAAACACCTTTCATCTACAGGTGATATCTTTTAA CACAAATAAAATGTAGTAGTCCTAGGAGACGGAATAGAAGGAGGTGGGGCCTAAAGCCGA ATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGTGAGGCGGAAAGAACCAGCTGGG GCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGG TTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCT TCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCC CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTG ATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGT CCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGG TCTATTCT?TTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGC TGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGG AAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGC AACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCT CAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCC CAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGA GGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGG CTTTTGCAAAAAGCTCCCGGGAGCTTGTATA?CCATTΑ?TCGGATCTGATCAAGAGACAGG ATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTG GGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGC CGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGG TGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGT TCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGG CGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCAT CATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCA CCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCA GGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAA GGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAA TATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGC GGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCIGAAGAGCTTGGCGGCGA ATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGC CTTCTATCGCCTTCTTGACGAGI'TCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGAC CAAGCGACGCCCAACCTGCCATCACGAGATTTCGA.:TCCACCGCCGCCTTCTATGAAAGG TTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTC ATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAA AGCAATAGCΆTCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGT TTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGC TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA CACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAA CTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAG CTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCC GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATG TGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTXTC CATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGA AACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG GCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTAT CGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAAC AGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAAC TACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTC GGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTT GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTT TCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATC TAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCT ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATA ACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCA CGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTG GTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCA TTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGG CAAAATGCCGCAAAAAAGGGAAiAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCA CCTGACGTC snRNA U6 gene is reported to be transcribed by RNA polymerase III, which produce short transcripts with uridines at the 3' end. The genomic fragment ofthe snRNA U6 gene containing the promoter region was amplified by PCR using a set of primers, 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No: 27), and 5'-TAGGCCCCACCTCCTTCTAT-3' (SEQ ID No: 28) and human placental DNA as a template. The product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen). The BamRl, Xhol fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' (SEQ ID No: 29) and 5'- CTCTATCTCGAGTGAGGCGGAAAGAACCA-3' (SEQ ID No: 30). The ligated DNA was used for a template of PCR with primers,
5'-TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTTTTCT-3' (SEQ ID No: 31) and
5'-TTTAAGCTTGAAGACACGGTGTTTCGTCCTTTCCACA-3' (SEQ ID No: 32). The product was digested with Hindlll, which was subsequently self-ligated to produce psiU6BX vector plasmid. For the control, psiU6BX-EGFP was prepared by cloning double-stranded oligonucleotides of 5'-CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCT
GCTTC-3' (SEQ IDNo: 33) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCT
GCTTC -3' (SEQ ID No: 34) into the Bbsl site in the psiU6BX vector. siRNA-expressing constructs The nucleotide sequences ofthe siRNAs were designed using an siRNA design computer program available from the Ambion website. (http://www.ambion.com/techlib/misc/siRNA_finder.html). Briefly, nucleotide sequences for siRNA synthesis are selected using the following protocol.
Selection of siRNA Target Sites: 1. Starting with the AUG start codon ofthe each gene transcript, scan downstream for an AA dinucleotide sequences. The occurrence of each AA and the 3' adjacent 19 nucleotides are recorded as potential siRNA target sites. Tuschl et al. don't recommend against designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75bases) as these may be richer in regulatory protein binding sites.
UTR-binding proteins and/or translation initiation complexes may interfere with binding of the siRNA endonuclease complex. 2. The potential target sites are compared to the appropriate genome database
(human, mouse, rat, etc.) to eliminate target sequences with significant homology to other coding sequences. 3. Qualifying target sequences are selected for synthesis. Several target sequences along the length ofthe gene are selected for evaluation.
The oligonucleotides used for siRNAs of PCDHl, CDH3 or GPRl 07 are shown below. Each oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence ofthe target sequence. The nucleotide sequences ofthe hairpin loop structure and target sequence are shown in SEQ ID NO:19 to SEQ ID NO:21 and SEQ ID NO:22 to SEQ ID NO:24, respectively (endonuclease recognition cites are eliminated from each hairpin loop structure sequence). Insert sequence of siRNA expression vectors for PCDHl 410si:
5'-CACCGACATCAATGACAACACACTTCAAGAGAGTGTGTTGTCATTGATGTC-
3' (SEQ ID NO: 13) and
5'-AAAAGACATCAATGACAACACACTCTCTTGAAGTGTGTTGTCATTGATGTC- 3' (SEQ ID NO:14)
Insert sequence of siRNA expression vectors for CDH3 si24: 5'-CACCGGAGACAGGCTGGTTGTTGTTCAAGAGACAACAACCAGCCTGTCTCC- 3' (SEQ ID NO: 15) and 5'-AAAAGGAGACAGGCTGGTTGTTGTCTCTTGAACAACAACCAGCCTGTCTCC- 3' (SEQ ID NO: 16)
Insert sequence of siRNA expression vectors for GPRl 07 1003 si: 5'-CACCGTGGCTCTACCAGCTCCTGTTCAAGAGACAGGAGCTGGTAGAGCCAC- 3' (SEQ ID NO: 17) and
5'-AAAAGTGGCTCTACCAGCTCCTGTCTCTTGAACAGGAGCTGGTAGAGCCAC- 3' (SEQ ID NO: 18)
Insert sequence of siRNA expression vectors for control EGFPsi: (control) 5'- CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTGCTTC -3' (SEQ ID NO: 33) and 5'-AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTGCTTC-
3' (SEQ ID NO: 34)
Sequence ID NO of each sequences are listed in Tablel
colony formation / MTT assay Human PDACa cell lines among PK45P, KLM1 and MIA-PaCa2, were plated onto 10-cm dishes (5 X 105 cells/dish) and transfected withpsiU6BX containing EGFP target sequence (EGFP) and psiU6BX containing target sequence using Lipofectamine 2000 (Invitrogen) or FuGENE6 (Roche), according to manufacture's instruction. Cells were selected by 500 mg/ml Geneticin for one week, and preliminary cells were harvested 48 hours after transfection and analyzed by RT-PCR to validate knockdown effect on PCDHl, CDH3 and GPRl 07. The primers of RT-PCR were the same ones described above. These cells were also stained by Giemsa solution and performed MTT assay to evaluate the colony formation and the cell number, respectively.
[Example 2] Reduction ofthe expression ofthe genes PCDHl, CDH3 or GPRl 07 and growth suppression of cancer cells by siRNA In previous study, it was generated precise expression profiles of PDACa by combining laser microdissection with genome-wide cDNA microarrays with 27,000 genes spotted. The present inventors identified more than 200 genes as up-regulated genes in
PDACa cells comparing with the expression pattern of normal pancreatic ductal epithelium that was thought to be the origin of PDACa (Nakamura T, Furukawa Y, Nakagawa H, Tsunoda T, Ohigashi H, Murata K, Ishikawa O, Ohgaki, Kashimura N, Miyamoto M, Hirano S, Kondo S, Katoh H, Nakamura Y, and Katagiri T. Genome-wide cDNA microarray analysis of gene-expression profiles in pancreatic cancers using populations of tumor cells and normal ductal epithelium cells selected for purity by laser microdissection. Oncogene, 2004 Feb 9, Epub ahead of print). Based on these expression profile of PDACa cells, the present inventors selected three over-expressing genes, and PCDHl and CDH3 were validated their overexpression in PDACa by RT-PCR using the cDNA from microdissected PDACa cells (Figure 1 A, B) or immunohistochemistry (Figure 2).
(1) PCDHl (Protocadherin 1) (Genbank Accession No.NM_002587; SEQ ID No.l, 2) To investigate the growth or survival effect of PCDHl on PDACa cells, the present inventors knocked down their endogenous expression of PCDHl specifically by mammalian vector-based RNA interference (RNAi) technique in PDACa cell line. PCDHl is expressed inrestrictedly in normal heart, placenta, prostate as shown in Northern blot analysis (Figure 3A). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body. The transfection of the siRNA-producing vectors clearly resulted in reduction of the endogenous expression in one designed siRNA, 410si, for PCDHl (Figure 4A). This knocking-down effect by the siRNA on PCDHl mRNA resulted in drastic growth suppression in colony formation assay (Figure 4B) and MTT assay (Figure 4C). These findings strongly suggested that over-expression of PCDHl in PDACa cells were associated with cancer cell viability. PCDHl and other protocadherins are supported to have homophilic interaction on the cell surface by means of their cadherin domains and modulate intercellular signal transduction for cytoskeleton conformation, cell motility or cell growth (Sano K, Tanihara H, Heimark RL, Obata S, Davidson M, St John T, Taketani S, Suzuki S. Protocadherins: a large family of cadherin-related molecules in central nervous system. EMBO J. , 12:2249-56, 1993, Frank M, and Kemler R. Protocadherins. Curr Opin Cell Biol, 14:557-62, 2002.). According to our data, PCDHl is likely to modulate positive signal for pancreatic cancer cell growth through its homophilic interaction in cell-cell adhesion.
(2) CDH3 (P-cadherin) (Genbank Accession No.NM_001793; SEQ ID No.3, 4) The present inventors validated CDH3 over-expression in PDACa cells by RT-PCR
(Figure IB) and immunohistochemistry (Figure 2), and according to the microarray data and RT-PCR (Figure IB), CDH3 over-expression was one ofthe most predominant patterns among more than 200 up-regulated genes in our PDACa profiles. CDH3 is expressed inrestrictedly in normal thymus, prostate, ovary, trachea as shown in Northern blot analysis (Figure 3B). This is not abundant in major vital organs, suggesting that targeting for these molecules would be expected to lead less toxicity in human body. To investigate the growth or survival effect of CDH3 on PDACa cells, the present inventors knocked down their endogenous expression of CDH3 specifically by mammalian vector-based RNA interference (RNAi) technique in PDACa cell line. The transfection of the siRNA-producing vectors clearly resulted in reduction ofthe endogenous expression in one designed siRNA, si24, for CDH3 (Figure 5A). This knocking-down effect by the siRNA on CDH3 mRNA resulted in drastic growth suppression in colony formation assay (Figure 5B) and MTT assay (Figure 5C). These findings strongly suggested that over- expression of CDH3 in PDACa cells were associated with cancer cell viability as well as cell-cell interaction, and this molecule may involve signal transduction from cell-cell interaction. PDACa is extremely aggressive and high expression of CDH3 in PDACa may be associated with their aggressiveness and metastatic potential as well.
(3) GPRl 07 (G protein-coupled receptor 107) (Genbank Accession No. AB046844; SEQ ID No.5, 6) The present inventors identified this orphan GPCR as a target for pancreas cancer, which function and ligands are unknown. GPRl 07 is expressed inrestrictedly in normal heart, placenta, skeletal muscle, testis, ovary, spinal cord as shown in Northern blot analysis (Figure 3C). To investigate the growth or survival effect of GPRl 07 on PDACa cells, the present inventors knocked down their endogenous expression of GPRl 07 specifically by siRNA in PDACa cell line. The transfection ofthe siRNA-producing vectors clearly resulted in reduction ofthe endogenous expression in one designed siRNA, 1003 si, for GPRl 07 (Figure 6A). This knocking-down effect by the siRNA on GPRl 07 mRNA resulted in growth suppression in colony formation assay (Figure 6B) and MTT assay (Figure 6C). These findings strongly suggested that over-expression of GPRl 07 in PDACa cells were associated with cancer cell viability. In conclusion, the present inventors identified three membrane-type molecules over-expressed in PDACa cells and all of them are likely to be associated with cancer cell growth, suggested these membrane-type molecules are ideal molecular targets for deadly pancreatic cancer treatment.
Industrial Applicability The present inventors have shown that the cell growth is suppressed by small interfering RNA (siRNA) that specifically target the PCDHl, CDH3 or GPRl 07 gene. Thus, this novel siRNAs are useful target for the development of anti-cancer pharmaceuticals. For example, agents that block the expression of PCDHl, CDH3 or GPRl 07 or prevent its activity may find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of pancreatic cancer, such as pancreatic ductal adenocarcinoma (PDACa). While the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope ofthe invention.

Claims

1. A method for treating or preventing pancreatic cancer in a subject comprising administering to said subject a composition comprising a small interfering RNA (siRNA) that inhibits expression of PCDHl, CDH3 or GPR107.
2. The method of claim 1, wherein said siRNA comprises a sense nucleic acid sequence and an anti-sense nucleic acid sequence that specifically hybridizes to a sequence from PCDHl, CDH3 or GPR107.
3. The method of claim 1 , wherein the pancreatic cancer is a pancreatic ductal adenocarcinoma (PDACa).
4. The method of claim 2, wherein said siRNA comprises a ribonucleotide sequence corresponding to a sequence selected from the group consisting of SEQ ID NOs: 22, 23 and 24 as the target sequence.
5. The method of claim 4, wherein said siRNA has the general formula 5'-[A]-[B]- [A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence selected from the group consisting of nucleotides of SEQ ID NOs: 22, 23 and 24. [B] is a ribonucleotide loop sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A].
6. The method of claim 1, wherein said composition comprises a transfection- enhancing agent.
7. A double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to a target sequence selected from the group consisting of SEQ ID NOs: 22, 23 and 24, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing the PCDHl, CDH3 or GPRl 07 gene, inhibits expression of said gene.
8. The double-stranded molecule of claim 7, wherein said target sequence comprises at least about 10 contiguous nucleotides from the nucleotide sequences selected from the group of SEQ ID NOs: 1, 3, and 5.
9. The double-stranded molecule of claim 8, wherein said target sequence comprises from about 19 to about 25 contiguous nucleotides from the nucleotide sequences selected from the group of SEQ ID NOs: 1, 3, and 5.
10. The double-stranded molecule of claim 9, wherein said double-stranded molecule is a single ribonucleotide transcript comprising the sense strand and the antisense strand linked via a single-stranded ribonucleotide sequence.
11. The double-stranded molecule of claim 8, wherein the double-stranded molecule is an oligonucleotide of less than about 100 nucleotides in length.
12. The double-stranded molecule of claim 11 , wherein the double-stranded molecule is an oligonucleotide of less than about 75 nucleotides in length.
13. The double-stranded molecule of claim 12, wherein the double-stranded molecule is an oligonucleotide of less than about 50 nucleotides in length.
14. The double-stranded molecule of claim 13, wherein the double-stranded molecule is an oligonucleotide of less than about 25 nucleotides in length.
15. The double-stranded polynucleotide of claim 14, wherein the double stranded molecule is an oligonucleotide of between about 19 and about 25 nucleotides in length.
16. A vector encoding the double-stranded molecule of claim 8.
17. The vector of claim 16, wherein the vector encodes a transcript having a secondary structure and comprises the sense strand and the antisense strand.
18. The vector of claim 17, wherein the transcript further comprises a single-stranded ribonucleotide sequence linking said sense strand and said antisense strand.
19. A vector comprising a polynucleotide comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid, wherein said sense strand nucleic acid comprises nucleotide sequence of SEQ ID NOs: 22, 23 and 24, and said antisense strand nucleic acid consists of a sequence complementary to the sense strand.
20. The vector of claim 19, wherein said polynucleotide has the general formula 5'-[A]-[B]-[A']-3' wherein [A] is a nucleotide sequence of SEQ ID NOs: 22, 23 and 24; [B] is a nucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a nucleotide sequence complementary to [A].
21. A pharmaceutical composition for treating or preventing pancreatic cancer comprising a pharmaceutically effective amount of a small interfering RNA (siRNA) that inhibits expression of PCDHl, CDH3 or GPR107 as an active ingredient, and a pharmaceutically acceptable carrier..
22. The pharmaceutical composition of claim 21, wherein the siRNA comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 22, 23 and 24 as the target sequence.
23. The composition of claim 22, wherein the siRNA has the general formula 5'-[A]-[B]-[A']-3' wherein [A] is a ribonucleotide sequence corresponding to a nucleotide sequence of SEQ ID NOs: 22, 23 and 24; [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides; and [A'] is a ribonucleotide sequence complementary to [A].
EP05721546A 2004-03-24 2005-03-18 Compositions and methods for treating pancreatic cancer Withdrawn EP1735442A2 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55580904P 2004-03-24 2004-03-24
PCT/JP2005/005619 WO2005090572A2 (en) 2004-03-24 2005-03-18 Compositions and methods for treating pancreatic cancer

Publications (1)

Publication Number Publication Date
EP1735442A2 true EP1735442A2 (en) 2006-12-27

Family

ID=34961863

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05721546A Withdrawn EP1735442A2 (en) 2004-03-24 2005-03-18 Compositions and methods for treating pancreatic cancer

Country Status (4)

Country Link
EP (1) EP1735442A2 (en)
JP (1) JP2007530431A (en)
CN (1) CN1977044A (en)
WO (1) WO2005090572A2 (en)

Families Citing this family (11)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
TW200908998A (en) * 2007-06-27 2009-03-01 Oncotherapy Science Inc Compositions and methods of treating cancer
CN101827936B (en) 2007-08-20 2014-12-10 肿瘤疗法科学股份有限公司 CDH3 peptide and agent containing CDH3 peptide
US8435749B2 (en) 2008-06-30 2013-05-07 Oncotherapy Science, Inc. Anti-CDH3 antibodies labeled with radioisotope label and uses thereof
TW201008574A (en) 2008-08-19 2010-03-01 Oncotherapy Science Inc INHBB epitope peptides and vaccines containing the same
US9017669B2 (en) 2009-12-28 2015-04-28 Oncotherapy Science, Inc. Anti-CDH3 antibodies and uses thereof
LT2535358T (en) 2010-02-10 2018-03-26 Fujifilm Ri Pharma Co., Ltd. Radioactive metal-labeled anti-cadherin antibody
CN101825799A (en) * 2010-05-26 2010-09-08 福州华映视讯有限公司 Method for assembling naked-eye stereoscopic display
TW201625692A (en) 2014-11-14 2016-07-16 諾華公司 Antibody drug conjugate
CN115896106A (en) * 2016-03-01 2023-04-04 佛罗里达大学研究基金会有限公司 AAV vectors for the treatment of overt retinitis pigmentosa
CN112204145B (en) 2018-06-01 2024-03-26 佛罗里达大学研究基金会有限公司 Compositions and methods for treating dominant retinitis pigmentosa
CN108866058B (en) * 2018-07-12 2021-09-10 苏州吉玛基因股份有限公司 KRAS-targeted siRNA and application thereof in preparation of pancreatic cancer treatment drug

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1432724A4 (en) * 2002-02-20 2006-02-01 Sirna Therapeutics Inc INTERFERENCE MEDIATION INHIBITION OF GENE RNA FROM MAP KINASE

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005090572A2 *

Also Published As

Publication number Publication date
CN1977044A (en) 2007-06-06
WO2005090572A2 (en) 2005-09-29
WO2005090572A3 (en) 2006-04-13
JP2007530431A (en) 2007-11-01

Similar Documents

Publication Publication Date Title
Wang et al. Knockdown of c-Myc expression by RNAi inhibits MCF-7 breast tumor cells growth in vitro and in vivo
Li et al. Use of RNA interference to target cyclin E-overexpressing hepatocellular carcinoma
Heidenreich et al. AML1/MTG8 oncogene suppression by small interfering RNAs supports myeloid differentiation of t (8; 21)-positive leukemic cells
JP2011078418A (en) Compositions and methods for treating lung cancer
ZA200304127B (en) Method for inhibiting the expression of a target gene.
Zhang et al. MicroRNA‐146a targets PRKCE to modulate papillary thyroid tumor development
CA2432350A1 (en) Method for inhibiting the expression of a target gene
Gong et al. Resistin promotes 3T3-L1 preadipocyte differentiation
US20100086526A1 (en) Nucleic acid constructs and methods for specific silencing of h19
KR20100017422A (en) Methods of identifying genes involved in memory formation using small interfering rna(sirna)
WO2010008069A1 (en) Cell proliferation inhibitor
CN101796184A (en) Compositions and methods of treating cancer
Takigami et al. Synthetic siRNA targeting the breakpoint of EWS/Fli‐1 inhibits growth of Ewing sarcoma xenografts in a mouse model
JP4467559B2 (en) Compositions and methods for inhibiting cell proliferation
EP1735442A2 (en) Compositions and methods for treating pancreatic cancer
JP2006500916A (en) Methods and compositions for treating neoplasia associated with hnRNPA1 and A2 nucleic acid molecules
Zhang et al. RNA interference, A potential strategy for isoform-specific phosphatidylinositol 3-kinase targeted therapy in ovarian cancer
US20090215863A1 (en) Gene Silencing of Protease Activated Receptor 1(Par1)
KR102707587B1 (en) COMPOSITION FOR ENHANCING SENSITIVITY TO ANTI-CANCER AGENT COMPRISING OF miR-4487 AS AN ACTIVE INGREDIENT
US20060003956A1 (en) Materials and methods for the derepression of the E-cadherin promoter
WO2021016061A2 (en) Inhibitors of microrna 451a for treatment of endometriosis
JP2009165357A (en) Preventive and therapeutic agent for feline infectious peritonitis virus (FIPV)
Pu et al. Suppression of EGFR Expression by Antisense RNA and RNAi
TW201718854A (en) RNA interference agents for p21 gene modulation

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20061023

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

17Q First examination report despatched

Effective date: 20070511

DAX Request for extension of the european patent (deleted)
R17C First examination report despatched (corrected)

Effective date: 20070803

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20091001