EP1631687A2 - Methods and products for identification and assessment of tlr ligands - Google Patents

Methods and products for identification and assessment of tlr ligands

Info

Publication number
EP1631687A2
EP1631687A2 EP04760178A EP04760178A EP1631687A2 EP 1631687 A2 EP1631687 A2 EP 1631687A2 EP 04760178 A EP04760178 A EP 04760178A EP 04760178 A EP04760178 A EP 04760178A EP 1631687 A2 EP1631687 A2 EP 1631687A2
Authority
EP
European Patent Office
Prior art keywords
tlr
cell
expression
promoter region
nucleic acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04760178A
Other languages
German (de)
French (fr)
Inventor
Jörg VOLLMER
Marion Jurk
Grayson B. Lipford
Christian Schetter
Alexandra Forsbach
Arthur M. Krieg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Coley Pharmaceutical GmbH
Coley Pharmaceutical Group Inc
Original Assignee
Coley Pharmaceutical GmbH
Coley Pharmaceutical Group Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Coley Pharmaceutical GmbH, Coley Pharmaceutical Group Inc filed Critical Coley Pharmaceutical GmbH
Publication of EP1631687A2 publication Critical patent/EP1631687A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants

Definitions

  • the first recognized immunostimulatory motif was the CpG motif in which at least the C ofthe dinucleotide was unmethylated. It has been postulated that mammalian subjects recognize the unmethylated dinucleotide as being of bacterial origin, and thus mount a heightened immune response following exposure. The ensuing immune response includes both cell mediated and humoral aspects. Since the discovery ofthe CpG immunostimulatory motif, other immunostimulatory motifs have also been identified including the poly-T and T-rich motifs, the TG motif and the poly-G motif.
  • immunostimulation has also been observed in response to exposure to methylated CpG motifs and motif-less nucleic acids having phosphorothioate backbone linkages.
  • the responses induced by immunostimulatory nucleic acids are varied and can include production and secretion of cytokines, chemokines, and other growth factors.
  • the nucleic acids can induce a heightened immune stimulation regardless of whether an antigen is also introduced to the subject. Identification of new motifs as well as of subtle differences between response profiles of different nucleic acids oftentimes can be laborious, and a high throughput system for screening nucleic acids for their ability to be immunostimulatory as well as to determine the profile of responses they induce would be useful.
  • the invention provides in its broadest sense screening methods and tools for identification and discrimination of immunomodulatory molecules and assessment and standardization of samples containing known immunomodulatory molecules.
  • the immunomodulatory molecules can be immunostimulatory or immunoinhibitory, and most preferably are Toll-like receptor (TLR) ligands.
  • TLR Toll-like receptor
  • the invention provides a screening method for identifying TLR agonists.
  • the method comprises contacting a cell line endogenously expressing at least one TLR with a test compound and measuring a test level of TLR signaling activity, wherein a positive test level is indicative of a TLR agonist (i.e., an immunostimulatory compound).
  • a positive test level may be apparent without referring to a control. Preferably, however, it is determined relative to a control (i.e., the TLR signaling activity from a reference compound).
  • the reference compound is a compound that induces no response (i.e., a zero response) or a minimal response.
  • a test level that is greater than the reference level is indicative of a compound with TLR signaling activity.
  • the reference compound is a compound that induces a positive response (i.e., a non-zero response) and that is immunostimulatory.
  • positive response i.e., a non-zero response
  • these reference compounds are referred to herein as negative and positive reference compounds, respectively. If the reference compound is immunostimulatory (i.e., a positive reference compound), a non-zero test level that is lower than the reference level is still indicative of an immunostimulatory test compound.
  • test compound is less immunostimulatory than the reference compound (for that particular readout), but it is nonetheless immunostimulatory given the non-zero response induced.
  • reference compound for that particular readout
  • the reference may also be a standard curve or data generated previously.
  • the screening method involves exposing the same cell to a positive reference compound and a test compound in order to identify a test compound that inhibits the immunostimulatory response ofthe positive reference compound (i.e., a TLR antagonist or an immunoinhibitory compound).
  • the screening method involves exposing the same cells to a positive reference compound and a test compound in order to identify a test compound that enhances the immunostimulatory response ofthe positive reference compound (i.e., an enhancer).
  • the assay requires a co-incubation ofthe positive reference compound, the test compound and the cells. Separate assays with positive reference compound alone and optionally negative reference compound alone are usually also performed.
  • the positive reference compound is a known TLR ligand. Non-limiting examples include but are not limited to TLR3 ligands, TLR7 ligands, TLR8 ligands and TLR9 ligands.
  • the positive reference compound is an immunostimulatory nucleic acid.
  • the positive reference compound is a CpG nucleic acid, a poly-T nucleic acid, a T-rich nucleic acid or a poly-G nucleic acid.
  • Another example of a positive reference compound is a nucleic acid comprising a backbone that contains at least one phosphorothioate linkage.
  • the RPMI 8226 cell line expresses TLR7 and responds to the imidazoquinoline compound R-848 (Resiquimod) which is known to signal through TLR7 and TLR8. Accordingly, the screening method can be performed using RPMI 8226, Raji or RAMOS cells and an imidazoquinoline compound such as R-848 or R-847 (Imiquimod) as the positive reference compound.
  • the test compound is a nucleic acid such as but not limited to a DNA, an RNA and a DNA RNA hybrid.
  • the test compound may be a nucleic acid that does not comprise motif selected from the group consisting of a CpG motif, a poly-T motif, a T- rich motif and a poly-G motif.
  • the test compound may be a nucleic acid that comprises a phosphorothioate backbone linkage.
  • the test compound is a non- nucleic acid small molecule.
  • the non-nucleic acid small molecule may be derived from a molecular library.
  • the test compound comprises amino acids, carbohydrates such as polysaccharides.
  • test compounds are putative ligands for TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10 or TLR11.
  • the cell is a RPMI 8226 cell, a Raji cell, a RAMOS cell, a THP-1 cells, a Nairn cell or a KG-1 cell and the TLR is TLR9.
  • the cell is a RPMI 8226 cell, a Raji cell or a RAMOS cell and the TLR is TLR7.
  • the cell is a KG-1 cell, a Nairn cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, a Hep-2 cells, a A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell and the TLR is TLR3.
  • the cell is an RPMI 8226 cell and the TLR is TLR7 or TLR9.
  • the cell is a Raji cell and the TLR is TLR9, TLR7 or TLR3.
  • the TLR signaling activity may be measured or detected in a number of ways.
  • the TLR signaling activity is measured by cytokine, chemokme, or growth factor secretion.
  • the cytokine secretion may be selected from the group consisting of IL-6 secretion, IL-10 secretion, IL-12 secretion, IFN- ⁇ secretion and TNF-a secretion, but is not so limited.
  • the chemokine secretion may be IP-10 secretion or IL-8 secretion, but is not so limited.
  • the TLR signaling activity is measured by antibody secretion.
  • the antibody secretion may be IgM secretion, but is not limited to this antibody subtype.
  • the TLR signaling activity is measured by phosphorylation.
  • the total level of phosphorylation in the cell or the level of phosphorylation of particular factors in the cell may be measured. These factors are preferably signaling factors and can be selected from the group consisting of IRAK, ERK, MyD88, TRAP6, p38, Jun, c-fos, and subunits of NF- ⁇ B, but are not so limited.
  • the TLR signaling activity is measured by cell surface marker expression.
  • the TLR signaling activity is measured by an increase in cell surface marker expression. Examples of cell surface markers to be analyzed include CD71, CD86, HLA-DR, CD80, HLA Class L CD54 and CD69.
  • the TLR signaling activity is measured by a decrease in cell surface marker expression. Cell surface marker expression can be determined using flow cytometry. TLR signaling activity can also be measured by protein production (e.g., by Western blot).
  • the TLR signaling activity is measured by gene expression.
  • Gene expression profiles may be determined using Northern blot analysis or RT-PCR that uses mRNA or total RNA as a starting material.
  • the gene expression of interest may be that ofthe chemokines and cytokines and cell surface molecules recited above. Gene expression analysis can be performed using microarray techniques.
  • the TLR signaling activity is measured by cell proliferation.
  • Cell proliferation assays can be measured in a number of ways including but not limited to 3 H-thymidine incorporation.
  • the cell is an RPMI 8226 cell and TLR signaling is indicated by expression of a marker such as CD71, CD86 and/or HLA-DR or by expression, production or secretion of a factor such as IL-8, IL-10, IP-10 and/or TNF- ⁇ .
  • a marker such as CD71, CD86 and/or HLA-DR or by expression, production or secretion of a factor such as IL-8, IL-10, IP-10 and/or TNF- ⁇ .
  • the RPMI 8226 cell is unmodified.
  • the cell is a Raji cell and the TLR signaling is indicated by IL-6 or JTN-o2 expression, production or secretion.
  • the cell is a RAMOS cell and the TLR signaling is indicated by CD80 cell surface expression.
  • TLR signaling activity can be measured via a native readout or an artificial readout or both.
  • a native readout is one that does not rely on introduction of a reporter construct into the cell of interest.
  • the cell line may be used in a modified or unmodified form.
  • the cell line is transfected with a reporter construct.
  • the transfection may be transient or stable.
  • the reporter construct generally comprises a promoter, a coding sequence and a polyadenylation signal.
  • the coding sequence may comprise a reporter sequence selected from the group consisting of an enzyme (e.g., luciferase, alkaline phosphatase, ⁇ - galactosidase, chloramphenicol acetyltransferase (CAT), secreted alkaline phosphatase, etc.), a bioluminescence marker (e.g., green fluorescent protein (GFP, U.S. Patent No.
  • an enzyme e.g., luciferase, alkaline phosphatase, ⁇ - galactosidase, chloramphenicol acetyltransferase (CAT), secreted alkaline phosphatase, etc.
  • the coding sequence encodes a protein, the level or activity of which can be quantified, with preferably a wide linear range.
  • the promoter is a promoter that is responsive to TLR signaling pathways (i.e., a "TLR responsive promoter"), h some embodiments, the promoter contains a binding site for a transcription factor activated upon CpG nucleic acid exposure, such as for example NF- ⁇ B. In other embodiments, the promoter contains a binding site for a transcription factor that is activated by a positive reference compound other than CpG nucleic acids.
  • the transcription factor binding site may be selected from the group consisting of a NF- ⁇ B binding site, an AP-1 binding site, a CRE, a SRE, an ISRE, a GAS, an ATF2 binding site, an IRF3 binding site, an I F7 binding site, an NFAT binding site, a p53 binding site, an SRF binding site, and a TARE, as well as others known to those of skill in the art.
  • the promoter contains a functional promoter element from an IL-1 gene, an IL-6 gene, an IL-8 gene, an IL-10 gene, an IL-12 p40 gene, an JTN- ⁇ l gene, an D?N-o4 gene, an IFN-jS gene, an IFN- ⁇ gene, a TNF- ⁇ gene, a TNF- ⁇ gene, an IP -9 gene, an IP-10 gene, a RANTES gene, an IT AC gene, a MCP-1 gene, an IGFBP4 gene, a CD54 gene, a CD69 gene, a CD71 gene, a CD80 gene, a CD86 gene, a HLA-DR gene, and a HLA class I gene.
  • a functional promoter element from an IL-1 gene, an IL-6 gene, an IL-8 gene, an IL-10 gene, an IL-12 p40 gene, an JTN- ⁇ l gene, an D?N-o4 gene, an IFN-jS gene, an IFN- ⁇ gene, a TNF
  • the TLR responsive promoter may be a TLR1 responsive promoter, a TLR2 responsive promoter, a TLR3 responsive promoter, a TLR4 responsive promoter, a TLR5 responsive promoter, a TLR6 responsive promoter, a TLR7 responsive promoter, a TLR8 responsive promoter, a TLR9 responsive promoter, a TLR10 responsive promoter or a TLR11 responsive promoter.
  • the cell line may be transfected with a reporter construct having a promoter derived from a particular cytokine, chemokine, or cell surface marker, and a unique reporter coding sequence conjugated thereto.
  • the readout from a particular reporter construct is a surrogate readout for cytokine, chemokine, or cell surface marker readout. Measuring readout from the reporter coding sequences described herein is in some instances easier than measuring cytokine or chemokine secretion, or upregulation of a cell surface marker.
  • the cell line may be transfected with a number of reporter constructs each having a promoter derived from a particular cytokine, chemokine, or cell surface marker, and a unique distinguishable coding sequence conjugated thereto.
  • multiple readouts are possible from one screen. In other embodiments, multiple native readouts are also possible from one screen.
  • the cell may be further transfected with a nucleic acid that codes for a TLR polypeptide or a fragment thereof.
  • the TLR is one that is not endogenously expressed by the cell.
  • the cell is an RPMI 8226 cell which has been shown to express TLR7 and TLR9 according to the invention, then it may be modified to express TLRs other than these (e.g., TLR8) in some embodiments.
  • the RPMI 8226 cell is responsive to TLR8 ligands.
  • the TLR is a human TLR (i.e., hTLR).
  • the invention provides an RPMI 8226 cell transfected with a TLR nucleic acid.
  • the TLR nucleic acid is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR8, TLR10 and TLR11.
  • the encoded TLRs nucleic acids can derive from human or non-human sources. Examples of non-human sources include, but are not limited to, murine, bovine, canine, feline, ovine, porcine, and equine species. Other species include chicken and fish, e.g., aquaculture species.
  • the TLR nucleic acids can also include chimeric sequences consisting of domains originating from different species. In preferred embodiments, the TLR is a human TLR.
  • kits including the cells lines (e.g., the RPMI 8226 cell line), the reporter constructs and/or expression constructs described above, and instructions for use.
  • the cells lines e.g., the RPMI 8226 cell line
  • the reporter constructs and/or expression constructs described above and instructions for use.
  • TLR ligands i.e., specific compounds which are ligands for a particular TLR
  • the methods permit a qualitative and, importantly, a quantitative assessment of biological activity of individual lots of TLR ligands, pre-formulation as well as post-formulation.
  • Such methods are useful in the manufacture and validation of pharmaceutical compositions containing, as an active agent, at least one specific ligand of at least one specific TLR.
  • the specific TLR can be any known TLR, including without limitation TLR3, TLR7, TLR8 and TLR9.
  • the specific TLR ligand is an isolated TLR ligand, either found in nature or synthetic (not found in nature), including in particular certain nucleic acid molecules and small molecules.
  • Nucleic acid molecules that are specific TLR ligands include synthetic and nahirally-occurring oligonucleotides having specific base sequence motifs.
  • specific TLR ligands include both agonists and antagonists of specific TLR.
  • the methods ofthe invention deal specifically with characterizing biotechnological/biological products which are classified as DNA products.
  • DNA products are explicitly excluded in ICH Harmonised Tripartite Guideline Specifications: Test Procedures and Acceptance Criteria for Biotechnological/Biological Products, Step 4 - 10 March 1999, ⁇ 1.3.
  • the invention provides a method for quality assessment of a test composition containing a known TLR ligand.
  • the method according to this aspect ofthe invention involves measuring a reference activity of a reference composition comprising a known TLR ligand, wherein the known TLR ligand is a nucleic acid molecule; measuring a test activity of a test composition comprising the known TLR ligand; and comparing the test activity to the reference activity.
  • the method further involves the step of selecting the test composition if the test activity falls within a predetermined range of variance about the reference activity.
  • the reference composition is a first production lot of a pharmaceutical composition comprising the known TLR ligand
  • the test composition is a second production lot of a pharmaceutical composition comprising the known TLR ligand.
  • This embodiment is particularly useful as a method for developing and applying acceptance criteria for finished pharmaceutical products containing a known TLR ligand.
  • the reference composition is a first in-process lot of a composition comprising the known TLR ligand
  • the test composition is a second in-process lot of a composition comprising the known TLR ligand.
  • This embodiment is particularly useful as a method for developing and applying acceptance criteria for raw materials and/or other in-process materials containing a known TLR ligand bound for use in a pharmaceutical product.
  • measuring the reference activity involves contacting the reference composition with an isolated cell expressing a TLR responsive to the known TLR ligand, and measuring the test activity involves contacting the test composition with the isolated cell expressing the TLR responsive to the known TLR ligand.
  • the isolated cell expressing the TLR responsive to the known TLR ligand includes an expression vector for the TLR responsive to the known TLR ligand. Such expression vector, and likewise for any expression vector according to the instant invention, can be introduced into the cell using any suitable method.
  • TLR ligand naturally expresses the TLR responsive to the known TLR ligand.
  • a cell can be naturally occurring or it can be a cell line, provided the cell does not include an expression vector introduced into the cell for the purpose of artificially inducing the cell to express or overexpress the TLR.
  • the isolated cell expressing the TLR responsive to the known TLR ligand is RPMI 8226.
  • the isolated cell expressing the TLR responsive to the known TLR ligand is Raji, RAMOS, Nairn, THP-1 or KG-1 and the TLR is TLR9.
  • the isolated cell expressing the TLR responsive to the known TLR ligand is RPMI 8226, Raji or RAMOS and the TLR is TLR7.
  • the isolated cell expressing the TLR responsive to the known TLR ligand is a KG-1 cell, a Nairn cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, a Hep-2 cells, a A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell and the TLR is TLR3.
  • measuring the reference activity and measuring the test activity each comprises measuring signaling activity mediated by a TLR responsive to the known TLR ligand.
  • TLR signaling involves a series of intracellular signaling events. These signaling events give rise to various downstream products, including certain transcription factors (e.g., NF- ⁇ B and AP-1), cytokines, chemokines, etc., which can affect the activity of certain gene promoters.
  • the signaling activity is activity of a reporter gene or reporter construct under the control of a NF- ⁇ B response element.
  • the signaling activity is activity of a reporter gene or reporter construct under the control of an interferon-stimulated response element (ISRE); an IFN- ⁇ promoter; an IFN- ⁇ promoter; an IL-6 promoter; an IL-8 promoter; an IL-12 p40 promoter; a RANTES promoter; an IL-10 promoter or an IP-10 promoter.
  • ISRE interferon-stimulated response element
  • the known TLR ligand is an immunostimulatory nucleic acid.
  • An immunostimulatory nucleic acid can include, without limitation, a CpG nucleic acid.
  • the known TLR ligand is an immunoinhibitory nucleic acid.
  • the method according to this aspect ofthe invention can further involve measuring the reference activity ofthe reference composition and measuring the test activity ofthe test composition, each performed in the presence of a known immunostimulatory TLR ligand.
  • the known TLR ligand is a ligand for a particular TLR.
  • the known TLR ligand is a TLR9 ligand. More specifically, in one embodiment the known TLR ligand is a CpG nucleic acid. h one embodiment, the known TLR ligand is a TLR3 ligand. Such a ligand can include, for example, a double-stranded RNA or a homolog thereof. In one embodiment, the known TLR ligand is a TLR7 ligand. In one embodiment the known TLR ligand is a TLR8 ligand.
  • the invention provides in another aspect a method for quality assessment of a test lot of a pharmaceutical product containing a known TLR9 ligand.
  • the method according to this aspect ofthe invention involves measuring a reference activity of a reference lot of a pharmaceutical product comprising a known TLR9 ligand, wherein the known TLR9 ligand is a nucleic acid molecule; measuring a test activity of a test lot of a pharmaceutical product comprising the known TLR9 ligand; comparing the test activity to the reference activity; and rejecting the test lot if the test activity falls outside of a predetermined range of variance about the reference activity.
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TGT CGT TTT GTC GTT-3' (SEQ ID NO:l).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TGA CGT TTT GTC GTT-3* (SEQ ED NO:139).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TGT CGT TTT TTT CGA-3' (SEQ ID NO: 140). h one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5*-TCG TCG TTT CGT CGT TTC GTC GTT-3' (SEQ ID NO: 141).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT CGT CGT TTT GTC GTT-3' (SEQ ID NO: 142).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TTC GGT CGT TTT-3' (SEQ ID NO:143).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TTC GTG CGT TTT T-3' (SEQ ID NO: 144).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TCG GCG GCC GCC G-3* (SEQ ID NO: 145).
  • the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TC_G TTT TAC_GGC GCC_GTG CCG-3' (SEQ ID NO: 146), wherein every internucleoside linkage is phosphorothioate except for those indicated by "__", which are phosphodiester.
  • Fig. 1 is a bar graph showing cell surface expression of various markers by RPMI 8226 24 hours and 48 hours following stimulation with CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), LPS and IL-1.
  • Fig. 2 is a bar graph showing IL-8 production by RPMI 822624 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
  • Fig. 3 is a bar graph showing IL-6 production by RPMI 8226 24 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
  • Fig. 4 is a bar graph showing IP-10 production by RPMI 8226 24 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
  • Fig. 5 is a bar graph showing IL-10 production by RPMI 822624 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
  • Fig. 6 is a dose response curve showing fold induction of IL-8 production 24 hours after exposure to CpG nucleic acid (SEQ ID NO: 1) and non-CpG nucleic acid (SEQ ID NO: 2).
  • the EC 50 for CpG nucleic acid is 19 nM and the EC 50 for non-CpG nucleic acid is 263 nM.
  • Fig. 7 is a bar graph showing NF- ⁇ B activation in RPMI 8226 transfected transiently with a NF- ⁇ B-luciferase reporter gene construct as a function of cell density and nucleic acid amount transfected, following exposure to CpG nucleic acid (SEQ ID NO: 1), LPS and TNF- ⁇ . NF- ⁇ B activation is measured by luciferase activity.
  • Fig. 8 is a bar graph showing RT-PCR results from RNA isolated from RPMI 8226 using gene specific primers for TLR7, TLR8 and TLR9 genes.
  • Fig. 9 is a dose response curve showing IP-10 production induced by SEQ ID NO: 1, and inhibition thereof in the presence of SEQ HD NO: 151, a immunoinhibitory nucleic acid.
  • Fig. 10 is a bar graph showing the results of a TLR9 RT-PCR analysis of a number of cell lines.
  • Fig. 11 is a bar graph showing the results of a TLR7 RT-PCR analysis of a number of cell lines.
  • Fig. 12 is a bar graph showing the results of a TLR3 RT-PCR analysis of a number of cell lines.
  • Fig. 13 is a bar graph showing the results of a TLR3, TLR7, TLR8 and TLR9 RT-PCR analysis ofthe Raji cell line.
  • Fig. 14 is a graph showing IL-6 production by the Raji cell line upon stimulation with various ODN (SEQ ID NO:l; SEQ ID NO:154; SEQ ID NO:158; SEQ ID NO:160; SEQ ID NO:159; SEQ ID NO:161).
  • Fig. 15 is a bar graph showing IL-6 production ofthe Raji cell line upon stimulation with poly I:C and R-848.
  • Fig. 16 is a bar graph showing D?N- ⁇ 2 production by the Raji cell line upon stimulation with CpG ODN (SEQ ID NO: 1), R-848 and poly I:C.
  • Fig. 17 is a bar graph showing CD80 expression (by flow cytometry) by the RAMOS cell line upon stimulation with CpG ODN (SEQ ID NO: 1) and non-CpG ODN (SEQ ID NO: 2).
  • Fig. 18A is a bar graph showing the induction of NF- ⁇ B by 293 fibroblast cells transfected with human TLR9 in response to exposure to various stimuli, including CpG- ODN, GpC-ODN, LPS, and medium.
  • Fig. 18B is a bar graph showing the amount of IL-8 produced by 293 fibroblast cells transfected with human TLR9 in response to exposure to various stimuli, including CpG- ODN, GpC-ODN, LPS, and medium.
  • Fig. 19 is a bar graph showing the induction of NF- ⁇ B-luc produced by stably transfected 293-mTLR9 cells in response to exposure to various stimuli, including CpG-ODN, methylated CpG-ODN (Me-CpG-ODN), GpC-ODN, LPS and medium.
  • Fig. 20 is a bar graph showing the induction of NF- ⁇ B-luc produced by stably transfected 293-hTLR9 cells in response to exposure to various stimuli, including CpG-ODN, methylated CpG-ODN (Me-CpG-ODN), GpC-ODN, LPS and medium.
  • CpG-ODN CpG-ODN
  • Me-CpG-ODN methylated CpG-ODN
  • GpC-ODN GpC-ODN
  • LPS medium.
  • 21 is a series of gel images depicting the results of reverse transcriptase- polymerase chain reaction (RT-PCR) assays for murine TLR9 (mTLR9), human TLR9 (hTLR9), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in untransfected control 293 cells, 293 cells transfected with mTLR9 (293-mTLR9), and 293 cells transfected with hTLR9 (293-hTLR9).
  • RT-PCR reverse transcriptase- polymerase chain reaction
  • SEQ ID NO:l is the nucleotide sequence of an immunostimulatory nucleic acid (TLR9 ligand).
  • SEQ ID NO:2 is the nucleotide sequence of a non-CpG nucleic acid.
  • SEQ ID NO:3 is the nucleotide sequence of human TLR2 cDNA (U88878).
  • SEQ ID NO:4 is the amino acid sequence of human TLR2 protein (AAC34133).
  • SEQ ID NO:5 is the nucleotide sequence of murine TLR2 cDNA (AF165189).
  • SEQ ID NO:6 is the amino acid sequence of murine TLR2 protein (NP_036035).
  • SEQ ID NO:7 is the nucleotide sequence of human TLR3 cDNA (NM_003265).
  • SEQ ID NO:8 is the amino acid sequence of human TLR3 protein (NP_003256).
  • SEQ ID NO:9 is the nucleotide sequence of murine TLR3 cDNA (AF355152).
  • SEQ ID NO:10 is the amino acid sequence of murine TLR3 protein (AAK26117).
  • SEQ ID NO:l 1 is the nucleotide sequence of human TLR4 cDNA (U88880).
  • SEQ ID NO: 12 is the nucleotide sequence of human TLR4 cDNA transcript variant 4 (NM_138557).
  • SEQ ID NO: 13 is the nucleotide sequence of human TLR4 cDNA transcript variant 2
  • SEQ ID NO: 14 is the nucleotide sequence of human TLR4 cDNA transcript variant 1 (NM 38554).
  • SEQ ID NO: 15 is the nucleotide sequence of human TLR4 cDNA transcript variant 3 (NM_003266).
  • SEQ ID NO: 16 is the amino acid sequence of human TLR4 protein isoform A (NP_612564).
  • SEQ ID NO: 17 is the amino acid sequence of human TLR4 protein isoform B (NP_612566).
  • SEQ ID NO: 18 is the amino acid sequence of human TLR4 protein isoform C
  • SEQ ID NO: 19 is the amino acid sequence of human TLR4 protein isoform D (NP_612567).
  • SEQ ID NO:20 is the nucleotide sequence of murine TLR4 cDNA (NM_021297).
  • SEQ ID NO:21 is the nucleotide sequence of murine TLR4 mRNA (AFl 85285).
  • SEQ ID NO:22 is the nucleotide sequence of murine TLR4 mRNA (AFl 10133).
  • SEQ ID NO:23 is the amino acid sequence of murine TLR4 protein (AAD29272).
  • SEQ ID NO:24 is the amino acid sequence of murine TLR4 protein (AAF04278).
  • SEQ ID NO:25 is the nucleotide sequence of human TLR5 cDNA (AB060695).
  • SEQ ID NO:26 is the amino acid sequence of human TLR5 protein (BAB43558).
  • SEQ ID NO:27 is the amino acid sequence of human TLR5 protein (O60602).
  • SEQ ID NO:28 is the amino acid sequence of human TLR5 protein (AAC34136).
  • SEQ ID NO:29 is the nucleotide sequence of murine TLR5 cDNA (AF186107).
  • SEQ ID NO:30 is the amino acid sequence of murine TLR5 protein (AAF65625).
  • SEQ ID NO:31 is the nucleotide sequence of human TLR7 cDNA (AF240467).
  • SEQ ID NO:32 is the nucleotide sequence of human TLR7 cDNA (AF245702).
  • SEQ ID NO:33 is the nucleotide sequence of human TLR7 cDNA (NM_016562).
  • SEQ ID NO:34 is the amino acid sequence of human TLR7 protein (AAF60188).
  • SEQ ID NO:35 is the amino acid sequence of human TLR7 protein (AAF78035).
  • SEQ ID NO:36 is the amino acid sequence of human TLR7 protein (NP_057646).
  • SEQ ID NO:37 is the amino acid sequence of human TLR7 protein (Q9NYK1).
  • SEQ ID NO:38 is the nucleotide sequence of murine TLR7 cDNA (AY035889).
  • SEQ ID NO:39 is the nucleotide sequence of murine TLR7 splice variant
  • SEQ ID NO:40 is the nucleotide sequence of murine TLR7 splice variant (AF334942).
  • SEQ ID NO:41 is the amino acid sequence of murine TLR7 protein (AAK62676).
  • SEQ ID NO:42 is the amino acid sequence of murine TLR7 protein (AAL73191).
  • SEQ ID NO:43 is the amino acid sequence of murine TLR7 protein (AAL73192).
  • SEQ ID NO:44 is the amino acid sequence of murine TLR7 protein (NP_573474).
  • SEQ ID NO:45 is the amino acid sequence of murine TLR7 protein (P58681).
  • SEQ ID NO:46 is the nucleotide sequence of human TLR8 cDNA (AF245703).
  • SEQ ID NO:47 is the nucleotide sequence of human TLR8 cDNA (AF246971).
  • SEQ ID NO:48 is the nucleotide sequence of human TLR8 cDNA (NM_138636).
  • SEQ ID NO:49 is the nucleotide sequence of human TLR8 cDNA (NM_016610).
  • SEQ ID NO:50 is the amino acid sequence of human TLR8 protein (AAF78036).
  • SEQ ID NO: 51 is the amino acid sequence of human TLR8 protein (AAF64061).
  • SEQ ID NO:52 is the amino acid sequence of human TLR8 protein (Q9NR97).
  • SEQ ID NO:53 is the amino acid sequence of human TLR8 protein (NP_619542).
  • SEQ ID NO:54 is the amino acid sequence of human TLR8 protein (NP_057694).
  • SEQ ID NO:55 is the nucleotide sequence of murine TLR8 cDNA (AY035890).
  • SEQ ID NO:56 is the nucleotide sequence of murine TLR8 cDNA (NM_133212).
  • SEQ ID NO:57 is the amino acid sequence of murine TLR8 protein (AAK62677).
  • SEQ ID NO:58 is the amino acid sequence of murine TLR8 protein (NP_573475).
  • SEQ ID NO:59 is the amino acid sequence of murine TLR8 protein (P58682).
  • SEQ ID NO:60 is the nucleotide sequence of human TLR9 cDNA (AF245704).
  • SEQ ID NO:61 is the nucleotide sequence of human TLR9 cDNA (AB045180).
  • SEQ ID NO:62 is the amino acid sequence of human TLR9 protein (AAF78037).
  • SEQ ID NO:63 is the amino acid sequence of human TLR9 protein (AAF72189).
  • SEQ ID NO:64 is the amino acid sequence of human TLR9 protein (AAG01734).
  • SEQ ID O:65 is the amino acid sequence of human TLR9 protein (AAG01735).
  • SEQ ID NO:66 is the amino acid sequence of human TLR9 protein (AAG01736).
  • SEQ ID NO:67 is the amino acid sequence of human TLR9 protein (BAB 19259).
  • SEQ ID NO:68 is the nucleotide sequence of murine TLR9 cDNA (AF348140).
  • SEQ ID NO:69 is the nucleotide sequence of murine TLR9 cDNA (AB045181).
  • SEQ ID NO:70 is the nucleotide sequence of murine TLR9 cDNA (AF314224).
  • SEQ ID NO:71 is the nucleotide sequence of murine TLR9 cDNA (NM_031178).
  • SEQ ID NO:72 is the amino acid sequence of murine TLR9 protein (AAK29625).
  • SEQ ID NO:73 is the amino acid sequence of murine TLR9 protein (AAK28488).
  • SEQ ID NO:74 is the amino acid sequence of murine TLR9 protein (BAB19260).
  • SEQ ID NO:75 is the amino acid sequence of murine TLR9 protein (NP_112455).
  • SEQ ID NO:76 is the nucleotide sequence of human TLR10 cDNA (AF296673).
  • SEQ ID NO:77 is the amino acid sequence of human TLR10 protein (AAK26744).
  • SEQ ID NO:78 is the nucleotide sequence of human TLR6 cDNA (AB020807).
  • SEQ ID NO:79 is the nucleotide sequence of human TLR6 mRNA (NM_006068).
  • SEQ ID NO:80 is the amino acid sequence of human TLR6 protein (BAA78631).
  • SEQ I NO:81 is the amino acid sequence of human TLR6 protein (NP_006059).
  • SEQ ID NO:82 is the amino acid sequence of human TLR6 protein (Q9Y2C9).
  • SEQ ID NO:83 is the nucleotide sequence of murine TLR6 cDNA (AB020808).
  • SEQ ID NO:84 is the nucleotide sequence of murine TLR6 cDNA (NM_011604).
  • SEQ ID NO:85 is the nucleotide sequence of murine TLR6 cDNA (AF314636).
  • SEQ ID NO:86 is the amino acid sequence of murine TLR6 protein (BAA78632).
  • SEQ ID NO:87 is the amino acid sequence of murine TLR6 protein (AAG38563).
  • SEQ ID NO:88 is the amino acid sequence of murine TLR6 protein (NP_035734).
  • SEQ ID NO:89 is the amino acid sequence of murine TLR6 protein (Q9EPW9).
  • SEQ ID NO:90 is the nucleotide sequence of a consensus sequence for NF- ⁇ B p50 subunit.
  • SEQ ID NO:91 is the nucleotide sequence of a consensus sequence for NF- ⁇ B p65 subunit.
  • SEQ ID NO: 92 is the nucleotide sequence of an example of an F- ⁇ B p65 subunit binding site.
  • SEQ ID NO:93 is the nucleotide sequence of an example of a murine CREB binding site.
  • SEQ ID NO: 94 is the nucleotide sequence of an example of a murine AP-1 binding site.
  • SEQ ID NO:95 is the nucleotide sequence of an example of a murine AP-1 binding site.
  • SEQ ID NO:96 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO:97 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO:98 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO: 99 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO: 100 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO:101 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO: 102 is the nucleotide sequence of an example of an ISRE.
  • SEQ ID NO: 103 is the nucleotide sequence of an example of an SRE.
  • SEQ ID NO: 104 is the nucleotide sequence of an example of an SRE.
  • SEQ ID NO: 105 is the nucleotide sequence of an example of an SRE.
  • SEQ ID NO: 106 is the nucleotide sequence of an example of an NF AT binding site.
  • SEQ ID NO: 107 is the nucleotide sequence of an example of an NF AT binding site.
  • SEQ ID NO: 108 is the nucleotide sequence of an example of an NF AT binding site.
  • SEQ ID NO: 109 is the nucleotide sequence of an example of an NFAT binding site.
  • SEQ ID NO:l 10 is the nucleotide sequence of an example of a GAS.
  • SEQ ID NO: 111 is the nucleotide sequence of a p53 binding site consensus sequence.
  • SEQ ID NO: 112 is the nucleotide sequence of an example of ap53 binding site.
  • SEQ ID NO:l 13 is the nucleotide sequence of an example of a p53 binding site.
  • SEQ ID NO: 114 is the nucleotide sequence of an example of ap53 binding site.
  • SEQ ID NO:115 is the nucleotide sequence of an example of ap53 binding site.
  • SEQ ID NO:l 16 is the nucleotide sequence of an example of a p53 binding site.
  • SEQ ID NO: 117 is the nucleotide sequence of an example of ap53 binding site.
  • SEQ ID NO: 118 is the nucleotide sequence of an example of a TARE (TNF- ⁇ response element).
  • SEQ TD NO: 119 is the nucleotide sequence of an example of an SRF binding site.
  • SEQ ID NO: 120 is the nucleotide sequence of an example of an SRF binding site.
  • SEQ ID NO: 121 is the nucleotide sequence ofthe -620 to +50 promoter region of IFN- ⁇ 4.
  • SEQ ID NO: 122 is the nucleotide sequence ofthe -140 to +9 promoter region of IFN- ⁇ l.
  • SEQ ID NO: 123 is the nucleotide sequence ofthe -140 to +9 promoter region of IFN- ⁇ l (point mutation, AL353732).
  • SEQ ID NO: 124 is the nucleotide sequence ofthe -280 to +20 promoter region of IFN-/3.
  • SEQ ID NO: 125 is the nucleotide sequence ofthe -397 to +5 promoter region of human RANTES (AB023652).
  • SEQ ID NO:126 is the nucleotide sequence ofthe -751 to +30 promoter region of human IL-12 p40.
  • SEQ ID NO: 127 is the nucleotide sequence ofthe -250 to +30 promoter region of human IL-12 p40.
  • SEQ ID NO: 128 is the nucleotide sequence ofthe -288 to +7 promoter region of human IL-6.
  • SEQ ID NO: 129 is the nucleotide sequence ofthe IL-6 gene promoter from -1174 to +7 (M22111).
  • SEQ ID NO: 130 is the nucleotide sequence ofthe -734 to +44 promoter region derived from human IL-8.
  • SEQ ID NO: 131 is the nucleotide sequence ofthe -162 to 44 promoter region of human IL-8.
  • SEQ ID NO:132 is the nucleotide sequence ofthe -615 to +30 promoter region of human TNF- ⁇ .
  • SEQ ID NO : 133 is the nucleotide sequence of a promoter region of human TNF-/3.
  • SEQ ID NO: 134 is the nucleotide sequence ofthe -875 to +97 promoter region of human IP-10.
  • SEQ ID NO: 135 is the nucleotide sequence of the -219 to +114 promoter region of human CXCL11 (DP-9).
  • SEQ ID NO: 136 is the nucleotide sequence ofthe full length promoter region of human CXCL11 (IP-9).
  • SEQ ID NO: 137 is the nucleotide sequence ofthe -289 to +217 promoter region of
  • IGFBP4 Insulin growth factor binding protein 4
  • SEQ ID NO: 138 is the nucleotide sequence ofthe full length promoter region of IGFBP4.
  • SEQ ID NO: 139 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO: 140 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO:141 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO: 142 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO: 143 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO:144 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO: 145 is the nucleotide sequence of an immunostimulatory nucleic acid.
  • SEQ ID NO: 146 is the nucleotide sequence of an irnmunostimulatory nucleic acid.
  • SEQ ID NO: 147 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
  • SEQ ID NO: 148 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
  • SEQ ID NO: 149 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
  • SEQ ID NO: 150 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
  • SEQ ID NO: 151 is the nucleotide sequence of an immunoinhibitory nucleic acid.
  • SEQ ID NO: 152 is the nucleotide sequence of a sense primer for human TLR3.
  • SEQ ID NO: 153 is the nucleotide sequence of an antisense primer for human TLR3.
  • SEQ ID NO: 154 is the nucleotide sequence of a GpC nucleic acid.
  • SEQ ID NO: 155 is the nucleotide sequence of a CpG ODN.
  • SEQ ID NO: 156 is the nucleotide sequence of a GpC ODN.
  • SEQ ID NO: 157 is the nucleotide sequence of a Me-CpG ODN.
  • SEQ ID NO: 158 is the nucleotide sequence of a TLR9 ligand.
  • SEQ ID NO: 159 is the nucleotide sequence of a TLR9 ligand.
  • SEQ ID NO: 160 is the nucleotide sequence of a TLR9 ligand.
  • SEQ ID NO: 161 is the nucleotide sequence of a TLR9 ligand.
  • the invention relates to screening methods and tools to be used to identify and discriminate between newly discovered immunomodulatory molecules and to compare and standardize compositions of known immunomodulatory molecules.
  • the immunomodulatory molecules are preferably TLR ligands.
  • the invention is based in part on the discovery that cell lines expressing endogenous TLR respond to TLR ligands in a manner similar to the response of peripheral blood mononuclear cells (PBMC).
  • PBMC peripheral blood mononuclear cells
  • TLR ligands can be categorized and distinguished based on the cellular changes they induce (i.e., their induction profiles). The ability of a TLR ligand to provide therapeutic or prophylactic benefit to a subject depends on its induction profile.
  • TLR ligands for a panel of response indicators or parameters allows for rapid discrimination and categorization of TLR ligands. Moreover, the similarity between the cell line responses and those observed after in vivo administration ofthe TLR ligand indicates that the cell lines are suitable predictors of in vivo activity. The use of in vitro propagated cell lines additionally overcomes the variability encountered when using freshly isolated PBMC.
  • TLR ligands identified according to the invention therefore can be used therapeutically or prophylactically in a more patient- or disorder-specific manner.
  • the invention allows for the tailoring of TLR ligands for particular patients or disorders.
  • the invention identifies a number of cell lines that can be used to identify TLR ligands based on endogenous TLR expression such as TLR3, TLR7 and TLR9 expression.
  • the invention is premised in part on the discovery of TLR9 expression in a number of cell lines including RPMI 8226, Raji, RAMOS, THP-1, Nalm-6 and KG-1.
  • Cell lines RPMI 8226, Raji and RAMOS have been determined to express TLR7 according to the invention.
  • TLR3 Cell lines KG-1 cell, a Nairn cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, a Hep-2 cells, a A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell have been discovered to express TLR3 according to the invention. It is further premised in part on the discovery that RPMI 8226 cells respond to the imidazoquinoline compound R-848. Consistent with this latter finding, it was also discovered that RPMI 8226 cells express TLR7.
  • the invention in other aspects provides for screening methods and tools for verifying and standardizing compositions containing known TLR ligands. These compositions may be for example commercial production lots to be used in a clinical setting. Accordingly, the invention provides methods for standardizing lots of known TLR ligands prior to distribution and use clinically. In this way, production processes can be observed and controlled and substandard production lots can be identified and eliminated prior to shipment.
  • the methods ofthe instant invention can be used at any step in the preparation and production of clinical material, i.e., pharmaceutical product.
  • the methods will find use in characterizing or validating raw materials, in-process materials, finished product materials (e.g., pre-release materials), and post-production materials (e.g., post-release materials).
  • the methods can also be used to validate existing process methods, as well as to validate new or changed process methods used in the production ofthe pharmaceutical product.
  • the screening assays provided herein may be used to identify immunomodulatory agents.
  • Immunomodulatory agents are agents that either stimulate or inhibit immune responses in a subject. Accordingly, as used herein, immunomodulation embraces both immunostimulation and immunoinhibition.
  • the screening methods are used to identify TLR agonists and antagonists. The methods can also be used to identify compounds that enhance the immunostimulation induced by a TLR agonist. This latter set of compounds is referred to herein as "enhancers”.
  • a TLR agonist is a compound that stimulates TLR signaling activity.
  • a TLR antagonist is a compound that inhibits TLR signaling activity.
  • Agonists are generally referred to herein as immunostimulatory compounds because stimulation of TLR is associated with immune stimulation.
  • Antagonists are generally referred to herein as immunoinhibitory compounds because inhibition of TLR is associated with immune inhibition.
  • TLR antagonists include compounds that reduce (or eliminate completely) the immunostimulation induced by a TLR agonist.
  • the agonists, antagonists and enhancers are TLR ligands (i.e., they bind to a TLR).
  • the test compounds with agonist, antagonist or enhancer activity may act downstream or upstream ofthe TLR-TLR ligand interaction.
  • an "immunostimulatory compound” as used herein refers to a natural or synthetic compound that characteristically induces a TLR-mediated response when contacted with a suitable functional TLR polypeptide.
  • the immunostimulatory compound is a natural or synthetic compound that induces a TLR-mediated response when contacted with a cell that naturally or artificially expresses a suitable functional TLR polypeptide.
  • the cell may be an experimental cell or a primary cell such as a PBMC.
  • immunostimulatory compounds include the following immunostimulatory nucleic acids, which are discussed in further detail below: 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 1)
  • Imidazoquinolines are immune response modifiers thought to induce expression of several cytokines including interferons (e.g., IFN- ⁇ and IFN-
  • Imidazoquinolines are capable of stimulating a Thl immune response, as evidenced in part by their ability to induce increases in IgG2a levels.
  • Imidazoquinoline agents reportedly are also capable of inhibiting production of Th2 cytokines such as IL-4, IL-5, and IL-13.
  • Some ofthe cytokines induced by imidazoquinolines are produced by macrophages and dendritic cells.
  • an "immunoinhibitory compound” as used herein refers to a natural or synthetic compound that characteristically inhibits a TLR-mediated response when contacted with a suitable functional TLR polypeptide.
  • the immunoinhibitory compound is a natural or synthetic compound that inhibits a TLR-mediated response when contacted with a cell that naturally or artificially expresses a suitable functional TLR polypeptide.
  • immunoinhibitory compounds and TLR antagonists encompass certain small molecules (chloroquine, q ⁇ inacrine, 9-aminoacridines and 4-aminoquinolines, and derivatives thereof) described by Macfarlane and colleagues in U.S. Pat. 6,221,882; U.S. Pat. 6,399,630; U.S. Pat. 6,479,504; U.S. Pat. 6,521,637; and published U.S. Pat. application 2002/0151564, the contents of all of which are hereby inco ⁇ orated by reference in their entirety.
  • the invention provides in part methods and tools that utilize cell lines, in modified or unmodified form, as surrogates for PBMC.
  • hnmunomodulation by TLR ligands can be assessed using one or preferably more parameters including but not limited to cytokine and chemokine secretion, upregulation of cell surface markers, changes in cell proliferation, phosphorylation changes, and the like. These parameters may be native readouts or artificial readouts as described herein.
  • the cellular response to immunostimulatory nucleic acids by the cell lines described herein resembles that of PBMC that these cells can be used to identify and differentiate between immunomodulatory compounds based on the extent ofthe induced response and the particular profile of that response.
  • the invention provides a number of cell lines each with a particular endogenous TLR expression profile, as described herein.
  • the cell lines can be used to identify immunomodulatory compounds with particular response profiles. As an example, the cell lines can be used to identify molecules that are mimics to known TLR ligands. The cell lines can also be used to identify TLR ligands that trigger some but not necessarily all ofthe responses induced by known TLR ligands. For example, the cell line can be used to distinguish between compounds based on individual or group cytokine or chemokine secretion, or based on upregulation of one, a subset or all cell surface markers. As an example, in some therapeutic instances, it may be desirable to use a compound that induces the secretion of relatively high levels of chemokine such as IP-10, yet induces only relatively low levels of one or more other factors.
  • chemokine such as IP-10
  • the screening methods ofthe invention allow for the identification of such a compound with this type of induction profile. It is to be understood that the screening method also can be used to determine effective amounts of known and newly identified immunomodulatory compounds. For example, the EC 5 0 value of a TLR ligand for the production of a particular cytokine or chemokine can be determined, thereby facilitating comparison between different nucleic acids.
  • these assays require the incubation of cells with a reference compound and a test compound, and an analysis ofthe readout. Depending on the embodiment, the same cells are exposed to the reference compound and the test compound.
  • An example of this latter embodiment is a screening assay for compounds that enhance the immunostimulatory effects of a TLR agonist.
  • Another example is a screening assay for compounds that inhibit the immunostimulatory effects of a TLR agonist.
  • the reference compound is a positive reference compound (i.e., it is itself immunostimulatory).
  • the reference compound is a negative reference compound (i.e., it is inert and neither immunostimulatory nor immunoinhibitory), then any test level that is greater than the reference level is indicative of a test compound that has at least some immunostimulatory capacity.
  • the negative reference compound is used to set background levels of immunostimulation or in munoinhibition observed in the absence ofthe test compound. If the reference compound is a positive reference compound (i.e., it is immunostimulatory), then it is possible to compare and contrast the induction profile ofthe test compound to that ofthe reference compound.
  • reference assays individually containing a positive and a negative reference compound are performed alongside the test assay.
  • the test assay is a screen for an immunostimulatory TLR ligand
  • reference assays can be a positive reference assay (in which the reference compound is immunostimulatory), a negative reference assay (in which the reference compounds is immunologically inert or neutral), or both.
  • a test compound is defined as immunostimulatory if it induces a response greater than that ofthe negative reference compound.
  • the level and profile ofthe immunostimulatory response can be compared to the level and profile induced by the positive reference compound.
  • test compound that induces a level of immunostimulation less than that ofthe positive reference compound may still be considered immunostimulatory according to the invention. Modifications to these screening assays for a desired readout will be apparent to those of ordinary skill in the are based on the teachings provided herein.
  • the assay may generally involve co-incubation ofthe test compound and a positive reference compound.
  • the control assay may include co-incubation ofthe negative and positive reference compounds.
  • co-incubation embraces simultaneous or consecutive addition of the reference and test compounds.
  • the test compound may be added before or after the positive reference compound.
  • An immunoinhibitory test compound may be identified by a diminution ofthe immunostimulatory response induced by the positive reference compound when in the presence ofthe test compound. If the level ofthe response is less in the presence ofthe test compound, this indicates that the test compound is capable of interfering with the immunostimulatory effects ofthe positive reference compound.
  • simultaneous or consecutive addition of a putative immunoinhibitory test compound can reduce the amount of cytokines or chemokines secreted by cells in response to the positive reference compound alone, indicating an inhibition of the immunostimulatory effects of the positive reference compound.
  • the reference immunoinhibitory compound can be used at one or more concentrations in conjunction with a selected or constant concentration of reference immunostimulatory compound. Under proper conditions, the immunostimulatory effect ofthe reference immunostimulatory compound will be less in the presence ofthe immunoinhibitory substance than in the absence ofthe immunoinhibitory substance. Furthermore, under proper conditions, the immunostimulatory effect ofthe reference immunostimulatory compound will decrease with increasing concentration ofthe immunoinhibitory substance.
  • the breadth of response by the cell line to immunomodulatory compounds, and its facile manipulation, allows for the identification of novel compounds.
  • the cell line allows the rapid discovery of such compounds given that is lends itself to high throughput screening methods such as those provided herein. These methods and compositions are described in greater detail below.
  • the invention therefore provides screening methods that utilize cell lines that either endogenous express TLRs such as the RPMI 8226 cell line as well as cell lines that have been modified to express TLRs.
  • the invention further provides compositions that comprise such cell lines.
  • the verification and standardization methods ofthe invention generally involve assays in which an isolated cell expressing a functional TLR is contacted with each of two compositions, each composition containing a known ligand for the TLR.
  • One composition is a reference composition, and the assay using the reference composition yields a reference activity.
  • the second composition is a test composition, and the assay using the test composition yields a test activity.
  • the two contacting steps can be performed on separate cells that are alike, and typically will be performed on separate populations of cells that are alike.
  • the separate cells or the separate populations of cells can be drawn from a single population of cells, hi typical usage according to this embodiment, the reference and test activities are measured essentially concurrently, although the use of historical reference activity is also contemplated by the methods ofthe invention.
  • the two contacting steps can be performed on a single cell or on a single population of cells, usually in an essentially concurrent manner when it is desirable to have competition between reference and test compositions, hi one embodiment the known TLR ligand is a nucleic acid molecule.
  • the assays ofthe invention are performed under specific conditions so that comparison can be made between reference and test activities or levels.
  • the results ofthe comparison can be used as a basis upon which to accept or reject the test material as suitable for its intended use.
  • the biological characterization ofthe reference composition will generally entail a series of biological activity measurements ofthe reference composition using a single assay under defined conditions in order to define a range of inter-test variance.
  • the range of inter- test variance so obtained using reference composition can be used to define an acceptable range of variance within which a subsequent test measurement must fall in order to satisfy quality standards.
  • Such a range of acceptable variance can serve as a basis for developing predetermined range of variance about the reference activity, i.e., acceptance criteria for a particular test composition or test lot.
  • a particular reference composition can be assayed under defined conditions in a number of independent measurements and found to yield a result expressed as 100 ⁇ 5 units of activity.
  • test material under this example could be selected on the basis ofthe test activity falling within a predetermined range of variance about the reference activity. In short, the test material can be deemed acceptable provided the test activity falls within a predetermined range of activity that is related to the activity ofthe reference material.
  • the methods ofthe invention provide for comparison between a reference lot of a particular TLR ligand and a test lot ofthe same particular TLR ligand. Such comparison is useful for quality control assessment ofthe test lot of material, also referred to herein as validation, e.g., product validation. Such comparison is also useful for process validation.
  • the methods ofthe invention provide for comparison between a reference lot of a particular TLR ligand and a test lot of a different TLR ligand.
  • T test TLR ligand
  • R reference TLR ligand
  • test TLR ligand (C) is capable of exerting two different effects, wherein each effect is characteristic of one of two different classes of TLR ligand and is best characterized by one of two different reference TLR ligands (A and B)
  • the test TLR ligand (C) can be compared with either ofthe two reference TLR ligands (A or B).
  • test composition C could be found, for example, to possess 50 percent A-like activity compared with reference A and 70 percent B-like activity compared with reference B. Test composition C could thus independently meet or fail to meet predetermined standards for each of A-like activity and B-like activity. Such comparison is also useful for quality control assessment ofthe test lot of material, e.g., product validation.
  • test TLR ligand C can alternatively or additionally be compared against reference TLR ligand C, as described in the preceding paragraph.
  • certain conditions for carrying out the assays are standardized and used for measurements of both reference activity and test activity. In this way direct comparison between reference activity and test activity can be made readily. Conditions that can be standardized and used in this manner can include, without limitation, readout, temperature, media characteristics, duration (time between introduction of reference composition or test composition and activity measurement), methods of sampling, etc.
  • the methods ofthe invention can be at least partially automated in order to increase throughput and/or to reduce inter-test variability.
  • robotic devices and workstations with the capacity to dispense and/or sample fluids in a set or programmable fashion are now well known in the art and can be used in performing the methods ofthe instant invention. hi one embodiment a standard curve of reference composition activity is employed.
  • the standard curve is generated by selecting conditions including concentration of the reference composition such that the dose-response curve is essentially linear (and the slope is non-zero) over a range of concentrations that includes the effective concentration at which activity is 50 percent of maximum (EC50).
  • the standard curve spans a range of concentrations defined by EC50 ⁇ 1 log concentration, e.g., lxl 0 "7 M - 1x10 "
  • the standard curve spans a broader range of concentrations defined by EC50 ⁇ 2 log concentration, e.g., lxlO "8 M - lxlO "4 M, where EC50 is lxl 0 "6 M.
  • the standard curve spans a narrower range of concentrations defined by EC50 ⁇ 0.5 log concentration, e.g., 3.16xl0 "7 M - 3.16x10 "
  • Concentration range is chosen to yield a complete sigmoidal response, e.g., concentration should include EC50 + 3 log concentration or EC50 ⁇ 4 log concentration, h the case of testing an inhibitory compound the value determined would be the IC50, i.e., concentration where inhibition ofthe stimulatory signal is half-maximal.
  • the methods ofthe invention can be adapted to be automated or at least partially automated methods, as well as to parallel array or high throughput format methods.
  • the assays can be set up using multiwell plates in which cells are dispensed in individual wells and reagents are added in a systematic manner using a multiwell delivery device suited to the geometry ofthe multiwell plate.
  • an experimental cell is a non-primary cell (i.e., it is not a cell that has been recently harvested from a subject). It excludes, for example, freshly harvested PBMCs.
  • An experimental cell includes a cell from a cell line such as the RPMI 8226 cell line.
  • the cell naturally expresses a functional TLR.
  • the cell may be a PBMC, preferably a PBMC freshly harvested from a subj ect.
  • TLR agonists, antagonists or enhancers may possess one or more particular attributes. These attributes include but are not limited to being of human origin, being an immortalized stable cell line, endogenously expressing at least one functional TLR or a combination of functional TLRs, having intact signaling mechanisms, having intact uptake mechanisms, being able to upregulate cytokines, chemokines or cell surface markers, deriving from normal human B cells or from myeloma or B cell leukemia, deriving from human plasmacytoid and myeloid dendritic cells, and readily activatable by TLR ligands such as TLR7 ligands, TLR8 ligands or TLR9 ligands such as CpG nucleic acids or nucleic acids having other immunostimulatory sequence motifs or small molecules such as imidazoquinoline compounds.
  • TLR ligands such as TLR7 ligands, TLR8 ligands or TLR9 ligands such as CpG nucleic acids or nu
  • the cell line is the Raji cell line which expresses TLR3, TLR7 and TLR9. This latter cell line secretes, for example, IL-6 and IFN- ⁇ 2 upon CpG nucleic acid exposure.
  • the cell line is RPMI 8226 which expresses TLR7 and TLR9. Upon CpG nucleic acid exposure, this cell line expresses, produces and/or secretes IL- 8, IL- 10, IP- 10 and TNF- ⁇ . It also expresses at its cell surface CD86, HLA-DR and CD71.
  • the cell line is the RAMOS cell line which expresses TLR3, TLR7 and TLR9.
  • This cell line at least induces CD80 cell surface expression in response to CpG nucleic acid exposure.
  • the cell lines have been observed to respond in a concentration dependent manner to TLR ligands such as but not limited to CpG nucleic acids and some non-CpG nucleic acids including T-rich nucleic acids, poly-T nucleic acids and poly-G nucleic acids. The highest responses have been observed using CpG nucleic acids.
  • the screening methods employ a variety of cell lines as shown in the Examples.
  • A549 human lung carcinoma, ATCC CCL-185
  • BeWo human choriocarcinoma, ATCC CCL-98
  • HeLa human cervix carcinoma, ATCC CCL-2
  • Hep-2 human cervix carcinoma, ATCC CCL-23
  • KG-1 human acute myeloid leukemia, ATCC CCL-246
  • MUTZ-3 human acute myelomonocytic leukemia, German Collection of Cell lines and Microorganisms (DSZM) ACC-295
  • Nalm-6 human B cell precursor leukemia, DSZM ACC-128)
  • NK-92 human Natural killer cell line, ATCC CRL-2407
  • NK-92 MI E - 2 independent human Natural killer cell line, ATCC CRL-2408
  • Raji human B lymphocyte Burkitt's lymphoma, ATCC CCL-86
  • RAMOS B lymphocyte Burkitt's lymphoma, ATCC CRL-1596
  • RPMI 8226 human B lymphocyte
  • each ofthe afore-mentioned cell lines has a particular endogenous TLR expression profile which dictates its suitability in a particular screening assay.
  • a cell that artificially expresses a functional TLR can be a cell that does not express the functional TLR but for a transfected TLR expression vector.
  • human 293 fibroblasts ATCC CRL- 1573 do not express TLR7, TLR8 or TLR9, and they express very little TLR3.
  • such cells can be transiently or stably transfected with suitable expression vector (or vectors) so as to yield cells that do express TLR3, TLR7, TLR8, TLR9, or any combination thereof.
  • a cell that artificially expresses a functional TLR can be a cell that expresses the functional TLR at a significantly higher level with the TLR expression vector than it does without the TLR expression vector.
  • Transfected cells are considered modified cells, as used herein.
  • a cell that artificially expresses an expression or reporter construct is preferably stably transfected.
  • RPMI 8226 cell line is a human multiple myeloma cell line.
  • the cell line was established from the peripheral blood of a 61 year old man at the time of diagnosis for multiple myeloma (IgG lambda type).
  • RPMI 8226 was previously reported as responsive to CpG nucleic acids as evidenced by the production and secretion of IL-6 protein and production of LL-12p40 mRNA. (Takeshita et al. (2000), Eur. J. Immunol. 30, 108-116, and Takeshita et al. (2000) Ibid. 30, 1967-1976) Takeshita et al.
  • the cell line solely to study promoter constructs in order to identify transcription factor binding sites important for CpG nucleic acid signaling. It is now known according to the invention that the cell line produces a number of other chemokines and cytokines including IL-8, IL-10 and IP-10. It has also been discovered according to the invention that the cell line responds to immunostimulatory nucleic acids by upregulating cell surface expression of particular markers. Many of these markers, including CD71, CD86 and HLA-DR, are similarly upregulated in PBMCs exposed to immunostimulatory nucleic acids. This has been observed using flow cytometric analysis ofthe cell line following CpG nucleic acid exposure. In other aspects ofthe invention, the cell line can be used in similar screening assays that involve secretion of IL-6, IL-12 and/or TNF- ⁇ .
  • TLR7 has previously been found expressed on human B cells.
  • RPMI 8226 expresses TLR9 as well as TLR7, thus making it a suitable cell line for identifying immunostimulatory nucleic acid and/or imidazoquinoline (e.g., R-848) mimics or other small molecules that also signal through TLR7 and/or TLR9.
  • Incubation of RPMI 8226 cells with the imidazoquinoline R-848 (Resiquimod) induces for example IL-8, IL-10 and IP- 10 production.
  • TLR1 and TLR2 signals in response to peptidoglycan and lipopeptides.
  • TLR4 has been reported to signal in response to lipopolysaccharide (LPS). Hoshino K et al.
  • TLR9 ligands are described herein under "Immunostimulatory Nucleic Acids". Certain imidazoquinoline compounds having antiviral activity are ligands of TLR7 and TLR8. Imidazoquinolines are potent synthetic activators of immune cells with antiviral and antitumor properties. R-848 is a ligand for human TLR7 and TLR8. Jurk M et al. (2002) Nat Immunol 3 :499. Ligands of TLR3 include poly(I:C) and double-stranded RNA (dsRNA). Alexopoulou et a. (2001) Nature 413:732-738. For purposes of this invention, poly(I:C) and double- stranded RNA (dsRNA) are classified as oligonucleotide molecules. TLR3 may have a role in host defense against viruses.
  • a test and/or reference compound can be a nucleic acid such as an oligonucleotide or a polynucleotide, an oligopeptide, a polypeptide, a lipid such as a lipopolysaccharide, a carbohydrate such as an oligosaccharide or a polysaccharide, or a small molecule.
  • these compounds may also comprise or be synthesized from elements such as amino acids, carbohydrates, hormones, lipids, organic molecules, and the like.
  • Small molecules in general include naturally occurring, synthetic, and semisynthetic organic and organometallic compounds with molecular weight less than about 2.5 kDa. Examples of small molecules include most drugs, subunits of polymeric materials, and analogs and derivatives thereof. Some specific examples of small molecules include the imidazoquinolines. As used herein, an imidazoquinolines include imidazoquinoline amines (imidazoquinolinamines), imidazopyridine amines, 6,7-fused cycloalkylimidazopyridine amines, and 1,2 bridged imidazoquinoline amines. These compounds have been described in U.S. Pat. Nos.
  • imidazoquinoline agents include resiquimod (R-848; S-28463; 4-amino-2 ethoxymethyl- ⁇ , ⁇ - dimethyl-lH-imidazo[4,5-c]quinoline-l-ethanol); and imiquimod (R-837; S-26308; l-(2- methylpropyl)-lH-imidazo[4,5-c]quinoline-4-amine).
  • test and reference compounds may be formulated for pharmaceutical use or not.
  • a test compound not formulated for pharmaceutical use can be a compound (e.g., a lot or batch ofthe compound) under evaluation for possible use in preparing a pharmaceutical formulation ofthe compound.
  • a reference compound is a compound having a known activity in the presence of a TLR.
  • the reference compound may stimulate TLR signaling (and is therefore regarded as a positive reference compound), or it may be inert in the presence of a TLR (and is therefore regarded as a negative reference compound). If it is a positive reference compound, it need not be the best known stimulator of TLR signaling (i.e., it is possible that other reference compounds and even test compounds will stimulate TLR signaling to a greater extent).
  • the readout ofthe screening assay may simply be stated relative to the level of signaling that occurs in the presence ofthe reference compound.
  • the reference compound is analyzed prior to the screening assay in order to determine its level of activity on a TLR.
  • the reference compound and the test compound will be assayed separately (i.e., in separate wells); in other aspects, the reference compound and the test compound will be assayed together (i.e., in the same well). These latter aspects are designed to measure the ability of a test compound to modulate the activity ofthe reference compound.
  • the activity ofthe test compound and the reference compound combined may be the same as that ofthe positive reference compound alone, indicating at a minimum that the test compound is not inhibitory; or it may be less than that ofthe positive reference compound, indicating at a minimum that it is inhibitory to the effect ofthe reference compound; or it maybe additive or synergistic possibly indicating that the test compound is an enhancer.
  • the effect of an enhance may be due to its ability to stimulate TLR signaling independently ofthe positive reference compound.
  • a "reference composition” as used herein refers to a composition that includes a reference compound and optionally another agent, e.g., a pharmaceutically acceptable carrier and/or another biologically active agent.
  • a reference compound may be an immunostimulatory compound or it may be an immunoinhibitory compound.
  • the reference compositions include both finished products, e.g., finished pharmaceutical products, as well as raw materials and other in-process materials used for the preparation of such finished products, all of which contain a known TLR ligand.
  • a "production lot” shall refer to a batch or lot of a completed product prepared for release as clinical material, e.g., a pharmaceutical product.
  • an "in-process lot” shall refer to a batch or lot of unfinished product that is prepared in the course of making a production lot; an “in-process lot” shall also refer to a batch or lot of raw material provided for use in the production of a production lot.
  • the reference compositions ofthe invention are highly characterized in terms of their chemical, physical, and biological properties.
  • a reference composition will be a specific composition previously determined to have a specific activity, or range of specific activity, ofthe particular known TLR ligand present in the composition.
  • specific activity refers to an amount of activity per unit mass or per unit volume ofthe reference composition as a whole, as determined using a defined assay under defined conditions.
  • the reference composition is a representative sample of a particular lot or batch of a specific TLR ligand. In one embodiment the reference composition is a representative sample of a particular lot or batch of a specific TLR ligand formulated for pharmaceutical use, e.g., a sterile solution ofthe TLR ligand at a determined concentration or activity.
  • TLR ligand e.g., nucleobase sequence and type of backbone of a nucleic acid; structural formula of a small molecule
  • concentration e.g., concentration; diluent composition; and purity.
  • Such parameters as purity and concentration can be determined using any appropriate physicochemical method, e.g., optical spectroscopy including absorbance at one or more specified wavelengths; nuclear magnetic resonance (NMR) spectroscopy; mass spectrometry (MS), including matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS); melting point; specific gravity; chromatography including as appropriate high pressure liquid chromatography (HPLC), one- and two-dimensional polyacrylamide gel electrophoresis (PAGE), capillary electrophoresis, and the like; as well as other methods known to those of skill in the art.
  • optical spectroscopy including absorbance at one or more specified wavelengths
  • nuclear magnetic resonance (NMR) spectroscopy nuclear magnetic resonance (NMR) spectroscopy
  • MS mass spectrometry
  • MALDI-MS matrix-assisted laser desorption/ionization mass spectrometry
  • melting point e.g., melting point
  • specific gravity e.g., chromatography including as
  • Reference compositions can also be very well characterized in terms of their biological activity, independent ofthe methods ofthe invention, although the methods ofthe invention generally include such characterization, at least in part.
  • a reference composition can be very well characterized in terms of its biological activity by characterizing, both qualitatively and quantitatively, the response by sensitive cells to the reference composition under defined conditions.
  • a reference composition can be a specific CpG oligonucleotide such as SEQ ID NO:l which in a specific assay and under specific conditions of temperature, concentration, duration of contact between the CpG oligonucleotide and a population of TLR9-expressing cells, and particular readout, reliably yields a specific result or range of results.
  • Results can be expressed in any suitable manner, but can include results expressed on a per-cell basis, e.g., picograms of particular cytokine per cell per hour of contact with the reference composition.
  • Reference compositions can be very well characterized in terms of their biological activity according to one or more parameters, for example, according to their capacity to induce each of a plurality of cytokines.
  • test composition refers to a composition that includes a test compound and optionally another agent, e.g., a pharmaceutically acceptable carrier and/or another biologically active agent.
  • a test compound can be an immunostimulatory compound or it can be an immunoinhibitory compound.
  • the test compound is a known TLR ligand.
  • Test compositions ofthe invention may comprise known TLR agonist or TLR antagonist compounds, generally but not necessarily nominally the same as the reference compositions against which comparison is to be made according to some aspects ofthe invention.
  • test compositions may encompass immunostimulatory compounds, immunoinhibitory compounds, known TLR ligands, finished pharmaceutical products, and raw materials and other in-process materials used for the preparation of such finished products.
  • a test composition is not characterized at all, or is only partially characterized, or is not as well characterized as the reference composition, in terms of its chemical, physical, or (most particularly) biological properties.
  • the methods of the invention permit further characterization ofthe test composition by comparison with a reference composition.
  • a test composition will be a specific composition previously determined to be a ligand of a specific TLR.
  • the test composition is a representative sample of a particular lot or batch of a specific TLR ligand.
  • the test composition is a representative sample of a particular lot or batch of a specific TLR ligand formulated for pharmaceutical use, e.g., a sterile solution ofthe TLR ligand at a determined concentration or activity.
  • Nucleic acids useful as reference compounds and as test compounds in the methods of the invention include single- and double-stranded natural and synthetic nucleic acids, including those with phosphodiester, stabilized, and chimeric backbones.
  • nucleic acids also encompassed are at least the following classes of nucleic acids, which are described in detail below: immunostimulatory CpG nucleic acids (CpG nucleic acids), including but not limited to types A, B, and C; immunostimulatory non-CpG nucleic acids, including without limitation methylated CpG nucleic acids, T-rich nucleic acids, TG-motif nucleic acids, Cpl motif nucleic acids, and poly-G nucleic acids; and immunoir ⁇ ibitory nucleic acids.
  • Nucleic acids useful as reference compounds and as test compounds in the methods ofthe invention also include nucleic acids with modified backbones, including "soft" and “semi-soft" oligonucleotides as described herein. As will be appreciated from the descriptions below, certain of these various classes of nucleic acids can coexist in a given nucleic acid molecule.
  • nucleic acid as used herein with respect to test compounds and reference compounds used in the methods ofthe invention, shall refer to any polymer of two or more individual nucleoside or nucleotide units. Typically individual nucleoside or nucleotide units will include any one or combination of deoxyribonucleosides, ribonucleosides, deoxyribonucleotides, and ribonucleotides.
  • the individual nucleotide or nucleoside units of the nucleic acid can be naturally occurring or not naturally occurring.
  • the individual nucleotide units can include deoxyadenosine, deoxycytidine, deoxyguanosine, thymidine, and uracil.
  • individual nucleosides also include synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g., as described in Uhlmann E et al. (1990) Chem Rev 90:543-84.
  • the linkages between individual nucleotide or nucleoside units can be naturally occurring or not naturally occurring.
  • the linkages can be phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, as well as peptide linkages and other covalent linkages, known in the art, suitable for joining adjacent nucleoside or nucleotide units.
  • the linkages can also be mixed in a single polymer (e.g., a semi-soft backbone).
  • the nucleic acid test compounds and nucleic acid reference compounds typically range in size from 3-4 units to a few tens of units, e.g., 18-40 units. lh some embodiments the nucleic acids are oligonucleotides made up of 2 to about 100 nucleotides, and more typically 4 to about 40 nucleotides. Oligonucleotides composed exclusively of deoxynucleotides are termed oligodeoxyribonucleotides or, equivalently, oligodeoxynucleotides (ODN).
  • ODN oligodeoxynucleotides
  • a CpG nucleic acid is an immunostimulatory nucleic acid which contains a cytosine- guanine (CG) dinucleotide, the C residue of which is unmethylated.
  • CG cytosine- guanine
  • the effects of CpG nucleic acids on immune modulation have been described extensively in U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068; and published patent applications, such as PCT/US95/01570 (WO 96/02555); PCT/US98/04703 (WO 98/40100); and PCT/US99/09863 (WO 99/56755).
  • the entire contents of each of these patents and published patent applications is hereby incorporated by reference.
  • the entire immunostimulatory nucleic acid can be unmethylated or portions can be unmethylated, but at least the C ofthe 5'-CG-3' must be unmethylated.
  • the CpG nucleic acid sequences ofthe invention include, without limitation, those broadly described above as well as those disclosed in U.S. Pat. Nos. 6,207,646 and 6,239,116.
  • the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO:l).
  • the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTGACGTTTTGTCGTT-3' (SEQ ID NO:139). In one embodiment the CpG nucleic acid has a base sequence provided by
  • the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTCGTCGTTTCGTCGTT-3' (SEQ ID NO: 141).
  • the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTCGTCGTTTTGTCGTT-3' (SEQ ID NO: 142).
  • the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTTCGGTCGTTTT-3' (SEQ ID NO: 143).
  • the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTTCGTGCGTTTTT-3' (SEQ ID NO: 144). In one embodiment the CpG nucleic acid has a base sequence provided by
  • the CpG nucleic acid has a base sequence provided by 5*-TCGTC_GTTTTAC_GGCGCC_ GTGCCG-3' (SEQ ID NO: 146).
  • the oligonucleotides described by SEQ ID NOs: 1, 139-145 are fully stabilized phosphorothioate backbone ODN.
  • the oligonucleotide of SEQ ID NO:146 has a chimeric backbone in which all internucleoside linkages are phosphorothioate except for those indicated by "_", which are phosphodiester.
  • Type B CpG nucleic acids such as SEQ ID NO:l include the earliest described CpG nucleic acids and characteristically activate B cells but do not induce or only weakly induce expression of IFN- ⁇ .
  • Type B nucleic acids are described in U.S. Patents 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068.
  • Type A CpG nucleic acids described in published international application PCT/USOO/26527 (WO 01/22990), incorporate a CpG motif, include a hybrid phosphodiester/phosphorothioate backbone, and characteristically induce plasmacytoid dendritic cells to express large amounts of IFN- ⁇ but do not activate or only weakly activate B cells.
  • Type C oligonucleotides incorporate a CpG, include a chimeric backbone, include a GC-rich palindromic or nearly-palindromic region, and are capable of both activating B cells and inducing expression of IFN- ⁇ . These have been described, for example, in copending U.S. Pat. application Ser. No. 10/224,523, filed August 19, 2002. Exemplary sequences of A, B and C class nucleic acids are described in the afore-mentioned references, patents and patent applications, the entire contents of which are hereby incorporated by reference herein.
  • a non-CpG nucleic acid is used.
  • a non-CpG nucleic acid is an immunostimulatory nucleic acid which either does not have a CpG motif in its sequence, or has a CpG motif which contains a methylated C residue.
  • the non-CpG nucleic acid may still be immunostimulatory by virtue of its having other immunostimulatory motifs such as those described herein and known in the art.
  • the non-CpG nucleic acid is a methylated CpG nucleic acid.
  • the non-CpG nucleic acid is still immunostimulatory despite methylation ofthe C ofthe CpG motif, even without having another non-CpG immunostimulatory motif described herein and known in the art.
  • the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-TZGTZGTTTTGTZGTTTTGTZGTT-3' (SEQ ID NO: 147), wherein Z represents 5-methylcytosine.
  • the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-TZGTZGZTGTZTZZGZTTZTTZTTGZZ-3' (SEQ ID NO: 148), wherein Z represents 5-methylcytosine.
  • the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-GZGTTTGZTZTTZTTZTTGZG-3' (SEQ ID NO: 149), wherein Z represents 5-methylcytosine.
  • non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-GZZZAAGZTGGZATZZGTZA-3' (SEQ ID NO: 150), wherein Z represents 5-methylcytosine.
  • Non-CpG nucleic acids include T-rich immunostimulatory nucleic acids.
  • the T-rich immunostimulatory nucleic acids include those disclosed in published PCT patent application PCT/US00/26383 (WO 01/22972), the entire contents of which are incorporated herein by reference. In some embodiments, T-rich nucleic acids 24 bases in length are used.
  • a T-rich nucleic acid is a nucleic acid which includes at least one poly T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues.
  • a nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5'-TTTT-3'.
  • the T-rich nucleic acid includes more than one poly T sequence.
  • the T-rich nucleic acid may have 2, 3, 4, or more poly T sequences, such as SEQ ID NO:l.
  • Non-CpG nucleic acids also include poly-G immunostimulatory nucleic acids. A variety of references describe the immunostimulatory properties of poly-G nucleic acids. Pisetsky DS et al.
  • the immunostimulatory nucleic acids ofthe invention can also be those which do not possess CpG, methylated CpG, T-rich, or poly-G motifs.
  • immunostimulatory nucleic acid sequences include but are not limited to those immunostimulatory sequences described and listed in U.S. Non-Provisional Pat. Application No. 09/669,187, filed on September 25, 2000, and in corresponding published PCT patent application PCT/USOO/26383 (WO 01/22972).
  • Immunoinhibitory nucleic acids have been described in Lenert P et al. (2001) Antisense Nucleic Acid Drug Dev 11 :247-56 and in Stnnz L et al. (2002) Eur J Immunol 32:1212-22. These inhibitory phosphorothioate ODN (S-ODN) differ from stimulatory S- ODN by having 2-3 G substitutions in the central motif. As inhibitory S-ODN did not directly interfere with the NF- ⁇ B DNA bmding but prevented CpG-induced NF- ⁇ B nuclear translocation of p50, p65, and c-Rel and blocked pl05, I ⁇ B ⁇ , and I ⁇ B ⁇ degradation, Lenert et al.
  • IKK inhibitory kinase
  • the immunoinhibitory nucleic acid has a base sequence provided by 5'-TCCTGGCGGGGAAGT-3' (SEQ ID NO: 151). hnmunoinhibitory nucleic acids have also been described in U.S. Pat. No. 6,194,388, issued to Krieg et al.
  • the immunoinhibitory oligonucleotides disclosed by Krieg et al. are oligonucleotides with GCG trinucleotides at or near the ends ofthe oligonucleotide and are represented by the formula 5 ' GCGX n GCG 3 ' in which X is a nucleotide and n is an integer between 0 and 50.
  • the nucleic acids used as either test or reference compounds can be double-stranded or single-stranded. They can be deoxyribonucleotide (DNA) or ribonucleotide (RNA) molecules. Generally, double-stranded molecules are more stable in vivo, while single- stranded molecules have increased immune activity. Thus in some the nucleic acid is single- stranded and in other embodiments the nucleic acid is double-stranded, h certain embodiments, while the nucleic acid is single-stranded, it is capable of forming secondary and tertiary structures (e.g., by folding back on itself, or by hybridizing with itself either throughout its entirety or at select segments along its length).
  • secondary and tertiary structures e.g., by folding back on itself, or by hybridizing with itself either throughout its entirety or at select segments along its length.
  • nucleic acids are preferably in the range of 6 to 100 bases in length.
  • nucleic acids of any size equal to or greater than 6 nucleotides are capable of inducing an immune response.
  • nucleic acid is in the range of between 8 and 100 and in some embodiments between 8 and 50 or 8 and 30 nucleotides in size.
  • nucleic acid and “oligonucleotide” are used interchangeably to mean multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)).
  • a substituted pyrimidine e.g., cytosine (C), thymine (T) or uracil (U)
  • purine e.g., adenine (A) or guanine (G)
  • nucleic acid and oligonucleotide refer to oligoribonucleotides as well as oligodeoxyribonucleotides.
  • the terms “nucleic acid” and “oligonucleotide” shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base containing polymer.
  • Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by nucleic acid synthesis).
  • nucleic acid and oligonucleotide also encompass nucleic acids or oligonucleotides with substitutions or modifications, such as in the bases and/or sugars.
  • they include nucleic acids having backbone sugars that are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 2' position and other than a phosphate group or hydroxy group at the 5' position.
  • modified nucleic acids may include a 2'-O-alkylated ribose group, hi addition, modified nucleic acids may include sugars such as arabinose or 2'-fluoroarabinose instead of ribose.
  • nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have an amino acid backbone with nucleic acid bases). Other examples are described in more detail below.
  • the immunostimulatory and immunoinhibitory nucleic acids can encompass various chemical modifications and substitutions, in comparison to natural RNA and DNA, involving a phosphodiester internucleoside bridge, a ⁇ -D-ribose unit and/or a natural nucleoside base (adenine, guanine, cytosine, thymine, uracil).
  • Examples of chemical modifications are known to the skilled person and are described, for example, in Uhlmann E et al. (1990) Chem Rev 90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S.
  • An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at a particular phosphodiester internucleoside bridge and/or at a particular ⁇ -D-ribose unit and/or at a particular natural nucleoside base position in comparison to an oligonucleotide ofthe same sequence which is composed of natural DNA or RNA.
  • the oligonucleotides may comprise one or more modifications and wherein each modification is independently selected from: a) the replacement of a phosphodiester internucleoside bridge located at the 3' and/or the
  • nucleoside by a modified internucleoside bridge
  • phosphodiester bridge located at the 3' and/or the 5' end of a nucleoside by a dephospho bridge
  • e) the replacement of a natural nucleoside base by a modified nucleoside base by a modified nucleoside base.
  • the oligonucleotides may include modified intemucleotide linkages, such as those described in (a) or (b) above. These modified linkages may be partially resistant to degradation (e.g., are stabilized).
  • a "stabilized oligonucleotide molecule" shall mean an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via an exo- or endo- nuclease) resulting from such modifications.
  • Oligonucleotides having phosphorothioate linkages may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases.
  • a phosphodiester internucleoside bridge located at the 3' and/or the 5' end of a nucleoside can be replaced by a modified internucleoside bridge, wherein the modified internucleoside bridge is for example selected from phosphorothioate, phosphorodithioate,
  • dephospho bridges are described, for example, in Uhlmann E and Peyman A in "Methods in Molecular Biology", Vol. 20, “Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa, 1993, Chapter 16, pp. 355 ff), wherein a dephospho bridge is for example selected from the dephospho bridges formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl-hydrazo, dimethylenesulfone and/or silyl groups.
  • a sugar phosphate unit i.e., a ⁇ -D-ribose and phosphodiester internucleoside bridge together forming a sugar phosphate unit
  • the sugar phosphate backbone i.e., a sugar phosphate backbone is composed of sugar phosphate units
  • the other unit is for example suitable to build up a "morpholino-derivative" oligomer (as described, for example, in Stirchak EP et al.
  • Nucleic Acids Res 17:6129-41 that is, e.g., the replacement by a morpholino-derivative unit; or to build up a polyamide nucleic acid ("PNA"; as described for example, in Nielsen PE et al. (1994) Bioconjug Chem 5:3-7), that is, e.g., the replacement by a PNA backbone unit, e.g., by 2-aminoethylglycine.
  • PNA polyamide nucleic acid
  • the oligonucleotide may have other carbohydrate backbone modifications and replacements, such as peptide nucleic acids with phosphate groups (PHONA), locked nucleic acids (LNA), and oligonucleotides having backbone sections with alkyl linkers or amino linkers.
  • the alkyl linker may be branched or unbranched, substituted or unsubstituted, and chirally pure or a racemic mixture.
  • a ⁇ -ribose unit or a ⁇ -D-2'-deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is for example selected from ⁇ -D-ribose, ⁇ -D-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-F-arabinose, 2'-O-(C ⁇ C 6 )alkyl-ribose, preferably 2'- O-(C ⁇ -C 6 )alkyl-ribose is 2'-O-methylribose, 2'-O-(C 2 -C 6 )alkenyl-ribose, 2'-[O-(C 1 -C 6 )alkyl- O-(C ⁇ -C 6 )aikyl]-ribose, 2 l -NH 2 -2'-deoxyribose, ⁇ -D-xylo-fur
  • the sugar is 2'-O-methylribose, particularly for one or both nucleotides linked by a phosphodiester or phosphodiester-like internucleoside linkage.
  • the nucleic acids may be soft or semi-soft nucleic acids.
  • a soft nucleic acid is an immunostimulatory nucleic acid having a partially stabilized backbone, in which phosphodiester or phosphodiester-like intemucleotide linkages occur only within and immediately adjacent to at least one internal pyrimidine -purine dinucleotide (YZ).
  • YZ is YG, a pyrimidine-guanosine (YG) dinucleotide.
  • the at least one internal YZ dinucleotide itself has a phosphodiester or phosphodiester-like intemucleotide linkage.
  • a phosphodiester or phosphodiester-like intemucleotide linkage occurring immediately adjacent to the at least one internal YZ dinucleotide can be 5', 3', or both 5' and 3' to the at least one internal YZ dinucleotide.
  • phosphodiester or phosphodiester-like intemucleotide linkages involve "internal dinucleotides".
  • An internal dinucleotide in general shall mean any pair of adjacent nucleotides connected by an intemucleotide linkage, in which neither nucleotide in the pair of nucleotides is a terminal nucleotide, i.e., neither nucleotide in the pair of nucleotides is a nucleotide defining the 5 ' or 3' end ofthe nucleic acid.
  • a linear nucleic acid that is n nucleotides long has a total of n-1 dinucleotides and only n-3 internal dinucleotides.
  • Each intemucleotide linkage in an internal dinucleotide is an internal intemucleotide linkage.
  • a linear nucleic acid that is n nucleotides long has a total of n-1 intemucleotide linkages and only n-3 internal intemucleotide linkages.
  • the strategically placed phosphodiester or phosphodiester-like intemucleotide linkages therefore, refer to phosphodiester or phosphodiester-like intemucleotide linkages positioned between any pair of nucleotides in the nucleic acid sequence.
  • the phosphodiester or phosphodiester-like intemucleotide linkages are not positioned between either pair of nucleotides closest to the 5' or 3' end.
  • a phosphodiester or phosphodiester-like intemucleotide linkage occurring immediately adjacent to the at least one internal YZ dinucleotide is itself an internal intemucleotide linkage.
  • the YZ dinucleotide has a phosphodiester or phosphodiester-like intemucleotide linkage, and in addition (a) Ni and Y are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when Ni is an internal nucleotide, (b) Z and N 2 are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when N 2 is an internal nucleotide, or (c) Ni and Y are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when Ni is an internal nucleo
  • Soft nucleic acids according to the instant invention are believed to be relatively susceptible to nuclease cleavage compared to completely stabilized nucleic acids. Without meaning to be bound to a particular theory or mechanism, it is believed that soft nucleic acids ofthe invention are cleavable to fragments with reduced or no immunostimulatory activity relative to full-length soft nucleic acids. Incorporation of at least one nuclease-sensitive intemucleotide linkage, particularly near the middle ofthe nucleic acid, is believed to provide an "off switch" which alters the pharmacokinetics ofthe nucleic acid so as to reduce the duration of maximal immunostimulatory activity ofthe nucleic acid. This can be of particular value in tissues and in clinical applications in which it is desirable to avoid injury related to chronic local inflammation or immunostimulation, e.g., the kidney.
  • a semi-soft nucleic acid is an immunostimulatory nucleic acid having a partially stabilized backbone, in which phosphodiester or phosphodiester-like intemucleotide linkages occur only within at least one internal pyrimidine-purine (YZ) dinucleotide.
  • Semi-soft nucleic acids generally possess increased immunostimulatory potency relative to corresponding fully stabilized immunostimulatory nucleic acids. Due to the greater potency of semi-soft nucleic acids, semi-soft nucleic acids may be used, in some instances, at lower effective concentations and have lower effective doses than conventional fully stabilized immunostimulatory nucleic acids in order to achieve a desired biological effect.
  • inclusion of even one internal phosphodiester or phosphodiester-like YZ intemucleotide linkage is believed to be advantageous over no internal phosphodiester or phosphodiester-like YZ intemucleotide linkage.
  • the position along the length ofthe nucleic acid can also affect potency.
  • the soft and semi-soft nucleic acids will generally include, in addition to the phosphodiester or phosphodiester-like intemucleotide linkages at preferred internal positions, 5' and 3' ends that are resistant to degradation.
  • Such degradation-resistant ends can involve any suitable modification that results in an increased resistance against exonuclease digestion over co ⁇ esponding unmodified ends.
  • the 5' and 3' ends can be stabilized by the inclusion thereof at least one phosphate modification ofthe backbone.
  • the at least one phosphate modification ofthe backbone at each end is independently a phosphorothioate, phosphorodithioate, methylphosphonate, or methylphosphorothioate intemucleotide linkage.
  • the degradation- resistant end includes one or more nucleotide units connected by peptide or amide linkages at the 3' end.
  • a phosphodiester intemucleotide linkage is the type of linkage characteristic of nucleic acids found in nature.
  • the phosphodiester intemucleotide linkage includes a phosphorus atom flanked by two bridging oxygen atoms and bound also by two additional oxygen atoms, one charged and the other uncharged.
  • Phosphodiester intemucleotide linkage is particularly preferred when it is important to reduce the tissue half-life ofthe nucleic acid.
  • a phosphodiester-like intemucleotide linkage is a phosphoras-containing bridging group that is chemically and/or diastereomerically similar to phosphodiester.
  • Measures of similarity to phosphodiester include susceptibility to nuclease digestion and ability to activate RNAse H.
  • nucleic acids are susceptible to nuclease digestion, while both phosphodiester and phosphorothioate nucleic acids activate RNAse H.
  • the phosphodiester-like intemucleotide linkage is boranophosphate (or equivalently, boranophosphonate) linkage.
  • the phosphodiester-like intemucleotide linkage is diasteromerically pure Rp phosphorothioate. It is believed that diasteromerically pure Rp phosphorothioate is more susceptible to nuclease digestion and is better at activating RNAse H than mixed or diastereomerically pure Sp phosphorothioate. Stereoisomers of CpG nucleic acids are the subject of co-pending U.S. patent application 09/361,575 filed July 27, 1999, and published PCT application PCT/US99/17100 (WO 00/06588).
  • phosphodiester-like intemucleotide linkage specifically excludes phosphorodithioate and methylphosphonate intemucleotide linkages.
  • the soft and semi-soft nucleic acids ofthe invention may have phosphodiester like linkages between C and G.
  • a phosphodiester-like linkage is a phosphorothioate linkage in an Rp conformation. Nucleic acid p-chirality can have apparently opposite effects on the immune activity of a CpG nucleic acid, depending upon the time point at which activity is measured.
  • the R p but not the Sp stereoisomer of phosphorothioate CpG nucleic acid induces JNK phosphorylation in mouse spleen cells.
  • the Sp but not the R p stereoisomer is active in stimulating spleen cell proliferation. This difference in the kinetics and bioactivity ofthe R p and Sp stereoisomers does not result from any difference in cell uptake, but rather most likely is due to two opposing biologic roles ofthe p-chirality.
  • the enhanced activity ofthe Rp stereoisomer compared to the Sp for stimulating immune cells at early time points indicates that the Rp may be more effective at interacting with the CpG receptor, TLR9, or inducing the downstream signaling pathways.
  • the faster degradation ofthe Rp PS-nucleic acids compared to the Sp results in a much shorter duration of signaling, so that the Sp PS-nucleic acids appear to be more biologically active when tested at later time points.
  • nucleic acids also include substituted purines and pyrimidines such as C-5 propyne pyrimidine and 7-deaza-7-substituted purine modified bases.
  • Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, and thymine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties.
  • a modified base is any base which is chemically distinct from the naturally occurring bases typically found in DNA and RNA such as T, C, G, A, and U, but which share basic chemical stmctures with these naturally occurring bases.
  • the modified nucleoside base may be, for example, selected from hypoxanthine, uracil, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(C 1 -C 6 )-alkyluracil, 5-(C 2 -C 6 )-alkenyluracil, 5-(C 2 -C 6 )- alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(C ⁇ -C 6 )-alkylcytosine, 5-(C 2 -C 6 )-alkenylcytosine, 5-(C 2 -C 6 )- alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N 2 -dimethylguanine, 2,4-diamino-purine, 8-
  • Modified cytosines include but are not limited to 5-substituted cytosines (e.g., 5- methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo-cytosine, 5- hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines, N4-substituted cytosines (e.g., N4- ethyl-cytosine), 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g., N,N'-propylene cytosine or phenoxazine), and uracil and its derivatives (e.g., 5-fluoro-
  • the cytosine base is substituted by a universal base (e.g., 3-nitropy ⁇ ole, P-base), an aromatic ring system (e.g., fluorobenzene or difluorobenzene) or a hydrogen atom (dSpacer).
  • a universal base e.g., 3-nitropy ⁇ ole, P-base
  • an aromatic ring system e.g., fluorobenzene or difluorobenzene
  • dSpacer hydrogen atom
  • Modified guanines include but are not limited to 7-deazaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine),
  • N2-substituted guanines e.g., N2-methyl- guanine
  • 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione 2,6-diaminopurine, 2-aminopurine
  • purine indole, adenine, substituted adenines (e.g., N6-methyl-adenine, 8-oxo- adenine) 8-substituted guanine (e.g., 8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine.
  • the guanine base is substituted by a universal base (e.g., 4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring system (e.g., benzimidazole or dichloro-benzimidazole, l-methyl-lH-[l,2,4]triazole-3-carboxylic acid amide) or a hydrogen atom (dSpacer).
  • a universal base e.g., 4-methyl-indole, 5-nitro-indole, and K-base
  • an aromatic ring system e.g., benzimidazole or dichloro-benzimidazole, l-methyl-lH-[l,2,4]triazole-3-carboxylic acid amide
  • dSpacer hydrogen atom
  • An isolated oligonucleotide generally refers to an oligonucleotide which is separated from components which it is normally associated with in nature.
  • an isolated oligonucleotide may be one which is separated from a cell, from a nucleus, from mitochondria or from chromatin.
  • Modified backbones such as phosphorothioates can be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries.
  • Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Pat. No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (e.g., Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1 : 165).
  • the cell lines can be used in their native state without any modification.
  • the RPMI 8226 cell line it can be used to identify compounds that signal through at least TLR9 and/or TLR7.
  • the cell line can be modified to express a TLR that it does not naturally express.
  • the cell to be used in the screening method may express one or more endogenous TLR and yet still be manipulated to express an additional TLR different from those it endogenously expresses.
  • the cell may also be manipulated in order to increase or decrease the level of TLR that it endogenously expresses.
  • the cells may be stably or transiently transfected.
  • a cell that does not naturally express a protein or polypeptide, but is genetically manipulated to do so is refe ⁇ ed to as ectopically expressing the protein or polypeptide.
  • the basic screening method remains the same regardless of which TLR is expressed by the cell.
  • the reference compound and the readout may vary depending upon the TLR(s) expressed.
  • the screening method is used to identify a compound that signals tlirough a TLR such as for example TLR9.
  • the positive reference compound may be an immunostimulatory compound aheady known to act through TLR9 (e.g., CpG nucleic acid).
  • a functional TLR is a full-length TLR protein or a fragment thereof capable of inducing or inhibiting a signal in response to interaction with its ligand.
  • the functional TLR will include at least a TLR ligand-binding fragment ofthe extracellular domain ofthe full-length TLR and at least a fragment of a TIR domain capable of interacting with another Toll homology domain-containing polypeptide, e.g., MyD88.
  • the functional TLR is a full-length TLR selected from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and TLR10.
  • nucleic acid and amino acid sequences for ten currently known human TLRs are available from public databases such as GenBank.
  • nucleic acid and amino acid sequences for various TLRs from numerous non- human species are also available from public databases including GenBank.
  • nucleic acid and amino acid sequences for human TLR9 can be found as GenBank accession numbers AF245704 (coding region spanning nucleotides 145-3243) (SEQ ID NO: 60) and AAF78037 (SEQ JD NO: 62), respectively.
  • Nucleic acid and amino acid sequences for murine TLR9 can be found as GenBank accession numbers AF348140 (coding region spanning nucleotides 40-3138) (SEQ ID NO: 68) and AAK29625 (SEQ ID NO: 72), respectively.
  • Nucleic acid and amino acid sequences for human TLR8 can be found as
  • GenBank accession numbers AF245703 (coding region spanning nucleotides 49-3174) (SEQ ID NO: 46) and AAF78036 (SEQ TD NO: 50), respectively.
  • Nucleic acid and amino acid sequences for murine TLR8 (mTLR8) can be found as GenBank accession numbers AY035890 (coding region spanning nucleotides 59-3157) (SEQ ID NO: 55) and AAK62677 (SEQ ID NO: 57), respectively.
  • Nucleic acid and amino acid sequences for human TLR7 can be found as GenBank accession numbers AF240467 (coding region spanning nucleotides 135-3285) (SEQ ID NO: 31) and AAF60188 (SEQ ID NO: 34), respectively.
  • Nucleic acid and amino acid sequences for murine TLR7 can be found as GenBank accession numbers AY035889 (coding region spanning nucleotides 49-3201) (SEQ ID NO: 38) and AAK62676 (SEQ ID NO: 41), respectively.
  • Nucleic acid and amino acid sequences for human TLR3 can be found as GenBank accession numbers NM_003265 (coding region spanning nucleotides 102-2816) (SEQ ID NO: 7) and NP_003256 (SEQ ID NO: 8), respectively.
  • Nucleic acid and amino acid sequences for murine TLR3 can be found as GenBank accession numbers AF355152 (coding region spanning nucleotides 44-2761) (SEQ ID NO: 9) and AAK26117 (SEQ ID NO: 10), respectively.
  • Nucleic acid and amino acid sequences for human TLR1 (hTLRl) can be found as
  • GenBank accession numbers NM_003263 and NP_003254 are GenBank accession numbers NM_003263 and NP_003254, respectively.
  • Nucleic acid and amino acid sequences for murine TLR1 (mTLRl) can be found as GenBank accession numbers NM_030682 and NP_109607, respectively.
  • the functional TLR also is not limited to native TLR polypeptides.
  • a native TLR is one that is naturally occurring.
  • the TLR may be a non-native (or non-naturally occurring TLR).
  • An example is a chimeric TLR having an extracellular domain and the cytoplasmic domain derived from TLRs from different species.
  • Such chimeric TLR polypeptides can include, for example, a human TLR extracellular domain and a murine TLR cytoplasmic domain.
  • such chimeric TLR polypeptides can include chimerae created with different TLR splice variants or allotypes.
  • TLR signaling activity is activity that results from interaction of a TLR with a TLR ligand.
  • TLR signaling can be measured in a number of ways including but not limited to interaction between a TLR and a protein or factor (such as an adaptor protein), interaction between downstream proteins or factors (such as an adaptor protein) with each other, activation of nuclear factors such as transcription factors or transcription complexes, up- or down- regulation of genes, phosphorylation or dephosphorylation of proteins or factors in the signaling cascade, expression, production and/or secretion of cytokines and/or chemokines, changes in cell cycle status, up- or down-regulation of cell surface marker expression, and the like.
  • Those of ordinary skill in the art are familiar with assays for measuring these latter events including but not limited to gel shift assays, immunoprecipitations, phosphorylation . status analysis of proteins, Northern analysis, RT-PCR analysis, etc.
  • TLR signaling pathway or cascade. It is to be understood that this is meant to be illustrative and that different factors may be involved in the signaling of particular TLR.
  • TIR cytoplasmic Toll/IL-1 receptor
  • One TLR signaling pathway is known to use the cytoplasmic Toll/IL-1 receptor (TIR) homology domain, present in all TLRs. This domain interacts (e.g., binds to) and thereby transduces a signal to a similar domain on an adapter protein (e.g., MyD88). This type of interaction is refe ⁇ ed to as a like:like interaction of TIR domains. This interaction is followed by an another interaction between the adapter protein and a kinase, through their respective "death domains".
  • TIR cytoplasmic Toll/IL-1 receptor
  • TRAF6 tumor necrosis factor receptor-associated factor-6
  • MAPKKK mitogen-activated kinase kinase kinase
  • the target of this kinase is another kinase made up of two chains, called I kappa B kinase ⁇ (IKK ⁇ ) and I kappa B kinase ⁇ (IKK ⁇ ), that together form a heterodimer of !KK ⁇ :IKKj8, which phosphorylates I kappa B.
  • NF-KB translocates to the nucleus to activate genes with kappa B binding sites in their promoters and enhancers such as the genes encoding IL-6, IL-8, the p40 subunit of IL-12, and the costimulatory molecule CD86.
  • the signaling mechanisms of TLRs are not limited to this pathway; other signaling pathways exist and can be used in the screening readouts ofthe methods provided herein.
  • the screening assays employ a number of readouts (or parameters).
  • the readouts can be native readouts.
  • a native readout is one that does not rely on introduction of a reporter construct into the cell of interest.
  • the readouts can be artificial.
  • An artificial readout is one that relies on introduction of a reporter construct into the cell of interest. Examples of both are provided herein.
  • a given assay may measure one or more native readouts and one or more artificial readouts.
  • Each readout whether native or artificial is related to signaling pathways that ensue after TLR engagement with a ligand.
  • Each cell line described herein will be associated with a particular set of native readouts which the invention seeks to determine in the screening assays provided.
  • the response ofthe RPMI 8226 cell line to an immunomodulatory molecule can be assessed in terms of native readouts such as CD71 expression, CD86 expression, HLA-DR expression, IL-8 expression, IL-8 production, IL-8 secretion, IL-10 expression, IL-10 production, IL-10 secretion, IP-10 expression, IP-10 production, IP-10 secretion, TNF- ⁇ expression, TNF- ⁇ production and TNF- ⁇ secretion.
  • RAMOS response can be assessed, inter alia, by CD80 cell surface expression.
  • Raji response can be assessed, inter alia, by IL-6 secretion.
  • the cell line can be used in an unmodified form.
  • an unmodified cell line will naturally respond to a TLR ligand through a native readout system.
  • an RPMI 8226 cell exposed to an immunostimulatory TLR ligand may increase expression of IP-10 from the native gene locus.
  • the cell line may be modified to contain a reporter construct that acts as a surrogate for the IP-10 gene locus.
  • the reporter construct may contain the TLR responsive promoter elements that are naturally found in the native IP-10 locus operably linked to a reporter coding sequence that encodes a gene product that is detectable and quantifiable. The sfructure and variability of suitable reporter constructs will be discussed in greater detail herein.
  • Readouts typically include the induction of a gene under control of a specific promoter such as a NF- ⁇ B promoter.
  • the gene under the control ofthe NF- ⁇ B promoter can be a gene which naturally includes an NF- ⁇ B promoter or it can be a gene in a construct in which an NF- ⁇ B promoter has been inserted.
  • Endogenous genes and transfected constructs which include the NF- ⁇ B promoter include but are not limited to IL-8, IL-12 p40, NF- ⁇ B-luc, IL-12 p40-luc, and TNF-luc.
  • Cytokines generally include, without limitation, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, IL-15, IL-18, IFN- ⁇ , IFN- ⁇ , IFN- ⁇ , TNF- ⁇ , GM-CSF, G-CSF, M-CSF.
  • Thl cytokines include but are not limited to IL-2, IFN- ⁇ , and IL- 12.
  • Th2 cytokines include but are not limited to IL-4, IL-5, and IL-10.
  • chemokines of particular significance in the invention include but are not limited to CCL5 (RANTES), CXCL9 (Mig), CXCLIO (IP-10), CXCL11 (I-TAC), IL-8, and MCP-1.
  • TLR signaling activity can also be measured by phosphorylation, such as total cellular phosphorylation or phosphorylation of specific factors such as but not limited to IRAK, ERK, MyD88, TRAF6, p38, NF- B subunits, c-Jun and c-Fos.
  • TLR signaling activity can be measured by changes in gene expression.
  • the expression of CD71, CD86, CD80, CD69, CD54, HLA-DR, HLA class I, IL-6, IL-8, IL-10, LP-9, IP-10, IFN- ⁇ , TNF- ⁇ , and the like can be assessed as a measure of TLR signaling activity.
  • Gene expression analysis may be performed using microa ⁇ ay techniques.
  • TLR signaling activity can also be measured by cell proliferation status or changes thereto.
  • TLR signaling activity can also be measured by cell surface marker expression such as the cell surface expression of markers such as but not limited to CD71, CD86, HLA-DR, CD80, HLA class I, CD54 and CD69.
  • TLR signaling activity can also be measured by antibody secretion such as but not limited to IgM secretion.
  • the cells can be manipulated by the introduction of expression and/or reporter constructs.
  • the expression constructs preferably comprise a TLR coding sequence, as described above.
  • the reporter constructs can be used as surrogate measures of native TLR signaling activity. These reporter constructs are intended to substitute for the "native" readouts capable with the cell line.
  • the reporter constructs include a promoter element derived from a gene known to be modulated following TLR engagement with a TLR ligand.
  • the reporter construct further includes a coding sequence linked to the promoter.
  • the coding sequence is usually that of a reporter (i.e., a protein that is detectable or quantifiable).
  • the reporter construct generally includes a promoter, a coding sequence and a polyadenylation signal.
  • These nucleic acids shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, in addition to promoter elements that are responsive to TLR signaling.
  • the nucleic acid constructs may optionally include enhancer sequences or upstream activator sequences as desired.
  • the promoter in the reporter constract will include a TLR responsive promoter element, and will therefore be regarded as a TLR responsive promoter.
  • a TLR responsive promoter is a promoter having an activity that is modulated (i.e., either activated or inhibited) by signaling tlirough a TLR (e.g., by TLR interaction with its ligand).
  • the promoter contains sites that are bound by transcription factors modulated by TLR signaling. The factors may be activated or inhibited by TLR signaling.
  • Activation ofthe transcription factor includes increases in the activity of the transcription factor per se, increases in its ability to interact with other factors or with DNA that serve to increase its activity, and increases in its transcription and translation (i.e., increased mRNA and protein levels ofthe transcription factor).
  • inhibition ofthe transcription factor includes decreases in the activity ofthe transcription factor per se, decreases in its ability to interact with other factors or with DNA that serve to decrease its activity, and decreases in its transcription and translation (i.e., decreased mRNA and protein levels ofthe transcription factor).
  • the effect on the transcription factor is usually the downstream result of other interactions in the signaling pathway.
  • the expression of coding sequences linked to such promoters will therefore be modulated by TLR signaling events, and it is the level of expression of these coding sequences that can be used as a readout of TLR signaling in the screening methods provided herein.
  • the TLR responsive promoter may comprise a transcription factor binding site selected from the group consisting of a NF-KLB binding site, an AP-1 binding site, a CRE, a SRE, an interferon-stimulated response element (ISRE), a GAS, an ATF2 binding site, an TJ F3 binding site, an IRF7 binding site, an NFAT binding site, a p53 bmding site, an SRF binding site, and a TARE, among others.
  • These binding sites and their sequences are known in the art. Below is a exemplary list of these sequences.
  • W A or T
  • R A or G
  • Y C or T
  • TARE (TNF- ⁇ response element): e.g. from the COLI Al promoter
  • the TLR responsive promoter element can be derived from the promoter of a naturally occurring (i.e., an endogenous) gene that is activated or inhibited by TLR signaling (such as the IL-6 gene, the IL-8 gene, the IL-10 gene, the IL-12 p40 gene, the 1P-9 gene, the IP-10 gene, the type 1 IFN gene, the IFN- ⁇ 4 gene, the JJFN-/3 gene, the TNF- ⁇ gene, the TNF- 3 gene, the RANTES gene, the ITAC gene, the IGFBP4 gene, the CD54 gene, the CD69 gene, the CD71 gene, the CD80 gene, the CD86 gene, the HLA-DR gene, the HLA class I gene, and the like).
  • the afore-mentioned genes are genes that are known to be activated in response to TLR interaction with its lig
  • the upstream (5') - 620 to +50 promoter region of IFN- ⁇ 4 or the upstream (5 ') -140 to +9 promoter region of IFN- ⁇ l can be used.
  • the EFN- ⁇ 4 sequence is cloned into the Smal site of the pGL3-Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') promoter region of IFN- ⁇ 4.
  • the promoter can also be the upstream (5') -280 to +20 promoter region of IFN- ⁇ .
  • the promoter can also be the upstream (5') —397 to +5 promoter region of RANTES.
  • the RANTES promoter sequence is cloned into the Nhel site (filled in with Klenow) ofthe pGL3-Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') -397 to +5 promoter region ofRANTES.
  • the promoter can also be the upstream truncated (-250 to +30) and full length (-860 to
  • +30) promoter regions derived from human IL-12 p40 genomic DNA was cloned as a Kpnl-Xhol insert into p ⁇ gal-Basic (Promega) resulting in an expression vector that includes a ⁇ gal gene under the control ofthe upstream (5') -250 to +30 promoter region of human IL-12 p40.
  • the full length IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into p ⁇ gal-Basic (Promega) resulting in an expression vector that includes a ⁇ gal gene under the control ofthe upstream (5') -751 to +30 promoter region of human IL-12 p40.
  • the truncated -250 to +30 promoter region of human IL-12 p40 was cloned into the pGL3-Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') -250 to +30 promoter region of human IL-12 p40.
  • the full length LL-12 p40 promoter of human IL-12 p40 was cloned into the pGL3 -Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') -751 to +30 promoter region of human IL-12 p40.
  • the promoter can also be the upstream (5') -288 to +7 promoter region derived from human IL-6 genomic DNA.
  • the promoter can also be derived from the full-length promoter region ofthe IL-6 gene from -1174 to + 7 (Accession No M22111, SEQ ID NO:129).
  • the promoter can also be the upstream (5') -734 to +44 or the upstream (5') -162 to +44 promoter region derived from human IL-8 genomic DNA. Mukaida N et al. (1989) J Immunol 143:1366-71.
  • the promoter can also be derived from the -615 to +30 promoter region of human TNF- ⁇ .
  • the promoter can also be derived from a promoter region of human TNF-/3.
  • the promoter can also be derived from the -875 to +97 promoter region of human IP- 10.
  • the promoter can also be derived from the -219 to +114 promoter region of human CXCL11 (JP 9).
  • the promoter can also be derived from the full length (-934 to +114) promoter region of human CXCL11 (1P9).
  • the promoter can also be derived from the -289 to +217 promoter region of human IGFBP4 (Insulin growth factor binding protein 4).
  • the promoter can also be derived from the full length (-836 to +217) promoter region of human IGFBP4.
  • the promoter response element generally will be present in multiple copies, e.g., as tandem repeats.
  • coding sequence for luciferase is under control of an upstream 6X tandem repeat of NF- ⁇ B response element.
  • an ISRE-luciferase reporter construct useful in the invention is available from Stratagene (catalog no. 219092) and includes a 5x ISRE tandem repeat joined to a TATA box upstream of a luciferase reporter gene.
  • the reporter constract coding sequence is preferably any nucleotide sequence that codes for a protein capable of detection or quantification.
  • the protein can be an enzyme (e.g., luciferase, alkaline phosphatase, /3-galactosidase, chloramphenicol acetyltransferase (CAT), secreted alkaline phosphatase, etc.), a bioluminescence marker (e.g., green fluorescent protein (GFP, U.S. Pat. No. 5,491,084), etc.), blue fluorescent protein (BFP, e.g., U.S. Pat. No.
  • GFP green fluorescent protein
  • BFP blue fluorescent protein
  • a surface-expressed molecule e.g., CD25, CD80, CD86
  • a secreted molecule e.g., IL-1, IL-6, IL-8, IL-12 p40, TNF- ⁇
  • hapten or antigen e.g., IL-1, IL-6, IL-8, IL-12 p40, TNF- ⁇
  • substrate can be supplied as part ofthe assay, and detection can involve measurement of chemiluminescence, fluorescence, color development, incorporation of radioactive label, drug resistance, or other marker of enzyme activity.
  • detection can be accomplished using flow cytometry (FACS) analysis or functional assays.
  • the coding sequence encodes a protein having a level or an activity that is quantifiable, preferably with a wide linear range.
  • the expression constract coding sequence is preferably a TLR coding sequence derived from the sequences listed herein.
  • the expression construct promoter is a constitutive promoter, although in some embodiments it may be inducible. Those of ordinary skill in the art are familiar with such promoters.
  • a coding sequence and the regulatory sequences are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription and/or translation ofthe coding sequence under the influence or control ofthe regulatory sequence.
  • Two DNA sequences are said to be operably linked if induction of a promoter in the 5' regulatory sequence results in the transcription ofthe coding sequence and if the nature ofthe linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability ofthe promoter region to direct the transcription ofthe coding sequence, or (3) interfere with the ability ofthe co ⁇ esponding RNA transcript to be translated into a protein.
  • a regulatory sequence would be operably linked to a coding sequence if the gene expression sequence were capable of effecting transcription of that coding sequence such that the resulting transcript is translated into the desired protein or polypeptide.
  • Methods for nucleic acid introduction into cells are known in the art.
  • the nucleic acid may be delivered to the cells alone or in association with a vector.
  • a vector is any vehicle capable of facilitating the transfer ofthe nucleic acid to the cells so that the reporter can be expressed.
  • the vector generally transports the nucleic acid to the cells with reduced degradation relative to the extent of degradation that would result in the absence ofthe vector, hi general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or inco ⁇ oration ofthe antigen nucleic acid sequences.
  • Viral vectors are a prefe ⁇ ed type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retroviras, such as Moloney murine leukemia viras, Harvey murine sarcoma vims, murine mammary tumor viras, and Rous sarcoma viras; adenoviras, adeno-associated viras; SV40-type viruses; polyoma viruses; Epstein-Ban viruses; papilloma viruses; he ⁇ es viras; vaccinia viras; polio viras; and RNA viras such as a retroviras.
  • retroviras such as Moloney murine leukemia viras, Harvey murine sarcoma vims, murine mammary tumor viras, and Rous sarcoma viras
  • adenoviras adeno-associated
  • Prefe ⁇ ed viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest.
  • Non-cytopathic viruses include refrovirases, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA.
  • Refrovirases have been approved for human gene therapy trials. Most useful are those refrovirases that are replication-deficient (i.e., capable of directing synthesis ofthe desired proteins, but incapable of manufacturing an infectious particle).
  • Such genetically altered refroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo.
  • a prefe ⁇ ed viras for certain applications is the adeno-associated virus, a double-stranded DNA virus.
  • the adeno-associated viras can be engineered to be replication -deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions.
  • wild-type adeno-associated viras manifest some preference for integration sites into human cellular DNA, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of refroviral infection.
  • adeno-associated viras infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event.
  • the adeno-associated viras can also function in an exfrachromosomal fashion.
  • Recombinant adeno-associated viruses that lack the replicase protein apparently lack this integration sequence specificity.
  • Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid.
  • Plasmids include pBR322, pUC 18, pUC 19, pRc/CMV, S V40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
  • the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors.
  • biological vectors and chemical/physical vectors are useful in the delivery and/or uptake of reporter constructs ofthe invention.
  • a "chemical/physical vector” refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering the reference and test compound.
  • a prefe ⁇ ed chemical/physical vector ofthe invention is a colloidal dispersion system.
  • Colloidal dispersion systems include lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes.
  • a prefe ⁇ ed colloidal system ofthe invention is a liposome. Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2 - 4.0 ⁇ m can encapsulate large macromolecules.
  • LUV large unilamellar vessels
  • RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci, (1981) 6:77).
  • Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein.
  • Ligands which may be useful for targeting a liposome to an immune cell include, but are not limited to, intact or fragments of molecules which interact with immune cell specific receptors and molecules, such as antibodies, which interact with the cell surface markers of immune cells. Such ligands may easily be identified by binding assays well known to those of skill in the art.
  • the liposome may be targeted to the cancer by coupling it to a one of the immunotherapeutic antibodies discussed earlier.
  • the vector may be coupled to a nuclear targeting peptide, which will direct the vector to the nucleus ofthe host cell.
  • Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENETM (a non-liposomal lipid with a special DNA condensing enhancer) and SUPERFECTTM (a novel acting dendrimeric technology).
  • Liposomes are commercially available from Gibco BRL, for example, as LTJPOFECTINTM and LIPOFECTACETM, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB).
  • DOTMA N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride
  • DDAB dimethyl dioctadecylammonium bromide
  • CpG ODN (SEQ ID NO: 1) is cu ⁇ ently in preclinical and clinical trials for a number of clinical applications. SEQ ID NO: 1 has been discovered to induce signaling through TLR9. In order to assess different lots of clinical material, the methods ofthe invention are employed, using a highly characterized lot of SEQ ID NO:l as a reference.
  • the CpG-non-responsive human embryonal kidney cell line HEK293 (e.g., ATCC CRL-1573) was stably transfected with a hTLR9 expression construct and found to express full-length human TLR9 constitutively.
  • the cells also contained a genomic copy of a reporter constract with a 6x NF- ⁇ B binding site and a luciferase gene reporter cassette.
  • CpG ODN SEQ ID NO:l
  • the cells are then lysed and activity ofthe luciferase protein determined by its catalytic activity of luciferin oxidation which is measured in a luminometer. Results are expressed as fold induction above medium control.
  • Assay set-up includes a reference standard material which is highly pure and well characterized.
  • the reference material is used to create a standard curve within a defined range where the dose-response curve is linear (e.g., in the range ofthe EC50 value for SEQ ID NO:l, 70-100 nM).
  • the test material is dissolved for testing and assayed at a defined concentration.
  • Activity ofthe test material is calculated using the standard curve ofthe reference material. Quality ofthe tested material is deemed acceptable if activity ofthe test material compared to activity ofthe reference material falls within predetermined limits.
  • Example 1 The assay of Example 1 is performed using RPMI 8226 cells (ATCC CCL-155) in place ofthe stably transfected HEK cells of Example 1.
  • RPMI 8226 cells naturally express human TLR9.
  • the cells are stably transfected with a 6x NF- ⁇ B-luciferase reporter construct. It is to be understood that the assay could also be carried out by measuring a native readout such as IL-10 secretion.
  • human TLR3 cDNA was amplified by the polymerase chain method (PCR) from a cDNA made from human 293 cells using the primers 5'-GAAACTCGAGCCACCATGAGACAGACTTTGCCTTGTATCTAC-3' (sense, SEQ JD NO:152) and S'-GAAAGAATTCTTAATGTACAGAGTTTTTGGATCCAAG-S' (antisense, SEQ ID NO: 153).
  • the primers introduce Xhol and EcoRI restriction endonuclease sites at their 5' ends for use in subsequent cloning into the expression vector.
  • the resulting amplification product fragment was cloned into pGEM-T Easy vector (Promega), isolated, cut with ⁇ ol and EcoRI restriction endonucleases, ligated into an XholJEcoRl-digested pcDNA3.1 expression vector (Invitrogen).
  • the insert was fully sequenced and translated into protein.
  • the open reading frame codes for a protein 904 amino acids long, having the sequence co ⁇ esponding to GenBank accession no. NP_003256 (S ⁇ Q ID NO:8).
  • mTLR3 Co ⁇ esponding nucleotide and amino acid sequences for murine TLR3 (mTLR3) are known.
  • the nucleotide sequence of mTLR3 cDNA has been reported as GenBank accession no. AF355152 (SEQ ID NO:9), and the amino acid sequence of mTLR3 has been reported as GenBank accession no. AAK26117 (SEQ ID NO:10).
  • Human TLR3 cDNA and murine TLR3 cDNA in pT-Adv vector were individually cloned into the expression vector pcDNA3.1(-) from Invitrogen using the EcoRI site.
  • the resulting expression vectors mentioned above were transfected into CpG-DNA non-responsive human 293 fibroblast cells (ATCC, CRL- 1573) using the calcium phosphate method. Utilizing a "gain of function" assay it was possible to reconstitute human TLR3 (hTLR3) and murine TLR3 (mTLR3) signaling in 293 fibroblast cells.
  • NF- B activation is central to the IL-l/TLR signal transduction pathway (Medzhitov R et al. (1998) Mol Cell 2:253-8; Muzio M et al. (1998) JExp Med 187:2097-101), in a first set of experiments human 293 fibroblast cells were transfected with hTLR3 alone or co-transfected with hTLR3 and an NF- ⁇ B-driven luciferase reporter constract.
  • 293 fibroblast cells were fransfected with hTLR3 alone or co-transfected with hTLR3 and a RANTES-driven luciferase reporter constract (described in Example 14 below).
  • hTLR7 human TLR7
  • mTLR7 murine TLR7
  • 293 cells were fransfected in 10 cm plates (2x10 6 cells/plate) with 16 ⁇ g of DNA and selected with 0.7 mg/ml G418 (PAA Laboratories GmbH, C ⁇ lbe, Germany). Clones were tested for TLR9 expression by RT-PCR, for example as shown in Fig. 21. The clones were also screened for IL-8 production or NF- B-luciferase activity after stimulation with ODN. Four different types of clones were generated. 293-hTLR9-luc: expressing human TLR9 and 6x NF- ⁇ B-luciferase reporter
  • 293-mTLR9-luc expressing murine TLR9 and 6x NF- ⁇ B-luciferase reporter 293-hTLR9: expressing human TLR9
  • TLR9 human or mouse
  • reporter vectors may be used in the practice ofthe invention. Some of the reporter vectors are commercially available, e.g., the luciferase reporter vectors pNF- ⁇ B-Luc (Stratagene) and pAPl-Luc (Stratagene). These two reporter vectors place the luciferase gene under control of an upstream (5') promoter region derived from genomic DNA for NF- B or API, respectively.
  • Other reporter vectors can be constructed following standard methods using the desired promoter and a vector containing a suitable reporter, such as luciferase, ⁇ -galactosidase ( ⁇ -gal), chloramphenicol acetyltransferase (CAT), and other reporters known by those skilled in the art. Following are some examples of reporter vectors constructed for use in the present invention.
  • IFN- ⁇ 4 is an immediate-early type 1 IFN. Sequence-specific PCR products for the -
  • 620 to +50 promoter region of IFN- ⁇ 4 were derived from genomic DNA of human 293 cells and cloned into the Smal site ofthe pGL3-Basic Vector (Promega).
  • the resulting expression vector includes a luciferase gene under control of an upstream (5') -620 to +50 promoter region of IFN- ⁇ 4.
  • the sequence ofthe -620 to +50 promoter region of IFN- ⁇ 4 is provided as SEQ ID NO:121.
  • IFN- ⁇ l is a late type 1 IFN. Sequence-specific PCR products for the -140 to +9 promoter region of IFN- ⁇ l were derived from genomic DNA of human 293 cells and cloned into Smal site ofthe pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -140 to +9 promoter region of IFN- ⁇ l. A sequence ofthe -140 to +9 promoter region of IFN- ⁇ l is provided as SEQ ID NO: 122.
  • IFN- ⁇ is an immediate-early type 1 TEN.
  • the -280 to +20 promoter region of IFN- ⁇ was derived from the pUC ⁇ 26 vector (Algarte M et al. (1999) J Virol 73:2694-702) by restriction at EcoRI and Taql sites. The 300 bp restriction fragment was filled in by Klenow enzyme and cloned into N?eI-digested and filled in pGL3 -Basic Vector (Promega).
  • the resulting expression vector includes a luciferase gene under control of an upstream (5') -280 to +20 promoter region of IF ⁇ - ⁇ .
  • a sequence ofthe -280 to +20 promoter region of IF ⁇ - ⁇ is provided as SEQ ID ⁇ O:123.
  • Reporter constructs are made using the -285 to +7 promoter region derived from human IL-6 genomic DNA.
  • the IL-6 promoter region is cloned as a Kpnl-Xhol insert into pGL3-Basic Vector (Promega).
  • the resulting expression vector includes a luciferase gene under control of an upstream (5 1 ) -288 to +7 promoter region derived from human IL-6 genomic DNA.
  • a sequence ofthe -288 to +7 promoter region of human IL-6 is provided as SEQ ID NO: 128.
  • the promoter can also be derived from the full-length promoter region ofthe IL-6 gene from -1174 to + 7 (GenBank Accession No M22111) as shown below as SEQ ID NO: 129.
  • Reporter constructs have been made using a -546 to +44 and a truncated -133 to +44 promoter region derived from human IL-8 genomic DNA. Mukaida N et al. (1989) J Immunol 143:1366-71. In each reporter constract the IL-8 promoter region was cloned as a Kpnl-Xhol insert into pGL3-Basic Vector (Promega).
  • One ofthe resulting expression vectors includes a luciferase gene under control of an upstream (5') -546 to +44 promoter region derived from human IL-8 genomic DNA.
  • Another ofthe resulting expression vectors includes a luciferase gene under control of an upsfream (5') -133 to +44 promoter region derived from human IL-8 genomic DNA.
  • the promoter can also be the upsfream (5') -734 to +44 or the upstream (5') -162 to +44 promoter region derived from human IL-8 genomic DNA. Mukaida N et al. (1989) J Immunol 143:1366-71. A sequence ofthe -734 to +44 promoter region derived from human IL-8 is provided below as SEQ ID NO: 130.
  • Reporter constructs have been made using truncated (-250 to +30, SEQ ID NO:127) and full length (-751 to +30, SEQID NO:126) promoter regions derived from human IL-12 p40 genomic DNA. (Takeshita et al. Eur. J. Immunol. 2000. 30: 108-116.)
  • the truncated IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into p ⁇ gal-Basic (Promega).
  • the resulting expression vector includes a ⁇ gal gene under control of an upsfream (5') -250 to +30 promoter region of human IL-12 p40.
  • a second reporter constract the full length IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into p ⁇ gal-Basic (Promega).
  • the resulting expression vector includes a ⁇ gal gene under control of an upstream (5') -751 to +30 promoter region of human IL-12 p40.
  • a third reporter constract the truncated -250 to +30 promoter region of human IL-12 p40 was cloned into the pGL3-Basic Vector (Promega).
  • the resulting expression vector includes a luciferase gene under control of an upstream (5') -250 to +30 promoter region of human IL-12 p40.
  • a fourth reporter construct the full length IL-12 p40 promoter of human IL-12 p40 was cloned into the pGL3-Basic Vector (Promega).
  • the resulting expression vector includes a luciferase gene under control of an upstream (5') -751 to +30 promoter region of human IL-12 p40.
  • a sequence ofthe -751 to +30 promoter region of human IL-12 p40 is provided as SEQ ID NO: 126.
  • chemokine RANTES Transcription ofthe chemokine RANTES is believed to be regulated at least in part by IRF3 and by NF- B. Lin R et al. (1999) JMol Cell Biol 19(2):959-66; Genin P et al. (2000) J Immunol 164:5352-61.
  • a 483 bp sequence-specific PCR product including the -397 to +5 promoter region of RANTES was derived from genomic DNA of human 293 cells, restricted with Pstl and cloned into pCAT-Basic Vector (Promega) using Hindlll (filled in with Klenow) and Pstl sites (filled in).
  • the -397 to +5 promoter region of RANTES was then isolated from the resulting RANTES/chloramphenicol acetyltransferase (CAT) reporter plasmid by restriction with BglU and Sail, filled in with Klenow enzyme, and cloned into the Nhel site (filled in with Klenow) ofthe pGL3-Basic Vector (Promega).
  • the resulting expression vector includes a luciferase gene under control of an upstream (5') -397 to +5 promoter region of RANTES. Comparison ofthe insert sequence -397 to +5 of Genin P et al. (2000) J Immunol 164:5352-61 and GenBank accession no.
  • AB023652 (SEQ ID NO:125) revealed two point deletions (at positions 105 and 273 of SEQ 3D NO: 125) which do not create new restriction sites.
  • a sequence ofthe -397 to +5 promoter region of RANTES is provided as SEQ ID NO: 125.
  • TLR expression was determined using total RNA of cells prepared by standard methods (QIAGEN). RNA was transcribed to cDNA using AMV Reverse Transcriptase (Roche). Quantitative PCR was performed with TLR-gene specific primer sets using a LightCycler mstrament (Roche). Controls for genomic DNA impurities were performed by a similar PCR method using RNA (but without reverse transciptase). A variety of cell lines was screened for their expression of TLR3, 7, 8 and 9.
  • cell lines are A549 (human lung carcinoma), BeWo (human choriocarcinoma), HeLa (human cervix carcinoma), Hep-2 (human cervix carcinoma), KG-1 (human acute myeloid leukemia), MUTZ-3 (human acute myelomonocytic leukemia), Nalm-6 (human B cell precursor leukemia), NK-92 (human Natural killer cell line), NK-92 MI (human Natural killer cell line, IL-2 independent), Raji (human Burkitt's lymphoma, B lymphocyte), RAMOS (Burkitt's lymphoma, B lymphocyte), RPMI 8226 (human multiple myeloma, B lymphocyte), THP-1 (human acute monocytic leukemia), U937 (human lymphoma) and Jurkat (human T cell leukemia).
  • A549 human lung carcinoma
  • BeWo human choriocarcinoma
  • HeLa human cervix carcinoma
  • Hep-2 human cervix carcinoma
  • TLR7 All B cell lines express, as determined by Real Time-PCR (RT-PCR), endogenous TLR9. In addition, all lines except NALM co-express TLR7. Nevertheless, none ofthe other cell lines appeared to express TLR7, whereas low TLR9 expression on the mRNA level was observed for KG-1 and THP-1. TLR3 appeared to be expressed in most of these cell lines, with the highest mRNA levels for example in the NK cell lines (e.g., NK-92).
  • RT-PCR Real Time-PCR
  • Raji cells contain high levels of TLR9 mRNA and low levels of TLR3 and TLR7 mRNA suggesting high expression of TLR9 protein and lower levels of TLR3 and TLR7 protein.
  • TLR9 can be used to screen potential new TLR9 ligands (CpG ODN, etc.), cell lines expressing TLR7 to screen potential new TLR7 ligands (ORN (oligoribonucleotides), small molecules, etc.), and cell lines expressing both receptors may be used to screen for "hybrid" TLR7 and 9 agonists.
  • cell lines lacking TLR8 expression i.e., all cell lines tested
  • TLR3 e.g., Raji cells
  • TLR3 Poly I:C
  • Increased expression of cell surface markers was determined using cells stimulated as described above and then stained with different monoclonal antibody combinations specific for the cell surface markers. Analysis ofthe cells was performed by flow cytometry.
  • Changes in reporter gene activity were determined using cells fransfected with a NF- ⁇ B reporter constract (Stratagene) and a /3-galactosidase reporter control plasmid (Invitrogen) using elecfroporation.
  • NF- ⁇ B analysis a 5x NF- ⁇ B-Luciferase Vector (Stratagene) was used. The amount of DNA transfected as well as cell concentration was varied. Stimulation was performed 24h after transfection. Cells were stimulated with the indicated amounts of ODN, R-848, LPS, TNF- ⁇ , or IL-1 ⁇ for the indicated incubation times.
  • Cell extracts were prepared by lysing the cells in 100 ⁇ l reporter lysis buffer (Promega) using the freeze-thaw method. All data were normalized for /3-galactosidase expression. Stimulation indices were calculated in reference to luciferase activity of medium without addition of ODN.
  • Figs. 14 and 15 show IL-6 production of Raji cells upon stimulation with ODN, poly I:C or R-848.
  • Fig. 16 shows IFN- ⁇ 2 production of Raji cells upon stimulation with ODN, poly I:C or R-848. h all assays, cells were incubated with Na-Butyrate for 48h before stimulation with TLR ligands.
  • CpG stimulation ofthe RAMOS cell lines can result in the CpG-specific upregulation of cell surface markers such as CD80, as shown in Fig. 17.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Cell Biology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Investigating Or Analysing Biological Materials (AREA)

Abstract

The invention provides in part novel screening methods and compositions for identifying and distinguishing between candidate immunomodulatory compounds. The invention further provides methods for assessing biological activity of composition containing a known TLR ligand. These latter methods can be used for quality assessment and selection of various lots of test compositions, including pharmaceutical products for clinical use.

Description

METHODS AND PRODUCTS FOR IDENTIFICATION AND ASSESSMENT
OF TLR LIGANDS
Background of the Invention Nucleic acids with immunostimulatory activity have been identified. The first recognized immunostimulatory motif was the CpG motif in which at least the C ofthe dinucleotide was unmethylated. It has been postulated that mammalian subjects recognize the unmethylated dinucleotide as being of bacterial origin, and thus mount a heightened immune response following exposure. The ensuing immune response includes both cell mediated and humoral aspects. Since the discovery ofthe CpG immunostimulatory motif, other immunostimulatory motifs have also been identified including the poly-T and T-rich motifs, the TG motif and the poly-G motif. In some instances, immunostimulation has also been observed in response to exposure to methylated CpG motifs and motif-less nucleic acids having phosphorothioate backbone linkages. The responses induced by immunostimulatory nucleic acids are varied and can include production and secretion of cytokines, chemokines, and other growth factors. The nucleic acids can induce a heightened immune stimulation regardless of whether an antigen is also introduced to the subject. Identification of new motifs as well as of subtle differences between response profiles of different nucleic acids oftentimes can be laborious, and a high throughput system for screening nucleic acids for their ability to be immunostimulatory as well as to determine the profile of responses they induce would be useful.
Summary ofthe Invention
The invention provides in its broadest sense screening methods and tools for identification and discrimination of immunomodulatory molecules and assessment and standardization of samples containing known immunomodulatory molecules. The immunomodulatory molecules can be immunostimulatory or immunoinhibitory, and most preferably are Toll-like receptor (TLR) ligands.
In one aspect, the invention provides a screening method for identifying TLR agonists. The method comprises contacting a cell line endogenously expressing at least one TLR with a test compound and measuring a test level of TLR signaling activity, wherein a positive test level is indicative of a TLR agonist (i.e., an immunostimulatory compound). The positive test level may be apparent without referring to a control. Preferably, however, it is determined relative to a control (i.e., the TLR signaling activity from a reference compound).
In some embodiments, the reference compound is a compound that induces no response (i.e., a zero response) or a minimal response. In this case, a test level that is greater than the reference level is indicative of a compound with TLR signaling activity. More preferably, the reference compound is a compound that induces a positive response (i.e., a non-zero response) and that is immunostimulatory. These reference compounds are referred to herein as negative and positive reference compounds, respectively. If the reference compound is immunostimulatory (i.e., a positive reference compound), a non-zero test level that is lower than the reference level is still indicative of an immunostimulatory test compound. In this latter embodiment, the test compound is less immunostimulatory than the reference compound (for that particular readout), but it is nonetheless immunostimulatory given the non-zero response induced. There may be one or more concurrent or consecutive assays with a negative reference compound, a positive reference compound, or both. The reference may also be a standard curve or data generated previously.
In a related aspect, the screening method involves exposing the same cell to a positive reference compound and a test compound in order to identify a test compound that inhibits the immunostimulatory response ofthe positive reference compound (i.e., a TLR antagonist or an immunoinhibitory compound). In still a related aspect, the screening method involves exposing the same cells to a positive reference compound and a test compound in order to identify a test compound that enhances the immunostimulatory response ofthe positive reference compound (i.e., an enhancer).
In both of these latter aspects, the assay requires a co-incubation ofthe positive reference compound, the test compound and the cells. Separate assays with positive reference compound alone and optionally negative reference compound alone are usually also performed.
The positive reference compound is a known TLR ligand. Non-limiting examples include but are not limited to TLR3 ligands, TLR7 ligands, TLR8 ligands and TLR9 ligands. In some embodiments, the positive reference compound is an immunostimulatory nucleic acid. In some embodiments, the positive reference compound is a CpG nucleic acid, a poly-T nucleic acid, a T-rich nucleic acid or a poly-G nucleic acid. Another example of a positive reference compound is a nucleic acid comprising a backbone that contains at least one phosphorothioate linkage.
It has been further discovered according to the invention that the RPMI 8226 cell line expresses TLR7 and responds to the imidazoquinoline compound R-848 (Resiquimod) which is known to signal through TLR7 and TLR8. Accordingly, the screening method can be performed using RPMI 8226, Raji or RAMOS cells and an imidazoquinoline compound such as R-848 or R-847 (Imiquimod) as the positive reference compound.
In one embodiment, the test compound is a nucleic acid such as but not limited to a DNA, an RNA and a DNA RNA hybrid. The test compound may be a nucleic acid that does not comprise motif selected from the group consisting of a CpG motif, a poly-T motif, a T- rich motif and a poly-G motif. The test compound may be a nucleic acid that comprises a phosphorothioate backbone linkage. In another embodiment, the test compound is a non- nucleic acid small molecule. The non-nucleic acid small molecule may be derived from a molecular library. In other embodiments, the test compound comprises amino acids, carbohydrates such as polysaccharides. It may be a hormone or a lipid or contain moieties derived therefrom. In other embodiments, the test compounds are putative ligands for TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10 or TLR11.
In one embodiment, the cell is a RPMI 8226 cell, a Raji cell, a RAMOS cell, a THP-1 cells, a Nairn cell or a KG-1 cell and the TLR is TLR9. In another embodiment, the cell is a RPMI 8226 cell, a Raji cell or a RAMOS cell and the TLR is TLR7. In yet another embodiment, the cell is a KG-1 cell, a Nairn cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, a Hep-2 cells, a A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell and the TLR is TLR3.
In another embodiment, the cell is an RPMI 8226 cell and the TLR is TLR7 or TLR9. hi still another embodiment, the cell is a Raji cell and the TLR is TLR9, TLR7 or TLR3. Depending upon the embodiment, the TLR signaling activity may be measured or detected in a number of ways. In one embodiment, the TLR signaling activity is measured by cytokine, chemokme, or growth factor secretion. The cytokine secretion may be selected from the group consisting of IL-6 secretion, IL-10 secretion, IL-12 secretion, IFN-α secretion and TNF-a secretion, but is not so limited. The chemokine secretion may be IP-10 secretion or IL-8 secretion, but is not so limited.
In another embodiment, the TLR signaling activity is measured by antibody secretion. The antibody secretion may be IgM secretion, but is not limited to this antibody subtype. fri another embodiment, the TLR signaling activity is measured by phosphorylation. The total level of phosphorylation in the cell or the level of phosphorylation of particular factors in the cell may be measured. These factors are preferably signaling factors and can be selected from the group consisting of IRAK, ERK, MyD88, TRAP6, p38, Jun, c-fos, and subunits of NF-κB, but are not so limited.
In still a further embodiment, the TLR signaling activity is measured by cell surface marker expression. In one embodiment, the TLR signaling activity is measured by an increase in cell surface marker expression. Examples of cell surface markers to be analyzed include CD71, CD86, HLA-DR, CD80, HLA Class L CD54 and CD69. In other embodiments, the TLR signaling activity is measured by a decrease in cell surface marker expression. Cell surface marker expression can be determined using flow cytometry. TLR signaling activity can also be measured by protein production (e.g., by Western blot).
In another embodiment, the TLR signaling activity is measured by gene expression. Gene expression profiles may be determined using Northern blot analysis or RT-PCR that uses mRNA or total RNA as a starting material. The gene expression of interest may be that ofthe chemokines and cytokines and cell surface molecules recited above. Gene expression analysis can be performed using microarray techniques.
In yet another embodiment, the TLR signaling activity is measured by cell proliferation. Cell proliferation assays can be measured in a number of ways including but not limited to 3H-thymidine incorporation.
In one embodiment, the cell is an RPMI 8226 cell and TLR signaling is indicated by expression of a marker such as CD71, CD86 and/or HLA-DR or by expression, production or secretion of a factor such as IL-8, IL-10, IP-10 and/or TNF-α. Preferably, in this latter embodiment, the RPMI 8226 cell is unmodified. In another embodiment, the cell is a Raji cell and the TLR signaling is indicated by IL-6 or JTN-o2 expression, production or secretion. In yet another embodiment, the cell is a RAMOS cell and the TLR signaling is indicated by CD80 cell surface expression.
TLR signaling activity can be measured via a native readout or an artificial readout or both. A native readout is one that does not rely on introduction of a reporter construct into the cell of interest.
The cell line may be used in a modified or unmodified form. In one embodiment, the cell line is transfected with a reporter construct. The transfection may be transient or stable. The reporter construct generally comprises a promoter, a coding sequence and a polyadenylation signal. The coding sequence may comprise a reporter sequence selected from the group consisting of an enzyme (e.g., luciferase, alkaline phosphatase, β- galactosidase, chloramphenicol acetyltransferase (CAT), secreted alkaline phosphatase, etc.), a bioluminescence marker (e.g., green fluorescent protein (GFP, U.S. Patent No. 5,491,084), etc.), a surface-expressed molecule (e.g., CD25), a secreted molecule (e.g., IL-8, IL-12 p40, TNF-α, etc.), and other detectable protein sequences known to those of skill in the art. Preferably, the coding sequence encodes a protein, the level or activity of which can be quantified, with preferably a wide linear range.
In some embodiments, the promoter is a promoter that is responsive to TLR signaling pathways (i.e., a "TLR responsive promoter"), h some embodiments, the promoter contains a binding site for a transcription factor activated upon CpG nucleic acid exposure, such as for example NF-κB. In other embodiments, the promoter contains a binding site for a transcription factor that is activated by a positive reference compound other than CpG nucleic acids. The transcription factor binding site may be selected from the group consisting of a NF-κB binding site, an AP-1 binding site, a CRE, a SRE, an ISRE, a GAS, an ATF2 binding site, an IRF3 binding site, an I F7 binding site, an NFAT binding site, a p53 binding site, an SRF binding site, and a TARE, as well as others known to those of skill in the art.
In another embodiment, the promoter contains a functional promoter element from an IL-1 gene, an IL-6 gene, an IL-8 gene, an IL-10 gene, an IL-12 p40 gene, an JTN-αl gene, an D?N-o4 gene, an IFN-jS gene, an IFN-γ gene, a TNF-α gene, a TNF-β gene, an IP -9 gene, an IP-10 gene, a RANTES gene, an IT AC gene, a MCP-1 gene, an IGFBP4 gene, a CD54 gene, a CD69 gene, a CD71 gene, a CD80 gene, a CD86 gene, a HLA-DR gene, and a HLA class I gene.
The TLR responsive promoter may be a TLR1 responsive promoter, a TLR2 responsive promoter, a TLR3 responsive promoter, a TLR4 responsive promoter, a TLR5 responsive promoter, a TLR6 responsive promoter, a TLR7 responsive promoter, a TLR8 responsive promoter, a TLR9 responsive promoter, a TLR10 responsive promoter or a TLR11 responsive promoter.
In these latter embodiments, the cell line may be transfected with a reporter construct having a promoter derived from a particular cytokine, chemokine, or cell surface marker, and a unique reporter coding sequence conjugated thereto. In this way, the readout from a particular reporter construct is a surrogate readout for cytokine, chemokine, or cell surface marker readout. Measuring readout from the reporter coding sequences described herein is in some instances easier than measuring cytokine or chemokine secretion, or upregulation of a cell surface marker.
In these latter embodiments, the cell line may be transfected with a number of reporter constructs each having a promoter derived from a particular cytokine, chemokine, or cell surface marker, and a unique distinguishable coding sequence conjugated thereto. In these embodiments, multiple readouts are possible from one screen. In other embodiments, multiple native readouts are also possible from one screen.
In a related embodiment, the cell may be further transfected with a nucleic acid that codes for a TLR polypeptide or a fragment thereof. Preferably, the TLR is one that is not endogenously expressed by the cell. As an example, if the cell is an RPMI 8226 cell which has been shown to express TLR7 and TLR9 according to the invention, then it may be modified to express TLRs other than these (e.g., TLR8) in some embodiments. In this aspect, the RPMI 8226 cell is responsive to TLR8 ligands. In preferred embodiments, the TLR is a human TLR (i.e., hTLR). hi another aspect, the invention provides an RPMI 8226 cell transfected with a TLR nucleic acid. In still another embodiment, the TLR nucleic acid is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR8, TLR10 and TLR11. The encoded TLRs nucleic acids can derive from human or non-human sources. Examples of non-human sources include, but are not limited to, murine, bovine, canine, feline, ovine, porcine, and equine species. Other species include chicken and fish, e.g., aquaculture species. The TLR nucleic acids can also include chimeric sequences consisting of domains originating from different species. In preferred embodiments, the TLR is a human TLR.
In still another aspect, the invention provides kits including the cells lines (e.g., the RPMI 8226 cell line), the reporter constructs and/or expression constructs described above, and instructions for use.
Other aspects ofthe invention provide methods for analyzing the biological activity of individual lots of material containing previously identified specific TLR ligands (i.e., specific compounds which are ligands for a particular TLR) intended for use as, or for use in the preparation of, pharmaceutical compositions. The methods permit a qualitative and, importantly, a quantitative assessment of biological activity of individual lots of TLR ligands, pre-formulation as well as post-formulation. Such methods are useful in the manufacture and validation of pharmaceutical compositions containing, as an active agent, at least one specific ligand of at least one specific TLR. The specific TLR can be any known TLR, including without limitation TLR3, TLR7, TLR8 and TLR9. The specific TLR ligand is an isolated TLR ligand, either found in nature or synthetic (not found in nature), including in particular certain nucleic acid molecules and small molecules. Nucleic acid molecules that are specific TLR ligands include synthetic and nahirally-occurring oligonucleotides having specific base sequence motifs. Furthermore, specific TLR ligands include both agonists and antagonists of specific TLR.
These methods are to be distinguished from test procedures and acceptance criteria for new drug substances and new drug products which are classified as chemical substances. Unlike the afore-mentioned test procedures and acceptance criteria, the methods ofthe instant invention deal specifically with characterizing drug substances and drug products which are classified' as oligonucleotides. Oligonucleotides are explicitly excluded in ICH Topic Q6A Specifications: Test Procedures and Acceptance Criteria for New Drug Substances and New Drug Products: Chemical Substances, Step 4 - Consensus Guideline: 6 October 1999, § 1.3. Further still, the methods ofthe instant invention are to be distinguished from test procedures and acceptance criteria for biotechnological/biological products. Unlike the aforementioned test procedures and acceptance criteria, the methods ofthe invention deal specifically with characterizing biotechnological/biological products which are classified as DNA products. DNA products are explicitly excluded in ICH Harmonised Tripartite Guideline Specifications: Test Procedures and Acceptance Criteria for Biotechnological/Biological Products, Step 4 - 10 March 1999, § 1.3.
In one aspect, the invention provides a method for quality assessment of a test composition containing a known TLR ligand. The method according to this aspect ofthe invention involves measuring a reference activity of a reference composition comprising a known TLR ligand, wherein the known TLR ligand is a nucleic acid molecule; measuring a test activity of a test composition comprising the known TLR ligand; and comparing the test activity to the reference activity. In one embodiment the method further involves the step of selecting the test composition if the test activity falls within a predetermined range of variance about the reference activity.
In one embodiment, the reference composition is a first production lot of a pharmaceutical composition comprising the known TLR ligand, and the test composition is a second production lot of a pharmaceutical composition comprising the known TLR ligand. This embodiment is particularly useful as a method for developing and applying acceptance criteria for finished pharmaceutical products containing a known TLR ligand. fri another embodiment, the reference composition is a first in-process lot of a composition comprising the known TLR ligand, and the test composition is a second in-process lot of a composition comprising the known TLR ligand. This embodiment is particularly useful as a method for developing and applying acceptance criteria for raw materials and/or other in-process materials containing a known TLR ligand bound for use in a pharmaceutical product.
In one embodiment according to this aspect ofthe invention, measuring the reference activity involves contacting the reference composition with an isolated cell expressing a TLR responsive to the known TLR ligand, and measuring the test activity involves contacting the test composition with the isolated cell expressing the TLR responsive to the known TLR ligand. Further, in one embodiment the isolated cell expressing the TLR responsive to the known TLR ligand includes an expression vector for the TLR responsive to the known TLR ligand. Such expression vector, and likewise for any expression vector according to the instant invention, can be introduced into the cell using any suitable method. In one embodiment, the isolated cell expressing the TLR responsive to the known
TLR ligand naturally expresses the TLR responsive to the known TLR ligand. Such a cell can be naturally occurring or it can be a cell line, provided the cell does not include an expression vector introduced into the cell for the purpose of artificially inducing the cell to express or overexpress the TLR. In one particular embodiment, the isolated cell expressing the TLR responsive to the known TLR ligand is RPMI 8226. In another embodiment, the isolated cell expressing the TLR responsive to the known TLR ligand is Raji, RAMOS, Nairn, THP-1 or KG-1 and the TLR is TLR9. hi another embodiment, the isolated cell expressing the TLR responsive to the known TLR ligand is RPMI 8226, Raji or RAMOS and the TLR is TLR7. In yet another embodiment, the isolated cell expressing the TLR responsive to the known TLR ligand is a KG-1 cell, a Nairn cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, a Hep-2 cells, a A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell and the TLR is TLR3.
Further according to this aspect ofthe invention, in one embodiment measuring the reference activity and measuring the test activity each comprises measuring signaling activity mediated by a TLR responsive to the known TLR ligand. As described in greater detail elsewhere herein, TLR signaling involves a series of intracellular signaling events. These signaling events give rise to various downstream products, including certain transcription factors (e.g., NF-κB and AP-1), cytokines, chemokines, etc., which can affect the activity of certain gene promoters. For example, in one embodiment the signaling activity is activity of a reporter gene or reporter construct under the control of a NF-κB response element.
In other embodiments, the signaling activity is activity of a reporter gene or reporter construct under the control of an interferon-stimulated response element (ISRE); an IFN-α promoter; an IFN-β promoter; an IL-6 promoter; an IL-8 promoter; an IL-12 p40 promoter; a RANTES promoter; an IL-10 promoter or an IP-10 promoter.
In one embodiment, the known TLR ligand is an immunostimulatory nucleic acid. An immunostimulatory nucleic acid can include, without limitation, a CpG nucleic acid. In another embodiment, the known TLR ligand is an immunoinhibitory nucleic acid. When the known TLR ligand is a TLR antagonist (e.g., an immunoinhibitory oligonucleotide), the method according to this aspect ofthe invention can further involve measuring the reference activity ofthe reference composition and measuring the test activity ofthe test composition, each performed in the presence of a known immunostimulatory TLR ligand. In various embodiments, the known TLR ligand is a ligand for a particular TLR. Thus in one embodiment the known TLR ligand is a TLR9 ligand. More specifically, in one embodiment the known TLR ligand is a CpG nucleic acid. h one embodiment, the known TLR ligand is a TLR3 ligand. Such a ligand can include, for example, a double-stranded RNA or a homolog thereof. In one embodiment, the known TLR ligand is a TLR7 ligand. In one embodiment the known TLR ligand is a TLR8 ligand.
The invention provides in another aspect a method for quality assessment of a test lot of a pharmaceutical product containing a known TLR9 ligand. The method according to this aspect ofthe invention involves measuring a reference activity of a reference lot of a pharmaceutical product comprising a known TLR9 ligand, wherein the known TLR9 ligand is a nucleic acid molecule; measuring a test activity of a test lot of a pharmaceutical product comprising the known TLR9 ligand; comparing the test activity to the reference activity; and rejecting the test lot if the test activity falls outside of a predetermined range of variance about the reference activity. hi one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TGT CGT TTT GTC GTT-3' (SEQ ID NO:l). In one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TGA CGT TTT GTC GTT-3* (SEQ ED NO:139).
In one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TGT CGT TTT TTT CGA-3' (SEQ ID NO: 140). h one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5*-TCG TCG TTT CGT CGT TTC GTC GTT-3' (SEQ ID NO: 141). hi one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT CGT CGT TTT GTC GTT-3' (SEQ ID NO: 142).
In one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TTC GGT CGT TTT-3' (SEQ ID NO:143).
In one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TTC GTG CGT TTT T-3' (SEQ ID NO: 144).
In one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TCG TTT TCG GCG GCC GCC G-3* (SEQ ID NO: 145). hi one embodiment according to this aspect ofthe invention, the known TLR9 ligand is an oligonucleotide having a base sequence provided by 5'-TCG TC_G TTT TAC_GGC GCC_GTG CCG-3' (SEQ ID NO: 146), wherein every internucleoside linkage is phosphorothioate except for those indicated by "__", which are phosphodiester.
Each ofthe limitations ofthe invention can encompass various embodiments ofthe invention. It is, therefore, anticipated that each ofthe limitations ofthe invention involving any one element or combinations of elements can be included in each aspect ofthe invention.
Brief Description of the Figures Fig. 1 is a bar graph showing cell surface expression of various markers by RPMI 8226 24 hours and 48 hours following stimulation with CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), LPS and IL-1.
Fig. 2 is a bar graph showing IL-8 production by RPMI 822624 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
Fig. 3 is a bar graph showing IL-6 production by RPMI 8226 24 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS. Fig. 4 is a bar graph showing IP-10 production by RPMI 8226 24 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
Fig. 5 is a bar graph showing IL-10 production by RPMI 822624 hours after exposure to CpG nucleic acid (SEQ ID NO: 1), non-CpG nucleic acid (SEQ ID NO: 2), R-848 and LPS.
Fig. 6 is a dose response curve showing fold induction of IL-8 production 24 hours after exposure to CpG nucleic acid (SEQ ID NO: 1) and non-CpG nucleic acid (SEQ ID NO: 2). The EC50 for CpG nucleic acid is 19 nM and the EC50 for non-CpG nucleic acid is 263 nM. Fig. 7 is a bar graph showing NF-κB activation in RPMI 8226 transfected transiently with a NF-κB-luciferase reporter gene construct as a function of cell density and nucleic acid amount transfected, following exposure to CpG nucleic acid (SEQ ID NO: 1), LPS and TNF-α. NF-κB activation is measured by luciferase activity.
Fig. 8 is a bar graph showing RT-PCR results from RNA isolated from RPMI 8226 using gene specific primers for TLR7, TLR8 and TLR9 genes.
Fig. 9 is a dose response curve showing IP-10 production induced by SEQ ID NO: 1, and inhibition thereof in the presence of SEQ HD NO: 151, a immunoinhibitory nucleic acid.
Fig. 10 is a bar graph showing the results of a TLR9 RT-PCR analysis of a number of cell lines. Fig. 11 is a bar graph showing the results of a TLR7 RT-PCR analysis of a number of cell lines.
Fig. 12 is a bar graph showing the results of a TLR3 RT-PCR analysis of a number of cell lines. Fig. 13 is a bar graph showing the results of a TLR3, TLR7, TLR8 and TLR9 RT-PCR analysis ofthe Raji cell line.
Fig. 14 is a graph showing IL-6 production by the Raji cell line upon stimulation with various ODN (SEQ ID NO:l; SEQ ID NO:154; SEQ ID NO:158; SEQ ID NO:160; SEQ ID NO:159; SEQ ID NO:161).
Fig. 15 is a bar graph showing IL-6 production ofthe Raji cell line upon stimulation with poly I:C and R-848.
Fig. 16 is a bar graph showing D?N-α2 production by the Raji cell line upon stimulation with CpG ODN (SEQ ID NO: 1), R-848 and poly I:C. Fig. 17 is a bar graph showing CD80 expression (by flow cytometry) by the RAMOS cell line upon stimulation with CpG ODN (SEQ ID NO: 1) and non-CpG ODN (SEQ ID NO: 2).
Fig. 18A is a bar graph showing the induction of NF-κB by 293 fibroblast cells transfected with human TLR9 in response to exposure to various stimuli, including CpG- ODN, GpC-ODN, LPS, and medium.
Fig. 18B is a bar graph showing the amount of IL-8 produced by 293 fibroblast cells transfected with human TLR9 in response to exposure to various stimuli, including CpG- ODN, GpC-ODN, LPS, and medium.
Fig. 19 is a bar graph showing the induction of NF-κB-luc produced by stably transfected 293-mTLR9 cells in response to exposure to various stimuli, including CpG-ODN, methylated CpG-ODN (Me-CpG-ODN), GpC-ODN, LPS and medium.
Fig. 20 is a bar graph showing the induction of NF-κB-luc produced by stably transfected 293-hTLR9 cells in response to exposure to various stimuli, including CpG-ODN, methylated CpG-ODN (Me-CpG-ODN), GpC-ODN, LPS and medium. Fig. 21 is a series of gel images depicting the results of reverse transcriptase- polymerase chain reaction (RT-PCR) assays for murine TLR9 (mTLR9), human TLR9 (hTLR9), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) in untransfected control 293 cells, 293 cells transfected with mTLR9 (293-mTLR9), and 293 cells transfected with hTLR9 (293-hTLR9).
It is to be understood that the Figures are not required for enablement ofthe invention.
Brief Description of Sequences SEQ ID NO:l is the nucleotide sequence of an immunostimulatory nucleic acid (TLR9 ligand).
SEQ ID NO:2 is the nucleotide sequence of a non-CpG nucleic acid.
SEQ ID NO:3 is the nucleotide sequence of human TLR2 cDNA (U88878). SEQ ID NO:4 is the amino acid sequence of human TLR2 protein (AAC34133).
SEQ ID NO:5 is the nucleotide sequence of murine TLR2 cDNA (AF165189).
SEQ ID NO:6 is the amino acid sequence of murine TLR2 protein (NP_036035).
SEQ ID NO:7 is the nucleotide sequence of human TLR3 cDNA (NM_003265).
SEQ ID NO:8 is the amino acid sequence of human TLR3 protein (NP_003256). SEQ ID NO:9 is the nucleotide sequence of murine TLR3 cDNA (AF355152).
SEQ ID NO:10 is the amino acid sequence of murine TLR3 protein (AAK26117).
SEQ ID NO:l 1 is the nucleotide sequence of human TLR4 cDNA (U88880).
SEQ ID NO: 12 is the nucleotide sequence of human TLR4 cDNA transcript variant 4 (NM_138557). SEQ ID NO: 13 is the nucleotide sequence of human TLR4 cDNA transcript variant 2
(NM 38556).
SEQ ID NO: 14 is the nucleotide sequence of human TLR4 cDNA transcript variant 1 (NM 38554).
SEQ ID NO: 15 is the nucleotide sequence of human TLR4 cDNA transcript variant 3 (NM_003266).
SEQ ID NO: 16 is the amino acid sequence of human TLR4 protein isoform A (NP_612564).
SEQ ID NO: 17 is the amino acid sequence of human TLR4 protein isoform B (NP_612566). SEQ ID NO: 18 is the amino acid sequence of human TLR4 protein isoform C
(NP_003257).
SEQ ID NO: 19 is the amino acid sequence of human TLR4 protein isoform D (NP_612567).
SEQ ID NO:20 is the nucleotide sequence of murine TLR4 cDNA (NM_021297). SEQ ID NO:21 is the nucleotide sequence of murine TLR4 mRNA (AFl 85285).
SEQ ID NO:22 is the nucleotide sequence of murine TLR4 mRNA (AFl 10133).
SEQ ID NO:23 is the amino acid sequence of murine TLR4 protein (AAD29272).
SEQ ID NO:24 is the amino acid sequence of murine TLR4 protein (AAF04278). SEQ ID NO:25 is the nucleotide sequence of human TLR5 cDNA (AB060695).
SEQ ID NO:26 is the amino acid sequence of human TLR5 protein (BAB43558).
SEQ ID NO:27 is the amino acid sequence of human TLR5 protein (O60602).
SEQ ID NO:28 is the amino acid sequence of human TLR5 protein (AAC34136). SEQ ID NO:29 is the nucleotide sequence of murine TLR5 cDNA (AF186107).
SEQ ID NO:30 is the amino acid sequence of murine TLR5 protein (AAF65625).
SEQ ID NO:31 is the nucleotide sequence of human TLR7 cDNA (AF240467).
SEQ ID NO:32 is the nucleotide sequence of human TLR7 cDNA (AF245702).
SEQ ID NO:33 is the nucleotide sequence of human TLR7 cDNA (NM_016562). SEQ ID NO:34 is the amino acid sequence of human TLR7 protein (AAF60188).
SEQ ID NO:35 is the amino acid sequence of human TLR7 protein (AAF78035).
SEQ ID NO:36 is the amino acid sequence of human TLR7 protein (NP_057646).
SEQ ID NO:37 is the amino acid sequence of human TLR7 protein (Q9NYK1).
SEQ ID NO:38 is the nucleotide sequence of murine TLR7 cDNA (AY035889). SEQ ID NO:39 is the nucleotide sequence of murine TLR7 splice variant
(NM 33211).
SEQ ID NO:40 is the nucleotide sequence of murine TLR7 splice variant (AF334942).
SEQ ID NO:41 is the amino acid sequence of murine TLR7 protein (AAK62676).
SEQ ID NO:42 is the amino acid sequence of murine TLR7 protein (AAL73191). SEQ ID NO:43 is the amino acid sequence of murine TLR7 protein (AAL73192).
SEQ ID NO:44 is the amino acid sequence of murine TLR7 protein (NP_573474).
SEQ ID NO:45 is the amino acid sequence of murine TLR7 protein (P58681).
SEQ ID NO:46 is the nucleotide sequence of human TLR8 cDNA (AF245703).
SEQ ID NO:47 is the nucleotide sequence of human TLR8 cDNA (AF246971). SEQ ID NO:48 is the nucleotide sequence of human TLR8 cDNA (NM_138636).
SEQ ID NO:49 is the nucleotide sequence of human TLR8 cDNA (NM_016610).
SEQ ID NO:50 is the amino acid sequence of human TLR8 protein (AAF78036).
SEQ ID NO: 51 is the amino acid sequence of human TLR8 protein (AAF64061).
SEQ ID NO:52 is the amino acid sequence of human TLR8 protein (Q9NR97). SEQ ID NO:53 is the amino acid sequence of human TLR8 protein (NP_619542).
SEQ ID NO:54 is the amino acid sequence of human TLR8 protein (NP_057694).
SEQ ID NO:55 is the nucleotide sequence of murine TLR8 cDNA (AY035890).
SEQ ID NO:56 is the nucleotide sequence of murine TLR8 cDNA (NM_133212). SEQ ID NO:57 is the amino acid sequence of murine TLR8 protein (AAK62677). SEQ ID NO:58 is the amino acid sequence of murine TLR8 protein (NP_573475). SEQ ID NO:59 is the amino acid sequence of murine TLR8 protein (P58682). SEQ ID NO:60 is the nucleotide sequence of human TLR9 cDNA (AF245704). SEQ ID NO:61 is the nucleotide sequence of human TLR9 cDNA (AB045180). SEQ ID NO:62 is the amino acid sequence of human TLR9 protein (AAF78037). SEQ ID NO:63 is the amino acid sequence of human TLR9 protein (AAF72189). SEQ ID NO:64 is the amino acid sequence of human TLR9 protein (AAG01734). SEQ ID O:65 is the amino acid sequence of human TLR9 protein (AAG01735). SEQ ID NO:66 is the amino acid sequence of human TLR9 protein (AAG01736). SEQ ID NO:67 is the amino acid sequence of human TLR9 protein (BAB 19259). SEQ ID NO:68 is the nucleotide sequence of murine TLR9 cDNA (AF348140). SEQ ID NO:69 is the nucleotide sequence of murine TLR9 cDNA (AB045181). SEQ ID NO:70 is the nucleotide sequence of murine TLR9 cDNA (AF314224). SEQ ID NO:71 is the nucleotide sequence of murine TLR9 cDNA (NM_031178). SEQ ID NO:72 is the amino acid sequence of murine TLR9 protein (AAK29625). SEQ ID NO:73 is the amino acid sequence of murine TLR9 protein (AAK28488). SEQ ID NO:74 is the amino acid sequence of murine TLR9 protein (BAB19260). SEQ ID NO:75 is the amino acid sequence of murine TLR9 protein (NP_112455). SEQ ID NO:76 is the nucleotide sequence of human TLR10 cDNA (AF296673). SEQ ID NO:77 is the amino acid sequence of human TLR10 protein (AAK26744). SEQ ID NO:78 is the nucleotide sequence of human TLR6 cDNA (AB020807). SEQ ID NO:79 is the nucleotide sequence of human TLR6 mRNA (NM_006068). SEQ ID NO:80 is the amino acid sequence of human TLR6 protein (BAA78631). SEQ I NO:81 is the amino acid sequence of human TLR6 protein (NP_006059). SEQ ID NO:82 is the amino acid sequence of human TLR6 protein (Q9Y2C9). SEQ ID NO:83 is the nucleotide sequence of murine TLR6 cDNA (AB020808). SEQ ID NO:84 is the nucleotide sequence of murine TLR6 cDNA (NM_011604). SEQ ID NO:85 is the nucleotide sequence of murine TLR6 cDNA (AF314636). SEQ ID NO:86 is the amino acid sequence of murine TLR6 protein (BAA78632). SEQ ID NO:87 is the amino acid sequence of murine TLR6 protein (AAG38563). SEQ ID NO:88 is the amino acid sequence of murine TLR6 protein (NP_035734). SEQ ID NO:89 is the amino acid sequence of murine TLR6 protein (Q9EPW9). SEQ ID NO:90 is the nucleotide sequence of a consensus sequence for NF-κB p50 subunit.
SEQ ID NO:91 is the nucleotide sequence of a consensus sequence for NF-κB p65 subunit.
SEQ ID NO: 92 is the nucleotide sequence of an example of an F-κB p65 subunit binding site.
SEQ ID NO:93 is the nucleotide sequence of an example of a murine CREB binding site.
SEQ ID NO: 94 is the nucleotide sequence of an example of a murine AP-1 binding site.
SEQ ID NO:95 is the nucleotide sequence of an example of a murine AP-1 binding site.
SEQ ID NO:96 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO:97 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO:98 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO: 99 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO: 100 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO:101 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO: 102 is the nucleotide sequence of an example of an ISRE.
SEQ ID NO: 103 is the nucleotide sequence of an example of an SRE.
SEQ ID NO: 104 is the nucleotide sequence of an example of an SRE.
SEQ ID NO: 105 is the nucleotide sequence of an example of an SRE.
SEQ ID NO: 106 is the nucleotide sequence of an example of an NF AT binding site.
SEQ ID NO: 107 is the nucleotide sequence of an example of an NF AT binding site.
SEQ ID NO: 108 is the nucleotide sequence of an example of an NF AT binding site.
SEQ ID NO: 109 is the nucleotide sequence of an example of an NFAT binding site.
SEQ ID NO:l 10 is the nucleotide sequence of an example of a GAS.
SEQ ID NO: 111 is the nucleotide sequence of a p53 binding site consensus sequence.
SEQ ID NO: 112 is the nucleotide sequence of an example of ap53 binding site.
SEQ ID NO:l 13 is the nucleotide sequence of an example of a p53 binding site.
SEQ ID NO: 114 is the nucleotide sequence of an example of ap53 binding site.
SEQ ID NO:115 is the nucleotide sequence of an example of ap53 binding site.
SEQ ID NO:l 16 is the nucleotide sequence of an example of a p53 binding site. SEQ ID NO: 117 is the nucleotide sequence of an example of ap53 binding site.
SEQ ID NO: 118 is the nucleotide sequence of an example of a TARE (TNF-α response element).
SEQ TD NO: 119 is the nucleotide sequence of an example of an SRF binding site. SEQ ID NO: 120 is the nucleotide sequence of an example of an SRF binding site.
SEQ ID NO: 121 is the nucleotide sequence ofthe -620 to +50 promoter region of IFN-α4.
SEQ ID NO: 122 is the nucleotide sequence ofthe -140 to +9 promoter region of IFN- αl. SEQ ID NO: 123 is the nucleotide sequence ofthe -140 to +9 promoter region of IFN- αl (point mutation, AL353732).
SEQ ID NO: 124 is the nucleotide sequence ofthe -280 to +20 promoter region of IFN-/3.
SEQ ID NO: 125 is the nucleotide sequence ofthe -397 to +5 promoter region of human RANTES (AB023652).
SEQ ID NO:126 is the nucleotide sequence ofthe -751 to +30 promoter region of human IL-12 p40.
SEQ ID NO: 127 is the nucleotide sequence ofthe -250 to +30 promoter region of human IL-12 p40. SEQ ID NO: 128 is the nucleotide sequence ofthe -288 to +7 promoter region of human IL-6.
SEQ ID NO: 129 is the nucleotide sequence ofthe IL-6 gene promoter from -1174 to +7 (M22111).
SEQ ID NO: 130 is the nucleotide sequence ofthe -734 to +44 promoter region derived from human IL-8.
SEQ ID NO: 131 is the nucleotide sequence ofthe -162 to 44 promoter region of human IL-8.
SEQ ID NO:132 is the nucleotide sequence ofthe -615 to +30 promoter region of human TNF-α. SEQ ID NO : 133 is the nucleotide sequence of a promoter region of human TNF-/3.
SEQ ID NO: 134 is the nucleotide sequence ofthe -875 to +97 promoter region of human IP-10. SEQ ID NO: 135 is the nucleotide sequence of the -219 to +114 promoter region of human CXCL11 (DP-9).
SEQ ID NO: 136 is the nucleotide sequence ofthe full length promoter region of human CXCL11 (IP-9). SEQ ID NO: 137 is the nucleotide sequence ofthe -289 to +217 promoter region of
IGFBP4 (Insulin growth factor binding protein 4).
SEQ ID NO: 138 is the nucleotide sequence ofthe full length promoter region of IGFBP4.
SEQ ID NO: 139 is the nucleotide sequence of an immunostimulatory nucleic acid. SEQ ID NO: 140 is the nucleotide sequence of an immunostimulatory nucleic acid.
SEQ ID NO:141 is the nucleotide sequence of an immunostimulatory nucleic acid.
SEQ ID NO: 142 is the nucleotide sequence of an immunostimulatory nucleic acid.
SEQ ID NO: 143 is the nucleotide sequence of an immunostimulatory nucleic acid.
SEQ ID NO:144 is the nucleotide sequence of an immunostimulatory nucleic acid. SEQ ID NO: 145 is the nucleotide sequence of an immunostimulatory nucleic acid.
SEQ ID NO: 146 is the nucleotide sequence of an irnmunostimulatory nucleic acid.
SEQ ID NO: 147 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
SEQ ID NO: 148 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
SEQ ID NO: 149 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid.
, SEQ ID NO: 150 is the nucleotide sequence of an immunostimulatory methylated CpG nucleic acid. SEQ ID NO: 151 is the nucleotide sequence of an immunoinhibitory nucleic acid.
SEQ ID NO: 152 is the nucleotide sequence of a sense primer for human TLR3. SEQ ID NO: 153 is the nucleotide sequence of an antisense primer for human TLR3. SEQ ID NO: 154 is the nucleotide sequence of a GpC nucleic acid. SEQ ID NO: 155 is the nucleotide sequence of a CpG ODN. SEQ ID NO: 156 is the nucleotide sequence of a GpC ODN.
SEQ ID NO: 157 is the nucleotide sequence of a Me-CpG ODN. SEQ ID NO: 158 is the nucleotide sequence of a TLR9 ligand. SEQ ID NO: 159 is the nucleotide sequence of a TLR9 ligand. SEQ ID NO: 160 is the nucleotide sequence of a TLR9 ligand. SEQ ID NO: 161 is the nucleotide sequence of a TLR9 ligand.
Detailed Description of the Invention In its broadest sense, the invention relates to screening methods and tools to be used to identify and discriminate between newly discovered immunomodulatory molecules and to compare and standardize compositions of known immunomodulatory molecules. The immunomodulatory molecules are preferably TLR ligands.
Thus, the invention is based in part on the discovery that cell lines expressing endogenous TLR respond to TLR ligands in a manner similar to the response of peripheral blood mononuclear cells (PBMC). PBMC respond to immunomodulatory TLR ligands by modulating one or more parameters including gene expression, cell surface marker expression, cytokine and/or chemokine production and secretion, cell cycle status, phosphorylation status, and the like. TLR ligands can be categorized and distinguished based on the cellular changes they induce (i.e., their induction profiles). The ability of a TLR ligand to provide therapeutic or prophylactic benefit to a subject depends on its induction profile. The ability to screen new TLR ligands for a panel of response indicators or parameters allows for rapid discrimination and categorization of TLR ligands. Moreover, the similarity between the cell line responses and those observed after in vivo administration ofthe TLR ligand indicates that the cell lines are suitable predictors of in vivo activity. The use of in vitro propagated cell lines additionally overcomes the variability encountered when using freshly isolated PBMC.
The TLR ligands identified according to the invention therefore can be used therapeutically or prophylactically in a more patient- or disorder-specific manner. The invention allows for the tailoring of TLR ligands for particular patients or disorders.
The invention identifies a number of cell lines that can be used to identify TLR ligands based on endogenous TLR expression such as TLR3, TLR7 and TLR9 expression. As an example, the invention is premised in part on the discovery of TLR9 expression in a number of cell lines including RPMI 8226, Raji, RAMOS, THP-1, Nalm-6 and KG-1. Cell lines RPMI 8226, Raji and RAMOS have been determined to express TLR7 according to the invention. Cell lines KG-1 cell, a Nairn cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, a Hep-2 cells, a A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell have been discovered to express TLR3 according to the invention. It is further premised in part on the discovery that RPMI 8226 cells respond to the imidazoquinoline compound R-848. Consistent with this latter finding, it was also discovered that RPMI 8226 cells express TLR7.
The invention in other aspects provides for screening methods and tools for verifying and standardizing compositions containing known TLR ligands. These compositions may be for example commercial production lots to be used in a clinical setting. Accordingly, the invention provides methods for standardizing lots of known TLR ligands prior to distribution and use clinically. In this way, production processes can be observed and controlled and substandard production lots can be identified and eliminated prior to shipment.
The methods ofthe instant invention can be used at any step in the preparation and production of clinical material, i.e., pharmaceutical product. In particular, the methods will find use in characterizing or validating raw materials, in-process materials, finished product materials (e.g., pre-release materials), and post-production materials (e.g., post-release materials). The methods can also be used to validate existing process methods, as well as to validate new or changed process methods used in the production ofthe pharmaceutical product.
Screening Assays Generally
The screening assays provided herein may be used to identify immunomodulatory agents. Immunomodulatory agents are agents that either stimulate or inhibit immune responses in a subject. Accordingly, as used herein, immunomodulation embraces both immunostimulation and immunoinhibition. The screening methods are used to identify TLR agonists and antagonists. The methods can also be used to identify compounds that enhance the immunostimulation induced by a TLR agonist. This latter set of compounds is referred to herein as "enhancers". A TLR agonist is a compound that stimulates TLR signaling activity. A TLR antagonist is a compound that inhibits TLR signaling activity. Agonists are generally referred to herein as immunostimulatory compounds because stimulation of TLR is associated with immune stimulation. Antagonists are generally referred to herein as immunoinhibitory compounds because inhibition of TLR is associated with immune inhibition. TLR antagonists include compounds that reduce (or eliminate completely) the immunostimulation induced by a TLR agonist. h some embodiments, the agonists, antagonists and enhancers are TLR ligands (i.e., they bind to a TLR). In other embodiments, the test compounds with agonist, antagonist or enhancer activity may act downstream or upstream ofthe TLR-TLR ligand interaction.
An "immunostimulatory compound" as used herein refers to a natural or synthetic compound that characteristically induces a TLR-mediated response when contacted with a suitable functional TLR polypeptide. In one embodiment the immunostimulatory compound is a natural or synthetic compound that induces a TLR-mediated response when contacted with a cell that naturally or artificially expresses a suitable functional TLR polypeptide. Depending on the aspect ofthe invention, the cell may be an experimental cell or a primary cell such as a PBMC.
Examples of immunostimulatory compounds include the following immunostimulatory nucleic acids, which are discussed in further detail below: 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO: 1)
5'-TCGTCGTTTTGACGTTTTGTCGTT-3' (SEQ ID NO:139) 5'-TCGTCGTTTTGTCGTTTTTTTCGA-3' (SEQ ID NO: 140)
5'-TCGTCGTTTCGTCGTTTCGTCGTT-3' (SEQ ID NO: 141)
5'-TCGTCGTTTCGTCGTTTTGTCGTT-3' (SEQ ID NO: 142)
5'-TCGTCGTTTTTCGGTCGTTTT-3' (SEQ ID NO: 143)
5*-TCGTCGTTTTTCGTGCGTTTTT-3' (SEQ ID NO: 144) 5'-TCGTCGTTTTCGGCGGCCGCCG-3' (SEQ ID NO: 145)
5'-TCGTC_GTTTTAC_GGCGCC_GTGCCG-3' (SEQ ID NO: 146)
Imidazoquinolines are immune response modifiers thought to induce expression of several cytokines including interferons (e.g., IFN-α and IFN-|S), TNF-α and some interleukins (e.g., IL-1, IL-6 and IL-12) as well as chemokines (e.g., IP-10 and IL-8). Imidazoquinolines are capable of stimulating a Thl immune response, as evidenced in part by their ability to induce increases in IgG2a levels. Imidazoquinoline agents reportedly are also capable of inhibiting production of Th2 cytokines such as IL-4, IL-5, and IL-13. Some ofthe cytokines induced by imidazoquinolines are produced by macrophages and dendritic cells. Some species of imidazoquinolines have been reported to increase NK cell lytic activity and to stimulate B cells proliferation and differentiation, thereby inducing antibody production and secretion. Imidazoquinoline mimics can also be tested using the screening methods. An "immunoinhibitory compound" as used herein refers to a natural or synthetic compound that characteristically inhibits a TLR-mediated response when contacted with a suitable functional TLR polypeptide. hi one embodiment the immunoinhibitory compound is a natural or synthetic compound that inhibits a TLR-mediated response when contacted with a cell that naturally or artificially expresses a suitable functional TLR polypeptide.
In addition to the immunoinhibitory nucleic acids disclosed elsewhere herein, immunoinhibitory compounds and TLR antagonists encompass certain small molecules (chloroquine, qμinacrine, 9-aminoacridines and 4-aminoquinolines, and derivatives thereof) described by Macfarlane and colleagues in U.S. Pat. 6,221,882; U.S. Pat. 6,399,630; U.S. Pat. 6,479,504; U.S. Pat. 6,521,637; and published U.S. Pat. application 2002/0151564, the contents of all of which are hereby incoφorated by reference in their entirety.
The invention provides in part methods and tools that utilize cell lines, in modified or unmodified form, as surrogates for PBMC. hnmunomodulation by TLR ligands can be assessed using one or preferably more parameters including but not limited to cytokine and chemokine secretion, upregulation of cell surface markers, changes in cell proliferation, phosphorylation changes, and the like. These parameters may be native readouts or artificial readouts as described herein.
The cellular response to immunostimulatory nucleic acids by the cell lines described herein (e.g., RPMI 8226, Raji, RAMOS, and the like) so resembles that of PBMC that these cells can be used to identify and differentiate between immunomodulatory compounds based on the extent ofthe induced response and the particular profile of that response. The invention provides a number of cell lines each with a particular endogenous TLR expression profile, as described herein.
The cell lines can be used to identify immunomodulatory compounds with particular response profiles. As an example, the cell lines can be used to identify molecules that are mimics to known TLR ligands. The cell lines can also be used to identify TLR ligands that trigger some but not necessarily all ofthe responses induced by known TLR ligands. For example, the cell line can be used to distinguish between compounds based on individual or group cytokine or chemokine secretion, or based on upregulation of one, a subset or all cell surface markers. As an example, in some therapeutic instances, it may be desirable to use a compound that induces the secretion of relatively high levels of chemokine such as IP-10, yet induces only relatively low levels of one or more other factors. The screening methods ofthe invention allow for the identification of such a compound with this type of induction profile. It is to be understood that the screening method also can be used to determine effective amounts of known and newly identified immunomodulatory compounds. For example, the EC50 value of a TLR ligand for the production of a particular cytokine or chemokine can be determined, thereby facilitating comparison between different nucleic acids. Generally, these assays require the incubation of cells with a reference compound and a test compound, and an analysis ofthe readout. Depending on the embodiment, the same cells are exposed to the reference compound and the test compound. An example of this latter embodiment is a screening assay for compounds that enhance the immunostimulatory effects of a TLR agonist. Another example is a screening assay for compounds that inhibit the immunostimulatory effects of a TLR agonist. In both examples, the reference compound is a positive reference compound (i.e., it is itself immunostimulatory).
In other embodiments, particularly those directed at identifying immunostimulatory compounds, separate aliquots from the same cell line (or from the same freshly harvested cell population) are exposed to either the reference compound or the test compound, and the readouts from each are measured and compared to the other. If the reference compound is a negative reference compound (i.e., it is inert and neither immunostimulatory nor immunoinhibitory), then any test level that is greater than the reference level is indicative of a test compound that has at least some immunostimulatory capacity. Generally, the negative reference compound is used to set background levels of immunostimulation or in munoinhibition observed in the absence ofthe test compound. If the reference compound is a positive reference compound (i.e., it is immunostimulatory), then it is possible to compare and contrast the induction profile ofthe test compound to that ofthe reference compound.
In some instances, separate reference assays individually containing a positive and a negative reference compound are performed alongside the test assay. For example, if the test assay is a screen for an immunostimulatory TLR ligand, then reference assays can be a positive reference assay (in which the reference compound is immunostimulatory), a negative reference assay (in which the reference compounds is immunologically inert or neutral), or both. A test compound is defined as immunostimulatory if it induces a response greater than that ofthe negative reference compound. The level and profile ofthe immunostimulatory response can be compared to the level and profile induced by the positive reference compound. It is to be understood that a test compound that induces a level of immunostimulation less than that ofthe positive reference compound may still be considered immunostimulatory according to the invention. Modifications to these screening assays for a desired readout will be apparent to those of ordinary skill in the are based on the teachings provided herein.
If the test assay is a screen for an immunoinhibitory TLR ligand, then the assay may generally involve co-incubation ofthe test compound and a positive reference compound. The control assay may include co-incubation ofthe negative and positive reference compounds. As used herein, co-incubation embraces simultaneous or consecutive addition of the reference and test compounds. The test compound may be added before or after the positive reference compound. An immunoinhibitory test compound may be identified by a diminution ofthe immunostimulatory response induced by the positive reference compound when in the presence ofthe test compound. If the level ofthe response is less in the presence ofthe test compound, this indicates that the test compound is capable of interfering with the immunostimulatory effects ofthe positive reference compound. As an example, simultaneous or consecutive addition of a putative immunoinhibitory test compound can reduce the amount of cytokines or chemokines secreted by cells in response to the positive reference compound alone, indicating an inhibition of the immunostimulatory effects of the positive reference compound.
The reference immunoinhibitory compound can be used at one or more concentrations in conjunction with a selected or constant concentration of reference immunostimulatory compound. Under proper conditions, the immunostimulatory effect ofthe reference immunostimulatory compound will be less in the presence ofthe immunoinhibitory substance than in the absence ofthe immunoinhibitory substance. Furthermore, under proper conditions, the immunostimulatory effect ofthe reference immunostimulatory compound will decrease with increasing concentration ofthe immunoinhibitory substance.
The breadth of response by the cell line to immunomodulatory compounds, and its facile manipulation, allows for the identification of novel compounds. The cell line allows the rapid discovery of such compounds given that is lends itself to high throughput screening methods such as those provided herein. These methods and compositions are described in greater detail below. The invention therefore provides screening methods that utilize cell lines that either endogenous express TLRs such as the RPMI 8226 cell line as well as cell lines that have been modified to express TLRs. The invention further provides compositions that comprise such cell lines.
The verification and standardization methods ofthe invention generally involve assays in which an isolated cell expressing a functional TLR is contacted with each of two compositions, each composition containing a known ligand for the TLR. One composition is a reference composition, and the assay using the reference composition yields a reference activity. The second composition is a test composition, and the assay using the test composition yields a test activity. The two contacting steps can be performed on separate cells that are alike, and typically will be performed on separate populations of cells that are alike. For example, the separate cells or the separate populations of cells can be drawn from a single population of cells, hi typical usage according to this embodiment, the reference and test activities are measured essentially concurrently, although the use of historical reference activity is also contemplated by the methods ofthe invention. As an alternative, the two contacting steps can be performed on a single cell or on a single population of cells, usually in an essentially concurrent manner when it is desirable to have competition between reference and test compositions, hi one embodiment the known TLR ligand is a nucleic acid molecule.
The assays ofthe invention are performed under specific conditions so that comparison can be made between reference and test activities or levels. The results ofthe comparison can be used as a basis upon which to accept or reject the test material as suitable for its intended use.
The biological characterization ofthe reference composition will generally entail a series of biological activity measurements ofthe reference composition using a single assay under defined conditions in order to define a range of inter-test variance. The range of inter- test variance so obtained using reference composition can be used to define an acceptable range of variance within which a subsequent test measurement must fall in order to satisfy quality standards. Such a range of acceptable variance can serve as a basis for developing predetermined range of variance about the reference activity, i.e., acceptance criteria for a particular test composition or test lot. For example, a particular reference composition can be assayed under defined conditions in a number of independent measurements and found to yield a result expressed as 100 ± 5 units of activity. Under this same example, a subsequent test measurement of a test composition performed using the same assay and defined conditions is found to yield 97 units of activity. The activity ofthe test composition under this example thus yielded a result that falls within the normal range of inter-test variance observed for the reference composition. Accordingly, the test material under this example could be selected on the basis ofthe test activity falling within a predetermined range of variance about the reference activity. In short, the test material can be deemed acceptable provided the test activity falls within a predetermined range of activity that is related to the activity ofthe reference material.
In one embodiment, the methods ofthe invention provide for comparison between a reference lot of a particular TLR ligand and a test lot ofthe same particular TLR ligand. Such comparison is useful for quality control assessment ofthe test lot of material, also referred to herein as validation, e.g., product validation. Such comparison is also useful for process validation.
In another embodiment, the methods ofthe invention provide for comparison between a reference lot of a particular TLR ligand and a test lot of a different TLR ligand. In a simple example, where a test TLR ligand (T) is expected to have little or no activity characteristic of reference TLR ligand (R), comparison can be made between T and R to confirm the lack of R-like activity possessed by T. In a more complex example, where a test TLR ligand (C) is capable of exerting two different effects, wherein each effect is characteristic of one of two different classes of TLR ligand and is best characterized by one of two different reference TLR ligands (A and B), the test TLR ligand (C) can be compared with either ofthe two reference TLR ligands (A or B). In this second example, test composition C could be found, for example, to possess 50 percent A-like activity compared with reference A and 70 percent B-like activity compared with reference B. Test composition C could thus independently meet or fail to meet predetermined standards for each of A-like activity and B-like activity. Such comparison is also useful for quality control assessment ofthe test lot of material, e.g., product validation. Of course test TLR ligand C can alternatively or additionally be compared against reference TLR ligand C, as described in the preceding paragraph.
To facilitate the methods ofthe invention, certain conditions for carrying out the assays are standardized and used for measurements of both reference activity and test activity. In this way direct comparison between reference activity and test activity can be made readily. Conditions that can be standardized and used in this manner can include, without limitation, readout, temperature, media characteristics, duration (time between introduction of reference composition or test composition and activity measurement), methods of sampling, etc. In some embodiments the methods ofthe invention can be at least partially automated in order to increase throughput and/or to reduce inter-test variability. For example, robotic devices and workstations with the capacity to dispense and/or sample fluids in a set or programmable fashion are now well known in the art and can be used in performing the methods ofthe instant invention. hi one embodiment a standard curve of reference composition activity is employed. Typically the standard curve is generated by selecting conditions including concentration of the reference composition such that the dose-response curve is essentially linear (and the slope is non-zero) over a range of concentrations that includes the effective concentration at which activity is 50 percent of maximum (EC50). In one embodiment the standard curve spans a range of concentrations defined by EC50 ± 1 log concentration, e.g., lxl 0"7 M - 1x10"
5 M, where EC50 is lxl 0"6 M. In another embodiment the standard curve spans a broader range of concentrations defined by EC50 ± 2 log concentration, e.g., lxlO"8 M - lxlO"4 M, where EC50 is lxl 0"6 M. In yet another embodiment the standard curve spans a narrower range of concentrations defined by EC50 ± 0.5 log concentration, e.g., 3.16xl0"7 M - 3.16x10"
6 M, where EC50 is lxlO"6 M. The foregoing embodiments are intended to be exemplary and not limiting in any way. One of skill in the art will be able to select, for a given reference composition and without undue experimentation, an appropriate range of concentrations about some middle value in order to generate an essentially linear standard curve with a non-zero slope. hi one embodiment a non-linear standard curve of reference and test composition activity is employed. The standard curve can be generated by selecting conditions including concentrations ofthe reference composition such that the dose-response curve is sigmoidal and the EC50 value can be determined. Comparison of reference and test activity can be done by comparing, e.g., the EC50 values of both curves. Concentration range is chosen to yield a complete sigmoidal response, e.g., concentration should include EC50 + 3 log concentration or EC50 ± 4 log concentration, h the case of testing an inhibitory compound the value determined would be the IC50, i.e., concentration where inhibition ofthe stimulatory signal is half-maximal. The methods ofthe invention can be adapted to be automated or at least partially automated methods, as well as to parallel array or high throughput format methods. For example, the assays can be set up using multiwell plates in which cells are dispensed in individual wells and reagents are added in a systematic manner using a multiwell delivery device suited to the geometry ofthe multiwell plate. Manual and robotic multiwell delivery devices suitable for use in a high throughput screening assay are known by those skilled in the art. Each well or array element can be mapped in a one-to-one manner to a particular test condition, such as the test compound. Readouts can also be performed in this multiwell array, preferably using a multiwell plate reader device or the like. Examples of such devices are known in the art and are available through commercial sources. Sample and reagent handling can be automated to ftirther enhance the throughput capacity ofthe screening assay, such that dozens, hundreds, thousands, or even millions of parallel assays can be performed in a day or in a week. Fully robotic systems are known in the art for applications such as generation and analysis of combinatorial libraries of synthetic compounds. See, for example, U.S. Pat. Nos. 5,443,791 and 5,708,158.
Cell lines
The screening methods may use experimental cells. As used herein, an experimental cell is a non-primary cell (i.e., it is not a cell that has been recently harvested from a subject). It excludes, for example, freshly harvested PBMCs. An experimental cell includes a cell from a cell line such as the RPMI 8226 cell line.
In certain embodiments, the cell naturally expresses a functional TLR. In one embodiment relating to the verification and standardization aspects ofthe invention, the cell may be a PBMC, preferably a PBMC freshly harvested from a subj ect.
Cells that would be suitable for identification of TLR agonists, antagonists or enhancers according to the invention may possess one or more particular attributes. These attributes include but are not limited to being of human origin, being an immortalized stable cell line, endogenously expressing at least one functional TLR or a combination of functional TLRs, having intact signaling mechanisms, having intact uptake mechanisms, being able to upregulate cytokines, chemokines or cell surface markers, deriving from normal human B cells or from myeloma or B cell leukemia, deriving from human plasmacytoid and myeloid dendritic cells, and readily activatable by TLR ligands such as TLR7 ligands, TLR8 ligands or TLR9 ligands such as CpG nucleic acids or nucleic acids having other immunostimulatory sequence motifs or small molecules such as imidazoquinoline compounds. hi some embodiments, the cell line is the Raji cell line which expresses TLR3, TLR7 and TLR9. This latter cell line secretes, for example, IL-6 and IFN-α2 upon CpG nucleic acid exposure. In other embodiments, the cell line is RPMI 8226 which expresses TLR7 and TLR9. Upon CpG nucleic acid exposure, this cell line expresses, produces and/or secretes IL- 8, IL- 10, IP- 10 and TNF-α. It also expresses at its cell surface CD86, HLA-DR and CD71. In yet other embodiments, the cell line is the RAMOS cell line which expresses TLR3, TLR7 and TLR9. This cell line at least induces CD80 cell surface expression in response to CpG nucleic acid exposure. The cell lines have been observed to respond in a concentration dependent manner to TLR ligands such as but not limited to CpG nucleic acids and some non-CpG nucleic acids including T-rich nucleic acids, poly-T nucleic acids and poly-G nucleic acids. The highest responses have been observed using CpG nucleic acids. The screening methods employ a variety of cell lines as shown in the Examples.
These include A549 (human lung carcinoma, ATCC CCL-185), BeWo (human choriocarcinoma, ATCC CCL-98), HeLa (human cervix carcinoma, ATCC CCL-2), Hep-2 (human cervix carcinoma, ATCC CCL-23), KG-1 (human acute myeloid leukemia, ATCC CCL-246), MUTZ-3 (human acute myelomonocytic leukemia, German Collection of Cell lines and Microorganisms (DSZM) ACC-295), Nalm-6 (human B cell precursor leukemia, DSZM ACC-128), NK-92 (human Natural killer cell line, ATCC CRL-2407), NK-92 MI (E - 2 independent human Natural killer cell line, ATCC CRL-2408), Raji (human B lymphocyte Burkitt's lymphoma, ATCC CCL-86), RAMOS (B lymphocyte Burkitt's lymphoma, ATCC CRL-1596), RPMI 8226 (human B lymphocyte multiple myeloma, ATCC CCL-155), THP-1 (human acute monocytic leukemia, ATCC TIB 202), U937 (human lymphoma, ATCC CRL- 1593.2) and Jurkat (human T cell leukemia, ATCC TIB 152).
As shown in the Examples, each ofthe afore-mentioned cell lines has a particular endogenous TLR expression profile which dictates its suitability in a particular screening assay. A cell that artificially expresses a functional TLR can be a cell that does not express the functional TLR but for a transfected TLR expression vector. For example, human 293 fibroblasts (ATCC CRL- 1573) do not express TLR7, TLR8 or TLR9, and they express very little TLR3. As described in the examples below, such cells can be transiently or stably transfected with suitable expression vector (or vectors) so as to yield cells that do express TLR3, TLR7, TLR8, TLR9, or any combination thereof. Alternatively, a cell that artificially expresses a functional TLR can be a cell that expresses the functional TLR at a significantly higher level with the TLR expression vector than it does without the TLR expression vector. Transfected cells are considered modified cells, as used herein.
A cell that artificially expresses an expression or reporter construct is preferably stably transfected.
RPMI The RPMI 8226 cell line is a human multiple myeloma cell line. The cell line was established from the peripheral blood of a 61 year old man at the time of diagnosis for multiple myeloma (IgG lambda type). RPMI 8226 was previously reported as responsive to CpG nucleic acids as evidenced by the production and secretion of IL-6 protein and production of LL-12p40 mRNA. (Takeshita et al. (2000), Eur. J. Immunol. 30, 108-116, and Takeshita et al. (2000) Ibid. 30, 1967-1976) Takeshita et al. however used the cell line solely to study promoter constructs in order to identify transcription factor binding sites important for CpG nucleic acid signaling. It is now known according to the invention that the cell line produces a number of other chemokines and cytokines including IL-8, IL-10 and IP-10. It has also been discovered according to the invention that the cell line responds to immunostimulatory nucleic acids by upregulating cell surface expression of particular markers. Many of these markers, including CD71, CD86 and HLA-DR, are similarly upregulated in PBMCs exposed to immunostimulatory nucleic acids. This has been observed using flow cytometric analysis ofthe cell line following CpG nucleic acid exposure. In other aspects ofthe invention, the cell line can be used in similar screening assays that involve secretion of IL-6, IL-12 and/or TNF-α.
It has recently been discovered that R-848 mediates its immunostimulatory effects via other TLR family members, namely TLR7 and TLR8. TLR7 has previously been found expressed on human B cells. It has now also been discovered according to the invention that RPMI 8226 expresses TLR9 as well as TLR7, thus making it a suitable cell line for identifying immunostimulatory nucleic acid and/or imidazoquinoline (e.g., R-848) mimics or other small molecules that also signal through TLR7 and/or TLR9. Incubation of RPMI 8226 cells with the imidazoquinoline R-848 (Resiquimod) induces for example IL-8, IL-10 and IP- 10 production.
Known TLR Ligands
Ligands for many but not all ofthe TLRs have been described. For instance, it has been reported that TLR1 and TLR2 signals in response to peptidoglycan and lipopeptides. Yoshimura A et al. (1999) J Immunol 163:1-5; Brightbill HD et al. (1999) Science 285:732-6; Aliprantis AO et al. (1999) Science 285 :736-9; Takeuchi O et al. (1999) Immunity 11 :443-51 ; Underbill DM et al. (1999) Nature 401:811-5. TLR4 has been reported to signal in response to lipopolysaccharide (LPS). Hoshino K et al. (1999) J Immunol 162:3749-52; Poltorak A et al. (1998) Science 282:2085-8; Medzhitov R et al. (1997) Nature 388:394-7. Bacterial flagellin has been reported to be a natural ligand for TLR5. Hayashi F et al. (2001) Nature 410: 1099-1103. TLR6, in conjunction with TLR2, has been reported to signal in response to proteoglycan. Ozinsky A et al. (2000) Proc Natl Acad Sci USA 97:13766-71; Takeuchi O et al. (2001) Int Immunol 13:933-40. TLR9 is a receptor for CpG DNA. Hemmi H et al. (2000) Nature 408:740-5. Other
TLR9 ligands are described herein under "Immunostimulatory Nucleic Acids". Certain imidazoquinoline compounds having antiviral activity are ligands of TLR7 and TLR8. Imidazoquinolines are potent synthetic activators of immune cells with antiviral and antitumor properties. R-848 is a ligand for human TLR7 and TLR8. Jurk M et al. (2002) Nat Immunol 3 :499. Ligands of TLR3 include poly(I:C) and double-stranded RNA (dsRNA). Alexopoulou et a. (2001) Nature 413:732-738. For purposes of this invention, poly(I:C) and double- stranded RNA (dsRNA) are classified as oligonucleotide molecules. TLR3 may have a role in host defense against viruses.
Reference and Test Compounds
A test and/or reference compound can be a nucleic acid such as an oligonucleotide or a polynucleotide, an oligopeptide, a polypeptide, a lipid such as a lipopolysaccharide, a carbohydrate such as an oligosaccharide or a polysaccharide, or a small molecule. Alternatively, these compounds may also comprise or be synthesized from elements such as amino acids, carbohydrates, hormones, lipids, organic molecules, and the like.
Small molecules in general include naturally occurring, synthetic, and semisynthetic organic and organometallic compounds with molecular weight less than about 2.5 kDa. Examples of small molecules include most drugs, subunits of polymeric materials, and analogs and derivatives thereof. Some specific examples of small molecules include the imidazoquinolines. As used herein, an imidazoquinolines include imidazoquinoline amines (imidazoquinolinamines), imidazopyridine amines, 6,7-fused cycloalkylimidazopyridine amines, and 1,2 bridged imidazoquinoline amines. These compounds have been described in U.S. Pat. Nos. 4,689,338; 4,929,624; 5,238,944; 5,266,575; 5,268,376; 5,346,905; 5,352,784; 5,389,640; 5,395,937; 5,482,936; 5,494,916; 5,525,612; 6,039,969 and 6,110,929. Particular species of imidazoquinoline agents include resiquimod (R-848; S-28463; 4-amino-2 ethoxymethyl-α,α- dimethyl-lH-imidazo[4,5-c]quinoline-l-ethanol); and imiquimod (R-837; S-26308; l-(2- methylpropyl)-lH-imidazo[4,5-c]quinoline-4-amine). Further examples of specific small molecules include 4-aminoquinoline and derivatives thereof, 9-aminoacridine and derivatives thereof, and additional compounds disclosed in U.S. Pat. Nos. 6,221,882; 6,399,630; 6,479,504; and 6,521,637; and published U.S. Pat. Application No. 2002/0151564 Al, the entire contents of which are hereby incorporated by reference. The test and reference compounds may be formulated for pharmaceutical use or not.
For example, a test compound not formulated for pharmaceutical use can be a compound (e.g., a lot or batch ofthe compound) under evaluation for possible use in preparing a pharmaceutical formulation ofthe compound.
A reference compound, as used herein, is a compound having a known activity in the presence of a TLR. The reference compound may stimulate TLR signaling (and is therefore regarded as a positive reference compound), or it may be inert in the presence of a TLR (and is therefore regarded as a negative reference compound). If it is a positive reference compound, it need not be the best known stimulator of TLR signaling (i.e., it is possible that other reference compounds and even test compounds will stimulate TLR signaling to a greater extent). The readout ofthe screening assay may simply be stated relative to the level of signaling that occurs in the presence ofthe reference compound. Preferably, the reference compound is analyzed prior to the screening assay in order to determine its level of activity on a TLR. hi some aspects ofthe invention, the reference compound and the test compound will be assayed separately (i.e., in separate wells); in other aspects, the reference compound and the test compound will be assayed together (i.e., in the same well). These latter aspects are designed to measure the ability of a test compound to modulate the activity ofthe reference compound. The activity ofthe test compound and the reference compound combined (i.e., when assayed together in the same well) may be the same as that ofthe positive reference compound alone, indicating at a minimum that the test compound is not inhibitory; or it may be less than that ofthe positive reference compound, indicating at a minimum that it is inhibitory to the effect ofthe reference compound; or it maybe additive or synergistic possibly indicating that the test compound is an enhancer. The effect of an enhance may be due to its ability to stimulate TLR signaling independently ofthe positive reference compound. A "reference composition" as used herein refers to a composition that includes a reference compound and optionally another agent, e.g., a pharmaceutically acceptable carrier and/or another biologically active agent. A reference compound may be an immunostimulatory compound or it may be an immunoinhibitory compound. As discussed further below, in some aspects ofthe invention the reference compositions include both finished products, e.g., finished pharmaceutical products, as well as raw materials and other in-process materials used for the preparation of such finished products, all of which contain a known TLR ligand. As used herein, a "production lot" shall refer to a batch or lot of a completed product prepared for release as clinical material, e.g., a pharmaceutical product. As used herein, an "in-process lot" shall refer to a batch or lot of unfinished product that is prepared in the course of making a production lot; an "in-process lot" shall also refer to a batch or lot of raw material provided for use in the production of a production lot. In some aspects ofthe invention, the reference compositions ofthe invention are highly characterized in terms of their chemical, physical, and biological properties. A reference composition will be a specific composition previously determined to have a specific activity, or range of specific activity, ofthe particular known TLR ligand present in the composition. As used herein, "specific activity" refers to an amount of activity per unit mass or per unit volume ofthe reference composition as a whole, as determined using a defined assay under defined conditions. In one embodiment the reference composition is a representative sample of a particular lot or batch of a specific TLR ligand. In one embodiment the reference composition is a representative sample of a particular lot or batch of a specific TLR ligand formulated for pharmaceutical use, e.g., a sterile solution ofthe TLR ligand at a determined concentration or activity.
At least the following parameters are typically very well defined for a given reference composition: chemical formula ofthe active ingredient TLR ligand (e.g., nucleobase sequence and type of backbone of a nucleic acid; structural formula of a small molecule); concentration; diluent composition; and purity. Such parameters as purity and concentration can be determined using any appropriate physicochemical method, e.g., optical spectroscopy including absorbance at one or more specified wavelengths; nuclear magnetic resonance (NMR) spectroscopy; mass spectrometry (MS), including matrix-assisted laser desorption/ionization mass spectrometry (MALDI-MS); melting point; specific gravity; chromatography including as appropriate high pressure liquid chromatography (HPLC), one- and two-dimensional polyacrylamide gel electrophoresis (PAGE), capillary electrophoresis, and the like; as well as other methods known to those of skill in the art.
Reference compositions can also be very well characterized in terms of their biological activity, independent ofthe methods ofthe invention, although the methods ofthe invention generally include such characterization, at least in part. A reference composition can be very well characterized in terms of its biological activity by characterizing, both qualitatively and quantitatively, the response by sensitive cells to the reference composition under defined conditions. For example, a reference composition can be a specific CpG oligonucleotide such as SEQ ID NO:l which in a specific assay and under specific conditions of temperature, concentration, duration of contact between the CpG oligonucleotide and a population of TLR9-expressing cells, and particular readout, reliably yields a specific result or range of results. Results can be expressed in any suitable manner, but can include results expressed on a per-cell basis, e.g., picograms of particular cytokine per cell per hour of contact with the reference composition. Reference compositions can be very well characterized in terms of their biological activity according to one or more parameters, for example, according to their capacity to induce each of a plurality of cytokines.
The methods ofthe invention also involve measurement of a test activity of a test composition containing a known TLR ligand. A "test composition" as used herein refers to a composition that includes a test compound and optionally another agent, e.g., a pharmaceutically acceptable carrier and/or another biologically active agent. A test compound can be an immunostimulatory compound or it can be an immunoinhibitory compound. In some aspects ofthe invention, the test compound is a known TLR ligand. Test compositions ofthe invention may comprise known TLR agonist or TLR antagonist compounds, generally but not necessarily nominally the same as the reference compositions against which comparison is to be made according to some aspects ofthe invention. Thus test compositions may encompass immunostimulatory compounds, immunoinhibitory compounds, known TLR ligands, finished pharmaceutical products, and raw materials and other in-process materials used for the preparation of such finished products. Unlike a reference composition, a test composition is not characterized at all, or is only partially characterized, or is not as well characterized as the reference composition, in terms of its chemical, physical, or (most particularly) biological properties. The methods of the invention permit further characterization ofthe test composition by comparison with a reference composition. In some aspects, a test composition will be a specific composition previously determined to be a ligand of a specific TLR. In one embodiment the test composition is a representative sample of a particular lot or batch of a specific TLR ligand. In one embodiment the test composition is a representative sample of a particular lot or batch of a specific TLR ligand formulated for pharmaceutical use, e.g., a sterile solution ofthe TLR ligand at a determined concentration or activity.
Immunostimulatory and Immunoinhibitory Nucleic Acids Nucleic acids useful as reference compounds and as test compounds in the methods of the invention include single- and double-stranded natural and synthetic nucleic acids, including those with phosphodiester, stabilized, and chimeric backbones. Also encompassed are at least the following classes of nucleic acids, which are described in detail below: immunostimulatory CpG nucleic acids (CpG nucleic acids), including but not limited to types A, B, and C; immunostimulatory non-CpG nucleic acids, including without limitation methylated CpG nucleic acids, T-rich nucleic acids, TG-motif nucleic acids, Cpl motif nucleic acids, and poly-G nucleic acids; and immunoirύ ibitory nucleic acids. Nucleic acids useful as reference compounds and as test compounds in the methods ofthe invention also include nucleic acids with modified backbones, including "soft" and "semi-soft" oligonucleotides as described herein. As will be appreciated from the descriptions below, certain of these various classes of nucleic acids can coexist in a given nucleic acid molecule.
A "nucleic acid" as used herein with respect to test compounds and reference compounds used in the methods ofthe invention, shall refer to any polymer of two or more individual nucleoside or nucleotide units. Typically individual nucleoside or nucleotide units will include any one or combination of deoxyribonucleosides, ribonucleosides, deoxyribonucleotides, and ribonucleotides. The individual nucleotide or nucleoside units of the nucleic acid can be naturally occurring or not naturally occurring. For example, the individual nucleotide units can include deoxyadenosine, deoxycytidine, deoxyguanosine, thymidine, and uracil. In addition to naturally occurring 2'-deoxy and 2'-hydroxyl forms, individual nucleosides also include synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g., as described in Uhlmann E et al. (1990) Chem Rev 90:543-84. The linkages between individual nucleotide or nucleoside units can be naturally occurring or not naturally occurring. For example, the linkages can be phosphodiester, phosphorothioate, phosphorodithioate, phosphoramidate, as well as peptide linkages and other covalent linkages, known in the art, suitable for joining adjacent nucleoside or nucleotide units. The linkages can also be mixed in a single polymer (e.g., a semi-soft backbone). The nucleic acid test compounds and nucleic acid reference compounds typically range in size from 3-4 units to a few tens of units, e.g., 18-40 units. lh some embodiments the nucleic acids are oligonucleotides made up of 2 to about 100 nucleotides, and more typically 4 to about 40 nucleotides. Oligonucleotides composed exclusively of deoxynucleotides are termed oligodeoxyribonucleotides or, equivalently, oligodeoxynucleotides (ODN). A CpG nucleic acid is an immunostimulatory nucleic acid which contains a cytosine- guanine (CG) dinucleotide, the C residue of which is unmethylated. The effects of CpG nucleic acids on immune modulation have been described extensively in U.S. Pat. Nos. 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068; and published patent applications, such as PCT/US95/01570 (WO 96/02555); PCT/US98/04703 (WO 98/40100); and PCT/US99/09863 (WO 99/56755). The entire contents of each of these patents and published patent applications is hereby incorporated by reference. The entire immunostimulatory nucleic acid can be unmethylated or portions can be unmethylated, but at least the C ofthe 5'-CG-3' must be unmethylated. The CpG nucleic acid sequences ofthe invention include, without limitation, those broadly described above as well as those disclosed in U.S. Pat. Nos. 6,207,646 and 6,239,116.
In one embodiment the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTGTCGTTTTGTCGTT-3' (SEQ ID NO:l).
In one embodiment the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTGACGTTTTGTCGTT-3' (SEQ ID NO:139). In one embodiment the CpG nucleic acid has a base sequence provided by
5'-TCGTCGTTTTGTCGTTTTTTTCGA-3' (SEQ TD NO: 140).
In one embodiment the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTCGTCGTTTCGTCGTT-3' (SEQ ID NO: 141).
In one embodiment the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTCGTCGTTTTGTCGTT-3' (SEQ ID NO: 142).
In one embodiment the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTTCGGTCGTTTT-3' (SEQ ID NO: 143).
In one embodiment the CpG nucleic acid has a base sequence provided by 5'-TCGTCGTTTTTCGTGCGTTTTT-3' (SEQ ID NO: 144). In one embodiment the CpG nucleic acid has a base sequence provided by
5'-TCGTCGTTTTCGGCGGCCGCCG-3' (SEQ ID NO: 145).
In one embodiment the CpG nucleic acid has a base sequence provided by 5*-TCGTC_GTTTTAC_GGCGCC_ GTGCCG-3' (SEQ ID NO: 146). The oligonucleotides described by SEQ ID NOs: 1, 139-145 are fully stabilized phosphorothioate backbone ODN. The oligonucleotide of SEQ ID NO:146 has a chimeric backbone in which all internucleoside linkages are phosphorothioate except for those indicated by "_", which are phosphodiester. CpG nucleic acids have been further classified by structure and function into at least the following three types, all of which are intended to be encompassed within the methods of the instant invention: Type B CpG nucleic acids such as SEQ ID NO:l include the earliest described CpG nucleic acids and characteristically activate B cells but do not induce or only weakly induce expression of IFN-α. Type B nucleic acids are described in U.S. Patents 6,194,388; 6,207,646; 6,214,806; 6,218,371; 6,239,116; and 6,339,068. Type A CpG nucleic acids, described in published international application PCT/USOO/26527 (WO 01/22990), incorporate a CpG motif, include a hybrid phosphodiester/phosphorothioate backbone, and characteristically induce plasmacytoid dendritic cells to express large amounts of IFN-α but do not activate or only weakly activate B cells. Type C oligonucleotides incorporate a CpG, include a chimeric backbone, include a GC-rich palindromic or nearly-palindromic region, and are capable of both activating B cells and inducing expression of IFN-α. These have been described, for example, in copending U.S. Pat. application Ser. No. 10/224,523, filed August 19, 2002. Exemplary sequences of A, B and C class nucleic acids are described in the afore-mentioned references, patents and patent applications, the entire contents of which are hereby incorporated by reference herein.
In other embodiments ofthe invention, a non-CpG nucleic acid is used. A non-CpG nucleic acid is an immunostimulatory nucleic acid which either does not have a CpG motif in its sequence, or has a CpG motif which contains a methylated C residue. In some instances, the non-CpG nucleic acid may still be immunostimulatory by virtue of its having other immunostimulatory motifs such as those described herein and known in the art. In one embodiment the non-CpG nucleic acid is a methylated CpG nucleic acid. In some instances the non-CpG nucleic acid is still immunostimulatory despite methylation ofthe C ofthe CpG motif, even without having another non-CpG immunostimulatory motif described herein and known in the art. In one embodiment the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-TZGTZGTTTTGTZGTTTTGTZGTT-3' (SEQ ID NO: 147), wherein Z represents 5-methylcytosine. fri one embodiment the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-TZGTZGZTGTZTZZGZTTZTTZTTGZZ-3' (SEQ ID NO: 148), wherein Z represents 5-methylcytosine.
In one embodiment the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-GZGTTTGZTZTTZTTZTTGZG-3' (SEQ ID NO: 149), wherein Z represents 5-methylcytosine.
In one embodiment the non-CpG nucleic acid is a methylated CpG nucleic acid having a base sequence provided by 5'-GZZZAAGZTGGZATZZGTZA-3' (SEQ ID NO: 150), wherein Z represents 5-methylcytosine. Non-CpG nucleic acids include T-rich immunostimulatory nucleic acids. The T-rich immunostimulatory nucleic acids include those disclosed in published PCT patent application PCT/US00/26383 (WO 01/22972), the entire contents of which are incorporated herein by reference. In some embodiments, T-rich nucleic acids 24 bases in length are used. A T-rich nucleic acid is a nucleic acid which includes at least one poly T sequence and/or which has a nucleotide composition of greater than 25% T nucleotide residues. A nucleic acid having a poly-T sequence includes at least four Ts in a row, such as 5'-TTTT-3'. In some embodiments the T-rich nucleic acid includes more than one poly T sequence. In important embodiments, the T-rich nucleic acid may have 2, 3, 4, or more poly T sequences, such as SEQ ID NO:l. Non-CpG nucleic acids also include poly-G immunostimulatory nucleic acids. A variety of references describe the immunostimulatory properties of poly-G nucleic acids. Pisetsky DS et al. (1993) Mol Biol Reports 18:217-221; Krieger M et al. (1994) Ann Rev Biochem 63:601-637; Macaya RF et al. (1993) Proc Natl Acad Sci USA 90:3745-3749; Wyatt JR et al. (1994) Proc Natl Acad Sci USA 91:1356-1360; Rando and Hogan, 1998, In Applied Antisense Oligonucleotide Technology, Krieg and Stein, eds., pp. 335-352; Kimura Y et al. (1994) J Biochem (Tokyo) 116:991-994.
The immunostimulatory nucleic acids ofthe invention can also be those which do not possess CpG, methylated CpG, T-rich, or poly-G motifs.
Exemplary immunostimulatory nucleic acid sequences include but are not limited to those immunostimulatory sequences described and listed in U.S. Non-Provisional Pat. Application No. 09/669,187, filed on September 25, 2000, and in corresponding published PCT patent application PCT/USOO/26383 (WO 01/22972).
Immunoinhibitory nucleic acids have been described in Lenert P et al. (2001) Antisense Nucleic Acid Drug Dev 11 :247-56 and in Stnnz L et al. (2002) Eur J Immunol 32:1212-22. These inhibitory phosphorothioate ODN (S-ODN) differ from stimulatory S- ODN by having 2-3 G substitutions in the central motif. As inhibitory S-ODN did not directly interfere with the NF-κB DNA bmding but prevented CpG-induced NF-κB nuclear translocation of p50, p65, and c-Rel and blocked pl05, IκBα, and IκBβ degradation, Lenert et al. suggested that the putative target of immunoinhibitory ODN would lie upstream of inhibitory kinase (IKK) activation. Stunz et al. reported that replacing GCGTT or ACGTT with GCGGG or ACGGG converted a stimulatory 15-mer ODN into an inhibitory ODN. All inhibitory ODN had three consecutive G, and a fourth G increased inhibitory activity, but a deazaguanosine substitution to prevent planar stacking did not affect activity. Inhibitory ODN blocked apoptosis protection and cell-cycle entry induced by stimulatory ODN, but not that induced by lipopolysaccliaride, anti-CD40 or anti-IgM+IL-4. ODN-driven up-regulation of cyclin D(2), c-Myc, c-Fos, c-Jun and Bcl(XL) and down-regulation of cyclin kinase inhibitor p27(kipl) were all blocked by inhibitory ODN. Stunz et al. also reported that interference with uptake of stimulatory ODN did not account for the inhibitory effects ofthe immunoinhibitory nucleic acids.
In one embodiment the immunoinhibitory nucleic acid has a base sequence provided by 5'-TCCTGGCGGGGAAGT-3' (SEQ ID NO: 151). hnmunoinhibitory nucleic acids have also been described in U.S. Pat. No. 6,194,388, issued to Krieg et al. The immunoinhibitory oligonucleotides disclosed by Krieg et al. are oligonucleotides with GCG trinucleotides at or near the ends ofthe oligonucleotide and are represented by the formula 5 ' GCGXnGCG 3 ' in which X is a nucleotide and n is an integer between 0 and 50.
The nucleic acids used as either test or reference compounds can be double-stranded or single-stranded. They can be deoxyribonucleotide (DNA) or ribonucleotide (RNA) molecules. Generally, double-stranded molecules are more stable in vivo, while single- stranded molecules have increased immune activity. Thus in some the nucleic acid is single- stranded and in other embodiments the nucleic acid is double-stranded, h certain embodiments, while the nucleic acid is single-stranded, it is capable of forming secondary and tertiary structures (e.g., by folding back on itself, or by hybridizing with itself either throughout its entirety or at select segments along its length). Accordingly, while the primary structure of such a nucleic acid may be single-stranded, its higher order structures may be double- or triple-stranded. For facilitating uptake into cells, the nucleic acids are preferably in the range of 6 to 100 bases in length. However, nucleic acids of any size equal to or greater than 6 nucleotides (even many kb long) are capable of inducing an immune response. Preferably the nucleic acid is in the range of between 8 and 100 and in some embodiments between 8 and 50 or 8 and 30 nucleotides in size.
The terms "nucleic acid" and "oligonucleotide" are used interchangeably to mean multiple nucleotides (i.e., molecules comprising a sugar (e.g., ribose or deoxyribose) linked to a phosphate group and to an exchangeable organic base, which is either a substituted pyrimidine (e.g., cytosine (C), thymine (T) or uracil (U)) or a substituted purine (e.g., adenine (A) or guanine (G)). As used herein, the terms "nucleic acid" and "oligonucleotide" refer to oligoribonucleotides as well as oligodeoxyribonucleotides. The terms "nucleic acid" and "oligonucleotide" shall also include polynucleosides (i.e., a polynucleotide minus the phosphate) and any other organic base containing polymer. Nucleic acid molecules can be obtained from existing nucleic acid sources (e.g., genomic or cDNA), but are preferably synthetic (e.g., produced by nucleic acid synthesis).
The terms "nucleic acid" and "oligonucleotide" also encompass nucleic acids or oligonucleotides with substitutions or modifications, such as in the bases and/or sugars. For example, they include nucleic acids having backbone sugars that are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 2' position and other than a phosphate group or hydroxy group at the 5' position. Thus modified nucleic acids may include a 2'-O-alkylated ribose group, hi addition, modified nucleic acids may include sugars such as arabinose or 2'-fluoroarabinose instead of ribose. Thus the nucleic acids may be heterogeneous in backbone composition thereby containing any possible combination of polymer units linked together such as peptide-nucleic acids (which have an amino acid backbone with nucleic acid bases). Other examples are described in more detail below.
The immunostimulatory and immunoinhibitory nucleic acids can encompass various chemical modifications and substitutions, in comparison to natural RNA and DNA, involving a phosphodiester internucleoside bridge, a β-D-ribose unit and/or a natural nucleoside base (adenine, guanine, cytosine, thymine, uracil). Examples of chemical modifications are known to the skilled person and are described, for example, in Uhlmann E et al. (1990) Chem Rev 90:543; "Protocols for Oligonucleotides and Analogs" Synthesis and Properties & Synthesis and Analytical Techniques, S. Agrawal, Ed, Humana Press, Totowa, USA 1993; Crooke ST et al. (1996) Annu Rev Pharmacol Toxicol 36:107-129; and Hunziker J et al. (1995) Mod Synth Methods 7:331-417. An oligonucleotide according to the invention may have one or more modifications, wherein each modification is located at a particular phosphodiester internucleoside bridge and/or at a particular β-D-ribose unit and/or at a particular natural nucleoside base position in comparison to an oligonucleotide ofthe same sequence which is composed of natural DNA or RNA.
For example, the oligonucleotides may comprise one or more modifications and wherein each modification is independently selected from: a) the replacement of a phosphodiester internucleoside bridge located at the 3' and/or the
5' end of a nucleoside by a modified internucleoside bridge, b) the replacement of phosphodiester bridge located at the 3' and/or the 5' end of a nucleoside by a dephospho bridge, c) the replacement of a sugar phosphate unit from the sugar phosphate backbone by another unit, d) the replacement of a β-D-ribose unit by a modified sugar unit, and e) the replacement of a natural nucleoside base by a modified nucleoside base.
More detailed examples for the chemical modification of an oligonucleotide are as follows.
The oligonucleotides may include modified intemucleotide linkages, such as those described in (a) or (b) above. These modified linkages may be partially resistant to degradation (e.g., are stabilized). A "stabilized oligonucleotide molecule" shall mean an oligonucleotide that is relatively resistant to in vivo degradation (e.g., via an exo- or endo- nuclease) resulting from such modifications. Oligonucleotides having phosphorothioate linkages, in some embodiments, may provide maximal activity and protect the oligonucleotide from degradation by intracellular exo- and endo-nucleases. A phosphodiester internucleoside bridge located at the 3' and/or the 5' end of a nucleoside can be replaced by a modified internucleoside bridge, wherein the modified internucleoside bridge is for example selected from phosphorothioate, phosphorodithioate,
1 9
NR R -phosphoramidate, boranophosphate, α-hydroxybenzyl phosphonate, phosphate-(d- C21)-O-alkyl ester, phosphate-[(C6-C12)aryl-(C1-C 1)-O-alkyl]ester, ( -C^alkylphosphonate and/or (C6-C12)arylphosphonate bridges, (C7-Cι2)-α-hydroxymethyl-aryl (e.g., disclosed in WO 95/01363), wherein (C6-C12)aryl, (C6-C20)aryl and (C6-C14)aryl are optionally substituted by halogen, alkyl, alkoxy, nitro, cyano, and where R1 and R2 are, independently of each other, hydrogen, (Cι-Cι8)-aikyι, (C6-C20)-aryl, (C6-C14)-aryl-(C1-C8)-alkyl, preferably hydrogen, (C1-C8)-alkyl, preferably (Cι-C4)-alkyl and/or methoxyethyl, or R1 and R2 form, together with the nitrogen atom carrying them, a 5-6-membered heterocyclic ring which can additionally contain a further heteroatom from the group O, S and N.
The replacement of a phosphodiester bridge located at the 3' and/or the 5' end of a nucleoside by a dephospho bridge (dephospho bridges are described, for example, in Uhlmann E and Peyman A in "Methods in Molecular Biology", Vol. 20, "Protocols for Oligonucleotides and Analogs", S. Agrawal, Ed., Humana Press, Totowa, 1993, Chapter 16, pp. 355 ff), wherein a dephospho bridge is for example selected from the dephospho bridges formacetal, 3'-thioformacetal, methylhydroxylamine, oxime, methylenedimethyl-hydrazo, dimethylenesulfone and/or silyl groups.
A sugar phosphate unit (i.e., a β-D-ribose and phosphodiester internucleoside bridge together forming a sugar phosphate unit) from the sugar phosphate backbone (i.e., a sugar phosphate backbone is composed of sugar phosphate units) can be replaced by another unit, wherein the other unit is for example suitable to build up a "morpholino-derivative" oligomer (as described, for example, in Stirchak EP et al. (1989) Nucleic Acids Res 17:6129-41), that is, e.g., the replacement by a morpholino-derivative unit; or to build up a polyamide nucleic acid ("PNA"; as described for example, in Nielsen PE et al. (1994) Bioconjug Chem 5:3-7), that is, e.g., the replacement by a PNA backbone unit, e.g., by 2-aminoethylglycine. The oligonucleotide may have other carbohydrate backbone modifications and replacements, such as peptide nucleic acids with phosphate groups (PHONA), locked nucleic acids (LNA), and oligonucleotides having backbone sections with alkyl linkers or amino linkers. The alkyl linker may be branched or unbranched, substituted or unsubstituted, and chirally pure or a racemic mixture.
A β-ribose unit or a β-D-2'-deoxyribose unit can be replaced by a modified sugar unit, wherein the modified sugar unit is for example selected from β-D-ribose, α-D-2'-deoxyribose, L-2'-deoxyribose, 2'-F-2'-deoxyribose, 2'-F-arabinose, 2'-O-(Cι~C6)alkyl-ribose, preferably 2'- O-(Cι-C6)alkyl-ribose is 2'-O-methylribose, 2'-O-(C2-C6)alkenyl-ribose, 2'-[O-(C1-C6)alkyl- O-(Cι-C6)aikyl]-ribose, 2l-NH2-2'-deoxyribose, β-D-xylo-furanose, α-arabinofuranose, 2,4-dideoxy-β-D-erythro-hexo-pyranose, and carbocyclic (described, for example, in Froehler J (1992) Am Chem Soc 114:8320) and/or open-chain sugar analogs (described, for example, in Vandendriessche et al. (1993) Tetrahedron 49:7223) and/or bicyclosugar analogs (described, for example, in Tarkov M et al. (1993) Helv Chim Acta 76:481). fii some embodiments the sugar is 2'-O-methylribose, particularly for one or both nucleotides linked by a phosphodiester or phosphodiester-like internucleoside linkage.
In some embodiments, the nucleic acids may be soft or semi-soft nucleic acids. A soft nucleic acid is an immunostimulatory nucleic acid having a partially stabilized backbone, in which phosphodiester or phosphodiester-like intemucleotide linkages occur only within and immediately adjacent to at least one internal pyrimidine -purine dinucleotide (YZ). Preferably YZ is YG, a pyrimidine-guanosine (YG) dinucleotide. The at least one internal YZ dinucleotide itself has a phosphodiester or phosphodiester-like intemucleotide linkage. A phosphodiester or phosphodiester-like intemucleotide linkage occurring immediately adjacent to the at least one internal YZ dinucleotide can be 5', 3', or both 5' and 3' to the at least one internal YZ dinucleotide.
In particular, phosphodiester or phosphodiester-like intemucleotide linkages involve "internal dinucleotides". An internal dinucleotide in general shall mean any pair of adjacent nucleotides connected by an intemucleotide linkage, in which neither nucleotide in the pair of nucleotides is a terminal nucleotide, i.e., neither nucleotide in the pair of nucleotides is a nucleotide defining the 5 ' or 3' end ofthe nucleic acid. Thus a linear nucleic acid that is n nucleotides long has a total of n-1 dinucleotides and only n-3 internal dinucleotides. Each intemucleotide linkage in an internal dinucleotide is an internal intemucleotide linkage. Thus a linear nucleic acid that is n nucleotides long has a total of n-1 intemucleotide linkages and only n-3 internal intemucleotide linkages. The strategically placed phosphodiester or phosphodiester-like intemucleotide linkages, therefore, refer to phosphodiester or phosphodiester-like intemucleotide linkages positioned between any pair of nucleotides in the nucleic acid sequence. In some embodiments the phosphodiester or phosphodiester-like intemucleotide linkages are not positioned between either pair of nucleotides closest to the 5' or 3' end.
Preferably a phosphodiester or phosphodiester-like intemucleotide linkage occurring immediately adjacent to the at least one internal YZ dinucleotide is itself an internal intemucleotide linkage. Thus for a sequence Ni YZ N , wherein Ni and N are each, independent ofthe other, any single nucleotide, the YZ dinucleotide has a phosphodiester or phosphodiester-like intemucleotide linkage, and in addition (a) Ni and Y are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when Ni is an internal nucleotide, (b) Z and N2 are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when N2 is an internal nucleotide, or (c) Ni and Y are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when Ni is an internal nucleotide and Z and N2 are linked by a phosphodiester or phosphodiester-like intemucleotide linkage when N2 is an internal nucleotide.
Soft nucleic acids according to the instant invention are believed to be relatively susceptible to nuclease cleavage compared to completely stabilized nucleic acids. Without meaning to be bound to a particular theory or mechanism, it is believed that soft nucleic acids ofthe invention are cleavable to fragments with reduced or no immunostimulatory activity relative to full-length soft nucleic acids. Incorporation of at least one nuclease-sensitive intemucleotide linkage, particularly near the middle ofthe nucleic acid, is believed to provide an "off switch" which alters the pharmacokinetics ofthe nucleic acid so as to reduce the duration of maximal immunostimulatory activity ofthe nucleic acid. This can be of particular value in tissues and in clinical applications in which it is desirable to avoid injury related to chronic local inflammation or immunostimulation, e.g., the kidney.
A semi-soft nucleic acid is an immunostimulatory nucleic acid having a partially stabilized backbone, in which phosphodiester or phosphodiester-like intemucleotide linkages occur only within at least one internal pyrimidine-purine (YZ) dinucleotide. Semi-soft nucleic acids generally possess increased immunostimulatory potency relative to corresponding fully stabilized immunostimulatory nucleic acids. Due to the greater potency of semi-soft nucleic acids, semi-soft nucleic acids may be used, in some instances, at lower effective concentations and have lower effective doses than conventional fully stabilized immunostimulatory nucleic acids in order to achieve a desired biological effect.
It is believed that the foregoing properties of semi-soft nucleic acids generally increase with increasing "dose" of phosphodiester or phosphodiester-like intemucleotide linkages involving internal YZ dinucleotides. Thus it is believed, for example, that generally for a given nucleic acid sequence with five internal YZ dinucleotides, an nucleic acid with five internal phosphodiester or phosphodiester-like YZ intemucleotide linkages is more immunostimulatory than an nucleic acid with four internal phosphodiester or phosphodiester- like YG intemucleotide linkages, which in turn is more immunostimulatory than an nucleic acid with three internal phosphodiester or phosphodiester-like YZ intemucleotide linkages, which in turn is more immunostimulatory than an nucleic acid with two internal phosphodiester or phosphodiester-like YZ intemucleotide linkages, which in turn is more immunostimulatory than an nucleic acid with one internal phosphodiester or phosphodiester- like YZ intemucleotide linkage. Importantly, inclusion of even one internal phosphodiester or phosphodiester-like YZ intemucleotide linkage is believed to be advantageous over no internal phosphodiester or phosphodiester-like YZ intemucleotide linkage. In addition to the number of phosphodiester or phosphodiester-like intemucleotide linkages, the position along the length ofthe nucleic acid can also affect potency. The soft and semi-soft nucleic acids will generally include, in addition to the phosphodiester or phosphodiester-like intemucleotide linkages at preferred internal positions, 5' and 3' ends that are resistant to degradation. Such degradation-resistant ends can involve any suitable modification that results in an increased resistance against exonuclease digestion over coπesponding unmodified ends. For instance, the 5' and 3' ends can be stabilized by the inclusion thereof at least one phosphate modification ofthe backbone. In a preferred embodiment, the at least one phosphate modification ofthe backbone at each end is independently a phosphorothioate, phosphorodithioate, methylphosphonate, or methylphosphorothioate intemucleotide linkage. In another embodiment, the degradation- resistant end includes one or more nucleotide units connected by peptide or amide linkages at the 3' end.
A phosphodiester intemucleotide linkage is the type of linkage characteristic of nucleic acids found in nature. The phosphodiester intemucleotide linkage includes a phosphorus atom flanked by two bridging oxygen atoms and bound also by two additional oxygen atoms, one charged and the other uncharged. Phosphodiester intemucleotide linkage is particularly preferred when it is important to reduce the tissue half-life ofthe nucleic acid. A phosphodiester-like intemucleotide linkage is a phosphoras-containing bridging group that is chemically and/or diastereomerically similar to phosphodiester. Measures of similarity to phosphodiester include susceptibility to nuclease digestion and ability to activate RNAse H. Thus for example phosphodiester, but not phosphorothioate, nucleic acids are susceptible to nuclease digestion, while both phosphodiester and phosphorothioate nucleic acids activate RNAse H. In a prefeπed embodiment the phosphodiester-like intemucleotide linkage is boranophosphate (or equivalently, boranophosphonate) linkage. U.S. Patent No. 5,177,198; U.S. Patent No. 5,859,231; U.S. Patent No. 6,160,109; U.S. Patent No. 6,207,819; Sergueev et al., (1998) J Am Chem Soc 120:9417-27. In another prefeπed embodiment the phosphodiester-like intemucleotide linkage is diasteromerically pure Rp phosphorothioate. It is believed that diasteromerically pure Rp phosphorothioate is more susceptible to nuclease digestion and is better at activating RNAse H than mixed or diastereomerically pure Sp phosphorothioate. Stereoisomers of CpG nucleic acids are the subject of co-pending U.S. patent application 09/361,575 filed July 27, 1999, and published PCT application PCT/US99/17100 (WO 00/06588). It is to be noted that for purposes ofthe instant invention, the term "phosphodiester-like intemucleotide linkage" specifically excludes phosphorodithioate and methylphosphonate intemucleotide linkages. As described above the soft and semi-soft nucleic acids ofthe invention may have phosphodiester like linkages between C and G. One example of a phosphodiester-like linkage is a phosphorothioate linkage in an Rp conformation. Nucleic acid p-chirality can have apparently opposite effects on the immune activity of a CpG nucleic acid, depending upon the time point at which activity is measured. At an early time point of 40 minutes, the Rp but not the Sp stereoisomer of phosphorothioate CpG nucleic acid induces JNK phosphorylation in mouse spleen cells. In contrast, when assayed at a late time point of 44 hr, the Sp but not the Rp stereoisomer is active in stimulating spleen cell proliferation. This difference in the kinetics and bioactivity ofthe Rp and Sp stereoisomers does not result from any difference in cell uptake, but rather most likely is due to two opposing biologic roles ofthe p-chirality. First, the enhanced activity ofthe Rp stereoisomer compared to the Sp for stimulating immune cells at early time points indicates that the Rp may be more effective at interacting with the CpG receptor, TLR9, or inducing the downstream signaling pathways. On the other hand, the faster degradation ofthe Rp PS-nucleic acids compared to the Sp results in a much shorter duration of signaling, so that the Sp PS-nucleic acids appear to be more biologically active when tested at later time points.
A surprisingly strong effect is achieved by the p-chirality at the CpG dinucleotide itself. In comparison to a stereo-random CpG nucleic acid the congener in which the single CpG dinucleotide was linked in Rp was slightly more active, while the congener containing an Sp linkage was nearly inactive for inducing spleen cell proliferation. Nucleic acids also include substituted purines and pyrimidines such as C-5 propyne pyrimidine and 7-deaza-7-substituted purine modified bases. Wagner RW et al. (1996) Nat Biotechnol 14:840-4. Purines and pyrimidines include but are not limited to adenine, cytosine, guanine, and thymine, and other naturally and non-naturally occurring nucleobases, substituted and unsubstituted aromatic moieties. A modified base is any base which is chemically distinct from the naturally occurring bases typically found in DNA and RNA such as T, C, G, A, and U, but which share basic chemical stmctures with these naturally occurring bases. The modified nucleoside base may be, for example, selected from hypoxanthine, uracil, dihydrouracil, pseudouracil, 2-thiouracil, 4-thiouracil, 5-aminouracil, 5-(C1-C6)-alkyluracil, 5-(C2-C6)-alkenyluracil, 5-(C2-C6)- alkynyluracil, 5-(hydroxymethyl)uracil, 5-chlorouracil, 5-fluorouracil, 5-bromouracil, 5-hydroxycytosine, 5-(Cι-C6)-alkylcytosine, 5-(C2-C6)-alkenylcytosine, 5-(C2-C6)- alkynylcytosine, 5-chlorocytosine, 5-fluorocytosine, 5-bromocytosine, N2-dimethylguanine, 2,4-diamino-purine, 8-azapurine, a substituted 7-deazapurine, preferably
7-deaza-7-substituted and/or 7-deaza-8-substituted purine, 5-hydroxymethylcytosine, N4- alkylcytosine, e.g., N4-ethylcytosine, 5-hydroxydeoxycytidine, 5- hydroxymethyldeoxycytidine, N4-alkyldeoxycytidine, e.g., N4-ethyldeoxycytidine, 6- thiodeoxyguanosine, and deoxyribonucleosides of nitropyrrole, C5-propynylpyrirnidine, and diaminopurine e.g., 2,6-diaminopurine, inosine, 5-methylcytosine, 2-aminopurine,
2-amino-6-chloropurine, hypoxanthine or other modifications of a natural nucleoside bases. This list is meant to be exemplary and is not to be interpreted to be limiting.
Modified cytosines include but are not limited to 5-substituted cytosines (e.g., 5- methyl-cytosine, 5-fluoro-cytosine, 5-chloro-cytosine, 5-bromo-cytosine, 5-iodo-cytosine, 5- hydroxy-cytosine, 5-hydroxymethyl-cytosine, 5-difluoromethyl-cytosine, and unsubstituted or substituted 5-alkynyl-cytosine), 6-substituted cytosines, N4-substituted cytosines (e.g., N4- ethyl-cytosine), 5-aza-cytosine, 2-mercapto-cytosine, isocytosine, pseudo-isocytosine, cytosine analogs with condensed ring systems (e.g., N,N'-propylene cytosine or phenoxazine), and uracil and its derivatives (e.g., 5-fluoro-uracil, 5-bromo-uracil, 5- bromovinyl-uracil, 4-thio-uracil, 5-hydroxy-uracil, 5-propynyl-uracil). In another embodiment, the cytosine base is substituted by a universal base (e.g., 3-nitropyπole, P-base), an aromatic ring system (e.g., fluorobenzene or difluorobenzene) or a hydrogen atom (dSpacer).
Modified guanines include but are not limited to 7-deazaguanine, 7-deaza-7-substituted guanine (such as 7-deaza-7-(C2-C6)alkynylguanine),
7-deaza-8-substituted guanine, hypoxanthine, N2-substituted guanines (e.g., N2-methyl- guanine), 5-amino-3-methyl-3H,6H-thiazolo[4,5-d]pyrimidine-2,7-dione, 2,6-diaminopurine, 2-aminopurine, purine, indole, adenine, substituted adenines (e.g., N6-methyl-adenine, 8-oxo- adenine) 8-substituted guanine (e.g., 8-hydroxyguanine and 8-bromoguanine), and 6-thioguanine. In another embodiment, the guanine base is substituted by a universal base (e.g., 4-methyl-indole, 5-nitro-indole, and K-base), an aromatic ring system (e.g., benzimidazole or dichloro-benzimidazole, l-methyl-lH-[l,2,4]triazole-3-carboxylic acid amide) or a hydrogen atom (dSpacer). For use in the instant invention, the oligonucleotide reference compounds and test compounds can be synthesized de novo using any of a number of procedures well known in the art, for example, the /3-cyanoethyl phosphoramidite method (Beaucage SL et al. (1981) Tetrahedron Lett 22:1859), or the nucleoside H-phosphonate method (Garegg et al. (1986) Tetrahedron Lett 27:4051-4; Froehler BC et al. (1986) Nucleic Acids Res 14:5399-407; Garegg et al (1986) Tetrahedron Lett 27:4055-8; Gaffney et al. (1988) Tetrahedron Lett 29:2619-22). These chemistries can be performed by a variety of automated nucleic acid synthesizers available in the market. These oligonucleotides are refeπed to as synthetic oligonucleotides. An isolated oligonucleotide generally refers to an oligonucleotide which is separated from components which it is normally associated with in nature. As an example, an isolated oligonucleotide may be one which is separated from a cell, from a nucleus, from mitochondria or from chromatin.
Modified backbones such as phosphorothioates can be synthesized using automated techniques employing either phosphoramidate or H-phosphonate chemistries. Aryl-and alkyl-phosphonates can be made, e.g., as described in U.S. Pat. No. 4,469,863; and alkylphosphotriesters (in which the charged oxygen moiety is alkylated as described in U.S. Pat. No. 5,023,243 and European Pat. No. 092,574) can be prepared by automated solid phase synthesis using commercially available reagents. Methods for making other DNA backbone modifications and substitutions have been described (e.g., Uhlmann E et al. (1990) Chem Rev 90:544; Goodchild J (1990) Bioconjugate Chem 1 : 165).
TLR expression
The cell lines can be used in their native state without any modification. For example, in the case ofthe RPMI 8226 cell line, it can be used to identify compounds that signal through at least TLR9 and/or TLR7. In other instances, however, the cell line can be modified to express a TLR that it does not naturally express. In still other instances, the cell to be used in the screening method may express one or more endogenous TLR and yet still be manipulated to express an additional TLR different from those it endogenously expresses.
The cell may also be manipulated in order to increase or decrease the level of TLR that it endogenously expresses. The cells may be stably or transiently transfected.
A cell that does not naturally express a protein or polypeptide, but is genetically manipulated to do so is refeπed to as ectopically expressing the protein or polypeptide. The basic screening method remains the same regardless of which TLR is expressed by the cell. However, the reference compound and the readout may vary depending upon the TLR(s) expressed. In the most simple aspect, the screening method is used to identify a compound that signals tlirough a TLR such as for example TLR9. In this case, the positive reference compound may be an immunostimulatory compound aheady known to act through TLR9 (e.g., CpG nucleic acid).
The methods ofthe invention involve, in part, contacting a functional TLR with a test composition. A functional TLR is a full-length TLR protein or a fragment thereof capable of inducing or inhibiting a signal in response to interaction with its ligand. Generally the functional TLR will include at least a TLR ligand-binding fragment ofthe extracellular domain ofthe full-length TLR and at least a fragment of a TIR domain capable of interacting with another Toll homology domain-containing polypeptide, e.g., MyD88. In various embodiments the functional TLR is a full-length TLR selected from TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, and TLR10. To date, there are eleven TLRs known. Nucleic acid and amino acid sequences for ten currently known human TLRs are available from public databases such as GenBank. Similarly, nucleic acid and amino acid sequences for various TLRs from numerous non- human species are also available from public databases including GenBank. For example, nucleic acid and amino acid sequences for human TLR9 (hTLR9) can be found as GenBank accession numbers AF245704 (coding region spanning nucleotides 145-3243) (SEQ ID NO: 60) and AAF78037 (SEQ JD NO: 62), respectively. Nucleic acid and amino acid sequences for murine TLR9 (mTLR9) can be found as GenBank accession numbers AF348140 (coding region spanning nucleotides 40-3138) (SEQ ID NO: 68) and AAK29625 (SEQ ID NO: 72), respectively. Nucleic acid and amino acid sequences for human TLR8 (hTLR8) can be found as
GenBank accession numbers AF245703 (coding region spanning nucleotides 49-3174) (SEQ ID NO: 46) and AAF78036 (SEQ TD NO: 50), respectively. Nucleic acid and amino acid sequences for murine TLR8 (mTLR8) can be found as GenBank accession numbers AY035890 (coding region spanning nucleotides 59-3157) (SEQ ID NO: 55) and AAK62677 (SEQ ID NO: 57), respectively.
Nucleic acid and amino acid sequences for human TLR7 (hTLR7) can be found as GenBank accession numbers AF240467 (coding region spanning nucleotides 135-3285) (SEQ ID NO: 31) and AAF60188 (SEQ ID NO: 34), respectively. Nucleic acid and amino acid sequences for murine TLR7 (mTLR7) can be found as GenBank accession numbers AY035889 (coding region spanning nucleotides 49-3201) (SEQ ID NO: 38) and AAK62676 (SEQ ID NO: 41), respectively.
Nucleic acid and amino acid sequences for human TLR3 (hTLR3) can be found as GenBank accession numbers NM_003265 (coding region spanning nucleotides 102-2816) (SEQ ID NO: 7) and NP_003256 (SEQ ID NO: 8), respectively. Nucleic acid and amino acid sequences for murine TLR3 (hTLR3) can be found as GenBank accession numbers AF355152 (coding region spanning nucleotides 44-2761) (SEQ ID NO: 9) and AAK26117 (SEQ ID NO: 10), respectively. Nucleic acid and amino acid sequences for human TLR1 (hTLRl) can be found as
GenBank accession numbers NM_003263 and NP_003254, respectively. Nucleic acid and amino acid sequences for murine TLR1 (mTLRl) can be found as GenBank accession numbers NM_030682 and NP_109607, respectively.
The functional TLR also is not limited to native TLR polypeptides. As used herein, a native TLR is one that is naturally occurring. The TLR may be a non-native (or non-naturally occurring TLR). An example is a chimeric TLR having an extracellular domain and the cytoplasmic domain derived from TLRs from different species. Such chimeric TLR polypeptides can include, for example, a human TLR extracellular domain and a murine TLR cytoplasmic domain. In alternative embodiments, such chimeric TLR polypeptides can include chimerae created with different TLR splice variants or allotypes.
TLR Signaling Pathways
The screening methods provided by the invention measure TLR signaling activity. TLR signaling activity is activity that results from interaction of a TLR with a TLR ligand. TLR signaling can be measured in a number of ways including but not limited to interaction between a TLR and a protein or factor (such as an adaptor protein), interaction between downstream proteins or factors (such as an adaptor protein) with each other, activation of nuclear factors such as transcription factors or transcription complexes, up- or down- regulation of genes, phosphorylation or dephosphorylation of proteins or factors in the signaling cascade, expression, production and/or secretion of cytokines and/or chemokines, changes in cell cycle status, up- or down-regulation of cell surface marker expression, and the like. Those of ordinary skill in the art are familiar with assays for measuring these latter events including but not limited to gel shift assays, immunoprecipitations, phosphorylation . status analysis of proteins, Northern analysis, RT-PCR analysis, etc.
The following is an exemplary TLR signaling pathway or cascade. It is to be understood that this is meant to be illustrative and that different factors may be involved in the signaling of particular TLR. One TLR signaling pathway is known to use the cytoplasmic Toll/IL-1 receptor (TIR) homology domain, present in all TLRs. This domain interacts (e.g., binds to) and thereby transduces a signal to a similar domain on an adapter protein (e.g., MyD88). This type of interaction is refeπed to as a like:like interaction of TIR domains. This interaction is followed by an another interaction between the adapter protein and a kinase, through their respective "death domains". In the case of at least TLR4 signaling, the kinase then interacts with tumor necrosis factor (TNF) receptor-associated factor-6 (TRAF6). Medzhitov R et al, Mol Cell 2:253 (1998); Kopp EB et al., Curr Opin Immunol 11:15 (1999). After TRAF6, two sequential kinase activation steps lead to phosphorylation ofthe inhibitory protein I kappa B and its dissociation from NF-κB. The first kinase is a mitogen-activated kinase kinase kinase (MAPKKK) known as NTK, for NF-κB-inducing kinase. The target of this kinase is another kinase made up of two chains, called I kappa B kinase α (IKK α) and I kappa B kinase β (IKK β), that together form a heterodimer of !KKα:IKKj8, which phosphorylates I kappa B. NF-KB translocates to the nucleus to activate genes with kappa B binding sites in their promoters and enhancers such as the genes encoding IL-6, IL-8, the p40 subunit of IL-12, and the costimulatory molecule CD86. The signaling mechanisms of TLRs are not limited to this pathway; other signaling pathways exist and can be used in the screening readouts ofthe methods provided herein.
The screening assays employ a number of readouts (or parameters). The readouts can be native readouts. A native readout is one that does not rely on introduction of a reporter construct into the cell of interest. The readouts can be artificial. An artificial readout is one that relies on introduction of a reporter construct into the cell of interest. Examples of both are provided herein. In still other embodiments, a given assay may measure one or more native readouts and one or more artificial readouts. Each readout whether native or artificial is related to signaling pathways that ensue after TLR engagement with a ligand. Each cell line described herein will be associated with a particular set of native readouts which the invention seeks to determine in the screening assays provided. As an example, the response ofthe RPMI 8226 cell line to an immunomodulatory molecule can be assessed in terms of native readouts such as CD71 expression, CD86 expression, HLA-DR expression, IL-8 expression, IL-8 production, IL-8 secretion, IL-10 expression, IL-10 production, IL-10 secretion, IP-10 expression, IP-10 production, IP-10 secretion, TNF-α expression, TNF-α production and TNF-α secretion. RAMOS response can be assessed, inter alia, by CD80 cell surface expression. Raji response can be assessed, inter alia, by IL-6 secretion.
As described in greater detail herein, the cell line can be used in an unmodified form. In one respect, an unmodified cell line will naturally respond to a TLR ligand through a native readout system. For example, an RPMI 8226 cell exposed to an immunostimulatory TLR ligand may increase expression of IP-10 from the native gene locus. Alternatively, the cell line may be modified to contain a reporter construct that acts as a surrogate for the IP-10 gene locus. For example, the reporter construct may contain the TLR responsive promoter elements that are naturally found in the native IP-10 locus operably linked to a reporter coding sequence that encodes a gene product that is detectable and quantifiable. The sfructure and variability of suitable reporter constructs will be discussed in greater detail herein. Readouts typically include the induction of a gene under control of a specific promoter such as a NF-κB promoter. The gene under the control ofthe NF-κB promoter can be a gene which naturally includes an NF-κB promoter or it can be a gene in a construct in which an NF-κB promoter has been inserted. Endogenous genes and transfected constructs which include the NF-κB promoter include but are not limited to IL-8, IL-12 p40, NF-κB-luc, IL-12 p40-luc, and TNF-luc.
Increases in cytokine levels can result from increased production, increased stability, increased secretion, or any combination ofthe forgoing, ofthe cytokine in response to the TLR-mediated signaling. Cytokines generally include, without limitation, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-10, IL-11, IL-12, IL-13, IL-15, IL-18, IFN-α, IFN-β, IFN-γ, TNF-α, GM-CSF, G-CSF, M-CSF. Thl cytokines include but are not limited to IL-2, IFN-γ, and IL- 12. Th2 cytokines include but are not limited to IL-4, IL-5, and IL-10.
Increases in chemokine levels can result from increased production, increased stability, increased secretion, or any combination ofthe forgoing, ofthe chemokine in response to the TLR-mediated signaling. Chemokines of particular significance in the invention include but are not limited to CCL5 (RANTES), CXCL9 (Mig), CXCLIO (IP-10), CXCL11 (I-TAC), IL-8, and MCP-1. TLR signaling activity can also be measured by phosphorylation, such as total cellular phosphorylation or phosphorylation of specific factors such as but not limited to IRAK, ERK, MyD88, TRAF6, p38, NF- B subunits, c-Jun and c-Fos.
TLR signaling activity can be measured by changes in gene expression. The expression of CD71, CD86, CD80, CD69, CD54, HLA-DR, HLA class I, IL-6, IL-8, IL-10, LP-9, IP-10, IFN-α, TNF-α, and the like can be assessed as a measure of TLR signaling activity. Gene expression analysis may be performed using microaπay techniques.
TLR signaling activity can also be measured by cell proliferation status or changes thereto. TLR signaling activity can also be measured by cell surface marker expression such as the cell surface expression of markers such as but not limited to CD71, CD86, HLA-DR, CD80, HLA class I, CD54 and CD69.
TLR signaling activity can also be measured by antibody secretion such as but not limited to IgM secretion.
Reporter and Expression Constructs
The cells can be manipulated by the introduction of expression and/or reporter constructs. The expression constructs preferably comprise a TLR coding sequence, as described above. The reporter constructs can be used as surrogate measures of native TLR signaling activity. These reporter constructs are intended to substitute for the "native" readouts capable with the cell line. In order to act as substitutes, the reporter constructs include a promoter element derived from a gene known to be modulated following TLR engagement with a TLR ligand. The reporter construct further includes a coding sequence linked to the promoter. The coding sequence is usually that of a reporter (i.e., a protein that is detectable or quantifiable).
The reporter construct generally includes a promoter, a coding sequence and a polyadenylation signal. These nucleic acids shall include, as necessary, 5' non-transcribing and 5' non-translating sequences involved with the initiation of transcription and translation, respectively, such as a TATA box, capping sequence, CAAT sequence, in addition to promoter elements that are responsive to TLR signaling. The nucleic acid constructs may optionally include enhancer sequences or upstream activator sequences as desired.
The promoter in the reporter constract will include a TLR responsive promoter element, and will therefore be regarded as a TLR responsive promoter. As used herein, a TLR responsive promoter is a promoter having an activity that is modulated (i.e., either activated or inhibited) by signaling tlirough a TLR (e.g., by TLR interaction with its ligand). In order to be modulated by TLR signaling, the promoter contains sites that are bound by transcription factors modulated by TLR signaling. The factors may be activated or inhibited by TLR signaling. Activation ofthe transcription factor includes increases in the activity of the transcription factor per se, increases in its ability to interact with other factors or with DNA that serve to increase its activity, and increases in its transcription and translation (i.e., increased mRNA and protein levels ofthe transcription factor). Conversely, inhibition ofthe transcription factor includes decreases in the activity ofthe transcription factor per se, decreases in its ability to interact with other factors or with DNA that serve to decrease its activity, and decreases in its transcription and translation (i.e., decreased mRNA and protein levels ofthe transcription factor). The effect on the transcription factor is usually the downstream result of other interactions in the signaling pathway. The expression of coding sequences linked to such promoters will therefore be modulated by TLR signaling events, and it is the level of expression of these coding sequences that can be used as a readout of TLR signaling in the screening methods provided herein.
The TLR responsive promoter may comprise a transcription factor binding site selected from the group consisting of a NF-KLB binding site, an AP-1 binding site, a CRE, a SRE, an interferon-stimulated response element (ISRE), a GAS, an ATF2 binding site, an TJ F3 binding site, an IRF7 binding site, an NFAT binding site, a p53 bmding site, an SRF binding site, and a TARE, among others. These binding sites and their sequences are known in the art. Below is a exemplary list of these sequences. W = A or T, R = A or G, Y = C or T
NF-κB Binding site:
Consensus p50 subunit
5' GGGGATYCCC 3' (SEQ ID NO:90) Consensus p65 subunit
5' GGGRNTTTCC 3' (SEQ ID NO:91)
Example of p65 subunit binding site
5' AGT TGA GGG GAC TTT CCC AGG C 3' (SEQ IDNO:92)
CREB Binding site:
5'AGA GAT TGC CTGACGTCAGAGAGC TAG3' (SEQ IDNO:93) AP-1 Bmding site:
5'- CGC TTG ATG AGT CAG CCG GAA -3' (SEQ ID NO:94) 5'- CGC ATG AGT CAG ACA -3' (SEQ ID NO:95) ISRE :
5'- TGCAGAAGTGAAACTGAGG-3' (SEQ ID NO:96) 5'- AGAACGAAACA-3' (SEQ ID NO:97) 5'- GAGAAGTGAAAGTGG-3' (SEQ ID NO:98) 5'- TAAGAACATGAAACTGAA-3' (SEQ ID NO:99) 5'- ATGAAACTGAAAGTA-3' (SEQ ID NO:100)
5'- TGAAAACCGAAAGCGC-3' (SEQ 3D NO:101) 5'- AGAAATGGAAAGT-3' (SEQ ID NO: 102)
SRE 5'- TCACCCCAC-3' (SEQ ID NO:103)
5'- CTCACCCCAC-3' (SEQ ID NO: 104) 5'- GCCACCCTAC-3' (SEQ ID NO: 105)
NFAT: 5'- TATGAAACAGTTTTTCC -3' (SEQ ID NO:106)
5'- AGGAAACTC -3' (SEQ ID NO: 107) 5'- ARGARATTCC -3' (SEQ ID NO: 108) 5'- CCAGTTGAGCCAGAGA-3' (SEQ ID NO:109) GAS:
5'- CTTTCAGTTTCATATTACTCTAAATCCATT -3' (SEQ ID NO:l 10) p53 Binding Site : p53 Consensus site:
5'- RRRCWWGYYY-3' (SEQ ID Oilll)
Examples of p53 binding sites: 5'- AGGCATGCCT -3' (SEQ ID NO:l 12) 5'- GGGCTTGCCC -3' (SEQ ID NO:l 13)
5'- GGGCTTGCTT -3' (SEQ ID NO:114) 5'- GCCTGGACTTGCC -3' (SEQ ID NO:115) 5'- GGACATGCCCGGGCATGTCC -3' (SEQ ID NO:l 16) 5'- GTAGCATTAGCCCAGACATGTCC -3' (SEQ ID NO: 117)
TARE (TNF-α response element): e.g. from the COLI Al promoter
5'GAGGTATGCAGACAAGAGTCAGAGTTTCCCCTTGAA 3' (SEQ ID NO: 118)
SRF
5'- CCWWWWWWGG-3' (SEQ ID NO.119) 5'- CCAAATAAGGC -3' (SEQ ID NO:120) The TLR responsive promoter element can be derived from the promoter of a naturally occurring (i.e., an endogenous) gene that is activated or inhibited by TLR signaling (such as the IL-6 gene, the IL-8 gene, the IL-10 gene, the IL-12 p40 gene, the 1P-9 gene, the IP-10 gene, the type 1 IFN gene, the IFN-α4 gene, the JJFN-/3 gene, the TNF-α gene, the TNF- 3 gene, the RANTES gene, the ITAC gene, the IGFBP4 gene, the CD54 gene, the CD69 gene, the CD71 gene, the CD80 gene, the CD86 gene, the HLA-DR gene, the HLA class I gene, and the like). The afore-mentioned genes are genes that are known to be activated in response to TLR interaction with its ligand.
Suitable promoter regions are described in the Examples. Briefly, the upstream (5') - 620 to +50 promoter region of IFN-α4 or the upstream (5 ') -140 to +9 promoter region of IFN-αl can be used. In one embodiment, the EFN-α4 sequence is cloned into the Smal site of the pGL3-Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') promoter region of IFN-α4.
The promoter can also be the upstream (5') -280 to +20 promoter region of IFN-β. The promoter can also be the upstream (5') —397 to +5 promoter region of RANTES.
In one embodiment, the RANTES promoter sequence is cloned into the Nhel site (filled in with Klenow) ofthe pGL3-Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') -397 to +5 promoter region ofRANTES. The promoter can also be the upstream truncated (-250 to +30) and full length (-860 to
+30) promoter regions derived from human IL-12 p40 genomic DNA. In one embodiment, the truncated IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into pβgal-Basic (Promega) resulting in an expression vector that includes a β gal gene under the control ofthe upstream (5') -250 to +30 promoter region of human IL-12 p40. In another embodiment, the full length IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into pβgal-Basic (Promega) resulting in an expression vector that includes a β gal gene under the control ofthe upstream (5') -751 to +30 promoter region of human IL-12 p40. In another embodiment, the truncated -250 to +30 promoter region of human IL-12 p40 was cloned into the pGL3-Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') -250 to +30 promoter region of human IL-12 p40. hi yet another embodiment, the full length LL-12 p40 promoter of human IL-12 p40 was cloned into the pGL3 -Basic Vector (Promega) resulting in an expression vector that includes a luciferase gene under the control ofthe upstream (5') -751 to +30 promoter region of human IL-12 p40.
The promoter can also be the upstream (5') -288 to +7 promoter region derived from human IL-6 genomic DNA. The promoter can also be derived from the full-length promoter region ofthe IL-6 gene from -1174 to + 7 (Accession No M22111, SEQ ID NO:129).
The promoter can also be the upstream (5') -734 to +44 or the upstream (5') -162 to +44 promoter region derived from human IL-8 genomic DNA. Mukaida N et al. (1989) J Immunol 143:1366-71.
The promoter can also be derived from the -615 to +30 promoter region of human TNF-α.
The promoter can also be derived from a promoter region of human TNF-/3.
The promoter can also be derived from the -875 to +97 promoter region of human IP- 10.
The promoter can also be derived from the -219 to +114 promoter region of human CXCL11 (JP 9). The promoter can also be derived from the full length (-934 to +114) promoter region of human CXCL11 (1P9).
The promoter can also be derived from the -289 to +217 promoter region of human IGFBP4 (Insulin growth factor binding protein 4). The promoter can also be derived from the full length (-836 to +217) promoter region of human IGFBP4. The promoter response element generally will be present in multiple copies, e.g., as tandem repeats. For example, in one reporter construct, coding sequence for luciferase is under control of an upstream 6X tandem repeat of NF-κB response element. In another example, an ISRE-luciferase reporter construct useful in the invention is available from Stratagene (catalog no. 219092) and includes a 5x ISRE tandem repeat joined to a TATA box upstream of a luciferase reporter gene.
The reporter constract coding sequence is preferably any nucleotide sequence that codes for a protein capable of detection or quantification. The protein can be an enzyme (e.g., luciferase, alkaline phosphatase, /3-galactosidase, chloramphenicol acetyltransferase (CAT), secreted alkaline phosphatase, etc.), a bioluminescence marker (e.g., green fluorescent protein (GFP, U.S. Pat. No. 5,491,084), etc.), blue fluorescent protein (BFP, e.g., U.S. Pat. No. 6,486,382), etc.), a surface-expressed molecule (e.g., CD25, CD80, CD86), a secreted molecule (e.g., IL-1, IL-6, IL-8, IL-12 p40, TNF-α), a hapten or antigen, and other detectable protein products known to those of skill in the art. For assays relying on enzyme activity readout, substrate can be supplied as part ofthe assay, and detection can involve measurement of chemiluminescence, fluorescence, color development, incorporation of radioactive label, drug resistance, or other marker of enzyme activity. For assays relying on surface expression of a molecule, detection can be accomplished using flow cytometry (FACS) analysis or functional assays. Secreted molecules can be assayed using enzyme-linked immunosorbent assay (ELISA) or bioassays. Many of these and other suitable readout systems are well known in the art and are commercially available. Preferably, the coding sequence encodes a protein having a level or an activity that is quantifiable, preferably with a wide linear range. The expression constract coding sequence is preferably a TLR coding sequence derived from the sequences listed herein. Preferably, the expression construct promoter is a constitutive promoter, although in some embodiments it may be inducible. Those of ordinary skill in the art are familiar with such promoters.
As used herein, a coding sequence and the regulatory sequences (such as promoters) are said to be operably linked when they are covalently linked in such a way as to place the expression or transcription and/or translation ofthe coding sequence under the influence or control ofthe regulatory sequence. Two DNA sequences are said to be operably linked if induction of a promoter in the 5' regulatory sequence results in the transcription ofthe coding sequence and if the nature ofthe linkage between the two DNA sequences does not (1) result in the introduction of a frame-shift mutation, (2) interfere with the ability ofthe promoter region to direct the transcription ofthe coding sequence, or (3) interfere with the ability ofthe coπesponding RNA transcript to be translated into a protein. Thus, a regulatory sequence would be operably linked to a coding sequence if the gene expression sequence were capable of effecting transcription of that coding sequence such that the resulting transcript is translated into the desired protein or polypeptide. Methods for nucleic acid introduction into cells are known in the art.
The nucleic acid may be delivered to the cells alone or in association with a vector. In its broadest sense, a vector is any vehicle capable of facilitating the transfer ofthe nucleic acid to the cells so that the reporter can be expressed. The vector generally transports the nucleic acid to the cells with reduced degradation relative to the extent of degradation that would result in the absence ofthe vector, hi general, the vectors useful in the invention include, but are not limited to, plasmids, phagemids, viruses, other vehicles derived from viral or bacterial sources that have been manipulated by the insertion or incoφoration ofthe antigen nucleic acid sequences. Viral vectors are a prefeπed type of vector and include, but are not limited to, nucleic acid sequences from the following viruses: retroviras, such as Moloney murine leukemia viras, Harvey murine sarcoma vims, murine mammary tumor viras, and Rous sarcoma viras; adenoviras, adeno-associated viras; SV40-type viruses; polyoma viruses; Epstein-Ban viruses; papilloma viruses; heφes viras; vaccinia viras; polio viras; and RNA viras such as a retroviras. One can readily employ other vectors not named but known in the art.
Prefeπed viral vectors are based on non-cytopathic eukaryotic viruses in which non-essential genes have been replaced with the gene of interest. Non-cytopathic viruses include refrovirases, the life cycle of which involves reverse transcription of genomic viral RNA into DNA with subsequent proviral integration into host cellular DNA. Refrovirases have been approved for human gene therapy trials. Most useful are those refrovirases that are replication-deficient (i.e., capable of directing synthesis ofthe desired proteins, but incapable of manufacturing an infectious particle). Such genetically altered refroviral expression vectors have general utility for the high-efficiency transduction of genes in vivo. Standard protocols for producing replication-deficient refrovirases (including the steps of incoφoration of exogenous genetic material into a plasmid, transfection of a packaging cell lined with plasmid, production of recombinant refrovirases by the packaging cell line, collection of viral particles from tissue culture media, and infection ofthe target cells with viral particles) are provided in Kriegler, M., Gene Transfer and Expression, A Laboratory Manual W.H. Freeman CO., New York (1990) and Murray, E.J. Methods in Molecular Biology, vol. 7, Humana Press, Inc., Cliffton, New Jersey (1991).
A prefeπed viras for certain applications is the adeno-associated virus, a double-stranded DNA virus. The adeno-associated viras can be engineered to be replication -deficient and is capable of infecting a wide range of cell types and species. It further has advantages such as, heat and lipid solvent stability; high transduction frequencies in cells of diverse lineages, including hemopoietic cells; and lack of superinfection inhibition thus allowing multiple series of transductions. Reportedly, wild-type adeno-associated viras manifest some preference for integration sites into human cellular DNA, thereby minimizing the possibility of insertional mutagenesis and variability of inserted gene expression characteristic of refroviral infection. In addition, wild-type adeno-associated viras infections have been followed in tissue culture for greater than 100 passages in the absence of selective pressure, implying that the adeno-associated virus genomic integration is a relatively stable event. The adeno-associated viras can also function in an exfrachromosomal fashion. Recombinant adeno-associated viruses that lack the replicase protein apparently lack this integration sequence specificity.
Other vectors include plasmid vectors. Plasmid vectors have been extensively described in the art and are well-known to those of skill in the art. See e.g., Sambrook et al, Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, 1989. In the last few years, plasmid vectors have been found to be particularly advantageous for delivering genes to cells in vivo because of their inability to replicate within and integrate into a host genome. These plasmids, however, having a promoter compatible with the host cell, can express a peptide from a gene operatively encoded within the plasmid. Some commonly used plasmids include pBR322, pUC 18, pUC 19, pRc/CMV, S V40, and pBlueScript. Other plasmids are well-known to those of ordinary skill in the art. Additionally, plasmids may be custom designed using restriction enzymes and ligation reactions to remove and add specific fragments of DNA.
In general, the vectors useful in the invention are divided into two classes: biological vectors and chemical/physical vectors. Biological vectors and chemical/physical vectors are useful in the delivery and/or uptake of reporter constructs ofthe invention.
Most biological vectors are used for delivery of nucleic acids and thus would be most appropriate in the delivery of nucleic acids.
As used herein, a "chemical/physical vector" refers to a natural or synthetic molecule, other than those derived from bacteriological or viral sources, capable of delivering the reference and test compound.
A prefeπed chemical/physical vector ofthe invention is a colloidal dispersion system. Colloidal dispersion systems include lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. A prefeπed colloidal system ofthe invention is a liposome. Liposomes are artificial membrane vessels which are useful as a delivery vector in vivo or in vitro. It has been shown that large unilamellar vessels (LUV), which range in size from 0.2 - 4.0 μm can encapsulate large macromolecules. RNA, DNA and intact virions can be encapsulated within the aqueous interior and be delivered to cells in a biologically active form (Fraley, et al., Trends Biochem. Sci, (1981) 6:77). Liposomes may be targeted to a particular tissue by coupling the liposome to a specific ligand such as a monoclonal antibody, sugar, glycolipid, or protein. Ligands which may be useful for targeting a liposome to an immune cell include, but are not limited to, intact or fragments of molecules which interact with immune cell specific receptors and molecules, such as antibodies, which interact with the cell surface markers of immune cells. Such ligands may easily be identified by binding assays well known to those of skill in the art. hi still other embodiments, the liposome may be targeted to the cancer by coupling it to a one of the immunotherapeutic antibodies discussed earlier. Additionally, the vector may be coupled to a nuclear targeting peptide, which will direct the vector to the nucleus ofthe host cell. Lipid formulations for transfection are commercially available from QIAGEN, for example, as EFFECTENE™ (a non-liposomal lipid with a special DNA condensing enhancer) and SUPERFECT™ (a novel acting dendrimeric technology).
Liposomes are commercially available from Gibco BRL, for example, as LTJPOFECTIN™ and LIPOFECTACE™, which are formed of cationic lipids such as N-[l-(2, 3 dioleyloxy)-propyl]-N, N, N-trimethylammonium chloride (DOTMA) and dimethyl dioctadecylammonium bromide (DDAB). Methods for making liposomes are well known in the art and have been described in many publications. Liposomes also have been reviewed by Gregoriadis, G. in Trends in Biotechnology, (1985) 3:235-241. In some prefeπed embodiments, the method of choice for delivering DNA (for transfection) to the cells is elecfroporation, particularly where a stably transfected cell line is sought.
The present invention is further illustrated by the following Examples, which in no way should be construed as ftirther limiting.
Examples Example 1. Biological Activity of Production Lot of CpG ODN (SEQ ID NO:l) Assayed Using Cells Stably Transfected with hTLR9 Expression Vector
CpG ODN (SEQ ID NO: 1) is cuπently in preclinical and clinical trials for a number of clinical applications. SEQ ID NO: 1 has been discovered to induce signaling through TLR9. In order to assess different lots of clinical material, the methods ofthe invention are employed, using a highly characterized lot of SEQ ID NO:l as a reference.
In a TLR9 assay, the CpG-non-responsive human embryonal kidney cell line HEK293 (e.g., ATCC CRL-1573) was stably transfected with a hTLR9 expression construct and found to express full-length human TLR9 constitutively. The cells also contained a genomic copy of a reporter constract with a 6x NF-κB binding site and a luciferase gene reporter cassette. Incubation ofthe cells with CpG ODN (SEQ ID NO:l) activates NF-κB driven expression of luciferase, while incubation with medium alone (negative control) does not. The cells are then lysed and activity ofthe luciferase protein determined by its catalytic activity of luciferin oxidation which is measured in a luminometer. Results are expressed as fold induction above medium control.
Assay set-up includes a reference standard material which is highly pure and well characterized. The reference material is used to create a standard curve within a defined range where the dose-response curve is linear (e.g., in the range ofthe EC50 value for SEQ ID NO:l, 70-100 nM). The test material is dissolved for testing and assayed at a defined concentration. Activity ofthe test material is calculated using the standard curve ofthe reference material. Quality ofthe tested material is deemed acceptable if activity ofthe test material compared to activity ofthe reference material falls within predetermined limits.
Example 2. Biological Activity of Production Lot of CpG ODN (SEQ ID NO:l) Assayed Using RPMI 8226 Cells
The assay of Example 1 is performed using RPMI 8226 cells (ATCC CCL-155) in place ofthe stably transfected HEK cells of Example 1. RPMI 8226 cells naturally express human TLR9. The cells are stably transfected with a 6x NF-κB-luciferase reporter construct. It is to be understood that the assay could also be carried out by measuring a native readout such as IL-10 secretion.
Example 3. Expression Vectors for Human TLR3 (hTLR3) and Murine TLR3 (mTLR3)
To create an expression vector for human TLR3, human TLR3 cDNA was amplified by the polymerase chain method (PCR) from a cDNA made from human 293 cells using the primers 5'-GAAACTCGAGCCACCATGAGACAGACTTTGCCTTGTATCTAC-3' (sense, SEQ JD NO:152) and S'-GAAAGAATTCTTAATGTACAGAGTTTTTGGATCCAAG-S' (antisense, SEQ ID NO: 153). The primers introduce Xhol and EcoRI restriction endonuclease sites at their 5' ends for use in subsequent cloning into the expression vector. The resulting amplification product fragment was cloned into pGEM-T Easy vector (Promega), isolated, cut with^ol and EcoRI restriction endonucleases, ligated into an XholJEcoRl-digested pcDNA3.1 expression vector (Invitrogen). The insert was fully sequenced and translated into protein. The cDNA sequence conesponds to the published cDNA sequence for hTLR3, available as GenBank accession no. NM_003265 (SΕQ ID NO:7). The open reading frame codes for a protein 904 amino acids long, having the sequence coπesponding to GenBank accession no. NP_003256 (SΕQ ID NO:8). Coπesponding nucleotide and amino acid sequences for murine TLR3 (mTLR3) are known. The nucleotide sequence of mTLR3 cDNA has been reported as GenBank accession no. AF355152 (SEQ ID NO:9), and the amino acid sequence of mTLR3 has been reported as GenBank accession no. AAK26117 (SEQ ID NO:10).
Example 4. Reconstitution of TLR3 Signaling in 293 Fibroblasts
Human TLR3 cDNA and murine TLR3 cDNA in pT-Adv vector (from Clontech) were individually cloned into the expression vector pcDNA3.1(-) from Invitrogen using the EcoRI site. The resulting expression vectors mentioned above were transfected into CpG-DNA non-responsive human 293 fibroblast cells (ATCC, CRL- 1573) using the calcium phosphate method. Utilizing a "gain of function" assay it was possible to reconstitute human TLR3 (hTLR3) and murine TLR3 (mTLR3) signaling in 293 fibroblast cells.
Since NF- B activation is central to the IL-l/TLR signal transduction pathway (Medzhitov R et al. (1998) Mol Cell 2:253-8; Muzio M et al. (1998) JExp Med 187:2097-101), in a first set of experiments human 293 fibroblast cells were transfected with hTLR3 alone or co-transfected with hTLR3 and an NF-κB-driven luciferase reporter constract.
Likewise, in a second set of experiments, 293 fibroblast cells were transfected with hTLR3 alone or co-transfected with hTLR3 and an IFN-α4-driven luciferase reporter construct (described in Example 8 below).
In a third group of experiments, 293 fibroblast cells were fransfected with hTLR3 alone or co-transfected with hTLR3 and a RANTES-driven luciferase reporter constract (described in Example 14 below).
Example 5. Reconstitution of TLR7 Signaling
Methods for cloning murine and human TLR7 have been described in pending U.S. Pat. Application No. 09/954,987 and coπesponding published PCT application PCT USO 1/29229 (WO 02/22809), both filed September 17, 2001, the contents of which are incoφorated herein by reference. Human TLR7 cDNA and murine TLR7 cDNA in pT-Adv vector (from Clontech) were individually cloned into the expression vector pcDNA3.1(-) from Invitrogen using the EcoRI site. Utilizing a "gain of function" assay it was possible to reconstitute human TLR7 (hTLR7) and murine TLR7 (mTLR7) signaling in CpG-DNA non-responsive human 293 fibroblasts (ATCC, CRL-1573). The expression vectors mentioned above were fransfected into 293 fibroblast cells using the calcium phosphate method.
Example 6. Reconstitution of TLR8 Signaling Methods for cloning murine and human TLR8 have been described in pending U.S.
Pat. Application No. 09/954,987 and coπesponding published PCT application PCT/USOl/29229 (WO 02/22809), both filed September 17, 2001, the contents of which are incoφorated by reference. Human TLR8 cDNA and murine TLR8 cDNA in pT-Adv vector (from Clontech) were individually cloned into the expression vector pcDNA3.1(-) from Invitrogen using the EcoRI site. Utilizing a "gain of function" assay it was possible to reconstitute human TLR8 (hTLR8) and murine TLR8 (mTLR8) signaling in CpG-DNA non-responsive human 293 fibroblasts (ATCC, CRL-1573). The expression vectors mentioned above were transfected into 293 fibroblast cells using the calcium phosphate method.
Example 7. Reconstitution of TLR9 Signaling in 293 Fibroblasts
Methods for cloning murine and human TLR9 have been described in pending U.S. Pat. Application No. 09/954,987 and coπesponding published PCT application PCT/USOl/29229 (WO 02/22809), both filed September 17, 2001, the contents of which are incoφorated by reference. Human TLR9 cDNA and murine TLR9 cDNA in pT-Adv vector (from Clontech) were individually cloned into the expression vector pcDNA3.1(-) from Invitrogen using the EcoRI site. Utilizing a "gain of function" assay it was possible to reconstitute human TLR9 (hTLR9) and murine TLR9 (mTLR9) signaling in CpG-DNA non-responsive human 293 fibroblasts (ATCC, CRL-1573). The expression vectors mentioned above were transfected into 293 fibroblast cells using the calcium phosphate method.
To generate stable clones expressing human TLR9, murine TLR9, or either TLR9 with the NF-κB-luc reporter plasmid, 293 cells were fransfected in 10 cm plates (2x106 cells/plate) with 16 μg of DNA and selected with 0.7 mg/ml G418 (PAA Laboratories GmbH, Cδlbe, Germany). Clones were tested for TLR9 expression by RT-PCR, for example as shown in Fig. 21. The clones were also screened for IL-8 production or NF- B-luciferase activity after stimulation with ODN. Four different types of clones were generated. 293-hTLR9-luc: expressing human TLR9 and 6x NF-κB-luciferase reporter
293-mTLR9-luc: expressing murine TLR9 and 6x NF-κB-luciferase reporter 293-hTLR9: expressing human TLR9
293-mTLR9 : expressing murine TLR9
Human 293 fibroblast cells were transiently transfected with hTLR9 and a 6x NF-κB-luciferase reporter plasmid (NF-κB-luc, kindly provided by Patrick Baeuerle, Munich, Germany) (Fig. 18 A) or with hTLR9 alone (Fig. 18B). After stimulus with CpG-ODN (2μM, TCGTCGTTTTGTCGTTTTGTCGTT, SEQ ID NO:l), GpC-ODN (2μM, TGCTGCTTTTGTGCTTTTGTGCTT, SEQ ID NO: 154), LPS (100 ng/ml) or media, NF-κB activation by luciferase readout (8h, Fig. 18 A) or IL-8 production by ELISA (48h, Fig. 18B) was monitored. Results are representative of three independent experiments. Fig. 18 shows that cells expressing hTLR9 responded to CpG-DNA but not to LPS.
Human 293 fibroblast cells were transiently transfected with mTLR9 and the NF- B-luc constract. Similar data was obtained for IL-8 production (not shown). Thus expression of TLR9 (human or mouse) in 293 cells results in a gain of function for CpG DNA stimulation similar to hTLR4 reconstitution of LPS responses.
Figs. 19 and 20 demonstrate the responsiveness of a stable 293-mTLR9-luc and 293-hTLR9-luc clones after stimulation with CpG-ODN (2μM, SEQ ID NO:l), GpC-ODN (2μM, SEQ ID NO:154), Me-CpG-ODN (2μM; TZGTZGTTTTGTZGTTTTGTZGTT, Z = 5-methylcytidine, SEQ JD NO: 147), LPS (100 ng/ml) or media, as measured by monitoring NF-κB activation. Similar results were obtained utilizing IL-8 production with the stable clones. These results demonstrate that CpG-DNA non-responsive cell lines can be stably genetically complemented with TLR9 to become responsive to CpG DNA in a motif-specific manner.
Example 8. Method of Making IFN-α4 Reporter Vector
A number of reporter vectors may be used in the practice ofthe invention. Some of the reporter vectors are commercially available, e.g., the luciferase reporter vectors pNF-κB-Luc (Stratagene) and pAPl-Luc (Stratagene). These two reporter vectors place the luciferase gene under control of an upstream (5') promoter region derived from genomic DNA for NF- B or API, respectively. Other reporter vectors can be constructed following standard methods using the desired promoter and a vector containing a suitable reporter, such as luciferase, β-galactosidase (β-gal), chloramphenicol acetyltransferase (CAT), and other reporters known by those skilled in the art. Following are some examples of reporter vectors constructed for use in the present invention. IFN-α4 is an immediate-early type 1 IFN. Sequence-specific PCR products for the -
620 to +50 promoter region of IFN-α4 were derived from genomic DNA of human 293 cells and cloned into the Smal site ofthe pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -620 to +50 promoter region of IFN-α4. The sequence ofthe -620 to +50 promoter region of IFN-α4 is provided as SEQ ID NO:121.
Example 9. Method of Making IFN-αl Reporter Vector
IFN-αl is a late type 1 IFN. Sequence-specific PCR products for the -140 to +9 promoter region of IFN-αl were derived from genomic DNA of human 293 cells and cloned into Smal site ofthe pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -140 to +9 promoter region of IFN-αl. A sequence ofthe -140 to +9 promoter region of IFN-αl is provided as SEQ ID NO: 122.
Example 10. Method of Making IFN-β Reporter Vector IFN-β is an immediate-early type 1 TEN. The -280 to +20 promoter region of IFN-β was derived from the pUCβ26 vector (Algarte M et al. (1999) J Virol 73:2694-702) by restriction at EcoRI and Taql sites. The 300 bp restriction fragment was filled in by Klenow enzyme and cloned into N?eI-digested and filled in pGL3 -Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -280 to +20 promoter region of IFΝ-β. A sequence ofthe -280 to +20 promoter region of IFΝ-β is provided as SEQ ID ΝO:123.
Example 11. Method of Making Human IL-6 Reporter Vectors
Reporter constructs are made using the -285 to +7 promoter region derived from human IL-6 genomic DNA. (Takeshita et al. Eur. j. Immunol. 2000. 30: 108-116.) In one reporter constract the IL-6 promoter region is cloned as a Kpnl-Xhol insert into pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (51) -288 to +7 promoter region derived from human IL-6 genomic DNA. A sequence ofthe -288 to +7 promoter region of human IL-6 is provided as SEQ ID NO: 128.
The promoter can also be derived from the full-length promoter region ofthe IL-6 gene from -1174 to + 7 (GenBank Accession No M22111) as shown below as SEQ ID NO: 129.
Example 12. Method of Making Human IL-8 Reporter Vectors
Reporter constructs have been made using a -546 to +44 and a truncated -133 to +44 promoter region derived from human IL-8 genomic DNA. Mukaida N et al. (1989) J Immunol 143:1366-71. In each reporter constract the IL-8 promoter region was cloned as a Kpnl-Xhol insert into pGL3-Basic Vector (Promega). One ofthe resulting expression vectors includes a luciferase gene under control of an upstream (5') -546 to +44 promoter region derived from human IL-8 genomic DNA. Another ofthe resulting expression vectors includes a luciferase gene under control of an upsfream (5') -133 to +44 promoter region derived from human IL-8 genomic DNA.
The promoter can also be the upsfream (5') -734 to +44 or the upstream (5') -162 to +44 promoter region derived from human IL-8 genomic DNA. Mukaida N et al. (1989) J Immunol 143:1366-71. A sequence ofthe -734 to +44 promoter region derived from human IL-8 is provided below as SEQ ID NO: 130.
Example 13. Method of Making Human IL-12 p40 Reporter Vectors
Reporter constructs have been made using truncated (-250 to +30, SEQ ID NO:127) and full length (-751 to +30, SEQID NO:126) promoter regions derived from human IL-12 p40 genomic DNA. (Takeshita et al. Eur. J. Immunol. 2000. 30: 108-116.) In one reporter construct the truncated IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into pβgal-Basic (Promega). The resulting expression vector includes a β gal gene under control of an upsfream (5') -250 to +30 promoter region of human IL-12 p40. In a second reporter constract the full length IL-12 p40 promoter was cloned as a Kpnl-Xhol insert into pβgal-Basic (Promega). The resulting expression vector includes a β gal gene under control of an upstream (5') -751 to +30 promoter region of human IL-12 p40. In a third reporter constract the truncated -250 to +30 promoter region of human IL-12 p40 was cloned into the pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -250 to +30 promoter region of human IL-12 p40. In a fourth reporter construct the full length IL-12 p40 promoter of human IL-12 p40 was cloned into the pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -751 to +30 promoter region of human IL-12 p40. A sequence ofthe -751 to +30 promoter region of human IL-12 p40 is provided as SEQ ID NO: 126.
Example 14. Method of Making RANTES Reporter Vector
Transcription ofthe chemokine RANTES is believed to be regulated at least in part by IRF3 and by NF- B. Lin R et al. (1999) JMol Cell Biol 19(2):959-66; Genin P et al. (2000) J Immunol 164:5352-61. A 483 bp sequence-specific PCR product including the -397 to +5 promoter region of RANTES was derived from genomic DNA of human 293 cells, restricted with Pstl and cloned into pCAT-Basic Vector (Promega) using Hindlll (filled in with Klenow) and Pstl sites (filled in). The -397 to +5 promoter region of RANTES was then isolated from the resulting RANTES/chloramphenicol acetyltransferase (CAT) reporter plasmid by restriction with BglU and Sail, filled in with Klenow enzyme, and cloned into the Nhel site (filled in with Klenow) ofthe pGL3-Basic Vector (Promega). The resulting expression vector includes a luciferase gene under control of an upstream (5') -397 to +5 promoter region of RANTES. Comparison ofthe insert sequence -397 to +5 of Genin P et al. (2000) J Immunol 164:5352-61 and GenBank accession no. AB023652 (SEQ ID NO:125) revealed two point deletions (at positions 105 and 273 of SEQ 3D NO: 125) which do not create new restriction sites. A sequence ofthe -397 to +5 promoter region of RANTES is provided as SEQ ID NO: 125.
Example 15. RT-PCR Analysis of Cell Lines for TLR Expression TLR expression was determined using total RNA of cells prepared by standard methods (QIAGEN). RNA was transcribed to cDNA using AMV Reverse Transcriptase (Roche). Quantitative PCR was performed with TLR-gene specific primer sets using a LightCycler mstrament (Roche). Controls for genomic DNA impurities were performed by a similar PCR method using RNA (but without reverse transciptase). A variety of cell lines was screened for their expression of TLR3, 7, 8 and 9. These cell lines are A549 (human lung carcinoma), BeWo (human choriocarcinoma), HeLa (human cervix carcinoma), Hep-2 (human cervix carcinoma), KG-1 (human acute myeloid leukemia), MUTZ-3 (human acute myelomonocytic leukemia), Nalm-6 (human B cell precursor leukemia), NK-92 (human Natural killer cell line), NK-92 MI (human Natural killer cell line, IL-2 independent), Raji (human Burkitt's lymphoma, B lymphocyte), RAMOS (Burkitt's lymphoma, B lymphocyte), RPMI 8226 (human multiple myeloma, B lymphocyte), THP-1 (human acute monocytic leukemia), U937 (human lymphoma) and Jurkat (human T cell leukemia).
All B cell lines express, as determined by Real Time-PCR (RT-PCR), endogenous TLR9. In addition, all lines except NALM co-express TLR7. Nevertheless, none ofthe other cell lines appeared to express TLR7, whereas low TLR9 expression on the mRNA level was observed for KG-1 and THP-1. TLR3 appeared to be expressed in most of these cell lines, with the highest mRNA levels for example in the NK cell lines (e.g., NK-92).
Raji cells contain high levels of TLR9 mRNA and low levels of TLR3 and TLR7 mRNA suggesting high expression of TLR9 protein and lower levels of TLR3 and TLR7 protein.
These results indicate that the cell lines expressing TLR9 can be used to screen potential new TLR9 ligands (CpG ODN, etc.), cell lines expressing TLR7 to screen potential new TLR7 ligands (ORN (oligoribonucleotides), small molecules, etc.), and cell lines expressing both receptors may be used to screen for "hybrid" TLR7 and 9 agonists. In addition, cell lines lacking TLR8 expression (i.e., all cell lines tested) can be used to confirm the specificity of a TLR7 versus a TLR8 ligand (i.e., the latter should not be able to stimulate TLR7-expressing cells). In contrast, cell lines expressing TLR3 (e.g., Raji cells) may be used to screen for potential new TLR3 ligands (dsRNA, etc.).
Example 16. Screening of Various Cell Lines for Responses to TLR Ligands
Except where otherwise indicated, the following general methods were used. Cells were plated at 5 x 105/ml in 48 well plates in RPMI medium with 10% FBS. Stimulation was performed by addition ofthe oligonucleotides or other compounds diluted to the test concentrations in TE. Cells were incubated for 24 or 48h and the supernatants were taken to analyse for the presence of cytokines or chemokines. The TLR ligands used are as follows: TLR3: Poly I:C
TLR7, TLR8: R-848
TLR9:
T*C*C*A*G*G*A*C*T*T*C*T*C*T*C*A*G*G*T*T (SEQ ID NO: 2); T*C*G*T*C*G*T*T*T*T*G*T*C*G*T*T*T*T*G*T*C*G*T*T (SEQ ID NO: 1)* T*G*C*T*G*C*T*T*T*T*G*T*G*C*T*T*T*T*G*T*G*C*T*T (SEQ ID NO: 154)' T*C*G*T*C*G*T*T*T*T*C*Q*G*C* *C*G*C*G*C*C*G (SEQ ID NO: 158); G*G*G_G_A_C_G_A_C_G_T_C_G_T_G_G*G*G*G*G*G (SEQ ID NO: 159); τ*G*C*T*G*C*T*T*T*T*C*G*G*C*G*G*C*C*G*C*C*G (SEQ ID NO: 160); G*G*G_G_A_G_C_A_G_C_T_G_C_T_G_G*G*G*G*G*G (SEQ ID NO: 161). * phosphorothioate linkage; _ phosphodiester linkage.
Increased expression of cell surface markers was determined using cells stimulated as described above and then stained with different monoclonal antibody combinations specific for the cell surface markers. Analysis ofthe cells was performed by flow cytometry.
Changes in reporter gene activity were determined using cells fransfected with a NF-κB reporter constract (Stratagene) and a /3-galactosidase reporter control plasmid (Invitrogen) using elecfroporation. For NF-κB analysis, a 5x NF-κB-Luciferase Vector (Stratagene) was used. The amount of DNA transfected as well as cell concentration was varied. Stimulation was performed 24h after transfection. Cells were stimulated with the indicated amounts of ODN, R-848, LPS, TNF-α, or IL-1 β for the indicated incubation times. Cell extracts were prepared by lysing the cells in 100 μl reporter lysis buffer (Promega) using the freeze-thaw method. All data were normalized for /3-galactosidase expression. Stimulation indices were calculated in reference to luciferase activity of medium without addition of ODN.
Stimulation ofthe Raji cell line with a TLR9 ligand (CpG ODN), a TLR3 ligand (poly I:C) or a TLR7 ligand (R-848) results in the ligand-specific secretion of cytokines. Figs. 14 and 15 show IL-6 production of Raji cells upon stimulation with ODN, poly I:C or R-848. Fig. 16 shows IFN-α2 production of Raji cells upon stimulation with ODN, poly I:C or R-848. h all assays, cells were incubated with Na-Butyrate for 48h before stimulation with TLR ligands. CpG stimulation ofthe RAMOS cell lines can result in the CpG-specific upregulation of cell surface markers such as CD80, as shown in Fig. 17.
Example 17. Inhibition of a Positive Reference Compound Response with an Inhibitory Test Compound
Inhibition of CpG mediated chemokine production was determined using RPMI 8226 cells incubated with increasing amounts of SEQ ID NO:l in the presence of an immunoinhibitory ODN (SEQ ID NO: 151). IP-10 production was measured 24h later by ELISA (Fig. 9).
Equivalents The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the invention. The present invention is not to be limited in scope by examples provided, since the examples are intended as a single illustration of one aspect of the invention and other functionally equivalent embodiments are within the scope ofthe invention. Various modifications ofthe invention in addition to those shown and described herein will become apparent to those skilled in the art from the foregoing description and fall within the scope ofthe appended claims. The advantages and objects ofthe invention are not necessarily encompassed by each embodiment ofthe invention.
All references, patents and patent publications that are recited in this application are incoφorated in their entirety herein by reference.
We claim:

Claims

Claims
1. A screening method for identifying agonists of Toll-like receptor (TLR) signaling activity, comprising contacting an RPMI 8226 cell that expresses a TLR with a test compound and measuring a test level of TLR signaling activity, wherein a test level that is positive is indicative of a test compound that is a TLR agonist, and wherein the TLR signaling activity is selected from the group consisting of CD71 expression, CD86 expression, HLA-DR expression, IL-8 expression, IL-8 production, IL-8 secretion, IL- 10 expression, TX- 10 production, IL- 10 secretion, IP- 10 expression, 3P- 10 production, IP- 10 secretion, TNF-α expression, TNF-α production and TNF-α secretion.
2. A screening method for identifying agonists of Toll-like receptor (TLR) signaling activity, comprising contacting a cell that expresses a TLR with a test compound and measuring a test level of TLR signaling activity, wherein a test level that is positive is indicative of an immunostimulatory compound, and wherein the cell is a Raji cell, a RAMOS cell, a Nairn cell, a THP-1 cell, or a KG- 1 cell.
3. The method of claim 1 or 2, wherein the test level is positive relative to a reference level determined by contacting the cell with a reference compound and measuring a reference TLR signaling activity.
4. The method of claim 3, wherein the reference compound is a positive reference compound
5. The method of claim 4, wherein the positive reference compound is selected from the group consisting of an immunostimulatory nucleic acid and an imidazoquinoline compound.
6. The method of claim 3, wherein the reference compound is a negative reference compound.
7. The method of claim 6, wherein the negative reference compound is medium alone.
8. The method of claim 5, wherein the immunostimulatory nucleic acid is selected from the group consisting of a CpG nucleic acid, a T-rich nucleic acid, a poly-T nucleic acid and a poly-G nucleic acid.
9. The method of claim 5, wherein the imidazoquinoline compound is selected from the group consisting of R-848 and R-847.
10. The method of claim 1 or 2, wherein the test compound is a nucleic acid. i
11. The method of claim 10, wherein the nucleic acid does not comprise a motif selected from the group consisting of a CpG motif, a poly-T motif, a T-rich motif and a poly-G motif.
12. The method of claim 10, wherein the nucleic acid comprises a phosphorothioate backbone linkage.
13. The method of claim 10, wherein the nucleic acid is a DNA, an RNA or a DNA-RNA hybrid.
14. The method of claim 1 or 2, wherein the test compound is a non- nucleic acid small molecule.
15. The method of claim 1 or 2, wherein the test compound comprises an amino acid, a carbohydrate, a lipid, or a hormone.
16. The method of claim 15, wherein the carbohydrate is a polysaccharide.
17. The method of claim 1 or 2, wherein the test compound is derived from a molecular library.
18. The method of claim 1, wherein the cell is transfected with a nucleic acid.
19. The method of claim 18, wherein the nucleic acid encodes a TLR or a reporter constract.
20 The method of claim 2, wherein the cell is transfected with a nucleic acid.
21. The method of claim 20, wherein the nucleic acid encodes a TLR or a reporter constract.
22. The method of claim 19 or 21, wherein the TLR is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and TLR10.
23. The method of claim 22, wherein the TLR is a human TLR.
24. The method of claim 19 or 21 , wherein the reporter constract is selected from the group consisting of a luciferase reporter constract, a /3-galactosidase reporter constract, a chloramphenicol acetylfransferase reporter constract, a green fluorescent protein reporter construct, and a secreted alkaline phosphatase constract.
25. The method of claim 19 or 21 , wherein the reporter construct comprises a TLR responsive promoter.
26. The method of claim 25, wherein the TLR responsive promoter comprises a transcription factor bmding site selected from the group consisting of a NF-κB binding site, an AP-1 binding site, a CRE, a SRE, an ISRE, a GAS, an ATF2 binding site, an TJRF3 binding site, an IRF7 binding site, an NFAT binding site, a p53 binding site, an SRF binding site, and a TARE.
27. The method of claim 25, wherein the TLR responsive promoter is a promoter region selected from the group consisting of an IL-1 promoter region, an IL-6 promoter region, an IL-8 promoter region, an IL-10 promoter region, an IL-12 p40 promoter region, an IFN-αl promoter region, an IFN-α4 promoter region, an IFN-/3 promoter region, an IFN-γ promoter region, a TNF-α promoter region, a TNF-/3 promoter region, an IP-9 promoter region, an IP-10 promoter region, a RANTES promoter region, an ITAC promoter region, a MCP-1 promoter region, an IGFBP4 promoter region, a CD54 promoter region, a CD69 promoter region, a CD71 promoter region, a CD80 promoter region, a CD86 promoter region, a HLA-DR promoter region, and a HLA class I promoter region.
28. The method of claim 18 or 20, wherein the cell is stably fransfected.
29. The method of claim 1 or 2, wherein the TLR signaling activity is measured by cytokine secretion or chemokine secretion.
30. The method of claim 1, wherein the TLR signaling activity is selected from the group consisting of IL-8 secretion, IL-10 secretion, IP-10 secretion and TNF-α secretion.
31. The method of claim 2, wherein the TLR signaling activity is selected from the group consisting of IL-6 expression, IL-6 production, IL-6 secretion, IL-8 expression, IL-8 production, IL-8 secretion, IL-10 expression, IL-10 production, IL-10 secretion, IP-10 expression, 3P- 10 production, IP-10 secretion, IL-12 expression, IL-12 production, IL-12 secretion, TNF-α expression, TNF-α production and TNF-α secretion.
32. The method of claim 2, wherein the TLR signaling activity is measured by phosphorylation.
33. The method of claim 32, wherein phosphorylation is total cellular phosphorylation.
34. The method of claim 32, wherein phosphorylation is phosphorylation of a factor selected from the group consisting of IRAK, ERK, MyD88, TRAF6, p38, NFkB subunits, c-Jun and c-Fos.
35. The method of claim 1 or 2, wherein the TLR signaling activity is measured by gene expression.
36. The method of claim 1 , wherein the TLR signaling activity is measured by gene expression selected from the group consisting of CD71 expression, CD86 expression,
HLA-DR expression, IL-8 expression, IL-10 expression, IP-10 expression, and TNF-α expression.
37. The method of claim 35, wherein TLR signaling activity is measured by microaπay techniques.
38. The method of claim 2, wherein the TLR signaling activity is measured by cell proliferation.
39. The method of claim 1 or 2, wherein TLR signaling activity is measured by cell surface marker expression.
40. The method of claim 1 , wherein TLR signaling activity is measured by cell surface expression of CD71, CD86 or HLA-DR.
41. The method of claim 2, wherein TLR signaling activity is measured by CD71 cell surface expression, CD86 cell surface expression, HLA-DR cell surface expression, CD80 cell surface expression, HLA class I cell surface expression, CD54 cell surface expression and CD69 cell surface expression.
42. The method of claim 2, wherein TLR signaling activity is measured by antibody secretion.
43. The method of claim 42, wherein the antibody secretion is IgM secretion.
44. A composition comprising an RPMI 8226 cell stably transfected with a nucleic acid encoding a TLR polypeptide, or a fragment thereof.
45. The composition of claim 44, further comprising a reporter constract comprising a promoter and a reporter sequence wherein the promoter is a TLR responsive promoter.
46. The composition of claim 45, wherein the TLR responsive promoter comprises a nucleic acid sequence selected from the group consisting of an NF-κB binding site, an AP-1 binding site, a CRE, a SRE, an ISRE, a GAS, an ATF2 binding site, an IRF3 binding site, an IRF7 binding site, an NFAT binding site, a p53 binding site, an SRF binding site, and a TARE.
47. The composition of claim 45, wherein the reporter sequence is selected from the group consisting of a luciferase sequence, a /3-galactosidase sequence, a green fluorescent protein sequence, a secreted alkaline phosphatase sequence and a chloramphenicol transferase sequence.
48. The composition of claim 44, wherein the TLR polypeptide or fragment thereof is a human TLR polypeptide or fragment thereof.
49. The composition of claim 44, wherein the TLR polypeptide or fragment thereof is selected from the group consisting of TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and TLR10.
50. The composition of claim 44, wherein the TLR polypeptide or fragment thereof is a human TLR polypeptide.
51. A screening method for identifying agonists of Toll-like receptor (TLR) signaling activity, comprising contacting an cell that ectopically expresses a TLR with a test compound and measuring a test level of TLR signaling activity, wherein a test level that is positive is indicative of a test compound that is a TLR agonist, and wherein the cell that ectopically expresses a TLR is selected from the group consisting of RPMI 8226, RAMOS, Raji, Nairn, THP-1, KG-1 and 293 HEK.
52. The method of claim 51, wherein the test level is positive relative to a reference level determined by contacting the cell with a reference compound and measuring a reference TLR signaling activity.
53. The method of claim 52, wherein the reference compound is a positive reference compound.
54. The method of claim 53, wherein the positive reference compound is selected from the group consisting of an immunostimulatory nucleic acid and an imidazoquinoline compound.
55. The method of claim 54, wherein the immunostimulatory nucleic acid is selected from the group consisting of a CpG nucleic acid, a T-rich nucleic acid, a poly-T nucleic acid and a poly-G nucleic acid.
56. The method of claim 54, wherein the imidazoquinoline compound is selected from the group consisting of R-848 and R-847.
57. The method of claim 52, wherein the reference compound is negative reference compound.
58. The method of claim 57, wherein the negative reference compound is medium alone.
59. The method of claim 51 , wherein the test compound is a nucleic acid.
60. The method of claim 59, wherein the nucleic acid does not comprise a motif selected from the group consisting of a CpG motif, a poly-T motif, a T-rich motif and a poly-G motif.
61. The method of claim 59, wherein the nucleic acid comprises a phosphorothioate backbone linkage.
62. The method of claim 59, wherein the nucleic acid is a DNA, an RNA, or a DNA-RNA hybrid.
63. The method of claim 51 , wherein the test compound is a non-nucleic acid small molecule.
64. The method of claim 51 , wherein the test compound comprises an amino acid, a carbohydrate, a lipid, or a hormone.
65. The method of claim 64, wherein the carbohydrate is a polysaccharide.
66. The method of claim 51 , wherein the test compound is derived from a molecular library.
67. The method of claim 51 , wherein the TLR signaling activity is selected from the group consisting of CD71 expression, CD86 expression, HLA-DR expression, IL-6 expression, IL-6 production, IL-6 secretion, IL-8 expression, IL-8 production, 3L-8 secretion, IL-10 expression, IL-10 production, IL-10 secretion, IL-12 expression, IL-12 production, IL- 12 secretion, IP-10 expression, IP-10 production, IP-10 secretion, TNF-α expression, TNF-α production and TNF-α secretion.
68. The method of claim 51 , wherein the TLR is selected from the group consisting of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and TLR10.
69. The method of claim 51 , wherein the TLR is a human TLR.
70. The method of claim 51 , wherein the cell is fransfected with a reporter constract.
71. The method of claim 70, wherein the reporter constract is selected from the group consisting of a luciferase reporter construct, a /3-galactosidase reporter constract, a chloramphenicol acetylfransferase reporter construct, a green fluorescent protein reporter constract, and a secreted alkaline phosphatase constract.
72. The method of claim 71 , wherein the TLR signaling activity is measured by luciferase expression, /3-galactosidase expression, chloramphenicol expression, acetylfransferase expression, green fluorescent protein expression, alkaline phosphatase expression and alkaline phosphatase secretion.
73. The method of claim 71 , wherein the reporter construct comprises a TLR responsive promoter.
74. The method of claim 25 or 73, wherein the TLR responsive promoter is a TLRl responsive promoter, a TLR2 responsive promoter, a TLR3 responsive promoter, a TLR4 responsive promoter, a TLR5 responsive promoter, a TLR6 responsive promoter, a TLR7 responsive promoter, a TLR8 responsive promoter, a TLR9 responsive promoter and a TLR10 responsive promoter.
75. The method of claim 73 , wherein the TLR responsive promoter comprises a transcription factor binding site selected from the group consisting of an NF- B binding site, an AP-1 binding site, a CRE, a SRE, an ISRE, a GAS, an ATF2 binding site, an IRF3 bmding site, an IJ F7 binding site, an NFAT binding site, a p53 binding site, an SRF binding site, and a TARE.
76. The method of claim 73, wherein the TLR responsive promoter is a promoter region selected from the group consisting of an IL-1 promoter region, an IL-6 promoter region, an IL-8 promoter region, an IL-10 promoter region, an IL-12 p40 promoter region, an IFN-αl promoter region, an IFN-α4 promoter region, an IFN-/3 promoter region, an IFN-γ promoter region, a TNF-α promoter region, a TNF-/3 promoter region, an 3P-9 promoter region, an IP-10 promoter region, a RANTES promoter region, an ITAC promoter region, a MCP-1 promoter region, an IGFBP4 promoter region, a CD54 promoter region, a CD69 promoter region, a CD71 promoter region, a CD80 promoter region, a CD86 promoter region, a HLA-DR promoter region, and a HLA class I promoter region.
77. The method of claim 51 , wherein the cell is stably transfected with a TLR nucleic acid.
78. The method of claim 70, wherein the cell is stably transfected with the reporter construct.
79. The method of claim 51 , wherein the TLR signaling activity is measured by cytokine secretion or chemokine secretion.
80. The method of claim 79, wherein the cytokine secretion or chemokine secretion is selected from the group consisting of IL-8 secretion, TNF-α secretion, IL-10 secretion and IP-10 secretion.
81. The method of claim 79, wherein the cytokine secretion or chemokine secretion is selected from the group consisting of IL-6 secretion and IL-12 secretion.
82. The method of claim 51 , wherein the TLR signaling activity is measured by phosphorylation.
83. The method of claim 82, wherein phosphorylation is total cellular phosphorylation.
84. The method of claim 82, wherein phosphorylation is phosphorylation of a factor selected from the group consisting of IRAK, ERK, MyD88, TRAF6, p38, NF-κB subunits, c-Jun and c-Fos.
85. The method of claim 51 , wherein the TLR signaling activity is measured by gene expression.
86. The method of claim 85, wherein the gene expression is selected from the group consisting of IL-8 expression, IL-10 expression, IP-10 expression, CD71 expression, CD86 expression and HLA-DR expression.
87. The method of claim 85, wherein the gene expression is selected from the group consisting of IL-6 expression, IL-12 expression and TNF-α expression.
88. The method of claim 51 , wherein the TLR signaling activity is measured by microaπay techniques.
89. The method of claim 51 , wherein the TLR signaling activity is measured by cell proliferation.
90. The method of claim 51 , wherein the TLR signaling activity is measured by cell surface marker expression.
91. The method of claim 90, wherein the cell surface marker expression is selected from the group consisting of CD71 cell surface expression, CD 86 cell surface expression and HLA-DR cell surface expression.
92. The method of claim 90, wherein the cell surface marker expression is selected from the group consisting of CD80 cell surface expression, HLA class I cell surface expression, CD54 cell surface expression and CD69 cell surface expression.
93. The method of claim 51 , wherein the TLR signaling activity is measured by antibody secretion.
94. The method of claim 93, wherein the antibody secretion is IgM secretion.
95. A screening method for identifying antagonists of Toll-like receptor (TLR) signaling activity, comprising contacting a cell with a positive reference compound and measuring a reference level of TLR signaling activity, contacting the cell with the positive reference compound and a test compound, and measuring a test level of TLR signaling activity, wherein a test level that is less than a reference level is indicative of test compound that is a TLR antagonist, and wherein the cell is selected from the group consisting of a RPMI 8226 cell, a RAMOS cell, a Raji cell, a THP-1 cell, a Nairn cell and a KG-1 cell.
96. The method of claim 95, wherein the positive reference compound is selected from the group consisting of an immunostimulatory nucleic acid and an immunostimulatory imidazoquinoline compound.
97. The method of claim 96, wherein the immunostimulatory nucleic acid is selected from the group consisting of a CpG nucleic acid, a T-rich nucleic acid, a poly-T nucleic acid and a poly-G nucleic acid.
98. The method of claim 96, wherein the imidazoquinoline compound is selected from the group consisting of R-848 and R-847.
99. The method of claim 95, wherein the test compound is a nucleic acid.
100. The method of claim 99, wherein the nucleic acid does not comprise a motif selected from the group consisting of a CpG motif, a poly-T motif, a T-rich motif and a poly-G motif.
101. The method of claim 99, wherein the nucleic acid comprises a phosphorothioate backbone linkage.
102. The method of claim 99, wherein the nucleic acid is a DNA, an RNA or a DNA-RNA hybrid.
103. The method of claim 95, wherein the test compound is a non-nucleic acid small molecule.
104. The method of claim 95, wherein the test compound comprises an amino acid, a carbohydrate, a lipid, or a hormone.
105. The method of claim 104, wherein the carbohydrate is a polysaccharide.
106. The method of claim 95, wherein the test compound is derived from a molecular library.
107. The method of claim 95, wherein the experimental cell is transfected with a nucleic acid.
108. The method of claim 107, wherein the nucleic acid encodes a TLR or a reporter constract.
109. The method of claim 108, wherein the TLR is selected from the group consisting of TLRl, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9 and TLR10.
110. The method of claim 108, wherein the TLR is a human TLR.
111. The method of claim 108, wherein the reporter construct is selected from the group consisting of a luciferase reporter constract, a /3-galactosidase reporter constract, a chloramphenicol acetylfransferase reporter constract, a green fluorescent protein reporter construct, and a secreted alkaline phosphatase constract.
112. The method of claim 111, wherein the TLR signaling activity is selected from the group consisting of luciferase expression, /3-galactosidase expression, chloramphenicol acetylfransferase expression, green fluorescent protein expression, alkaline phosphatase expression and alkaline phosphatase secretion.
113. The method of claim 108, wherein the reporter constract comprises a TLR responsive promoter.
114. The method of claim 113, wherein the TLR responsive promoter comprises a transcription factor binding site selected from the group consisting of an NF-κB bmding site, an AP-1 binding site, a CRE, a SRE, an ISRE, a GAS, an ATF2 binding site, an IJ F3 binding site, an IRF7 binding site, an NFAT binding site, a p53 binding site, an SRF binding site, and a TARE.
115. The method of claim 113, wherein the TLR responsive promoter is a promoter region selected from the group consisting of an IL-1 promoter region, an IL-6 promoter region, an IL-8 promoter region, an IL-10 promoter region, an IL-12 p40 promoter region, an IFN-αl promoter region, an IFN-α4 promoter region, an IFN-/3 promoter region, an IFN-γ promoter region, a TNF-α promoter region, a TNF-/3 promoter region, an IP-9 promoter region, an IP-10 promoter region, a RANTES promoter region, an ITAC promoter region, a MCP-1 promoter region, an IGFBP4 promoter region, a CD54 promoter region, a CD69 promoter region, a CD71 promoter region, a CD 80 promoter region, a CD 86 promoter region, a HLA-DR promoter region, and a HLA class I promoter region.
116. The method of claim 113, wherein the TLR responsive promoter is selected from the group consisting of a TLRl responsive promoter, TLR2 responsive promoter, a TLR3 responsive promoter, a TLR4 responsive promoter, a TLR5 responsive promoter, a TLR6 responsive promoter, a TLR7 responsive promoter, a TLR8 responsive promoter, a TLR9 responsive promoter and a TLR 10 responsive promoter.
117. The method of claim 107, wherein the cell is stably transfected with the nucleic acid.
118. The method of claim 95, wherein the TLR signaling activity is measured by cytokine secretion or chemokine secretion.
119. The method of claim 118, wherein the cytokine secretion or chemokine secretion is selected from the group consisting of IL-6 secretion, IL-12 secretion and TNF-α secretion.
120. The method of claim 118, wherein the cytokine secretion or chemokine secretion is selected from the group consisting of IL-8 secretion, IL-10 secretion and IP-10 secretion.
121. The method of claim 95 , wherein the TLR signaling activity is measured by phosphorylation.
122. The method of claim 121, wherein phosphorylation is total cellular phosphorylation.
123. The method of claim 122, wherein phosphorylation is phosphorylation of a factor selected from the group consisting of IRAK, ERK, MyD88, TRAF6, p38, NF-κB subunits, c-Jun and c-Fos.
124. The method of claim 95, wherein the TLR signaling activity is measured by gene expression.
125. The method of claim 124, wherein the gene expression is selected from the group consisting of CD71 expression, CD86 expression, HLA-DR expression, IL-8 expression, 3L-10 expression and 3P-10 expression.
126. The method of claim 124, wherein the gene expression is selected from the group consisting of IL-6 expression, IL-12 expression and TNF-α expression.
127. The method of claim 95, wherein the TLR signaling activity is measured by microaπay techniques.
128. The method of claim 95, wherein the TLR signaling activity is measured by cell proliferation.
129. The method of claim 95, wherein the TLR signaling activity is measured by cell surface marker expression.
130. The method of claim 129, wherein the cell surface marker expression is selected from the group consisting of CD71 cell surface expression, CD86 cell surface expression and HLA-DR MHC class II cell surface expression.
131. The method of claim 129, wherein the cell surface marker expression is selected from the group consisting of CD 80 cell surface expression, HLA class I cell surface expression, CD54 cell surface expression and CD69 cell surface expression.
132. The method of claim 95, wherein the TLR signaling activity is measured by antibody secretion.
133. The method of claim 132, wherein the antibody secretion is IgM secretion.
134. The method of claim 95, wherein the cell is contacted to the positive reference compound and the test compound simultaneously.
135. The method of claim 95, wherein the cell is contacted to the positive reference compound prior to contact with the test compound.
136. The method of claim 95, wherein the cell is contacted to the test compound prior to contact with the positive reference compound.
137. A method for quality assessment of a test composition containing a known Toll like receptor (TLR) ligand, comprising: measuring a reference activity of a reference composition comprising a known TLR ligand, wherein the known TLR ligand is a nucleic acid molecule; measuring a test activity of a test composition comprising the known TLR ligand; and comparing the test activity to the reference activity.
138. The method of claim 137, further comprising selecting the test composition if the test activity falls within a predetermined range of variance about the reference activity.
139. The method of claim 1 , wherein the reference composition is a first production lot of a pharmaceutical composition comprising the known TLR ligand, and wherein the test composition is a second production lot of a pharmaceutical composition comprising the known TLR ligand.
140. The method of claim 137, wherein the reference composition is a first in-process lot of a composition comprising the known TLR ligand, and wherein the test composition is a second in-process lot of a composition comprising the known TLR ligand.
141. The method of claim 137, wherein the measuring the reference activity comprises contacting the reference composition with an isolated cell expressing a TLR responsive to the known TLR ligand, and wherein the measuring the test activity comprises contacting the test composition with the isolated cell expressing a TLR responsive to the known TLR ligand.
142. The method of claim 141, wherein the isolated cell expressing the TLR responsive to the known TLR ligand comprises an expression vector for the TLR responsive to the known TLR ligand.
143. The method of claim 141, wherem the isolated cell expressing the TLR responsive to the known TLR ligand naturally expresses the TLR responsive to the known TLR ligand.
144. The method of claim 141, wherein the isolated cell expressing the TLR responsive to the known TLR ligand is RPMI 8226.
145. The method of claim 137, wherein the measuring the reference activity and the measuring the test activity each comprise measuring signaling activity mediated by a TLR responsive to the known TLR ligand.
146. The method of claim 145, wherein the signaling activity is activity of a reporter construct under confrol of NF-κB response element.
147. The method of claim 145 , wherein the signaling activity is activity of a reporter constract under control of interferon-stimulated response element (ISRE).
148. The method of claim 145, wherein the signaling activity is activity of a reporter gene under control of an IFN-α promoter.
149. The method of claim 145, wherein the signaling activity is activity of a reporter gene under control of an IFN-β promoter.
150. The method of claim 145, wherein the signaling activity is activity of a reporter gene under control of an IL-6 promoter.
151. The method of claim 145, wherein the signaling activity is activity of a reporter gene under control of an IL-8 promoter.
152. The method of claim 145, wherein the signaling activity is activity of a reporter gene under control of an IL-12 p40 promoter.
153. The method of claim 145, wherein the signaling activity is activity of a reporter gene under confrol of a RANTES promoter.
154. The method of claim 137, wherein the known TLR ligand is a TLR9 ligand.
155. The method of claim 137, wherein the known TLR ligand is a TLR3 ligand.
156. The method of claim 137, wherein the known TLR ligand is a TLR7 ligand.
157. The method of claim 137, wherein the known TLR ligand is a TLR8 ligand.
158. The method of claim 137, wherein the known TLR ligand is an immunostimulatory nucleic acid.
159. The method of claim 137, wherein the known TLR ligand is a CpG nucleic acid.
160. The method of claim 137, wherein the known TLR ligand is an immunoinhibitory nucleic acid.
161. A method for quality assessment of a test lot of a pharmaceutical product containing a known TLR9 ligand, comprising: measuring a reference activity of a reference lot of a pharmaceutical product comprising a known TLR9 ligand, wherein the known TLR9 ligand is a nucleic acid molecule; measuring a test activity of a test lot of a pharmaceutical product comprising the known TLR9 ligand; comparing the test activity to the reference activity; and rejecting the test lot if the test activity falls outside of a predetermined range of variance about the reference activity.
162. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence TCGTCGTTTTGTCGTTTTGTCGTT (SEQ ID NO:l).
163. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTTGACGTTTTGTCGTT-3' (SEQ ID NO: 139).
164. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTTGTCGTTTTTTTCGA-3' (SEQ ID NO: 140).
165. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTCGTCGTTTCGTCGTT-3'
(SEQ ID NO: 141).
166. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTCGTCGTTTTGTCGTT-3* (SEQ ID NO: 142).
167. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTTTCGGTCGTTTT-3' (SEQ ID NO: 143).
168. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTTTCGTGCGTTTTT-3' (SEQ ID NO: 144).
169. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTCGTTTTCGGCGGCCGCCG-3' (SEQ ID NO: 145).
170. The method of claim 161, wherein the known TLR9 ligand is an oligonucleotide comprising a base sequence 5'-TCGTC_GTTTTAC_GGCGCC_GTGCCG-3' (SEQ ID NO: 146), wherein every internucleoside linkage is phosphorothioate except for those indicated by "_", which are phosphodiester.
171. A screening method for identifying agonists of Toll-like receptor (TLR) signaling activity, comprising contacting a cell that expresses a TLR with a test compound and measuring a test level of TLR signaling activity, wherein a test level that is positive is indicative of a test compound that is a TLR agonist, and wherein the cell is a Raji cell, a RAMOS cell, a Nairn cell, a THP-1 cell, or a KG- 1 cell, and the TLR is TLR9.
172. A screening method for identifying agonists of Toll-like receptor
(TLR) signaling activity, comprising contacting a cell that expresses a TLR with a test compound and measuring a test level of TLR signaling activity, wherein a test level that is positive is indicative of a test compound that is a TLR agonist, and wherein the cell is a Raji cell or a RAMOS cell, and the TLR is TLR7.
173. A screening method for identifying agonists of Toll-like receptor (TLR) signaling activity, comprising contacting a cell that expresses a TLR with a test compound and measuring a test level of TLR signaling activity, wherein a test level that is positive is indicative of a test compound that is a TLR agonist, and wherem the cell is a Raji cell, a RAMOS cell, a KG-1 cell, a Nalm-6 cell, a Jurkat cell, a Hela cell, a Hep-2 cell, an A549 cell, a Bewo cell, an NK-92 cell or an NK-92 MI cell, and the TLR is TLR3.
174. A screening method for identifying antagonists of Toll-like receptor (TLR) signaling activity, comprising contacting a cell with a positive reference compound and measuring a reference level of TLR signaling activity, contacting the cell with the positive reference compound and a test compound, and measuring a test level of TLR signaling activity, wherein a test level that is less than a reference level is indicative of a test compound that is a TLR antagonist, and wherein the cell is selected from the group consisting of a RPMI 8226 cell, a RAMOS cell, a Raji cell, a THP-1 cell, a Nairn cell and a KG-1 cell, and the TLR is TLR9.
175. A screening method for identifying antagonists of Toll-like receptor
(TLR) signaling activity, comprising contacting a cell with a positive reference compound and measuring a reference level of TLR signaling activity, contacting the cell with the positive reference compound and a test compound, and measuring a test level of TLR signaling activity, wherein a test level that is less than a reference level is indicative of a test compound that is a TLR antagonist, and wherem the cell is selected from the group consisting of a RPMI 8226 cell, a RAMOS cell and a Raji cell, and the TLR is TLR7.
175. A screening method for identifying antagonists of Toll-like receptor (TLR) signaling activity, comprising contacting a cell with a positive reference compound and measuring a reference level of TLR signaling activity, contacting the cell with the positive reference compound and a test compound, and measuring a test level of TLR signaling activity, wherein a test level that is less than a reference level is indicative of a test compound that is a TLR antagonist, and wherein the cell is selected from the group consisting of a Raji cell, a RAMOS cell, a KG-1 cell, a Nalm-6 cell, a Jurkat cell, a Hela cell, a Hep-2 cell, an A549 cell, a Bewo cell, an NK-92 cell and an NK-92 MI cell, and the TLR is TLR3.
176. A screening method for identifying an enhancer of a Toll-like receptor (TLR) agonist, comprising contacting a cell with a positive reference compound and measuring a reference level of TLR signaling activity, and contacting a cell with the positive reference compound and a test compound and measuring a test level of TLR signaling activity, wherein the positive reference compound is a TLR agonist, and a test level that is greater than the reference level is indicative of a test compound that is an enhancer of a TLR agonist.
177. The method of claim 176, wherein the positive reference compound is an immunostimulatory nucleic acid.
178. The method of claim 176, wherein the positive reference compound is an imidazoquinoline compound.
180. The method of claim 176, wherein the cell is selected from the group consisting of a KG-1 cell, a Nalm-6 cell, a Raji cell, a RAMOS cell, a Jurkat cell, a Hela cell, a Hep-2 cell, an A549 cell, a Bewo cell, an NK-92 cell and an NK-92 MI cell, and the TLR is TLR3.
181. The method of claim 176, wherein the cell is selected from the group consisting of a KG-1 cell, a Nalm-6 cell, a Raji cell, an RPMI 8226 cell, a RAMOS cell, and a THP-1 cell, and the TLR is TLR9.
182. The method of claim 176, wherein the cell is selected from the group consisting of a Raji cell, an RPMI 8226 cell and a RAMOS cell, and the TLR is TLR7.
183. The method of claim 1 , wherein the TLR is TLR7 or TLR9.
184. The method of claim 172-175 or 176, wherein the cell is unmodified.
EP04760178A 2003-04-22 2004-04-22 Methods and products for identification and assessment of tlr ligands Withdrawn EP1631687A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US46458803P 2003-04-22 2003-04-22
US46458603P 2003-04-22 2003-04-22
PCT/US2004/012788 WO2004094671A2 (en) 2003-04-22 2004-04-22 Methods and products for identification and assessment of tlr ligands

Publications (1)

Publication Number Publication Date
EP1631687A2 true EP1631687A2 (en) 2006-03-08

Family

ID=33313485

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04760178A Withdrawn EP1631687A2 (en) 2003-04-22 2004-04-22 Methods and products for identification and assessment of tlr ligands

Country Status (2)

Country Link
EP (1) EP1631687A2 (en)
WO (1) WO2004094671A2 (en)

Families Citing this family (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6239116B1 (en) 1994-07-15 2001-05-29 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US20030026782A1 (en) 1995-02-07 2003-02-06 Arthur M. Krieg Immunomodulatory oligonucleotides
US6207646B1 (en) 1994-07-15 2001-03-27 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US7935675B1 (en) 1994-07-15 2011-05-03 University Of Iowa Research Foundation Immunostimulatory nucleic acid molecules
US6406705B1 (en) 1997-03-10 2002-06-18 University Of Iowa Research Foundation Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant
ES2628744T3 (en) 1998-05-22 2017-08-03 Ottawa Hospital Research Institute Methods and products to induce immunity in mucous membranes
DE60044236D1 (en) 1999-02-17 2010-06-02 Csl Ltd IMMUNOGENIC COMPLEXES AND METHODS RELATED TO THEM
CN1939541A (en) 1999-09-25 2007-04-04 衣阿华大学研究基金会 Immunostimulatory nucleic acids
US6949520B1 (en) 1999-09-27 2005-09-27 Coley Pharmaceutical Group, Inc. Methods related to immunostimulatory nucleic acid-induced interferon
US7585847B2 (en) 2000-02-03 2009-09-08 Coley Pharmaceutical Group, Inc. Immunostimulatory nucleic acids for the treatment of asthma and allergy
SI1296714T1 (en) 2000-06-22 2010-01-29 S For Entpr University Of Iowa Combination of CpG and antibodies directed against CD19,CD20, CD22 or CD40 for the treatment or prevention of cancer.
JP2005500806A (en) 2000-09-15 2005-01-13 コーリー ファーマシューティカル ゲーエムベーハー Process for high-throughput screening of immune agonist / immunoantagonists based on CpG
ES2314099T3 (en) 2001-08-17 2009-03-16 Coley Pharmaceutical Gmbh IMMUNO STIMULANT OLIGONUCLEOTIDES WITH REASONS COMBINED WITH IMPROVED ACTIVITY.
EP3006043B1 (en) 2002-04-04 2019-05-29 Zoetis Belgium S.A. Immunostimulatory g,u-containing oligoribonucleotides
US20040053880A1 (en) 2002-07-03 2004-03-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7605138B2 (en) 2002-07-03 2009-10-20 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7569553B2 (en) 2002-07-03 2009-08-04 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7576066B2 (en) 2002-07-03 2009-08-18 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
US7807803B2 (en) 2002-07-03 2010-10-05 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
CA2494508A1 (en) * 2002-07-03 2004-01-15 Coley Pharmaceutical Group, Inc. Nucleic acid compositions for stimulating immune responses
AR040996A1 (en) 2002-08-19 2005-04-27 Coley Pharm Group Inc IMMUNE STIMULATING NUCLEIC ACIDS
JP2006515277A (en) 2002-10-29 2006-05-25 コーリー ファーマシューティカル グループ, リミテッド Methods and products for treatment and prevention of hepatitis C virus infection
AU2003300919A1 (en) 2002-12-11 2004-06-30 Coley Pharmaceutical Gmbh 5' cpg nucleic acids and methods of use
AU2004275876B2 (en) 2003-09-25 2011-03-31 Coley Pharmaceutical Gmbh Nucleic acid-lipophilic conjugates
OA13278A (en) * 2003-10-30 2007-01-31 Coley Pharm Gmbh C-Class oligonucleotide analogs with enhanced immunostimulatory potency.
MY159370A (en) 2004-10-20 2016-12-30 Coley Pharm Group Inc Semi-soft-class immunostimulatory oligonucleotides
CA2587676A1 (en) 2004-11-19 2006-05-26 Institut Gustave Roussy Improved treatment of cancer by double-stranded rna
EP1945766A2 (en) * 2005-09-16 2008-07-23 Coley Pharmaceutical GmbH Immunostimulatory single-stranded ribonucleic acid with phosphodiester backbone
US8383598B2 (en) 2005-10-12 2013-02-26 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (IRO) compounds to modulate toll-like receptor based immune response
US8399423B2 (en) 2005-10-12 2013-03-19 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (IRO) compounds to modulate toll-like receptor based immune response
US8426375B2 (en) 2005-10-12 2013-04-23 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (IRO) compounds to modulate toll-like receptor based immune response
CA2624755C (en) * 2005-10-12 2017-03-28 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (iro) compounds to modulate toll-like receptor based immune response
KR20080072934A (en) 2005-11-25 2008-08-07 콜리 파마슈티칼 게엠베하 Immunostimulatory oligoribonucleotides
PT2078080E (en) 2006-09-27 2015-09-18 Coley Pharm Gmbh Cpg oligonucleotide analogs containing hydrophobic t analogs with enhanced immunostimulatory activity
US8377898B2 (en) 2006-10-12 2013-02-19 Idera Pharmaceuticals, Inc. Immune regulatory oligonucleotide (IRO) compounds to modulate toll-like receptor based immune response
CA2722589A1 (en) 2008-04-25 2009-10-29 Innate Pharma Improved tlr3 agonist compositions
US8853177B2 (en) 2008-10-06 2014-10-07 Idera Pharmaceuticals, Inc. Use of inhibitors of toll-like receptors in the prevention and treatment of hypercholesterolemia and hyperlipidemia and diseases related thereto
BR112013025500B8 (en) 2011-04-08 2021-04-06 Roquette Freres method to detect peptidoglycan (pgn) contamination of glucose polymers
EP3554515A4 (en) 2016-12-15 2020-08-26 Duke University ANTIBODIES AND METHOD OF DEPLOYMENT REGULATORY B10 CELLS AND USE IN COMBINATION WITH IMMUNCHECKPOINT INHIBITORS
WO2020214963A1 (en) * 2019-04-18 2020-10-22 Genentech, Inc. Antibody potency assay
US20220170042A1 (en) * 2020-11-27 2022-06-02 Wyvern Pharmaceuticals Inc. Compositions and methods for regulating production of a precursor protein
US20240216364A1 (en) 2021-04-28 2024-07-04 Enyo Pharma Strong potentiation of tlr3 agonists effects using fxr agonists as a combined treatment

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030032090A1 (en) * 1997-05-07 2003-02-13 Schering Corporation, A New Jersey Corporation Human receptor proteins; related reagents and methods
CN1935840A (en) * 1997-05-07 2007-03-28 先灵公司 Human receptor proteins, related reagents and methods
DK1025227T3 (en) * 1997-10-17 2006-05-01 Genentech Inc Human TOLL homologues
EP1177439B1 (en) * 1999-04-29 2004-09-08 Coley Pharmaceutical GmbH Screening for immunostimulatory dna functional modifiers
GB0001704D0 (en) * 2000-01-25 2000-03-15 Glaxo Group Ltd Protein
JP2005500806A (en) * 2000-09-15 2005-01-13 コーリー ファーマシューティカル ゲーエムベーハー Process for high-throughput screening of immune agonist / immunoantagonists based on CpG
WO2002085933A1 (en) * 2001-04-20 2002-10-31 The Institute For Systems Biology Toll-like receptor 5 ligands and methods of use
KR20050034583A (en) * 2001-10-05 2005-04-14 콜리 파마슈티칼 게엠베하 Toll-like receptor 3 signaling agonists and antagonists

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BAUER S ET AL: "Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES (PNAS), NATIONAL ACADEMY OF SCIENCE, US LNKD- DOI:10.1073/PNAS.161293498, vol. 98, no. 16, 31 July 2001 (2001-07-31), pages 9237 - 9242, XP002221247, ISSN: 0027-8424 *
BRITIGAN B E ET AL: "Lactoferrin binds CpG-containing oligonucleotides and inhibits their immunostimulatory effects on human B cells.", JOURNAL OF IMMUNOLOGY (BALTIMORE, MD. : 1950) 1 SEP 2001 LNKD- PUBMED:11509640, vol. 167, no. 5, 1 September 2001 (2001-09-01), pages 2921 - 2928, ISSN: 0022-1767 *
MOESBY L ET AL: "Endotoxin testing of proteins for parenteral administration using the Mono Mac 6 assay", JOURNAL OF CLINICAL PHARMACY AND THERAPEUTICS, vol. 25, no. 4, August 2000 (2000-08-01), pages 283 - 289, XP009135148, ISSN: 0269-4727 *
TAKESHITA FUMIHIKO ET AL: "CpG ODN-mediated regulation of IL-12 p40 transcription", EUROPEAN JOURNAL OF IMMUNOLOGY, vol. 30, no. 7, July 2000 (2000-07-01), pages 1967 - 1976, ISSN: 0014-2980 *

Also Published As

Publication number Publication date
WO2004094671A9 (en) 2005-01-27
WO2004094671A2 (en) 2004-11-04
WO2004094671A3 (en) 2005-09-22

Similar Documents

Publication Publication Date Title
EP1631687A2 (en) Methods and products for identification and assessment of tlr ligands
AU2020223671B2 (en) Combination tumor immunotherapy
EP1366077B1 (en) PROCESS FOR HIGH THROUGHPUT SCREENING OF CpG-BASED IMMUNO-AGONIST/ANTAGONIST
KR100969727B1 (en) Immunostimulatory nucleic acid
EP2241325B1 (en) Use of CPG oligonucleotides in the treatment of hepatitis C virus infection
Uccellini et al. Autoreactive B cells discriminate CpG-rich and CpG-poor DNA and this response is modulated by IFN-α
JP2010504982A (en) Composition of TLR ligand and antiviral agent
WO2004026888A2 (en) Toll-like receptor 9 (tlr9) from various mammalian species
BRPI0617254A2 (en) Single-stranded oligonucleotide, pharmaceutical composition, methods for stimulating tlr7 activity in a tlr7-expressing cell, for stimulating tlr8 activity in a tlr8-expressing cell, and for stimulating an immune response in a patient
CA2560114A1 (en) Immunomodulatory oligonucleotides
NZ535952A (en) Immunostimulatory G,U-containing oligoribonucleotides
WO2004011613A2 (en) Composition & methods for treatment and screening
CA3000195A1 (en) Tlr modulators and methods of use
US20170240896A1 (en) Inhibitory Oligonucleotides for Treating Tumors
US20120295272A1 (en) Proinflammatory nucleic acids
Tuetken in the Pathogenesis of Lupus
CA2352084A1 (en) Immunostimulatory dna
Kandimalla et al. Impact of Secondary Structure of Toll-Like
AU1538900A (en) Immunostimulatory dna
HK1149894B (en) Use of cpg oligonucleotides in the treatment of hepatitis c virus infection

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20051031

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT LV MK

RIN1 Information on inventor provided before grant (corrected)

Inventor name: KRIEG, ARTHUR, M.

Inventor name: FORSBACH, ALEXANDRA

Inventor name: SCHETTER, CHRISTIAN

Inventor name: LIPFORD, GRAYSON, B.

Inventor name: JURK, MARION

Inventor name: VOLLMER, JOERG

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20101118