EP1625201A2 - Production of carotenoids in microorganisms - Google Patents

Production of carotenoids in microorganisms

Info

Publication number
EP1625201A2
EP1625201A2 EP04751536A EP04751536A EP1625201A2 EP 1625201 A2 EP1625201 A2 EP 1625201A2 EP 04751536 A EP04751536 A EP 04751536A EP 04751536 A EP04751536 A EP 04751536A EP 1625201 A2 EP1625201 A2 EP 1625201A2
Authority
EP
European Patent Office
Prior art keywords
microorganism
nucleic acid
carotenoid
carotene
carotenoids
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP04751536A
Other languages
German (de)
French (fr)
Other versions
EP1625201A4 (en
Inventor
Claudia Schmidt-Dannert
Pyung Cheon Lee
Benjamin N. Mijts
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Minnesota Twin Cities
University of Minnesota System
Original Assignee
University of Minnesota Twin Cities
University of Minnesota System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Minnesota Twin Cities, University of Minnesota System filed Critical University of Minnesota Twin Cities
Publication of EP1625201A2 publication Critical patent/EP1625201A2/en
Publication of EP1625201A4 publication Critical patent/EP1625201A4/en
Ceased legal-status Critical Current

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P23/00—Preparation of compounds containing a cyclohexene ring having an unsaturated side chain containing at least ten carbon atoms bound by conjugated double bonds, e.g. carotenes
    • A—HUMAN NECESSITIES
    • A23—FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23L—FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L5/00—Preparation or treatment of foods or foodstuffs, in general; Food or foodstuffs obtained thereby; Materials therefor
    • A23L5/40—Colouring or decolouring of foods
    • A23L5/42—Addition of dyes or pigments, e.g. in combination with optical brighteners
    • A23L5/43—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives
    • A23L5/44—Addition of dyes or pigments, e.g. in combination with optical brighteners using naturally occurring organic dyes or pigments, their artificial duplicates or their derivatives using carotenoids or xanthophylls
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0069—Oxidoreductases (1.) acting on single donors with incorporation of molecular oxygen, i.e. oxygenases (1.13)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0083—Miscellaneous (1.14.99)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/1085—Transferases (2.) transferring alkyl or aryl groups other than methyl groups (2.5)

Definitions

  • This invention relates to production of carotenoids in microorganisms, and more particularly to production of oxygenated carotenoids, unnatural cyclic carotenoids, and torulene derivatives in microorganisms.
  • Carotenoids are a structurally diverse class of terpenoid pigments found naturally associated with many microorganisms, plants and animals. They are currently produced for feed, food, nutraceutical, cosmetic, and pharmaceutical applications.
  • the global market for carotenoids has been projected to reach approximately one billion dollars by 2005 at an average annual growth rate of 2.9%, with an individual growth rate of 7.0% in the pharmaceutical sector owing to recent discoveries of the health related benefits of carotenoids, including anti-cancer activity and chronic disease prevention. This growth is explicit in the fast growing "over the counter (OTC) medicine" sector.
  • OTC over the counter
  • microorganisms and plants synthesize more than 600 different carotenoids, only a handful can be produced in useful quantities.
  • Most of the commercially important carotenoids are currently produced by chemical synthesis or by extraction from natural sources such as plants. These production processes are limited in terms of quantity as well as structural diversity of carotenoids and the increasing market has created a need for alternative production methods.
  • the invention is based on the extension of metabolic pathways with a functionally diverse array of modifying enzymes to engineer pathways for the recombinant production of carotenoid structures in microorganisms.
  • carotenoids that have not been isolated in nature (e.g. diapotorulene or water soluble carotenoids) or synthesized in engineered cells (e.g., the first deep purple carotenoid phillipsiaxanthiii or C30 purple carotenoids such as 4,4'-diapocarotene-4,4'-dial) can be produced.
  • Genes located later in a biosynthetic pathway can be modified and can exhibit a higher catalytic promiscuity than those earlier in the pathway, allowing them to accept unnatural substrates.
  • Using directed evolution to diverge natural pathways towards new possible metabolic routes in combination with an extension of these pathways with additional genes is a powerful approach to discover novel natural and unnatural compounds and produce these compounds in microbial hosts.
  • the invention features a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a dehydrosqualene desaturase, and a carotenoid oxygenase, wherein the microorganism produces detectable amounts of a 4,4- diapo- ⁇ -carotene or a diaponeurosporene derivative, the derivative having a terminal aldehyde or terminal carboxyl acid moiety (e.g., diapolycopene dialdehyde or diapolycopene dicarboxylic acid).
  • a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a dehydrosqualene desaturase, and a carotenoid oxygenase, wherein the microorganism produces detectable amounts of a 4,4- diapo- ⁇ -carotene or a diaponeurosporene derivative, the derivative having a terminal al
  • the derivative can be 4,4'-diapo- ⁇ - carotene-al or 4,4'-diapo— ⁇ -carotene dial.
  • the derivative also can be a water soluble carotenoid such as norbixin.
  • the diapophytoene synthase can be the S. aureus or O. iheyensis diapophytoene synthase.
  • the dehydrosqualene desaturase can be the S. aureus or O. iheyensis dehydrosqualene desaturase.
  • the carotenoid oxygenase can be the S. aureus or O. iheyensis carotenoid oxygenase.
  • the exogenous nucleic acid further can encode a farnesyl diphosphate synthase (e.g., IspA).
  • the invention also features a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a diapophytoene desaturase, and a lycopene cyclase, wherein the microorganism produces detectable amounts of diapotorulene.
  • the exogenous nucleic acid further can encode a famesyl diphosphate synthase.
  • Methods for producing diapotorulene can include culturing such a microorganism under conditions wherein the microorganism produces diapotorulene.
  • the invention features a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a diapophytoene desaturase, and a spheroidene monooxygenase, wherein the microorganism produces detectable amounts of an acyclic C35 carotenoid.
  • Methods for producing acyclic C35 carotenoids can include culturing such a microorganism under conditions wherein the microorganism produces the acyclic C35 carotenoids.
  • Microorganisms that include an exogenous nucleic acid encoding geranyl geranyl diphosphate (GGDP) synthase, phytoene synthase, phytoene desaturase, and a spheroidene monooxygenase also are featured, wherein the microorganism produces detectable amounts of an acyclic xanthophyll or a tetradehydrolycopene derivative.
  • the acyclic xanthophylls can be selected from the group consisting of ⁇ -carotene-2-one, neurosporene-2-one, and lycopene-2-one.
  • the tetradehydrolycopene derivative can be phillipsiaxanthin.
  • Methods for producing an acyclic xanthophyll or a tetradehydrolycopene derivative can include culturing such a microorganism under conditions wherein the microorganism produces the compound.
  • the invention features a microorganism that includes an exogenous nucleic acid encoding GGDP synthase, phytoene synthase, phytoene desaturase, a lycopene cyclase, and a ⁇ -carotene oxygenase, the microorganism producing detectable amounts of ketotorulene.
  • Methods for producing ketotorulene can include culturing such a microorganism under conditions wherein the microorganism produces ketotorulene.
  • the invention also features a microorganism that includes an exogenous nucleic acid encoding GGDP synthase, phytoene synthase, phytoene desaturase, a lycopene cyclase, a lycopene cyclase, and a ⁇ -carotene desaturase, the microorganism producing detectable amounts of didehydro- ⁇ -carotene.
  • Methods for producing didehydro- ⁇ - carotene can include culturing such a microorganism under conditions wherein the microorganism produces didehydro- ⁇ -carotene.
  • the invention features a microorganism that includes an exogenous nucleic acid encoding GGDP synthase, phytoene synthase, phytoene desaturase, a lycopene cyclase, a lycopene cyclase, and a ⁇ -carotene hydroxylase, the microorganism producing detectable amounts of hydroxytorulene.
  • the exogenous nucleic acid further can encode a zeaxanthin glucosylase such that the microorganism produces detectable amounts of torulene glucoside.
  • Methods for producing torulene glucoside can include culturing such a microorganism under conditions wherein the microorganism produces torulene glucoside.
  • the invention features a composition that includes one or more compounds selected from the group consisting of diapolycopene dialdehyde, diapolycopene dicarboxylic acid, diapotorulene, ⁇ -carotene-2-one, neurosporene-2-one, lycopene-2-one, phillipsiaxanthin, ketotorulene, didehydro- ⁇ -carotene, hydroxytorulene, and torulene glucoside.
  • the composition can be a food composition.
  • the invention also features a composition that includes a compound selected from the group consisting of 4,4'-diapo- ⁇ -carotene-al and 4,4'-diapo- ⁇ -carotene-dial.
  • the composition can be a food composition.
  • the invention features a method of making a compound selected from the group consisting of 4,4'-diapo- ⁇ -carotene-al and 4,4'-diapo- ⁇ -carotene-dial.
  • the method includes culturing a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a dehydrosqualene desaturase, and a carotenoid oxygenase under conditions wherein the microorganism produces the compound.
  • the method further can include extracting the compound from the microorganism.
  • the microorganism can produce at least about 1 mg/L, 10 mg/L, or 100 mg/L of the compound.
  • FIG. 1 is a schematic of biosynthetic routes to different acyclic and cyclic C40 and C30 carotenoids in engineered E. coli. Red arrows indicate branching of the central desaturation pathways to the routes for the biosynthesis of novel carotenoid structures (red).
  • FIGs 2A-2C are HPLC analyses of carotenoid extracts of E. coli transformants expressing C30 carotenogenic enzymes (CrtM and CrtN) on pAC-crtMcrtN (A) together with lycopene cyclase pUC-crt7 (B) or spheroidene monooxygenase p ⁇ C-crtA (C).
  • FIGs 2D and 2E are the ESI mass spectra of diapolycopene and diapotorulene, respectively.
  • FIG 2F is the APCI mass spectrum of the C35 ketocarotenoid.
  • FIGs 3 A and 3B are HPLC and HP-TLC analysis of E. coli cells producing acyclic oxygenated C40 carotenoids.
  • FIGs 3C-3E are ESI mass spectra of ⁇ -carotene-2-one, neurosporene-2-one, and lycopene-2-one, respectively.
  • FIG 3F is the APCI mass spectrum of phillipsiaxanthin.
  • FIGs 4A- 4F are HPLC analyses of carotenoid extracts of E. coli transformants expressing: (A) pAC-crtE-crtR-crtZ/ -crty ( ⁇ , ⁇ -carotene pathway); (B) pAC-crtE-crtB- crtI14-crtY2 (evolved torulene pathway); (C) pAC-crtE-crtB-crtI14-crtY; and (D) pAC- crtE-crtB-crtI14-crtY2, extended with carotene oxygenase CrtO on pUC-crtO; and ( ⁇ ) ⁇ pAC-crtE-crtB-crtI14-crtY and (F) pAC-crtE-crtB-crtI14-crtY2, extended with carotene desaturase Crt
  • FIG 4G is the ⁇ SI mass spectrum of 4-keto-torulene.
  • FIG 4H is the APCI mass spectrum of didehydro- ⁇ , ⁇ -carotene.
  • FIGs 5A-5D are HPLC analyses of carotenoid extracts of E. coli cells carrying: (A) TpAC-crtE-crtB-crtI14-crtY , ⁇ -carotene pathway) and (B) pAC-crtE-crtBcrtI14- crtY2 (evolved torulene pathway), together with ⁇ -carotene hydroxylase (crtZ); and (C) pAC-crtE-crtB-crtI14-crtY-crtZ and (D) ⁇ pAC-crtE-crtB-crtIJ4-crtY2-crtZ, together with zeaxanthin glucosylase (crtX).
  • crtX zeaxanthin glucosylase
  • FIGs 5E and 5F are the ESI mass spectra of hydroxytorulene and torulene glucoside
  • FIG 6 is a schematic of the subcloning of carotenoid genes required for lycopene production from pUC-crtE, pUC-crtR, pUC-crt/into pGAPZ.
  • FIG 7 is a schematic of the assembly of a tri-gene construct in pGAPZ for lycopene production in P. pastoris.
  • FIG 8 is an HPLC-analysis of a carotenoid extract obtained from lycopene producing engineered P. pastoris transformants overexpressing genes crtE, crtB, and crtl.
  • FIG 9 is a biosynthetic pathway leading to the production of novel purple C30 carotenoids in engineered E. coli cells.
  • FIG 10 depicts the analysis of purple carotenoid extracts from E. coli cells co- expressing crtM and crtN with a carotenoid oxygenase.
  • FIGs 11 A and FIG 1 IB are schematics of the Staphylococcus aureus and Oceanobacillus iheyensis, respectively, carotenoid operon maps.
  • FIG 12 is a diagram of the C30 biosynthetic pathway using CrtOx. Overproduced and identified purple carotenoid structures are boxed.
  • the invention provides methods and materials for producing carotenoids in microorganisms.
  • the first committed step in C 40 caiOtenoid biosynthesis is the extension of the general isoprenoid pathway by the enzymes geranyl geranyl disphosphate (GGDP) synthase (CrtE) and phytoene synthase (CrtB) to form the colorless carotenoid phytoene.
  • GGDP geranyl geranyl disphosphate
  • CrtB phytoene synthase
  • the introduction of additional double bonds into phytoene by phytoene desaturase (Crtl) produces the colored carotenoids neurosporene (three desaturations) or lycopene (four desaturations) from which different acyclic and cyclic carotenoids are then synthesized (FIG 1).
  • C 30 carotenoid biosynthesis also is an extension of the general isoprenoid pathway by the enzyme dehydrosqualene synthase (CrtM) to form dehydrosqualene (FIGS 1 and 9).
  • Diapophytoene synthase (CrtN) can desaturate dehydrosqualene to form various carotenoids, including 4,4 '-diapophytoene, 4,4-diapo- ⁇ - carotene, and diaponeurosporene.
  • Carotenoid oxidoreductase (also called carotenoid oxidase herein) can introduce terminal aldehyde or carboxy functions into 4,4- diapo- ⁇ -carotene and diaponeurosporene.
  • Fully conjugated C 30 carotenoids containing terminal oxygen functional groups at their acylic end groups are useful, for example, as food colorants (e.g., as a substitute for annatto, which is extracted from the plant Bixa orella) as well as building blocks for self- assembled vesicles for drug-delivery and conducting polymers.
  • food colorants e.g., as a substitute for annatto, which is extracted from the plant Bixa orella
  • building blocks for self- assembled vesicles for drug-delivery and conducting polymers e.g., as a substitute for annatto, which is extracted from the plant Bixa orella
  • the lipase of Candida antartica can be used to synthesize polymers from carotenoid dicarboxylic acids and alcohols such as glycerol or other diols.
  • Carotenoids that contain polar oxygen groups on both ends also can be used to form unilamellar vesicles in which the membrane spanning carotenoid molecule is in contact with both the hydrophilic exterior and interior of the vesicle (as opposed to two phospho lipid molecules in biomembranes).
  • Any microorganism eukaryotic or prokaryotic, can be used to produce carotenoids, including bacteria (e.g., Escherichia coli, Bacillus, Brevibacterium,
  • yeast e.g., Pichia pastoris, Phaffla rhodozyma, or Saccharomyces cerevisiae
  • other fungi e.g., Neurospora crassa
  • algae e.g., Dunaliella sp.
  • Such microorganisms may or may not naturally produce carotenoids.
  • Microorganisms that are considered "food grade" (i.e., non-toxigenic) and have the ability to accumulate carotenoids are particularly useful.
  • yeast cells have a diverse isoprenoid metabolism and can accumulate large quantities of ergosterols, lipophilic compounds like carotenoids, in their membranes.
  • P. pastoris a non-carotenogenic methylotropic yeast is particularly useful as it has extreme peroxisome proliferation ability under inducing conditions, hi addition, P. pastoris can be grown to extremely high cell densities (>130 g dry cell weight per liter).
  • a microorganism of the invention is genetically modified such that one or more particular carotenoids are produced.
  • Such microorganisms can contain one or more exogenous nucleic acid molecules that encode polypeptides having enzymatic activity.
  • exogenous as used herein with reference to nucleic acid and a particular microorganism refers to any nucleic acid that does not originate from that particular microorganism as found in nature. Thus, non-naturally-occurring nucleic acid is considered to be exogenous to a microorganism once introduced into the microorganism.
  • non-naturally-occurring nucleic acid can contain nucleic acid sequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature.
  • a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non-naturally-occurring nucleic acid, and thus is exogenous to a microorganism once introduced into the microorganism, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature.
  • any vector, autonomously replicating plasmid, or virus that as a whole does not exist in nature is considered to be non-naturally-occurring nucleic acid.
  • virus e.g., retrovirus, adenovirus, or herpes virus
  • genomic DNA fragments produced by PCR or restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature.
  • any nucleic acid containing a promoter sequence and polypeptide-encoding sequence e.g., cDNA or genomic DNA in an arrangement not found in nature is non-naturally-occurring nucleic acid.
  • Nucleic acid that is naturally-occurring can be exogenous to a particular cell.
  • an entire chromosome isolated from a cell of person X is an exogenous nucleic acid with respect to a cell of person Y once that chromosome is introduced into Y's cell.
  • a microorganism can be given an exogenous nucleic acid molecule that encodes a polypeptide having an enzymatic activity that catalyzes the production of a compound not normally produced by that microorganism.
  • a microorganism can be given an exogenous nucleic acid molecule that encodes a polypeptide having an enzymatic activity that catalyzes the production of a compound that is normally produced by that microorganism.
  • the genetically modified microorganism can produce more of the compound, or can produce the compound more efficiently, than a similar microorganism not having the genetic modification.
  • a polypeptide having a particular enzymatic activity can be a polypeptide that is either naturally-occurring or non-naturally-occurring.
  • a naturally-occurring polypeptide is any polypeptide having an amino acid sequence as found in nature, including wild-type and polymorphic polypeptides. Such naturally-occurring polypeptides can be obtained from any species including, without limitation, animal (e.g., mammalian), plant, fungal, and bacterial species.
  • a non-naturally-occurring polypeptide is any polypeptide having an amino acid sequence that is not found in nature.
  • a non-naturally-occurring polypeptide can be a mutated version of a naturally-occurring polypeptide, or an engineered polypeptide.
  • a non-naturally-occurring polypeptide having dehydrosqualene synthase activity can be a mutated version of a naturally-occurring polypeptide having dehydrosqualene synthase activity that retains at least some dehydrosqualene synthase activity.
  • a polypeptide can be mutated by, for example, sequence additions, deletions, substitutions, or combinations thereof.
  • the invention provides genetically modified microorganisms that can be used to perform one or more steps of a metabolic pathway described herein.
  • an individual microorganism can contain exogenous nucleic acid such that each of the polypeptides necessary to perform the steps depicted in FIGS 1 or 9 are expressed.
  • microorganisms can contain any number of exogenous nucleic acid molecules.
  • a particular microorganism can contain three exogenous nucleic acid molecules with each one encoding one of the three polypeptides necessary to convert famesyl diphosphate (FDP) into a C30 purple carotenoid such as diapolycopene dialdehyde or diapolycopene dicarboxylic acid as depicted in FIG 9, or a particular microorganism can endogenously produce polypeptides necessary to convert FDP into dehydrosqualene while containing exogenous nucleic acids that encode polypeptides necessary to convert dehydrosqualene into a C30 purple carotenoid.
  • a single exogenous nucleic acid molecule can encode one or more than one polypeptide.
  • a single exogenous nucleic acid molecule can contain sequences that encode two or three different polypeptides.
  • the cells described herein can contain a single copy, or multiple copies (e.g., about 5, 10, 20, 35, 50, 75, 100 or 150 copies), of a particular exogenous nucleic acid molecule.
  • the cells described herein can contain more than one particular exogenous nucleic acid molecule.
  • a particular cell can contain about 50 copies of exogenous nucleic acid molecule X as well as about 75 copies of exogenous nucleic acid molecule Y.
  • a nucleic acid molecule encoding a polypeptide having enzymatic activity can be identified and obtained using any method such as those described herein.
  • nucleic acid molecules that encode a polypeptide having enzymatic activity can be identified and obtained using common molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR.
  • standard nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with known enzymatic polypeptides.
  • Sequence alignment software such as MEGALIGN ® (DNASTAR, Madison, WI, 1997) can be used to compare various sequences.
  • nucleic acid molecules encoding known enzymatic polypeptides can be mutated using common molecular cloning techniques (e.g., site-directed mutageneses). Possible mutations include, without limitation, deletions, insertions, and base substitutions, as well as combinations of deletions, insertions, and base substitutions.
  • nucleic acid and amino acid databases e.g., GenBank ®
  • GenBank ® can be used to identify a nucleic acid sequence that encodes a polypeptide having enzymatic activity.
  • any amino acid sequence having some homology to a polypeptide having enzymatic activity can be used as a query to search GenBank ® .
  • the identified polypeptides then can be analyzed to determine whether or not they exhibit enzymatic activity.
  • nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a polypeptide having enzymatic activity. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded polypeptide has enzymatic activity. Briefly, any nucleic acid molecule that encodes a known enzymatic polypeptide, or fragment thereof, can be used as a probe to identify a similar nucleic acid molecules by hybridization under conditions of moderate to high stringency.
  • moderately stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO 4 (pH 7.4), 5X SSC, 5X Denhart's solution, 50 ⁇ g/mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng/mL probe (about 5xl0 7 cpm/ ⁇ g), while the washes are performed at about 50°C with a wash solution containing 2X SSC and 0.1% sodium dodecyl sulfate.
  • Highly stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO 4 (pH 7.4), 5X SSC, 5X Denhart's solution, 50 ⁇ g/mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng/mL probe (about 5xl0 7 cpm/ ⁇ g), while the washes are performed at about 65°C with a wash solution containing 0.2X SSC and 0.1% sodium dodecyl sulfate.
  • Hybridization can be done by Southern or Northern analysis to identify a DNA or RNA sequence, respectively, that hybridizes to a probe.
  • the probe can be labeled with a biotin, digoxygenin, an enzyme, or a radioisotope such as 32 P.
  • the DNA or RNA to be analyzed can be electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al, (1989) Molecular Cloning, second edition, Cold Spring harbor Laboratory, Plainview, NY.
  • a probe is at least about 20 nucleotides in length.
  • Expression cloning techniques also can be used to identify and obtain a nucleic acid molecule that encodes a polypeptide having enzymatic activity.
  • a substrate known to interact with a particular enzymatic polypeptide can be used to screen a phage display library containing that enzymatic polypeptide.
  • Phage display libraries can be generated as described elsewhere (Burritt et al., Anal. Biochem. 238:1-13 (1990)), or can be obtained from commercial suppliers such as Novagen (Madison, WI).
  • polypeptide sequencing techniques can be used to identify and obtain a nucleic acid molecule that encodes a polypeptide having enzymatic activity.
  • a purified polypeptide can be separated by gel electrophoresis, and its amino acid sequence determined by, for example, amino acid microsequencing techniques. Once determined, the amino acid sequence can be used to design degenerate oligonucleotide primers. Degenerate oligonucleotide primers can be used to obtain the nucleic acid encoding the polypeptide by PCR. Once obtained, the nucleic acid can be sequenced, cloned into an appropriate expression vector, and introduced into a microorganism.
  • any method can be used to introduce an exogenous nucleic acid molecule into a cell.
  • many methods for introducing nucleic acid into microorganisms such as bacteria and yeast are well known to those skilled in the art.
  • heat shock, lipofection, electroporation, conjugation, fusion of protoplasts, and biolistic delivery are common methods for introducing nucleic acid into bacteria and yeast cells. See, e.g., Ito et al, J. Bacterol. 153:163-168 (1983); Durrens et al., Curr. Genet. 18:7-12 (1990); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991).
  • exogenous nucleic acid molecule contained within a particular microorganism can be maintained within that microorganism in any form.
  • exogenous nucleic acid molecules can be integrated into the genome of the microorganism or maintained in an episomal state.
  • a microorganism of the invention can be a stable or transient transformant.
  • a microorganism described herein can contain a single copy, or multiple copies (e.g., about 5, 10, 20, 35, 50, 75, 100 or 150 copies), of a particular exogenous nucleic acid molecule as described herein.
  • Methods for expressing an amino acid sequence from an exogenous nucleic acid molecule are well known to those skilled in the art. Such methods include, without limitation, constructing a nucleic acid such that a regulatory element promotes the expression of a nucleic acid sequence that encodes a polypeptide.
  • regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription.
  • regulatory elements include, without limitation, promoters, enhancers, and the like. Any type of promoter can be used to express an amino acid sequence from an exogenous nucleic acid molecule.
  • promoters include, without limitation, constitutive promoters, tissue-specific promoters, and promoters responsive or unresponsive to a particular stimulus (e.g., light, oxygen, chemical concentration, and the like).
  • methods for expressing a polypeptide from an exogenous nucleic acid molecule in cells such as bacterial cells and yeast cells are well known to those skilled in the art.
  • nucleic acid constructs that are capable of expressing exogenous polypeptides within E. coli are well known. See, e.g., Sambrook et ah, Molecular cloning: a laboratory manual, Cold Spring Harbour Laboratory Press, New York, USA, second edition (1989).
  • microorganisms that contain exogenous nucleic acid are well known to those skilled in the art. Such methods include, without limitation, PCR and nucleic acid hybridization techniques such as Northern and Southern analysis. In some cases, immunohisto-chemistry and biochemical techniques can be used to determine if a microorganism contains a particular nucleic acid by detecting the expression of the encoded enzymatic polypeptide encoded by that particular nucleic acid molecule. For example, an antibody having specificity for an encoded enzyme can be used to determine whether or not a particular cell contains that encoded enzyme.
  • biochemical techniques can be used to determine if a cell contains a particular nucleic acid molecule encoding an enzymatic polypeptide by detecting an organic product produced as a result of the expression of the enzymatic polypeptide. For example, detection of 4,4'-diapo- lycopene-dial or 4,4'-diapolycopene-al-oic acid after introduction of one or more exogenous nucleic acids that encode polypeptides having CrtN, CrtM, and CrtOx activity into a microorganism that does not normally express such polypeptides can indicate that that microorganism not only contains the introduced exogenous nucleic acid molecule but also expresses the encoded enzymatic polypeptide from that introduced exogenous nucleic acid molecule.
  • Acyclic carotenoids can be produced in microorganisms by introducing one or more exogenous nucleic acids into the microorganism.
  • nucleic acids encoding dehydrosqualene synthase (CrtM) and diapophytoene synthase (CrtN) can be used in combination with a nucleic acid encoding a carotenoid oxygenase (also called a carotenoid oxidoreductase herein) to produce derivatives of 4,4-diapo- ⁇ -carotene or a diaponeurosporene having one or two terminal aldehydes or carboxyl acid moieties (e.g., 4,4'-diapo-lycopene-dial, 4,4'-diapo- ⁇ -carotene-dial, 4,4'-diapo-lycopene-al-oic acid).
  • Organisms containing such C30 carotenoids with terminal aldehyde and carboxyl functions are purple in color.
  • a nucleic acid encoding a farnesyldiphosphate synthase (FPP synthase) e.g., IspA from E. coli
  • FPP synthase farnesyldiphosphate synthase
  • Genes encoding CrtM and CrtN have been identified from Staphylococcus aureus and Oceanobacillus iheyensis.
  • the nucleic acid sequences of CrtM and CrtN are available in GenBank under Accession No. X73889 for S. aureus and Accession No.
  • NC_004193.1 for O. iheyensis the amino acid sequences of CrtM and CrtN from S. aureus are available in GenBank under Accession Nos. A55548 and B55548, respectively; the amino acid sequences of CrtM and CrtN from O. iheyensis are available in GenBank under Accession Nos.NP_693381, and NP_693382, respectively.
  • Suitable genes encoding carotenoid oxygenases include ORF3 from S. aureus (GenBank Accession No. CAA66626.1); ORF1, 2, and 3 from Oceanobacillus iheyensis (TIGR Accession Nos. OB2460, OB2461 , and OB2459, respectively); and ORF6 from Methylobacterium extorquens (TIGR Accession No. RMQ04999, contigl482_20719_22191).
  • the amino acid sequences of the carotenoid oxygenases from S. aureus and O. iheyensis can be found in GenBank under Accession Nos. NP_373088 and NP_693380, respectively.
  • Nucleic acids encoding FPP synthases have been identified from E. coli (IspA),
  • CrtM and CrtN also can be used in combination with lycopene cyclase (CrtY) to produce diapotorulene, a cyclic derivative of diaponeurosporene.
  • CrtY catalyzes the introduction of ⁇ -rings into either end of lycopene to synthesize ⁇ , ⁇ -carotene, which can be further modified.
  • Genes encoding CrtY have been identified in a variety of species, including Pantoea species (formerly Erwinia).
  • crtY can be used from P. ananatis (GenBank Accession No. D90087).
  • a modified crtY such as crtY2 can be used. See, for example, U.S.
  • CrtY2 is a variant that cyclizes didehydrolycopene, the precursor of tetradehydrolycopene, to produce the red carotenoid torulene.
  • Fa esyl diphosphate synthase e.g., IspA from E. coli
  • IspA from E. coli
  • Acyclic C35 ketocarotenoids can be produced using CrtN and CrtM in combination with spheroidene monooxygenase (CrtA), which catalyzes the oxygenation of spheroidene or hydroxysphroidene at C2.
  • CrtA spheroidene monooxygenase
  • Genes encoding CrtA are available from a variety of microorganisms, including Rhodobacter (e.g., R. capsulatus, GenBank Accession No. Z11165). Microorganisms expressing such nucleic acids are more yellow in color than microorganisms expressing only CrtN and CrtM.
  • acyclic carotenoids can be produced in microorganisms using a nucleic acid encoding geranyl geranyl diphosphate (GGDP) synthase (CrtE), phytoene synthase (CrtB), and phytoene desaturase (Crtl) in combination with a nucleic acid encoding one or more additional carotenoid enzymes.
  • GGDP geranyl geranyl diphosphate
  • CrtB phytoene synthase
  • Crtl phytoene desaturase
  • Such nucleic acids can be part of the same construct or on different constructs.
  • Genes encoding CrtE, CrtB, and Crtl have been identified from a variety of species, including, for example, Pantoea (see GenBank Accession No. D90087).
  • a modified Crtl such as CrtI14, a six-step phytoene desaturase capable of synthesizing the fully conjugated 3,4,3',4'-tetradehydrolycopene in E. coli, also can be used. See, for example, U.S. Patent Application 20020051998 and Schmidt-Dannert et al. (2000) supra. Microorganisms expressing crtE, crtB, and crtl accumulate lycopene, while microorganisms expressing crtE, crtB, and crtI14 accumulate tetradehydrolycopene.
  • tetradehydrolycopene can be produced in microorganisms using a five step desaturase from Neurospora crassa (GenBank Accession No. M57465) in place o ⁇ crtI14.
  • Acyclic xanthophylls such as ⁇ -carotene-2- one, neurosporene-2-one, and lycopene-2-one can be produced by introducing a nucleic acid encoding spheroidene monooxygenase (CrtA) such as the CrtA from Rhodobacter into a crtE, crtB, and crtl- containing microorganism.
  • Phillipsiaxanthin a deep purple carotenoid
  • Phillipsiaxanthin a deep purple carotenoid
  • a nucleic acid encoding CrtA into a microorganism containing crtE, crtB, and crtI14.
  • the gene encoding the five-step desaturase from N. crassa can be used in place of crtll ' 4.
  • an exogenous nucleic acid encoding a ⁇ -carotene oxygenase (CrtO, also known as ⁇ -carotene ketolase) such as the CrtO from Synechocystis sp. PCC 6803 (GenBank Accession No. D64004) can be introduced into a microorganism containing crtE, crtB, crtI14, and crtY2.
  • Aromatic torulene (didehydro- ⁇ -carotene) can be produced by introducing an exogenous nucleic acid encoding ⁇ -carotene desaturase (CrtU) into a microorganism containing crtE, crtB, crtI14, and crtY2. Suitable genes encoding CrtU have been identified from Streptomyces griseus, Mycobacterium aurum, or Brevibacterium linens (GenBank Accession No. AF139916). Microorganisms containing the five-step desaturase fromN. crassa also make torulene and can be used in place of the modified enzymes.
  • Hydroxytorulene can be produced in a microorganism by introducing an exogenous nucleic acid encoding ⁇ -carotene hydroxylase (CrtZ) such as the CrtZ from Pantoea (GenBank Accession No. D90087) into a microorganism containing crtE, crtB, crtI14, and crtY.
  • An exogenous nucleic acid encoding zeaxanthin glucosylase (CrtX) can be introduced into a microorganism containing crtE, crtB, crtI14, crtY, and crtZ to produce torulene glucoside.
  • the microorganisms described herein can be used to produce carotenoids (e.g., diapolycopene dialdehyde, diapolycopene dicarboxylic acid, diapotorulene, acyclic C35 ketocarotenoids, tetradehydrolycopene, acyclic xanthophylls, ketotorulene, or hydroxytorulene).
  • carotenoids e.g., diapolycopene dialdehyde, diapolycopene dicarboxylic acid, diapotorulene, acyclic C35 ketocarotenoids, tetradehydrolycopene, acyclic xanthophylls, ketotorulene, or hydroxytorulene.
  • carotenoids e.g., diapolycopene dialdehyde, diapolycopene dicarboxylic acid, diapotorulene, acyclic C35 ketocaroten
  • substantially pure polypeptides having enzymatic activity can be used alone or in combination with microorganisms to produce carotenoids.
  • substantially pure as used herein with reference to a polypeptide means the polypeptide is substantially free of other polypeptides, lipids, carbohydrates, and nucleic acid with which it is associated in nature.
  • a substantially pure polypeptide can be at least about 60, 65, 70, 75, 80, 85, 90, 95, or 99 percent pure.
  • a substantially pure polypeptide will yield a single major band on a polyacrylamide gel.
  • the invention provides a substantially pure polypeptide having one or more of the following activities: a synthase (e.g., dehydrosqualene synthase, EC 2.5.1.-; diapophytoene synthase; phytoene synthase, EC 2.5.1.32; or geranyl geranyl diphosphate synthase, EC 2.5.1.29), desaturase (e.g., phytoene desaturase, EC 1.14.99.30), or oxygenase (e.g., spheroidene monooxygenase) activity.
  • a synthase e.g., dehydrosqualene synthase, EC 2.5.1.-; diapophytoene synthase; phytoene synthase, EC 2.5.1.32; or geranyl geranyl diphosphate synthase, EC 2.5.1.29
  • desaturase e.g., phytoene desaturase
  • the invention provides a composition that contains two or more (e.g., three, four, five, six, seven, eight, nine, ten, or more) substantially pure polypeptide preparations.
  • a composition can contain a substantially pure polypeptide preparation of the diapophytoene synthase polypeptide from S. aureus and a substantially pure polypeptide preparation of the dehydrosqualene synthase polypeptide from S. aureus.
  • Such compositions can be in the form of a container.
  • two or more substantially pure polypeptide preparations can be located within a column.
  • the polypeptides can be immobilized on a substrate such as a resin.
  • any method can be used to obtain a substantially pure polypeptide.
  • common polypeptide purification techniques such as affinity chromatography and HPLC as well as polypeptide synthesis techniques can be used.
  • any material can be used as a source to obtain a substantially pure polypeptide.
  • tissue from wild-type or transgenic animals can be used as a source material.
  • tissue culture cells engineered to over-express a particular polypeptide of interest can be used to obtain a substantially pure polypeptide.
  • a polypeptide within the scope of the invention can be "engineered" to contain an amino acid sequence that allows the polypeptide to be captured onto an affinity matrix.
  • a tag such as c-myc, hemagglutinin, polyhistidine, or FlagTM tag (Kodak) can be used to aid polypeptide purification.
  • tags can be inserted anywhere within the polypeptide including at either the carboxyl or amino termini.
  • Other fusions that can be used include enzymes such as alkaline phosphatase that can aid in the detection of the polypeptide.
  • a preparation containing substantially pure polypeptides having dehydrosqualene synthase, diapophytoene synthase, and carotenoid oxidoreductase activity can be used to catalyze the formation C30 purple carotenoids such as diapolycopene dialdehyde and diapolycopene dicarboxylic acid.
  • cell-free extracts containing a polypeptide having enzymatic activity can be used alone or in combination with substantially pure polypeptides and/or cells to produce carotenoids. Any method can be used to produce a cell-free extract.
  • osmotic shock, sonication, and/or a repeated freeze-thaw cycle followed by filtration and/or centrifugation can be used to produce a cell-free extract from intact cells.
  • a microorganism, substantially pure polypeptide, and/or cell-free extract can be used to produce any carotenoid that is, in turn, treated chemically to produce another compound.
  • a chemical process can be used to produce a particular compound that is, in turn, converted into a carotenoid using a cell, substantially pure polypeptide, and/or cell- free extract described herein.
  • carotenoids are produced by providing a microorganism and culturing the provided microorganism with a suitable culture medium, h general, the culture media and/or culture conditions can be such that the microorganisms grow to an adequate density and produce carotenoids efficiently.
  • a suitable culture medium h general, the culture media and/or culture conditions can be such that the microorganisms grow to an adequate density and produce carotenoids efficiently.
  • any method can be used such as those described elsewhere (Manual of Industrial Microbiology and Biotechnology, 2 nd Edition, Editors: A. L. Demain and J. E. Davies, ASM Press; and Principles of Fermentation Technology, P. F. Stanbury and A. Whitaker, Pergamon).
  • a large tank e.g., a 100 gallon, 200 gallon, 500 gallon, or more tank
  • appropriate culture medium with, for example, a glucose carbon source
  • the microorganisms are incubated to allow biomass to be produced.
  • the broth containing the microorganisms can be transferred to a second tank.
  • This second tank can be any size.
  • the second tank can be larger, smaller, or the same size as the first tank.
  • the second tank is larger than the first such that additional culture medium can be added to the broth from the first tank, h addition, the culture medium within this second tank can be the same as, or different from, that used in the first tank.
  • the first tank can contain medium with glucose
  • the second tank can contain medium with glycerol.
  • the microorganisms can be incubated to allow for the production of a carotenoid.
  • any method can be used to isolate the carotenoids. For example, common separation techniques can be used to remove the biomass from the broth, and common isolation procedures (e.g., extraction, distillation, and ion-exchange procedures) can be used to obtain the carotenoid from the biomass.
  • a microorganism of the invention produces the carotenoids of interest at a concentration of at least about 1 mg per L (e.g., at least about 2.5 mg/L, 5 mg/L, 10 mg/L, 20 mg/L, 25 mg/L, 50 mg/L, 75 mg/L, 80 mg/L, 90 mg/L, 100 mg/L, or 120 mg/L).
  • any method can be used. See, e.g., Applied Environmental Microbiology 59(12):4261-4265 (1993).
  • compositions of the invention can be purified carotenoid compounds (e.g., neurosporene-2-one, ⁇ -carotene-2-one, lycopene-2-one, phillipsiaxanthin, hydroxytorulene, torulene glucoside, ketotorulene, didehydro- ⁇ , ⁇ -carotene, diapotorulene, diapolycopene, 4,4'-diapo- ⁇ -carotene-al, a C35 carotenoid, 4,4'-diapo- lycopene-dial, 4,4'-diapo- ⁇ -carotene-dial, 4,4'-diapo-lycopene-al-oic acid, or a water soluble carotenoid such as norbixin), or combinations of carotenoid compounds, crude extracts containing one or more carotenoids, or the dried biomass.
  • carotenoid compounds e.g., neurosporene-2-one,
  • Crude extracts can be prepared from microorganisms using standard techniques, including, for example, extraction with an organic solvent such as methanol or acetone. Chromatographic techniques such as high-performance liquid chromatography (HPLC) or thin-layer chromatography (TLC) can be used to further purify the crude extracts.
  • HPLC high-performance liquid chromatography
  • TLC thin-layer chromatography
  • the microorganisms producing the carotenoids i.e., the biomass
  • Compositions can be used in pharmaceutical compositions, nutraceuticals, cosmetics, food or feed compositions, or as antioxidant supplements.
  • crtM dehydrosqualene synthase
  • crtN diapophytoene synthase
  • ATCC 35556D Staphylococcus aureus
  • crtA spheroidene monooxygenase
  • DSMZ 1710 Rhodobacter capsulatus
  • crtO ⁇ -carotene oxygenase
  • ⁇ -carotene desaturase (crtU) Brevibacterium linens (DSMZ 20426), ⁇ -carotene hydroxylase (crtZ), zeaxanthin glucosylase (crtX) from Erwinia uredovora (Pantoea ananatis DSMZ 30080) were amplified from genomic DNA using a 5' primer containing at its 5' end aXbal or EcoRI site followed by an optimized Shine-Dalgarno sequence (underlined) and a start codon (bold) (5'- AGGAGGATTACAAAATG-3', S ⁇ Q ⁇ D NO: 1) and a 3' primer containing at its 5' end a EcoRI or Ncol site (Table 1 A).
  • PCR products were then digested with restriction enzymes and cloned into the corresponding sites of plasmid pUCmod (Schmidt-Dannert et al. (2000), Nat. Biotechnol. 18:750-753) to facilitate constitutive expression from a modified / ⁇ c-promoter.
  • crtE, crtB and crtl (2000), supra to produce lycopene ⁇ pAC-crtE-crtB-crtI14 pACmod constitutively Schmidt-Dannert et al. expressing crtE, crtB and (2000), supra mutant crtI14 to produce tetradehydrolycopene pAC-crtE-crtB-crtll 4-crtY pACmod constitutively Herein expressing crtE, crtB, mutant crtl 14 and crtY to produce ⁇ - carotene ⁇ >AC ⁇ crtE-crtB-ctiI14-crtY2 pACmod constitutively Herein expressing crtE, crtB, mutant crtl 14 and mutant crtY2 to produce torulene pAC-crtE-crtB-crtI14-crtY-crtZ pACmod constitutively Herein expressing
  • crtM and crtN were subcloned from pUCmod into the Sail (crtM) or a.Bam ⁇ .1 (crtN) site of pACmod (see Schmidt-Dannert et al. (2000) supra) by amplification of the genes together with the modified constitutive ⁇ c-promoter, using primers that introduce the corresponding restriction enzyme sites at both ends, to give pAC-crtM-crtN, where crtM and crtN have the same orientation as the disrupted tetracycline resistance gene.
  • genes encoding wild-type (crtY) or mutant lycopene cyclase (crtY2) were subcloned from pUCmod into the Sail site of pAC-crtE-crtB-crtll 4 (see Schmidt- Dannert et al. (2000) supra) to give p AC-crtE-crtB-crtll 4-crtY and pAC-crtE-crtR- crtI14-crtY2, respectively (crtY/Y2 have the same orientation as crtE and crtI14).
  • crtZ was subcloned similarly into the Ppn ⁇ Ul site of TpAC-crtE-crtB-crtlU-crtY and pAC-crtE-crtB-crtI14-crtY2 to produce pAC-crtE-crtR- crtI14-crtY-crtZ and ⁇ AC-crtE-crtB-crtI14-crtY2-crtZ, respectively (crtZ has the same orientation as crtYIY2).
  • E. coli JM109 were cultivated for 48 hr in the dark at 28 °C in Luria-Bertani (LB) medium (200 ml medium in a 500 ml flask or 11 medium in a 3 L flask) supplemented with the appropriate selective antibiotics chloramphenicol (50 ⁇ g/ml) and/or carbenicillin (lOO ⁇ g/ml).
  • LB Luria-Bertani
  • the acetone extract was kept at - 80°C for one day to form a white precipitate and filtrated with 0.2 ⁇ m nylon membrane to remove the precipitate.
  • the resulting pigment extracts were re-extracted with an equal volume of ethyl acetate or hexane after addition of 1/2 volume of saltwater (15% NaCl).
  • the organic phase that contained carotenoids was collected and washed with water.
  • the collected organic phase was completely evaporated in a vacuum to dryness at room temperature, resuspended with 0.5-1 ml hexane, applied to silica gel chromatography (25 X 120 cm) and eluted stepwise with increasing amount of acetone in hexane (0% acetone to 30% acetone in hexane basis).
  • the color fractions were then dried under nitrogen gas or in a vacuum and dissolved in 1-2 ml hexane.
  • a preparative TLC and HPLC were used for the further purification of carotenoids.
  • the preparative TLC was performed under the same conditions as the above and carotenoids were eluted with acetone or methanol.
  • the preparative HPLC if needed, was carried out with a semi- preparative Zorbax SB-C18 column (9.6 x 250 mm, 5 ⁇ m; Agilent Technologies, Palo Alto, CA), and eluted under isocratic conditions with two solvent systems [A; 90% acetonitrile and 10% methanol and B; 90% (acetonitrile: water, 100: 15) and 10% methanol] at a flow rate of 1.5 ml min "1 , which were optimized based on peak resolution, using an Agilent 1100 HPLC system equipped with an photodiode array detector.
  • the ESI mass spectrum of diapolycopene is shown in FIG 2D. This is in contrast to earlier reports where CrtN was shown to catalyze efficiently the three step desaturation of dehydrosqualene leading to the formation of 4,4'-diaponeurosporene in recombinant E. coli (see Wieland, et al., (1994). J. Bacteriol. 176, 7719-7726). However, Arnold et al. reported the accumulation of 30% diapolycopene in recombinant E. coli cells constructed for directed evolution studies aimed at evolving CrtM for function in a C 40 pathway (see Umeno et al. (2002). J. Bacteriol. 184, 6690-6699).
  • E. coli cells harboring pAC-crtN-crtM also accumulated significant amounts of polar carotenoids.
  • Molecular masses and absorption spectra showed them to be various diapolycopene and diaponeurosporene derivatives carrying methoxy and/or hydroxy-functional groups at one or both of their ends.
  • Acyclic end groups of bacterial C 30 diapocarotenoids are frequently oxidized to hydroxy, aldehyde or carboxy-groups, which can be further acylated and/or glucosylated.
  • the diapocarotenoid end-groups are prone to oxidation by free peroxyl-radicals (especially hydroperoxyl radicals) formed in lipid membranes during oxygen stress.
  • the observed mefhoxy-groups may have formed from hydroperoxyl-groups in the presence of methanol present during isolation and analysis. Significant modification of C 40 carotenoids was not observed, indicating that the orientation of the C 30 carotenoids in the lipid membrane of E. coli may be different and thus increasing its reactivity with reactive oxygen species like peroxyl-radicals.
  • EXAMPLE 2 Lycopene cyclase CrtY cyclizes the C30 carotenoid diaponeurosporene
  • Cyclization of C 30 diapocarotenoids which is a common modification of C 40 carotenoids, is so far unknown. Because lycopene cyclase CrtY acts on ⁇ -end groups, which are the same in acyclic C 40 carotenoids (like e.g. lycopene) and C 30 carotenoids (like diaponeurosporene or diapo- ⁇ -carotene), it was reasoned that expression of crtY on pUC-crty together with the genes for diapolycopene biosynthesis on pAC-crtM-crtN, would produce novel unnatural cyclic diapocarotenoids in E. coli.
  • FDP synthase (IspA) was over-expressed in order to increase the precursor pool and alter production levels.
  • Spheroidene monooxygenase CrtA oxygenizes acyclic intermediates of the diapophytoene (C30) desaturation pathway
  • Rhodobacter strains see Armstrong et al (1989) Mol. Gen. Genet. 216:254-268).
  • CrtA was chosen as a possible enzyme for the introduction of keto-groups into diapolycopene.
  • CrtC first hydroxylation at C 1 ,C 1'
  • CrtD desaturation at C3,C4 (C3,C4') (CrtD) and methoxylation at CI, CI 1 (CrtF).
  • Spheroidene monooxygenase CrtA oxygenizes acyclic intermediates of the phytoene (C40) desaturation pathway
  • C40 phytoene
  • CrtA was applied to introduce keto- groups and thus extend the chromophore of these products.
  • the APCI mass spectrum of phillipsiaxanthin is shown in FIG 3F. Lycopene-2-one was accumulated as a minor product along with other polar xanthophylls that could not be identified unequivocally (Figure 3B).
  • keto-groups at position C4(4') of one or both rings of ⁇ , ⁇ - carotene is catalyzed by ⁇ -carotene oxygenases or ketolases.
  • Most ⁇ -carotene oxygenases show homology to fatty acid desaturases and introduce keto-groups at both ⁇ - rings to synthesize canthaxanthin, the precursor of the biotechnologically important carotenoid astaxanthin ( Figure 1).
  • ⁇ -carotene oxygenase CrtO from Synechocystis sp.
  • Aromatic carotenoids are produced from ⁇ , ⁇ -carotene and torulene by CrtU
  • Aromatic carotenoids have been isolated from several bacteria and three bacterial ⁇ -carotene desaturases (CrtU) have recently been cloned and characterized in their homologous hosts. See Krugel et al. (1999) Biochim. Biophys. Acta 1439, 57-64; Krubasik and Sandmann (2000). Mol. Gen. Genetics 263, 423-432; and Viveiros et al., (2000) FEMS Microbiol. Lett. 187, 95-101).
  • the symmetrical aromatization of ⁇ , ⁇ - carotene to isoreneriatene ( ⁇ , ⁇ -carotene) by CrtU involves the introduction of two double bonds and a concurrent methyl group shift for each ⁇ -ring ( Figure 1). It was first examined whether CrtU can function cooperatively with other heterologous carotenoid enzymes in engineered E. coli.
  • crtZ was cloned into pAC-crtE-crtB-crtI14-crtY , ⁇ -carotene) and p AC-crtE-crtB-crtll 4-crtY2 (torulene) to create p AC-crtE-crtB-crtll 4- crtY-crtZ and pAC-crtE-crtB-crtI14-crtY2-crtZ.
  • FIG. 5 ⁇ ⁇ SI mass spectrum for hydroxytorulene is shown in FIG. 5 ⁇ .
  • Subsequent combination inE. coli of p AC-crtE-crtB-crtll 4-crtY21 crtY-crtZ together with the terminal enzyme CrtX of the glucosylation pathway expressed on pUC-crt gave rise to a number of very polar carotenoid structures in E. coli.
  • the assembled ⁇ , ⁇ -carotene glucosylation pathway in E. coli harboring AC-crtE-crtB-crtll 4-crtY-crtZ and pUC-crt produced zeaxanthin-diglucoside as a major product.
  • coli-Pichia shuttle vector (pGAPZ, Invitrogen) bearing a functional constitutive GAP-promoter and a terminator. All expression cassettes were then assembled on a single vector (FIG 7). After purification from E. coli, the plasmid was transformed into P. pastoris and carotenoid producing variants were selected. Production levels were compared between clones with peroxisomal targeting of proteins and those without targeting. For subsequent product analysis various extraction procedures were compared and even modified to optimize extraction of carotenoid from P. pastoris.
  • FIG. 8 shows the HPLC analysis of the carotenoid extract in recombinant P. pastoris.
  • E. coli cells expressing diapophytoene synthase crtN and diapophytoene desaturase crtM from Staphylococcus and producing diaponeurosporene and diapolycopene were co-transformed with newly discovered carotenoid oxygenase sequences identified in the genomes of Staphylococcus and Oceanobacillus (see Table 2).
  • E. coli cells co-expressing the C30 carotenoid pathway together with carotenoid oxegenases from these organisms turned purple due to the production of C30 carotenoids containing terminal aldehyde and carboxyl functions.
  • FIG 9 shows the pathway leading to these compounds.
  • FIG 10 shows examples of purple carotenoids extracted from engineered E. coli cells.
  • the discovered carotenoid oxygenases also can be used to oxidize the acyclic ends of other C30 and C40 carotenoid structures (for example, lycopene, neurosporene, didehydrolycopene and torulene) to produce a variety of novel carotenoid aldehydes and carotenoid carboxylic acids.
  • C30 and C40 carotenoid structures for example, lycopene, neurosporene, didehydrolycopene and torulene
  • E. coli JM109 All cloning and DNA manipulations were carried out in E. coli JM109 using standard techniques (Sambrook et al, Molecular cloning: a laboratory manual, Cold Spring Harbour Laboratory Press, New York, USA, second edition (1989)) and unless otherwise stated, microorganisms were grown at 30°C with shaking at 300 RPM. Following sequencing, plasmids were transformed into E. coli strain JM109 for expression (Table 3). S. aureus (ATCC 35556D) genomic DNA was acquired from the ATCC. O. iheyensis was acquired from DSMZ and cultured in PY medium (Lu et al. (2001) FEMS Microbiol. Lett. 205:291-9) for 48 hours at room temperature with shaking at 300 RPM. Genomic DNA was prepared using a Promega Wizard SV genomic DNA kit.
  • S. aureus carotenoid pathway genes CrtN and CrtM Cloning of the S. aureus carotenoid pathway genes CrtN and CrtM is described above. The cloning of the E. coli prenyltransferase IspA and construction of the plasmid pACJspA SAM SAN have been described by Lee et al., (2003) Chem. Biol. 10:453-62. The S. aureus carotenoid gene CrtOx was amplified from S. aureus (ATCC 35556D) genomic DNA using PCR primers SAlOx-f-X (5'-
  • aureus carotenoid pathway genes CrtGT and CrtXY were amplified from genomic D ⁇ A using PCR primer pairs SAGTF_Xbal (5'gctctagaaggaggattacaaaatgaaatggttatcacgaatat, SEQ ID ⁇ O:6), SAGTR_NotI (5'ttcctttgcggccgcccttgatttattgttctt, SEQ ID NO:7) and SAXYF_Xbal (5*- gctctagaaggaggattacaaaatgaaaccatgaaaaaaatata, SEQ ID NO:8), SAXYR_Notl (5' ttcctttgcggccgcttagtcatgacgttcac, SEQ ID NO:9), respectively. Following digestion of the PCR products wit Xbal and Notl, the genes were cloned into similarly prepared pUCmod to yield pUC-
  • O. iheyensis homologues of the genes CrtM and Cri ⁇ present in the O. iheyensis genomic operon were PCR amplified as a contiguous D ⁇ A fragment using the primers OI ⁇ Xbal_F (5'-gctctagaaggaggatgtctatgaaa-3', SEQ ID NO: 10) and OIM_Notl_R (5'- ttcctttgcggccgctagatactagtagcttga-3', SEQ ID NO:l 1) and cloned into the pUCMod vector as above. E. coli JM109 strains harboring this plasmid produced a yellow pigmented phenotype.
  • a contiguous OIM-N DNA fragment was then PCR amplified using the PCR primers pUCinRjSall (5'-gacgcgtcgacatatgcggtgtgaaataccg-3', S ⁇ Q ID NO: 12) and pUCInF_SphI (5'-gacgcgcatgcccgactggaaagcgg-3', S ⁇ Q ID NO: 13) and subcloned into the pACMod vector to produce pAC OIM-N.
  • This vector was then digested with Sphl and Sail and ligated into similarly digested pACJspA vector to produce pAC_IspA_O ⁇ M-N.
  • coli strains harboring pAC_IspA_SAM_SAN / pUC _OIOx, pACJsp A_OrM-N / pUC_OIOx and p AC_IspA_O ⁇ M-N / pUC_S AOx were cultured under optimized conditions and carotenoids extracted by acetone and analysed by TLC.
  • JM109 pACJspA SAM_SAN ⁇ UC_SAOx
  • pACJspA SAM_SAN ⁇ UC_SAOx was cultured at 30°C in 500 mL LBG medium for 24 hours and cells pelleted.
  • Carotenoids were extracted by addition of 15 mL of acetone to cell pellets and incubation in a sonicating water bath at 4°C for 30 minutes, followed by centrifugation to remove cell debris: Extraction with acetone was repeated until no pigment was visible in the cell pellets and the supernatants pooled. Pooled extracts were dried down completely under a stream of N 2 gas and resuspended in 20 mL of hexanes.
  • a precipitate that formed upon hexane resuspension was pelleted by centrifugation, dried and resuspended in 20 mL ethyl acetate. Both samples were two-phase extracted with 20 mL 5M NaCl, solvent phases recovered, dried down and resuspended in 2 mL of acetone. The hexane fraction was then loaded onto silica gel open columns developed with hexanes followed by mixtures of hexanes with increasing acetone concentrations (10, 25, and 50%) acetone). The ethyl acetate fraction was similarly developed using a starting mobile phase of 80% hexanes, 20% acetone followed by 50% acetone, 50% hexanes. Like fractions from each column preparation were pooled, dried down and stored at - 80°C.
  • JM109 (pACJspA_SAM_SAN pUC_SAOx) was cultured at 30°C in 500 mL LBG medium and 20 mL culture samples collected at 24 hour intervals for 144 hours. Samples were centrifuged when collected, supernatants discarded and pellets stored at - 20°C until analysis. Pigments in cell pellets were repeatedly extracted with 2 mL acetone as above until no additional pigment was visible in the acetone supernatant. Acetone fractions were dried down under a stream of N 2 gas, resuspended in 5 mL ethyl acetate, and washed with 5 mL salt water. The ethyl acetate was then dried under N 2 gas and samples resuspended in 1 mL methanol for analysis.
  • CrtOx a homolog of CrtN
  • CrtGT putative glycosyl transferase
  • CrtXY additional short ORF with no homology to known proteins
  • the CrtGT gene was proposed to be a glycosyl transferase that produces glycosyl ester carotenoids.
  • a BLAST search did not reveal any homologous sequences for the short ORF CrtXY.
  • the structure of the operon can be seen in FIG 11 A.
  • BLAST searches against the NCBI Genbank database revealed homologues of each of these genes are present in the genome of Oceanobacillus iheyensis.
  • a similar operon structure is present in this organism although the gene arrangement is different (see FIG 1 IB).
  • the proposed engineered biosynthetic pathway for these enzymes is provided in FIG 12.
  • This strain along with a control strain harboring pUCMod in place of pUC SAOx, were cultured me in LB medium supplemented with carbenicillin and chloramphenicol for 24 hours at 37°C, 300 RPM and carotenoids extracted with acetone.
  • Analysis of the carotenoids of this strain by normal phase silica-gel TLC using a ethyl acetate: hexane 1:3 mobile phase revealed the presence of a number of novel, polar carotenoids when compared to the control strain. Cloning and expression in E.
  • E. coli of the two other carotenoid ORF's SAGT and SAXY resulted in a pleiotrophic phenotype.
  • E. coli clones constitutively expressing SAGT or SAXY on pUCmod were negatively affected in cell growth and exhibited an aberrant colony morphology (shiny, small colonies), indicating that both genes encode enzymes with broad substrate specificity that act on substrates other than carotenoid too, e.g. membrane lipids.
  • Previous results have indicated that medium and culture conditions can considerably influence the yield and product distribution of recombinantly produced carotenoids. The E.
  • LBG and TB medium had considerably higher carotenoid production than LB medium and overall carotenoid production in LBG medium was highest, hi both cases, higher carotenoid production was observed at 30°C compared to 37°C.
  • Different color phenotypes were observed for cell pellets - dark orange/red in TB medium and dark purple in LBG medium.
  • TLC analysis indicated the presence of similar product profiles but different product distributions - a violet pigment being the dominant product in LBG medium with higher accumulation of less polar precursors in TB medium.
  • carotenoid products In order to structurally characterize the obtained carotenoid products, a 500 mL culture was grown under optimized conditions, carotenoids extracted into acetone and then partitioned into two solvent phases (less polar hexanes and more polar ethyl acetate) and products separated by open column silica gel cliromatography. Each solvent partition yielded a number of different carotenoid fractions of increasing polarity that were visualized by TLC. In total, five unique carotenoid fractions were identified and analyzed by LC-MS.
  • the major product of the more polar ethyl acetate solvent fraction was the strong red / violet compound 3 which was found to have a parent mass of 429.1 and a fragmentation pattern consistent with the fully desaturated C30 dialdehyde diapocarotenoid 4,4'-Diapocarotene-4,4'-dial.
  • the more polar violet compound 5 was found to have a parent mass of 445.2 and a fragmentation pattern consistent with the structure 4,4'-Diapocarotene-4-al, 4'-oic acid.
  • the remaining compounds have parent masses consistent with mono- and dialdehyde precursors of varying carotenoid backbone desaturation states (Table 4).
  • Table 4 The presence of compound 5 strongly suggested that a CrtOx catalyzed, non-specific reaction from terminal aldehyde to carboxyl function, occurs at a relatively slow rate.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Polymers & Plastics (AREA)
  • Food Science & Technology (AREA)
  • Nutrition Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Microorganisms containing one or more exogenous nucleic acids and producing detectable amounts of carotenoids are described.

Description

PRODUCTION OF CAROTENOIDS IN MICROORGANISMS
STATEMENTAS TO FEDERALLYSPONSORED RESEARCH
This invention was made with government support under SSC/N66001-02-1-8928 awarded by the U.S. Advanced Research Projects Agency. The government has certain rights in the invention.
CROSS-REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application Serial No. 60/468,910, filed May 7, 2003.
TECHNICAL FIELD
This invention relates to production of carotenoids in microorganisms, and more particularly to production of oxygenated carotenoids, unnatural cyclic carotenoids, and torulene derivatives in microorganisms.
BACKGROUND Carotenoids are a structurally diverse class of terpenoid pigments found naturally associated with many microorganisms, plants and animals. They are currently produced for feed, food, nutraceutical, cosmetic, and pharmaceutical applications. The global market for carotenoids has been projected to reach approximately one billion dollars by 2005 at an average annual growth rate of 2.9%, with an individual growth rate of 7.0% in the pharmaceutical sector owing to recent discoveries of the health related benefits of carotenoids, including anti-cancer activity and chronic disease prevention. This growth is explicit in the fast growing "over the counter (OTC) medicine" sector. Although microorganisms and plants synthesize more than 600 different carotenoids, only a handful can be produced in useful quantities. Most of the commercially important carotenoids are currently produced by chemical synthesis or by extraction from natural sources such as plants. These production processes are limited in terms of quantity as well as structural diversity of carotenoids and the increasing market has created a need for alternative production methods.
SUMMARY The invention is based on the extension of metabolic pathways with a functionally diverse array of modifying enzymes to engineer pathways for the recombinant production of carotenoid structures in microorganisms. As a result, carotenoids that have not been isolated in nature (e.g. diapotorulene or water soluble carotenoids) or synthesized in engineered cells (e.g., the first deep purple carotenoid phillipsiaxanthiii or C30 purple carotenoids such as 4,4'-diapocarotene-4,4'-dial) can be produced. Genes located later in a biosynthetic pathway can be modified and can exhibit a higher catalytic promiscuity than those earlier in the pathway, allowing them to accept unnatural substrates. Using directed evolution to diverge natural pathways towards new possible metabolic routes in combination with an extension of these pathways with additional genes is a powerful approach to discover novel natural and unnatural compounds and produce these compounds in microbial hosts.
In one aspect, the invention features a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a dehydrosqualene desaturase, and a carotenoid oxygenase, wherein the microorganism produces detectable amounts of a 4,4- diapo-ζ-carotene or a diaponeurosporene derivative, the derivative having a terminal aldehyde or terminal carboxyl acid moiety (e.g., diapolycopene dialdehyde or diapolycopene dicarboxylic acid). For example, the derivative can be 4,4'-diapo-ζ- carotene-al or 4,4'-diapo— ζ-carotene dial. The derivative also can be a water soluble carotenoid such as norbixin. The diapophytoene synthase can be the S. aureus or O. iheyensis diapophytoene synthase. The dehydrosqualene desaturase can be the S. aureus or O. iheyensis dehydrosqualene desaturase. The carotenoid oxygenase can be the S. aureus or O. iheyensis carotenoid oxygenase. The exogenous nucleic acid further can encode a farnesyl diphosphate synthase (e.g., IspA).
The invention also features a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a diapophytoene desaturase, and a lycopene cyclase, wherein the microorganism produces detectable amounts of diapotorulene. The exogenous nucleic acid further can encode a famesyl diphosphate synthase. Methods for producing diapotorulene can include culturing such a microorganism under conditions wherein the microorganism produces diapotorulene.
In another aspect, the invention features a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a diapophytoene desaturase, and a spheroidene monooxygenase, wherein the microorganism produces detectable amounts of an acyclic C35 carotenoid. Methods for producing acyclic C35 carotenoids can include culturing such a microorganism under conditions wherein the microorganism produces the acyclic C35 carotenoids. Microorganisms that include an exogenous nucleic acid encoding geranyl geranyl diphosphate (GGDP) synthase, phytoene synthase, phytoene desaturase, and a spheroidene monooxygenase also are featured, wherein the microorganism produces detectable amounts of an acyclic xanthophyll or a tetradehydrolycopene derivative. The acyclic xanthophylls can be selected from the group consisting of ζ-carotene-2-one, neurosporene-2-one, and lycopene-2-one. The tetradehydrolycopene derivative can be phillipsiaxanthin. Methods for producing an acyclic xanthophyll or a tetradehydrolycopene derivative can include culturing such a microorganism under conditions wherein the microorganism produces the compound.
In yet another aspect, the invention features a microorganism that includes an exogenous nucleic acid encoding GGDP synthase, phytoene synthase, phytoene desaturase, a lycopene cyclase, and a β-carotene oxygenase, the microorganism producing detectable amounts of ketotorulene. Methods for producing ketotorulene can include culturing such a microorganism under conditions wherein the microorganism produces ketotorulene. The invention also features a microorganism that includes an exogenous nucleic acid encoding GGDP synthase, phytoene synthase, phytoene desaturase, a lycopene cyclase, a lycopene cyclase, and a β-carotene desaturase, the microorganism producing detectable amounts of didehydro-βφ-carotene. Methods for producing didehydro-βφ- carotene can include culturing such a microorganism under conditions wherein the microorganism produces didehydro-βφ-carotene. hi another aspect, the invention features a microorganism that includes an exogenous nucleic acid encoding GGDP synthase, phytoene synthase, phytoene desaturase, a lycopene cyclase, a lycopene cyclase, and a β-carotene hydroxylase, the microorganism producing detectable amounts of hydroxytorulene. The exogenous nucleic acid further can encode a zeaxanthin glucosylase such that the microorganism produces detectable amounts of torulene glucoside. Methods for producing torulene glucoside can include culturing such a microorganism under conditions wherein the microorganism produces torulene glucoside. hi yet another aspect, the invention features a composition that includes one or more compounds selected from the group consisting of diapolycopene dialdehyde, diapolycopene dicarboxylic acid, diapotorulene, ζ-carotene-2-one, neurosporene-2-one, lycopene-2-one, phillipsiaxanthin, ketotorulene, didehydro-βφ-carotene, hydroxytorulene, and torulene glucoside. The composition can be a food composition.
The invention also features a composition that includes a compound selected from the group consisting of 4,4'-diapo-ζ-carotene-al and 4,4'-diapo- ζ -carotene-dial. The composition can be a food composition.
In another aspect, the invention features a method of making a compound selected from the group consisting of 4,4'-diapo-ζ-carotene-al and 4,4'-diapo- ζ -carotene-dial. The method includes culturing a microorganism that includes an exogenous nucleic acid encoding a diapophytoene synthase, a dehydrosqualene desaturase, and a carotenoid oxygenase under conditions wherein the microorganism produces the compound. The method further can include extracting the compound from the microorganism. The microorganism can produce at least about 1 mg/L, 10 mg/L, or 100 mg/L of the compound. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Although methods and materials similar or equivalent to those described herein can be used to practice the invention, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.
Other features and advantages of the invention will be apparent from the following detailed description, and from the claims.
DESCRIPTION OF DRAWINGS
FIG. 1 is a schematic of biosynthetic routes to different acyclic and cyclic C40 and C30 carotenoids in engineered E. coli. Red arrows indicate branching of the central desaturation pathways to the routes for the biosynthesis of novel carotenoid structures (red). FIGs 2A-2C are HPLC analyses of carotenoid extracts of E. coli transformants expressing C30 carotenogenic enzymes (CrtM and CrtN) on pAC-crtMcrtN (A) together with lycopene cyclase pUC-crt7 (B) or spheroidene monooxygenase pϋC-crtA (C). The following diapocarotenoids were identified: peak 1, diaponeurosporene (λmax: 415, 438, 467; M+ at m/e = 402.2); peak 2, diapolycopene (λmax: 443, 468, 503; M+ at m/e = 400.1); peak 3, diapotorulene (λmax: 425, 449; M+ at m/e = 402.1); peak 4, diaponeurosporene-derivative (λmax: 399, 422, 449; M+ at m/e=536.3). Double or triple peaks represent different geometrical isomers. Insets: recorded absorption spectra for individual peaks.
FIGs 2D and 2E are the ESI mass spectra of diapolycopene and diapotorulene, respectively.
FIG 2F is the APCI mass spectrum of the C35 ketocarotenoid. FIGs 3 A and 3B are HPLC and HP-TLC analysis of E. coli cells producing acyclic oxygenated C40 carotenoids. HPLC and HP-TLC analysis of carotenoid extracts of E. coli pAC-crtE-crtB-crtl (A) and E. coli pAC-crtE-crtB-crtI14 (B) both coexpressing spheroidene monooxygenase (pUC-crtA). The following carotenoids were identified: peak 1, ζ-carotene (λmax: 377, 400, 424; M+ at m/e = 540.4); peak 2, neurosporene (λmax: 419, 442, 470; M+ at m/e = 538.4); peak 3, lycopene (λmax: 449, 475, 507; M+ at m/e = 536.4); peak 4, ζ-carotene-2-one (λmax: 377, 400, 424; M+ at m/e = 556.4); peak 5, neurosporene-2-one (λmax: 419, 442, 470; M+ at m/e = 554.4); peak 6, lycopene-2-one (λmax: 449, 475, 507; M+ at m/e = 552.4); peak 7, phillipsiaxanthin (λmax: 516, 524; M+ at m/e = 596.3). Double or triple peaks represent different geometrical isomers. Insets: recorded absorption spectra for individual peaks.
FIGs 3C-3E are ESI mass spectra of ζ-carotene-2-one, neurosporene-2-one, and lycopene-2-one, respectively. FIG 3F is the APCI mass spectrum of phillipsiaxanthin.
FIGs 4A- 4F are HPLC analyses of carotenoid extracts of E. coli transformants expressing: (A) pAC-crtE-crtR-crtZ/ -crty (β,β-carotene pathway); (B) pAC-crtE-crtB- crtI14-crtY2 (evolved torulene pathway); (C) pAC-crtE-crtB-crtI14-crtY; and (D) pAC- crtE-crtB-crtI14-crtY2, extended with carotene oxygenase CrtO on pUC-crtO; and (Ε) τpAC-crtE-crtB-crtI14-crtY and (F) pAC-crtE-crtB-crtI14-crtY2, extended with carotene desaturase CrtU on τp JC-crtU. The following carotenoids were identified: peak 1, β,β- carotene (λmax: 425, 451, 478; M+ at m/e = 536.4); peak 2, torulene (λmax:454, 481, 514; M+ at m/e = 534.4); peak 3, lycopene (λmax: 449, 475, 507; M+ at m/e = 536.4); peak 4, echinenone (λmax: 457; M+ at m/e = 550.4); peak 5, canthaxanthin (λmax: 463;M+ at m/e =564.4); peak 6, Ketotorulene (λmax: 454, 481, 514;M+at m/e=548.3); peak 7, isoreniaratene (λmax: 425, 451, 478; M+ at m/e = 528.3); peak 8, didehydro-β,^- carotene (λmax: 454, 481, 514; M+ at m/e = 530.2). Double or triple peaks represent different geometrical isomers. Insets: recorded absorption spectra for individual peaks. FIG 4G is the ΕSI mass spectrum of 4-keto-torulene. FIG 4H is the APCI mass spectrum of didehydro-β,φ-carotene.
FIGs 5A-5D are HPLC analyses of carotenoid extracts of E. coli cells carrying: (A) TpAC-crtE-crtB-crtI14-crtY , β-carotene pathway) and (B) pAC-crtE-crtBcrtI14- crtY2 (evolved torulene pathway), together with β-carotene hydroxylase (crtZ); and (C) pAC-crtE-crtB-crtI14-crtY-crtZ and (D) τpAC-crtE-crtB-crtIJ4-crtY2-crtZ, together with zeaxanthin glucosylase (crtX). The following carotenoids were identified: peak 1, zeaxanthin (λmax: 425, 451, 478; M+ at m/e = 568.3); peak 2, hydroxy-torulene (λmax: 454, 481, 514; M+ at m/e = 550.3); peak 3, β-cryptoxanthin-monoglucoside (λmax: 425, 451, 478; M+ at m/e = 714.5); peak 4, zeaxanthin-monoglucoside (λmax: 425, 451, 478; M+ at m/e = 730.5); peak 5, zeaxanthin-diglucoside (λmax: 425, 451, 478; M+ at m/e = 892.5); peak 6, torulene-monoglucoside (λmax: 454, 481, 514; M+ at m/e = 712.4). FIGs 5E and 5F are the ESI mass spectra of hydroxytorulene and torulene glucoside, respectively.
FIG 6 is a schematic of the subcloning of carotenoid genes required for lycopene production from pUC-crtE, pUC-crtR, pUC-crt/into pGAPZ. FIG 7 is a schematic of the assembly of a tri-gene construct in pGAPZ for lycopene production in P. pastoris.
FIG 8 is an HPLC-analysis of a carotenoid extract obtained from lycopene producing engineered P. pastoris transformants overexpressing genes crtE, crtB, and crtl.
FIG 9 is a biosynthetic pathway leading to the production of novel purple C30 carotenoids in engineered E. coli cells.
FIG 10 depicts the analysis of purple carotenoid extracts from E. coli cells co- expressing crtM and crtN with a carotenoid oxygenase.
FIGs 11 A and FIG 1 IB are schematics of the Staphylococcus aureus and Oceanobacillus iheyensis, respectively, carotenoid operon maps. FIG 12 is a diagram of the C30 biosynthetic pathway using CrtOx. Overproduced and identified purple carotenoid structures are boxed.
DETAILED DESCRIPTION
In general, the invention provides methods and materials for producing carotenoids in microorganisms. The first committed step in C40 caiOtenoid biosynthesis is the extension of the general isoprenoid pathway by the enzymes geranyl geranyl disphosphate (GGDP) synthase (CrtE) and phytoene synthase (CrtB) to form the colorless carotenoid phytoene. The introduction of additional double bonds into phytoene by phytoene desaturase (Crtl) produces the colored carotenoids neurosporene (three desaturations) or lycopene (four desaturations) from which different acyclic and cyclic carotenoids are then synthesized (FIG 1). C30 carotenoid biosynthesis also is an extension of the general isoprenoid pathway by the enzyme dehydrosqualene synthase (CrtM) to form dehydrosqualene (FIGS 1 and 9). Diapophytoene synthase (CrtN) can desaturate dehydrosqualene to form various carotenoids, including 4,4 '-diapophytoene, 4,4-diapo-ζ- carotene, and diaponeurosporene. Carotenoid oxidoreductase (CrtOx) (also called carotenoid oxidase herein) can introduce terminal aldehyde or carboxy functions into 4,4- diapo-ζ-carotene and diaponeurosporene.
Fully conjugated C30 carotenoids containing terminal oxygen functional groups at their acylic end groups are useful, for example, as food colorants (e.g., as a substitute for annatto, which is extracted from the plant Bixa orella) as well as building blocks for self- assembled vesicles for drug-delivery and conducting polymers. For example, the lipase of Candida antartica can be used to synthesize polymers from carotenoid dicarboxylic acids and alcohols such as glycerol or other diols. Carotenoids that contain polar oxygen groups on both ends also can be used to form unilamellar vesicles in which the membrane spanning carotenoid molecule is in contact with both the hydrophilic exterior and interior of the vesicle (as opposed to two phospho lipid molecules in biomembranes).
Microorganisms for Producing Carotenoids
Any microorganism, eukaryotic or prokaryotic, can be used to produce carotenoids, including bacteria (e.g., Escherichia coli, Bacillus, Brevibacterium,
Streptomyces, or Pseudomonas), yeast (e.g., Pichia pastoris, Phaffla rhodozyma, or Saccharomyces cerevisiae) and other fungi (e.g., Neurospora crassa), and algae (e.g., Dunaliella sp.). Such microorganisms may or may not naturally produce carotenoids. Microorganisms that are considered "food grade" (i.e., non-toxigenic) and have the ability to accumulate carotenoids are particularly useful. For example, yeast cells have a diverse isoprenoid metabolism and can accumulate large quantities of ergosterols, lipophilic compounds like carotenoids, in their membranes. P. pastoris, a non-carotenogenic methylotropic yeast is particularly useful as it has extreme peroxisome proliferation ability under inducing conditions, hi addition, P. pastoris can be grown to extremely high cell densities (>130 g dry cell weight per liter).
Typically, a microorganism of the invention is genetically modified such that one or more particular carotenoids are produced. Such microorganisms can contain one or more exogenous nucleic acid molecules that encode polypeptides having enzymatic activity. The term "exogenous" as used herein with reference to nucleic acid and a particular microorganism refers to any nucleic acid that does not originate from that particular microorganism as found in nature. Thus, non-naturally-occurring nucleic acid is considered to be exogenous to a microorganism once introduced into the microorganism. It is important to note that non-naturally-occurring nucleic acid can contain nucleic acid sequences or fragments of nucleic acid sequences that are found in nature provided the nucleic acid as a whole does not exist in nature. For example, a nucleic acid molecule containing a genomic DNA sequence within an expression vector is non-naturally-occurring nucleic acid, and thus is exogenous to a microorganism once introduced into the microorganism, since that nucleic acid molecule as a whole (genomic DNA plus vector DNA) does not exist in nature. Thus, any vector, autonomously replicating plasmid, or virus (e.g., retrovirus, adenovirus, or herpes virus) that as a whole does not exist in nature is considered to be non-naturally-occurring nucleic acid. It follows that genomic DNA fragments produced by PCR or restriction endonuclease treatment as well as cDNAs are considered to be non-naturally-occurring nucleic acid since they exist as separate molecules not found in nature. It also follows that any nucleic acid containing a promoter sequence and polypeptide-encoding sequence (e.g., cDNA or genomic DNA) in an arrangement not found in nature is non-naturally-occurring nucleic acid.
Nucleic acid that is naturally-occurring can be exogenous to a particular cell. For example, an entire chromosome isolated from a cell of person X is an exogenous nucleic acid with respect to a cell of person Y once that chromosome is introduced into Y's cell. It is noted that a microorganism can be given an exogenous nucleic acid molecule that encodes a polypeptide having an enzymatic activity that catalyzes the production of a compound not normally produced by that microorganism. Alternatively, a microorganism can be given an exogenous nucleic acid molecule that encodes a polypeptide having an enzymatic activity that catalyzes the production of a compound that is normally produced by that microorganism. In this case, the genetically modified microorganism can produce more of the compound, or can produce the compound more efficiently, than a similar microorganism not having the genetic modification.
A polypeptide having a particular enzymatic activity can be a polypeptide that is either naturally-occurring or non-naturally-occurring. A naturally-occurring polypeptide is any polypeptide having an amino acid sequence as found in nature, including wild-type and polymorphic polypeptides. Such naturally-occurring polypeptides can be obtained from any species including, without limitation, animal (e.g., mammalian), plant, fungal, and bacterial species. A non-naturally-occurring polypeptide is any polypeptide having an amino acid sequence that is not found in nature. Thus, a non-naturally-occurring polypeptide can be a mutated version of a naturally-occurring polypeptide, or an engineered polypeptide. For example, a non-naturally-occurring polypeptide having dehydrosqualene synthase activity can be a mutated version of a naturally-occurring polypeptide having dehydrosqualene synthase activity that retains at least some dehydrosqualene synthase activity. A polypeptide can be mutated by, for example, sequence additions, deletions, substitutions, or combinations thereof. The invention provides genetically modified microorganisms that can be used to perform one or more steps of a metabolic pathway described herein. For example, an individual microorganism can contain exogenous nucleic acid such that each of the polypeptides necessary to perform the steps depicted in FIGS 1 or 9 are expressed. It is important to note that such microorganisms can contain any number of exogenous nucleic acid molecules. For example, a particular microorganism can contain three exogenous nucleic acid molecules with each one encoding one of the three polypeptides necessary to convert famesyl diphosphate (FDP) into a C30 purple carotenoid such as diapolycopene dialdehyde or diapolycopene dicarboxylic acid as depicted in FIG 9, or a particular microorganism can endogenously produce polypeptides necessary to convert FDP into dehydrosqualene while containing exogenous nucleic acids that encode polypeptides necessary to convert dehydrosqualene into a C30 purple carotenoid.
In addition, a single exogenous nucleic acid molecule can encode one or more than one polypeptide. For example, a single exogenous nucleic acid molecule can contain sequences that encode two or three different polypeptides. Further, the cells described herein can contain a single copy, or multiple copies (e.g., about 5, 10, 20, 35, 50, 75, 100 or 150 copies), of a particular exogenous nucleic acid molecule. Again, the cells described herein can contain more than one particular exogenous nucleic acid molecule. For example, a particular cell can contain about 50 copies of exogenous nucleic acid molecule X as well as about 75 copies of exogenous nucleic acid molecule Y. A nucleic acid molecule encoding a polypeptide having enzymatic activity can be identified and obtained using any method such as those described herein. For example, nucleic acid molecules that encode a polypeptide having enzymatic activity can be identified and obtained using common molecular cloning or chemical nucleic acid synthesis procedures and techniques, including PCR. h addition, standard nucleic acid sequencing techniques and software programs that translate nucleic acid sequences into amino acid sequences based on the genetic code can be used to determine whether or not a particular nucleic acid has any sequence homology with known enzymatic polypeptides. Sequence alignment software such as MEGALIGN® (DNASTAR, Madison, WI, 1997) can be used to compare various sequences. In addition, nucleic acid molecules encoding known enzymatic polypeptides can be mutated using common molecular cloning techniques (e.g., site-directed mutageneses). Possible mutations include, without limitation, deletions, insertions, and base substitutions, as well as combinations of deletions, insertions, and base substitutions. Further, nucleic acid and amino acid databases (e.g., GenBank®) can be used to identify a nucleic acid sequence that encodes a polypeptide having enzymatic activity. Briefly, any amino acid sequence having some homology to a polypeptide having enzymatic activity, or any nucleic acid sequence having some homology to a sequence encoding a polypeptide having enzymatic activity can be used as a query to search GenBank®. The identified polypeptides then can be analyzed to determine whether or not they exhibit enzymatic activity.
In addition, nucleic acid hybridization techniques can be used to identify and obtain a nucleic acid molecule that encodes a polypeptide having enzymatic activity. Such similar nucleic acid molecules then can be isolated, sequenced, and analyzed to determine whether the encoded polypeptide has enzymatic activity. Briefly, any nucleic acid molecule that encodes a known enzymatic polypeptide, or fragment thereof, can be used as a probe to identify a similar nucleic acid molecules by hybridization under conditions of moderate to high stringency. For the purpose of this invention, moderately stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO4 (pH 7.4), 5X SSC, 5X Denhart's solution, 50 μg/mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng/mL probe (about 5xl07 cpm/μg), while the washes are performed at about 50°C with a wash solution containing 2X SSC and 0.1% sodium dodecyl sulfate.
Highly stringent hybridization conditions mean the hybridization is performed at about 42°C in a hybridization solution containing 25 mM KPO4 (pH 7.4), 5X SSC, 5X Denhart's solution, 50 μg/mL denatured, sonicated salmon sperm DNA, 50% formamide, 10% Dextran sulfate, and 1-15 ng/mL probe (about 5xl07 cpm/μg), while the washes are performed at about 65°C with a wash solution containing 0.2X SSC and 0.1% sodium dodecyl sulfate.
Hybridization can be done by Southern or Northern analysis to identify a DNA or RNA sequence, respectively, that hybridizes to a probe. The probe can be labeled with a biotin, digoxygenin, an enzyme, or a radioisotope such as 32P. The DNA or RNA to be analyzed can be electrophoretically separated on an agarose or polyacrylamide gel, transferred to nitrocellulose, nylon, or other suitable membrane, and hybridized with the probe using standard techniques well known in the art such as those described in sections 7.39-7.52 of Sambrook et al, (1989) Molecular Cloning, second edition, Cold Spring harbor Laboratory, Plainview, NY. Typically, a probe is at least about 20 nucleotides in length. Expression cloning techniques also can be used to identify and obtain a nucleic acid molecule that encodes a polypeptide having enzymatic activity. For example, a substrate known to interact with a particular enzymatic polypeptide can be used to screen a phage display library containing that enzymatic polypeptide. Phage display libraries can be generated as described elsewhere (Burritt et al., Anal. Biochem. 238:1-13 (1990)), or can be obtained from commercial suppliers such as Novagen (Madison, WI).
Further, polypeptide sequencing techniques can be used to identify and obtain a nucleic acid molecule that encodes a polypeptide having enzymatic activity. For example, a purified polypeptide can be separated by gel electrophoresis, and its amino acid sequence determined by, for example, amino acid microsequencing techniques. Once determined, the amino acid sequence can be used to design degenerate oligonucleotide primers. Degenerate oligonucleotide primers can be used to obtain the nucleic acid encoding the polypeptide by PCR. Once obtained, the nucleic acid can be sequenced, cloned into an appropriate expression vector, and introduced into a microorganism. Any method can be used to introduce an exogenous nucleic acid molecule into a cell. In fact, many methods for introducing nucleic acid into microorganisms such as bacteria and yeast are well known to those skilled in the art. For example, heat shock, lipofection, electroporation, conjugation, fusion of protoplasts, and biolistic delivery are common methods for introducing nucleic acid into bacteria and yeast cells. See, e.g., Ito et al, J. Bacterol. 153:163-168 (1983); Durrens et al., Curr. Genet. 18:7-12 (1990); and Becker and Guarente, Methods in Enzymology 194:182-187 (1991).
An exogenous nucleic acid molecule contained within a particular microorganism can be maintained within that microorganism in any form. For example, exogenous nucleic acid molecules can be integrated into the genome of the microorganism or maintained in an episomal state. In other words, a microorganism of the invention can be a stable or transient transformant. Again, a microorganism described herein can contain a single copy, or multiple copies (e.g., about 5, 10, 20, 35, 50, 75, 100 or 150 copies), of a particular exogenous nucleic acid molecule as described herein.
Methods for expressing an amino acid sequence from an exogenous nucleic acid molecule are well known to those skilled in the art. Such methods include, without limitation, constructing a nucleic acid such that a regulatory element promotes the expression of a nucleic acid sequence that encodes a polypeptide. Typically, regulatory elements are DNA sequences that regulate the expression of other DNA sequences at the level of transcription. Thus, regulatory elements include, without limitation, promoters, enhancers, and the like. Any type of promoter can be used to express an amino acid sequence from an exogenous nucleic acid molecule. Examples of promoters include, without limitation, constitutive promoters, tissue-specific promoters, and promoters responsive or unresponsive to a particular stimulus (e.g., light, oxygen, chemical concentration, and the like). Moreover, methods for expressing a polypeptide from an exogenous nucleic acid molecule in cells such as bacterial cells and yeast cells are well known to those skilled in the art. For example, nucleic acid constructs that are capable of expressing exogenous polypeptides within E. coli are well known. See, e.g., Sambrook et ah, Molecular cloning: a laboratory manual, Cold Spring Harbour Laboratory Press, New York, USA, second edition (1989).
Methods of identifying microorganisms that contain exogenous nucleic acid are well known to those skilled in the art. Such methods include, without limitation, PCR and nucleic acid hybridization techniques such as Northern and Southern analysis. In some cases, immunohisto-chemistry and biochemical techniques can be used to determine if a microorganism contains a particular nucleic acid by detecting the expression of the encoded enzymatic polypeptide encoded by that particular nucleic acid molecule. For example, an antibody having specificity for an encoded enzyme can be used to determine whether or not a particular cell contains that encoded enzyme. Further, biochemical techniques can be used to determine if a cell contains a particular nucleic acid molecule encoding an enzymatic polypeptide by detecting an organic product produced as a result of the expression of the enzymatic polypeptide. For example, detection of 4,4'-diapo- lycopene-dial or 4,4'-diapolycopene-al-oic acid after introduction of one or more exogenous nucleic acids that encode polypeptides having CrtN, CrtM, and CrtOx activity into a microorganism that does not normally express such polypeptides can indicate that that microorganism not only contains the introduced exogenous nucleic acid molecule but also expresses the encoded enzymatic polypeptide from that introduced exogenous nucleic acid molecule. Methods for detecting specific enzymatic activities or the presence of particular organic products are well known to those skilled in the art. For example, the presence of a carotenoid such as 4,4'-diapo-lycopene-dial or 4,4'- diapolycopene-al-oic acid can be determined as described elsewhere for other carotenoids (See, e.g., Lee et al. (2003) Chem. Biol. 10:453-62).
Production of Acyclic Carotenoids
Acyclic carotenoids can be produced in microorganisms by introducing one or more exogenous nucleic acids into the microorganism. For example, nucleic acids encoding dehydrosqualene synthase (CrtM) and diapophytoene synthase (CrtN) can be used in combination with a nucleic acid encoding a carotenoid oxygenase (also called a carotenoid oxidoreductase herein) to produce derivatives of 4,4-diapo-ζ-carotene or a diaponeurosporene having one or two terminal aldehydes or carboxyl acid moieties (e.g., 4,4'-diapo-lycopene-dial, 4,4'-diapo- ζ-carotene-dial, 4,4'-diapo-lycopene-al-oic acid). Organisms containing such C30 carotenoids with terminal aldehyde and carboxyl functions are purple in color. In some embodiments, a nucleic acid encoding a farnesyldiphosphate synthase (FPP synthase) (e.g., IspA from E. coli) can be used in combination with the nucleic acids encoding CrtM, CrtN, and CrtOx. Genes encoding CrtM and CrtN have been identified from Staphylococcus aureus and Oceanobacillus iheyensis. The nucleic acid sequences of CrtM and CrtN are available in GenBank under Accession No. X73889 for S. aureus and Accession No. NC_004193.1 for O. iheyensis; the amino acid sequences of CrtM and CrtN from S. aureus are available in GenBank under Accession Nos. A55548 and B55548, respectively; the amino acid sequences of CrtM and CrtN from O. iheyensis are available in GenBank under Accession Nos.NP_693381, and NP_693382, respectively.
Suitable genes encoding carotenoid oxygenases include ORF3 from S. aureus (GenBank Accession No. CAA66626.1); ORF1, 2, and 3 from Oceanobacillus iheyensis (TIGR Accession Nos. OB2460, OB2461 , and OB2459, respectively); and ORF6 from Methylobacterium extorquens (TIGR Accession No. RMQ04999, contigl482_20719_22191). The amino acid sequences of the carotenoid oxygenases from S. aureus and O. iheyensis can be found in GenBank under Accession Nos. NP_373088 and NP_693380, respectively. Nucleic acids encoding FPP synthases have been identified from E. coli (IspA),
Bacillus subtilis, Arabidopsis thaliana, Neurospora crassa, Gallus gallus, and Homo sapiens. The nucleic acid sequence encoding IspA is available in GenBank under Accession No. AAC73524. A number of genes encoding the enzymes for central carotenoid biosynthetic routes have been cloned and genes from different species have been shown to function cooperatively when combined.
CrtM and CrtN also can be used in combination with lycopene cyclase (CrtY) to produce diapotorulene, a cyclic derivative of diaponeurosporene. CrtY catalyzes the introduction of β-rings into either end of lycopene to synthesize β, β-carotene, which can be further modified. Genes encoding CrtY have been identified in a variety of species, including Pantoea species (formerly Erwinia). For example, crtY can be used from P. ananatis (GenBank Accession No. D90087). Alternatively, a modified crtY such as crtY2 can be used. See, for example, U.S. Patent Application 20020051998 and Schmidt- Damiert et al. (2000) Nat. Biotech. 18:75-753. CrtY2 is a variant that cyclizes didehydrolycopene, the precursor of tetradehydrolycopene, to produce the red carotenoid torulene. Fa esyl diphosphate synthase (e.g., IspA from E. coli) can be used to increase production of diapotorulene relative to diaponeurosporene. Acyclic C35 ketocarotenoids can be produced using CrtN and CrtM in combination with spheroidene monooxygenase (CrtA), which catalyzes the oxygenation of spheroidene or hydroxysphroidene at C2. Genes encoding CrtA are available from a variety of microorganisms, including Rhodobacter (e.g., R. capsulatus, GenBank Accession No. Z11165). Microorganisms expressing such nucleic acids are more yellow in color than microorganisms expressing only CrtN and CrtM.
In other embodiments, acyclic carotenoids can be produced in microorganisms using a nucleic acid encoding geranyl geranyl diphosphate (GGDP) synthase (CrtE), phytoene synthase (CrtB), and phytoene desaturase (Crtl) in combination with a nucleic acid encoding one or more additional carotenoid enzymes. Such nucleic acids can be part of the same construct or on different constructs. Genes encoding CrtE, CrtB, and Crtl have been identified from a variety of species, including, for example, Pantoea (see GenBank Accession No. D90087). A modified Crtl such as CrtI14, a six-step phytoene desaturase capable of synthesizing the fully conjugated 3,4,3',4'-tetradehydrolycopene in E. coli, also can be used. See, for example, U.S. Patent Application 20020051998 and Schmidt-Dannert et al. (2000) supra. Microorganisms expressing crtE, crtB, and crtl accumulate lycopene, while microorganisms expressing crtE, crtB, and crtI14 accumulate tetradehydrolycopene. Alternatively, tetradehydrolycopene can be produced in microorganisms using a five step desaturase from Neurospora crassa (GenBank Accession No. M57465) in place oϊcrtI14. Acyclic xanthophylls such as ζ-carotene-2- one, neurosporene-2-one, and lycopene-2-one can be produced by introducing a nucleic acid encoding spheroidene monooxygenase (CrtA) such as the CrtA from Rhodobacter into a crtE, crtB, and crtl- containing microorganism. Phillipsiaxanthin, a deep purple carotenoid, can be produced by introducing a nucleic acid encoding CrtA into a microorganism containing crtE, crtB, and crtI14. As indicated above, the gene encoding the five-step desaturase from N. crassa can be used in place of crtll '4.
Production of Torulene Derivatives
To produce torulene derivatives such as ketotorulene, an exogenous nucleic acid encoding a β-carotene oxygenase (CrtO, also known as β-carotene ketolase) such as the CrtO from Synechocystis sp. PCC 6803 (GenBank Accession No. D64004) can be introduced into a microorganism containing crtE, crtB, crtI14, and crtY2. Aromatic torulene (didehydro-βφ-carotene) can be produced by introducing an exogenous nucleic acid encoding β-carotene desaturase (CrtU) into a microorganism containing crtE, crtB, crtI14, and crtY2. Suitable genes encoding CrtU have been identified from Streptomyces griseus, Mycobacterium aurum, or Brevibacterium linens (GenBank Accession No. AF139916). Microorganisms containing the five-step desaturase fromN. crassa also make torulene and can be used in place of the modified enzymes.
Hydroxytorulene can be produced in a microorganism by introducing an exogenous nucleic acid encoding β-carotene hydroxylase (CrtZ) such as the CrtZ from Pantoea (GenBank Accession No. D90087) into a microorganism containing crtE, crtB, crtI14, and crtY. An exogenous nucleic acid encoding zeaxanthin glucosylase (CrtX) can be introduced into a microorganism containing crtE, crtB, crtI14, crtY, and crtZ to produce torulene glucoside.
Producing Carotenoids
The microorganisms described herein can be used to produce carotenoids (e.g., diapolycopene dialdehyde, diapolycopene dicarboxylic acid, diapotorulene, acyclic C35 ketocarotenoids, tetradehydrolycopene, acyclic xanthophylls, ketotorulene, or hydroxytorulene). For example, as discussed above, one or more exogenous nucleic acids can be introduced into a microorganism and cultured under conditions optimal for carotenoid production.
In addition, substantially pure polypeptides having enzymatic activity can be used alone or in combination with microorganisms to produce carotenoids. The term "substantially pure" as used herein with reference to a polypeptide means the polypeptide is substantially free of other polypeptides, lipids, carbohydrates, and nucleic acid with which it is associated in nature. A substantially pure polypeptide can be at least about 60, 65, 70, 75, 80, 85, 90, 95, or 99 percent pure. Typically, a substantially pure polypeptide will yield a single major band on a polyacrylamide gel.
In one embodiment, the invention provides a substantially pure polypeptide having one or more of the following activities: a synthase (e.g., dehydrosqualene synthase, EC 2.5.1.-; diapophytoene synthase; phytoene synthase, EC 2.5.1.32; or geranyl geranyl diphosphate synthase, EC 2.5.1.29), desaturase (e.g., phytoene desaturase, EC 1.14.99.30), or oxygenase (e.g., spheroidene monooxygenase) activity. In another embodiment, the invention provides a composition that contains two or more (e.g., three, four, five, six, seven, eight, nine, ten, or more) substantially pure polypeptide preparations. For example, a composition can contain a substantially pure polypeptide preparation of the diapophytoene synthase polypeptide from S. aureus and a substantially pure polypeptide preparation of the dehydrosqualene synthase polypeptide from S. aureus. Such compositions can be in the form of a container. For example, two or more substantially pure polypeptide preparations can be located within a column. In some embodiments, the polypeptides can be immobilized on a substrate such as a resin.
Any method can be used to obtain a substantially pure polypeptide. For example, common polypeptide purification techniques such as affinity chromatography and HPLC as well as polypeptide synthesis techniques can be used. In addition, any material can be used as a source to obtain a substantially pure polypeptide. For example, tissue from wild-type or transgenic animals can be used as a source material. In addition, tissue culture cells engineered to over-express a particular polypeptide of interest can be used to obtain a substantially pure polypeptide. Further, a polypeptide within the scope of the invention can be "engineered" to contain an amino acid sequence that allows the polypeptide to be captured onto an affinity matrix. For example, a tag such as c-myc, hemagglutinin, polyhistidine, or Flag™ tag (Kodak) can be used to aid polypeptide purification. Such tags can be inserted anywhere within the polypeptide including at either the carboxyl or amino termini. Other fusions that can be used include enzymes such as alkaline phosphatase that can aid in the detection of the polypeptide.
For example, a preparation containing substantially pure polypeptides having dehydrosqualene synthase, diapophytoene synthase, and carotenoid oxidoreductase activity can be used to catalyze the formation C30 purple carotenoids such as diapolycopene dialdehyde and diapolycopene dicarboxylic acid. Further, cell-free extracts containing a polypeptide having enzymatic activity can be used alone or in combination with substantially pure polypeptides and/or cells to produce carotenoids. Any method can be used to produce a cell-free extract. For example, osmotic shock, sonication, and/or a repeated freeze-thaw cycle followed by filtration and/or centrifugation can be used to produce a cell-free extract from intact cells. It is noted that a microorganism, substantially pure polypeptide, and/or cell-free extract can be used to produce any carotenoid that is, in turn, treated chemically to produce another compound. Likewise, a chemical process can be used to produce a particular compound that is, in turn, converted into a carotenoid using a cell, substantially pure polypeptide, and/or cell- free extract described herein.
Typically, carotenoids are produced by providing a microorganism and culturing the provided microorganism with a suitable culture medium, h general, the culture media and/or culture conditions can be such that the microorganisms grow to an adequate density and produce carotenoids efficiently. For large-scale production processes, any method can be used such as those described elsewhere (Manual of Industrial Microbiology and Biotechnology, 2nd Edition, Editors: A. L. Demain and J. E. Davies, ASM Press; and Principles of Fermentation Technology, P. F. Stanbury and A. Whitaker, Pergamon). Briefly, a large tank (e.g., a 100 gallon, 200 gallon, 500 gallon, or more tank) containing appropriate culture medium with, for example, a glucose carbon source is inoculated with a particular microorganism. After inoculation, the microorganisms are incubated to allow biomass to be produced. Once a desired biomass is reached, the broth containing the microorganisms can be transferred to a second tank. This second tank can be any size. For example, the second tank can be larger, smaller, or the same size as the first tank. Typically, the second tank is larger than the first such that additional culture medium can be added to the broth from the first tank, h addition, the culture medium within this second tank can be the same as, or different from, that used in the first tank. For example, the first tank can contain medium with glucose, while the second tank can contain medium with glycerol. Once transferred, the microorganisms can be incubated to allow for the production of a carotenoid. Once produced, any method can be used to isolate the carotenoids. For example, common separation techniques can be used to remove the biomass from the broth, and common isolation procedures (e.g., extraction, distillation, and ion-exchange procedures) can be used to obtain the carotenoid from the biomass. Typically, a microorganism of the invention produces the carotenoids of interest at a concentration of at least about 1 mg per L (e.g., at least about 2.5 mg/L, 5 mg/L, 10 mg/L, 20 mg/L, 25 mg/L, 50 mg/L, 75 mg/L, 80 mg/L, 90 mg/L, 100 mg/L, or 120 mg/L). When determining the yield of a carotenoid for a particular microorganism, any method can be used. See, e.g., Applied Environmental Microbiology 59(12):4261-4265 (1993).
Compositions
Compositions of the invention can be purified carotenoid compounds (e.g., neurosporene-2-one, ζ-carotene-2-one, lycopene-2-one, phillipsiaxanthin, hydroxytorulene, torulene glucoside, ketotorulene, didehydro-β,φ-carotene, diapotorulene, diapolycopene, 4,4'-diapo- ζ-carotene-al, a C35 carotenoid, 4,4'-diapo- lycopene-dial, 4,4'-diapo- ζ-carotene-dial, 4,4'-diapo-lycopene-al-oic acid, or a water soluble carotenoid such as norbixin), or combinations of carotenoid compounds, crude extracts containing one or more carotenoids, or the dried biomass. Crude extracts can be prepared from microorganisms using standard techniques, including, for example, extraction with an organic solvent such as methanol or acetone. Chromatographic techniques such as high-performance liquid chromatography (HPLC) or thin-layer chromatography (TLC) can be used to further purify the crude extracts. In other embodiments, the microorganisms producing the carotenoids (i.e., the biomass) are collected and dried. Compositions can be used in pharmaceutical compositions, nutraceuticals, cosmetics, food or feed compositions, or as antioxidant supplements.
The invention will be further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Methods and Materials Cloning and culture growth.
Genes encoding dehydrosqualene synthase (crtM), diapophytoene synthase (crtN) from Staphylococcus aureus (ATCC 35556D), spheroidene monooxygenase (crtA) from Rhodobacter capsulatus (DSMZ 1710), β-carotene oxygenase (crtO) from Synechocystis sp. (ATCC 27184), β-carotene desaturase (crtU) Brevibacterium linens (DSMZ 20426), β-carotene hydroxylase (crtZ), zeaxanthin glucosylase (crtX) from Erwinia uredovora (Pantoea ananatis DSMZ 30080) were amplified from genomic DNA using a 5' primer containing at its 5' end aXbal or EcoRI site followed by an optimized Shine-Dalgarno sequence (underlined) and a start codon (bold) (5'- AGGAGGATTACAAAATG-3', SΕQ ΕD NO: 1) and a 3' primer containing at its 5' end a EcoRI or Ncol site (Table 1 A). PCR products were then digested with restriction enzymes and cloned into the corresponding sites of plasmid pUCmod (Schmidt-Dannert et al. (2000), Nat. Biotechnol. 18:750-753) to facilitate constitutive expression from a modified /αc-promoter.
Table 1. Genes (A) and plasmids (B) used in the experiments.
(A) Gene Enzyme Typical reaction catalyzed Accession no. or Reference crtM Dehydrosqualene Head-to-head condensation X73889 synthase of 2 FDP rtN Diapophytoene Introduction of 3 X73889 synthase desaturations in dehydrosqualene rtE GGPP synthase Head-to-head condensation D90087 oflDP+ FDP rtB Phytoene synthase Head-to-head condensation D90087 of 2 GGDP crtl Phytoene desaturase Introduction of 4 D90087 desaturations in phytoene crtU 4 In vitro evolved Introduction of 6 Schmidt-Dannert et al. phytoene desaturase desaturations in phytoene (2000), supra crtY Lycopene cyclase Cyclization of ψ-end groups D90087 ' in lycopene to form β-rings crtY2 In vitro evolved Cyclization of ψ-end group Schmidt-Dannert et al. lycopene cyclase in didehydrolycopene to form (2000), supra β-ring rtA Spheroidene Oxygenation at C2 of Z11165 monooxygenase spheroidene or hydroxysphroidene ' crtO β-carotene oxygenase Oxygenation at C4, C4' of β- D64004 carotene crtU β-carotene desaturase Desaturation/methyltransfer AF139916 of β-rings in β-carotene crtZ β-carotene Hydroxylation of C3, C3' of D90087 hydroxylase β-carotene rtX Zeaxanthin Glycosylation of C3, C3' of D90087 glucosylase zeaxanthin
(B) Plasmid Properties Reference pUCmod Constitutive expression Schmidt-Dannert et al. vector modified from pUC19, (2000), supra
Ap pACmod Cloning vector modified Schmidt-Dannert et al. frompACYC184, Cm (2000), supra pUC-crt pUCmod constitutively Herein expressing crtM pUC-crtΛT pUCmod constitutively Herein expressing crtN pUC-crt7 pUCmod constitutively Schmidt-Dannert et al. expressing crtY (2000), supra pUC-crtF2 pUCmod constitutively Schmidt-Dannert et al. expressing crtY2 (2000), supra pUC-crtA pUCmod constitutively Herein expressing crtA pUC-crtO pUCmod constitutively Herein expressing crtO pUC-crtU pUCmod constitutively Herein expressing crtU pUC-crtZ pUCmod constitutively Herein expressing crtZ pUC-crtX pUCmod constitutively Herein expressing crtX pAC-crtM-crtN pACmod constitutively Herein expressing crtM and crtN to produce diaponeurosporene pAC-crtE-crtB-crtl pACmod constitutively Schmidt-Dannert et al. expressing crtE, crtB and crtl (2000), supra to produce lycopene ιpAC-crtE-crtB-crtI14 pACmod constitutively Schmidt-Dannert et al. expressing crtE, crtB and (2000), supra mutant crtI14 to produce tetradehydrolycopene pAC-crtE-crtB-crtll 4-crtY pACmod constitutively Herein expressing crtE, crtB, mutant crtl 14 and crtY to produce β- carotene γ>AC~crtE-crtB-ctiI14-crtY2 pACmod constitutively Herein expressing crtE, crtB, mutant crtl 14 and mutant crtY2 to produce torulene pAC-crtE-crtB-crtI14-crtY-crtZ pACmod constitutively Herein expressing crtE, crtB, mutant crtI14, crtY and crtZ to produce zeaxanthin AC~crtE-crtB-crtI14-crtY2-crtZ pACmod constitutively Herein expressing crtE, crtB, mutant crtl 14, mutant crtY2 and crtZ to produce monohydroxytorulene
For C30 carotenoid pathway assembly, crtM and crtN were subcloned from pUCmod into the Sail (crtM) or a.BamΗ.1 (crtN) site of pACmod (see Schmidt-Dannert et al. (2000) supra) by amplification of the genes together with the modified constitutive αc-promoter, using primers that introduce the corresponding restriction enzyme sites at both ends, to give pAC-crtM-crtN, where crtM and crtN have the same orientation as the disrupted tetracycline resistance gene. Likewise, for assembly of the β-carotene and torulene pathways, genes encoding wild-type (crtY) or mutant lycopene cyclase (crtY2) were subcloned from pUCmod into the Sail site of pAC-crtE-crtB-crtll 4 (see Schmidt- Dannert et al. (2000) supra) to give p AC-crtE-crtB-crtll 4-crtY and pAC-crtE-crtR- crtI14-crtY2, respectively (crtY/Y2 have the same orientation as crtE and crtI14). To assemble the glucosylation pathways, crtZ was subcloned similarly into the PpnϊUl site of TpAC-crtE-crtB-crtlU-crtY and pAC-crtE-crtB-crtI14-crtY2 to produce pAC-crtE-crtR- crtI14-crtY-crtZ and \}AC-crtE-crtB-crtI14-crtY2-crtZ, respectively (crtZ has the same orientation as crtYIY2). These plasmids and the carotenoids biosynthetic pathways expressed are described in Table IB.
For carotenoid production, recombinant E. coli JM109 were cultivated for 48 hr in the dark at 28 °C in Luria-Bertani (LB) medium (200 ml medium in a 500 ml flask or 11 medium in a 3 L flask) supplemented with the appropriate selective antibiotics chloramphenicol (50μg/ml) and/or carbenicillin (lOOμg/ml).
Isolation of carotenoids. Wet cells from a 200 ml (-500 mg) or 4 L culture (-10 g) were repeatedly extracted at 4°C with a total volume of 30 ml or 400 m methanol or acetone until all visible pigments were extracted. After centrifugation (4°C, 6000 rpm), the colored supernatants were pooled and combined supernatants were centrifuged again, filtrated (nylon membrane 0.2 μm, Whatman) to remove fine particles, evaporated in a vacuum to dryness and finally resuspended with 30-50 ml acetone. The acetone extract was kept at - 80°C for one day to form a white precipitate and filtrated with 0.2 μm nylon membrane to remove the precipitate. The resulting pigment extracts were re-extracted with an equal volume of ethyl acetate or hexane after addition of 1/2 volume of saltwater (15% NaCl). The organic phase that contained carotenoids was collected and washed with water. The collected organic phase was completely evaporated in a vacuum to dryness at room temperature, resuspended with 0.5-1 ml hexane, applied to silica gel chromatography (25 X 120 cm) and eluted stepwise with increasing amount of acetone in hexane (0% acetone to 30% acetone in hexane basis). The color fractions were then dried under nitrogen gas or in a vacuum and dissolved in 1-2 ml hexane. A 1-3 μl aliquot of the fractions and the crude extracts were subjected to high-performance TLC separation for initial analysis of the crude extract and the color fractions composition on Whatman silica gel 6θA plates (4.5 μm particle size, 200 μm thickness) using the following solvent systems: i) acetone:hexane (40:60) for acyclic C30 and C40 xanthophylls, ii) hexanexhloroform: acetone (85:15:20) for diapocarotenoids and cyclic xanthophylls, iii) hexanexhloroform (85:15) for cyclic aromatic carotenoids, iv) hexanexhloroform (100:5) for cyclic C40 carotenoids and v) hexane:acetone (80:20) for hydroxylated cyclic C40 carotenoids and vi) chloroform:methanol (80:20) for glucosylated cyclic C40 carotenoids. For the further purification of carotenoids, a preparative TLC and HPLC were used. The preparative TLC was performed under the same conditions as the above and carotenoids were eluted with acetone or methanol. The preparative HPLC, if needed, was carried out with a semi- preparative Zorbax SB-C18 column (9.6 x 250 mm, 5μm; Agilent Technologies, Palo Alto, CA), and eluted under isocratic conditions with two solvent systems [A; 90% acetonitrile and 10% methanol and B; 90% (acetonitrile: water, 100: 15) and 10% methanol] at a flow rate of 1.5 ml min"1, which were optimized based on peak resolution, using an Agilent 1100 HPLC system equipped with an photodiode array detector.
Analysis of carotenoids.
For the analysis of carotenoids, 10-20 μl of the crude extract and the collected color fractions were applied to a Zorbax SB-C18 column (4.6 x 250 mm, 5μm; Agilent Technologies, Palo Alto, CA), and typically eluted under isocratic conditions with a solvent system containing 90% (acetonitrile: H2O, 99:1) and 10% (methanol: tetrahydrofurane, 8:2) at a flow rate of 1 ml min"1 using an Agilent 1100 HPLC system equipped with an photodiode array detector. Gradient conditions with solvent A (acetonitrile: H2O, 85:15) and solvent B (methanol: tetrahydrofurane, 8:2) were used for the elution of acyclic C 0 xanthophylls (0-30 min, A:B 95:5; 30-60 min, A:B 88:12; 60-90 min, A:B 1:1; 90-120 min, A:B 1 :9). For structural elucidation, carotenoids were identified by a combination of HPLC retention times, absorption spectra and mass fragmentation spectra. See, Schwieter, et al., (1966) Helv. Chim. Acta 49, 992-996; Enzell et al., (1968) Acta Chem. Scand. 22, 1054-1055; and Enzell et al, Acta Chem. Scand. 23, 727-750. Authentic standards for comparison were isolated from recombinant E. coli containing plasmids for lycopene, tetradehydrolycopene, torulene and β, β-carotene biosynthesis. Mass fragmentation spectra were monitored in a mass range of m/z 200- 800 or 1000 on a LCQ mass spectrophotometer equipped with an electron spray ionization (ESI) or atmosphere pressure chemical ionization (APCI) interface (Thermo Finnigan, USA). Parent molecular ions were further fragmented by MS/MS analysis using an APCI interface at optimal collision-induced dissociation energy (28-30%). EXAMPLE 1
Co-expression of dehydrosqualene synthase CrtM and desaturase CrtN produces the fully conjugated C30 carotenoid diapolycopene
To extend the isoprenoid pathway in E. coli for synthesis of C30 carotenoids, two expression cassettes comprising a constitutive /αc-promoter upstream of either crtM or crtN were assembled to yield pAC-crtM-crtN. E. coli cells transformed with pAC-crtM- crtN developed a deep yellow-orange color suggesting the production of diapocarotenoids. Analysis of the cell extracts by HPLC-mass spectrometry showed that, in this system, CrtN efficiently introduced four double bonds into dehydrosqualene to predominantly (90%) synthesize the fully conjugated 4,4'-diapolycoρene in recombinant E. coli (FIG 2A). The ESI mass spectrum of diapolycopene is shown in FIG 2D. This is in contrast to earlier reports where CrtN was shown to catalyze efficiently the three step desaturation of dehydrosqualene leading to the formation of 4,4'-diaponeurosporene in recombinant E. coli (see Wieland, et al., (1994). J. Bacteriol. 176, 7719-7726). However, Arnold et al. reported the accumulation of 30% diapolycopene in recombinant E. coli cells constructed for directed evolution studies aimed at evolving CrtM for function in a C40 pathway (see Umeno et al. (2002). J. Bacteriol. 184, 6690-6699). Unexpectedly, it was observed that E. coli cells harboring pAC-crtN-crtM also accumulated significant amounts of polar carotenoids. Molecular masses and absorption spectra showed them to be various diapolycopene and diaponeurosporene derivatives carrying methoxy and/or hydroxy-functional groups at one or both of their ends. Acyclic end groups of bacterial C30 diapocarotenoids are frequently oxidized to hydroxy, aldehyde or carboxy-groups, which can be further acylated and/or glucosylated. The diapocarotenoid end-groups are prone to oxidation by free peroxyl-radicals (especially hydroperoxyl radicals) formed in lipid membranes during oxygen stress. The observed mefhoxy-groups may have formed from hydroperoxyl-groups in the presence of methanol present during isolation and analysis. Significant modification of C40 carotenoids was not observed, indicating that the orientation of the C30 carotenoids in the lipid membrane of E. coli may be different and thus increasing its reactivity with reactive oxygen species like peroxyl-radicals. EXAMPLE 2 Lycopene cyclase CrtY cyclizes the C30 carotenoid diaponeurosporene
Cyclization of C30 diapocarotenoids, which is a common modification of C40 carotenoids, is so far unknown. Because lycopene cyclase CrtY acts on ψ-end groups, which are the same in acyclic C40 carotenoids (like e.g. lycopene) and C30 carotenoids (like diaponeurosporene or diapo-ζ-carotene), it was reasoned that expression of crtY on pUC-crty together with the genes for diapolycopene biosynthesis on pAC-crtM-crtN, would produce novel unnatural cyclic diapocarotenoids in E. coli. Indeed, a novel cyclic carotenoid along with diaponeurosporene was detected in cell extracts of such co- transformed recombinant E. coli cells (Figure 2B). Absorption and mass spectrum confirmed it to be diapotorulene, the cyclic derivative of diaponeurosporene. The ESI mass spectrum of diapotorulene is shown in FIG 2E. Other possible monocyclic and dicyclic diapocarotenoids derived from diapo-ζ-carotene were not detected. As famesyl diphosphate (FDP) is the precursor of the C30 biosynthetic pathway, the native E. coli
FDP synthase (IspA) was over-expressed in order to increase the precursor pool and alter production levels. Expression of the resulting construct (pAC-crtM-crtN-ispA) in E. coli increased the diapotorulene to diaponeurosporene ratio 3-5-fold.
EXAMPLE 3
Spheroidene monooxygenase CrtA oxygenizes acyclic intermediates of the diapophytoene (C30) desaturation pathway
Although many bacteria produce a large number of different acyclic xanthophylls (oxygenated carotenoids), only four genes encoding a hydratase (crtC), desaturase (crtD), methyl transferase (crtF) and a monooxygenase (crtA) have been cloned from
Rhodobacter strains (see Armstrong et al (1989) Mol. Gen. Genet. 216:254-268). To obtain acyclic carotenoids with expanded chromophores, CrtA was chosen as a possible enzyme for the introduction of keto-groups into diapolycopene. In purple bacteria under aerobic conditions, CrtA catalyzes the asymmetrical introduction of one keto-group at C2 as the terminal reaction of a sequence involving first hydroxylation at C 1 ,C 1' (CrtC) of neurosporene or lycopene, followed by desaturation at C3,C4 (C3,C4') (CrtD) and methoxylation at CI, CI1 (CrtF).
To produce acyclic C30 xanthophylls in engineered E. coli cells, the diapolycopene pathway was extended in E. coli pAC-crtM-crtN with crtA on pUC-crtA. The co- transformed cells appeared more yellow than E. coli pAC-crtM-crtN. HPLC analysis of the cell extract showed three new very polar peaks (Figure 2C). The absorption maxima and spectral fine structure of the major carotenoid corresponds to an acyclic carotenoid without conjugated carbonyl-functions and with eight conjugated double bonds as opposed to the nine conjugated double bonds in diaponeurosporene (Figure 1). The two minor peaks showed spectral properties similar to diapo-ζ-carotene and diapophytoene. Further structural analysis of the yellow carotenoid by HPLC-mass spectromefry showed an unexpected molecular mass of m/z 536.3 along with the prominent [M-18]+ (loss of a hydroxy-group) and [M-58] +, [M-87]+ ions (loss of an end-group adjacent to a keto- group), indicating a putative C 5 backbone structure rather than C30. Further fragmentation of the parent ion by MS/MS analysis gave additional unique [M- 18-16] + (loss of oxygen from carbonyl group) and [M-l 8-28] + ions (loss of carbonyl group). Although these fragmentation patterns are consistent with expected CrtA end-group monooxygenase activity, the high overall mass suggests a non-specific activity or unknown biocatalytic function of CrtA. The APCI mass spectrum of the putative C35 carotenoid is shown in FIG 2F.
EXAMPLE 4
Spheroidene monooxygenase CrtA oxygenizes acyclic intermediates of the phytoene (C40) desaturation pathway In order to generate new, acyclic, purple C40 xanthophylls in E. coli from the wild- type lycopene and in vitro evolved tetradehydrolycopene biosynthetic pathways, CrtA was applied to introduce keto- groups and thus extend the chromophore of these products. When lycopene or tetradehydrolycopene-accumulating E. coli cells harboring pAC-crtE- crtB-crtl (orange-red cells) or pAC-crtE-crtB-crtll 4 (pink cells) (see Schmidt-Dannert et al. (2000) supra) were co-transformed with pXJC-crtA, the cell color changed to yellow and deep red, respectively. All carotenoid extracts were separated by high-performance thin layer chromatography (HP-TLC) and high-pressure liquid chromatography (HPLC) (Figure 3) and structural identification was achieved by considering their polarity, absorption properties and mass fragmentation patterns (compared to fragmentation patterns of known carotenoid end-groups. Extension of the lycopene pathway by coexpression of xΛJC-crtA with \)AC-crtE-crtB-crtI in E. coli resulted in the synthesis of three novel acyclic xanthophylls ζ-carotene-2-one (7,8,7',8'-tetrahydro-l,2-dihydro-ψ,ψ- caroten-2-one), neurosporene-2-one (7,8-dihydro-l,2-dihydro-ψ,ψ-caroten-2-one) and lycopene-2-one (l,2-dihydro-ψ,ψ-caroten-2-one) (Figure 3 A). ESI mass spectra for ζ- carotene-2-one, neurosporene-2-one, and lycopene-2-one are shown in FIG 3C-3E. Unexpectedly, the yellow carotenoids ζ-carotene and neurosporene, undetectable intermediates in lycopene producing E. coli pAC-crtE-crtB-crtl, also accumulated, indicating that CrtA uncouples the desaturation sequence catalyzed by Crtl. In addition, several minor more polar compound peaks were observed after HPLC separation. These compounds showed absorption characteristics of lycopene and neurosporene but with masses corresponding to the respective diketo- and dihydroxy- diketo- derivatives. A deep purple dihydroxy- diketo- derivative of tetradehydrolycopene identified as phillipsiaxanthin (chemical synthesis and mass fragmentation described in Schwieter et al. (1966) Helv. Chim. Acta 49:992-996) and lycopene constitute the major carotenoids synthesized by E. coli τ>AC-crtE-crtB-crtI14 co-expressing vXJC-crtA. The APCI mass spectrum of phillipsiaxanthin is shown in FIG 3F. Lycopene-2-one was accumulated as a minor product along with other polar xanthophylls that could not be identified unequivocally (Figure 3B).
This examples indicates that co-expression of CrtA with acyclic C40 carotenoid pathways can introduce a keto-group at the C(2, 2') position of unnatural substrates that do not exhibit a C(3,4) double bond, which was previously thought to be necessary
(Britton (1998) Carotenoids: Biosynthesis and Metabolism, Vol. 3, G. Britton, ed. (Basel: Birkhauser), pp. 13-147). In addition, the complete conversion of tetradehydrolycopene to phillipsiaxanthin observed (Figure 3B), suggests it is a favorable substrate for CrtA activity when compared to the incomplete conversion of lycopene to lycopene-2-one in the presence of CrtA. EXAMPLE 5 β-carotene oxygenase CrtO introduces keto-groups in torulene and β,β-carotene
The catalytic promiscuity of different cloned β,β-carotene modifying enzymes towards torulene was probed for the production of novel cyclic carotenoids. To extend the evolved toralene and, as a control, the wild-type β, β-carotene pathway, with different carotenoid genes in E. coli, the lycopene cyclase crtY or evolved cyclase crtY2 genes were cloned into p AC-crtE-crtB-crtll 4 to yield p AC-crtE-crtB-crtll 4-crtY and pAC- crtE-crtB-crtI14-crtY2. E. coli cells harboring p AC-crtE-crtB-crtll 4-crtY developed a bright orange color due to the synthesis of β, β-carotene, while E. coli cells transformed with p AC-crtE-crtB-crtll 4-crtY2 turned bright red due to the production of toralene and lycopene (Figure 4A, B).
The introduction of keto-groups at position C4(4') of one or both rings of β,β- carotene is catalyzed by β-carotene oxygenases or ketolases. Most β-carotene oxygenases show homology to fatty acid desaturases and introduce keto-groups at both β- rings to synthesize canthaxanthin, the precursor of the biotechnologically important carotenoid astaxanthin (Figure 1). However, β-carotene oxygenase CrtO from Synechocystis sp. is unique as it shows high homology to phytoene dehydrogenases and has been reported to introduce only one keto-group at C4 of one β-ring, as present in torulene, to synthesize echinenone. E. coli p AC-crtE-crtB-crtll 4-crtY or pAC-crtE-crtR- crtI14-crtY2 expressing the β, β-carotene or torulene pathways, respectively, were co- transformed with pUC-crtO. Surprisingly, in this system where each carotenoid enzyme is individually expressed under the control of a constitutive /αc-promoter, CrtO introduced keto-groups efficiently at both rings of β,β-carotene to yield canthaxanthin in a similar ratio to the mono-keto product echinenone (Figure 4C). The symmetrical activity of CrtO on β, β-carotene was not related to the gene copy number of crtO on pUC-crtO as similar ratios of canthaxanthin and echinenone were produced by E. coli with the single plasmid system p AC-crtE-crtB-crtll ' 4-crtY-crtO . Analysis of extracts from cells expressing the CrtO extended torulene pathway, however, revealed synthesis of a new, major carotenoid in addition to smaller amounts of echinenone, canthaxanthin, torulene and lycopene (FIG 4D). Absorption maxima, polarity and mass fragmentation spectrum of this new carotenoid identified it as 4-keto-toralene (Figure 1). The ESI mass spectrum for ketotorulene is shown in FIG. 4G.
EXAMPLE 6
Aromatic carotenoids are produced from β,β-carotene and torulene by CrtU
Aromatic carotenoids have been isolated from several bacteria and three bacterial β-carotene desaturases (CrtU) have recently been cloned and characterized in their homologous hosts. See Krugel et al. (1999) Biochim. Biophys. Acta 1439, 57-64; Krubasik and Sandmann (2000). Mol. Gen. Genetics 263, 423-432; and Viveiros et al., (2000) FEMS Microbiol. Lett. 187, 95-101). The symmetrical aromatization of β,β- carotene to isoreneriatene (φ,φ-carotene) by CrtU involves the introduction of two double bonds and a concurrent methyl group shift for each β-ring (Figure 1). It was first examined whether CrtU can function cooperatively with other heterologous carotenoid enzymes in engineered E. coli.
The exclusive formation of isorenariatene by E. coli p AC-crtE-crtB-crtll 4-crtY co-expressed with pUC-crtU proved therefore that CrtU functions cooperatively with other carotenoid enzymes assembled from different organisms (Figure 4E). When E. coli cells harboring p AC-crtE-crtB-crtll 4-crtY2 were co-transformed with pUC-crtU, a new, more polar major carotenoid accumulated along with isoreniaratene, lycopene and torulene (Figure 4F) and was identified by adsorption maxima, polarity and mass fragmentation spectrum as aromatic torulene (didehydro-β,φ-carotene). The APCI mass spectrum of didehydro-β,φ-carotene is shown in FIG 4H.
EXAMPLE 7 β-carotene hydroxylase CrtZ and zeaxanthin glucosylase CrtX produce novel torulene derivatives
The catalytic promiscuity observed for CrtO and CrtU with torulene suggested that β-carotene hydroxylase CrtZ and zeaxanthin glucosylase CrtX, which converts β,β- carotene to the highly polar zeaxanthin-diglucoside in e.g. Erwinia strains (Figure 1), may exhibit similar broad substrate specificities and allow synthesis of a novel polar toralene- glucoside in E. coli. To extend the torulene and, as a control, the β, β-carotene biosynthesis pathway in E. coli with the two enzymes (CrtZ and CrtX) necessary for β- ring glucosylation, crtZ was cloned into pAC-crtE-crtB-crtI14-crtY , β-carotene) and p AC-crtE-crtB-crtll 4-crtY2 (torulene) to create p AC-crtE-crtB-crtll 4- crtY-crtZ and pAC-crtE-crtB-crtI14-crtY2-crtZ. Pathway extension with CrtZ resulted in the symmetrical hydroxylation of β,β-carotene to zeaxanthin, which was formed as the only product in E. coli p AC-crtE-crtB-crtll 4-crtY-crtZ (Figure 5A). However, a new polar carotenoid, with an absorption spectrum similar to torulene but with a mass spectrum expected for hydroxytorulene, accumulated as the main product in E. coli pAC-crtE-crtB- crtI14-crtY2-crtZ (Figure 5B) suggesting that torulene and β,β-carotene are equally good substrates for CrtZ. ΕSI mass spectrum for hydroxytorulene is shown in FIG. 5Ε. Subsequent combination inE. coli of p AC-crtE-crtB-crtll 4-crtY21 crtY-crtZ together with the terminal enzyme CrtX of the glucosylation pathway expressed on pUC-crt , gave rise to a number of very polar carotenoid structures in E. coli. The assembled β, β-carotene glucosylation pathway in E. coli harboring AC-crtE-crtB-crtll 4-crtY-crtZ and pUC-crt produced zeaxanthin-diglucoside as a major product. Other biosynthesis intermediates such as zeaxanthin, zeaxanthin-monoglucoside, β-cryptoxanthin-monoglucoside (one β- ring of β,β-carotene glucosylated) were also produced (Figure 5C). Neither hydroxytorulene nor its precursor torulene accumulated in E. coli cells carrying the assembled torulene glycosylation pathway, but a new carotenoid identified as toralene glucoside is synthesized in addition to different hydroxylated and glucosylated β,β- carotene derivatives (Figure 5D). The ΕSI mass spectrum of torulene glucoside is shown in FIG 5F. The formation of carotenoids where only one β-ring is hydroxylated or glucosylated, indicates that CrtZ and CrtX catalyze β-ring modification irrespective of the other end-structure present in a carotenoid molecule. EXAMPLE 8 Metabolic Engineering of the methylotropic yeast Pichia pastoris for enhanced carotenoid production Heterologous carotenoid genes required for lycopene (crtE, crtB, crtl), tetradehydrolycopene (crtE, crtB, crtI14), β, β-carotene (crtE, crtB, crtl, crtY) and torulene (crtE, crtB, crtI14, crtY2) production by extension of the general yeast isoprenoid pathway were subcloned (FIG 6) into a multi-copy integration E. coli-Pichia shuttle vector (pGAPZ, Invitrogen) bearing a functional constitutive GAP-promoter and a terminator. All expression cassettes were then assembled on a single vector (FIG 7). After purification from E. coli, the plasmid was transformed into P. pastoris and carotenoid producing variants were selected. Production levels were compared between clones with peroxisomal targeting of proteins and those without targeting. For subsequent product analysis various extraction procedures were compared and even modified to optimize extraction of carotenoid from P. pastoris.
Carotenoid production of the four example carotenoid pathways were analyzed and quantified by UV- visual spectra, thin layer chromatography and high performance liquid chromatography. Carotenoid levels in the range of several mg of carotenoids per gram of dry cell weight were obtained in P. pastoris. FIG. 8 shows the HPLC analysis of the carotenoid extract in recombinant P. pastoris.
EXAMPLE 9 Production of Acyclic Carotenoids Using Oxygenases
Recombinant E. coli cells expressing diapophytoene synthase crtN and diapophytoene desaturase crtM from Staphylococcus and producing diaponeurosporene and diapolycopene were co-transformed with newly discovered carotenoid oxygenase sequences identified in the genomes of Staphylococcus and Oceanobacillus (see Table 2). E. coli cells co-expressing the C30 carotenoid pathway together with carotenoid oxegenases from these organisms turned purple due to the production of C30 carotenoids containing terminal aldehyde and carboxyl functions. FIG 9 shows the pathway leading to these compounds. FIG 10 shows examples of purple carotenoids extracted from engineered E. coli cells. The discovered carotenoid oxygenases also can be used to oxidize the acyclic ends of other C30 and C40 carotenoid structures (for example, lycopene, neurosporene, didehydrolycopene and torulene) to produce a variety of novel carotenoid aldehydes and carotenoid carboxylic acids.
MATERIALS AND METHODS Bioinformatics.
Whole genome DNA sequences of S. aureus strains MW2 (NC 003923), N315 (NC 002745) and Mu50 (NC_002758) and Oceanobacillus iheyensis (NC 004193) were obtained from NCBI. Protein sequences of S. aureus CrtN (B55548) and CrtM (A55548) were obtained from NCBI. Homology searches were performed using NCBI BLAST' software. Altschul et al. (1990) J. Mol. Biol. 215:403-410. Genome region analysis and ORF prediction were performed using TIGR Comprehensive Microbial Resource (Peterson et al., (2001) Nucleic Acids Res. 29:123-5). Sequence editing was performed using Bioedit software (Hall (1999) Nucl. Acids Svmp. Ser. 41 :95-98). Enzyme activities and GenBank Accession numbers are provided in Table 2 (above).
Strains and culture conditions.
All cloning and DNA manipulations were carried out in E. coli JM109 using standard techniques (Sambrook et al, Molecular cloning: a laboratory manual, Cold Spring Harbour Laboratory Press, New York, USA, second edition (1989)) and unless otherwise stated, microorganisms were grown at 30°C with shaking at 300 RPM. Following sequencing, plasmids were transformed into E. coli strain JM109 for expression (Table 3). S. aureus (ATCC 35556D) genomic DNA was acquired from the ATCC. O. iheyensis was acquired from DSMZ and cultured in PY medium (Lu et al. (2001) FEMS Microbiol. Lett. 205:291-9) for 48 hours at room temperature with shaking at 300 RPM. Genomic DNA was prepared using a Promega Wizard SV genomic DNA kit.
Plasmid construction.
Cloning of the S. aureus carotenoid pathway genes CrtN and CrtM is described above. The cloning of the E. coli prenyltransferase IspA and construction of the plasmid pACJspA SAM SAN have been described by Lee et al., (2003) Chem. Biol. 10:453-62. The S. aureus carotenoid gene CrtOx was amplified from S. aureus (ATCC 35556D) genomic DNA using PCR primers SAlOx-f-X (5'-
Gctctagaaggaggattacaaaatgactaaacatatcatcg-3', SEQ ID NO:2) and SAlOx-f-N (5 - Ttcctttgcggccgctcacttcctattcttcgc-3', SEQ ID NO:3). The homologous gene from O. iheyensis was amplified from O. iheyensis genomic DNA using the PCR primers OIOxF
Xbal (S'-gctctagaaggaggTGAaTaaCATGAAAAAGGTAATTAT-S*, SEQ ID NO:4) and OIOxR otl (S'-ttcctttgcggccgcCCTTAACATTAACTAA-ATATCTGAT-S', SEQ ID NO:5). These PCR products were digested with^¥bαl and Notl enzymes and gel purified and ligated into similarly prepared pUCMod vector (described above) to yield pUC SAOx and pUC OIOx, respectively. Insert containing plasmids were isolated and sequenced to confirm no PCR errors were present. The two additional S. aureus carotenoid pathway genes CrtGT and CrtXY were amplified from genomic DΝA using PCR primer pairs SAGTF_Xbal (5'gctctagaaggaggattacaaaatgaaatggttatcacgaatat, SEQ ID ΝO:6), SAGTR_NotI (5'ttcctttgcggccgcccttgatttattgttctt, SEQ ID NO:7) and SAXYF_Xbal (5*- gctctagaaggaggattacaaaatgaaaaccatgaaaaaatata, SEQ ID NO:8), SAXYR_Notl (5' ttcctttgcggccgcttagtcatgacgttcac, SEQ ID NO:9), respectively. Following digestion of the PCR products wit Xbal and Notl, the genes were cloned into similarly prepared pUCmod to yield pUC-SAGT and pUC-SAXY, respectively.
O. iheyensis homologues of the genes CrtM and CriΝ present in the O. iheyensis genomic operon were PCR amplified as a contiguous DΝA fragment using the primers OIΝXbal_F (5'-gctctagaaggaggatgtctatgaaaa-3', SEQ ID NO: 10) and OIM_Notl_R (5'- ttcctttgcggccgctagatactagtagcttga-3', SEQ ID NO:l 1) and cloned into the pUCMod vector as above. E. coli JM109 strains harboring this plasmid produced a yellow pigmented phenotype. A contiguous OIM-N DNA fragment was then PCR amplified using the PCR primers pUCinRjSall (5'-gacgcgtcgacatatgcggtgtgaaataccg-3', SΕQ ID NO: 12) and pUCInF_SphI (5'-gacgcgcatgcccgactggaaagcgg-3', SΕQ ID NO: 13) and subcloned into the pACMod vector to produce pAC OIM-N. This vector was then digested with Sphl and Sail and ligated into similarly digested pACJspA vector to produce pAC_IspA_OιM-N.
Carotenoid Expression and optimization.
Initially, production of novel C30 carotenoids was attempted by co-expressing the plasmids pAC_IspA_SAM_SAN and pUC_SAOx in E. coli strain JM109. Recombinant cells were cultured at 37°C, 300 RPM in LB medium supplemented with carbenicillin and chloramphenicol. In order to optimize carotenoid production for this strain, cultures were grown in LB medium, LB supplemented with 0.5% glycerol (LBG), and TB medium at 30 and 37°C for 24 hours. E. coli strains harboring pAC_IspA_SAM_SAN / pUC _OIOx, pACJsp A_OrM-N / pUC_OIOx and p AC_IspA_OιM-N / pUC_S AOx were cultured under optimized conditions and carotenoids extracted by acetone and analysed by TLC.
Carotenoid extraction and purification.
For analytical identification of the novel carotenoids produced, JM109 (pACJspA SAM_SAN ρUC_SAOx) was cultured at 30°C in 500 mL LBG medium for 24 hours and cells pelleted. Carotenoids were extracted by addition of 15 mL of acetone to cell pellets and incubation in a sonicating water bath at 4°C for 30 minutes, followed by centrifugation to remove cell debris: Extraction with acetone was repeated until no pigment was visible in the cell pellets and the supernatants pooled. Pooled extracts were dried down completely under a stream of N2 gas and resuspended in 20 mL of hexanes. A precipitate that formed upon hexane resuspension was pelleted by centrifugation, dried and resuspended in 20 mL ethyl acetate. Both samples were two-phase extracted with 20 mL 5M NaCl, solvent phases recovered, dried down and resuspended in 2 mL of acetone. The hexane fraction was then loaded onto silica gel open columns developed with hexanes followed by mixtures of hexanes with increasing acetone concentrations (10, 25, and 50%) acetone). The ethyl acetate fraction was similarly developed using a starting mobile phase of 80% hexanes, 20% acetone followed by 50% acetone, 50% hexanes. Like fractions from each column preparation were pooled, dried down and stored at - 80°C.
Time Course Study.
JM109 (pACJspA_SAM_SAN pUC_SAOx) was cultured at 30°C in 500 mL LBG medium and 20 mL culture samples collected at 24 hour intervals for 144 hours. Samples were centrifuged when collected, supernatants discarded and pellets stored at - 20°C until analysis. Pigments in cell pellets were repeatedly extracted with 2 mL acetone as above until no additional pigment was visible in the acetone supernatant. Acetone fractions were dried down under a stream of N2 gas, resuspended in 5 mL ethyl acetate, and washed with 5 mL salt water. The ethyl acetate was then dried under N2 gas and samples resuspended in 1 mL methanol for analysis.
HPLC and LC-MS analysis.
Pooled fractions from silica gel chromatography above were analyzed by TLC as described previously and by HPLC and LC-MS. HPLC separation was performed using a Zorbax SB-C18 column (4.6 x 250 mm, 5 μM; Agilent technologies, Palo Alto, CA) with 100% MeOH as an isocratic mobile phase at a flow rate of 1 mL min"1 using an Agilent 1100 HPLC system equipped with a photodiode array detector. Mass spectromefry was performed under the same conditions as HPLC analysis. Mass spectra were monitored in a mass range of m/z 200-800 or 1000 on a LCQ mass spectrophotometer equipped with an atmosphere pressure chemical ionization (APCI) interface (Thermo Finnigan, USA).
Saponification and extraction of aqueous pigments.
Cell pellets from 500 mL 144 hour cultures of E. coli JM109 (pAC_IspA_SAM_SAN pUCJSAOx) were resuspended in 50 mL of dH2O, KOH added , to a final concentration of 10%, and samples incubated at 65°C for 2 hours or at room temperature overnight. Insoluble material was pelleted by centrifugation and the supernatant extracted twice with 50 mL hexanes. The remaining, lower aqueous phase was kept and acetic acid added to pH 4. This acidified sample was then extracted with ethyl acetate, the pigment forming a precipitate between the phases that was recovered, dried under a stream of N2 gas and stored at -20°C.
RESULTS Identification of novel C30 carotenoid genes.
Analysis of the genome region of S. aureus where CrtM and CrtN are present indicated the presence of a number of closely spaced genes in the same orientation, typical of a microbial operon stracture. The genes included a homolog of CrtN (CrtOx), a putative glycosyl transferase (CrtGT), and an additional short ORF with no homology to known proteins (CrtXY). As previous results with mutants of C30 carotenoid producing strains indicated that reactions that generate additional double bonds and carboxyl termini are enzymatically linked, it was proposed that CrtOx is a dual function desaturase / oxygenase enzyme. Based on its homology to known glycosyl transferases, the CrtGT gene was proposed to be a glycosyl transferase that produces glycosyl ester carotenoids. A BLAST search did not reveal any homologous sequences for the short ORF CrtXY. The structure of the operon can be seen in FIG 11 A. BLAST searches against the NCBI Genbank database revealed homologues of each of these genes are present in the genome of Oceanobacillus iheyensis. A similar operon structure is present in this organism although the gene arrangement is different (see FIG 1 IB). The proposed engineered biosynthetic pathway for these enzymes is provided in FIG 12.
Cloning and expression of novel carotenoid genes.
Initially, production of novel C30 carotenoids was attempted by co-expressing the plasmids pAC IspA SAM SAN and pUC SAOx in E. coli strain JM109. The SAOx (putative diapocarotene oxidase) gene was expressed on the high copy number plasmid pUCMod and the remaining carotenoid pathway genes on the low copy number plasmid pACMod in order to direct metabolic flux towards more polar carotenoid end products. This strain, along with a control strain harboring pUCMod in place of pUC SAOx, were cultured me in LB medium supplemented with carbenicillin and chloramphenicol for 24 hours at 37°C, 300 RPM and carotenoids extracted with acetone. E. coli expressing pAC_IspA_S AM_S AN and pUCjS AOx produced a distinctive violet phenotype when compared to the control strain. Analysis of the carotenoids of this strain by normal phase silica-gel TLC using a ethyl acetate: hexane 1:3 mobile phase revealed the presence of a number of novel, polar carotenoids when compared to the control strain. Cloning and expression in E. coli of the two other carotenoid ORF's SAGT and SAXY resulted in a pleiotrophic phenotype. E. coli clones constitutively expressing SAGT or SAXY on pUCmod were negatively affected in cell growth and exhibited an aberrant colony morphology (shiny, small colonies), indicating that both genes encode enzymes with broad substrate specificity that act on substrates other than carotenoid too, e.g. membrane lipids. Previous results have indicated that medium and culture conditions can considerably influence the yield and product distribution of recombinantly produced carotenoids. The E. coli (ρAC_IspA_SAM_SAN and ρUC_SAOx) strain producing novel carotenoids was therefore cultured in different media at different temperatures to optimize production. Both LBG and TB medium had considerably higher carotenoid production than LB medium and overall carotenoid production in LBG medium was highest, hi both cases, higher carotenoid production was observed at 30°C compared to 37°C. Different color phenotypes were observed for cell pellets - dark orange/red in TB medium and dark purple in LBG medium. TLC analysis indicated the presence of similar product profiles but different product distributions - a violet pigment being the dominant product in LBG medium with higher accumulation of less polar precursors in TB medium. For remaining experiments, recombinant strains were cultured in LBG medium at 30°C, 300 RPM. Carotenoid production was also analysed from strains harboring O. iheyensis genes in place of the pACMod vector, pUCMod vector or both. In each case the carotenoid products generated were similar but different product distributions were present, in general the genes from S. aureus appeared to produce higher yields of the most polar pigments.
Identification of novel carotenoid products.
In order to structurally characterize the obtained carotenoid products, a 500 mL culture was grown under optimized conditions, carotenoids extracted into acetone and then partitioned into two solvent phases (less polar hexanes and more polar ethyl acetate) and products separated by open column silica gel cliromatography. Each solvent partition yielded a number of different carotenoid fractions of increasing polarity that were visualized by TLC. In total, five unique carotenoid fractions were identified and analyzed by LC-MS. The major product of the more polar ethyl acetate solvent fraction was the strong red / violet compound 3 which was found to have a parent mass of 429.1 and a fragmentation pattern consistent with the fully desaturated C30 dialdehyde diapocarotenoid 4,4'-Diapocarotene-4,4'-dial. In addition, the more polar violet compound 5 was found to have a parent mass of 445.2 and a fragmentation pattern consistent with the structure 4,4'-Diapocarotene-4-al, 4'-oic acid. The remaining compounds have parent masses consistent with mono- and dialdehyde precursors of varying carotenoid backbone desaturation states (Table 4). The presence of compound 5 strongly suggested that a CrtOx catalyzed, non-specific reaction from terminal aldehyde to carboxyl function, occurs at a relatively slow rate.
A time course experiment was performed under the optimized culture conditions to detect additional dicarboxylic acid carotenoid products and to improve the production of more polar C30 carotenoids, in particular dicarboxylic acid derivatives. Pellets from each time sample were extracted with acetone and the solvent accessible carotenoids characterized by HPLC analysis. It was also found that significant levels of pigments that resisted extraction in acetone were present in 48 hour and higher samples. Furthermore, subsequent extractions of the acetone extract cell pellets indicated that this compound could not be extracted using common laboratory organic solvents (chloroform, methanol, ethanol, hexanes, petroleum ether, ethyl acetate and DMSO). Initial experiments indicated that the non-solvent accessible pigment produced was soluble in low concentrations of aqueous alkali salts such as NaOH or KOH. It was also found that this compound precipitated from aqueous solutions below pH 6.5, but the violet precipitate formed was not soluble in organic solvents. These physical properties are consistent with those of a short chain dicarboxylic acid carotenoid such as norbixin, which is soluble in aqueous solutions only as a salt.
OTHER EMBODIMENTS
It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.

Claims

WHAT IS CLAIMED IS:
1. A microorganism comprising an exogenous nucleic acid encoding a diapophytoene synthase, a dehydrosqualene desaturase, and a carotenoid oxygenase, wherein said microorganism produces detectable amounts of a 4,4-diapo-ζ-carotene or a diaponeurosporene derivative, said derivative having a terminal aldehyde or terminal carboxyl acid moiety.
2. The microorganism of claim 1 , wherein said derivative is diapolycopene dialdehyde or diapolycopene dicarboxylic acid.
3. The microorganism of claim 1, wherein said exogenous nucleic acid encodes a S. aureus diapophytoene synthase.
4. The microorganism of claim 1, wherein said exogenous nucleic acid encodes an O. iheyensis diapophytoene synthase.
5. The microorganism of claim 1, wherein said exogenous nucleic acid encodes a S. aureus dehydrosqualene desaturase.
6. The microorganism of claim 1, wherein said exogenous nucleic acid encodes an O. iheyensis dehydrosqualene desaturase.
7. The microorganism of claim 1, wherein said exogenous nucleic acid encodes a S. aureus carotenoid oxygenase.
8. The microorganism of claim 1, wherein said exogenous nucleic acid encodes an O. iheyensis carotenoid oxygenase.
9. The microorganism of claim 1, wherein said exogenous nucleic acid further encodes a famesyl diphosphate synthase.
10. The microorganism of claim 3, wherein said famesyl diphosphate synthase is IspA.
11. The microorganism of claim 1, wherein said derivative is 4,4'-diapo-ζ-carotene-al or 4,4'-diapo-ζ-carotene-dial.
12. The microorganism of claim 1, wherein said derivative is a water soluble carotenoid.
13. The microorganism of claim 5, wherein said water soluble carotenoid is norbixin.
14. A composition comprising a compound selected from the group consisting of 4,4'- diapo-ζ-carotene-al and 4,4'-diapo- ζ -carotene-dial.
15. The composition of claim 14, wherein said composition is a food composition.
16. A method of making a compound selected from the group consisting of 4,4'-diapo-ζ- carotene-al and 4,4'-diapo-ζ-carotene-dial, said method comprising culturing the microorganism of claim 1 under conditions wherein said microorganism produces said compound.
17. The method of claim 16, said method further comprising extracting said compound from said microorganism.
18. The method of claim 16, wherein said microorganism produces at least about 1 mg L of said compound.
19. The method of claim 16, wherein said microorganism produces at least about 10 mg/L of said compound.
20. The method of claim 16, wherein said microorganism produces at least 100 mg/L of said compound.
EP04751536A 2003-05-07 2004-05-06 PRODUCTION OF CAROTENOIDS IN MICROORGANISMS Ceased EP1625201A4 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US46891003P 2003-05-07 2003-05-07
PCT/US2004/014180 WO2004101746A2 (en) 2003-05-07 2004-05-06 Production of carotenoids in microorganisms

Publications (2)

Publication Number Publication Date
EP1625201A2 true EP1625201A2 (en) 2006-02-15
EP1625201A4 EP1625201A4 (en) 2007-10-03

Family

ID=33452238

Family Applications (1)

Application Number Title Priority Date Filing Date
EP04751536A Ceased EP1625201A4 (en) 2003-05-07 2004-05-06 PRODUCTION OF CAROTENOIDS IN MICROORGANISMS

Country Status (2)

Country Link
EP (1) EP1625201A4 (en)
WO (1) WO2004101746A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CA2625433A1 (en) * 2005-10-11 2007-04-19 Lycored Ltd. Carotenoid oxidation products as chemopreventive and chemotherapeutic agents
FR3017798B1 (en) * 2014-02-27 2017-03-24 Etienne Soudant COSMETIC COMPOSITION BASED ON CAROTENOIDES C30 APPROVED
CN103952347B (en) * 2014-04-22 2016-01-06 四川大学 One strain moderate salt tolerant bacillus marinus and application thereof
CN119242603B (en) * 2024-12-05 2025-04-22 华南理工大学 Dehydrosqualene desaturase mutant and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090176287A1 (en) * 2005-02-24 2009-07-09 Regents Of The University Of Minnesota Producing carotenoids

Also Published As

Publication number Publication date
EP1625201A4 (en) 2007-10-03
WO2004101746A2 (en) 2004-11-25
WO2004101746A3 (en) 2005-09-01

Similar Documents

Publication Publication Date Title
US5429939A (en) DNA sequences useful for the synthesis of carotenoids
US5811273A (en) DNA strands useful for the synthesis of xanthophylls and the process for producing the xanthophylls
US9822384B2 (en) Production of cannabinoids in yeast
EP2742131B1 (en) Methods and materials for recombinant production of saffron compounds
US7074588B2 (en) Carotenoid ketolase gene
KR0178871B1 (en) Keto group transduction enzymes, DNA encoding them and methods for producing ketocarotenoids
US20180371513A1 (en) Production of Anthocyanin from Simple Sugars
EP0393690A1 (en) DNA sequences useful for the synthesis of carotenoids
JP2000507451A (en) Genes for carotenoid biosynthesis and metabolism and systems for screening such genes
US20090176287A1 (en) Producing carotenoids
JPWO1995018220A1 (en) DNA strand useful for synthesizing xanthophyll and method for producing xanthophyll
CA2996711C (en) Method of fermentative alpha-ionone production
US5589581A (en) DNA sequences useful for the synthesis of carotenoids
WO2022245988A2 (en) Production of carotenoids
CN111527203B (en) Oxidation of sesquiterpenes catalyzed by cytochrome P450 monooxygenases
US7695931B2 (en) Carotenoid hydroxylase gene, method for preparing hydroxylated carotenoid, and novel geranylgeranyl pyrophosphate synthase
WO2003016503A2 (en) Genes encoding carotenoid compounds
WO2007126639A1 (en) Mutant carotenoid ketolase
EP1625201A2 (en) Production of carotenoids in microorganisms
US20050221467A1 (en) Biological production of tetradehydrolycopene
US7186523B2 (en) Method for synthesis of aryl-carotenoids
JP7813719B2 (en) Transformant and method for producing carotenoid composition using the same
CN118272421B (en) A method for engineering Yarrowia lipolytica to produce astaxanthin
JP2960967B2 (en) Keto group-introducing enzyme, DNA encoding the same, and method for producing ketocarotenoids
JPWO1996006172A1 (en) Keto group-introducing enzyme, DNA encoding the enzyme, and method for producing ketocarotenoids

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20051206

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT LV MK

RIC1 Information provided on ipc code assigned before grant

Ipc: C07H 21/04 20060101ALI20060307BHEP

Ipc: C12N 15/00 20060101ALI20060307BHEP

Ipc: C12N 1/20 20060101ALI20060307BHEP

Ipc: C12N 9/02 20060101ALI20060307BHEP

Ipc: C12N 9/00 20060101ALI20060307BHEP

Ipc: C12P 23/00 20060101AFI20060307BHEP

DAX Request for extension of the european patent (deleted)
A4 Supplementary search report drawn up and despatched

Effective date: 20070904

17Q First examination report despatched

Effective date: 20080506

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20091211