EP1727831A1 - Genes and polypeptides relating to prostate cancers - Google Patents

Genes and polypeptides relating to prostate cancers

Info

Publication number
EP1727831A1
EP1727831A1 EP05721047A EP05721047A EP1727831A1 EP 1727831 A1 EP1727831 A1 EP 1727831A1 EP 05721047 A EP05721047 A EP 05721047A EP 05721047 A EP05721047 A EP 05721047A EP 1727831 A1 EP1727831 A1 EP 1727831A1
Authority
EP
European Patent Office
Prior art keywords
polypeptide
seq
ofthe
amino acid
acid sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP05721047A
Other languages
German (de)
French (fr)
Inventor
Yusuke Nakamura
Hidewaki Nakagawa
Shuichi Nakatsuru
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Oncotherapy Science Inc
Original Assignee
Oncotherapy Science Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oncotherapy Science Inc filed Critical Oncotherapy Science Inc
Publication of EP1727831A1 publication Critical patent/EP1727831A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57555—Immunoassay; Biospecific binding assay; Materials therefor for cancer of the prostate
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • the present invention relates to the field of biological science, more specifically to the field of cancer therapy and diagnosis.
  • the present invention relates to novel polypeptides encoded by a novel gene B3537 (CCDC4) relating to prostate cancer.
  • CCDC4 novel gene B3537
  • the present invention relates to the novel gene CCDC4.
  • the genes and polypeptides ofthe present invention can be used, for example, in the diagnosis of prostate cancer, as target molecules for developing drugs against the disease, and for attenuating cell growth of prostate cancer.
  • FTIs farnesyltransferase
  • a tyrosine kinase inhibitor, STI-571, which selectively inactivates bcr-abl fusion proteins, has been developed to treat chronic myelogenous leukemias wherein constitutive activation of bcr-abl tyrosine kinase plays a crucial role in the transformation of leukocytes.
  • Agents of these kinds are designed to suppress oncogenic activity of specific gene products (Fujita et al., Cancer Res 61 :7722-6 (2001)). Therefore, gene products commonly up-regulated in cancerous cells may serve as potential targets for developing novel anti-cancer agents.
  • novel drugs targeting abnormally expressed molecules that have causative effects on cancer growth and progression have been proven to be effective to certain types of cancers.
  • Such drugs include Herceptin for breast cancer, Glivec (STI571) for CML and Iressa (ZD1839) for non-small cell lung cancer.
  • Glivec STI571
  • Iressa ZD1839
  • Several molecules have been known to be over-expressed in prostate cancer and are identified as therapeutic targets or markers of prostate cancer (Xu et al., Cancer Res 60: 6568-72 (2000); Luo et al, Cancer Res 62: 2220-6 (2002)). However, most of them are also highly expressed in other major organs. Thus, agents that target these molecules may be toxic to cancer cells but may also adversely affect normally growing cells of other organs.
  • CTLs cytotoxic T lymphocytes
  • TAAs tumor-associated antigens
  • TAAs are now in the stage of clinical development as targets of immunotherapy. TAAs discovered so far include MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)), gplOO (Kawakami et al., J Exp Med 180: 347-52 (1994)), SART (Shichijo et al., J Exp Med 187: 277-88 (1998)), and NY-ESO-1 (Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997)).
  • gene products which had been demonstrated to be specifically over-expressed in tumor cells have been shown to be recognized as targets inducing cellular immune responses.
  • Such gene products include p53 (Umano et al., Brit J Cancer 84: 1052-7 (2001)), HER2/neu (Tanaka et al., Brit J Cancer 84: 94-9 (2001)), CEA (Nukaya et al., Int J Cancer 80: 92-7 (1999)), and so on.
  • TAAs for the treatment of adenocarcinomas, including colorectal cancer, are available. TAAs abundantly expressed in cancer cells, and at the same time which expression is restricted to cancer cells would be promising candidates as immunotherapeutic targets.
  • PBMCs peripheral blood mononuclear cells
  • HLA-A24 and HLA-A0201 are one of the common HLA alleles in Japanese, as well as Caucasian populations (Date et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J Immunol 155: 4307-12 (1995); Kubo et al., J Immunol 152: 3913-24 (1994); Imanishi et al., Proceeding ofthe eleventh International Histocompatibility Workshop and Conference Oxford University Press, Oxford, 1065 (1992); Williams et al., Tissue Antigen 49: 129 (1997)).
  • antigenic peptides of cancers presented by these HLAs may be especially useful for the treatment of cancers among Japanese and Caucasian populations.
  • the induction of low-affinity CTL in vitro usually results from the use of peptide at a high concentration, generating a high level of specific peptide/MHC complexes on antigen presenting cells
  • the present inventors analyzed the expression profiles of genes in prostate cancer using a genome- wide cDNA microarray combined with laser microbeam microdissection.
  • PRCs prostate cancer cells
  • PINs non-invasive precursor cells
  • the present inventors identified 88 up-regulated genes and 207down-regulated genes commonly in both invasive PRCs and precursor PP s.
  • the present inventors focused on one EST and identified a novel gene, CCDC4, over-expressed in prostate cancer cells. .
  • CCDC4 was identified as specifically over-expressed gene in prostate cancer cells.
  • the present inventors show the knocking-down effect of CCDC4 by siRNA attenuated the growth of prostate cancer cells and this molecule can be potentially targeted for drug design for novel therapies of prostate cancer.
  • CCDC4 encodes a 530-amino acid protein comprising coiled-coiled domain. According to a Northern blot analysis, the expression of CCDC4 was shown to be restricted to testis and prostate. Many anticancer drugs are not only toxic to cancer cells but also for normally growing cells.
  • the present invention provides isolated gene, CCDC4 which serves as candidates of diagnostic markers for prostate cancer as well as promising potential targets for developing new strategies for diagnosis and effective anti-cancer agents. Furthermore, the present invention provides polypeptide encoded by this gene, as well as the production and the use ofthe same. More specifically, the present invention provides novel human polypeptide, CCDC4 or a functional equivalent thereof, which expressions are elevated in prostate cancer cells.
  • the CCDC4 polypeptide includes a 530 amino acid protein encoded by the open reading frame of SEQ ID NO: 1 or a 437 amino acid protein encoded by the open reading frame of SEQ F NO : 3.
  • the CCDC4 polypeptide preferably includes the amino acid sequence set forth in SEQ ID NO: 2 (Gene Bank Accession number: AB126828)or 4 (Gene Bank Accession number: AB 126829).
  • the present application also provides an isolated protein encoded from at least a portion ofthe CCDC4 polynucleotide sequence, or polynucleotide sequences at least 15% and more preferably at least 25% complementary to the sequence set forth in SEQ ID NO: 1 or 3.
  • the present invention further provides a novel human gene CCDC4 whose expressions is markedly elevated in a great majority of prostate cancers as compared to corresponding non-cancerous prostate duct epithelium.
  • the isolated CCDC4 gene includes a polynucleotide sequence as described in SEQ ID NO: 1 or 3.
  • the CCDC4 cDNA includes 8763 nucleotides that contain an open reading frame of 1593 nucleotides (SEQ ID NO: 1) or 8692 nucleotides that contain an open reading frame of 1314 nucleotides (SEQ ID NO: 3).
  • the present invention further encompasses polynucleotides which hybridize to and which are at least 15% and more preferably at least 25% complementary to the polynucleotide sequence set forth in SEQ ID NO: 1 or 3, to the extent that they encode a CCDC4 protein or a functional equivalent thereof.
  • polynucleotides are degenerates and allelic mutants of CCDC4 encoded by the sequence of SEQ ID NO: 1 or 3.
  • an isolated gene is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes.
  • the term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome ofthe organism in which it naturally occurs; (b) a polynucleotide inco ⁇ orated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide.
  • a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome ofthe organism in which it naturally occurs
  • the invention provides an isolated polynucleotide that encodes a polypeptide described herein or a fragment thereof.
  • the isolated polynucleotide includes a nucleotide sequence that is at least 60% identical to the nucleotide sequence shown in SEQ ID NO: 1 or 3. More preferably, the isolated nucleic acid molecule is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%> or more, identical to the nucleotide sequence shown in SEQ ID NO: 1 or 3.
  • the comparison is made with the full length ofthe reference sequence.
  • the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than SEQ ID NO: 1 or 3
  • the comparison is made to a segment ofthe reference sequence ofthe same length (excluding any loop required by the homology calculation).
  • the present invention also provides a method of producing a protein by transfecting or transforming a host cell with a polynucleotide sequence encoding the CCDC4 protein, and expressing the polynucleotide sequence.
  • the present invention provides vectors comprising a nucleotide sequence encoding the CCDC4 protein, and host cells harboring a polynucleotide encoding the CCDC4 protein. Such vectors and host cells may be used for producing the CCDC4 protein.
  • a binding agent that specifically recognizes the CCDC4 protein is also provided by the present application.
  • a binding agent may be an antibody raised against a CCD4 protein.
  • a binding agent may be a ligand specific for the protein, or a synthetic polypeptide that specifically binds the protein (see e.g., WO2004044011).
  • An antisense polynucleotide e.g., antisense DNA
  • ribozyme e.g., ribozyme
  • siRNA small interfering RNA
  • the present invention further provides a method for diagnosis of prostate cancer which includes the step of determining an expression level ofthe gene in a biological sample from a subject, comparing the expression level of CCDC4 gene with that in a normal sample, and defining that a high expression level ofthe CCDC4 gene in the sample indicates that the subject suffers from or is at risk of developing prostate cancer. Further, a method of screening for a compound for treating or preventing prostate cancer is provided by the present invention.
  • the method includes contacting the CCDC4 polypeptide with test compounds, and selecting test compounds that bind to or that alter the biological activity ofthe CCDC4 polypeptide.
  • the present invention further provides a method of screening for a compound for treating or preventing prostate cancer, wherein the method includes contacting a test compound with a cell expressing the CCDC4 polypeptide or introduced with a vector comprising the transcriptional regulatory region of CCDC4 upstream of a reporter gene, and selecting the test compound that suppresses the expression level ofthe CCDC4 polypeptide.
  • the present application also provides a pharmaceutical composition for treating or preventing prostate cancer.
  • the pharmaceutical composition may be, for example, an anti-cancer agent.
  • the pharmaceutical composition can comprise at least a portion of antisense S-oligonucleotides, siRNA molecules or ribozymes against the CCDC4 polynucleotide sequence shown and described in SEQ ID NOs: 1 and 3, respectively.
  • a suitable siRNA targets a sequence of SEQ ID NO: 8.
  • an siRNA ofthe invention comprises a nucleotide sequence from SEQ ID NO: 8. This may be preferably selected as targets for treating or preventing prostate cancer according to the present invention.
  • the pharmaceutical compositions may be also those comprising the compounds selected by the present methods of screening for compounds for treating or preventing cell proliferative diseases such as prostate cancer.
  • the course of action ofthe pharmaceutical composition is desirably to inhibit growth ofthe cancerous cells such as prostate cancer cells.
  • the pharmaceutical composition may be applied to mammals including humans and domesticated mammals.
  • the present invention further provides methods for treating or preventing prostate cancer using the pharmaceutical composition provided by the present invention.
  • the present invention provides method for treating or preventing cancer, which method comprises the step of administering the CCDC4 polypeptide. It is expected that anti tumor immunity is induced by the administration ofthe CCDC4 polypeptide.
  • the present invention also provides method for inducing anti tumor immunity, which method comprises the step of administering the CCDC4 polypeptide, as well as pharmaceutical composition for treating or preventing cancer comprising the CCDC4 polypeptide.
  • Fig.1(A) depicts photographs showing the results of semi-quantitative PCR.
  • CCDC4 was over-expressed in prostate cancer cells microdissected from human prostate cancer tissues.
  • Fig.1 (B) depicts photographs of Northern blot analysis showing the expression pattern in normal adult tissues of CCDC4. The 8.7kb transcript, CCDC4, is expressed restrictedly only in adult testis and prostate.
  • Fig.2 shows the effects of Knocking-down endogenous CCDC4 in prostate cancer cell line, PRC3, by siRNA.
  • Fig.2(A) is a photograph showing the results of RT-PCR. This photograph validates the knockdown effect of CCDC4 mRNA by transfection of siRNA expression vectors si#l .
  • Fig.2(B) is a photograph showing the results of colony formation assay. This photograph shows the drastic decrease of colony numbers in PRC3 cells one week after transfection with si#l that was validated to knock down CCDC4 effectively by RT-PCR.
  • Fig.2(C) is a bar chart showing the results of MTT assay. This assay also shows the drastic decreased number of the grown cells transfected with si#l .
  • CCDC4 According to the present invention, two genes with a similar sequence were identified and encode variants of CCDC4.
  • the cDNA ofthe longer variant consists of 8763 nucleotides containing an open reading frame of 1593 nucleotides (SEQ ID NO: 1) and the shorter variant consists of 8692 nucleotides containing an open reading frame of 1314 nucleotides (SEQ ID NO: 3). These open reading frames encode a 530 amino acid-protein and a 437 amino acid-protein, respectively.
  • the present invention provides substantially pure polypeptides encoded by these genes including polypeptides comprising the amino acid sequence of SEQ ID NO: 2 or 4, as well as functional equivalents thereof, to the extent that they encode a CCDC4 protein.
  • polypeptides functionally equivalent to CCDC4 include, for example, homologous proteins of other organisms corresponding to the human CCDC4 protein, as well as mutants of human CCDC4 proteins.
  • the term "functionally equivalent” means that the subject polypeptide has the activity to promote cell proliferation like the CCDC4 protein and to confer oncogenic activity to cancer cells. Whether the subject polypeptide has a cell proliferation activity or not can be judged by introducing the DNA encoding the subject polypeptide into a cell, expressing the respective polypeptide and detecting promotion of proliferation ofthe cells or increase in colony forming activity.
  • Such cells include, for example, NIH3T3, COS7 and HEK293.
  • polypeptides functionally equivalent to a given protein are well known by a person skilled in the art and include known methods of introducing mutations into the protein.
  • one skilled in the art can prepare polypeptides functionally equivalent to the human CCDC4 protein by introducing an appropriate mutation in the amino acid sequence of these proteins by site-directed mutagenesis
  • the polypeptide ofthe present invention includes those proteins having the amino acid sequences ofthe human CCDC4 protein in which one or more amino acids are mutated, provided the resulting mutated polypeptides are functionally equivalent to the human CCDC4 protein.
  • the number of amino acids to be mutated in such a mutant is generally 10 amino acids or less, preferably 6 amino acids or less, and more preferably 3 amino acids or less.
  • Mutated or modified proteins proteins having amino acid sequences modified by substituting, deleting, inserting and/or adding one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark et al., Proc Natl Acad Sci USA 81 : 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982); Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79: 6409-13 (1982)).
  • the amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties ofthe amino acid side-chain are conserved (a process known as conservative amino acid substitution).
  • amino acid side chains examples include hydrophobic amino acids (A, I, L, M, F, P, W, Y, N), hydrophilic amino acids (R, D, ⁇ , C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, N, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, ⁇ , E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W).
  • A, I, L, M, F, P, W, Y, N hydrophilic amino acids
  • R, D, ⁇ , C, E, Q amino acids
  • G, A, N, L, I, P a hydroxyl group containing side-chain
  • a polypeptide to which one or more amino acids residues are added to the amino acid sequence of human CCDC4 protein is a fusion protein containing the human CCDC4 protein.
  • Fusion proteins, fusions ofthe human CCDC4 protein and other peptides or proteins, are included in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the human CCDC4 protein ofthe invention with DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins fused to the protein ofthe present invention.
  • peptides that can be used as peptides that are fused to the protein of the present invention include, for example, FLAG (Hopp et al., Biotechnology 6: 1204-10 (1988)), 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, pl ⁇ HIV fragment, T7-tag, HSN-tag, E-tag, SV40T antigen fragment, lck tag, ⁇ -tubulin fragment, B-tag, Protein C fragment and the like.
  • FLAG Hopp et al., Biotechnology 6: 1204-10 (1988)
  • 6xHis containing six His (histidine) residues include, for example, FLAG (Hopp et al., Biotechnology 6: 1204-10 (1988)
  • 6xHis containing six His (histidine) residues include, for example, 6xHis containing six His (histidine) residues,
  • proteins that may be fused to a protein ofthe invention include GST (glutathione-S-transferase), Influenza agglutinin (HA), immunoglobulin constant region, ⁇ -galactosidase, MBP (maltose-binding protein) and such. Fusion proteins can be prepared by fusing commercially available D ⁇ A, encoding the fusion peptides or proteins discussed above, with the D ⁇ A encoding the polypeptide of the present invention and expressing the fused D ⁇ A prepared.
  • An alternative method known in the art to isolate functionally equivalent polypeptides is, for example, the method using a hybridization technique (Sambrook et al., Molecular Cloning 2nd ed.
  • polypeptides of the present invention include those that are encoded by DNA that hybridize with a whole or part ofthe DNA sequence encoding the human CCDC4 protein and are functionally equivalent to the human CCDC4 protein.
  • polypeptides include mammal homologues corresponding to the protein derived from human (for example, a polypeptide encoded by a monkey, rat, rabbit and bovine gene).
  • hybridization may be performed by conducting prehybridization at 68°C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68°C for 1 hour or longer.
  • the following washing step can be conducted, for example, in a low stringent condition.
  • a low stringent condition is, for example, 42°C, 2X SSC, 0.1% SDS, or preferably 50°C, 2X SSC, 0.1% SDS. More preferably, high stringent conditions are used.
  • a high stringent condition is, for example, washing 3 times in 2X SSC, 0.01%) SDS at room temperature for 20 min, then washing 3 times in lx SSC, 0.1 % SDS at 37°C for 20 min, and washing twice in lx SSC, 0.1%) SDS at 50°C for 20 min.
  • factors such as temperature and salt concentration, can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency.
  • a gene amplification method for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a polypeptide functionally equivalent to the human CCDC4 protein, using a primer synthesized based on the sequence information ofthe protein encoding DNA (SEQ ID NO: 1 or 3).
  • PCR polymerase chain reaction
  • Polypeptides that are functionally equivalent to the human CCDC4 protein encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques normally have a high homology to the amino acid sequence ofthe human CCDC4 protein.
  • High homology typically refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 85%), 90%, 93%, 95%, 98%), 99%) or higher between a polypeptide sequence or a polynucleotide sequence and a reference sequence. Percent homology (also referred to as percent identity) are typically carried out between two optimally aligned sequences. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences and comparison can be conducted, e.g., using the algorithm in "Wilbur and Lipman, Proc Natl Acad Sci USA 80: 726-30 (1983)".
  • a polypeptide ofthe present invention have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it has a function equivalent to that ofthe human CCDC4 protein ofthe present invention, it is within the scope ofthe present invention.
  • the polypeptides ofthe present invention can be prepared as recombinant proteins or natural proteins, by methods well known to those skilled in the art.
  • a recombinant protein can be prepared by inserting a DNA, which encodes the polypeptide ofthe present invention (for example, the DNA comprising the nucleotide sequence of SEQ ID NO: 1 or 3), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the polypeptide by subjecting the extract to chromatography, e.g., ion exchange chromatography, reverse phase chromatography, gel filtration or affinity chromatography utilizing a column to which antibodies against the protein ofthe present invention is fixed or by combining more than one of aforementioned columns. Also when the polypeptide ofthe present invention is expressed within host cells (for example, animal cells and E.
  • host cells for example, animal cells and E.
  • the expressed recombinant protein can be purified using a glutathione column or nickel column.
  • the polypeptide ofthe present invention when expressed as a protein tagged with c-myc, multiple histidines or FLAG it can be detected and purified using antibodies to c-myc, His or FLAG, respectively. After purifying the fusion protein, it is also possible to exclude regions other than the objective polypeptide by cutting with thrombin or factor-Xa as required.
  • a natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting the affinity column, in which antibodies binding to the CCDC4 protein described below are bound, with the extract of tissues or cells expressing the polypeptide ofthe present invention.
  • the antibodies can be polyclonal antibodies or monoclonal antibodies.
  • the present invention also encompasses partial peptides ofthe polypeptide ofthe present invention.
  • the partial peptide has an amino acid sequence specific to the polypeptide ofthe present invention and consists of at least 7 amino acids, preferably 8 amino acids or more, and more preferably 9 amino acids or more.
  • the partial peptide can be used, for example, for preparing antibodies against the polypeptide ofthe present invention, screening for a compound that binds to the polypeptide ofthe present invention, and screening for inhibitors ofthe polypeptide ofthe present invention.
  • a partial peptide ofthe invention can be produced by genetic engineering, by known methods of peptide synthesis or by digesting the polypeptide ofthe invention with an appropriate peptidase. For peptide synthesis, for example, solid phase synthesis or liquid phase synthesis may be used.
  • the present invention further provides polynucleotides that encode such CCDC4 polypeptides described above.
  • the polynucleotides ofthe present invention can be used for the in vivo or in vitro production ofthe polypeptide ofthe present invention as described above, or can be applied to gene therapy for diseases attributed to genetic abnormality in the gene encoding the protein ofthe present invention.
  • Any form ofthe polynucleotide ofthe present invention can be used so long as it encodes the polypeptide ofthe present invention, including mRNA, RNA, cDNA, genomic DNA, chemically synthesized polynucleotides.
  • the polynucleotide ofthe present invention includes a DNA comprising a given nucleotide sequences as well as its degenerate sequences, so long as the resulting DNA encodes a polypeptide ofthe present invention.
  • the polynucleotide ofthe present invention can be prepared by methods known to a person skilled in the art.
  • the polynucleotide ofthe present invention can be prepared by: preparing a cDNA library from cells which express the polypeptide ofthe present invention, and conducting hybridization using a partial sequence ofthe DNA ofthe present invention (for example, SEQ ID NO: 1 or 3) as a probe.
  • a cDNA library can be prepared, for example, by the method described in Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989); alternatively, commercially available cDNA libraries may be used.
  • a cDNA library can be also prepared by: extracting RNAs from cells expressing the polypeptide ofthe present invention, synthesizing oligo DNAs based on the sequence ofthe DNA ofthe present invention (for example, SEQ ID NO: 1 or 3), conducting PCR using the oligo DNAs as primers, and amplifying cDNAs encoding the protein ofthe present invention.
  • the sequence ofthe DNA ofthe present invention for example, SEQ ID NO: 1 or 3
  • the translation region encoded by the cDNA can be routinely determined, and the amino acid sequence of the polypeptide ofthe present invention can be easily obtained.
  • the genomic DNA can be isolated.
  • mRNAs may first be prepared from a cell, tissue or organ (e.g., testis or prostate) in which the object polypeptide ofthe invention is expressed.
  • Known methods can be used to isolate mRNAs; for instance, total RNA may be prepared by guanidine ultracentrifugation (Chirgwin et al., Biochemistry 18:5294-9 (1979)) or AGPC method (Chomczynski and Sacchi, Anal Biochem 162: 156-9 (1987)).
  • mRNA may be purified from total RNA using mRNA Purification Kit (Pharmacia) and such.
  • mRNA may be directly purified by QuickPrep mRNA Purification Kit (Pharmacia).
  • cDNA is used to synthesize cDNA using reverse transcriptase.
  • cDNA may be synthesized using a commercially available kit, such as the AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Seikagaku Kogyo).
  • cDNA may be synthesized and amplified following the 5 '-RACE method (Frohman et al., Proc Natl Acad Sci USA 85: 8998-9002 (1988); Belyavsky et al., Nucleic Acids Res 17: 2919-32 (1989)), which uses a primer and such, described herein, the 5'-Ampli FINDER RACE Kit (Clontech), and polymerase chain reaction (PCR).
  • 5 '-RACE method Frohman et al., Proc Natl Acad Sci USA 85: 8998-9002 (1988); Belyavsky et al., Nucleic Acids Res 17: 2919-32 (1989
  • a desired DNA fragment is prepared from the PCR products and ligated with a vector DNA.
  • the recombinant vectors are used to transform E. coli and such, and a desired recombinant vector is prepared from a selected colony.
  • the nucleotide sequence ofthe desired DNA can be verified by conventional methods, such as dideoxynucleotide chain termination.
  • the nucleotide sequence of a polynucleotide ofthe invention may be designed to be expressed more efficiently by taking into account the frequency of codon usage in the host to be used for expression (Grantham et al., Nucleic Acids Res 9: 43-74 (1981)).
  • sequence ofthe polynucleotide ofthe present invention may be altered by a commercially available kit or a conventional method.
  • sequence may be altered by digestion with restriction enzymes, insertion of a synthetic oligonucleotide or an appropriate polynucleotide fragment, addition of a linker, or insertion ofthe initiation codon (ATG) and/or the stop codon (TAA, TGA or TAG).
  • the polynucleotide ofthe present invention encompasses the DNA comprising the nucleotide sequence of SEQ ID NO: 1 or 3.
  • the present invention provides a polynucleotide that hybridizes under stringent conditions with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or 3, and encodes a polypeptide functionally equivalent to the CCDC4 protein ofthe invention described above.
  • stringent conditions For example, low stringent condition can be used. More preferably, high stringent condition can be used. These conditions are the same as that described above.
  • the hybridizing DNA above is preferably a cDNA or a chromosomal DNA.
  • the present invention also provides a polynucleotide which is complementary to the polynucleotide encoding human CCDC4 protein (SEQ ID NO: 1 or 3) or the complementary strand thereof, and which comprises at least 15 nucleotides.
  • the polynucleotide ofthe present invention is preferably a polynucleotide which specifically hybridizes with the DNA encoding the CCDC4 polypeptide ofthe present invention.
  • the term "specifically hybridize” as used herein, means that cross-hybridization does not occur significantly with DNA encoding other proteins, under the usual hybridizing conditions, preferably under stringent hybridizing conditions.
  • Such polynucleotides include, probes, primers, nucleotides and nucleotide derivatives (for example, antisense ohgonucleotides and ribozymes), which specifically hybridize with DNA encoding the polypeptide ofthe invention or its complementary strand. Moreover, such polynucleotide can be utilized for the preparation of DNA chip.
  • Vectors and host cells The present invention also provides a vector and host cell into which a polynucleotide ofthe present invention is introduced.
  • a vector ofthe present invention is useful to keep a polynucleotide, especially a DNA, ofthe present invention in host cell, to express the polypeptide ofthe present invention, or to administer the polynucleotide ofthe present invention for gene therapy.
  • E. coli is a host cell and the vector is amplified and produced in a large amount in E. coli (e.g., JM109, DH5 ⁇ , HB101 or XLlBlue), the vector should have "ori" to be amplified in E. coli and a marker gene for selecting transformed E.
  • coli e.g., a drug-resistance gene selected by a drug such as ampicillin, tetracycline, kanamycin, chloramphenicol or the like.
  • M13-series vectors, pUC-series vectors, pBR322, pBluescript, pCR-Script, etc. can be used.
  • pG ⁇ M-T, pDIR ⁇ CT and pT7 can also be used for subcloning and extracting cDNA as well as the vectors described above.
  • an expression vector is especially useful.
  • an expression vector to be expressed in E. coli should have the above characteristics to be amplified in E. coli.
  • the vector should have a promoter, for example, lacZ promoter (Ward et al., Nature 341: 544-6 (1989); FAS ⁇ B J 6: 2422-7 (1992)), araB promoter (Better et al., Science 240: 1041-3 (1988)), T7 promoter or the like, that can efficiently express the desired gene in E. coli.
  • a promoter for example, lacZ promoter (Ward et al., Nature 341: 544-6 (1989); FAS ⁇ B J 6: 2422-7 (1992)), araB promoter (Better et al., Science 240: 1041-3 (1988)), T7 promoter or the like, that can efficiently express the desired gene in E. coli.
  • the host is preferably BL21 which expresses T7 RNA polymerase
  • the vector may also contain a signal sequence for polypeptide secretion.
  • An exemplary signal sequence that directs the polypeptide to be secreted to the periplasm ofthe E. coli is the pelB signal sequence (Lei et al., J Bacteriol 169: 4379 (1987)).
  • Means for introducing ofthe vectors into the target host cells include, for example, the calcium chloride method, and the electroporation method.
  • expression vectors derived from mammals for example, pcDNA3 (Invitrogen) and p ⁇ GF-BOS (Nucleic Acids Res 18(17): 5322 (1990)), p ⁇ F, pCDM8), expression vectors derived from insect cells (for example, "Bac-to-BAC baculovirus expression system” (GIBCO BRL), pBacPAK8), expression vectors derived from plants (e.g., pMHl, pMH2), expression vectors derived from animal viruses (e.g., pHSN pMN pAdexLcw), expression vectors derived from retrovimses (e.g., pZIpneo), expression vector derived from yeast (e.g., "Pichia Expression Kit” (Invitrogen), p ⁇ Nll, SP-Q01) and expression vectors derived from Bacillus subtilis (e.g., pPL608, pKTH
  • mammals for example, pcDNA3
  • the vector In order to express the vector in animal cells, such as CHO, COS or ⁇ IH3T3 cells, the vector should have a promoter necessary for expression in such cells, for example, the SV40 promoter (Mulligan et al., Nature 277: 108 (1979)), the MMLV-LTR promoter, the EFl ⁇ promoter (Mizushima et al., Nucleic Acids Res 18: 5322 (1990)), the CMV promoter and the like, and preferably a marker gene for selecting transformants (for example, a drug resistance gene selected by a drug (e.g., neomycin, G418)).
  • a promoter necessary for expression in such cells for example, the SV40 promoter (Mulligan et al., Nature 277: 108 (1979)), the MMLV-LTR promoter, the EFl ⁇ promoter (Mizushima et al., Nucleic Acids Res 18: 5322 (1990)),
  • the present invention provides methods for producing a polypeptide of the present invention.
  • the polypeptides may be prepared by culturing a host cell which harbors an expression vector comprising a gene encoding the polypeptide.
  • methods may be used to express a gene stably and, at the same time, to amplify the copy number ofthe gene in cells.
  • a vector comprising the complementary DHFR gene e.g., pCHO I
  • MTX methotrexate
  • a polypeptide ofthe present invention obtained as above may be isolated from inside or outside (such as medium) of host cells and purified as a substantially pure homogeneous polypeptide.
  • the term "substantially pure” as used herein in reference to a given polypeptide means that the polypeptide is substantially free from other biological macromolecules.
  • the substantially pure polypeptide is at least 75%) (e.g., at least 80, 85, 95, or 99%) pure by dry weight.
  • Purity can be measured by any appropriate standard method, for example by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis.
  • the method for polypeptide isolation and purification is not limited to any specific method; in fact, any standard method may be used. For instance, column chromatography, filter, ultrafiltration, salt precipitation, solvent precipitation, solvent extraction, distillation, immunoprecipitation,
  • SDS-polyacrylamide gel electrophoresis, isoelectric point electrophoresis, dialysis, and recrystallization may be appropriately selected and combined to isolate and purify the polypeptide.
  • chromatography include, for example, affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, adsorption chromatography, and such (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed. Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press (1996)). These chromatographies may be performed by liquid chromatography, such as HPLC and FPLC.
  • the present invention provides for highly purified polypeptides prepared by the above methods.
  • a polypeptide ofthe present invention may be optionally modified or partially deleted by treating it with an appropriate protein modification enzyme before or after purification.
  • useful protein modification enzymes include, but are not limited to, trypsin, chymotrypsin, lysylendopeptidase, protein kinase, glucosidase and so on.
  • the present invention provides an antibody that binds to the polypeptide ofthe invention.
  • the antibody ofthe invention can be used in any form, such as monoclonal or polyclonal antibodies, and includes antiserum obtained by immunizing an animal such as a rabbit with the polypeptide ofthe invention, all classes of polyclonal and monoclonal antibodies, human antibodies and humanized antibodies produced by genetic recombination.
  • a polypeptide ofthe invention used as an antigen to obtain an antibody may be derived from any animal species, but preferably is derived from a mammal such as a human, mouse, or rat, more preferably from a human.
  • a human-derived polypeptide may be obtained from the nucleotide or amino acid sequences disclosed herein.
  • the polypeptide to be used as an immunization antigen may be a complete protein or a partial peptide ofthe protein.
  • a partial peptide may comprise, for example, the amino (N)-terminal or carboxy (C)-terminal fragment of a polypeptide ofthe present invention.
  • an antibody is defined as a protein that reacts with either the full length or a fragment of a polypeptide ofthe present invention.
  • a gene encoding a polypeptide ofthe invention or its fragment may be inserted into a known expression vector, which is then used to transform a host cell as described herein.
  • the desired polypeptide or its fragment may be recovered from the outside or inside of host cells by any standard method, and may subsequently be used as an antigen.
  • whole cells expressing the polypeptide or their lysates or a chemically synthesized polypeptide may be used as the antigen.
  • Any mammalian animal may be immunized with the antigen, but preferably the compatibility with parental cells used for cell fusion is taken into account.
  • animals of Rodentia, Lagomo ⁇ ha or Primates are used.
  • Animals of Rodentia include, for example, mouse, rat and hamster.
  • Animals of Lagomo ⁇ ha include, for example, rabbit.
  • Animals of Primates include, for example, a monkey of Catarrhini (old world monkey) such as Macaca fascicularis, rhesus monkey, sacred baboon and chimpanzees.
  • antigens may be diluted and suspended in an appropriate amount of phosphate buffered saline (PBS), physiological saline, etc.
  • PBS phosphate buffered saline
  • the antigen suspension may be mixed with an appropriate amount of a standard adjuvant, such as Freund's complete adjuvant, made into emulsion and then administered to mammalian animals.
  • a standard adjuvant such as Freund's complete adjuvant
  • it is followed by several administrations of antigen mixed with an appropriately amount of Freund's incomplete adjuvant every 4 to 21 days.
  • An appropriate carrier may also be used for immunization.
  • Polyclonal antibodies against the polypeptides ofthe present invention may be prepared by collecting blood from the immunized mammal examined for the increase of desired antibodies in the serum, and by separating serum from the blood by any conventional method.
  • Polyclonal antibodies include serum containing the polyclonal antibodies, as well as the fraction containing the polyclonal antibodies may be isolated from the serum.
  • Immunoglobulin G or M can be prepared from a fraction which recognizes only the polypeptide ofthe present invention using, for example, an affinity column coupled with the polypeptide ofthe present invention, and further purifying this fraction using protein A or protein G column.
  • immune cells are collected from the mammal immunized with the antigen and checked for the increased level of desired antibodies in the serum as described above, and are subjected to cell fusion.
  • the immune cells used for cell fusion are preferably obtained from spleen.
  • Other preferred parental cells to be fused with the above immunocyte include, for example, myeloma cells of mammalians, and more preferably myeloma cells having an acquired property for the selection of fused cells by drugs.
  • the above immunocyte and myeloma cells can be fused according to known methods, for example, the method of Milstein et al. (Galfre and Milstein, Methods Enzymol 73: 3-46 (1981)).
  • Resulting hybridomas obtained by the cell fusion may be selected by cultivating them in a standard selection medium, such as HAT medium (hypoxanthine, aminopterin and thymidine containing medium).
  • HAT medium hyperxanthine, aminopterin and thymidine containing medium.
  • the cell culture is typically continued in the HAT medium for several days to several weeks, the time being sufficient to allow all the other cells, with the exception ofthe desired hybridoma (non-fused cells), to die. Then, the standard limiting dilution is performed to screen and clone a hybridoma cell producing the desired antibody.
  • human lymphocytes such as those infected by EB virus may be immunized with a polypeptide, polypeptide expressing cells or their lysates in vitro. Then, the immunized lymphocytes are fused with human-derived myeloma cells that are capable of indefinitely dividing, such as U266, to yield a hybridoma producing a desired human antibody that is able to bind to the polypeptide can be obtained (Unexamined Published Japanese Patent Application No. (JP-A) Sho 63-17688).
  • the obtained hybridomas are subsequently transplanted into the abdominal cavity of a mouse and the ascites are extracted.
  • the obtained monoclonal antibodies can be purified by, for example, ammonium sulfate precipitation, a protein A or protein G column, DEAE ion exchange chromatography or an affinity column to which the polypeptide ofthe present invention is coupled.
  • the antibody ofthe present invention can be used not only for purification and detection ofthe polypeptide ofthe present invention, but also as a candidate for agonists and antagonists ofthe polypeptide ofthe present invention.
  • this antibody can be applied to the antibody treatment for diseases related to the polypeptide ofthe present invention.
  • a human antibody or a humanized antibody is preferable for reducing immunogenicity.
  • transgenic animals having a repertory of human antibody genes may be immunized with an antigen selected from a polypeptide, polypeptide expressing cells or their lysates.
  • Antibody producing cells are then collected from the animals and fused with myeloma cells to obtain hybridoma, from which human antibodies against the polypeptide can be prepared (see WO92-03918, WO93-2227, WO94-02602, WO94-25585,
  • an immune cell such as an immunized lymphocyte, producing antibodies may be immortalized by an oncogene and used for preparing monoclonal antibodies.
  • Monoclonal antibodies thus obtained can be also recombinantly prepared using genetic engineering techniques (see, for example, Borrebaeck and Larrick, Therapeutic Monoclonal Antibodies, published in the United Kingdom by MacMillan Publishers LTD (1990)).
  • a DNA encoding an antibody may be cloned from an immune cell, such as a hybridoma or an immunized lymphocyte producing the antibody, inserted into an appropriate vector, and introduced into host cells to prepare a recombinant antibody.
  • an antibody ofthe present invention may be a fragment of an antibody or modified antibody, so long as it binds to one or more ofthe polypeptides ofthe invention.
  • the antibody fragment may be Fab, F(ab') 2 , Fv or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston et al., Proc Natl Acad Sci USA 85: 5879-83 (1988)). More specifically, an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin.
  • a gene encoding the antibody fragment may be constructed, inserted into an expression vector and expressed in an appropriate host cell (see, for example, Co et al., J Immunol 152: 2968-76 (1994); Better and Horwitz, Methods Enzymol 178: 476-96 (1989); Pluckthun and Skerra, Methods Enzymol 178: 497-515 (1989); Lamoyi, Methods Enzymol 121: 652-63 (1986); Rousseaux et al., Methods Enzymol 121: 663-9 (1986); Bird and Walker, Trends Biotechnol 9: 132-7 (1991)).
  • An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG).
  • the present invention provides for such modified antibodies.
  • the modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in the field.
  • an antibody ofthe present invention may be obtained as a chimeric antibody, between a variable region derived from nonhuman antibody and the constant region derived from human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from nonhuman antibody, the frame work region (FR) and the constant region derived from human antibody.
  • CDR complementarity determining region
  • FR frame work region
  • Such antibodies can be prepared according to known technology. Humanization can be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see e.g., Verhoeyen et al, Science 239:1534-1536 (1988)).
  • humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species.
  • Fully human antibodies comprising human variable regions in addition to human framework and constant regions can also be used.
  • Such antibodies can be produced using various techniques known in the art. For example in vitro methods involve use of recombinant libraries of human antibody fragments displayed on bacteriophage (e.g., Hoogenboom & Winter, J. Mol. Biol. 227:381 (1991), Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated.
  • Antibodies obtained as above may be purified to homogeneity.
  • the separation and purification ofthe antibody can be performed according to separation and purification methods used for general proteins.
  • the antibody may be separated and isolated by the appropriately selected and combined use of column chromatographies, such as affinity chromatography, filter, ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel electrophoresis and isoelectric focusing (Antibodies: A Laboratory Manual.
  • a protein A column and protein G column can be used as the affinity column.
  • Exemplary protein A columns to be used include, for example, Hyper D, POROS and Sepharose F.F. (Pharmacia).
  • Exemplary chromatography, with the exception of affinity includes, for example, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse-phase chromatography, adso ⁇ tion chromatography and the like (Strategies for Protein
  • the chromatographic procedures can be carried out by liquid-phase chromatography, such as HPLC and FPLC.
  • chromatographic procedures can be carried out by liquid-phase chromatography, such as HPLC and FPLC.
  • measurement of absorbance enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), radioimmunoassay (RIA) and/or immunofluorescence may be used to measure the antigen binding activity ofthe antibody ofthe invention.
  • ELISA enzyme-linked immunosorbent assay
  • EIA enzyme immunoassay
  • RIA radioimmunoassay
  • the antibody ofthe present invention is immobilized on a plate, a polypeptide ofthe invention is applied to the plate, and then a sample containing a desired antibody, such as culture supernatant of antibody producing cells or purified antibodies, is applied.
  • a secondary antibody that recognizes the primary antibody and is labeled with an enzyme such as alkaline phosphatase
  • an enzyme substrate such as >-nitrophenyl phosphate
  • a fragment ofthe polypeptide, such as a C-terminal or N-terminal fragment, may be used as the antigen to evaluate the binding activity ofthe antibody.
  • BIAcore Pharmacia
  • the above methods allow for the detection or measurement ofthe polypeptide of the invention, by exposing the antibody ofthe invention to a sample assumed to contain the polypeptide ofthe invention, and detecting or measuring the immune complex formed by the antibody and the polypeptide. Because the method of detection or measurement ofthe polypeptide according to the invention can specifically detect or measure a polypeptide, the method may be useful in a variety of experiments in which the polypeptide is used.
  • Antisense polynucleotides, small interfering EN As and ribozymes The present invention includes an antisense oligonucleotide that hybridizes with any site within the nucleotide sequence of SEQ ID NO: lor 3. This antisense oligonucleotide is preferably against at least about 15 continuous nucleotides ofthe nucleotide sequence of SEQ ID NO: 1 or 3.
  • the above-mentioned antisense oligonucleotide, which contains an initiation codon in the above-mentioned at least 15 continuous nucleotides, is even more preferred.
  • Derivatives or modified products of antisense ohgonucleotides can also be used as antisense ohgonucleotides.
  • modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications.
  • antisense ohgonucleotides means, not only those in which the nucleotides corresponding to those constituting a specified region of a DNA or mRNA are entirely complementary, but also those having a mismatch of one or more nucleotides, as long as the DNA or mRNA and the antisense oligonucleotide can specifically hybridize with the nucleotide sequence of SEQ ID NO: 1 or 3.
  • Such polynucleotides are contained as those having, in the "at least about 15 continuous nucleotide sequence region", a homology of at least 70%) or higher, preferably at 80%) or higher, more preferably about 90% or higher, even more preferably about 95% or higher.
  • the algorithm stated herein can be used to determine the homology. Algorithms known in the art can be used to determine the homology. Furthermore, derivatives or modified products ofthe antisense-oligonucleotides can also be used as antisense-oligonucleotides in the present invention. Examples of such modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications. Such antisense polynucleotides are useful as probes for the isolation or detection of
  • the antisense oligonucleotide derivatives ofthe present invention act upon cells producing the polypeptide ofthe invention by binding to the DNA or mRNA encoding the polypeptide, inhibiting its transcription or translation, promoting the degradation ofthe mRNA and inhibiting the expression ofthe polypeptide ofthe invention, thereby resulting in the inhibition ofthe polypeptide 's function.
  • the present invention also includes small interfering RNAs (siRNA) comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid ofthe nucleotide sequence of SEQ ID NO: 1 or 3.
  • siRNA for suppressing the expression of CCDC4 include those that target the nucleotide sequence of SEQ ID NO: 8.
  • siRNA refers to a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques are used for introducing siRNA into cells, including those wherein DNA is used as the template to transcribe RNA.
  • the siRNA comprises a sense nucleic acid sequence and an antisense nucleic acid sequence of the polynucleotide encoding human CCDC4 protein (SEQ ID NO: 1 or 3).
  • the siRNA is constructed such that a single transcript (double stranded RNA) has both the sense and complementary antisense sequences from the target gene, e.g., a hai ⁇ in. Binding ofthe siRNA to a transcript corresponding to CCDC4 in the target cell results in a reduction in the protein production by the cell.
  • the length of the oligonucleotide is at least 10 nucleotides and may be as long as the naturally-occurring the transcript.
  • the oligonucleotide is about 19 to about 25 nucleotides in length.
  • the oligonucleotide is less than about 75, about 50, about 25 nucleotides in length.
  • a CCDC4 siRNA is directly introduced into the cells in a form that is capable of binding to the mRNA transcripts. In these embodiments, the siRNA molecules ofthe invention are typically modified as described above for antisense molecules.
  • the DNA encoding the CCDC4 siRNA is in a vector.
  • Vectors are produced for example by cloning a CCDC4 target sequence into an expression vector operatively-linked regulatory sequences flanking the CCDC4 sequence in a manner that allows for expression (by transcription ofthe DNA molecule) of both strands (Lee, N.S., Dohjima, T, Bauer, G, Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J.
  • RNA molecule that is antisense to CCDC4 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3' of the cloned DNA) and an RNA molecule that is the sense strand for the CCDC4 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' of the cloned DNA).
  • a first promoter e.g., a promoter sequence 3' of the cloned DNA
  • RNA molecule that is the sense strand for the CCDC4 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' of the cloned DNA).
  • the sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing ofthe CCDC4 gene.
  • two constructs are utilized to create the sense and antisense strands of a siRNA construct.
  • Cloned CCDC4 can encode a construct having secondary structure, e.g., hai ⁇ ins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene. Furthermore, a loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the hai ⁇ in loop structure.
  • the present invention also provides siRNA having the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA from a CCDC4 gene.
  • [A] is a ribonucleotide sequence corresponding a sequence of nucleotides 1666-1684 (SEQ ID NO: 8) of SEQ ID NO: l or 3
  • [B] is a ribonucleotide sequence consisting of about 3 to about 23 nucleotides
  • [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A].
  • the loop sequence may consist of arbitrary sequence having preferably 3 to 23 nucleotide in length.
  • the loop sequence for example, can be selected from group consisting of following sequences (http://www.ambion.com techlib/tb/tb_506.html).
  • nucleotide "u" can be added to the 3 'end of [A'], in order to enhance the inhibiting activity ofthe siRNA.
  • the number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5.
  • loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV- 1 replication by RNA interference. Nature 418: 435-438.).
  • CCC, CCACC or CCACACC Jacque, J. M., Triques, K., and Stevenson, M. "Modulation of HIV-1 replication by RNA interference.” Nature, Vol. 418: 435-438 (2002);
  • UUCG Lee, N.S., Dohjima, T, Bauer, G, Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J.
  • the loop sequence can be selected from group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA.
  • Preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA).
  • gaugguucugcagcaccac-[B]-guggugcugcagaaccauc for target sequence of SEQ ID NO: 8.
  • the regulatory sequences flanking the CCDC4 sequence are identical or are different, such that their expression can be modulated independently, or in a temporal or spatial manner.
  • siRNAs are transcribed intracellularly by cloning the CCDC4 gene templates into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter.
  • transfection-enhancing agent can be used. FuGENE (Rochediagnostices), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical) are useful as the transfection-enhancing agent.
  • the nucleotide sequence of siRNAs may be designed using an siRNA design computer program available from the Ambion website
  • Nucleotide sequences for the siRNA are selected by the computer program based on the following protocol: Selection of siRNA Target Sites: 1. Beginning with the AUG start codon ofthe object transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl, et al. Targeted mRNA degradation by double-stranded RNA in vitro.
  • target sequences can be selected along the length ofthe gene for evaluation.
  • Ohgonucleotides and ohgonucleotides complementary to various portions of CCDC4 mRNA were tested in vitro for their ability to decrease production of CCDC4 in tumor cells (e.g., using the PC3, or DU145 prostate cancer cell line) according to standard methods.
  • a reduction in CCDC4 gene product in cells contacted with the candidate siRNA composition compared to cells cultured in the absence ofthe candidate composition is detected using CCDC4-specific antibodies or other detection strategies. Sequences which decrease production of CCDC4 in in vitro cell-based or cell-free assays are then tested for there inhibitory effects on cell growth.
  • Sequences which inhibit cell growth in in vitro cell-based assay are test in in vivo in rats or mice to confirm decreased CCDC4 production and decreased tumor cell growth in animals with malignant neoplasms.
  • double-stranded molecules that include the nucleic acid sequence of target sequences, for example, nucleotides 1666-1684 (SEQ ID NO: 8) of SEQ ID NO: 1 or 3.
  • the double-stranded molecule comprising a sense strand and an antisense strand
  • the sense strand comprises a ribonucleotide sequence corresponding to SEQ ID NO: 8
  • the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand
  • said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule
  • said double-stranded molecule when introduced into a cell expressing the CCDC4 gene, inhibits expression of said gene.
  • the isolated nucleic acid is RNA or derivatives thereof
  • base "t" should be replaced with "u” in the nucleotide sequences.
  • the term “complementary” refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule
  • binding means the physical or chemical interaction between two nucleic acids or compounds or associated nucleic acids or compounds or combinations thereof.
  • Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches.
  • the sense strand and antisense strand ofthe isolated nucleotide ofthe present invention can form double stranded nucleotide or hai ⁇ in loop structure by the hybridization. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 matches.
  • duplexes contain no mismatches.
  • the nucleic acid molecule is less than 8763 nucleotides (for SEQ ID NO: 1) or 8692 nucleotides (for SEQ ID NO: 3) in length.
  • the nucleic acid molecule is less than 500, 200, or 75 nucleotides in length.
  • the isolated nucleic acids ofthe present invention are useful for siRNA against CCDC4 or DNA encoding the siRNA.
  • the sense strand is preferably longer than about 19 nucleotides, and more preferably longer than about 21 nucleotides.
  • the antisense oligonucleotide or siRNA ofthe invention inhibit the expression of the polypeptide ofthe invention and is thereby useful for suppressing the biological activity ofthe polypeptide ofthe invention.
  • expression-inhibitors, comprising the antisense oligonucleotide or siRNA ofthe invention are useful in the point that they can inhibit the biological activity ofthe polypeptide ofthe invention. Therefore, a composition comprising antisense oligonucleotide or siRNA ofthe present invention are useful in treating a prostate cancer.
  • CCDC4 siRNA oligonucleotide which inhibit the expression in mammalian cells include the target sequence containing SEQ ID NO: 8.
  • nucleotide "u” can be added to 3 'end ofthe antisense strand ofthe target sequence.
  • the number of "u”s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5.
  • the added "u”s form single strand at the 3 'end ofthe antisense strand ofthe siRNA.
  • expression-inhibitors comprising the antisense oligonucleotide or siRNA of the invention, are useful in the point that they can inhibit the biological activity ofthe polypeptide ofthe invention.
  • a composition comprising the antisense oligonucleotide or siRNA ofthe present invention is useful in treating a cell proliferative disease such as prostate cancer.
  • the present invention provides ribozymes that inhibit the expression ofthe CCDC4 polypeptide ofthe present invention.
  • ribozymes are classified into large ribozymes and small ribozymes.
  • a large ribozyme is known as an enzyme that cleaves the phosphate ester bond of nucleic acids. After the reaction with the large ribozyme, the reacted site consists of a
  • the large ribozyme is further classified into (1) group I intron RNA catalyzing transesterification at the 5 '-splice site by guanosine; (2) group II intron RNA catalyzing self-splicing through a two step reaction via lariat structure; and (3) RNA component ofthe ribonuclease P that cleaves the tRNA precursor at the 5' site through hydrolysis.
  • small ribozymes have a smaller size (about 40 bp) compared to the large ribozymes and cleave RNAs to generate a 5 '-hydroxyl group and a 2'-3' cyclic phosphate.
  • ribozymes inhibiting the expression ofthe polypeptides ofthe present invention can also be constructed based on their sequence information (SEQ ID NO: 1 or 3) and these conventional methods. Ribozymes against CCDC4 gene inhibit the expression of over-expressed CCDC4 protein and is thus useful for suppressing the biological activity ofthe protein. Therefore, the ribozymes are useful in treating or preventing prostate cancer.
  • the present invention provides a method for diagnosing cell proliferative disease such as prostate cancer using the expression level ofthe genes ofthe present invention as a diagnostic marker.
  • This diagnosing method comprises the steps of: (a) detecting the expression level of the CCDC4 gene ofthe present invention; and (b) relating an elevation ofthe expression level to prostate cancer.
  • the expression levels ofthe CCDC4 gene in a biological sample can be estimated by quantifying mRNA corresponding to or protein encoded by the CCDC4 gene. Quantification methods for mRNA are known to those skilled in the art. For example, the levels of mRNAs corresponding to the CCDC4 gene can be estimated by Northern blotting or RT-PCR.
  • the full-length nucleotide sequences ofthe CCDC4 genes are shown in SEQ ID NO: 1 or 3, anyone skilled in the art can design the nucleotide sequences for probes or primers to quantify the CCDC4 gene.
  • the expression level ofthe CCDC4 gene can be analyzed based on the activity or quantity of protein encoded by the gene.
  • a method for determining the quantity ofthe CCDC4 protein is shown in below.
  • immunoassay methods are useful for the determination ofthe proteins in biological materials. Any biological materials can be used as the biological sample for the determination ofthe protein or it's activity so long as the marker gene (CCDC4 gene) is expressed in the sample of a prostate cancer patient.
  • prostate duct epithelium can be mentioned as such biological sample.
  • bodily fluids such as blood and urine may be also analyzed.
  • a suitable method can be selected for the determination ofthe activity of a protein encoded by the CCDC4 gene according to the activity of a protein to be analyzed.
  • Expression levels ofthe CCDC4 gene in a biological sample are estimated and compared with those in a normal sample (e.g., a sample derived from a non-diseased subject). When such a comparison shows that the expression level ofthe target gene is higher than those in the normal sample, the subject is judged to be affected with prostate cancer.
  • the expression level of CCDC4 gene in the biological samples from a normal subject and subject to be diagnosed may be determined at the same time.
  • normal ranges ofthe expression levels can be determined by a statistical method based on the results obtained by analyzing the expression level ofthe gene in samples previously collected from a control group. A result obtained by comparing the sample of a subject is compared with the normal range; when the result does not fall within the normal range, the subject is judged to be affected with or is at risk of developing prostate cancer.
  • a diagnostic agent for diagnosing cell proliferative disease such as prostate cancer, is also provided.
  • the diagnostic agent ofthe present invention comprises a compound that binds to a polynucleotide or a polypeptide ofthe present invention.
  • an oligonucleotide that hybridizes to the polynucleotide ofthe present invention or an antibody that binds to the polypeptide ofthe present invention may be used as such a compound.
  • the present method of diagnosing prostate cancer may be applied for assessing the efficacy of treatment of prostate cancer in a subject.
  • a biological sample such as a test cell population, is obtained from a subject undergoing treatment for prostate cancer.
  • the method for assessment can be conducted according to conventional methods of diagnosing prostate cancer. If desired, biological samples are obtained from the subject at various time points before, during or after the treatment.
  • the expression level of CCDC4 gene, in the biological sample is then determined and compared to a control level derived, for example, from a reference cell population which includes cells whose state of prostate cancer (i.e., cancerous cell or non-cancerous cell) is known.
  • the control level is determined in a biological sample that has not been exposed to the treatment. If the control level is derived from a biological sample which contains no cancerous cell, a similarity between the expression level in the subject-derived biological sample and the control level indicates that the treatment is efficacious. A difference between the expression level ofthe CCDC4 gene in the subject-derived biological sample and the control level indicates a less favorable clinical outcome or prognosis.
  • the term “efficacious” refers that the treatment leads to a reduction in the expression of a pathologically up-regulated gene (CCDC4 gene) or a decrease in size, prevalence or proliferating potential of prostate cancer cells in a subject.
  • CCDC4 gene pathologically up-regulated gene
  • "efficacious” indicates that the treatment retards or prevents occurrence of prostate cancer.
  • the assessment of prostate cancer can be made using standard clinical protocols.
  • the efficaciousness of a treatment is determined in association with any known method for diagnosing or treating prostate cancer.
  • the present method of diagnosing prostate cancer may also be applied for assessing the prognosis of a subject with prostate cancer by comparing the expression level of CCDC4 gene in a patient-derived biological sample, such as test cell population, to a control level.
  • the expression level of CCDC4 gene in a biological sample derived from patients may be measured over a spectrum of disease stages to assess the prognosis ofthe patient.
  • An increase in the expression level of CCDC4 gene compared to a normal control level indicates less favorable prognosis.
  • a decrease in the expression level of CCDC4 gene indicates a more favorable prognosis for the patient.
  • the present invention provides a method of screening for a compound for treating or preventing prostate cancer using the polypeptide ofthe present invention.
  • An embodiment of this screening method comprises the steps of: (a) contacting a test compound with a polypeptide ofthe present invention; (b) detecting the binding activity between the polypeptide ofthe present invention and the test compound; and (c) selecting the compound that binds to the polypeptide ofthe present invention.
  • the polypeptide ofthe present invention to be used for screening may be a recombinant polypeptide or a protein derived from the nature or a partial peptide thereof.
  • the polypeptide ofthe present invention to be contacted with a test compound can be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides.
  • a method of screening for proteins for example, that bind to the polypeptide of the present invention using the polypeptide ofthe present invention, many methods well known by a person skilled in the art can be used. Such a screening can be conducted by, for example, immunoprecipitation method, specifically, in the following manner.
  • the gene encoding the polypeptide ofthe present invention is expressed in host (e.g., animal) cells and so on by inserting the gene to an expression vector for foreign genes, such as pSV2neo, pcDNA I, pcDNA3.1, pCAGGS and pCD8.
  • the promoter to be used for the expression may be any promoter that can be used commonly and include, for example, the SV40 early promoter (Rigby in Williamson (ed.), Genetic Engineering, vol. 3.
  • the introduction ofthe gene into host cells to express a foreign gene can be performed according to any methods, for example, the electroporation method (Chu et al., Nucleic Acids Res 15: 1311-26 (1987)), the calcium phosphate method (Chen and Okayama, Mol Cell Biol 7: 2745-52 (1987)), the DEAE dextran method (Lopata et al., Nucleic Acids Res 12: 5707-17 (1984); Sussman and Milman, Mol Cell Biol 4: 1642-3 (1985)), the Lipofectin method (Derijard, B Cell 7: 1025-37 (1994); Lamb et al., Nature Genetics 5: 22-30 (1993): Rabindran et al., Science 259: 230-4 (1993)) and so on.
  • electroporation method Chou et al., Nucleic Acids Res 15: 1311-26 (1987)
  • the calcium phosphate method Choen and Okayama, Mol Cell Biol 7: 27
  • the polypeptide ofthe present invention can be expressed as a fusion protein comprising a recognition site (epitope) of a monoclonal antibody by introducing the epitope ofthe monoclonal antibody, whose specificity has been revealed, to the N- or C- terminus ofthe polypeptide ofthe present invention.
  • a commercially available epitope-antibody system can be used (Experimental Medicine 13: 85-90 (1995)).
  • Vectors which can express a fusion protein with, for example, ⁇ -galactosidase, maltose binding protein, glutathione S-transferase, green florescence protein (GFP) and so on by the use of its multiple cloning sites are commercially available.
  • a fusion protein prepared by introducing only small epitopes consisting of several to a dozen amino acids so as not to change the property ofthe polypeptide ofthe present invention by the fusion is also reported.
  • Epitopes such as polyhistidine (His-tag), influenza aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple he ⁇ es virus glycoprotein (HSV-tag), E-tag (an epitope on monoclonal phage) and such, and monoclonal antibodies recognizing them can be used as the epitope-antibody system for screening proteins binding to the polypeptide ofthe present invention (Experimental Medicine 13: 85-90 (1995)).
  • an immune complex is formed by adding these antibodies to cell lysate prepared using an appropriate detergent.
  • the immune complex consists of the polypeptide ofthe present invention, a polypeptide comprising the binding ability with the polypeptide, and an antibody. Immunoprecipitation can be also conducted using antibodies against the polypeptide ofthe present invention, besides using antibodies against the above epitopes, which antibodies can be prepared as described above.
  • An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody.
  • an immune complex can be formed in the same manner as in the use ofthe antibody against the polypeptide ofthe present invention, using a substance specifically binding to these epitopes, such as glutathione-Sepharose 4B.
  • Immunoprecipitation can be performed by following or according to, for example, the methods in the literature (Harlow and Lane, Antibodies, 511-52, Cold Spring Harbor Laboratory publications, New York (1988)). SDS-PAGE is commonly used for analysis of immunoprecipitated proteins and the bound protein can be analyzed by the molecular weight ofthe protein using gels with an appropriate concentration.
  • the detection sensitivity for the protein can be improved by culturing cells in culture medium containing radioactive isotope, 35 S-methionine or 35 S-cystein, labeling proteins in the cells, and detecting the proteins.
  • the target protein can be purified directly from the SDS-polyacrylamide gel and its sequence can be determined, when the molecular weight of a protein has been revealed.
  • a protein binding to the polypeptide ofthe present invention can be obtained by preparing a cDNA library from cells, tissues, organs (for example, tissues such as testis or prostate ), or cultured cells (e.g.,PC3, DU145) expected to express a protein binding to the polypeptide ofthe present invention using a phage vector (e.g.
  • the polypeptide ofthe invention may be labeled by utilizing the binding between biotin and avidin, or by utilizing an antibody that specifically binds to the polypeptide ofthe present invention, or a peptide or polypeptide (for example, GST) that is fused to the polypeptide ofthe present invention. Methods using radioisotope or fluorescence and such may be also used.
  • a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", “Mammalian MATCHMAKER Two-Hybrid Assay Kit",
  • the polypeptide ofthe invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells.
  • a cDNA library is prepared from cells expected to express a protein binding to the polypeptide of the invention, such that the library, when expressed, is fused to the VP16 or GAL4 transcriptional activation region.
  • the cDNA library is then introduced into the above yeast cells and the cDNA derived from the library is isolated from the positive clones detected (when a protein binding to the polypeptide ofthe invention is expressed in yeast cells, the binding ofthe two activates a reporter gene, making positive clones detectable).
  • a protein encoded by the cDNA can be prepared by introducing the cDNA isolated above to E. coli and expressing the protein.
  • a reporter gene for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used in addition to the HIS3 gene.
  • a compound binding to the polypeptide ofthe present invention can also be screened using affinity chromatography.
  • the polypeptide ofthe invention may be immobilized on a carrier of an affinity column, and a test compound, containing a protein capable of binding to the polypeptide ofthe invention, is applied to the column.
  • a test compound herein may be, for example, cell extracts, cell lysates, etc. After loading the test compound, the column is washed, and compounds bound to the polypeptide ofthe invention can be prepared.
  • the test compound is a protein
  • the amino acid sequence ofthe obtained protein is analyzed, an oligo DNA is synthesized based on the sequence, and cDNA libraries are screened using the oligo DNA as a probe to obtain a DNA encoding the protein.
  • a biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound compound in the present invention.
  • the interaction between the polypeptide ofthe invention and a test compound can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the polypeptide ofthe invention and a test compound using a biosensor such as BIAcore.
  • the present invention provides a method of screening for a compound for treating or preventing prostate cancer using the polypeptide ofthe present invention comprising the steps as follows: (a) contacting a test compound with the polypeptide ofthe present invention; (b) detecting the biological activity ofthe polypeptide of step (a); and (c) selecting a compound that suppresses the biological activity ofthe polypeptide in comparison with the biological activity detected in the absence ofthe test compound. Since the CCDC4 protein ofthe present invention have the activity of promoting cell proliferation of prostate cancer cells, a compound which inhibits this activity of this protein ofthe present invention can be screened using this activity as an index. Any polypeptides can be used for screening so long as they comprise the biological activity ofthe CCDC4 protein.
  • Such biological activity include cell-proliferating activity ofthe human CCDC4 protein.
  • a human CCDC4 protein can be used and polypeptides functionally equivalent to these proteins can also be used.
  • Such polypeptides may be expressed endogenously or exogenously by cells.
  • the compound isolated by this screening is a candidate for agonists or antagonists ofthe polypeptide ofthe present invention.
  • agonist refers to molecules that activate the function ofthe polypeptide ofthe present invention by binding thereto.
  • antagonist refers to molecules that inhibit the function ofthe polypeptide ofthe present invention by binding thereto.
  • a compound isolated by this screening is a candidate for compounds which inhibit the in vivo interaction ofthe polypeptide ofthe present invention with molecules (including DNAs and proteins).
  • the biological activity to be detected in the present method is cell proliferation, it can be detected, for example, by preparing cells which express the polypeptide ofthe present invention, culturing the cells in the presence of a test compound, and determining the speed of cell proliferation, measuring the cell cycle and such, as well as by measuring the colony forming activity as described in the Examples.
  • the present invention provides methods for screening compounds for treating or preventing prostate cancer. As discussed in detail above, by controlling the expression levels ofthe CCDC4, one can control the onset and progression of prostate cancer.
  • compounds that may be used in the treatment or prevention of prostate cancer can be identified through screenings that use the expression levels of CCDC4 as indices.
  • screening may comprise, for example, the following steps: a) contacting a test compound with a cell expressing the CCDC4; and b) selecting a compound that reduces the expression level of CCDC4 in comparison with the expression level detected in the absence ofthe test compound.
  • Cells expressing at least one ofthe CCDC4 include, for example, cell lines established from prostate cancers; such cells can be used for the above screening ofthe present invention (e.g. , PC3, DU145).
  • the expression level can be estimated by methods well known to one skilled in the art.
  • a compound that reduces the expression level of CCDC4 can be selected as candidate agents to be used for the treatment or prevention of prostate cancer.
  • the screening method ofthe present invention may comprise the following steps: a) contacting a test compound with a cell into which a vector comprising the transcriptional regulatory region of one or more marker genes and a reporter gene that is expressed under the control ofthe transcriptional regulatory region has been introduced, wherein the one or more marker genes are CCDC4, b) measuring the expression level or activity of said reporter gene; and c) selecting a compound that reduces the expression level or activity of said reporter gene as compared to a control.
  • Suitable reporter genes and host cells are well known in the art.
  • the reporter construct required for the screening can be prepared by using the transcriptional regulatory region of a marker gene.
  • a reporter construct can be prepared by using the previous sequence information.
  • a nucleotide segment containing the transcriptional regulatory region can be isolated from a genome library based on the nucleotide sequence information ofthe marker gene.
  • supports that may be used for binding proteins include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercial available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they bay be filled into a column.
  • the binding of a protein to a support may be conducted according to routine methods, such as chemical bonding and physical adso ⁇ tion.
  • a protein may be bound to a support via antibodies specifically recognizing the protein.
  • binding of a protein to a support can be also conducted by means of avidin and biotin.
  • the binding between proteins is carried out in buffer, for example, but are not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding between the proteins.
  • a biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound protein.
  • the interaction between the proteins can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia).
  • CCDC4 polypeptide may be labeled, and the label ofthe bound protein may be used to detect or measure the bound protein.
  • the labeled protein is contacted with the other protein in the presence of a test compound, and then bound proteins are detected or measured according to the label after washing.
  • Labeling substances such as radioisotope (e.g., 3 H, 14 C, 32 P, 33 P, 35 S, 125 1, 131 I), enzymes (e.g., alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, ⁇ -glucosidase), fluorescent substances (e.g., fluorescein isothiosyanete (FITC), rhodamine) and biotin/avidin, may be used for the labeling of a protein in the present method.
  • radioisotope e.g., 3 H, 14 C, 32 P, 33 P, 35 S, 125 1, 131 I
  • enzymes e.g., alkaline phosphatase, horseradish peroxidase, ⁇ -galactosidase, ⁇
  • the detection or measurement can be carried out by liquid scintillation.
  • proteins labeled with enzymes can be detected or measured by adding a substrate ofthe enzyme to detect the enzymatic change ofthe substrate, such as generation of color, with abso ⁇ tiometer.
  • the bound protein may be detected or measured using fluorophotometer.
  • the antibody is preferably labeled with one ofthe labeling substances mentioned above, and detected or measured based on the labeling substance.
  • the antibody against the CCDC4 polypeptide or actin may be used as a primary antibody to be detected with a secondary antibody that is labeled with a labeling substance.
  • the antibody bound to the protein in the screening ofthe present invention may be detected or measured using protein G or protein A column.
  • a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", “Mammalian MATCHMAKER Two-Hybrid Assay Kit”, “MATCHMAKER one-Hybrid system” (Clontech); “HybriZAP Two-Hybrid Vector System” (Stratagene); the references “Dalton and Treisman, Cell 68: 597-612 (1992)", “Fields and Sternglanz, Trends Genet 10: 286-92 (1994)”).
  • the CCDC4 polypeptide ofthe invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells.
  • a reporter gene for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used besides HIS3 gene.
  • Any test compound for example, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural compounds can be used in the screening methods ofthe present invention.
  • test compound ofthe present invention can be also obtained using any ofthe numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound” library method and (5) synthetic library methods using affinity chromatography selection.
  • the biological library methods using affinity chromatography selection is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145). Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al. (1993) Proc. Natl. Acad. Sci.
  • a compound isolated by the screening methods ofthe present invention is a candidate for drugs which inhibit the activity ofthe polypeptide ofthe present invention, for treating or preventing diseases attributed to, for example, cell proliferative diseases, such as prostate cancer.
  • compositions for treating or preventing prostate cancer comprising any ofthe compounds selected by the screening methods ofthe present invention.
  • a compound isolated by the screening methods ofthe present invention as a pharmaceutical for humans or other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, chimpanzees, for treating a cell proliferative disease (e.g., prostate cancer)
  • the isolated compound can be directly administered or can be formulated into a dosage form using known pharmaceutical preparation methods.
  • the drugs can be taken orally, as sugarcoated tablets, capsules, elixirs and microcapsules; or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid.
  • the compounds can be mixed with pharmacologically acceptable carriers or medium, specifically, sterilized water, physiological saline, plant-oil, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders and such, in a unit dose form required for generally accepted drug implementation.
  • the amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable.
  • additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry.
  • a liquid carrier such as oil, can also be further included in the above ingredients.
  • Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections.
  • Physiological saline, glucose, and other isotonic liquids including adjuvants can be used as aqueous solutions for injections.
  • adjuvants such as D-sorbitol, D-mannnose, D-mannitol and sodium chloride
  • Suitable solubilizers such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80 (TM) and HCO-50.
  • Sesame oil or Soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizers and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol, phenol; and an anti-oxidant.
  • the prepared injection may be filled into a suitable ampule.
  • Methods well known to one skilled in the art may be used to administer the inventive pharmaceutical compound to patients, for example as intraarterial, intravenous, percutaneous injections and also as intranasal, transbronchial, intramuscular or oral administrations.
  • the dosage and method of administration vary according to the body- weight and age of a patient and the administration method; however, one skilled in the art can routinely select them. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to perform the therapy.
  • the dosage and method of administration vary according to the body- weight, age, and symptoms of a patient but one skilled in the art can select them suitably.
  • the dose of a compound that binds with the polypeptide ofthe present invention and regulates its activity is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).
  • a normal adult weight 60 kg
  • the present invention provides pharmaceutical compositions for treating or preventing prostate cancer comprising active ingredients that inhibits the expression of CCDC4 gene.
  • active ingredients include antisense polynucleotides, siRNAs or ribozymes against the CCDC4 gene or derivatives, such as expression vector, of the antisense polynucleotides, siRNAs or ribozymes.
  • active ingredients can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivatives.
  • tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, stabilizers, preservatives, pain-killers and such.
  • the active ingredient is given to the patient by directly applying onto the ailing site or by injecting into a blood vessel so that it will reach the site of ailment.
  • a mounting medium can also be used to increase durability and membrane-permeability. Examples of mouting medium includes liposome, poly-L-lysine, lipid, cholesterol, lipofectine or derivatives of these.
  • compositions ofthe present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered.
  • Another embodiment ofthe present invention is a composition for treating or preventing prostate cancer comprising an antibody against a polypeptide encoded by the CCDC4 gene or fragments ofthe antibody that bind to the polypeptide.
  • the dose of an antibody or fragments thereof for treating or preventing prostate cancer is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg).
  • the invention provides a method for treating or preventing prostate cancer in a subject.
  • Therapeutic compounds are administered prophylactically or therapeutically to subject suffering from or at risk of (or susceptible to) developing prostate cancer. Such subjects are identified using standard clinical methods or by detecting an aberrant expression level or activity of CCDC4. Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or, alternatively, delayed in its progression.
  • the therapeutic method includes decreasing the expression or function of CCDC4 gene. In these methods, the subject is treated with an effective amount of a compound, which decreases the over-expressed genes (CCDC4 gene) in the subject. Administration can be systemic or local.
  • Therapeutic compounds include compounds that decrease the expression level of such gene endogenously existing in the prostate cancerous cells (i.e., compounds that down-regulate the expression ofthe over-expressed gene(s)).
  • CCDC4 gene may be also inhibited in any of several ways known in the art including administering to the subject a nucleic acid that inhibits or antagonizes the expression ofthe gene(s).
  • Antisense ohgonucleotides, siRNA or ribozymes which disrupts expression ofthe gene(s) can be used for inhibiting the expression ofthe genes.
  • antisense-oligonucleotides corresponding to the nucleotide sequence of CCDC4 gene can be used to reduce the expression level ofthe CCDC4 gene.
  • the antisense-oligonucleotides ofthe present invention may act by binding to any ofthe polypeptides encoded by the CCDC4 gene, or mRNAs corresponding thereto, thereby inhibiting the transcription or translation ofthe genes, promoting the degradation ofthe mRNAs, and/or inhibiting the expression of proteins encoded by the genes, and fmally inhibiting the function ofthe CCDC4 proteins.
  • An antisense-oligonucleotides and derivatives thereof can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivative and used in the method for treating or preventing prostate cancer ofthe present invention.
  • the nucleic acids that inhibit one or more gene products of over-expressed genes also include small interfering RNAs (siRNA) comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid ofthe nucleotide sequence encoding the CCDC4 gene.
  • siRNA small interfering RNAs
  • Standard techniques of introducing siRNA into the cell can be used in the treatment or prevention ofthe present invention, including those in which DNA is a template from which RNA is transcribed.
  • the siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a hai ⁇ in. The method is used to suppress gene expression of a cell with up-regulated expression ofthe CCDC4 gene.
  • the nucleic acids that inhibit one or more gene products of over-expressed genes also include ribozymes against the over-expressed gene (CCDC4 gene).
  • the present invention provides a method for treating or preventing a cell proliferative disease, such as prostate cancer, using an antibody against the polypeptide of the present invention.
  • a pharmaceutically effective amount of an antibody against the polypeptide ofthe present invention is administered. Since the expression ofthe CCDC4 protein are up-regulated in prostate cancer cells and the suppression ofthe expression of these proteins leads to the decrease in cell proliferating activity, it is expected that cell proliferative diseases can be treated or prevented by binding the antibody and these proteins.
  • an antibody against the polypeptide ofthe present invention is administered at a dosage sufficient to reduce the activity ofthe protein ofthe present invention, which is in the range of 0.1 to about 250 mg/kg per day.
  • the dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day.
  • an antibody binding to a cell surface marker specific for tumor cells can be used as a tool for drug delivery.
  • the antibody conjugated with a cytotoxic agent is administered at a dosage sufficient to injure tumor cells.
  • the present invention also relates to a method of inducing anti-tumor immunity comprising the step of administering CCDC4 protein or an immunologically active fragment thereof, or a polynucleotide encoding the protein or fragments thereof.
  • the CCDC4 protein or the immunologically active fragments thereof are useful as vaccines against cell proliferative diseases such as prostate cancer.
  • the proteins or fragments thereof may be administered in a form bound to the T cell receptor (TCR) or presented by an antigen presenting cell (APC), such as macrophage, dendritic cell (DC), or B-cells. Due to the strong antigen presenting ability of DC, the use of DC is most preferable among the APCs.
  • vaccine against cell proliferative disease refers to a substance that has the function to induce anti-tumor immunity upon inoculation into animals.
  • anti-tumor immunity includes immune responses such as follows: induction of cytotoxic lymphocytes against tumors, - induction of antibodies that recognize tumors, and induction of anti-tumor cytokine production. Therefore, when a certain protein induces any one of these immune responses upon inoculation into an animal, the protein is decided to have anti-tumor immunity inducing effect.
  • the induction ofthe anti-tumor immunity by a protein can be detected by observing in vivo or in vitro the response ofthe immune system in the host against the protein.
  • cytotoxic T lymphocytes For example, a method for detecting the induction of cytotoxic T lymphocytes is well known.
  • a foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs).
  • APCs antigen presenting cells
  • T cells that respond to the antigen presented by APC in antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to T cell by APC, and detecting the induction of CTL.
  • APC has the effect of activating CD4+ T cells, CD8+ T cells, macrophages, eosinophils, and NK cells. Since CD4+ T cells and CD8+ T cells are also important in anti-tumor immunity, the anti-tumor immunity inducing action ofthe peptide can be evaluated using the activation effect of these cells as indicators.
  • APC is well known in the art.
  • DC is a representative APC having the strongest CTL inducing action among APCs.
  • the test polypeptide is initially contacted with DC, and then this DC is contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after the contact with DC shows that the test polypeptide has an activity of inducing the cytotoxic T cells.
  • Activity of CTL against tumors can be detected, for example, using the lysis of 51 Cr-labeled tumor cells as the indicator.
  • the method of evaluating the degree of tumor cell damage using 3 H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known.
  • peripheral blood mononuclear cells may also be used as the APC.
  • the induction of CTL is reported that it can be enhanced by culturing PBMC in the presence of GM-CSF and IL-4.
  • CTL has been shown to be induced by culturing PBMC in the presence of keyhole limpet hemocyanin (KLH) and IL-7.
  • KLH keyhole limpet hemocyanin
  • the test polypeptides confirmed to possess CTL inducing activity by these methods are polypeptides having DC activation effect and subsequent CTL inducing activity. Therefore, polypeptides that induce CTL against tumor cells are useful as vaccines against tumors.
  • APC that acquired the ability to induce CTL against rumors by contacting with the polypeptides are useful as vaccines against tumors.
  • CTL that acquired cytotoxicity due to presentation ofthe polypeptide antigens by APC can be also used as vaccines against tumors.
  • Such therapeutic methods for tumors using anti-tumor immunity due to APC and CTL are referred to as cellular immunotherapy.
  • efficiency ofthe CTL-induction is known to increase by combining a plurality of polypeptides having different structures and contacting them with DC. Therefore, when stimulating DC with protein fragments, it is advantageous to use a mixture of multiple types of fragments.
  • the induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal immunized with the polypeptide and when growth of tumor cells is suppressed by those antibodies, the polypeptide can be determined to have an ability to induce anti-tumor immunity.
  • Anti-tumor immunity is induced by administering the vaccine of this invention, and the induction of anti-tumor immunity enables treatment and prevention of cell proliferating diseases, such as prostate cancers.
  • Therapy against cancer or prevention of the onset of cancer includes any ofthe steps, such as inhibition ofthe growth of cancerous cells, involution of cancer and suppression of occurrence of cancer.
  • Such therapeutic and preventive effects are preferably statistically significant. For example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a vaccine against cell proliferative diseases is compared to a control without vaccine administration.
  • Student's t-test, the Mann- Whitney U-test or ANOVA may be used for statistical analysis.
  • the above-mentioned protein having immunological activity or a vector encoding the protein may be combined with an adjuvant.
  • An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity.
  • Examples of adjuvants include cholera toxin, salmonella toxin, alum and such, but are not limited thereto.
  • the vaccine of this invention may be combined appropriately with a pharmaceutically acceptable carrier.
  • a pharmaceutically acceptable carrier examples include sterilized water, physiological saline, phosphate buffer, culture fluid and such.
  • the vaccine may contain as necessary, stabilizers, suspensions, preservatives, surfactants and such.
  • the vaccine is administered systemically or locally. Vaccine administration may be performed by single administration or boosted by multiple administrations.
  • tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs of a subject receiving treatment or prevention therapy are collected, the cells are contacted with the polypeptide ex vivo, and following the induction of APC or CTL, the cells may be administered to the subject.
  • APC can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo.
  • APC or CTL induced in vitro can be cloned prior to administration. By cloning and growing cells having high activity of damaging target cells, cellular immunotherapy can be performed more effectively.
  • APC and CTL isolated in this manner may be used for cellular immunotherapy not only against individuals from whom the cells are derived, but also against similar types of tumors from other individuals.
  • a pharmaceutical composition for treating or preventing a cell proliferative disease, such as prostate cancer comprising a pharmaceutically effective amount ofthe CCDC4 polypeptide is provided.
  • the pharmaceutical composition may be used for raising anti tumor immunity.
  • the normal expression of CCDC4 is restricted to testis and prostate.
  • the CCDC4 polypeptides are preferable for treating cell proliferative disease, especially prostate cancers. Furthermore, since peptide fragments of proteins specifically expressed in cancerous cells were revealed to induce immune response against the cancer, peptide fragments of CCDC4 can also be used in a pharmaceutical composition for treating or preventing cell proliferative diseases such as prostate cancers.
  • the polypeptide or fragment thereof is administered at a dosage sufficient to induce anti-tumor immunity, which is in the range of 0.1 mg to 10 mg, preferably 0.3mg to 5mg, more preferably 0.8mg to 1.5 mg. The administrations are repeated.
  • lmg ofthe peptide or fragment thereof may be administered 4 times in every two weeks for inducing the anti-tumor immunity.
  • polynucleotides encoding CCDC4, or fragments thereof may be used for raising anti tumor immunity.
  • Such polynucleotides may be inco ⁇ orated in an expression vector to express CCDC4, or fragments thereof in a subject to be treated.
  • the present invention encompasses method for inducing anti tumor immunity wherein the polynucleotides encoding CCDC4, or fragments thereof are administered to a subject suffering or being at risk of developing cell proliferative diseases such as prostate cancer.
  • the following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same.
  • RNAs were purified from prostate cancer cells, PIN cells, and normal prostate duct epithelium that were microdissected from 20 prostate cancer tissues by laser microbeam microdissection. T7-based RNA amplification was carried out to obtain adequate RNA for microarray experiments. Aliquots of amplified RNA from prostate cancer cells and normal duct epithelium were labeled by reverse transcription with Cy5-dCTP and Cy3-dCTP, respectively (Amersham Biosciences, Buckinghamshire, UK).
  • the 361-bp PCR product was prepared by RT-PCR using primers: 5'-GTGACAAATCCATTGATCCTGA-3' (SEQ ID NO:5) and 5'- GAACACGTGGCATTCTAGAGGTA-3' (SEQ ID NO:6). Pre-hybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were auto-radiographed with intensifying screens at -80°C for 7 days. RT-PCR analysis validated the over-expression of CCDC4 in prostate cancer cells ( Figure 1 A).
  • siRNA-expressing constructs and colony formation / MTT assay.
  • the present inventors used siRNA-expression vector (psiU6BX) for RNAi effect to the target genes.
  • the U6 promoter was cloned into the upstream ofthe gene specific sequence (19nt sequence from the target transcript separated by a short spacer
  • TTCAAGAGA (SEQ ID NO: 7) from the reverse complement ofthe same sequence) and five thymidines as a termination signal; furthermore neo cassette was integrated to become resistant to Geneticin (Sigma).
  • the target sequences for CCDC4 are 5'-GATGGTTCTGCAGCACCAC-3' (SEQ.ID.NO.8) (si#l), and 5'-GAAGCAGCACGACTTCTTC-3' (SEQ.ID.NO.9) (siEGFP) as a negative control.
  • the ohgonucleotides used for CCDC4 siRNA are shown below.
  • si#l was prepared by cloning the following double-stranded oligonucleotide into the Bbsl site ofthe psiU6BX vector.
  • the corresponding nucleotide position relative to the CCDC4 nucleic acid sequence of SEQ ID NO: 1 or 3 is shown below.
  • the oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence ofthe target sequence CCDC4.
  • the nucleotide sequence ofthe hai ⁇ in loop structure of si#l is shown in SEQ ID NO: 10 (endonuclease recognition cites are eliminated from each hai ⁇ in loop structure sequence).
  • si#l (nucleotide numbers 1666-1684 of SEQ ID No: 1 or 3/ SEQ ID NO: 8) 5'-caccgatggt tctgcagcac cacttcaaga gagtggtgct gcagaaccat c-3' (SEQ ID NO: 11) 5'-aaaagatggt tctgcagcac cactctcttg aagtggtgct gcagaaccat c-3' (SEQ ID NO: 12)
  • Prostate cancer cell lines, PC3 and DU145 were plated onto 10-cm dishes (5 X 105 cells/dish) and transfected with psiU6BX containing EGFP target sequence (EGFP) and psiU6BX containing CCDC4 target sequence using Lipofectamine 2000 (Invitrogen) according to manufacture's instruction.
  • RT-PCR validated knockdown effect of CCDC4 mRNA by transfection of siRNA expression vectors si#l , but not by siEGFP.
  • Colony formation assay showed drastic decrease of colony numbers in the cells after transfection with si#l that were validated to knock down CCDC4 effectively by RT-PCR.
  • MTT assay also showed drastic decreased number ofthe grown cells transfected with si#l .
  • the genomic fragment ofthe snRNA U6 gene containing the promoter region was amplified by PCR using a set of primers, 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No: 14), and 5'-TAGGCCCCACCTCCTTCTAT-3' (SEQ ID No: 15) and human placental DNA as a template.
  • the product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen).
  • the BamRl, Xhol fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' (SEQ ID No: 16) and 5'- CTCTATCTCGAGTGAGGCGGAAAGAACCA-3 ' (SEQ ID No: 17).
  • the ligated DNA was used for a template of PCR with primers, 5'-TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTTTTCT-3' (SEQ ID No: 18) and 5'-TTTAAGCTTGAAGACACGGTGTTTCGTCCTTTCCACA-3' (SEQ ID No: 19).
  • the product was digested with Hindl ⁇ l, which was subsequently self-ligated to produce psiU6BX vector plasmid.
  • psiU6BX-EGFP was prepared by cloning double-stranded ohgonucleotides of
  • CTTC -3' (SEQ ID No: 21) into the Bbsl site in the psiU6BX vector.
  • CCDC4 human genes CCDC4 is markedly elevated in prostate cancer as compared to non-cancerous prostate duct epithelium. Accordingly, this gene is useful as a diagnostic marker of prostate cancer and the proteins encoded thereby are useful in diagnostic assays of prostate cancer.
  • the present inventors have also shown that the expression of novel protein CCDC4 promotes cell growth whereas cell growth is suppressed by small interfering RNAs corresponding to the CCDC4 gene. These findings show that CCDC4 protein stimulates oncogenic activity. Thus, each of these novel oncoproteins is a useful target for the development of anti-cancer pharmaceuticals.
  • agents that block the expression of CCDC4, or prevent its activity find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of prostate cancers.
  • agents include antisense ohgonucleotides, small interfering RNAs, and ribozymes against the CCDC4 gene, and antibodies that recognize CCDC4.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Organic Chemistry (AREA)
  • Microbiology (AREA)
  • Toxicology (AREA)
  • Pathology (AREA)
  • General Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Investigating Or Analysing Biological Materials (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present application provides novel human gene CCDC4 whose expression is markedly elevated in prostate cancers. The gene and polypeptide encoded by the gene can be used, for example, in the diagnosis of prostate cancers, as target molecules for developing drugs against the disease, and for attenuating cell growth of prostate cancer.

Description

DESCRIPTION
GENES AND POLYPEPTIDES RELATING TO PROSTATE CANCERS This application claims the benefit of U.S provisional Application Serial No. 60/555,810 filed March 23, 2004, the contents of which are hereby incorporated by reference in its entirely.
Technical Field The present invention relates to the field of biological science, more specifically to the field of cancer therapy and diagnosis. In particular, the present invention relates to novel polypeptides encoded by a novel gene B3537 (CCDC4) relating to prostate cancer. Furthermore, the present invention relates to the novel gene CCDC4. The genes and polypeptides ofthe present invention can be used, for example, in the diagnosis of prostate cancer, as target molecules for developing drugs against the disease, and for attenuating cell growth of prostate cancer.
Background Art Prostate cancer is one ofthe most common cancers in male in Western countries
(Gronberg, Lancet 361 : 859-64 (2003)). Incidence of prostate cancer is steadily increasing in developed countries due to the prevalence of Western-style diet and increasing number of senior population. Early diagnosis through serum testing for prostate specific antigen (PSA) provides an opportunity for curative surgery and has significantly improved the prognosis of prostate cancer. However, up to 30% of patients treated with radical prostatectomy relapse cancer (Han et al., J Urol 166: 416-9 (2001)). Most relapsed or advanced cancers respond to androgen ablation therapy because the growth of prostate cancer is androgen-dependent in the initial stages. However, most of the patients treated by the therapy eventually progress to androgen-independent disease, at which point they are no longer responsive to the therapy. The most serious clinical problem of prostate cancer is that androgen-independent prostate cancer is unresponsive to any other therapies (Gronberg, Lancet 361 : 859-64 (2003)). Thus, the establishment of new therapies other than androgen ablation therapy against prostate cancer is an urgent issue for the management of prostate cancer. cDNA microarray technologies have provided comprehensive profiles of gene expression in normal and malignant cells, and the ability to compare the gene expression in malignant and corresponding normal cells (Okabe et al., Cancer Res 61:2129-37 (2001); Kitahara et al., Cancer Res 61: 3544-9 (2001); Lin et al., Oncogene 21:4120-8 (2002); Hasegawa et al., Cancer Res 62:7012-7 (2002)). This approach enables understanding of the complex nature of cancer cells, and helps to understand the mechanism of carcinogenesis. Identification of genes that are deregulated in tumors can lead to more precise and accurate diagnosis of individual cancers, and to develop novel therapeutic targets (Bienz and Clevers, Cell 103:311 -20 (2000)). To disclose mechanisms underlying tumors from a genome-wide point of view, and to discover target molecules for diagnosis and development of novel therapeutic drugs, the present inventors have been analyzing the expression profiles of tumor cells using a cDNA microarray of 23040 genes (Okabe et al., Cancer Res 61 :2129-37 (2001); Kitahara et al., Cancer Res 61 :3544-9 (2001); Lin et al., Oncogene 21 :4120-8 (2002); Hasegawa et al., Cancer Res 62:7012-7 (2002)). Studies designed to reveal mechanisms of carcinogenesis have already facilitated identification of molecular targets for anti-tumor agents. For example, inhibitors of farnesyltransferase (FTIs) which were originally developed to inhibit the growth-signaling pathway related to Ras, whose activation depends on posttranslational farnesylation, has been effective in treating Ras-dependent tumors in animal models (He et al., Cell 99:335-45 (1999)). Clinical trials on human using a combination or anti-cancer drugs and anti-HER2 monoclonal antibody, trastuzumab, have been conducted to antagonize the proto-oncogene receptor HER2/neu; and have been achieving improved clinical response and overall survival of breast-cancer patients (Lin et al., Cancer Res 61:6345-9 (2001)). A tyrosine kinase inhibitor, STI-571, which selectively inactivates bcr-abl fusion proteins, has been developed to treat chronic myelogenous leukemias wherein constitutive activation of bcr-abl tyrosine kinase plays a crucial role in the transformation of leukocytes. Agents of these kinds are designed to suppress oncogenic activity of specific gene products (Fujita et al., Cancer Res 61 :7722-6 (2001)). Therefore, gene products commonly up-regulated in cancerous cells may serve as potential targets for developing novel anti-cancer agents. In fact, novel drugs targeting abnormally expressed molecules that have causative effects on cancer growth and progression have been proven to be effective to certain types of cancers. Such drugs include Herceptin for breast cancer, Glivec (STI571) for CML and Iressa (ZD1839) for non-small cell lung cancer. Several molecules have been known to be over-expressed in prostate cancer and are identified as therapeutic targets or markers of prostate cancer (Xu et al., Cancer Res 60: 6568-72 (2000); Luo et al, Cancer Res 62: 2220-6 (2002)). However, most of them are also highly expressed in other major organs. Thus, agents that target these molecules may be toxic to cancer cells but may also adversely affect normally growing cells of other organs. It has been demonstrated that CD8+ cytotoxic T lymphocytes (CTLs) recognize epitope peptides derived from tumor-associated antigens (TAAs) presented on MHC Class I molecule, and lyse tumor cells. Since the discovery of MAGE family as the first example of TAAs, many other TAAs have been discovered using immunological approaches (Boon, Int J Cancer 54: 177-80 (1993); Boon and van der Bruggen, J Exp Med 183: 725-9 (1996); van der Bruggen et al., Science 254: 1643-7 (1991); Brichard et al., J Exp Med 178: 489-95 (1993); Kawakami et al., J Exp Med 180: 347-52 (1994)). Some of the discovered TAAs are now in the stage of clinical development as targets of immunotherapy. TAAs discovered so far include MAGE (van der Bruggen et al., Science 254: 1643-7 (1991)), gplOO (Kawakami et al., J Exp Med 180: 347-52 (1994)), SART (Shichijo et al., J Exp Med 187: 277-88 (1998)), and NY-ESO-1 (Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997)). On the other hand, gene products which had been demonstrated to be specifically over-expressed in tumor cells, have been shown to be recognized as targets inducing cellular immune responses. Such gene products include p53 (Umano et al., Brit J Cancer 84: 1052-7 (2001)), HER2/neu (Tanaka et al., Brit J Cancer 84: 94-9 (2001)), CEA (Nukaya et al., Int J Cancer 80: 92-7 (1999)), and so on. In spite of significant progress in basic and clinical research concerning TAAs
(Rosenbeg et al, Nature Med 4: 321-7 (1998); Mukherji et al., Proc Natl Acad Sci USA 92: 8078-82 (1995); Hu et al., Cancer Res 56: 2479-83 (1996)), only limited number of candidate TAAs for the treatment of adenocarcinomas, including colorectal cancer, are available. TAAs abundantly expressed in cancer cells, and at the same time which expression is restricted to cancer cells would be promising candidates as immunotherapeutic targets. Further, identification of new TAAs inducing potent and specific antitumor immune responses is expected to encourage clinical use of peptide vaccination strategy in various types of cancer (Boon and can der Bruggen, J Exp Med 183: 725-9 (1996); van der Bruggen et al, Science 254: 1643-7 (1991); Brichard et al., J Exp Med 178: 489-95 (1993); Kawakami et al., J Exp Med 180: 347-52 (1994); Shichijo et al., J Exp Med 187: 277-88 (1998); Chen et al., Proc Natl Acad Sci USA 94: 1914-8 (1997); Harris, J Natl Cancer Inst 88: 1442-5 (1996); Butterfield et al., Cancer Res 59: 3134-42 (1999); Vissers et al., Cancer Res 59: 5554-9 (1999); van der Burg et al., J Immunol 156: 3308-14 (1996); Tanaka et al., Cancer Res 57: 4465-8 (1997); Fujie et al, Int J Cancer 80: 169-72 (1999); Kikuchi et al., Int J Cancer 81 : 459-66 (1999); Oiso et al., Int J Cancer 81: 387-94 (1999)). It has been repeatedly reported that peptide-stimulated peripheral blood mononuclear cells (PBMCs) from certain healthy donors produce significant levels of IFN-γ in response to the peptide, but rarely exert cytotoxicity against tumor cells in an HLA-A24 or -A0201 restricted manner in 51Cr-release assays (Kawano et al., Cancer Res 60: 3550-8 (2000); Nishizaka et al., Cancer Res 60: 4830-7 (2000); Tamura et al., Jpn J Cancer Res 92: 762-7 (2001)). However, both of HLA-A24 and HLA-A0201 are one of the common HLA alleles in Japanese, as well as Caucasian populations (Date et al., Tissue Antigens 47: 93-101 (1996); Kondo et al., J Immunol 155: 4307-12 (1995); Kubo et al., J Immunol 152: 3913-24 (1994); Imanishi et al., Proceeding ofthe eleventh International Histocompatibility Workshop and Conference Oxford University Press, Oxford, 1065 (1992); Williams et al., Tissue Antigen 49: 129 (1997)). Thus, antigenic peptides of cancers presented by these HLAs may be especially useful for the treatment of cancers among Japanese and Caucasian populations. Further, it is known that the induction of low-affinity CTL in vitro usually results from the use of peptide at a high concentration, generating a high level of specific peptide/MHC complexes on antigen presenting cells
(APCs), which will effectively activate these CTL (Alexander-Miller et al., Proc Natl Acad Sci USA 93: 4102-7 (1996)).
Summary ofthe Invention To disclose the mechanism of prostate cancer and identify novel diagnostic markers and/or drug targets for the treatment of these tumors, the present inventors analyzed the expression profiles of genes in prostate cancer using a genome- wide cDNA microarray combined with laser microbeam microdissection. In the previous study, precise expression profiles of prostate cancer cells (PRCs) and non-invasive precursor cells (PINs) by combining laser microdissection with genome-wide cDNA microarrays was performed. Comparing the expression profiles of invasive PRCs with normal prostatic epithelium or non-invasive precursor PINs, the present inventors identified 88 up-regulated genes and 207down-regulated genes commonly in both invasive PRCs and precursor PP s. In the present invention, the present inventors focused on one EST and identified a novel gene, CCDC4, over-expressed in prostate cancer cells. . As a result, CCDC4 was identified as specifically over-expressed gene in prostate cancer cells. The present inventors show the knocking-down effect of CCDC4 by siRNA attenuated the growth of prostate cancer cells and this molecule can be potentially targeted for drug design for novel therapies of prostate cancer. CCDC4 encodes a 530-amino acid protein comprising coiled-coiled domain. According to a Northern blot analysis, the expression of CCDC4 was shown to be restricted to testis and prostate. Many anticancer drugs are not only toxic to cancer cells but also for normally growing cells. However, agents suppressing the expression of CCDC4 may not adversely affect other organs due to the fact that normal expression of CCDC4 is restricted to testis and prostate, and thus may be conveniently used for treating or preventing prostate cancer. Thus, the present invention provides isolated gene, CCDC4 which serves as candidates of diagnostic markers for prostate cancer as well as promising potential targets for developing new strategies for diagnosis and effective anti-cancer agents. Furthermore, the present invention provides polypeptide encoded by this gene, as well as the production and the use ofthe same. More specifically, the present invention provides novel human polypeptide, CCDC4 or a functional equivalent thereof, which expressions are elevated in prostate cancer cells. In a preferred embodiment, the CCDC4 polypeptide includes a 530 amino acid protein encoded by the open reading frame of SEQ ID NO: 1 or a 437 amino acid protein encoded by the open reading frame of SEQ F NO : 3. The CCDC4 polypeptide preferably includes the amino acid sequence set forth in SEQ ID NO: 2 (Gene Bank Accession number: AB126828)or 4 (Gene Bank Accession number: AB 126829). The present application also provides an isolated protein encoded from at least a portion ofthe CCDC4 polynucleotide sequence, or polynucleotide sequences at least 15% and more preferably at least 25% complementary to the sequence set forth in SEQ ID NO: 1 or 3.
The present invention further provides a novel human gene CCDC4 whose expressions is markedly elevated in a great majority of prostate cancers as compared to corresponding non-cancerous prostate duct epithelium. The isolated CCDC4 gene includes a polynucleotide sequence as described in SEQ ID NO: 1 or 3. In particular, the CCDC4 cDNA includes 8763 nucleotides that contain an open reading frame of 1593 nucleotides (SEQ ID NO: 1) or 8692 nucleotides that contain an open reading frame of 1314 nucleotides (SEQ ID NO: 3). The present invention further encompasses polynucleotides which hybridize to and which are at least 15% and more preferably at least 25% complementary to the polynucleotide sequence set forth in SEQ ID NO: 1 or 3, to the extent that they encode a CCDC4 protein or a functional equivalent thereof. Examples of such polynucleotides are degenerates and allelic mutants of CCDC4 encoded by the sequence of SEQ ID NO: 1 or 3. As used herein, an isolated gene is a polynucleotide the structure of which is not identical to that of any naturally occurring polynucleotide or to that of any fragment of a naturally occurring genomic polynucleotide spanning more than three separate genes. The term therefore includes, for example, (a) a DNA which has the sequence of part of a naturally occurring genomic DNA molecule in the genome ofthe organism in which it naturally occurs; (b) a polynucleotide incoφorated into a vector or into the genomic DNA of a prokaryote or eukaryote in a manner such that the resulting molecule is not identical to any naturally occurring vector or genomic DNA; (c) a separate molecule such as a cDNA, a genomic fragment, a fragment produced by polymerase chain reaction (PCR), or a restriction fragment; and (d) a recombinant nucleotide sequence that is part of a hybrid gene, i.e., a gene encoding a fusion polypeptide. Accordingly, in one aspect, the invention provides an isolated polynucleotide that encodes a polypeptide described herein or a fragment thereof. Preferably, the isolated polynucleotide includes a nucleotide sequence that is at least 60% identical to the nucleotide sequence shown in SEQ ID NO: 1 or 3. More preferably, the isolated nucleic acid molecule is at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%> or more, identical to the nucleotide sequence shown in SEQ ID NO: 1 or 3. In the case of an isolated polynucleotide which is longer than or equivalent in length to the reference sequence, e.g., SEQ ID NO: 1 or 3, the comparison is made with the full length ofthe reference sequence. Where the isolated polynucleotide is shorter than the reference sequence, e.g., shorter than SEQ ID NO: 1 or 3, the comparison is made to a segment ofthe reference sequence ofthe same length (excluding any loop required by the homology calculation). The present invention also provides a method of producing a protein by transfecting or transforming a host cell with a polynucleotide sequence encoding the CCDC4 protein, and expressing the polynucleotide sequence. In addition, the present invention provides vectors comprising a nucleotide sequence encoding the CCDC4 protein, and host cells harboring a polynucleotide encoding the CCDC4 protein. Such vectors and host cells may be used for producing the CCDC4 protein. A binding agent that specifically recognizes the CCDC4 protein is also provided by the present application. For example, a binding agent may be an antibody raised against a CCD4 protein. Alternatively, a binding agent may be a ligand specific for the protein, or a synthetic polypeptide that specifically binds the protein (see e.g., WO2004044011). An antisense polynucleotide (e.g., antisense DNA), ribozyme, and siRNA (small interfering RNA) ofthe CCDC4 gene is also provided. The present invention further provides a method for diagnosis of prostate cancer which includes the step of determining an expression level ofthe gene in a biological sample from a subject, comparing the expression level of CCDC4 gene with that in a normal sample, and defining that a high expression level ofthe CCDC4 gene in the sample indicates that the subject suffers from or is at risk of developing prostate cancer. Further, a method of screening for a compound for treating or preventing prostate cancer is provided by the present invention. The method includes contacting the CCDC4 polypeptide with test compounds, and selecting test compounds that bind to or that alter the biological activity ofthe CCDC4 polypeptide. The present invention further provides a method of screening for a compound for treating or preventing prostate cancer, wherein the method includes contacting a test compound with a cell expressing the CCDC4 polypeptide or introduced with a vector comprising the transcriptional regulatory region of CCDC4 upstream of a reporter gene, and selecting the test compound that suppresses the expression level ofthe CCDC4 polypeptide. The present application also provides a pharmaceutical composition for treating or preventing prostate cancer. The pharmaceutical composition may be, for example, an anti-cancer agent. The pharmaceutical composition can comprise at least a portion of antisense S-oligonucleotides, siRNA molecules or ribozymes against the CCDC4 polynucleotide sequence shown and described in SEQ ID NOs: 1 and 3, respectively. A suitable siRNA targets a sequence of SEQ ID NO: 8. Thus, an siRNA ofthe invention comprises a nucleotide sequence from SEQ ID NO: 8. This may be preferably selected as targets for treating or preventing prostate cancer according to the present invention. The pharmaceutical compositions may be also those comprising the compounds selected by the present methods of screening for compounds for treating or preventing cell proliferative diseases such as prostate cancer. The course of action ofthe pharmaceutical composition is desirably to inhibit growth ofthe cancerous cells such as prostate cancer cells. The pharmaceutical composition may be applied to mammals including humans and domesticated mammals. The present invention further provides methods for treating or preventing prostate cancer using the pharmaceutical composition provided by the present invention. In addition, the present invention provides method for treating or preventing cancer, which method comprises the step of administering the CCDC4 polypeptide. It is expected that anti tumor immunity is induced by the administration ofthe CCDC4 polypeptide. Thus, the present invention also provides method for inducing anti tumor immunity, which method comprises the step of administering the CCDC4 polypeptide, as well as pharmaceutical composition for treating or preventing cancer comprising the CCDC4 polypeptide. It is to be understood that both the foregoing summary ofthe invention and the following detailed description are of a preferred embodiment, and not restrictive ofthe invention or other alternate embodiments ofthe invention.
Brief Description ofthe Drawings Fig.1(A) depicts photographs showing the results of semi-quantitative PCR. CCDC4 was over-expressed in prostate cancer cells microdissected from human prostate cancer tissues. Fig.1 (B) depicts photographs of Northern blot analysis showing the expression pattern in normal adult tissues of CCDC4. The 8.7kb transcript, CCDC4, is expressed restrictedly only in adult testis and prostate. Fig.2 shows the effects of Knocking-down endogenous CCDC4 in prostate cancer cell line, PRC3, by siRNA. Fig.2(A) is a photograph showing the results of RT-PCR. This photograph validates the knockdown effect of CCDC4 mRNA by transfection of siRNA expression vectors si#l . The si#l was designed specifically for CCDC4 mRNA sequence, and siEGFP was for EGFP mRNA sequence. RNA was harvested 48 hours after transfection and analyzed. ACTB was used to normalize input cDNA. Fig.2(B) is a photograph showing the results of colony formation assay. This photograph shows the drastic decrease of colony numbers in PRC3 cells one week after transfection with si#l that was validated to knock down CCDC4 effectively by RT-PCR. Fig.2(C) is a bar chart showing the results of MTT assay. This assay also shows the drastic decreased number of the grown cells transfected with si#l .
Detailed Description ofthe Invention The words "a", "an" and "the" as used herein mean "at least one" unless otherwise specifically indicated. To disclose the mechanism of prostate cancer and identify novel diagnostic markers and/or drug targets for the treatment and/or prevention of these tumors, the present inventors analyzed the expression profiles of genes in prostate cancer using a genome-wide cDNA microarray combined with laser microbeam microdissection. As a result, CCDC4 specifically over-expressed in prostate cancer cells was identified. Furthermore, suppression ofthe expression of CCDC4 gene with small interfering RNAs (siRNAs) resulted in a significant growth-inhibition of cancerous cells. These findings suggest that CCDC4 render oncogenic activities to cancer cells, and that inhibition ofthe activity of these proteins could be a promising strategy for the treatment and prevention of proliferative diseases such as prostate cancers.
CCDC4 According to the present invention, two genes with a similar sequence were identified and encode variants of CCDC4. The cDNA ofthe longer variant consists of 8763 nucleotides containing an open reading frame of 1593 nucleotides (SEQ ID NO: 1) and the shorter variant consists of 8692 nucleotides containing an open reading frame of 1314 nucleotides (SEQ ID NO: 3). These open reading frames encode a 530 amino acid-protein and a 437 amino acid-protein, respectively. Thus, the present invention provides substantially pure polypeptides encoded by these genes including polypeptides comprising the amino acid sequence of SEQ ID NO: 2 or 4, as well as functional equivalents thereof, to the extent that they encode a CCDC4 protein. Examples of polypeptides functionally equivalent to CCDC4 include, for example, homologous proteins of other organisms corresponding to the human CCDC4 protein, as well as mutants of human CCDC4 proteins. In the present invention, the term "functionally equivalent" means that the subject polypeptide has the activity to promote cell proliferation like the CCDC4 protein and to confer oncogenic activity to cancer cells. Whether the subject polypeptide has a cell proliferation activity or not can be judged by introducing the DNA encoding the subject polypeptide into a cell, expressing the respective polypeptide and detecting promotion of proliferation ofthe cells or increase in colony forming activity. Such cells include, for example, NIH3T3, COS7 and HEK293. Methods for preparing polypeptides functionally equivalent to a given protein are well known by a person skilled in the art and include known methods of introducing mutations into the protein. For example, one skilled in the art can prepare polypeptides functionally equivalent to the human CCDC4 protein by introducing an appropriate mutation in the amino acid sequence of these proteins by site-directed mutagenesis
(Hashimoto-Gotoh et al., Gene 152:271-5 (1995); Zoller and Smith, Methods Enzymol 100: 468-500 (1983); Kramer et al., Nucleic Acids Res. 12:9441-9456 (1984); Kramer and Fritz, Methods Enzymol 154: 350-67 (1987); Kunkel, Proc Natl Acad Sci USA 82: 488-92 (1985); Kunkel, Methods Enzymol 85: 2763-6 (1988)). Amino acid mutations can occur in nature, too. The polypeptide ofthe present invention includes those proteins having the amino acid sequences ofthe human CCDC4 protein in which one or more amino acids are mutated, provided the resulting mutated polypeptides are functionally equivalent to the human CCDC4 protein. The number of amino acids to be mutated in such a mutant is generally 10 amino acids or less, preferably 6 amino acids or less, and more preferably 3 amino acids or less. Mutated or modified proteins, proteins having amino acid sequences modified by substituting, deleting, inserting and/or adding one or more amino acid residues of a certain amino acid sequence, have been known to retain the original biological activity (Mark et al., Proc Natl Acad Sci USA 81 : 5662-6 (1984); Zoller and Smith, Nucleic Acids Res 10:6487-500 (1982); Dalbadie-McFarland et al., Proc Natl Acad Sci USA 79: 6409-13 (1982)). The amino acid residue to be mutated is preferably mutated into a different amino acid in which the properties ofthe amino acid side-chain are conserved (a process known as conservative amino acid substitution). Examples of properties of amino acid side chains are hydrophobic amino acids (A, I, L, M, F, P, W, Y, N), hydrophilic amino acids (R, D, Ν, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, N, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, Ν, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W). Note, the parenthetic letters indicate the one-letter codes of amino acids. An example of a polypeptide to which one or more amino acids residues are added to the amino acid sequence of human CCDC4 protein is a fusion protein containing the human CCDC4 protein. Fusion proteins, fusions ofthe human CCDC4 protein and other peptides or proteins, are included in the present invention. Fusion proteins can be made by techniques well known to a person skilled in the art, such as by linking the DNA encoding the human CCDC4 protein ofthe invention with DNA encoding other peptides or proteins, so that the frames match, inserting the fusion DNA into an expression vector and expressing it in a host. There is no restriction as to the peptides or proteins fused to the protein ofthe present invention. Known peptides that can be used as peptides that are fused to the protein of the present invention include, for example, FLAG (Hopp et al., Biotechnology 6: 1204-10 (1988)), 6xHis containing six His (histidine) residues, lOxHis, Influenza agglutinin (HA), human c-myc fragment, VSP-GP fragment, plδHIV fragment, T7-tag, HSN-tag, E-tag, SV40T antigen fragment, lck tag, α-tubulin fragment, B-tag, Protein C fragment and the like. Examples of proteins that may be fused to a protein ofthe invention include GST (glutathione-S-transferase), Influenza agglutinin (HA), immunoglobulin constant region, β-galactosidase, MBP (maltose-binding protein) and such. Fusion proteins can be prepared by fusing commercially available DΝA, encoding the fusion peptides or proteins discussed above, with the DΝA encoding the polypeptide of the present invention and expressing the fused DΝA prepared. An alternative method known in the art to isolate functionally equivalent polypeptides is, for example, the method using a hybridization technique (Sambrook et al., Molecular Cloning 2nd ed. 9.47-9.58, Cold Spring Harbor Lab. Press (1989)). One skilled in the art can readily isolate a DΝA having high homology with a whole or part of the DΝA sequence encoding the human CCDC4 protein (i.e., SEQ ID NO: 1 or 3), and isolate functionally equivalent polypeptides to the human CCDC4 protein from the isolated DNA. The polypeptides ofthe present invention include those that are encoded by DNA that hybridize with a whole or part ofthe DNA sequence encoding the human CCDC4 protein and are functionally equivalent to the human CCDC4 protein. These polypeptides include mammal homologues corresponding to the protein derived from human (for example, a polypeptide encoded by a monkey, rat, rabbit and bovine gene). In isolating a cDNA highly homologous to the DNA encoding the human CCDC4 protein from animals, it is particularly preferable to use tissues from testis or prostate. The condition of hybridization for isolating a DNA encoding a polypeptide functionally equivalent to the human CCDC4 protein can be routinely selected by a person skilled in the art. For example, hybridization may be performed by conducting prehybridization at 68°C for 30 min or longer using "Rapid-hyb buffer" (Amersham LIFE SCIENCE), adding a labeled probe, and warming at 68°C for 1 hour or longer. The following washing step can be conducted, for example, in a low stringent condition. A low stringent condition is, for example, 42°C, 2X SSC, 0.1% SDS, or preferably 50°C, 2X SSC, 0.1% SDS. More preferably, high stringent conditions are used. A high stringent condition is, for example, washing 3 times in 2X SSC, 0.01%) SDS at room temperature for 20 min, then washing 3 times in lx SSC, 0.1 % SDS at 37°C for 20 min, and washing twice in lx SSC, 0.1%) SDS at 50°C for 20 min. However, several factors, such as temperature and salt concentration, can influence the stringency of hybridization and one skilled in the art can suitably select the factors to achieve the requisite stringency. In place of hybridization, a gene amplification method, for example, the polymerase chain reaction (PCR) method, can be utilized to isolate a DNA encoding a polypeptide functionally equivalent to the human CCDC4 protein, using a primer synthesized based on the sequence information ofthe protein encoding DNA (SEQ ID NO: 1 or 3). Polypeptides that are functionally equivalent to the human CCDC4 protein encoded by the DNA isolated through the above hybridization techniques or gene amplification techniques normally have a high homology to the amino acid sequence ofthe human CCDC4 protein. "High homology" typically refers to a homology of 40% or higher, preferably 60% or higher, more preferably 80% or higher, even more preferably 85%), 90%, 93%, 95%, 98%), 99%) or higher between a polypeptide sequence or a polynucleotide sequence and a reference sequence. Percent homology (also referred to as percent identity) are typically carried out between two optimally aligned sequences. Methods of alignment of sequences for comparison are well-known in the art. Optimal alignment of sequences and comparison can be conducted, e.g., using the algorithm in "Wilbur and Lipman, Proc Natl Acad Sci USA 80: 726-30 (1983)". A polypeptide ofthe present invention have variations in amino acid sequence, molecular weight, isoelectric point, the presence or absence of sugar chains, or form, depending on the cell or host used to produce it or the purification method utilized. Nevertheless, so long as it has a function equivalent to that ofthe human CCDC4 protein ofthe present invention, it is within the scope ofthe present invention. The polypeptides ofthe present invention can be prepared as recombinant proteins or natural proteins, by methods well known to those skilled in the art. A recombinant protein can be prepared by inserting a DNA, which encodes the polypeptide ofthe present invention (for example, the DNA comprising the nucleotide sequence of SEQ ID NO: 1 or 3), into an appropriate expression vector, introducing the vector into an appropriate host cell, obtaining the extract, and purifying the polypeptide by subjecting the extract to chromatography, e.g., ion exchange chromatography, reverse phase chromatography, gel filtration or affinity chromatography utilizing a column to which antibodies against the protein ofthe present invention is fixed or by combining more than one of aforementioned columns. Also when the polypeptide ofthe present invention is expressed within host cells (for example, animal cells and E. coli) as a fusion protein with glutathione- S-transferase protein or as a recombinant protein supplemented with multiple histidines, the expressed recombinant protein can be purified using a glutathione column or nickel column. Alternatively, when the polypeptide ofthe present invention is expressed as a protein tagged with c-myc, multiple histidines or FLAG it can be detected and purified using antibodies to c-myc, His or FLAG, respectively. After purifying the fusion protein, it is also possible to exclude regions other than the objective polypeptide by cutting with thrombin or factor-Xa as required. A natural protein can be isolated by methods known to a person skilled in the art, for example, by contacting the affinity column, in which antibodies binding to the CCDC4 protein described below are bound, with the extract of tissues or cells expressing the polypeptide ofthe present invention. The antibodies can be polyclonal antibodies or monoclonal antibodies. The present invention also encompasses partial peptides ofthe polypeptide ofthe present invention. The partial peptide has an amino acid sequence specific to the polypeptide ofthe present invention and consists of at least 7 amino acids, preferably 8 amino acids or more, and more preferably 9 amino acids or more. The partial peptide can be used, for example, for preparing antibodies against the polypeptide ofthe present invention, screening for a compound that binds to the polypeptide ofthe present invention, and screening for inhibitors ofthe polypeptide ofthe present invention. A partial peptide ofthe invention can be produced by genetic engineering, by known methods of peptide synthesis or by digesting the polypeptide ofthe invention with an appropriate peptidase. For peptide synthesis, for example, solid phase synthesis or liquid phase synthesis may be used. The present invention further provides polynucleotides that encode such CCDC4 polypeptides described above. The polynucleotides ofthe present invention can be used for the in vivo or in vitro production ofthe polypeptide ofthe present invention as described above, or can be applied to gene therapy for diseases attributed to genetic abnormality in the gene encoding the protein ofthe present invention. Any form ofthe polynucleotide ofthe present invention can be used so long as it encodes the polypeptide ofthe present invention, including mRNA, RNA, cDNA, genomic DNA, chemically synthesized polynucleotides. The polynucleotide ofthe present invention includes a DNA comprising a given nucleotide sequences as well as its degenerate sequences, so long as the resulting DNA encodes a polypeptide ofthe present invention. The polynucleotide ofthe present invention can be prepared by methods known to a person skilled in the art. For example, the polynucleotide ofthe present invention can be prepared by: preparing a cDNA library from cells which express the polypeptide ofthe present invention, and conducting hybridization using a partial sequence ofthe DNA ofthe present invention (for example, SEQ ID NO: 1 or 3) as a probe. A cDNA library can be prepared, for example, by the method described in Sambrook et al., Molecular Cloning, Cold Spring Harbor Laboratory Press (1989); alternatively, commercially available cDNA libraries may be used. A cDNA library can be also prepared by: extracting RNAs from cells expressing the polypeptide ofthe present invention, synthesizing oligo DNAs based on the sequence ofthe DNA ofthe present invention (for example, SEQ ID NO: 1 or 3), conducting PCR using the oligo DNAs as primers, and amplifying cDNAs encoding the protein ofthe present invention. In addition, by sequencing the nucleotides ofthe obtained cDNA, the translation region encoded by the cDNA can be routinely determined, and the amino acid sequence of the polypeptide ofthe present invention can be easily obtained. Moreover, by screening the genomic DNA library using the obtained cDNA or parts thereof as a probe, the genomic DNA can be isolated. More specifically, mRNAs may first be prepared from a cell, tissue or organ (e.g., testis or prostate) in which the object polypeptide ofthe invention is expressed. Known methods can be used to isolate mRNAs; for instance, total RNA may be prepared by guanidine ultracentrifugation (Chirgwin et al., Biochemistry 18:5294-9 (1979)) or AGPC method (Chomczynski and Sacchi, Anal Biochem 162: 156-9 (1987)). In addition, mRNA may be purified from total RNA using mRNA Purification Kit (Pharmacia) and such. Alternatively, mRNA may be directly purified by QuickPrep mRNA Purification Kit (Pharmacia). The obtained mRNA is used to synthesize cDNA using reverse transcriptase. cDNA may be synthesized using a commercially available kit, such as the AMV Reverse Transcriptase First-strand cDNA Synthesis Kit (Seikagaku Kogyo). Alternatively, cDNA may be synthesized and amplified following the 5 '-RACE method (Frohman et al., Proc Natl Acad Sci USA 85: 8998-9002 (1988); Belyavsky et al., Nucleic Acids Res 17: 2919-32 (1989)), which uses a primer and such, described herein, the 5'-Ampli FINDER RACE Kit (Clontech), and polymerase chain reaction (PCR). A desired DNA fragment is prepared from the PCR products and ligated with a vector DNA. The recombinant vectors are used to transform E. coli and such, and a desired recombinant vector is prepared from a selected colony. The nucleotide sequence ofthe desired DNA can be verified by conventional methods, such as dideoxynucleotide chain termination. The nucleotide sequence of a polynucleotide ofthe invention may be designed to be expressed more efficiently by taking into account the frequency of codon usage in the host to be used for expression (Grantham et al., Nucleic Acids Res 9: 43-74 (1981)). The sequence ofthe polynucleotide ofthe present invention may be altered by a commercially available kit or a conventional method. For instance, the sequence may be altered by digestion with restriction enzymes, insertion of a synthetic oligonucleotide or an appropriate polynucleotide fragment, addition of a linker, or insertion ofthe initiation codon (ATG) and/or the stop codon (TAA, TGA or TAG). Specifically, the polynucleotide ofthe present invention encompasses the DNA comprising the nucleotide sequence of SEQ ID NO: 1 or 3. Furthermore, the present invention provides a polynucleotide that hybridizes under stringent conditions with a polynucleotide having a nucleotide sequence of SEQ ID NO: 1 or 3, and encodes a polypeptide functionally equivalent to the CCDC4 protein ofthe invention described above. One skilled in the art may appropriately choose stringent conditions. For example, low stringent condition can be used. More preferably, high stringent condition can be used. These conditions are the same as that described above. The hybridizing DNA above is preferably a cDNA or a chromosomal DNA. The present invention also provides a polynucleotide which is complementary to the polynucleotide encoding human CCDC4 protein (SEQ ID NO: 1 or 3) or the complementary strand thereof, and which comprises at least 15 nucleotides. The polynucleotide ofthe present invention is preferably a polynucleotide which specifically hybridizes with the DNA encoding the CCDC4 polypeptide ofthe present invention. The term "specifically hybridize" as used herein, means that cross-hybridization does not occur significantly with DNA encoding other proteins, under the usual hybridizing conditions, preferably under stringent hybridizing conditions. Such polynucleotides include, probes, primers, nucleotides and nucleotide derivatives (for example, antisense ohgonucleotides and ribozymes), which specifically hybridize with DNA encoding the polypeptide ofthe invention or its complementary strand. Moreover, such polynucleotide can be utilized for the preparation of DNA chip.
Vectors and host cells The present invention also provides a vector and host cell into which a polynucleotide ofthe present invention is introduced. A vector ofthe present invention is useful to keep a polynucleotide, especially a DNA, ofthe present invention in host cell, to express the polypeptide ofthe present invention, or to administer the polynucleotide ofthe present invention for gene therapy. When E. coli is a host cell and the vector is amplified and produced in a large amount in E. coli (e.g., JM109, DH5α, HB101 or XLlBlue), the vector should have "ori" to be amplified in E. coli and a marker gene for selecting transformed E. coli (e.g., a drug-resistance gene selected by a drug such as ampicillin, tetracycline, kanamycin, chloramphenicol or the like). For example, M13-series vectors, pUC-series vectors, pBR322, pBluescript, pCR-Script, etc. can be used. In addition, pGΕM-T, pDIRΕCT and pT7 can also be used for subcloning and extracting cDNA as well as the vectors described above. When a vector is used to produce the protein ofthe present invention, an expression vector is especially useful. For example, an expression vector to be expressed in E. coli should have the above characteristics to be amplified in E. coli. When E. coli, such as JM109, DH5α, HB101 or XL1 Blue, are used as a host cell, the vector should have a promoter, for example, lacZ promoter (Ward et al., Nature 341: 544-6 (1989); FASΕB J 6: 2422-7 (1992)), araB promoter (Better et al., Science 240: 1041-3 (1988)), T7 promoter or the like, that can efficiently express the desired gene in E. coli. In that respect, pGΕX-5X-l (Pharmacia), "QIAexpress system" (Qiagen), pEGFP and pET (in this case, the host is preferably BL21 which expresses T7 RNA polymerase), for example, can be used instead ofthe above vectors. Additionally, the vector may also contain a signal sequence for polypeptide secretion. An exemplary signal sequence that directs the polypeptide to be secreted to the periplasm ofthe E. coli is the pelB signal sequence (Lei et al., J Bacteriol 169: 4379 (1987)). Means for introducing ofthe vectors into the target host cells include, for example, the calcium chloride method, and the electroporation method. In addition to E. coli, for example, expression vectors derived from mammals (for example, pcDNA3 (Invitrogen) and pΕGF-BOS (Nucleic Acids Res 18(17): 5322 (1990)), pΕF, pCDM8), expression vectors derived from insect cells (for example, "Bac-to-BAC baculovirus expression system" (GIBCO BRL), pBacPAK8), expression vectors derived from plants (e.g., pMHl, pMH2), expression vectors derived from animal viruses (e.g., pHSN pMN pAdexLcw), expression vectors derived from retrovimses (e.g., pZIpneo), expression vector derived from yeast (e.g., "Pichia Expression Kit" (Invitrogen), pΝNll, SP-Q01) and expression vectors derived from Bacillus subtilis (e.g., pPL608, pKTH50) can be used for producing the polypeptide ofthe present invention. In order to express the vector in animal cells, such as CHO, COS or ΝIH3T3 cells, the vector should have a promoter necessary for expression in such cells, for example, the SV40 promoter (Mulligan et al., Nature 277: 108 (1979)), the MMLV-LTR promoter, the EFlα promoter (Mizushima et al., Nucleic Acids Res 18: 5322 (1990)), the CMV promoter and the like, and preferably a marker gene for selecting transformants (for example, a drug resistance gene selected by a drug (e.g., neomycin, G418)). Examples of known vectors with these characteristics include, for example, pMAM, pDR2, pBK-RSN, pBK-CMN pOPRSN and pOP13.
Producing polypeptides In addition, the present invention provides methods for producing a polypeptide of the present invention. The polypeptides may be prepared by culturing a host cell which harbors an expression vector comprising a gene encoding the polypeptide. According to needs, methods may be used to express a gene stably and, at the same time, to amplify the copy number ofthe gene in cells. For example, a vector comprising the complementary DHFR gene (e.g., pCHO I) may be introduced into CHO cells in which the nucleic acid synthesizing pathway is deleted, and then amplified by methotrexate (MTX). Furthermore, in case of transient expression of a gene, the method wherein a vector comprising a replication origin of SN40 (pcD, etc.) is transformed into COS cells comprising the SV40 T antigen expressing gene on the chromosome can be used. A polypeptide ofthe present invention obtained as above may be isolated from inside or outside (such as medium) of host cells and purified as a substantially pure homogeneous polypeptide. The term "substantially pure" as used herein in reference to a given polypeptide means that the polypeptide is substantially free from other biological macromolecules. The substantially pure polypeptide is at least 75%) (e.g., at least 80, 85, 95, or 99%) pure by dry weight. Purity can be measured by any appropriate standard method, for example by column chromatography, polyacrylamide gel electrophoresis, or HPLC analysis. The method for polypeptide isolation and purification is not limited to any specific method; in fact, any standard method may be used. For instance, column chromatography, filter, ultrafiltration, salt precipitation, solvent precipitation, solvent extraction, distillation, immunoprecipitation,
SDS-polyacrylamide gel electrophoresis, isoelectric point electrophoresis, dialysis, and recrystallization may be appropriately selected and combined to isolate and purify the polypeptide. Examples of chromatography include, for example, affinity chromatography, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse phase chromatography, adsorption chromatography, and such (Strategies for Protein Purification and Characterization: A Laboratory Course Manual. Ed. Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press (1996)). These chromatographies may be performed by liquid chromatography, such as HPLC and FPLC. Thus, the present invention provides for highly purified polypeptides prepared by the above methods. A polypeptide ofthe present invention may be optionally modified or partially deleted by treating it with an appropriate protein modification enzyme before or after purification. Useful protein modification enzymes include, but are not limited to, trypsin, chymotrypsin, lysylendopeptidase, protein kinase, glucosidase and so on.
Antibodies The present invention provides an antibody that binds to the polypeptide ofthe invention. The antibody ofthe invention can be used in any form, such as monoclonal or polyclonal antibodies, and includes antiserum obtained by immunizing an animal such as a rabbit with the polypeptide ofthe invention, all classes of polyclonal and monoclonal antibodies, human antibodies and humanized antibodies produced by genetic recombination. A polypeptide ofthe invention used as an antigen to obtain an antibody may be derived from any animal species, but preferably is derived from a mammal such as a human, mouse, or rat, more preferably from a human. A human-derived polypeptide may be obtained from the nucleotide or amino acid sequences disclosed herein.
According to the present invention, the polypeptide to be used as an immunization antigen may be a complete protein or a partial peptide ofthe protein. A partial peptide may comprise, for example, the amino (N)-terminal or carboxy (C)-terminal fragment of a polypeptide ofthe present invention. Herein, an antibody is defined as a protein that reacts with either the full length or a fragment of a polypeptide ofthe present invention. A gene encoding a polypeptide ofthe invention or its fragment may be inserted into a known expression vector, which is then used to transform a host cell as described herein. The desired polypeptide or its fragment may be recovered from the outside or inside of host cells by any standard method, and may subsequently be used as an antigen. Alternatively, whole cells expressing the polypeptide or their lysates or a chemically synthesized polypeptide may be used as the antigen. Any mammalian animal may be immunized with the antigen, but preferably the compatibility with parental cells used for cell fusion is taken into account. In general, animals of Rodentia, Lagomoφha or Primates are used. Animals of Rodentia include, for example, mouse, rat and hamster. Animals of Lagomoφha include, for example, rabbit. Animals of Primates include, for example, a monkey of Catarrhini (old world monkey) such as Macaca fascicularis, rhesus monkey, sacred baboon and chimpanzees. Methods for immunizing animals with antigens are known in the art. Intraperitoneal injection or subcutaneous injection of antigens is a standard method for immunization of mammals. More specifically, antigens may be diluted and suspended in an appropriate amount of phosphate buffered saline (PBS), physiological saline, etc. If desired, the antigen suspension may be mixed with an appropriate amount of a standard adjuvant, such as Freund's complete adjuvant, made into emulsion and then administered to mammalian animals. Preferably, it is followed by several administrations of antigen mixed with an appropriately amount of Freund's incomplete adjuvant every 4 to 21 days. An appropriate carrier may also be used for immunization. After immunization as above, serum is examined by a standard method for an increase in the amount of desired antibodies. Polyclonal antibodies against the polypeptides ofthe present invention may be prepared by collecting blood from the immunized mammal examined for the increase of desired antibodies in the serum, and by separating serum from the blood by any conventional method. Polyclonal antibodies include serum containing the polyclonal antibodies, as well as the fraction containing the polyclonal antibodies may be isolated from the serum. Immunoglobulin G or M can be prepared from a fraction which recognizes only the polypeptide ofthe present invention using, for example, an affinity column coupled with the polypeptide ofthe present invention, and further purifying this fraction using protein A or protein G column. To prepare monoclonal antibodies, immune cells are collected from the mammal immunized with the antigen and checked for the increased level of desired antibodies in the serum as described above, and are subjected to cell fusion. The immune cells used for cell fusion are preferably obtained from spleen. Other preferred parental cells to be fused with the above immunocyte include, for example, myeloma cells of mammalians, and more preferably myeloma cells having an acquired property for the selection of fused cells by drugs. The above immunocyte and myeloma cells can be fused according to known methods, for example, the method of Milstein et al. (Galfre and Milstein, Methods Enzymol 73: 3-46 (1981)). Resulting hybridomas obtained by the cell fusion may be selected by cultivating them in a standard selection medium, such as HAT medium (hypoxanthine, aminopterin and thymidine containing medium). The cell culture is typically continued in the HAT medium for several days to several weeks, the time being sufficient to allow all the other cells, with the exception ofthe desired hybridoma (non-fused cells), to die. Then, the standard limiting dilution is performed to screen and clone a hybridoma cell producing the desired antibody. In addition to the above method, in which a non-human animal is immunized with an antigen for preparing hybridoma, human lymphocytes such as those infected by EB virus may be immunized with a polypeptide, polypeptide expressing cells or their lysates in vitro. Then, the immunized lymphocytes are fused with human-derived myeloma cells that are capable of indefinitely dividing, such as U266, to yield a hybridoma producing a desired human antibody that is able to bind to the polypeptide can be obtained (Unexamined Published Japanese Patent Application No. (JP-A) Sho 63-17688). The obtained hybridomas are subsequently transplanted into the abdominal cavity of a mouse and the ascites are extracted. The obtained monoclonal antibodies can be purified by, for example, ammonium sulfate precipitation, a protein A or protein G column, DEAE ion exchange chromatography or an affinity column to which the polypeptide ofthe present invention is coupled. The antibody ofthe present invention can be used not only for purification and detection ofthe polypeptide ofthe present invention, but also as a candidate for agonists and antagonists ofthe polypeptide ofthe present invention. In addition, this antibody can be applied to the antibody treatment for diseases related to the polypeptide ofthe present invention. When the obtained antibody is to be administered to the human body (antibody treatment), a human antibody or a humanized antibody is preferable for reducing immunogenicity. For example, transgenic animals having a repertory of human antibody genes may be immunized with an antigen selected from a polypeptide, polypeptide expressing cells or their lysates. Antibody producing cells are then collected from the animals and fused with myeloma cells to obtain hybridoma, from which human antibodies against the polypeptide can be prepared (see WO92-03918, WO93-2227, WO94-02602, WO94-25585,
WO96-33735 and WO96-34096). Alternatively, an immune cell, such as an immunized lymphocyte, producing antibodies may be immortalized by an oncogene and used for preparing monoclonal antibodies. Monoclonal antibodies thus obtained can be also recombinantly prepared using genetic engineering techniques (see, for example, Borrebaeck and Larrick, Therapeutic Monoclonal Antibodies, published in the United Kingdom by MacMillan Publishers LTD (1990)). For example, a DNA encoding an antibody may be cloned from an immune cell, such as a hybridoma or an immunized lymphocyte producing the antibody, inserted into an appropriate vector, and introduced into host cells to prepare a recombinant antibody. The present invention also provides recombinant antibodies prepared as described above. Furthermore, an antibody ofthe present invention may be a fragment of an antibody or modified antibody, so long as it binds to one or more ofthe polypeptides ofthe invention. For instance, the antibody fragment may be Fab, F(ab')2, Fv or single chain Fv (scFv), in which Fv fragments from H and L chains are ligated by an appropriate linker (Huston et al., Proc Natl Acad Sci USA 85: 5879-83 (1988)). More specifically, an antibody fragment may be generated by treating an antibody with an enzyme, such as papain or pepsin. Alternatively, a gene encoding the antibody fragment may be constructed, inserted into an expression vector and expressed in an appropriate host cell (see, for example, Co et al., J Immunol 152: 2968-76 (1994); Better and Horwitz, Methods Enzymol 178: 476-96 (1989); Pluckthun and Skerra, Methods Enzymol 178: 497-515 (1989); Lamoyi, Methods Enzymol 121: 652-63 (1986); Rousseaux et al., Methods Enzymol 121: 663-9 (1986); Bird and Walker, Trends Biotechnol 9: 132-7 (1991)). An antibody may be modified by conjugation with a variety of molecules, such as polyethylene glycol (PEG). The present invention provides for such modified antibodies. The modified antibody can be obtained by chemically modifying an antibody. These modification methods are conventional in the field. Alternatively, an antibody ofthe present invention may be obtained as a chimeric antibody, between a variable region derived from nonhuman antibody and the constant region derived from human antibody, or as a humanized antibody, comprising the complementarity determining region (CDR) derived from nonhuman antibody, the frame work region (FR) and the constant region derived from human antibody. Such antibodies can be prepared according to known technology. Humanization can be performed by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody (see e.g., Verhoeyen et al, Science 239:1534-1536 (1988)). Accordingly, such humanized antibodies are chimeric antibodies, wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. Fully human antibodies comprising human variable regions in addition to human framework and constant regions can also be used. Such antibodies can be produced using various techniques known in the art. For example in vitro methods involve use of recombinant libraries of human antibody fragments displayed on bacteriophage (e.g., Hoogenboom & Winter, J. Mol. Biol. 227:381 (1991), Similarly, human antibodies can be made by introducing of human immunoglobulin loci into transgenic animals, e.g., mice in which the endogenous immunoglobulin genes have been partially or completely inactivated. This approach is described, e.g., in U.S. Patent Nos. 6,150,584, 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016. Antibodies obtained as above may be purified to homogeneity. For example, the separation and purification ofthe antibody can be performed according to separation and purification methods used for general proteins. For example, the antibody may be separated and isolated by the appropriately selected and combined use of column chromatographies, such as affinity chromatography, filter, ultrafiltration, salting-out, dialysis, SDS polyacrylamide gel electrophoresis and isoelectric focusing (Antibodies: A Laboratory Manual. Ed Harlow and David Lane, Cold Spring Harbor Laboratory (1988)), but are not limited thereto. A protein A column and protein G column can be used as the affinity column. Exemplary protein A columns to be used include, for example, Hyper D, POROS and Sepharose F.F. (Pharmacia). Exemplary chromatography, with the exception of affinity includes, for example, ion-exchange chromatography, hydrophobic chromatography, gel filtration, reverse-phase chromatography, adsoφtion chromatography and the like (Strategies for Protein
Purification and Characterization: A Laboratory Course Manual. Ed Daniel R. Marshak et al., Cold Spring Harbor Laboratory Press (1996)). The chromatographic procedures can be carried out by liquid-phase chromatography, such as HPLC and FPLC. For example, measurement of absorbance, enzyme-linked immunosorbent assay (ELISA), enzyme immunoassay (EIA), radioimmunoassay (RIA) and/or immunofluorescence may be used to measure the antigen binding activity ofthe antibody ofthe invention. In ELISA, the antibody ofthe present invention is immobilized on a plate, a polypeptide ofthe invention is applied to the plate, and then a sample containing a desired antibody, such as culture supernatant of antibody producing cells or purified antibodies, is applied. Then, a secondary antibody that recognizes the primary antibody and is labeled with an enzyme, such as alkaline phosphatase, is applied, and the plate is incubated. Next, after washing, an enzyme substrate, such as >-nitrophenyl phosphate, is added to the plate, and the absorbance is measured to evaluate the antigen binding activity ofthe sample. A fragment ofthe polypeptide, such as a C-terminal or N-terminal fragment, may be used as the antigen to evaluate the binding activity ofthe antibody. BIAcore (Pharmacia) may be used to evaluate the activity ofthe antibody according to the present invention. The above methods allow for the detection or measurement ofthe polypeptide of the invention, by exposing the antibody ofthe invention to a sample assumed to contain the polypeptide ofthe invention, and detecting or measuring the immune complex formed by the antibody and the polypeptide. Because the method of detection or measurement ofthe polypeptide according to the invention can specifically detect or measure a polypeptide, the method may be useful in a variety of experiments in which the polypeptide is used.
Antisense polynucleotides, small interfering EN As and ribozymes The present invention includes an antisense oligonucleotide that hybridizes with any site within the nucleotide sequence of SEQ ID NO: lor 3. This antisense oligonucleotide is preferably against at least about 15 continuous nucleotides ofthe nucleotide sequence of SEQ ID NO: 1 or 3. The above-mentioned antisense oligonucleotide, which contains an initiation codon in the above-mentioned at least 15 continuous nucleotides, is even more preferred. Derivatives or modified products of antisense ohgonucleotides can also be used as antisense ohgonucleotides. Examples of such modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications. The term "antisense ohgonucleotides" as used herein means, not only those in which the nucleotides corresponding to those constituting a specified region of a DNA or mRNA are entirely complementary, but also those having a mismatch of one or more nucleotides, as long as the DNA or mRNA and the antisense oligonucleotide can specifically hybridize with the nucleotide sequence of SEQ ID NO: 1 or 3. Such polynucleotides are contained as those having, in the "at least about 15 continuous nucleotide sequence region", a homology of at least 70%) or higher, preferably at 80%) or higher, more preferably about 90% or higher, even more preferably about 95% or higher. The algorithm stated herein can be used to determine the homology. Algorithms known in the art can be used to determine the homology. Furthermore, derivatives or modified products ofthe antisense-oligonucleotides can also be used as antisense-oligonucleotides in the present invention. Examples of such modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate-type, phosphorothioate modifications and phosphoroamidate modifications. Such antisense polynucleotides are useful as probes for the isolation or detection of
DNA encoding the polypeptide ofthe invention or as a primer used for amplifications. The antisense oligonucleotide derivatives ofthe present invention act upon cells producing the polypeptide ofthe invention by binding to the DNA or mRNA encoding the polypeptide, inhibiting its transcription or translation, promoting the degradation ofthe mRNA and inhibiting the expression ofthe polypeptide ofthe invention, thereby resulting in the inhibition ofthe polypeptide 's function. The present invention also includes small interfering RNAs (siRNA) comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid ofthe nucleotide sequence of SEQ ID NO: 1 or 3. More specifically, such siRNA for suppressing the expression of CCDC4 include those that target the nucleotide sequence of SEQ ID NO: 8. The term "siRNA" refers to a double stranded RNA molecule which prevents translation of a target mRNA. Standard techniques are used for introducing siRNA into cells, including those wherein DNA is used as the template to transcribe RNA. The siRNA comprises a sense nucleic acid sequence and an antisense nucleic acid sequence of the polynucleotide encoding human CCDC4 protein (SEQ ID NO: 1 or 3). The siRNA is constructed such that a single transcript (double stranded RNA) has both the sense and complementary antisense sequences from the target gene, e.g., a haiφin. Binding ofthe siRNA to a transcript corresponding to CCDC4 in the target cell results in a reduction in the protein production by the cell. The length of the oligonucleotide is at least 10 nucleotides and may be as long as the naturally-occurring the transcript. Preferably, the oligonucleotide is about 19 to about 25 nucleotides in length. Most preferably, the oligonucleotide is less than about 75, about 50, about 25 nucleotides in length. Examples of CCDC4 siRNA oligonucleotide which inhibit the growth ofthe cancer cell include the target sequence containing SEQ ID NO: 8. Furthermore, in order to enhance the inhibition activity ofthe siRNA, nucleotide "u" can be added to 3 'end of the antisense strand ofthe target sequence. The number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. The added "u"s form single strand at the 3 'end ofthe antisense strand ofthe siRNA. A CCDC4 siRNA is directly introduced into the cells in a form that is capable of binding to the mRNA transcripts. In these embodiments, the siRNA molecules ofthe invention are typically modified as described above for antisense molecules. Other modifications are also possible, for example, cholesterol-conjugated siRNAs have shown improved pharmacological properties (Song et al. Nature Med. 9:347-351 (2003)) . Alternatively, the DNA encoding the CCDC4 siRNA is in a vector. Vectors are produced for example by cloning a CCDC4 target sequence into an expression vector operatively-linked regulatory sequences flanking the CCDC4 sequence in a manner that allows for expression (by transcription ofthe DNA molecule) of both strands (Lee, N.S., Dohjima, T, Bauer, G, Li, H., Li, M.-J., Ehsani, A.,Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIN-1 rev transcripts in human cells. Nature Biotechnology 20 : 500-505.). An RNA molecule that is antisense to CCDC4 mRNA is transcribed by a first promoter (e.g., a promoter sequence 3' of the cloned DNA) and an RNA molecule that is the sense strand for the CCDC4 mRNA is transcribed by a second promoter (e.g., a promoter sequence 5' of the cloned DNA). The sense and antisense strands hybridize in vivo to generate siRNA constructs for silencing ofthe CCDC4 gene. Alternatively, two constructs are utilized to create the sense and antisense strands of a siRNA construct. Cloned CCDC4 can encode a construct having secondary structure, e.g., haiφins, wherein a single transcript has both the sense and complementary antisense sequences from the target gene. Furthermore, a loop sequence consisting of an arbitrary nucleotide sequence can be located between the sense and antisense sequence in order to form the haiφin loop structure. Thus, the present invention also provides siRNA having the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a sequence that specifically hybridizes to an mRNA or a cDNA from a CCDC4 gene. In preferred embodiments, [A] is a ribonucleotide sequence corresponding a sequence of nucleotides 1666-1684 (SEQ ID NO: 8) of SEQ ID NO: l or 3, [B] is a ribonucleotide sequence consisting of about 3 to about 23 nucleotides, and
[A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A]. The loop sequence may consist of arbitrary sequence having preferably 3 to 23 nucleotide in length. The loop sequence, for example, can be selected from group consisting of following sequences (http://www.ambion.com techlib/tb/tb_506.html). In the siRNA of the present invention, nucleotide "u" can be added to the 3 'end of [A'], in order to enhance the inhibiting activity ofthe siRNA. The number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. Furthermore, loop sequence consisting of 23 nucleotides also provides active siRNA (Jacque, J.-M., Triques, K., and Stevenson, M. (2002) Modulation of HIV- 1 replication by RNA interference. Nature 418: 435-438.). CCC, CCACC or CCACACC: Jacque, J. M., Triques, K., and Stevenson, M. "Modulation of HIV-1 replication by RNA interference." Nature, Vol. 418: 435-438 (2002); UUCG: Lee, N.S., Dohjima, T, Bauer, G, Li, H., Li, M.-J., Ehsani, A., Salvaterra, P., and Rossi, J. (2002) Expression of small interfering RNAs targeted against HIV-1 rev transcripts in human cells. Nature Biotechnology 20: 500-505.; Fruscoloni, P., Zamboni, M., and Tocchini-Valentini, G. P. "Exonucleolytic degradation of double-stranded RNA by an activity in Xenopus laevis germinal vesicles." Proc. Natl. Acad. Sci. USA 100(4): 1639-1644 (2003); and UUCAAGAGA: Dykxhoorn, D. M., Novina, C. D., and Shaφ, P. A. "Killing the messenger: Short RNAs that silence gene expression." Nature Reviews Molecular Cell Biology 4: 457-467 (2002). For example, preferable siRNAs having haiφin structure ofthe present invention are shown below. In the following structure, the loop sequence can be selected from group consisting of CCC, UUCG, CCACC, CCACACC, and UUCAAGAGA. Preferable loop sequence is UUCAAGAGA ("ttcaagaga" in DNA). gaugguucugcagcaccac-[B]-guggugcugcagaaccauc (for target sequence of SEQ ID NO: 8) The regulatory sequences flanking the CCDC4 sequence are identical or are different, such that their expression can be modulated independently, or in a temporal or spatial manner. siRNAs are transcribed intracellularly by cloning the CCDC4 gene templates into a vector containing, e.g., a RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter. For introducing the vector into the cell, transfection-enhancing agent can be used. FuGENE (Rochediagnostices), Lipofectamine 2000 (Invitrogen), Oligofectamine (Invitrogen), and Nucleofector (Wako pure Chemical) are useful as the transfection-enhancing agent. The nucleotide sequence of siRNAs may be designed using an siRNA design computer program available from the Ambion website
(http://www.ambion.com/techlib/misc/siRNA_finder.html). Nucleotide sequences for the siRNA are selected by the computer program based on the following protocol: Selection of siRNA Target Sites: 1. Beginning with the AUG start codon ofthe object transcript, scan downstream for AA dinucleotide sequences. Record the occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites. Tuschl, et al. Targeted mRNA degradation by double-stranded RNA in vitro. Genes Dev 13 (24): 3191-7 (1999), don't recommend against designing siRNA to the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75 bases) as these may be richer in regulatory protein binding sites. UTR-binding proteins and/or translation initiation complexes may interfere with the binding ofthe siRNA endonuclease complex. 2. Compare the potential target sites to the human genome database and eliminate from consideration any target sequences with significant homology to other coding sequences. The homology search can be performed using BLAST, which can be found on the NCBI server at: www.ncbi.nlm.nih.gov/BLAST/. 3. Select qualifying target sequences for synthesis. At Ambion, preferably several target sequences can be selected along the length ofthe gene for evaluation. Ohgonucleotides and ohgonucleotides complementary to various portions of CCDC4 mRNA were tested in vitro for their ability to decrease production of CCDC4 in tumor cells (e.g., using the PC3, or DU145 prostate cancer cell line) according to standard methods. A reduction in CCDC4 gene product in cells contacted with the candidate siRNA composition compared to cells cultured in the absence ofthe candidate composition is detected using CCDC4-specific antibodies or other detection strategies. Sequences which decrease production of CCDC4 in in vitro cell-based or cell-free assays are then tested for there inhibitory effects on cell growth. Sequences which inhibit cell growth in in vitro cell-based assay are test in in vivo in rats or mice to confirm decreased CCDC4 production and decreased tumor cell growth in animals with malignant neoplasms. Also included in the invention are double-stranded molecules that include the nucleic acid sequence of target sequences, for example, nucleotides 1666-1684 (SEQ ID NO: 8) of SEQ ID NO: 1 or 3. In the present invention, the double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to SEQ ID NO: 8, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing the CCDC4 gene, inhibits expression of said gene. In the present invention, when the isolated nucleic acid is RNA or derivatives thereof, base "t" should be replaced with "u" in the nucleotide sequences. As used herein, the term "complementary" refers to Watson-Crick or Hoogsteen base pairing between nucleotides units of a nucleic acid molecule, and the term "binding" means the physical or chemical interaction between two nucleic acids or compounds or associated nucleic acids or compounds or combinations thereof. Complementary nucleic acid sequences hybridize under appropriate conditions to form stable duplexes containing few or no mismatches. Furthermore, the sense strand and antisense strand ofthe isolated nucleotide ofthe present invention, can form double stranded nucleotide or haiφin loop structure by the hybridization. In a preferred embodiment, such duplexes contain no more than 1 mismatch for every 10 matches. In an especially preferred embodiment, where the strands ofthe duplex are fully complementary, such duplexes contain no mismatches. The nucleic acid molecule is less than 8763 nucleotides (for SEQ ID NO: 1) or 8692 nucleotides (for SEQ ID NO: 3) in length. For example, the nucleic acid molecule is less than 500, 200, or 75 nucleotides in length. Also included in the invention is a vector containing one or more ofthe nucleic acids described herein, and a cell containing the vectors. The isolated nucleic acids ofthe present invention are useful for siRNA against CCDC4 or DNA encoding the siRNA. When the nucleic acids are used for siRNA or coding DNA thereof, the sense strand is preferably longer than about 19 nucleotides, and more preferably longer than about 21 nucleotides. The antisense oligonucleotide or siRNA ofthe invention inhibit the expression of the polypeptide ofthe invention and is thereby useful for suppressing the biological activity ofthe polypeptide ofthe invention. Also, expression-inhibitors, comprising the antisense oligonucleotide or siRNA ofthe invention, are useful in the point that they can inhibit the biological activity ofthe polypeptide ofthe invention. Therefore, a composition comprising antisense oligonucleotide or siRNA ofthe present invention are useful in treating a prostate cancer. Examples of CCDC4 siRNA oligonucleotide which inhibit the expression in mammalian cells include the target sequence containing SEQ ID NO: 8. Furthermore, in order to enhance the inhibition activity ofthe siRNA, nucleotide "u" can be added to 3 'end ofthe antisense strand ofthe target sequence. The number of "u"s to be added is at least about 2, generally about 2 to about 10, preferably about 2 to about 5. The added "u"s form single strand at the 3 'end ofthe antisense strand ofthe siRNA. Also, expression-inhibitors, comprising the antisense oligonucleotide or siRNA of the invention, are useful in the point that they can inhibit the biological activity ofthe polypeptide ofthe invention. Therefore, a composition comprising the antisense oligonucleotide or siRNA ofthe present invention is useful in treating a cell proliferative disease such as prostate cancer. Furthermore, the present invention provides ribozymes that inhibit the expression ofthe CCDC4 polypeptide ofthe present invention. Generally, ribozymes are classified into large ribozymes and small ribozymes. A large ribozyme is known as an enzyme that cleaves the phosphate ester bond of nucleic acids. After the reaction with the large ribozyme, the reacted site consists of a
5 '-phosphate and 3 '-hydroxyl group. The large ribozyme is further classified into (1) group I intron RNA catalyzing transesterification at the 5 '-splice site by guanosine; (2) group II intron RNA catalyzing self-splicing through a two step reaction via lariat structure; and (3) RNA component ofthe ribonuclease P that cleaves the tRNA precursor at the 5' site through hydrolysis. On the other hand, small ribozymes have a smaller size (about 40 bp) compared to the large ribozymes and cleave RNAs to generate a 5 '-hydroxyl group and a 2'-3' cyclic phosphate. Hammerhead type ribozymes (Koizumi et al., FEBS LErr 228: 225 (1988)) and haiφin type ribozymes (Buzayan, Nature 323: 349 (1986); Kikuchi and Sasaki, Nucleic Acids Res 19: 6751 (1992)) are included in the small ribozymes. Methods for designing and constructing ribozymes are known in the art (see Koizumi et al., FEBS Lett 228: 225 (1988); Koizumi et al., Nucleic Acids Res 17: 7059 (1989); Kikuchi and Sasaki, Nucleic Acids Res 19: 6751 (1992)). Thus, ribozymes inhibiting the expression ofthe polypeptides ofthe present invention can also be constructed based on their sequence information (SEQ ID NO: 1 or 3) and these conventional methods. Ribozymes against CCDC4 gene inhibit the expression of over-expressed CCDC4 protein and is thus useful for suppressing the biological activity ofthe protein. Therefore, the ribozymes are useful in treating or preventing prostate cancer.
Diagnosing prostate cancer Moreover, the present invention provides a method for diagnosing cell proliferative disease such as prostate cancer using the expression level ofthe genes ofthe present invention as a diagnostic marker. This diagnosing method comprises the steps of: (a) detecting the expression level of the CCDC4 gene ofthe present invention; and (b) relating an elevation ofthe expression level to prostate cancer. The expression levels ofthe CCDC4 gene in a biological sample can be estimated by quantifying mRNA corresponding to or protein encoded by the CCDC4 gene. Quantification methods for mRNA are known to those skilled in the art. For example, the levels of mRNAs corresponding to the CCDC4 gene can be estimated by Northern blotting or RT-PCR. Since the full-length nucleotide sequences ofthe CCDC4 genes are shown in SEQ ID NO: 1 or 3, anyone skilled in the art can design the nucleotide sequences for probes or primers to quantify the CCDC4 gene. Also the expression level ofthe CCDC4 gene can be analyzed based on the activity or quantity of protein encoded by the gene. A method for determining the quantity ofthe CCDC4 protein is shown in below. For example, immunoassay methods are useful for the determination ofthe proteins in biological materials. Any biological materials can be used as the biological sample for the determination ofthe protein or it's activity so long as the marker gene (CCDC4 gene) is expressed in the sample of a prostate cancer patient. For example, prostate duct epithelium can be mentioned as such biological sample. However, bodily fluids such as blood and urine may be also analyzed. On the other hand, a suitable method can be selected for the determination ofthe activity of a protein encoded by the CCDC4 gene according to the activity of a protein to be analyzed. Expression levels ofthe CCDC4 gene in a biological sample are estimated and compared with those in a normal sample (e.g., a sample derived from a non-diseased subject). When such a comparison shows that the expression level ofthe target gene is higher than those in the normal sample, the subject is judged to be affected with prostate cancer. The expression level of CCDC4 gene in the biological samples from a normal subject and subject to be diagnosed may be determined at the same time. Alternatively, normal ranges ofthe expression levels can be determined by a statistical method based on the results obtained by analyzing the expression level ofthe gene in samples previously collected from a control group. A result obtained by comparing the sample of a subject is compared with the normal range; when the result does not fall within the normal range, the subject is judged to be affected with or is at risk of developing prostate cancer. In the present invention, a diagnostic agent for diagnosing cell proliferative disease, such as prostate cancer, is also provided. The diagnostic agent ofthe present invention comprises a compound that binds to a polynucleotide or a polypeptide ofthe present invention. Preferably, an oligonucleotide that hybridizes to the polynucleotide ofthe present invention or an antibody that binds to the polypeptide ofthe present invention may be used as such a compound. The present method of diagnosing prostate cancer may be applied for assessing the efficacy of treatment of prostate cancer in a subject. According to the method, a biological sample, such as a test cell population, is obtained from a subject undergoing treatment for prostate cancer. The method for assessment can be conducted according to conventional methods of diagnosing prostate cancer. If desired, biological samples are obtained from the subject at various time points before, during or after the treatment. The expression level of CCDC4 gene, in the biological sample is then determined and compared to a control level derived, for example, from a reference cell population which includes cells whose state of prostate cancer (i.e., cancerous cell or non-cancerous cell) is known. The control level is determined in a biological sample that has not been exposed to the treatment. If the control level is derived from a biological sample which contains no cancerous cell, a similarity between the expression level in the subject-derived biological sample and the control level indicates that the treatment is efficacious. A difference between the expression level ofthe CCDC4 gene in the subject-derived biological sample and the control level indicates a less favorable clinical outcome or prognosis. The term "efficacious" refers that the treatment leads to a reduction in the expression of a pathologically up-regulated gene (CCDC4 gene) or a decrease in size, prevalence or proliferating potential of prostate cancer cells in a subject. When a treatment is applied prophylactically, "efficacious" indicates that the treatment retards or prevents occurrence of prostate cancer. The assessment of prostate cancer can be made using standard clinical protocols. Furthermore, the efficaciousness of a treatment is determined in association with any known method for diagnosing or treating prostate cancer. Moreover, the present method of diagnosing prostate cancer may also be applied for assessing the prognosis of a subject with prostate cancer by comparing the expression level of CCDC4 gene in a patient-derived biological sample, such as test cell population, to a control level. Alternatively, the expression level of CCDC4 gene in a biological sample derived from patients may be measured over a spectrum of disease stages to assess the prognosis ofthe patient. An increase in the expression level of CCDC4 gene compared to a normal control level indicates less favorable prognosis. A decrease in the expression level of CCDC4 gene indicates a more favorable prognosis for the patient.
Screening compounds Using the CCDC4 gene, proteins encoded by the gene or transcriptional regulatory region ofthe gene, compounds can be screened that alter the expression ofthe gene or the biological activity of a polypeptide encoded by the gene. Such compounds are used as pharmaceuticals for treating or preventing prostate cancer. Therefore, the present invention provides a method of screening for a compound for treating or preventing prostate cancer using the polypeptide ofthe present invention. An embodiment of this screening method comprises the steps of: (a) contacting a test compound with a polypeptide ofthe present invention; (b) detecting the binding activity between the polypeptide ofthe present invention and the test compound; and (c) selecting the compound that binds to the polypeptide ofthe present invention. The polypeptide ofthe present invention to be used for screening may be a recombinant polypeptide or a protein derived from the nature or a partial peptide thereof. The polypeptide ofthe present invention to be contacted with a test compound can be, for example, a purified polypeptide, a soluble protein, a form bound to a carrier or a fusion protein fused with other polypeptides. As a method of screening for proteins, for example, that bind to the polypeptide of the present invention using the polypeptide ofthe present invention, many methods well known by a person skilled in the art can be used. Such a screening can be conducted by, for example, immunoprecipitation method, specifically, in the following manner. The gene encoding the polypeptide ofthe present invention is expressed in host (e.g., animal) cells and so on by inserting the gene to an expression vector for foreign genes, such as pSV2neo, pcDNA I, pcDNA3.1, pCAGGS and pCD8. The promoter to be used for the expression may be any promoter that can be used commonly and include, for example, the SV40 early promoter (Rigby in Williamson (ed.), Genetic Engineering, vol. 3. Academic Press, London, 83-141 (1982)), the EF-α promoter (Kim et al., Gene 91 : 217-23 (1990)), the CAG promoter (Niwa et al., Gene 108: 193-200 (1991)), the RSV LTR promoter (Cullen, Methods in Enzymology 152: 684-704 (1987)) the SRα promoter (Takebe et al., Mol Cell Biol 8: 466 (1988)), the CMV immediate early promoter (Seed and Arufifo, Proc Natl Acad Sci USA 84: 3365-9 (1987)), the SV40 late promoter (Gheysen and Fiers, J Mol Appl Genet 1 : 385-94 (1982)), the Adenovirus late promoter (Kaufman et al., Mol Cell Biol 9: 946 (1989)), the HSV TK promoter and so on. The introduction ofthe gene into host cells to express a foreign gene can be performed according to any methods, for example, the electroporation method (Chu et al., Nucleic Acids Res 15: 1311-26 (1987)), the calcium phosphate method (Chen and Okayama, Mol Cell Biol 7: 2745-52 (1987)), the DEAE dextran method (Lopata et al., Nucleic Acids Res 12: 5707-17 (1984); Sussman and Milman, Mol Cell Biol 4: 1642-3 (1985)), the Lipofectin method (Derijard, B Cell 7: 1025-37 (1994); Lamb et al., Nature Genetics 5: 22-30 (1993): Rabindran et al., Science 259: 230-4 (1993)) and so on. The polypeptide ofthe present invention can be expressed as a fusion protein comprising a recognition site (epitope) of a monoclonal antibody by introducing the epitope ofthe monoclonal antibody, whose specificity has been revealed, to the N- or C- terminus ofthe polypeptide ofthe present invention. A commercially available epitope-antibody system can be used (Experimental Medicine 13: 85-90 (1995)). Vectors which can express a fusion protein with, for example, β-galactosidase, maltose binding protein, glutathione S-transferase, green florescence protein (GFP) and so on by the use of its multiple cloning sites are commercially available. A fusion protein prepared by introducing only small epitopes consisting of several to a dozen amino acids so as not to change the property ofthe polypeptide ofthe present invention by the fusion is also reported. Epitopes, such as polyhistidine (His-tag), influenza aggregate HA, human c-myc, FLAG, Vesicular stomatitis virus glycoprotein (VSV-GP), T7 gene 10 protein (T7-tag), human simple heφes virus glycoprotein (HSV-tag), E-tag (an epitope on monoclonal phage) and such, and monoclonal antibodies recognizing them can be used as the epitope-antibody system for screening proteins binding to the polypeptide ofthe present invention (Experimental Medicine 13: 85-90 (1995)). In immunoprecipitation, an immune complex is formed by adding these antibodies to cell lysate prepared using an appropriate detergent. The immune complex consists of the polypeptide ofthe present invention, a polypeptide comprising the binding ability with the polypeptide, and an antibody. Immunoprecipitation can be also conducted using antibodies against the polypeptide ofthe present invention, besides using antibodies against the above epitopes, which antibodies can be prepared as described above. An immune complex can be precipitated, for example by Protein A sepharose or Protein G sepharose when the antibody is a mouse IgG antibody. If the polypeptide ofthe present invention is prepared as a fusion protein with an epitope, such as GST, an immune complex can be formed in the same manner as in the use ofthe antibody against the polypeptide ofthe present invention, using a substance specifically binding to these epitopes, such as glutathione-Sepharose 4B. Immunoprecipitation can be performed by following or according to, for example, the methods in the literature (Harlow and Lane, Antibodies, 511-52, Cold Spring Harbor Laboratory publications, New York (1988)). SDS-PAGE is commonly used for analysis of immunoprecipitated proteins and the bound protein can be analyzed by the molecular weight ofthe protein using gels with an appropriate concentration. Since the protein bound to the polypeptide ofthe present invention is difficult to detect by a common staining method, such as Coomassie staining or silver staining, the detection sensitivity for the protein can be improved by culturing cells in culture medium containing radioactive isotope, 35S-methionine or 35S-cystein, labeling proteins in the cells, and detecting the proteins. The target protein can be purified directly from the SDS-polyacrylamide gel and its sequence can be determined, when the molecular weight of a protein has been revealed. As a method for screening proteins binding to the polypeptide ofthe present invention using the polypeptide, for example, West- Western blotting analysis (Skolnik et al., Cell 65: 83-90 (1991)) can be used. Specifically, a protein binding to the polypeptide ofthe present invention can be obtained by preparing a cDNA library from cells, tissues, organs (for example, tissues such as testis or prostate ), or cultured cells (e.g.,PC3, DU145) expected to express a protein binding to the polypeptide ofthe present invention using a phage vector (e.g. , ZAP), expressing the protein on LB-agarose, fixing the protein expressed on a filter, reacting the purified and labeled polypeptide ofthe present invention with the above filter, and detecting the plaques expressing proteins bound to the polypeptide ofthe present invention according to the label. The polypeptide ofthe invention may be labeled by utilizing the binding between biotin and avidin, or by utilizing an antibody that specifically binds to the polypeptide ofthe present invention, or a peptide or polypeptide (for example, GST) that is fused to the polypeptide ofthe present invention. Methods using radioisotope or fluorescence and such may be also used. Alternatively, in another embodiment ofthe screening method ofthe present invention, a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit",
"MATCHMAKER one-Hybrid system" (Clontech); "HybriZAP Two-Hybrid Vector System" (Stratagene); the references "Dalton and Treisman, Cell 68: 597-612 (1992)", "Fields and Sternglanz, Trends Genet 10: 286-92 (1994)"). In the two-hybrid system, the polypeptide ofthe invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells. A cDNA library is prepared from cells expected to express a protein binding to the polypeptide of the invention, such that the library, when expressed, is fused to the VP16 or GAL4 transcriptional activation region. The cDNA library is then introduced into the above yeast cells and the cDNA derived from the library is isolated from the positive clones detected (when a protein binding to the polypeptide ofthe invention is expressed in yeast cells, the binding ofthe two activates a reporter gene, making positive clones detectable). A protein encoded by the cDNA can be prepared by introducing the cDNA isolated above to E. coli and expressing the protein. As a reporter gene, for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used in addition to the HIS3 gene. A compound binding to the polypeptide ofthe present invention can also be screened using affinity chromatography. For example, the polypeptide ofthe invention may be immobilized on a carrier of an affinity column, and a test compound, containing a protein capable of binding to the polypeptide ofthe invention, is applied to the column. A test compound herein may be, for example, cell extracts, cell lysates, etc. After loading the test compound, the column is washed, and compounds bound to the polypeptide ofthe invention can be prepared. When the test compound is a protein, the amino acid sequence ofthe obtained protein is analyzed, an oligo DNA is synthesized based on the sequence, and cDNA libraries are screened using the oligo DNA as a probe to obtain a DNA encoding the protein. A biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound compound in the present invention. When such a biosensor is used, the interaction between the polypeptide ofthe invention and a test compound can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Therefore, it is possible to evaluate the binding between the polypeptide ofthe invention and a test compound using a biosensor such as BIAcore. The methods of screening for molecules that bind when the immobilized polypeptide ofthe present invention is exposed to synthetic chemical compounds, or natural substance banks or a random phage peptide display library, and the methods of screening using high-throughput based on combinatorial chemistry techniques (Wrighton et al., Science 273: 458-64 (1996); Verdine, Nature 384: 11-13 (1996); Hogan, Nature 384: 17-9 (1996)) to isolate not only proteins but chemical compounds that bind to the protein ofthe present invention (including agonist and antagonist) are well known to one skilled in the art. Alternatively, the present invention provides a method of screening for a compound for treating or preventing prostate cancer using the polypeptide ofthe present invention comprising the steps as follows: (a) contacting a test compound with the polypeptide ofthe present invention; (b) detecting the biological activity ofthe polypeptide of step (a); and (c) selecting a compound that suppresses the biological activity ofthe polypeptide in comparison with the biological activity detected in the absence ofthe test compound. Since the CCDC4 protein ofthe present invention have the activity of promoting cell proliferation of prostate cancer cells, a compound which inhibits this activity of this protein ofthe present invention can be screened using this activity as an index. Any polypeptides can be used for screening so long as they comprise the biological activity ofthe CCDC4 protein. Such biological activity include cell-proliferating activity ofthe human CCDC4 protein. For example, a human CCDC4 protein can be used and polypeptides functionally equivalent to these proteins can also be used. Such polypeptides may be expressed endogenously or exogenously by cells. The compound isolated by this screening is a candidate for agonists or antagonists ofthe polypeptide ofthe present invention. The term "agonist" refers to molecules that activate the function ofthe polypeptide ofthe present invention by binding thereto. Likewise, the term "antagonist" refers to molecules that inhibit the function ofthe polypeptide ofthe present invention by binding thereto. Moreover, a compound isolated by this screening is a candidate for compounds which inhibit the in vivo interaction ofthe polypeptide ofthe present invention with molecules (including DNAs and proteins). When the biological activity to be detected in the present method is cell proliferation, it can be detected, for example, by preparing cells which express the polypeptide ofthe present invention, culturing the cells in the presence of a test compound, and determining the speed of cell proliferation, measuring the cell cycle and such, as well as by measuring the colony forming activity as described in the Examples. In a further embodiment, the present invention provides methods for screening compounds for treating or preventing prostate cancer. As discussed in detail above, by controlling the expression levels ofthe CCDC4, one can control the onset and progression of prostate cancer. Thus, compounds that may be used in the treatment or prevention of prostate cancer can be identified through screenings that use the expression levels of CCDC4 as indices. In the context ofthe present invention, such screening may comprise, for example, the following steps: a) contacting a test compound with a cell expressing the CCDC4; and b) selecting a compound that reduces the expression level of CCDC4 in comparison with the expression level detected in the absence ofthe test compound. Cells expressing at least one ofthe CCDC4 include, for example, cell lines established from prostate cancers; such cells can be used for the above screening ofthe present invention (e.g. , PC3, DU145). The expression level can be estimated by methods well known to one skilled in the art. In the method of screening, a compound that reduces the expression level of CCDC4 can be selected as candidate agents to be used for the treatment or prevention of prostate cancer. Alternatively, the screening method ofthe present invention may comprise the following steps: a) contacting a test compound with a cell into which a vector comprising the transcriptional regulatory region of one or more marker genes and a reporter gene that is expressed under the control ofthe transcriptional regulatory region has been introduced, wherein the one or more marker genes are CCDC4, b) measuring the expression level or activity of said reporter gene; and c) selecting a compound that reduces the expression level or activity of said reporter gene as compared to a control. Suitable reporter genes and host cells are well known in the art. The reporter construct required for the screening can be prepared by using the transcriptional regulatory region of a marker gene. When the transcriptional regulatory region of a marker gene has been known to those skilled in the art, a reporter construct can be prepared by using the previous sequence information. When the transcriptional regulatory region of a marker gene remains unidentified, a nucleotide segment containing the transcriptional regulatory region can be isolated from a genome library based on the nucleotide sequence information ofthe marker gene. Examples of supports that may be used for binding proteins include insoluble polysaccharides, such as agarose, cellulose and dextran; and synthetic resins, such as polyacrylamide, polystyrene and silicon; preferably commercial available beads and plates (e.g., multi-well plates, biosensor chip, etc.) prepared from the above materials may be used. When using beads, they bay be filled into a column. The binding of a protein to a support may be conducted according to routine methods, such as chemical bonding and physical adsoφtion. Alternatively, a protein may be bound to a support via antibodies specifically recognizing the protein. Moreover, binding of a protein to a support can be also conducted by means of avidin and biotin. The binding between proteins is carried out in buffer, for example, but are not limited to, phosphate buffer and Tris buffer, as long as the buffer does not inhibit the binding between the proteins. In the present invention, a biosensor using the surface plasmon resonance phenomenon may be used as a mean for detecting or quantifying the bound protein. When such a biosensor is used, the interaction between the proteins can be observed real-time as a surface plasmon resonance signal, using only a minute amount of polypeptide and without labeling (for example, BIAcore, Pharmacia). Alternatively, CCDC4 polypeptide may be labeled, and the label ofthe bound protein may be used to detect or measure the bound protein. Specifically, after pre-labeling one ofthe proteins, the labeled protein is contacted with the other protein in the presence of a test compound, and then bound proteins are detected or measured according to the label after washing. Labeling substances such as radioisotope (e.g., 3H, 14C, 32P, 33P, 35S, 1251, 131I), enzymes (e.g., alkaline phosphatase, horseradish peroxidase, β-galactosidase, β-glucosidase), fluorescent substances (e.g., fluorescein isothiosyanete (FITC), rhodamine) and biotin/avidin, may be used for the labeling of a protein in the present method. When the protein is labeled with radioisotope, the detection or measurement can be carried out by liquid scintillation. Alternatively, proteins labeled with enzymes can be detected or measured by adding a substrate ofthe enzyme to detect the enzymatic change ofthe substrate, such as generation of color, with absoφtiometer. Further, in case where a fluorescent substance is used as the label, the bound protein may be detected or measured using fluorophotometer. In case of using an antibody in the present screening, the antibody is preferably labeled with one ofthe labeling substances mentioned above, and detected or measured based on the labeling substance. Alternatively, the antibody against the CCDC4 polypeptide or actin may be used as a primary antibody to be detected with a secondary antibody that is labeled with a labeling substance. Furthermore, the antibody bound to the protein in the screening ofthe present invention may be detected or measured using protein G or protein A column. Alternatively, in another embodiment ofthe screening method ofthe present invention, a two-hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit", "MATCHMAKER one-Hybrid system" (Clontech); "HybriZAP Two-Hybrid Vector System" (Stratagene); the references "Dalton and Treisman, Cell 68: 597-612 (1992)", "Fields and Sternglanz, Trends Genet 10: 286-92 (1994)"). In the two-hybrid system, the CCDC4 polypeptide ofthe invention is fused to the SRF-binding region or GAL4-binding region and expressed in yeast cells. As a reporter gene, for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and such can be used besides HIS3 gene. Any test compound, for example, cell extracts, cell culture supernatant, products of fermenting microorganism, extracts from marine organism, plant extracts, purified or crude proteins, peptides, non-peptide compounds, synthetic micromolecular compounds and natural compounds can be used in the screening methods ofthe present invention. The test compound ofthe present invention can be also obtained using any ofthe numerous approaches in combinatorial library methods known in the art, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound" library method and (5) synthetic library methods using affinity chromatography selection. The biological library methods using affinity chromatography selection is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam (1997) Anticancer Drug Des. 12: 145). Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al. (1993) Proc. Natl. Acad. Sci. USA 90: 6909; Erb et al. (1994) Proc. Natl. Acad. Sci. USA 91: 11422; Zuckermann et al. (1994) J. Med. Chem. 37: 2678; Cho et al. (1993) Science 261 : 1303; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2059; Carell et al. (1994) Angew. Chem. Int. Ed. Engl. 33: 2061; Gallop et al. (1994) J. Med. Chem. 37: 1233). Libraries of compounds may be presented in solution (see Houghten (1992) Bio/Techniques 13: 412) or on beads (Lam (1991) Nature 354: 82), chips (Fodor (1993) Nature 364: 555), bacteria (US Pat. No. 5,223,409), spores (US Pat. No. 5,571,698;5,403,484, and 5,223,409), plasmids (Cull et al. (1992) Proc. Natl. Acad. Sci. USA 89: 1865) or phage (Scott and Smith (1990) Science 249: 386; Delvin (1990) Science 249: 404; Cwirla et al. (1990) Proc. Natl. Acad. Sci. USA 87: 6378; Felici (1991) J. Mol. Biol. 222: 301; US Pat. Application 2002103360). A compound isolated by the screening methods ofthe present invention is a candidate for drugs which inhibit the activity ofthe polypeptide ofthe present invention, for treating or preventing diseases attributed to, for example, cell proliferative diseases, such as prostate cancer. A compound in which a part ofthe structure ofthe compound obtained by the present screening methods ofthe present invention is converted by addition, deletion and/or replacement, is included in the compounds obtained by the screening methods ofthe present invention.
Pharmaceutical compositions for treating or preventing prostate cancer The present invention provides compositions for treating or preventing prostate cancer comprising any ofthe compounds selected by the screening methods ofthe present invention. When administrating a compound isolated by the screening methods ofthe present invention as a pharmaceutical for humans or other mammals, such as mice, rats, guinea-pigs, rabbits, cats, dogs, sheep, pigs, cattle, monkeys, baboons, chimpanzees, for treating a cell proliferative disease (e.g., prostate cancer) the isolated compound can be directly administered or can be formulated into a dosage form using known pharmaceutical preparation methods. For example, according to the need, the drugs can be taken orally, as sugarcoated tablets, capsules, elixirs and microcapsules; or non-orally, in the form of injections of sterile solutions or suspensions with water or any other pharmaceutically acceptable liquid. For example, the compounds can be mixed with pharmacologically acceptable carriers or medium, specifically, sterilized water, physiological saline, plant-oil, emulsifiers, suspending agents, surfactants, stabilizers, flavoring agents, excipients, vehicles, preservatives, binders and such, in a unit dose form required for generally accepted drug implementation. The amount of active ingredients in these preparations makes a suitable dosage within the indicated range acquirable. Examples of additives that can be mixed to tablets and capsules are, binders such as gelatin, corn starch, tragacanth gum and arabic gum; excipients such as crystalline cellulose; swelling agents such as corn starch, gelatin and alginic acid; lubricants such as magnesium stearate; sweeteners such as sucrose, lactose or saccharin; flavoring agents such as peppermint, Gaultheria adenothrix oil and cherry. When the unit dosage form is a capsule, a liquid carrier, such as oil, can also be further included in the above ingredients. Sterile composites for injections can be formulated following normal drug implementations using vehicles such as distilled water used for injections. Physiological saline, glucose, and other isotonic liquids including adjuvants, such as D-sorbitol, D-mannnose, D-mannitol and sodium chloride, can be used as aqueous solutions for injections. These can be used in conjunction with suitable solubilizers, such as alcohol, specifically ethanol, polyalcohols such as propylene glycol and polyethylene glycol, non-ionic surfactants, such as Polysorbate 80 (TM) and HCO-50. Sesame oil or Soy-bean oil can be used as a oleaginous liquid and may be used in conjunction with benzyl benzoate or benzyl alcohol as a solubilizers and may be formulated with a buffer, such as phosphate buffer and sodium acetate buffer; a pain-killer, such as procaine hydrochloride; a stabilizer, such as benzyl alcohol, phenol; and an anti-oxidant. The prepared injection may be filled into a suitable ampule. Methods well known to one skilled in the art may be used to administer the inventive pharmaceutical compound to patients, for example as intraarterial, intravenous, percutaneous injections and also as intranasal, transbronchial, intramuscular or oral administrations. The dosage and method of administration vary according to the body- weight and age of a patient and the administration method; however, one skilled in the art can routinely select them. If said compound is encodable by a DNA, the DNA can be inserted into a vector for gene therapy and the vector administered to perform the therapy. The dosage and method of administration vary according to the body- weight, age, and symptoms of a patient but one skilled in the art can select them suitably. For example, although there are some differences according to the symptoms, the dose of a compound that binds with the polypeptide ofthe present invention and regulates its activity is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg). When administering parenterally, in the form of an injection to a normal adult (weight 60 kg), although there are some differences according to the patient, target organ, symptoms and method of administration, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg per day, preferably about 0.1 to about 20 mg per day and more preferably about 0.1 to about 10 mg per day. Also, in the case of other animals too, it is possible to administer an amount converted to 60kgs of body- weight. Furthermore, the present invention provides pharmaceutical compositions for treating or preventing prostate cancer comprising active ingredients that inhibits the expression of CCDC4 gene. Such active ingredients include antisense polynucleotides, siRNAs or ribozymes against the CCDC4 gene or derivatives, such as expression vector, of the antisense polynucleotides, siRNAs or ribozymes. These active ingredients can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivatives. Also, as needed, they can be formulated into tablets, powders, granules, capsules, liposome capsules, injections, solutions, nose-drops and freeze-drying agents by adding excipients, isotonic agents, solubilizers, stabilizers, preservatives, pain-killers and such. These can be prepared according to conventional methods. The active ingredient is given to the patient by directly applying onto the ailing site or by injecting into a blood vessel so that it will reach the site of ailment. A mounting medium can also be used to increase durability and membrane-permeability. Examples of mouting medium includes liposome, poly-L-lysine, lipid, cholesterol, lipofectine or derivatives of these. The dosage of such compositions ofthe present invention can be adjusted suitably according to the patient's condition and used in desired amounts. For example, a dose range of 0.1 to 100 mg/kg, preferably 0.1 to 50 mg/kg can be administered. Another embodiment ofthe present invention is a composition for treating or preventing prostate cancer comprising an antibody against a polypeptide encoded by the CCDC4 gene or fragments ofthe antibody that bind to the polypeptide. Although there are some differences according to the symptoms, the dose of an antibody or fragments thereof for treating or preventing prostate cancer is about 0.1 mg to about 100 mg per day, preferably about 1.0 mg to about 50 mg per day and more preferably about 1.0 mg to about 20 mg per day, when administered orally to a normal adult (weight 60 kg). When administering parenterally, in the form of an injection to a normal adult (weight 60 kg), although there are some differences according to the condition ofthe patient, symptoms ofthe disease and method of administration, it is convenient to intravenously inject a dose of about 0.01 mg to about 30 mg per day, preferably about 0.1 to about 20 mg per day and more preferably about 0.1 to about 10 mg per day. Also in the case of other animals too, it is possible to administer an amount converted to 60 kg of body-weight.
Methods for treating or preventing prostate cancer The invention provides a method for treating or preventing prostate cancer in a subject. Therapeutic compounds are administered prophylactically or therapeutically to subject suffering from or at risk of (or susceptible to) developing prostate cancer. Such subjects are identified using standard clinical methods or by detecting an aberrant expression level or activity of CCDC4. Prophylactic administration occurs prior to the manifestation of overt clinical symptoms of disease, such that a disease or disorder is prevented or, alternatively, delayed in its progression. The therapeutic method includes decreasing the expression or function of CCDC4 gene. In these methods, the subject is treated with an effective amount of a compound, which decreases the over-expressed genes (CCDC4 gene) in the subject. Administration can be systemic or local. Therapeutic compounds include compounds that decrease the expression level of such gene endogenously existing in the prostate cancerous cells (i.e., compounds that down-regulate the expression ofthe over-expressed gene(s)).
Administration of such therapeutic compounds counter the effects of aberrantly-over expressed gene(s) in the subjects cells and are expected to improve the clinical condition of the subject. Such compounds can be obtained by the screening method ofthe present invention described above. The expression of CCDC4 gene may be also inhibited in any of several ways known in the art including administering to the subject a nucleic acid that inhibits or antagonizes the expression ofthe gene(s). Antisense ohgonucleotides, siRNA or ribozymes which disrupts expression ofthe gene(s) can be used for inhibiting the expression ofthe genes. As noted above, antisense-oligonucleotides corresponding to the nucleotide sequence of CCDC4 gene can be used to reduce the expression level ofthe CCDC4 gene. Specifically, the antisense-oligonucleotides ofthe present invention may act by binding to any ofthe polypeptides encoded by the CCDC4 gene, or mRNAs corresponding thereto, thereby inhibiting the transcription or translation ofthe genes, promoting the degradation ofthe mRNAs, and/or inhibiting the expression of proteins encoded by the genes, and fmally inhibiting the function ofthe CCDC4 proteins. An antisense-oligonucleotides and derivatives thereof can be made into an external preparation, such as a liniment or a poultice, by mixing with a suitable base material which is inactive against the derivative and used in the method for treating or preventing prostate cancer ofthe present invention. The nucleic acids that inhibit one or more gene products of over-expressed genes also include small interfering RNAs (siRNA) comprising a combination of a sense strand nucleic acid and an antisense strand nucleic acid ofthe nucleotide sequence encoding the CCDC4 gene. Standard techniques of introducing siRNA into the cell can be used in the treatment or prevention ofthe present invention, including those in which DNA is a template from which RNA is transcribed. The siRNA is constructed such that a single transcript has both the sense and complementary antisense sequences from the target gene, e.g., a haiφin. The method is used to suppress gene expression of a cell with up-regulated expression ofthe CCDC4 gene. Binding ofthe siRNA to the CCDC4 gene transcript in the target cell results in a reduction of CCDC4 protein production by the cell. The nucleic acids that inhibit one or more gene products of over-expressed genes also include ribozymes against the over-expressed gene (CCDC4 gene).
Moreover, the present invention provides a method for treating or preventing a cell proliferative disease, such as prostate cancer, using an antibody against the polypeptide of the present invention. According to the method, a pharmaceutically effective amount of an antibody against the polypeptide ofthe present invention is administered. Since the expression ofthe CCDC4 protein are up-regulated in prostate cancer cells and the suppression ofthe expression of these proteins leads to the decrease in cell proliferating activity, it is expected that cell proliferative diseases can be treated or prevented by binding the antibody and these proteins. Thus, an antibody against the polypeptide ofthe present invention is administered at a dosage sufficient to reduce the activity ofthe protein ofthe present invention, which is in the range of 0.1 to about 250 mg/kg per day. The dose range for adult humans is generally from about 5 mg to about 17.5 g/day, preferably about 5 mg to about 10 g/day, and most preferably about 100 mg to about 3 g/day. Alternatively, an antibody binding to a cell surface marker specific for tumor cells can be used as a tool for drug delivery. For example, the antibody conjugated with a cytotoxic agent is administered at a dosage sufficient to injure tumor cells.
The present invention also relates to a method of inducing anti-tumor immunity comprising the step of administering CCDC4 protein or an immunologically active fragment thereof, or a polynucleotide encoding the protein or fragments thereof. The CCDC4 protein or the immunologically active fragments thereof are useful as vaccines against cell proliferative diseases such as prostate cancer. In some cases the proteins or fragments thereof may be administered in a form bound to the T cell receptor (TCR) or presented by an antigen presenting cell (APC), such as macrophage, dendritic cell (DC), or B-cells. Due to the strong antigen presenting ability of DC, the use of DC is most preferable among the APCs. In the present invention, vaccine against cell proliferative disease refers to a substance that has the function to induce anti-tumor immunity upon inoculation into animals. In general, anti-tumor immunity includes immune responses such as follows: induction of cytotoxic lymphocytes against tumors, - induction of antibodies that recognize tumors, and induction of anti-tumor cytokine production. Therefore, when a certain protein induces any one of these immune responses upon inoculation into an animal, the protein is decided to have anti-tumor immunity inducing effect. The induction ofthe anti-tumor immunity by a protein can be detected by observing in vivo or in vitro the response ofthe immune system in the host against the protein. For example, a method for detecting the induction of cytotoxic T lymphocytes is well known. A foreign substance that enters the living body is presented to T cells and B cells by the action of antigen presenting cells (APCs). T cells that respond to the antigen presented by APC in antigen specific manner differentiate into cytotoxic T cells (or cytotoxic T lymphocytes; CTLs) due to stimulation by the antigen, and then proliferate (this is referred to as activation of T cells). Therefore, CTL induction by a certain peptide can be evaluated by presenting the peptide to T cell by APC, and detecting the induction of CTL. Furthermore, APC has the effect of activating CD4+ T cells, CD8+ T cells, macrophages, eosinophils, and NK cells. Since CD4+ T cells and CD8+ T cells are also important in anti-tumor immunity, the anti-tumor immunity inducing action ofthe peptide can be evaluated using the activation effect of these cells as indicators. A method for evaluating the inducing action of CTL using dendritic cells (DCs) as
APC is well known in the art. DC is a representative APC having the strongest CTL inducing action among APCs. In this method, the test polypeptide is initially contacted with DC, and then this DC is contacted with T cells. Detection of T cells having cytotoxic effects against the cells of interest after the contact with DC shows that the test polypeptide has an activity of inducing the cytotoxic T cells. Activity of CTL against tumors can be detected, for example, using the lysis of 51Cr-labeled tumor cells as the indicator. Alternatively, the method of evaluating the degree of tumor cell damage using 3H-thymidine uptake activity or LDH (lactose dehydrogenase)-release as the indicator is also well known. Apart from DC, peripheral blood mononuclear cells (PBMCs) may also be used as the APC. The induction of CTL is reported that it can be enhanced by culturing PBMC in the presence of GM-CSF and IL-4. Similarly, CTL has been shown to be induced by culturing PBMC in the presence of keyhole limpet hemocyanin (KLH) and IL-7. The test polypeptides confirmed to possess CTL inducing activity by these methods are polypeptides having DC activation effect and subsequent CTL inducing activity. Therefore, polypeptides that induce CTL against tumor cells are useful as vaccines against tumors. Furthermore, APC that acquired the ability to induce CTL against rumors by contacting with the polypeptides are useful as vaccines against tumors. Furthermore, CTL that acquired cytotoxicity due to presentation ofthe polypeptide antigens by APC can be also used as vaccines against tumors. Such therapeutic methods for tumors using anti-tumor immunity due to APC and CTL are referred to as cellular immunotherapy. Generally, when using a polypeptide for cellular immunotherapy, efficiency ofthe CTL-induction is known to increase by combining a plurality of polypeptides having different structures and contacting them with DC. Therefore, when stimulating DC with protein fragments, it is advantageous to use a mixture of multiple types of fragments. Alternatively, the induction of anti-tumor immunity by a polypeptide can be confirmed by observing the induction of antibody production against tumors. For example, when antibodies against a polypeptide are induced in a laboratory animal immunized with the polypeptide and when growth of tumor cells is suppressed by those antibodies, the polypeptide can be determined to have an ability to induce anti-tumor immunity. Anti-tumor immunity is induced by administering the vaccine of this invention, and the induction of anti-tumor immunity enables treatment and prevention of cell proliferating diseases, such as prostate cancers. Therapy against cancer or prevention of the onset of cancer includes any ofthe steps, such as inhibition ofthe growth of cancerous cells, involution of cancer and suppression of occurrence of cancer. Decrease in mortality of individuals having cancer, decrease of tumor markers in the blood, alleviation of detectable symptoms accompanying cancer and such are also included as the effect of therapy or prevention of cancer. Such therapeutic and preventive effects are preferably statistically significant. For example, in observation, at a significance level of 5% or less, wherein the therapeutic or preventive effect of a vaccine against cell proliferative diseases is compared to a control without vaccine administration. For example, Student's t-test, the Mann- Whitney U-test or ANOVA may be used for statistical analysis. The above-mentioned protein having immunological activity or a vector encoding the protein may be combined with an adjuvant. An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity. Examples of adjuvants include cholera toxin, salmonella toxin, alum and such, but are not limited thereto.
Furthermore, the vaccine of this invention may be combined appropriately with a pharmaceutically acceptable carrier. Examples of such carriers are sterilized water, physiological saline, phosphate buffer, culture fluid and such. Furthermore, the vaccine may contain as necessary, stabilizers, suspensions, preservatives, surfactants and such. The vaccine is administered systemically or locally. Vaccine administration may be performed by single administration or boosted by multiple administrations. When using APC or CTL as the vaccine of this invention, tumors can be treated or prevented, for example, by the ex vivo method. More specifically, PBMCs of a subject receiving treatment or prevention therapy are collected, the cells are contacted with the polypeptide ex vivo, and following the induction of APC or CTL, the cells may be administered to the subject. APC can be also induced by introducing a vector encoding the polypeptide into PBMCs ex vivo. APC or CTL induced in vitro can be cloned prior to administration. By cloning and growing cells having high activity of damaging target cells, cellular immunotherapy can be performed more effectively. Furthermore, APC and CTL isolated in this manner may be used for cellular immunotherapy not only against individuals from whom the cells are derived, but also against similar types of tumors from other individuals. Furthermore, a pharmaceutical composition for treating or preventing a cell proliferative disease, such as prostate cancer, comprising a pharmaceutically effective amount ofthe CCDC4 polypeptide is provided. The pharmaceutical composition may be used for raising anti tumor immunity. The normal expression of CCDC4 is restricted to testis and prostate. Therefore, suppression of this gene may not adversely affect other organs. Thus, the CCDC4 polypeptides are preferable for treating cell proliferative disease, especially prostate cancers. Furthermore, since peptide fragments of proteins specifically expressed in cancerous cells were revealed to induce immune response against the cancer, peptide fragments of CCDC4 can also be used in a pharmaceutical composition for treating or preventing cell proliferative diseases such as prostate cancers. In the present invention, the polypeptide or fragment thereof is administered at a dosage sufficient to induce anti-tumor immunity, which is in the range of 0.1 mg to 10 mg, preferably 0.3mg to 5mg, more preferably 0.8mg to 1.5 mg. The administrations are repeated. For example, lmg ofthe peptide or fragment thereof may be administered 4 times in every two weeks for inducing the anti-tumor immunity. In addition, polynucleotides encoding CCDC4, or fragments thereof may be used for raising anti tumor immunity. Such polynucleotides may be incoφorated in an expression vector to express CCDC4, or fragments thereof in a subject to be treated. Thus, the present invention encompasses method for inducing anti tumor immunity wherein the polynucleotides encoding CCDC4, or fragments thereof are administered to a subject suffering or being at risk of developing cell proliferative diseases such as prostate cancer. The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope ofthe invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing ofthe present invention, suitable methods and materials are described below. Any patents, patent applications and publications cited herein are incoφorated by reference. Best Mode for Carrying out the Invention The present invention is illustrated in details by following Examples, but is not restricted to these Examples. (1) cDNA microarray and laser microbeam microdissection. Fabrication ofthe cDNA microarray slides has been described (Ono et al. Cancer Res., 60: 5007-5011, 2000). For each analysis of expression profiles the present inventors prepared duplicate sets of cDNA microarray slides containing 23,040 cDNA spots, to reduce experimental fluctuation. Briefly, total RNAs were purified from prostate cancer cells, PIN cells, and normal prostate duct epithelium that were microdissected from 20 prostate cancer tissues by laser microbeam microdissection. T7-based RNA amplification was carried out to obtain adequate RNA for microarray experiments. Aliquots of amplified RNA from prostate cancer cells and normal duct epithelium were labeled by reverse transcription with Cy5-dCTP and Cy3-dCTP, respectively (Amersham Biosciences, Buckinghamshire, UK). Hybridization, washing, and detection were carried out as described previously (Ono et al., 2000). (2) Identification of a novel gene, CCDC4 (coiled-coil domain containing 4). By our genome-wide cDNA microarray, the present inventoers identified one up-regulated spot, housing-name B3537, which represented one EST (Homo sapiens cDNAFLJ35632). Combined the information of other ESTs with the sequence obtained by RACE using prostate cancer cDNA, we identified a novel gene, CCDC4. (3) Northern-blot analysis. Human multiple-tissue Northern blots (Clontech, Palo Alto, CA) were hybridized with a [α-32P] dCTP-labeled PCR product of B3537. The 361-bp PCR product was prepared by RT-PCR using primers: 5'-GTGACAAATCCATTGATCCTGA-3' (SEQ ID NO:5) and 5'- GAACACGTGGCATTCTAGAGGTA-3' (SEQ ID NO:6). Pre-hybridization, hybridization and washing were performed according to the supplier's recommendations. The blots were auto-radiographed with intensifying screens at -80°C for 7 days. RT-PCR analysis validated the over-expression of CCDC4 in prostate cancer cells (Figure 1 A). Northern blot analysis (Figure IB) demonstrated that this transcript is approximately 8.7 kb and it consisted of 6 exons, which encodes 530 amino-acids protein with coiled-coil domain (Gene Bank Accession number: AB126828) (SEQ ID NO:2). One alternative splicing form was also identified, which is expected to yield a short isoform 437 amino-acid protein lacking in C-terminal region ofthe long form (Gene Bank Accession number: AB 126829) (SEQ ID NO:4). This gene is expressed restrictedly in normal testis and prostate as shown in Northern blot analysis (Figure IB), indicating that targeting this molecule is expected to yield very little toxicity to normal human organs. (4) siRNA-expressing constructs and colony formation / MTT assay. The present inventors used siRNA-expression vector (psiU6BX) for RNAi effect to the target genes. The U6 promoter was cloned into the upstream ofthe gene specific sequence (19nt sequence from the target transcript separated by a short spacer
TTCAAGAGA(SEQ ID NO: 7) from the reverse complement ofthe same sequence) and five thymidines as a termination signal; furthermore neo cassette was integrated to become resistant to Geneticin (Sigma). The target sequences for CCDC4 are 5'-GATGGTTCTGCAGCACCAC-3' (SEQ.ID.NO.8) (si#l), and 5'-GAAGCAGCACGACTTCTTC-3' (SEQ.ID.NO.9) (siEGFP) as a negative control. The ohgonucleotides used for CCDC4 siRNA are shown below. si#l was prepared by cloning the following double-stranded oligonucleotide into the Bbsl site ofthe psiU6BX vector. The corresponding nucleotide position relative to the CCDC4 nucleic acid sequence of SEQ ID NO: 1 or 3 is shown below. The oligionucleotide is a combination of a sense nucleotide sequence and an antisense nucleotide sequence ofthe target sequence CCDC4. The nucleotide sequence ofthe haiφin loop structure of si#l is shown in SEQ ID NO: 10 (endonuclease recognition cites are eliminated from each haiφin loop structure sequence). si#l (nucleotide numbers 1666-1684 of SEQ ID No: 1 or 3/ SEQ ID NO: 8) 5'-caccgatggt tctgcagcac cacttcaaga gagtggtgct gcagaaccat c-3' (SEQ ID NO: 11) 5'-aaaagatggt tctgcagcac cactctcttg aagtggtgct gcagaaccat c-3' (SEQ ID NO: 12) Prostate cancer cell lines, PC3 and DU145, were plated onto 10-cm dishes (5 X 105 cells/dish) and transfected with psiU6BX containing EGFP target sequence (EGFP) and psiU6BX containing CCDC4 target sequence using Lipofectamine 2000 (Invitrogen) according to manufacture's instruction. Cells were selected by 500 mg/ml Geneticin for one week, and preliminary cells were harvested 48 hours after transfection and analyzed by RT-PCR to validate knockdown effect on CCDC4. The primers of RT-PCR were the same ones described above. These cells were also stained by Giemsa solution and performed MTT assay to evaluate the colony formation and the cell number, respectively. RT-PCR validated knockdown effect of CCDC4 mRNA by transfection of siRNA expression vectors si#l , but not by siEGFP. Colony formation assay showed drastic decrease of colony numbers in the cells after transfection with si#l that were validated to knock down CCDC4 effectively by RT-PCR. MTT assay also showed drastic decreased number ofthe grown cells transfected with si#l . These findings strongly support that CCDC4 is essential to PRC cell growth and molecular targeting of CCDC4 is a promising approach to develop novel PRC therapy.
Construction ofpsiU6BX3.0 Plasmid The DNA fragment encoding siRNA was inserted into the GAP at nucleotide 485-490 as indicated (-) in the following plasmid sequence (SEQ ID No: 13). GACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCTGGAT CCACTAGTAACGGCCGCCAGTGTGCTGGAATTCGGCTTGGGGATCAGCGTTTGAGTAAGA GCCCGCGTCTGAACCCTCCGCGCCGCCCCGGCCCCAGTGGAAAGACGCGCAGGCAAAACG CACCACGTGACGGAGCGTGACCGCGCGCCGAGCGCGCGCCAAGGTCGGGCAGGAAGAGGG CCTATTTCCCATGATTCCTTCATATTTGCATATACGATACAAGGCTGTTAGAGAGATAAT TAGAATTAATTTGACTGTAAACACAAAGATATTAGTACAAAATACGTGACGTAGAAAGTA ATAATTTCTTGGGTAGTTTGCAGTTTTAAAATTATGTTTTAAAATGGACTATCATATGCT TACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAAA CACC TTTTTACATCAGGTTGTTTTTCTGTTTGGTTTTTTTTTTACACCACGTTT ATACGCCGGTGCACGGTTTACCACTGAAAACACCTTTCATCTACAGGTGATATCTTTTAA CACAAATAAAATGTAGTAGTCCTAGGAGACGGAATAGAAGGAGGTGGGGCCTAAAGCCGA ATTCTGCAGATATCCATCACACTGGCGGCCGCTCGAGTGAGGCGGAAAGAACCAGCTGGG GCTCTAGGGGGTATCCCCACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGG TTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCT TCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCC CTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTG ATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGT CCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGG TCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGC TGATTTAACAAAAATTTAACGCGAATTAATTCTGTGGAATGTGTGTCAGTTAGGGTGTGG AAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGC AACCAGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGCAAAGCATGCATCT CAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCC CAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGA GGCCGCCTCTGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGG CTTTTGCAAAAAGCTCCCGGGAGCTTGTATATCCATTTTCGGATCTGATCAAGAGACAGG ATGAGGATCGTTTCGCATGATTGAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTG GGTGGAGAGGCTATTCGGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGC CGTGTTCCGGCTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGG TGCCCTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGGCGT TCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCTGCTATTGGG CGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCCGAGAAAGTATCCAT CATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCGGCTACCTGCCCATTCGACCA CCAAGCGAAACATCGCATCGAGCGAGCACGTACTCGGATGGAAGCCGGTCTTGTCGATCA GGATGATCTGGACGAAGAGCATCAGGGGCTCGCGCCAGCCGAACTGTTCGCCAGGCTCAA GGCGCGCATGCCCGACGGCGAGGATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAA TATCATGGTGGAAAATGGCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGC GGACCGCTATCAGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGA ATGGGCTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGC CTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGACCGAC CAAGCGACGCCCAACCTGCCATCACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG TTGGGCTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCTC ATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACAAATAA AGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGT TTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCTCTAGCTAGAGC TTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCA CACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAA CTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAG CTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCC GCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCT CACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATG TGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTC CATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGA AACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCT CCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTG GCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAG CTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTAT CGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAAC AGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAAC TACGGCTACACTAGAAGAACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTC GGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTTTTTTT GTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTT TCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGA TTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATC TAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCT ATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATA ACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACCGCGAGACCCA CGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGA AGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATTAATTGTTGCCGGGAAGCTAGA GTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTG GTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCCAACGATCAAGGCGA GTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTT GTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCT CTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCA TTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAAT ACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCC AACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGG CAAAATGCCGCΆAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTC CTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTT GAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCA CCTGACGTC snRNA U6 gene is reported to be transcribed by RNA polymerase III, which produce short transcripts with uridines at the 3' end. The genomic fragment ofthe snRNA U6 gene containing the promoter region was amplified by PCR using a set of primers, 5'-GGGGATCAGCGTTTGAGTAA-3' (SEQ ID No: 14), and 5'-TAGGCCCCACCTCCTTCTAT-3' (SEQ ID No: 15) and human placental DNA as a template. The product was purified and cloned into pCR plasmid vector using a TA cloning kit according to the supplier's protocol (Invitrogen). The BamRl, Xhol fragment containing the snRNA U6 gene was purified and cloned into nucleotide 1257 to 56 fragment of pcDNA3.1(+) plasmid, which was amplified by PCR with a set of primer, 5'-TGCGGATCCAGAGCAGATTGTACTGAGAGT-3' (SEQ ID No: 16) and 5'- CTCTATCTCGAGTGAGGCGGAAAGAACCA-3 ' (SEQ ID No: 17). The ligated DNA was used for a template of PCR with primers, 5'-TTTAAGCTTGAAGACTATTTTTACATCAGGTTGTTTTTCT-3' (SEQ ID No: 18) and 5'-TTTAAGCTTGAAGACACGGTGTTTCGTCCTTTCCACA-3' (SEQ ID No: 19). The product was digested with Hindlϊl, which was subsequently self-ligated to produce psiU6BX vector plasmid. For the control, psiU6BX-EGFP was prepared by cloning double-stranded ohgonucleotides of
5'- CACCGAAGCAGCACGACTTCTTCTTCAAGAGAGAAGAAGTCGTGCTG CTTC-3' (SEQ ID No: 20) and 5'- AAAAGAAGCAGCACGACTTCTTCTCTCTTGAAGAAGAAGTCGTGCTG
CTTC -3' (SEQ ID No: 21) into the Bbsl site in the psiU6BX vector.
Industrial Applicability The expression of human genes CCDC4 is markedly elevated in prostate cancer as compared to non-cancerous prostate duct epithelium. Accordingly, this gene is useful as a diagnostic marker of prostate cancer and the proteins encoded thereby are useful in diagnostic assays of prostate cancer. The present inventors have also shown that the expression of novel protein CCDC4 promotes cell growth whereas cell growth is suppressed by small interfering RNAs corresponding to the CCDC4 gene. These findings show that CCDC4 protein stimulates oncogenic activity. Thus, each of these novel oncoproteins is a useful target for the development of anti-cancer pharmaceuticals. For example, agents that block the expression of CCDC4, or prevent its activity find therapeutic utility as anti-cancer agents, particularly anti-cancer agents for the treatment of prostate cancers. Examples of such agents include antisense ohgonucleotides, small interfering RNAs, and ribozymes against the CCDC4 gene, and antibodies that recognize CCDC4. While the invention has been described in detail and with reference to specific embodiments thereof, it will be apparent to one skilled in the art that various changes and modifications can be made therein without departing from the spirit and scope ofthe invention.

Claims

1. A substantially pure polypeptide selected from the group consisting of: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 or a sequence having at least about 80%) homology to SEQ ID NO: 2 or 4 ; and (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of any one of SEQ ID NO: 2 or 4.
2. An isolated polynucleotide encoding the polypeptide of claim 1.
3. A vector comprising the polynucleotide of claim 2.
4. A host cell harboring the polynucleotide of claim 2 or the vector of claim 3.
5. A method for producing the polypeptide of claim 1 , said method comprising the steps of: (a) culturing the host cell of claim 4; (b) allowing the host cell to express the polypeptide; and (c) collecting the expressed polypeptide.
6. An antibody binding to the polypeptide of claim 1.
7. A polynucleotide that is complementary to the polynucleotide encoding the polypeptide of claim 1 or to the complementary strand thereof and that comprises at least 15 nucleotides.
8. An antisense polynucleotide or small interfering RNA against the polynucleotide encoding the polypeptide of claim 1.
9. The small interfering RNA of claim 8, wherein the sense strand thereof comprises the nucleotide sequence of SEQ ID NO: 8 as the target sequence and less than 75 nucleotides in length.
10. A method for diagnosing prostate cancer, said method comprising the steps of: (a) detecting the expression level of the gene encoding the amino acid sequence of SEQ ID NO: 2 or 4 in a biological sample; and (b) relating an elevation ofthe expression level to the disease.
11. The method of claim 10, wherein the expression level is detected by any one ofthe method select from the group consisting of: (a) detecting the mRNA encoding the amino acid sequence of SEQ ID NO: 2 or 4, (b) detecting the protein comprising the amino acid sequence of SEQ ID NO: 2 or 4, and (c) detecting the biological activity ofthe protein comprising the amino acid sequence of SEQ ID NO: 2 or 4.
12. A method of screening for a compound for treating or preventing prostate cancer, said method comprising the steps of: (a) contacting a test compound with a polypeptide selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4; (2) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 or a sequence having at least about 80%) homology to SEQ ID NO: 2 or 4; and (3) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO:l or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; (b) detecting the binding activity between the polypeptide and the test compound; and (c) selecting a compound that binds to the polypeptide.
13. A method of screening for a compound for treating or preventing prostate cancer, said method comprising the steps of: (a) contacting a test compound with a polypeptide selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4; (2) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 or a sequence having at least about 80%) homology to SEQ ID NO: 2 or 4; and (3) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; (b) detecting the biological activity ofthe polypeptide of step (a); and (c) selecting a compound that suppresses the biological activity ofthe polypeptide in comparison with the biological activity detected in the absence ofthe test compound.
14. The method of claim 13, wherein the biological activity is cell-proliferating activity.
15. A method of screening for a compound for treating or preventing prostate cancer, said method comprising the steps of: (a) contacting a test compound with a cell expressing one or more polynucleotides comprising the nucleotide sequence of SEQ ID NO: 1 or 3; and (b) selecting a compound that reduces the expression level of one or more polynucleotides comprising the nucleotide sequence of SEQ ID NO: 1 or 3 in comparison with the expression level detected in the absence ofthe test compound.
16. The method of claim 15, wherein the cell is prostate cancer cell.
17. A method of screening for a compound for treating or preventing prostate cancer, said method comprising the steps of: (a) contacting a test compound with a cell into which a vector comprising the transcriptional regulatory region of one or more marker genes and a reporter gene that is expressed under the control ofthe transcriptional regulatory region has been introduced, wherein the one or more marker genes comprise any one of nucleotide sequence selected from the group consisting of SEQ ID NO: 1 and 3, (b) measuring the expression level or activity of said reporter gene; and (c) selecting a compound that reduces the expression level or activity of said reporter gene as compared to a control.
18. A composition for treating or preventing prostate cancer, said composition comprising a pharmaceutically effective amount of an antisense polynucleotide or small interfering RNA against a polynucleotide and pharmaceutically acceptable carrier, wherein the polynucleotide encodes a polypeptide selected from the group consisting of: (a) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; and (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4 as an active ingredient, and a pharmaceutically acceptable carrier.
19. The composition of claim 18, wherein said small interfering RNA comprises the nucleotide sequence of SEQ ID NO: 8 as the target sequence.
20. The composition of claim 19, said siRNA has the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence coresponding to the nucleotide sequence of SEQ ID NO: 8, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A].
21. The composition of claim 18, wherein said composition comprises a transfection-enhancing agent.
22. A composition for treating or preventing prostate cancer, said composition comprising a pharmaceutically effective amount of an antibody against a polypeptide selected from the group consisting of: (a) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; and (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4 as an active ingredient, and a pharmaceutically acceptable carrier.
23. A composition for treating or preventing prostate cancer, said composition comprising a pharmaceutically effective amount ofthe compound selected by the method of any one of claims 12 to 17 as an active ingredient, and a pharmaceutically acceptable carrier.
24. A method for treating or preventing prostate cancer, said method comprising the step of administering a pharmaceutically effective amount of an antisense polynucleotide, or small interfering RNA against a polynucleotide encoding a polypeptide selected from the group consisting of: (1) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4; (2) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; and (3) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4.
25. The method of claim 24, wherein said siRNA comprises the nucleotide sequence of SEQ ID NO: 8 as the target sequence.
26. The method of claim 25, said siRNAhas the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence coresponding to the nucleotide sequence of SEQ ID NO: 8, [B] is a ribonucleotide sequence consisting of 3 to 23 nucleotides, and [A'] is a ribonucleotide sequence consisting ofthe complementary sequence of [A].
27. The method of claim 24, wherein said composition comprises a transfection-enhancing agent.
28. A method for treating or preventing prostate cancer, said method comprising the step of administering a pharmaceutically effective amount of an antibody against a polypeptide selected from the group consisting of: (a) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; and (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4.
29. A method for treating or preventing prostate cancer, said method comprising the step of administering a pharmaceutically effective amount of a compound selected by the method of any one of claims 12 to 17.
30. A method for treating or preventing prostate cancer, said method comprising the step of administering a pharmaceutically effective amount of a polypeptide selected from the group consisting of (a)-(c), or a polynucleotide encoding the polypeptide: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4 or fragment thereof; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4; (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting ofthe nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting ofthe amino acid sequence of SEQ ID NO: 2 or 4, or fragment thereof.
31. A method for inducing an anti tumor immunity, said method comprising the step of contacting a polypeptide selected from the group consisting of (a)-(c) with antigen presenting cells, or introducing a polynucleotide encoding the polypeptide or a vector comprising the polynucleotide to antigen presenting cells: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4, or fragment thereof; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4; (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 or 4, or fragment thereof.
32. The method for inducing an anti tumor immunity of claim 31 , wherein the method further comprising the step of administering the antigen presenting cells to a subject.
33. A pharmaceutical composition for treating or preventing prostate cancer, said composition comprising a pharmaceutically effective amount of polypeptide selected from the group of (a)-(c), or a polynucleotide encoding the polypeptide: (a) a polypeptide comprising the amino acid sequence of SEQ ID NO: 2 or 4, or fragment thereof; (b) a polypeptide that comprises the amino acid sequence of SEQ ID NO: 2 or 4 in which one or more amino acids are substituted, deleted, inserted and/or added and that has a biological activity equivalent to a protein consisting of the amino acid sequence of SEQ ID NO: 2 or 4; (c) a polypeptide encoded by a polynucleotide that hybridizes under stringent conditions to a polynucleotide consisting of the nucleotide sequence of SEQ ID NO: 1 or 3, wherein the polypeptide has a biological activity equivalent to a polypeptide consisting of the amino acid sequence of SEQ ID NO: 2 or 4, or fragment thereof as an active ingredient, and a pharmaceutically acceptable carrier.
34. The pharmaceutical composition of claim 33, wherein the polynucleotide is incoφorated in an expression vector.
35. A diagnostic agent comprises an oligonucleotide that hybridizes to the polynucleotide encoding the polypeptide of claim 1, or an antibody that binds to the polypeptide of claim 1.
36. A double-stranded molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to SEQ ID NO: 8, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double-stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing the CCDC4 gene, inhibits expression of said gene.
37. The double-stranded molecule of claim 36, wherein said sense strand comprises from about 19 to about 25 contiguous nucleotides from SEQ ID No: 1.
38. The double-stranded molecule of claim 36, wherein said sense strand consists ofthe ribonucleotide sequence corresponding to SEQ ID NO: 8.
39. The double-stranded molecule of claim 36, wherein a single ribonucleotide transcript comprises the sense strand and the antisense strand, said double-stranded molecule further comprising a single-stranded ribonucleotide sequence linking said sense strand and said antisense strand.
40. A vector encoding the double-stranded molecule of claim 36.
41. The vector of claim 40, wherein the vector encodes a transcript having a secondary structure, wherein the transcript comprises the sense strand and the antisense strand.
42. The vector of claim 40, wherein the transcript further comprises a single-stranded ribonucleotide sequence linking said sense strand and said antisense strand. **********
EP05721047A 2004-03-23 2005-03-11 Genes and polypeptides relating to prostate cancers Withdrawn EP1727831A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US55581004P 2004-03-23 2004-03-23
PCT/JP2005/004860 WO2005090398A1 (en) 2004-03-23 2005-03-11 Genes and polypeptides relating to prostate cancers

Publications (1)

Publication Number Publication Date
EP1727831A1 true EP1727831A1 (en) 2006-12-06

Family

ID=34962343

Family Applications (1)

Application Number Title Priority Date Filing Date
EP05721047A Withdrawn EP1727831A1 (en) 2004-03-23 2005-03-11 Genes and polypeptides relating to prostate cancers

Country Status (5)

Country Link
EP (1) EP1727831A1 (en)
JP (1) JP2008505601A (en)
CN (1) CN1984925A (en)
TW (1) TW200540183A (en)
WO (1) WO2005090398A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008102906A1 (en) * 2007-02-20 2008-08-28 Oncotherapy Science, Inc. Hspc-hrpc transition genes

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5925362A (en) * 1993-08-11 1999-07-20 Jenner Technologies Method to elicit an antitumor response with human prostate-specific antigen
US5783435A (en) * 1996-08-06 1998-07-21 Lamparski; Henry G. Prostate cancer drug screenings
AU2001241541A1 (en) * 2000-02-17 2001-08-27 Millennium Predictive Medicine, Inc. Novel genes, compositions, kits, and methods for identification, assessment, prevention, and therapy of human prostate cancer
US20020045170A1 (en) * 2000-04-06 2002-04-18 Wong Gordon G. Polynucleotides encoding novel secreted proteins
EP1440981A3 (en) * 2003-01-21 2005-11-23 Research Association for Biotechnology Full-length human cdna

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2005090398A1 *

Also Published As

Publication number Publication date
TW200540183A (en) 2005-12-16
JP2008505601A (en) 2008-02-28
CN1984925A (en) 2007-06-20
WO2005090398A1 (en) 2005-09-29

Similar Documents

Publication Publication Date Title
EP1556518B1 (en) Genes and polypeptides relating to human pancreatic cancers
EP1549676A1 (en) Genes and polypeptides relating to human myeloid leukemia
WO2006085684A9 (en) Method of diagnosing bladder cancer
US7521205B2 (en) Genes and polypeptides relating to prostate cancers
EP1551998A2 (en) Method for diagnosing non-small cell lung cancers
US20060210576A1 (en) Method for treating or preventing metastasis of colorectal cancers
US8067153B2 (en) Genes and polypeptides relating to prostate cancers
EP1910570B1 (en) Gene and polypeptide relating to breast cancer
WO2005090398A1 (en) Genes and polypeptides relating to prostate cancers
US20060240425A1 (en) Genes and polypeptides relating to myeloid leukemia

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20061018

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LI LT LU MC NL PL PT RO SE SI SK TR

RIN1 Information on inventor provided before grant (corrected)

Inventor name: NAKAGAWA, HIDEWAKI

Inventor name: NAKAMURA, YUSUKE

Inventor name: NAKATSURU, SHUICHI

DAX Request for extension of the european patent (deleted)
STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN

18W Application withdrawn

Effective date: 20090223