EP1613168A1 - Composition with heart rate reducing properties - Google Patents

Composition with heart rate reducing properties

Info

Publication number
EP1613168A1
EP1613168A1 EP04725669A EP04725669A EP1613168A1 EP 1613168 A1 EP1613168 A1 EP 1613168A1 EP 04725669 A EP04725669 A EP 04725669A EP 04725669 A EP04725669 A EP 04725669A EP 1613168 A1 EP1613168 A1 EP 1613168A1
Authority
EP
European Patent Office
Prior art keywords
heart rate
food material
lactic acid
fragment
dna sequence
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP04725669A
Other languages
German (de)
French (fr)
Inventor
Bénédicte Flambard
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Chr Hansen AS
Original Assignee
Chr Hansen AS
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Chr Hansen AS filed Critical Chr Hansen AS
Priority to EP04725669A priority Critical patent/EP1613168A1/en
Publication of EP1613168A1 publication Critical patent/EP1613168A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/01Hydrolysed proteins; Derivatives thereof
    • A61K38/012Hydrolysed proteins; Derivatives thereof from animals
    • A61K38/018Hydrolysed proteins; Derivatives thereof from animals from milk
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; PREPARATION THEREOF
    • A23C11/00Milk substitutes, e.g. coffee whitener compositions
    • A23C11/02Milk substitutes, e.g. coffee whitener compositions containing at least one non-milk component as source of fats or proteins
    • A23C11/10Milk substitutes, e.g. coffee whitener compositions containing at least one non-milk component as source of fats or proteins containing or not lactose but no other milk components as source of fats, carbohydrates or proteins
    • A23C11/103Milk substitutes, e.g. coffee whitener compositions containing at least one non-milk component as source of fats or proteins containing or not lactose but no other milk components as source of fats, carbohydrates or proteins containing only proteins from pulses, oilseeds or nuts, e.g. nut milk
    • A23C11/106Addition of, or treatment with, microorganisms
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; PREPARATION THEREOF
    • A23C9/00Milk preparations; Milk powder or milk powder preparations
    • A23C9/12Fermented milk preparations; Treatment using microorganisms or enzymes
    • A23C9/123Fermented milk preparations; Treatment using microorganisms or enzymes using only microorganisms of the genus lactobacteriaceae; Yoghurt
    • A23C9/1234Fermented milk preparations; Treatment using microorganisms or enzymes using only microorganisms of the genus lactobacteriaceae; Yoghurt characterised by using a Lactobacillus sp. other than Lactobacillus Bulgaricus, including Bificlobacterium sp.
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23KFODDER
    • A23K20/00Accessory food factors for animal feeding-stuffs
    • A23K20/10Organic substances
    • A23K20/142Amino acids; Derivatives thereof
    • A23K20/147Polymeric derivatives, e.g. peptides or proteins
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17Amino acids, peptides or proteins
    • A23L33/18Peptides; Protein hydrolysates
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23LFOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES, NOT OTHERWISE PROVIDED FOR; PREPARATION OR TREATMENT THEREOF
    • A23L33/00Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof
    • A23L33/10Modifying nutritive qualities of foods; Dietetic products; Preparation or treatment thereof using additives
    • A23L33/17Amino acids, peptides or proteins
    • A23L33/19Dairy proteins
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K35/00Medicinal preparations containing materials or reaction products thereof with undetermined constitution
    • A61K35/12Materials from mammals; Compositions comprising non-specified tissues or cells; Compositions comprising non-embryonic stem cells; Genetically modified cells
    • A61K35/20Milk; Whey; Colostrum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K36/00Medicinal preparations of undetermined constitution containing material from algae, lichens, fungi or plants, or derivatives thereof, e.g. traditional herbal medicines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • A61K38/02Peptides of undefined number of amino acids; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00Drugs for disorders of the urinary system
    • A61P13/12Drugs for disorders of the urinary system of the kidneys
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/04Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/06Antiarrhythmics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/10Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00Drugs for disorders of the cardiovascular system
    • A61P9/12Antihypertensives
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00Microorganisms; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/20Bacteria; Culture media therefor
    • C12N1/205Bacterial isolates
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/48Hydrolases (3) acting on peptide bonds (3.4)
    • C12N9/50Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
    • C12N9/52Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from bacteria or Archaea
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P21/00Preparation of peptides or proteins
    • C12P21/06Preparation of peptides or proteins produced by the hydrolysis of a peptide bond, e.g. hydrolysate products
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23CDAIRY PRODUCTS, e.g. MILK, BUTTER OR CHEESE; MILK OR CHEESE SUBSTITUTES; PREPARATION THEREOF
    • A23C2220/00Biochemical treatment
    • A23C2220/20Treatment with microorganisms
    • A23C2220/202Genetic engineering of microorganisms used in dairy technology
    • AHUMAN NECESSITIES
    • A23FOODS OR FOODSTUFFS; TREATMENT THEREOF, NOT COVERED BY OTHER CLASSES
    • A23VINDEXING SCHEME RELATING TO FOODS, FOODSTUFFS OR NON-ALCOHOLIC BEVERAGES AND LACTIC OR PROPIONIC ACID BACTERIA USED IN FOODSTUFFS OR FOOD PREPARATION
    • A23V2400/00Lactic or propionic acid bacteria
    • A23V2400/11Lactobacillus
    • A23V2400/147Helveticus
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12RINDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
    • C12R2001/00Microorganisms ; Processes using microorganisms
    • C12R2001/01Bacteria or Actinomycetales ; using bacteria or Actinomycetales
    • C12R2001/225Lactobacillus

Definitions

  • the present invention relates to the use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable proteins, with a lactic acid bacterium to obtain a fermented food material which comprises peptides or other active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate in a mammalian.
  • CAD coronary artery disease
  • CHD coronary heart disease
  • CAD and CHD is a "hardening" of the arteries on the surface of the heart, where the term “hardening” refers to a condition that causes the arteries to become so narrowed and stiff that the block the free flow of blood.
  • Lower heart rate is related with better outcome and in particular with a reduced risk of arrhythmias. Higher heart rate may reflect a higher metabolic rate and lower vagal tone thus increasing ischemic risk. Furthermore higher heart rates may also deteriorate ventricular function (Lombardi, F in Zaza et al., 2001). Thus it is not surprising that it has been reported that an important risk factor associated with CAD or CHD is a high heart rate. CAD or CHD is frequently treated with medications. These medications fall into different categories such as:
  • Beta blockers that reduce the workload of the heart by blocking certain chemicals from binding to beta-receptors in the heart.
  • Calcium channel blockers that increase blood flow through the heart and may reduce the workload of the heart by blocking calcium ions from signalling the blood vessels to constrict or tighten.
  • Anti platelets e.g. aspirin
  • Anti platelets that inhibit the formation of blood clots by decreasing the abil- ity of platelets (microscopic particles found in the blood) to bind together and form a blood clot.
  • the prevention of a high heart rate in the early stage of the development of the disease can be an alternative to treatment of high heart rate with drugs.
  • a large number of food derived bioactive compounds are currently considered as beneficial for general well being or as health promoting.
  • WO0185984 discloses that milk fermented with a starter containing Lactobacillus helveticus and Saccharomyces cerevisiae reduces the systolic and diastolic blood pressure, yet no changes were observed in other indexes, including pulse rate.
  • WO0185984 also relates to peptides having anti- hypertensive effect (blood reducing effect), where the peptides from an enzymatic digest of whey protein. Changes in heart rate and blood pressure were measured. A significant reduction in mean arterial blood pressure was observed, and except for the observation of the 75 mg/kg dose, which elicited a decrease in heart rate, no significant difference between the heart rate responses occurred at the doses of 30 and 150 mg/kg.
  • the problem to be solved by the present invention is to provide an alternative composition useful for reducing heart rate.
  • the solution is based on that the present inventors have identified that by fermenting a food material, preferably milk, with a lactic acid bacterium (LAB), active components with in- creased heart rate reducing properties are obtained.
  • a food material preferably milk
  • LAB lactic acid bacterium
  • a first aspect of the invention relates to the use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable pro- teins, with a lactic acid bacterium to obtain a fermented food material which comprises peptides or other active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate in a mammalian.
  • the invention provides a fermented food material having heart rate reducing properties in a mammalian and comprising active components produced by the fermentation of the food material with at least one lactic acid bacterium strain.
  • a food material fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998) is a preferred embodiment.
  • the invention provides a fermented food material having heart rate reducing properties in a mammalian and comprising dead or alive Lacto- bacillus helveticus strain DSM 14998 or a mutant thereof.
  • the heart rate reducing component(s) isolated from the fermented food material is(are) provided.
  • the invention describes the use of the fermented food material or heart rate reducing active components isolated there from for the manufacture a medicament for the treatment or relief of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, arrhythmia, tachyarrythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyslipidemia, dyslipo- proteinemia.
  • CAD coronary artery disease
  • CHD coronary heart disease
  • angina pectoris such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, arrhythmia, tachyarrythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyslipidemia,
  • the term "for reducing the heart rate in a mammalian” denotes reduction of heart rate in relation to the heart rate before administration of the composition as described herein.
  • the heart rate reducing properties should be determined in an animal model.
  • the fermented product is administered to spontaneous hypertensive rats (SHR) by gavage and determine the heart rate for 24 hours after ga- vage by telemetry in conscious SHR at different time points.
  • Placebo should preferably be the corresponding unfermented food material such as e.g. unfermented milk.
  • a model based on normotensive Wistar rats as described in Example 6 can be used to assess the reduction of heart rate.
  • lactic acid bacterium designates a group of Gram positive, catalase negative, non-motile, microaerophilic or anaerobic bacteria that ferment sugar with the production of acids including lactic acid as the predominantly produced acid, acetic acid, formic acid and propionic acid.
  • Embodiment(s) of the present invention is described below, by way of example(s) only.
  • the food material should comprise animal milk proteins or vegetable proteins.
  • animal milk proteins preferably enumerated by, for example milk protein components, such as whole or defatted animal milk or milk casein.
  • Food material with vegetable proteins may preferably be enumerated by, for example corn, corn protein, wheat, wheat protein, soybean, defatted soybean or soybean protein.
  • the use of lactic acid bacteria as described herein provides directly after fermentation a use- ful amount of peptides or other active components with very good heart rate reducing properties. Consequently, it is not considered necessary to further purify or up-concentrate the peptides or other active components from the fermented food material.
  • the fermented food material may be packed directly and provided to the market as a food product, preferably a functional food product, or a food product additive, e.g. in a freeze-dried form. In Example 1 this is demonstrated. In short, the results of Example 1 show that fermented milk in itself without any further treatment has good heart rate reducing effect. Further freeze-dried fermented milk could be suspended in neutral milk and thereby give a suitable food product. The freeze-dried fermented milk could therefore be seen as a suitable food additive product.
  • the term "functional food” denotes herein a food product where the consumer in some way is informed that it has a useful function in relation to heart rate reducing properties. When the term food is used it may also be feed. However, a food product is preferred.
  • an embodiment of the invention relates to a use as described herein where the composition is a food product comprising peptides or other active components with heart rate reducing properties obtainable by a process comprising following steps:
  • Step (ii) is preferably freeze-drying.
  • the term "packing” should be understood broadly. It denotes that once a food material is fermented and a fermented food material is obtained, the fermented food material should be packed in order to could be provided to the consumer. It may be packed in a bottle, a terra- pack, etc. Preferably, on the package or in corresponding marketing material is indicated that the product has heart rate reducing properties. This applies for any aspects or embodiments of a product as described herein.
  • the lactic acid bacteria in the food product may be dead or alive, since a heat-treated fermented food material also had heart rate reducing properties.
  • the term "for reducing the heart rate in a mammalian” denotes reduction of heart rate in relation to the heart rate before administration of the composition as described herein.
  • the heart rate reducing properties should be determined by administrating the product to spontaneous hypertensive rats (SHR) by gavage and determine the heart rate for 24 hours after gavage by telemetry in conscious SHR at different time points and preferentially continuously.
  • SHR spontaneous hypertensive rats
  • Other animal models are useful for evaluating the heart rate efficacy of the fermented product.
  • One example is the model of normotensive Wistar rats described in example 6.
  • Placebo should preferably be the corresponding unfermented food material such as e.g. unfermented milk. For further details see working example 1 herein.
  • the product may be used in a treatment of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, arrhythmia, tach- yarrythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyslipidemia, dyslipoproteinemia.
  • CAD coronary artery disease
  • CHD coronary heart disease
  • angina pectoris such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, arrhythmia, tach- yarrythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyslipidemia, dyslipoproteinemia.
  • CHF congestive heart failure
  • Example 1 In addition to the conditions just mention the issue of fluctuations of the heart rate attracts interest.
  • Example 1 it is demonstrated the fermented product effectively decreases heart rate but surprisingly also decreases fluctuations in the heart rate during the activity period of the experimental animals.
  • the damping of the fluctuations in the heart rate may be an important feature since changes in heart rate correlates with mortality in an experimental model (Zaza et al 2001).
  • the product may preferably be a food product or food additive, which people can consume in a daily or continuous manner.
  • the product has a heart rate reducing effect that is 10 % over placebo where pla- cebo is defined above as the corresponding unfermented food material.
  • the product has a heart rate reducing effect that is 15 % over placebo, even more preferably the product has a heart rate reducing effect that is 20 % over placebo and most preferably the product has a heart rate reducing effect that is 25 % over placebo.
  • the use of the lactic acid bacteria, as described herein, provides directly after the fermentation a useful amount of peptides or other active components with very good heart rate reducing properties.
  • the product is a medicament.
  • example 1 shows that the heart rate reducing effect is proportional to the con- centration factor of the product.
  • an embodiment of the invention relates to a use as described herein where the fermented food material is further processed in a way that purify or up-concentrate the peptides or other active components with heart rate reducing properties obtainable by a process comprising following steps: (ii) Preparing a fermented food material according to a process for preparing peptides or other active components with heart rate reducing properties as described herein,
  • step (i) The fermented food material of step (i) is further processed in a way that pu- rifies or up-concentrate the active components with heart rate reducing properties,
  • the process may comprise a further step (iv) where the up- concentrated peptides or other active components of (ii) is added to the food product.
  • a preferred embodiment for up-concentration according to step (ii) above is where the fermented food material containing peptides or other active components with heart rate reducing properties are centrifuged, and the resulting supernatant comprising the peptides or other active components are recovered.
  • the food material is milk then such a product is whey.
  • whey is a product with excellent heart rate reducing properties. Accordingly in a preferred embodiment the product is whey.
  • the centrifugation may preferably be performed, for example, at 2,000 to 20,000 rpm for 1 to 20 minutes.
  • the centrifugation may also be performed in a centrifugator.
  • the resulting supernatant may be subjected to further purifying treatment with a reverse- phase resin, for obtaining a sample in which the content of the peptides or other active components with heart rate reducing properties is increased.
  • the purifying treatment with a reverse-phase resin may be performed by abso ⁇ tion and elution of the peptides or other active components with a reverse-phase resin, and/or by reverse-phase chromatography, thereby increasing purity of the peptides or other active components.
  • this reverse-phase resin protocol reference is made to EP821968.
  • the fermented food material is further processed in a way wherein a nanofil- tration is performed on the fermented food material. This may be done in order to remove lactic acid or monovalent ions from the fermented food material.
  • the food material is fermented by lactic acid bacteria under operating conditions, which may be varied depending on the types of the food material and/or the combination of the lactic acid bacteria.
  • the food material is not already an aqueous solution
  • food material is dissolved in a suitable aqueous solution, which is then admixed with lactic acid bacteria and cultivated by way of fermentation.
  • the culturing of the lactic acid bacteria may be performed by adding pre-cultured lactic acid bacteria starter to the food material medium, which may have been previously heat-sterilized and cooled to the predetermined temperature for incubation.
  • the inoculation amount of the lactic acid bacteria starter may preferably be 10 5 to 10 7 cells of lactic acid bacteria/ml me- dium.
  • the temperature for incubation is usually 20 to 50°C and preferably 30 to 45°C.
  • the incubation time is usually 3 to 48 hours and preferably 6 to 24 hours. Particularly, it is preferred to perform cultivation in the medium having pH in a range of 3.5 to 7, more prefera- bly 5 to 6, in order to perform cultivation of lactic acid bacteria efficiently. Further, it is preferred to perform pH-stat cultivation maintaining pH in a range of 4 to 7.
  • the incubation may be terminated, without restriction, when the number of lactic acid bacteria exceeds 10 cells/ml.
  • a preferred embodiment relates to a process, as described herein, wherein the fermenting of the food material is performed under conditions, which produce from 0.5 to 25 mg peptides or other active components with heart rate reducing properties per 100 ml of the food material, more preferably which produce from 1 to 5 mg peptides or other active components with heart rate reducing properties per 100 ml of the food material.
  • Mammalians include animals such as domesticated animals (e.g. cats and dogs), pigs, cows, lambs and fish. In a preferred embodiment the mammalian is a human.
  • lactic acid bacterium designates a group of Gram positive, cata- lase negative, non-motile, microaerophihc or anaerobic bacteria that ferment sugar with the production of acids including lactic acid as the predominantly produced acid, acetic acid, formic acid and propionic acid.
  • lactic acid bacteria belonging to genus Lactobacillus such as Lactobacillus helveticus, Lactobacillus delbruekii subsp. bulgaricus, etc.
  • lactic acid bacteria belonging to genus Lactococcus such as Lactococcus lactis
  • lactic acid bacteria belonging to genus Streptococcus such as Streptococcus salivarius subsp.
  • thermophilus lactic acid bacteria belonging to genus Leuconostoc, such as Leuconostoc lactis, lactic acid bacteria belonging to genus Bifidobacterium, such as Bifidobacterium longum or Bifidobacterium breve, and lactic acid bacteria belonging to genus Pediococcus.
  • the lactic acid bacteria may be used as a mixture with other microorganisms, e.g. yeasts. Numerous different lactic acid bacteria are public available to the skilled person. Reference is e.g. made to Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ); and the Internet taxonomy browser of NCBI [at filing date available on http://www.ncbi.nlm.nih.gOv/.l.
  • DSMZ Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH
  • the lactic acid bacterium is a bacterium of the phylium Firmicutes, more preferably of the class Bacilli, even more preferably of the order Lactobacillales.
  • a preferred lactic acid bacterium is a bacterium of the family Lactobacillaceae, more preferably of the genus Lactobacillus.
  • it is a Lactobacillus helveticus strain.
  • a particular preferred embodiment relates to a use as described herein where the lactic acid bacterium is Lactobacillus helveticus with the registration number DSM 14998.
  • Lactobacillus helveticus strain with deposit accession num- ber FERM BP-4835 Lactobacillus helveticus strain with deposit accession number FERM BP-6060, Lactobacillus helveticus strain with deposit accession number DSM 13137, Lactobacillus helveticus CNRZ32 strain and Lactobacillus helveticus CP790 strain.
  • LAB comprising a 200 kDa cell wall proteinase
  • a preferred lactic acid bacterium is one that comprises a specific cell wall proteinase of around 200 kDa. Such a lactic acid bacterium is particular suitable to prepare peptides or other active components with heart rate reducing properties. This preferred LAB is described in detail below.
  • the specific cell wall proteinase is herein termed prtH200.
  • the prtH200 proteinase as de- scribed in this section, correspond to the prtH 204 kDa cell wall proteinase from the Lactobacillus helveticus CNRZ32 strain described in the article of University of Wisconsin and Utah State University [Pederson et al (1999, J. of Bacteriology, 181: 4592-4597)]. In this article it is not described nor suggested to use the CNRZ32 strain to make peptides or other active components with heart rate reducing properties.
  • the lactic acid bacterium is characterized in that it comprises a gene sequence encoding a cell wall proteinase (termed prtH200), wherein the gene sequence is defined as prtH200 is a DNA sequence encoding an enzyme exhibiting cell wall proteinase activity, which DNA sequence is selected from the group comprising of: (a) The DNA sequence shown in positions 1-5550 in SEQ ID NO 1 ;
  • the presence, in a lactic acid bacterium, of a gene sequence encoding the prtH200 proteinase may preferably be verified by PCR amplification using suitable designed PCR primers.
  • suitable designed PCR primers it is easy for him to verify the presence or not of the gene sequence in a lactic acid bacterium using his general knowl- edge to make a specific suitable PCR amplification protocol.
  • the skilled person may rapidly screen a number of lactic acid bacteria, identify the ones comprising a prtH200 gene sequence, and thereby obtain specific selected lactic acid bacteria with improved industrial relevant characteristics.
  • a sample of a particular preferred Lactobacillus helveticus strain CHCC5951 has been deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) under the accession number DSM 14998 with a deposit date of 15 th May 2002. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Micro organisms for the Pmposes of Patent Procedure.
  • a particular preferred embodiment relates to a use as described in this section where the lactic acid bacterium is Lactobacillus helveticus with the registration number DSM 14998.
  • the skilled reader can by conventional mutagenesis or re-isolation techniques obtain further mutants or derivatives which retain the ability to be suitable for preparing peptides or other active components with heart rate reducing properties.
  • the prtH200, orfF3 and orfF4 gene sequences as described in this section may be seen as finge ⁇ rints highly suitable to identity useful lactic acid bacteria as described in this section. Without being limited to theory, theoretically it may be that some strains could exist that despite comprising the fmge ⁇ rint gene sequence(s) as described in this section are not exhibiting the advantageous properties as described in this section. Accordingly, once having identified, in a lactic acid bacterium, the presence of finge ⁇ rint gene sequence(s) as described in this section, it may be advantageous to test the proteolytic activity of the lactic acid bacterium. In the present context, a preferred lactic acid bacterium has preferably a proteolytic activity as described below.
  • a lactic acid bacterium is considered to have proteolytic activity when it is capable of synthesizing an active cell wall proteinase.
  • the proteinase should have a specificity making it capable of degrading proteins (e.g. casein comprised in milk) to obtain peptides or other active components with heart rate reducing properties.
  • the proteolytic activity of a bacterium is ascertained by a protocol comprising the steps: (i) Fermenting overnight 200 ml of a food material with the bacterium,
  • the ACE inhibition activity assay is herein also termed DL50.
  • the food material is preferably fresh milk.
  • the bacterium is preferably inoculated to the food material in the form of an overnight stock culture of (1% v/v) and maintained overnight at a suitable temperature.
  • a suitable temperature is a temperature that is suitable for growth of the bacterium. The skilled person knows how to identify this for a particular lactic acid bacterium. For Lactobacillus species a suitable temperature is 37°C and for Lactococcus species a suitable temperature is 30°C.
  • a suitable temperature is 37°C and for Lactococcus species a suitable temperature is 30°C.
  • the lactic acid bacterium has a proteolytic activity making it capable of, in a pro- tocol comprising the steps:
  • ACE angiotensin-converting enzyme
  • the lactic acid bacterium is capable of producing peptides or other active components with an angiotensin-converting enzyme (ACE) inhibition activity (DL50) of from 0.25 to 4.0 (mg/ml), and even more preferably the proteolytic lactic acid bacterium is capable of producing peptides or other active components with an angiotensin-converting enzyme (ACE) inhibition activity (DL50) of from 0.25 to 3.5 (mg/ml).
  • ACE angiotensin-converting enzyme
  • the lower DL50 range may be, instead of 0.25 mg/ml, 1.0 mg/ml.
  • gene is herein defined according to is usual meaning as the fundamental physical and functional unit of heredity.
  • a gene is an ordered sequence of nucleotides (e.g. DNA or RNA) located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule).
  • Y C or T
  • R A or G
  • M A or C
  • K G or T
  • S G or C
  • W A or T
  • H A or C or T
  • B G or T or C
  • V G or C or A
  • D G or A or T
  • N G, A, C or T.
  • a fragment in relation to a DNA/amino acid sequence comprising a fragment denotes a continuous partial sequence. For instance, from position 75 to 300 in an amino acid sequence having 600 amino acids.
  • the term "a corresponding fragment” in relation to identity comparison between two sequences relates to a fragment of corresponding size.
  • the size difference, between the two fragments to be compared is less than 50%. In order words, if one fragment is 100 bp the other is preferably less than 150 bp. More preferably, the size difference, between the two fragments to be compared, is less than 25%, and even more preferably the size difference, between the two fragments to be compared, is less than 5%.
  • the activity of a cell wall proteinase is preferably verified while it is present in the lactic acid bacteria.
  • a suitable strategy is to construct a lactic acid bacterium with a lethal mutation in the gene encoding the cell wall proteinase to be analysed.
  • the proteolytic activity (for a suitable assay see below) of this constructed bacterium could then be compared with the corresponding wild type bacterium.
  • a measurable decrease in proteolytic activity of the lactic acid bacterium with a lethal mutation as compared with the corresponding wild type bacterium would experimentally confirm that the gene encoding the cell wall proteinase to be analysed is a gene encoding an active lactic acid cell wall proteinase.
  • NCBI National Center for Biotechnology Information
  • gi ⁇ 129346 ⁇ sp ⁇ P15293 ⁇ P2P_LACLC Pll-type proteinase precursor (Lactocepin) (Cell wall-associated serine proteinase).
  • Organism Lactococcus lactis subsp. cremoris.
  • Identity a 1600 amino acid fragment with 50% identity of to a corresponding frag- ment of the prtH200 amino acid sequence of SEQ ID NO 2.
  • gi ⁇ 149582 ⁇ gb ⁇ AAA25248.1 ⁇ proteinase Organism: Lactobacillus par acasei. Identity: a 1632 amino acid fragment with 49% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
  • Organism Lactobacillus pentosus.
  • Organism Streptococcus thermophilus
  • gi ⁇ 482386 ⁇ pir ⁇ A44833 lactocepin (EC 3.4.21.96).
  • Organism Lactococcus lactis.
  • Identity a 264 amino acid fragment with 61% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
  • sequences are all representing a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 30% identical to a corresponding fragment of the polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2.
  • Organism Streptococcus lactis Identity: a 81 bp fragment with 86% identity of to a corresponding fragment of the prtH200 DNA sequence of SEQ ID NO 1.
  • Organism S. cremoris Identity: a 81 bp fragment with 86% identity of to a corresponding fragment of the prtffiOO DNA sequence of SEQ ID NO 1.
  • Organism Lactococcus lactis.
  • sequences are all representing a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 50% identical to a corresponding fragment of the DNA sequence shown in positions 1-5550 of SEQ ID NO 1.
  • the LAB also comprises a gene comprising an open reading frame herein termed orfF3. This gene may be seen as an additional fmge ⁇ rint.
  • a lactic acid bacterium comprises the prtH200 gene and a gene sequence (termed orfF3) encoding an open reading frame wherein the gene sequences is identifiable by PCR amplification of genomic DNA of the lactic acid bacterium using sets of PCR primers selected from the group consisting of [sense sequence (S); antisense sequence (A)]: orfF3: (a): (S): 5' CGAAGGCGATAAGTCAAACTTTGATAATGC 3',
  • a lactic acid bacterium as described in this section, comprises the prtH200 gene and a gene sequence encoding an open reading frame (termed orfF3), wherein the gene sequence is defined as orfF3 is a DNA sequence encoding an open reading frame, which DNA se- quence is selected from the group comprising of:
  • open reading frame denotes a stretch of DNA that contains a signal for the start of translation followed in the correct register by a sufficient length of amino acid encoding triplets to form a protein, followed by a signal for termination of translation, and which may therefore indicate the presence of a protein coding gene.
  • an orfF3 gene as described in this section encodes a cell wall proteinase. Consequently, in a preferred embodiment the orfF3 gene as described in this section encodes a cell wall proteinase. orfF4:
  • the LAB also comprises a gene comprising an open reading frame herein termed orfF4.
  • a lactic acid bacterium comprises the prtH200 gene and a gene sequence (termed orfF4) encoding an open reading frame wherein the gene sequences is identifiable by PCR amplification of genomic DNA of the lactic acid bacterium using sets of PCR primers selected from the group consisting of [sense sequence (S); antisense sequence (A)]: orfF4: (a): (S): 5 ' GGTGTTGCTCCTGAAGC 3 '
  • a lactic acid bacterium as described in this section, comprises the prtH200 gene and a gene sequence encoding an open reading frame (termed orfF4), wherein the gene sequence is defined as orfF4 is a DNA sequence encoding an open reading frame, which DNA sequence is selected from the group comprising of: (a) The DNA sequence shown in positions 1-4881 in SEQ ID NO 5;
  • an orfF4 gene as described in this section encodes a cell wall proteinase. Consequently, in a preferred embodiment the orfF4 gene as described in this section encodes a cell wall proteinase.
  • a lactic acid bacterium as described in this section, comprises the prtH200 gene, the orfF3 gene and the orf4 gene as described in this section.
  • the presence of the gene sequences may preferably be verified by PCR amplification using PCR primers designed according to the teaching herein.
  • PCR primers designed according to the teaching herein When the skilled person has suitable designed PCR primers it is easy for him to ver- ify the presence or not of these genes in a lactic acid bacterium using his general knowledge to make a specific suitable PCR amplification protocol.
  • PCR amplification protocol (reaction) is made according to the description of Example 2 herein.
  • a positive PCR fragment relates to a PCR fragment of a gene as described in this section.
  • the PCR fragment may be DNA sequenced and the re- suiting DNA sequence may then be compared with the sequences disclosed herein. Further, a lactic acid bacterium with a lethal mutation in the gene corresponding to the PCR fragment could be constructed.
  • proteolytic activity (see below) of this constructed bacterium could then be compared with the corresponding wildtype bacterium and a measurable change in proteolytic activity between the two cells would experimentally confirm whether or not the gene corresponding to the amplified PCR fragment is a gene encoding a lactic acid cell wall proteinase as described in this section.
  • a specific lactic acid bacterium comprises gene(s) capable of giving corresponding positive PCR fragments using PCR primers designed according to the teaching herein.
  • PCR is the preferred way to investigate the presence or not in the lactic acid bacteria of the genes as described in this section. However, it may be done in other ways such as e.g. by Southern blot analysis. PCR primers
  • PrtH200 (a): (S): 5' CGATGATAATCCTAGCGAGC3', (A): 5' TGGCAGAACCTGTGCCTA 3'; (b): (S): 5' GCCAAGACGCCTCTGGTA 3', (A): 5 ' TAGGTATAGTTTCCATCAGGA 3 ' ; and
  • PrtH200 (a) (S) is shown in SEQ ID NO 7; PrtH200: (a): (A) is shown in SEQ ID NO 8; PrtH200 (b) (S) is shown in SEQ ID NO 9; PrtH200: (b): (A) is shown in SEQ ID NO 10;
  • PrtH200 (c) (S) is shown in SEQ ID NO 11 ; PrtH200: (c): (A) is shown in SEQ ID NO 12.
  • the amplified PrtH200 PCR fragment should preferably be of a size between 400 bp and 800 bp, more preferably of a size between 500 bp and 700 bp.
  • the amplified PrtH200 PCR fragment should preferably be of a size between 200 bp and 500 bp, more preferably of a size between 250 bp and 375 bp.
  • the amplified PrtH200 PCR fragment should preferably be of a size between 400 bp and 800 bp, more preferably of a size between 500 bp and 700 bp.
  • PrtH200 related PCR primers are primer set (a) and primer set (b).
  • orfF3 (a): (S): 5' CGAAGGCGATAAGTCAAACTTTGATAATGC 3', (A): 5' CCCGGTTCTGTAAGATAATTTGGATCG 3'; and (b): (S): 5' ASTCWRRYTTYGATRATGCW 3', (A): 5' BHKYAMSAWARTTTGGATCR 3'.
  • the amplified orfF3 PCR fragment should preferably be of a size between 1250 bp and 1900 bp, more preferably of a size between 1500 bp and 1725 bp .
  • the amplified orfF3 PCR fragment should preferably be of a size between 1250 bp and 1900 bp, more preferably of a size between 1500 bp and 1725 bp.
  • the most preferred orfF3 related PCR primers are the primer set (a).
  • orfF4 (a): (S): 5' GGTGTTGCTCCTGAAGC 3'
  • orfF4 (a): (S) is shown in SEQ ID NO 17; orfF4: (a): (A) is shown in SEQ ID NO 18.
  • the amplified orfF4 PCR fragment should preferably be of a size between 700 bp and 1150 bp, more preferably of a size between 875 bp and 1025 bp.
  • the DNA sequence homology/identity referred to above is determined as the degree of identity between two sequences indicating a deviation of the first sequence from the second.
  • NCBI National Center for Biotechnology Information
  • a preferred computer homology search program is a "Standard nu- cleotide-nucleotide BLAST [blastn]" search as specified, at the filing date of the present ap- plication, at the NCBI Internet site with setting filter: Low complexity; Expect: 10, Word Size: 11.
  • the reference sequence is introduced into the program and the program identifies fragments of published sequences together the identity percentage to a corresponding fragment of the reference sequence.
  • a prtH200 sequence as described in this section is preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 60% identical to a corresponding fragment of the prtH200 DNA sequence shown in position 1-5550 of SEQ ID NO 1, more preferably a DNA se- quence comprising a fragment of at least 75 base pairs (bp) that is at least 70%) identical to a corresponding fragment of the prtH200 DNA sequence shown in position 1-5550 of SEQ ID NO 1, and even more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 80% identical to a corresponding fragment of the prtH200 DNA sequence shown in position 1-5550 of SEQ ID NO 1.
  • the fragment is at least 100 bp pairs (bp), more preferably that the fragment is at least 200 bp pairs (bp), even more pref- erably that the fragment is at least 400 bp pairs (bp), and most preferably that the fragment is at least 1500 bp pairs (bp).
  • a orfF3 sequence as described in this section is preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 60% identical to a corresponding fragment of the orfF3 DNA sequence shown in position 1-2679 of SEQ ID NO 3, more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 70% identical to a corresponding fragment of the orfF3 DNA sequence shown in position 1-2679 of SEQ ID NO 3, and even more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 80% identical to a cooesponding fragment of the orfF3 DNA sequence shown in position 1-2679 of SEQ ID NO 3.
  • the fragment is at least 100 bp pairs (bp), more preferably that the fragment is at least 200 bp pairs (bp), even more preferably that the fragment is at least 400 bp pairs (bp), and most preferably that the fragment is at least 1500 bp pairs (bp).
  • a orfF4 sequence as described in this section is preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 60% identical to a corresponding fragment of the orfF4 DNA sequence shown in position 1-4881 of SEQ ID NO 5, more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 70% identical to a corresponding fragment of the orfF4 DNA sequence shown in position 1-4881 of SEQ ID NO 5, and even more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 80% identical to a corresponding fragment of the orfF4 DNA sequence shown in position 1-4881 of SEQ ID NO 5.
  • the fragment is at least 100 bp pairs (bp), more preferably that the fragment is at least 200 bp pairs (bp), even more preferably that the fragment is at least 400 bp pairs (bp), and most preferably that the fragment is at least 1500 bp pairs (bp).
  • the homology/identity may suitably be determined by means of computer programs known in the art, such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 5371 l)(Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453).
  • a preferred computer homology search program is a "Standard protein-protein BLAST [blastp]" search as speci- fied, at the filing date of the present application, at the NCBI Internet site with settings
  • a prtH200 sequence as de- scribed in this section is preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 40% identical to a cooesponding fragment of the prtH200 polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2, more preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 50% identical to a cooesponding fragment of the prtH200 polypeptide sequence shown in positions 1-1849 of SEQ LD NO 2, even more preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 65% identical to a corresponding fragment of the prtH200 polypeptide sequence shown in positions
  • the fragment is at least 300 amino acids (aa), more preferably that the fragment is at least 400 amino acids (aa), even more preferably that the fragment is at least 800 amino acids (aa), and most preferably that the fragment is at least 1200 amino acids (aa).
  • a orfF3 sequence as de- scribed in this section is preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 40% identical to a cooesponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4, more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 50% identical to a cooesponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4, even more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 65% identical to a cooesponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4, and most preferably a DNA sequence that encodes a polypeptide comprising a fragment
  • the fragment is at least 300 amino acids (aa), more preferably that the fragment is at least 400 amino acids (aa), even more preferably that the fragment is at least 800 amino acids (aa), and most preferably that the fragment is at least 1200 amino acids (aa).
  • a orfF4 sequence as described in this section is preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 40% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ ID NO 6, more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 50% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ LD NO 6, even more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 65% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ ID NO 6, and most preferably a DNA sequence that encodes a polypeptide comprising a fragment of at
  • the fragment is at least 300 amino acids (aa), more preferably that the fragment is at least 400 amino acids (aa), even more preferably that the fragment is at least 800 amino acids (aa), and most preferably that the fragment is at least 1200 amino acids (aa).
  • the homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453.
  • GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453.
  • the hybridisation refeoed to above is intended to comprise an analogous DNA sequence, which hybridises to a double-stranded DNA probe.
  • Suitable experimental conditions for de- termining hybridisation at low, medium, or high stringency between a nucleotide probe and a homologous DNA or RNA sequence involve pre-soaking of the filter containing the DNA fragments or RNA to hybridise in 5 x SSC (Sodium chloride/Sodium citrate, Sambrook et al. 1989) for 10 min, and prehybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution (Sambrook et al.
  • Molecules to which the ohgonucleotide probe hybridises under these conditions are detected using an X-ray film.
  • FIG. 1 Heart rate measurements in animals treated with concentration 3 (whey compositions containing solid whey components concentrated factor of 14.3 times) or placebo. Each data point is representing the average value from 8 animals. Note that the activity period of the animals is coincident with the period without light, i.e. the period indicated by the black bar.
  • FIG. 2 The reduction in heart rate in animals in the period 12-15 hours after the animals received whey compositions containing solid whey components concentrated 2, 6, 14.3 and 21 times relatively to the amount of solid components in whey obtained after fermentation of milk.
  • the animals was given the whey products by gavage, i.e. feeding by a stomach tube.
  • (O) indicates placebo.
  • the heart rate was determined in animals as described in Example 1 and compared to the heat rate in untreated animals.
  • Example 1 In vivo test of heart rate reducing properties
  • the milk (9.5%> of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1 % (v/v).
  • the fermented product was centrifuged, the pellet was discarded and the whey was filtered through a 0,45 mm filter and freeze-dried.
  • a second fermentation, fermented under the same conditions as the first one, was centrifuged and the whey fraction obtained.
  • the pellet was discarded and the whey was filtered through a 0,45 mm filter and frozen.
  • the whey was used to solubilize the freeze-dried whey powder to concentrate it with a factor 21 before feeding the rats.
  • the milk (9.5% of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1% (v/v). The total product was freeze-dried. A second fermentation, with the same conditions as the first one, was centrifuged. The pellet was discarded and the whey was filtered through a 0,45 mm filter and frozen. The whey was used to solubilize the freeze-dried fermented milk powder to concentrate it with a factor 5 before feeding the rats.
  • Freeze-dried fermented milk dissolved in milk Sample 3
  • the milk (9.5% of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1%> (v/v).
  • the total product was freeze-dried.
  • Milk (9.5% of protein content) was used to solubilize the freeze-dried powder to concentrate it with a factor 5 before feeding the rats.
  • the milk (9.5% of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1% (v/v).
  • Spontaneously Hypertensive Rats was obtained from LFFA CREDO (a Charles River company), Lyon, France.
  • Each treatment was administered between 9:15 h and 9:30 h by gavage and each animal received a total volume of 2.5 ml per animal.
  • Sample 1 Freeze-dried whey suspended in whey. Administered concentrated by factor 21
  • Sample 2 freeze-dried fermented milk suspended in whey, administered concentrated by factor 5
  • Heart rate (beats/min) after gavage.
  • Untreated ' and untreated 2 are the controls of study 1 and study number 2, respectively. Untreated 1 was the placebo for the sample 1 and untreated 2 was the placebo for all the other samples. We had two placebos be- cause the studies were done independently in two different in vivo studies.
  • the whey part of the product that contains the peptides or other active components is determinant in the heart rate reducer effect.
  • Sample 3 is freeze-dried fermented milk suspended in neutral pH milk. It reduces the heart rate significantly. This demonstrates the wide application of a fermented product as described herein since it may be dissolved in different liquids to get a required final appropriate use. Characteristic such as different pH are not affecting the heart rate reducer activity of the product.
  • Sample 5 with heat treatment after fermentation reduces also the heart rate. Substantially all bacteria are killed in this sample. Accordingly, this demonstrates that there is no need to have live bacteria in the final product.
  • Sample 6 has not been fermented but it includes the live bacteria. It does not reduce the heart rate. It demonstrates that the fermentation step is required.
  • Template DNA was obtained by phenol-chloroform extraction as previously described (Marmur (1961, Journal of Molecular Biology, 3, 208-218). The final preparation was genomic template DNA in a TE buffer + RNAse.
  • the PCR reaction was prepared as follows: (i) 1.0 ⁇ l of template DNA
  • Lactobacillus species were streaked on MRS agar and incubated anaerobically for 48 h at 37°C. A single colony was picked, inoculated into MRS broth and grown overnight at 37°C. Lactococcus species were streaked on M17 agar and incubated aerobically for 48 h at 30°C A single colony was picked, inoculated into Ml 7 broth and grown overnight at 30°C Stock cultures were prepared from these overnight cultures and were stored at -80°C in 20% glycerol.
  • Fermentation is performed by inoculate 200 ml of fresh milk with an overnight stock culture of example 1 (1% v/v) and maintain overnight at 37°C or 30°C dependent on the strain used.
  • the peptide pools of milk fermented are tested for ACE activity in vitro.
  • the DL50 (mg/ml) is the peptidic concentration, which inhibits 50% of ACE activity. The lower this value is, the better the anti-hypertensive effect of the fermented milk.
  • the ACE activity of the extracted peptides or other active components is measured by the following protocol:
  • ACE degrades a hippuryl-L-histidyl-L-leucine (HHL) substrate and adding a color agent develops a color. If peptides or other active components are present the peptides or other active components inhibit ACE and less HHL substrate is degraded. This means less color is developed after addition of the color agent.
  • HHL hippuryl-L-histidyl-L-leucine
  • Incubation buffer 188 mmol/1 boric acid pH 8.3, 1.375 mmol/1 potassium chloride. (Dissolve 2.91 g of boric acid and 25.63 g potassium chloride in 200 ml of distilled water. Ad- just the pH to 8.3 with 1 mol/1 potassium hydroxide and dilute to 250 ml with distilled water. Store at room temperature).
  • Substrate solution 5.8 mmol/1 hippuryl-L-histidyl-L-leucine (HHL). (Dissolve 250 mg hippuryl-L-histidyl-L-leucine in about 90 ml incubation buffer and fill up to 100 ml with the same buffer. Store at 40°C The substrate solution can be used for at least 2 weeks).
  • Stop solution 100 mmol/1 HEPES pH 9, 2.5 mmol EDTA.
  • the negative control comprises 12 ⁇ l of incubation buffer and 40 ⁇ l of substrate (HHL)
  • the ACE inhibition percentage is expressed by the formula :
  • OD405nm positive control- OD405nm sample ACE inhibition activity OD405nm positive control- OD405nm negative control
  • Each dilution has its own ACE inhibition percentage value that gives a curve expressing the ACE inhibition percentage in function of the peptide concentration of the whey.
  • DL50 peptidic concentration that inhibits 50 % of ACE activity
  • DL50 is obtained by reading the peptidic concentration at the intersection point between the curve and the cooesponding 50 % ACE inhibition point on the axe.
  • Example 1 To further substantiate the results presented in Example 1, a dose response experiment was performed by administering compositions containing variable amounts of freeze-dried whey obtained from fermented milk suspended in whey from fermented milk to Spontaneously Hypertensive Rats (SHR).
  • SHR Spontaneously Hypertensive Rats
  • milk was fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998) for 16 hours with an inoculation level of 1% (v/v).
  • the fermented milk was centrifuged, the pellet discarded and the whey freeze-dried.
  • a second fermentation with the same conditions as the first one was centrifuged.
  • the pellet was discarded and the whey was placed at 4°C.
  • the whey was used to solubilize the freeze-dried whey powder resulting in compositions containing solid whey components concentrated 2, 6 and 14.3 times relatively to the amount of solid components in whey obtained in the second fermentation.
  • the final step of the s lu- bilization was done shortly before feeding the composition to the rats.
  • each testing-period was separated by a "wash out" period of three days in which animals did not received fermented whey product in order to eliminate the activity of the previous dose.
  • the heart rate fluctuations is stabilized by the whey product fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998). This may be an important feature of the product since it has been observed that changes in heart rate cooelated well with mortality in an experimental rabbit model (Zaza et al 2001) and since in particular in stressed situations significant heart rate fluctuations are frequently observed.
  • Example 6 Comparison of milk products fermented with L. helveticus strain CHCC5951 with a similar commercial product fermented with a different strain.
  • the pu ⁇ ose of this example was to compare a commercial lactic acid bacterium fermented milk product that is claimed to have blood pressure reducing properties with the product fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998).
  • the effect on blood pressure and heart rat of the two products was evaluated by administering the two compositions to Wistar rats and measuring the systolic blood pressure, the dia- stolic blood pressure and the heart rate on anaesthetized animals.
  • milk was fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998) for 16 hours with an inoculation level of 1% (v/v), and the resulting product was freeze- dried to obtain a freeze dried milk powder.
  • a second fermentation with the same conditions as the first one, was performed and centrifuged. The pellet was discarded and the whey was filtered through a 0.45 ⁇ m filter and frozen. Shortly before feeding it to the rats the freeze- dried milk powder was dissolved in the whey.
  • This composition we refer to as a x5 concentration in this example.
  • the composition was administered to overnight fastened normotensive Wistar rats (300-320 grams) between 09:15 h and 09:30 h by gavage at a dose of 7.5 ml per kg of the x5 composition.
  • the effect of the composition was evaluated between 14:30 h and 16:30 h, i.e. 5-7 hours after the oral administration by measuring the values of arterial blood pressure and heart rate on anaesthetized animals. The results obtained are shown in table 3.
  • * indicates a significant difference at the p ⁇ 0.05 level between treated vs. untreated rats.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Zoology (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Wood Science & Technology (AREA)
  • Polymers & Plastics (AREA)
  • Biotechnology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Microbiology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Genetics & Genomics (AREA)
  • Cardiology (AREA)
  • Food Science & Technology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Epidemiology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Mycology (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Nutrition Science (AREA)
  • Virology (AREA)
  • Urology & Nephrology (AREA)
  • Diabetes (AREA)
  • Developmental Biology & Embryology (AREA)
  • Vascular Medicine (AREA)
  • Hematology (AREA)
  • Alternative & Traditional Medicine (AREA)

Abstract

Use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable proteins, with a lactic acid bacterium to obtain a fermented food material which comprises active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate and/or the fluctuations in the heart rate of a mammalian.

Description

Title: Composition with heart rate reducing properties
Field of invention:
The present invention relates to the use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable proteins, with a lactic acid bacterium to obtain a fermented food material which comprises peptides or other active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate in a mammalian.
Technical background and prior art:
Several studies clearly support the notion that a lower resting heart rate is linked to improved survival. In the general population, several studies have shown a strong positive cor- relation between higher resting heart rate and increased mortality. A two- to three-fold increase in mortality is observed for males with a resting heart rate higher than 88 beats pr. minutes (bpm) compared to a group of males with less than 65 bpm. The heart rate is not only related to cardiovascular mortality but seem also to relate to death from other causes such as cancer. It has even been hypothesized that there is a relation between low heart rate and life expectancy in general (Zaza et al., 2001).
The most common form of cardiovascular disease in the industrialized countries today is coronary artery disease (CAD) or coronary heart disease (CHD) which is the leading cause to heart attacks. CAD and CHD is a "hardening" of the arteries on the surface of the heart, where the term "hardening" refers to a condition that causes the arteries to become so narrowed and stiff that the block the free flow of blood.
Lower heart rate is related with better outcome and in particular with a reduced risk of arrhythmias. Higher heart rate may reflect a higher metabolic rate and lower vagal tone thus increasing ischemic risk. Furthermore higher heart rates may also deteriorate ventricular function (Lombardi, F in Zaza et al., 2001). Thus it is not surprising that it has been reported that an important risk factor associated with CAD or CHD is a high heart rate. CAD or CHD is frequently treated with medications. These medications fall into different categories such as:
1. Beta blockers that reduce the workload of the heart by blocking certain chemicals from binding to beta-receptors in the heart.
2. Nitrates that work directly on the blood vessels, causing them to relax and allowing more oxygen-rich blood to reach the heart.
3. Calcium channel blockers that increase blood flow through the heart and may reduce the workload of the heart by blocking calcium ions from signalling the blood vessels to constrict or tighten.
4. Anti platelets (e.g. aspirin) that inhibit the formation of blood clots by decreasing the abil- ity of platelets (microscopic particles found in the blood) to bind together and form a blood clot.
The prevention of a high heart rate in the early stage of the development of the disease can be an alternative to treatment of high heart rate with drugs. A large number of food derived bioactive compounds are currently considered as beneficial for general well being or as health promoting.
It is known that milk fermented by lactic acid bacteria (LAB) may produce anti-hypertensive effects due to the liberation of peptides from casein in the milk by the proteolytic activity of the lactic acid bacteria. This is for instance described in EP821968 (Calpis Food Industry), EP1016709 (Calpis Food Industry) and WO0132836 (Valio Ltd.).
The article of Yamamoto et al. (1996) discloses that milk fermented with a starter containing Lactobacillus helveticus and Saccharomyces cerevisiae reduces the systolic and diastolic blood pressure, yet no changes were observed in other indexes, including pulse rate. WO0185984 (Davisco International Foods, Inc.) also relates to peptides having anti- hypertensive effect (blood reducing effect), where the peptides from an enzymatic digest of whey protein. Changes in heart rate and blood pressure were measured. A significant reduction in mean arterial blood pressure was observed, and except for the observation of the 75 mg/kg dose, which elicited a decrease in heart rate, no significant difference between the heart rate responses occurred at the doses of 30 and 150 mg/kg.
The article of Fuglsang, A., et al. (2002) describes, as the article of Yamamoto et al. (1996), that fermented milk peptides have anti-hypertention properties. On page 3569, 1. column, 2. paragraph, it is stated in relation to tested samples that the heart rate was insignificant versus that of unfermented milk (placebo).
The above mentioned article of Yamamoto et al. (1996) and article Fuglsang (2002) and the WOO 185984 document indicates that although a lactic acid bacterium fermented product has blood pressure reducing properties there are no reason to believe that it should have heart rate reducing properties as well.
Summary of the invention:
The problem to be solved by the present invention is to provide an alternative composition useful for reducing heart rate.
The solution is based on that the present inventors have identified that by fermenting a food material, preferably milk, with a lactic acid bacterium (LAB), active components with in- creased heart rate reducing properties are obtained. For further details, see table 1 of working example 1.
Accordingly, a first aspect of the invention relates to the use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable pro- teins, with a lactic acid bacterium to obtain a fermented food material which comprises peptides or other active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate in a mammalian. In a second aspect, the invention provides a fermented food material having heart rate reducing properties in a mammalian and comprising active components produced by the fermentation of the food material with at least one lactic acid bacterium strain. In particular a food material fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998) is a preferred embodiment.
Food comprising living as well as dead bacterial is frequently claimed to be particular healthy to ingest, thus in a third aspect the invention provides a fermented food material having heart rate reducing properties in a mammalian and comprising dead or alive Lacto- bacillus helveticus strain DSM 14998 or a mutant thereof.
As can be seen from the dose-response experiment (Example 4) it appears possible to obtain even larger response if compositions were made with higher concentrations of the heart rate reducing compound(s). Thus in a fourth aspect the heart rate reducing component(s) isolated from the fermented food material is(are) provided.
In a further aspect, the invention describes the use of the fermented food material or heart rate reducing active components isolated there from for the manufacture a medicament for the treatment or relief of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, arrhythmia, tachyarrythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyslipidemia, dyslipo- proteinemia.
Definitions:
Prior to a discussion of the detailed embodiments of the invention is provided a definition of specific terms related to the main aspect of the invention.
The term "for reducing the heart rate in a mammalian" denotes reduction of heart rate in relation to the heart rate before administration of the composition as described herein. Before testing on humans, peferably the heart rate reducing properties should be determined in an animal model. In one useful animal model the fermented product is administered to spontaneous hypertensive rats (SHR) by gavage and determine the heart rate for 24 hours after ga- vage by telemetry in conscious SHR at different time points. Placebo should preferably be the corresponding unfermented food material such as e.g. unfermented milk. For further de- tails see working example 1 herein. But also a model based on normotensive Wistar rats as described in Example 6 can be used to assess the reduction of heart rate.
The term "lactic acid bacterium" designates a group of Gram positive, catalase negative, non-motile, microaerophilic or anaerobic bacteria that ferment sugar with the production of acids including lactic acid as the predominantly produced acid, acetic acid, formic acid and propionic acid.
Embodiment(s) of the present invention is described below, by way of example(s) only.
Detailed disclosure of the invention:
Food material
The food material should comprise animal milk proteins or vegetable proteins.
Preferably it comprises animal milk proteins preferably enumerated by, for example milk protein components, such as whole or defatted animal milk or milk casein.
Food material with vegetable proteins may preferably be enumerated by, for example corn, corn protein, wheat, wheat protein, soybean, defatted soybean or soybean protein.
Product comprising peptides or other active components with heart rate reducing properties
The use of lactic acid bacteria as described herein provides directly after fermentation a use- ful amount of peptides or other active components with very good heart rate reducing properties. Consequently, it is not considered necessary to further purify or up-concentrate the peptides or other active components from the fermented food material. The fermented food material may be packed directly and provided to the market as a food product, preferably a functional food product, or a food product additive, e.g. in a freeze-dried form. In Example 1 this is demonstrated. In short, the results of Example 1 show that fermented milk in itself without any further treatment has good heart rate reducing effect. Further freeze-dried fermented milk could be suspended in neutral milk and thereby give a suitable food product. The freeze-dried fermented milk could therefore be seen as a suitable food additive product.
The term "functional food" denotes herein a food product where the consumer in some way is informed that it has a useful function in relation to heart rate reducing properties. When the term food is used it may also be feed. However, a food product is preferred.
Accordingly, an embodiment of the invention relates to a use as described herein where the composition is a food product comprising peptides or other active components with heart rate reducing properties obtainable by a process comprising following steps:
(i) preparing a fermented food material according to a process for preparing active components with heart rate reducing properties as described herein, (ii) drying the fermented food material, and (iii) packing it in a suitable way to get a food product or food product additive.
Step (ii) is preferably freeze-drying.
The term "packing" should be understood broadly. It denotes that once a food material is fermented and a fermented food material is obtained, the fermented food material should be packed in order to could be provided to the consumer. It may be packed in a bottle, a terra- pack, etc. Preferably, on the package or in corresponding marketing material is indicated that the product has heart rate reducing properties. This applies for any aspects or embodiments of a product as described herein.
As shown in example 1 the lactic acid bacteria in the food product may be dead or alive, since a heat-treated fermented food material also had heart rate reducing properties. Use of product with heart rate reducing properties
As stated above, the term "for reducing the heart rate in a mammalian" denotes reduction of heart rate in relation to the heart rate before administration of the composition as described herein. Preferably the heart rate reducing properties should be determined by administrating the product to spontaneous hypertensive rats (SHR) by gavage and determine the heart rate for 24 hours after gavage by telemetry in conscious SHR at different time points and preferentially continuously. However also other animal models are useful for evaluating the heart rate efficacy of the fermented product. One example is the model of normotensive Wistar rats described in example 6. Placebo should preferably be the corresponding unfermented food material such as e.g. unfermented milk. For further details see working example 1 herein.
The product may be used in a treatment of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, arrhythmia, tach- yarrythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyslipidemia, dyslipoproteinemia. In such case the product is preferably a medicament. Preferred diseases are angina pectoris, hypertension, and atherosclerosis.
In addition to the conditions just mention the issue of fluctuations of the heart rate attracts interest. In Example 1, 4 and 5 it is demonstrated the fermented product effectively decreases heart rate but surprisingly also decreases fluctuations in the heart rate during the activity period of the experimental animals. In particular in stressed situations where signifi- cant heart rate fluctuations are frequently observed the damping of the fluctuations in the heart rate may be an important feature since changes in heart rate correlates with mortality in an experimental model (Zaza et al 2001).
Because coronary artery diseases tend to develop over a long period of time, there are opportunities throughout one's lifetime to prevent or control it. Preventive care can begin early, thus reducing the speed at which atherosclerosis develops. Therefore, another preferred use of the product is in a preventive manner. In such case the product may preferably be a food product or food additive, which people can consume in a daily or continuous manner.
Preferably the product has a heart rate reducing effect that is 10 % over placebo where pla- cebo is defined above as the corresponding unfermented food material. Using this definition, more preferably the product has a heart rate reducing effect that is 15 % over placebo, even more preferably the product has a heart rate reducing effect that is 20 % over placebo and most preferably the product has a heart rate reducing effect that is 25 % over placebo.
Subsequent purification of the heart rate reducing peptides or other active components from the fermented food material
As stated above, the use of the lactic acid bacteria, as described herein, provides directly after the fermentation a useful amount of peptides or other active components with very good heart rate reducing properties.
However, in some circumstances it may be preferred to perform a subsequent purification of the heart rate reducing peptides or other active components from the fermented food material. This may for instance be when the peptides or other active components are to be used in a medicament such as a pharmaceutical tablet, which requires a very high concentration of the heart rate reducing peptides or other active components. Accordingly, in an embodiment of the invention the product is a medicament.
Furthermore, example 1 shows that the heart rate reducing effect is proportional to the con- centration factor of the product.
Accordingly, an embodiment of the invention relates to a use as described herein where the fermented food material is further processed in a way that purify or up-concentrate the peptides or other active components with heart rate reducing properties obtainable by a process comprising following steps: (ii) Preparing a fermented food material according to a process for preparing peptides or other active components with heart rate reducing properties as described herein,
(ii) The fermented food material of step (i) is further processed in a way that pu- rifies or up-concentrate the active components with heart rate reducing properties,
(iii) Packing it in a suitable way to get a product.
This corresponds to a situation where one wants a relatively high concentration of the pep- tides or other active components with heart rate reducing properties in the product.
If the product is a food product the process may comprise a further step (iv) where the up- concentrated peptides or other active components of (ii) is added to the food product.
A preferred embodiment for up-concentration according to step (ii) above is where the fermented food material containing peptides or other active components with heart rate reducing properties are centrifuged, and the resulting supernatant comprising the peptides or other active components are recovered. If the food material is milk then such a product is whey. As can be seen in example 1, whey is a product with excellent heart rate reducing properties. Accordingly in a preferred embodiment the product is whey.
The centrifugation may preferably be performed, for example, at 2,000 to 20,000 rpm for 1 to 20 minutes. The centrifugation may also be performed in a centrifugator.
The resulting supernatant may be subjected to further purifying treatment with a reverse- phase resin, for obtaining a sample in which the content of the peptides or other active components with heart rate reducing properties is increased. The purifying treatment with a reverse-phase resin may be performed by absoφtion and elution of the peptides or other active components with a reverse-phase resin, and/or by reverse-phase chromatography, thereby increasing purity of the peptides or other active components. For further technical details in relation to this reverse-phase resin protocol reference is made to EP821968.
Alternatively, the fermented food material is further processed in a way wherein a nanofil- tration is performed on the fermented food material. This may be done in order to remove lactic acid or monovalent ions from the fermented food material.
For further technical details in relation to this nanofiltration protocol reference is made to WO01/32905.
As described in Example 4, there is a clear dosage dependent effect on the heart rate of the whey products concentrated up to a factor of 21 times. There is no indication in the experiment suggesting that a stationary or asymptotic level was reached, indicating that compositions comprising high amounts of the active compound(s) can have important uses as me- dicaments.
Fermentation
In the process of the present invention, the food material is fermented by lactic acid bacteria under operating conditions, which may be varied depending on the types of the food material and/or the combination of the lactic acid bacteria. Preferably, if the food material is not already an aqueous solution, food material is dissolved in a suitable aqueous solution, which is then admixed with lactic acid bacteria and cultivated by way of fermentation.
The culturing of the lactic acid bacteria may be performed by adding pre-cultured lactic acid bacteria starter to the food material medium, which may have been previously heat-sterilized and cooled to the predetermined temperature for incubation. The inoculation amount of the lactic acid bacteria starter may preferably be 105 to 107 cells of lactic acid bacteria/ml me- dium. The temperature for incubation is usually 20 to 50°C and preferably 30 to 45°C. The incubation time is usually 3 to 48 hours and preferably 6 to 24 hours. Particularly, it is preferred to perform cultivation in the medium having pH in a range of 3.5 to 7, more prefera- bly 5 to 6, in order to perform cultivation of lactic acid bacteria efficiently. Further, it is preferred to perform pH-stat cultivation maintaining pH in a range of 4 to 7. The incubation may be terminated, without restriction, when the number of lactic acid bacteria exceeds 10 cells/ml.
A preferred embodiment relates to a process, as described herein, wherein the fermenting of the food material is performed under conditions, which produce from 0.5 to 25 mg peptides or other active components with heart rate reducing properties per 100 ml of the food material, more preferably which produce from 1 to 5 mg peptides or other active components with heart rate reducing properties per 100 ml of the food material.
Mammalian
Mammalians include animals such as domesticated animals (e.g. cats and dogs), pigs, cows, lambs and fish. In a preferred embodiment the mammalian is a human.
Lactic acid bacterium
As said above, the term "lactic acid bacterium" designates a group of Gram positive, cata- lase negative, non-motile, microaerophihc or anaerobic bacteria that ferment sugar with the production of acids including lactic acid as the predominantly produced acid, acetic acid, formic acid and propionic acid.
Among others, it includes species of lactic acid bacteria belonging to genus Lactobacillus, such as Lactobacillus helveticus, Lactobacillus delbruekii subsp. bulgaricus, etc., lactic acid bacteria belonging to genus Lactococcus, such as Lactococcus lactis, lactic acid bacteria belonging to genus Streptococcus, such as Streptococcus salivarius subsp. thermophilus, lactic acid bacteria belonging to genus Leuconostoc, such as Leuconostoc lactis, lactic acid bacteria belonging to genus Bifidobacterium, such as Bifidobacterium longum or Bifidobacterium breve, and lactic acid bacteria belonging to genus Pediococcus.
The lactic acid bacteria may be used as a mixture with other microorganisms, e.g. yeasts. Numerous different lactic acid bacteria are public available to the skilled person. Reference is e.g. made to Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH (DSMZ); and the Internet taxonomy browser of NCBI [at filing date available on http://www.ncbi.nlm.nih.gOv/.l.
Preferably, the lactic acid bacterium is a bacterium of the phylium Firmicutes, more preferably of the class Bacilli, even more preferably of the order Lactobacillales. Within this order a preferred lactic acid bacterium is a bacterium of the family Lactobacillaceae, more preferably of the genus Lactobacillus. Preferably it is a Lactobacillus helveticus strain. For fur- ther details in relation to taxomony reference is made to (Bergey's Manual of Systematic Bacteriology, Second Edition, Volume 1 : The Archea and the Deeply Branching and Photo- trophic Bacteria).
A sample of a particular preferred Lactobacillus helveticus strain CHCC5951 has been de- posited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) under the accession number DSM 14998 with a deposit date of 15th May 2002. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Puφoses of Patent Procedure.
Accordingly, a particular preferred embodiment relates to a use as described herein where the lactic acid bacterium is Lactobacillus helveticus with the registration number DSM 14998.
Further, a sample of a Lactobacillus helveticus strain CHCC4080 has been deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) under the ac- cession number DSM 14997 with a deposit date of 15th May 2002. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Micro organisms for the Puφoses of Patent Procedure.
Further preferred organisms are Lactobacillus helveticus strain with deposit accession num- ber FERM BP-4835, Lactobacillus helveticus strain with deposit accession number FERM BP-6060, Lactobacillus helveticus strain with deposit accession number DSM 13137, Lactobacillus helveticus CNRZ32 strain and Lactobacillus helveticus CP790 strain. LAB comprising a 200 kDa cell wall proteinase
A preferred lactic acid bacterium is one that comprises a specific cell wall proteinase of around 200 kDa. Such a lactic acid bacterium is particular suitable to prepare peptides or other active components with heart rate reducing properties. This preferred LAB is described in detail below.
The specific cell wall proteinase is herein termed prtH200. The prtH200 proteinase, as de- scribed in this section, correspond to the prtH 204 kDa cell wall proteinase from the Lactobacillus helveticus CNRZ32 strain described in the article of University of Wisconsin and Utah State University [Pederson et al (1999, J. of Bacteriology, 181: 4592-4597)]. In this article it is not described nor suggested to use the CNRZ32 strain to make peptides or other active components with heart rate reducing properties.
The lactic acid bacterium is characterized in that it comprises a gene sequence encoding a cell wall proteinase (termed prtH200), wherein the gene sequence is defined as prtH200 is a DNA sequence encoding an enzyme exhibiting cell wall proteinase activity, which DNA sequence is selected from the group comprising of: (a) The DNA sequence shown in positions 1-5550 in SEQ ID NO 1 ;
(b) A DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 50% identical to a corresponding fragment of the DNA sequence defined in (a);
(c) A DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids
(aa) that is at least 30% identical to a corresponding fragment of the polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2;
(d) A DNA sequence which hybridizes with a double-stranded DNA probe comprising the DNA sequence shown in positions 1-5550 in SEQ ID NO 1 at low stringency; and
(e) A DNA sequence which is a fragment of the DNA sequences specified in (a), (b), (c), or (d). The presence, in a lactic acid bacterium, of a gene sequence encoding the prtH200 proteinase may preferably be verified by PCR amplification using suitable designed PCR primers. When the skilled person has suitable designed PCR primers it is easy for him to verify the presence or not of the gene sequence in a lactic acid bacterium using his general knowl- edge to make a specific suitable PCR amplification protocol.
Consequently, the skilled person may rapidly screen a number of lactic acid bacteria, identify the ones comprising a prtH200 gene sequence, and thereby obtain specific selected lactic acid bacteria with improved industrial relevant characteristics.
A sample of a particular preferred Lactobacillus helveticus strain CHCC5951 has been deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH) under the accession number DSM 14998 with a deposit date of 15th May 2002. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Micro organisms for the Pmposes of Patent Procedure.
Accordingly, a particular preferred embodiment relates to a use as described in this section where the lactic acid bacterium is Lactobacillus helveticus with the registration number DSM 14998.
Using as starting material the deposited the deposited DSM 14998 strain, the skilled reader can by conventional mutagenesis or re-isolation techniques obtain further mutants or derivatives which retain the ability to be suitable for preparing peptides or other active components with heart rate reducing properties.
Proteolytic activity of the lactic acid bacteria
The prtH200, orfF3 and orfF4 gene sequences as described in this section may be seen as fingeφrints highly suitable to identity useful lactic acid bacteria as described in this section. Without being limited to theory, theoretically it may be that some strains could exist that despite comprising the fmgeφrint gene sequence(s) as described in this section are not exhibiting the advantageous properties as described in this section. Accordingly, once having identified, in a lactic acid bacterium, the presence of fingeφrint gene sequence(s) as described in this section, it may be advantageous to test the proteolytic activity of the lactic acid bacterium. In the present context, a preferred lactic acid bacterium has preferably a proteolytic activity as described below.
In the present context, a lactic acid bacterium is considered to have proteolytic activity when it is capable of synthesizing an active cell wall proteinase. In other words, capable of proving a proteinase, which is active outside the intracellular part of the bacterium. Further, the proteinase should have a specificity making it capable of degrading proteins (e.g. casein comprised in milk) to obtain peptides or other active components with heart rate reducing properties.
Preferably, the proteolytic activity of a bacterium is ascertained by a protocol comprising the steps: (i) Fermenting overnight 200 ml of a food material with the bacterium,
(ii) Extracting the produced peptides or other active components, and (iii) Measuring the heart rate reducing properties of the extracted peptides or other active components by an assay measuring the peptidic concentration required to inhibit 50% of the ACE activity.
The ACE inhibition activity assay is herein also termed DL50. The lower the DL50 value is the better is the heart rate effect of the peptides or other active components comprised in the product.
In step (i) of the protocol, the food material is preferably fresh milk. Further, the bacterium is preferably inoculated to the food material in the form of an overnight stock culture of (1% v/v) and maintained overnight at a suitable temperature. A suitable temperature is a temperature that is suitable for growth of the bacterium. The skilled person knows how to identify this for a particular lactic acid bacterium. For Lactobacillus species a suitable temperature is 37°C and for Lactococcus species a suitable temperature is 30°C. In working example 3 herein is provided a detailed preferred protocol for the fermenting and extracting steps and a detailed preferred protocol for the DL50 ACE activity assay.
Preferably, the lactic acid bacterium has a proteolytic activity making it capable of, in a pro- tocol comprising the steps:
(i) Fermenting overnight 200 ml of a food material with the bacterium, (ii) Extracting the produced peptides or other active components, and (iii) Measuring the anti -hypertensive properties of the extracted peptides or other active components by an assay measuring the peptidic concentration required to inhibit 50% of the ACE activity (DL50),
Producing peptides or other active components with an angiotensin-converting enzyme (ACE) inhibition activity (DL50) of from 0.25 to 5.0 (mg/ml).
More preferably, the lactic acid bacterium is capable of producing peptides or other active components with an angiotensin-converting enzyme (ACE) inhibition activity (DL50) of from 0.25 to 4.0 (mg/ml), and even more preferably the proteolytic lactic acid bacterium is capable of producing peptides or other active components with an angiotensin-converting enzyme (ACE) inhibition activity (DL50) of from 0.25 to 3.5 (mg/ml).
The lower DL50 range may be, instead of 0.25 mg/ml, 1.0 mg/ml.
The term "gene" is herein defined according to is usual meaning as the fundamental physical and functional unit of heredity. A gene is an ordered sequence of nucleotides (e.g. DNA or RNA) located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule).
The "nomenclature of degenerated primers" is according to the standard nomenclature in the art. Y = C or T; R = A or G; M = A or C; K = G or T; S = G or C; W = A or T; H = A or C or T; B = G or T or C; V = G or C or A; D = G or A or T; N = G, A, C or T.
The term a "fragment" in relation to a DNA/amino acid sequence comprising a fragment denotes a continuous partial sequence. For instance, from position 75 to 300 in an amino acid sequence having 600 amino acids. The term "a corresponding fragment" in relation to identity comparison between two sequences relates to a fragment of corresponding size. Preferably, the size difference, between the two fragments to be compared, is less than 50%. In order words, if one fragment is 100 bp the other is preferably less than 150 bp. More preferably, the size difference, between the two fragments to be compared, is less than 25%, and even more preferably the size difference, between the two fragments to be compared, is less than 5%.
prtH200 cell wall proteinase
The activity of a cell wall proteinase is preferably verified while it is present in the lactic acid bacteria. A suitable strategy is to construct a lactic acid bacterium with a lethal mutation in the gene encoding the cell wall proteinase to be analysed. The proteolytic activity (for a suitable assay see below) of this constructed bacterium could then be compared with the corresponding wild type bacterium. A measurable decrease in proteolytic activity of the lactic acid bacterium with a lethal mutation as compared with the corresponding wild type bacterium would experimentally confirm that the gene encoding the cell wall proteinase to be analysed is a gene encoding an active lactic acid cell wall proteinase.
The skilled person knows how to construct a lactic acid bacterium with a suitable lethal mu- tation. Reference is made to e.g. Pederson et al (1999) and Yamamoto et al (1994) (see above).
At the filing date of the present invention, the National Center for Biotechnology Information (NCBI) offered at it Internet site (http://www.ncbi.nlm.nih. ov the possibility of mak- ing a standard BLAST computer sequence homology search.
The DNA and amino acid sequence of prtH200 of Lactobacillus helveticus DSM 14998 as shown in SEQ ID NO 1 and SEQ ID NO 2 has been published at the GeneBank database with accession number AF133727. The database sequence identification is gi\5758038\gb\AFI33727.I\AFI 33727. Standard protein-protein BLAST [blastp] search using the prtH200 amino acid sequence shown in position 1-1849 in SEQ ID NO 2 as reference sequence gave, among others, following results (in italic is given the database sequence identification. This info unambiguously identifies the published sequence and the skilled person know how to get the sequence based on this):
gi\129346\sp\P15293\P2P_LACLC: Pll-type proteinase precursor (Lactocepin) (Cell wall-associated serine proteinase). Organism: Lactococcus lactis subsp. cremoris. Identity: a 1600 amino acid fragment with 50% identity of to a corresponding frag- ment of the prtH200 amino acid sequence of SEQ ID NO 2.
gi\149582\gb\AAA25248.1\: proteinase Organism: Lactobacillus par acasei. Identity: a 1632 amino acid fragment with 49% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
gi\l 381114\gb\AAC41529.1\: (L48487) proteinase precursor Organism: Lactobacillus delbrueckii.
Identity: a 1682 amino acid fragment with 32% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
gi\18568398\gb\AAL76069.1\ (AF468027) cell-envelope proteinase. Organism: Lactobacillus pentosus.
Identity: a 415 amino acid fragment with 63% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
gi\9963932\gb\AAG09771.1\AF243528_l: (AF243528) cell envelope proteinase. Organism: Streptococcus thermophilus
Identity: a 781 amino acid fragment with 30% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
gi\482386\pir\\A44833: lactocepin (EC 3.4.21.96). Organism: Lactococcus lactis. Identity: a 264 amino acid fragment with 61% identity of to a corresponding fragment of the prtH200 amino acid sequence of SEQ ID NO 2.
These specific sequences are all representing a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 30% identical to a corresponding fragment of the polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2.
Standard nucleotide-nucleotide BLAST [blastn] search using the prtH200 DNA sequence shown in position 1-5550 in SEQ ID NO 1 as reference sequence gave, among others, following results
gi\149580\gb\M83946.1\LBAMPRO. Proteinase (prtP) gene. Organism: Lactobacillus paracasei. Identity: a 102 bp fragment with 84% identity of to a corresponding fragment of the prtH200 DNA sequence of SEQ ID NO 1.
gi\47197\emb\X14130.1\SLPRT763. plasmid ρLP763 prt gene for cell wall- associated serine proteinase. Organism: Streptococcus lactis Identity: a 81 bp fragment with 86% identity of to a corresponding fragment of the prtH200 DNA sequence of SEQ ID NO 1.
gi\472834\gb\M24767.1\STRWGPROT. Wg2 proteinase gene. Organism: S. cremoris Identity: a 81 bp fragment with 86% identity of to a corresponding fragment of the prtffiOO DNA sequence of SEQ ID NO 1.
gi\149476\gb\J04962.1\LACPRASE. Pill-type proteinase (prtP) and maturation protein. Organism: Lactococcus lactis.
Identity: a 81 bp fragment with 86% identity of to a corresponding fragment of the prtH200 DNA sequence of SEQ ID NO 1. gi|18568397|gb|AF468027.1|. cell-envelope proteinase (prtP) gene. Organism: Lactobacillus pentosus
Identity: a 102 bp fragment with 83% identity of to a corresponding fragment of the prtH200 DNA sequence of SEQ ID NO 1.
These specific sequences are all representing a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 50% identical to a corresponding fragment of the DNA sequence shown in positions 1-5550 of SEQ ID NO 1.
Other "fingerprint " gene sequences (orfF3 and orfF4):
orfF3:
Preferably, beside a prtH200 gene sequence the LAB also comprises a gene comprising an open reading frame herein termed orfF3. This gene may be seen as an additional fmgeφrint.
The DNA and amino acid sequence of orfF3 of Lactobacillus helveticus DSM 14998 is shown in SEQ ED NO 3 and SEQ ID NO 4.
Accordingly in a preferred embodiment, a lactic acid bacterium, as described in this section, comprises the prtH200 gene and a gene sequence (termed orfF3) encoding an open reading frame wherein the gene sequences is identifiable by PCR amplification of genomic DNA of the lactic acid bacterium using sets of PCR primers selected from the group consisting of [sense sequence (S); antisense sequence (A)]: orfF3: (a): (S): 5' CGAAGGCGATAAGTCAAACTTTGATAATGC 3',
(A): 5' CCCGGTTCTGTAAGATAATTTGGATCG 3'; and (b): (S): 5ΑSTCWRRYTTYGATRATGCW 3', (A): 5' BHKYAMSAWARTTTGGATCR 3'.
As said above suitable PCR primers may be identified based on the sequences disclosed herein. Accordingly, in a preferred embodiment, a lactic acid bacterium, as described in this section, comprises the prtH200 gene and a gene sequence encoding an open reading frame (termed orfF3), wherein the gene sequence is defined as orfF3 is a DNA sequence encoding an open reading frame, which DNA se- quence is selected from the group comprising of:
(a) The DNA sequence shown in positions 1-2679 in SEQ LD NO 3;
(b) A DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 40% identical to a corresponding fragment of the DNA sequence defined in (a); (c) A DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 30% identical to a corresponding fragment of the polypeptide sequence shown in positions 1-893 of SEQ ID NO 4;
(d) A DNA sequence which hybridises with a double-stranded DNA probe comprising the DNA sequence shown in positions 1-2679 in
SEQ ID NO 3 at low stringency; and
(e) A DNA sequence which is a fragment of the DNA sequences specified in (a), (b), (c), or (d).
The term "open reading frame" denotes a stretch of DNA that contains a signal for the start of translation followed in the correct register by a sufficient length of amino acid encoding triplets to form a protein, followed by a signal for termination of translation, and which may therefore indicate the presence of a protein coding gene.
At the filing date of the present application, a standard protein-protein BLAST [blastp] search using the deduced orfF3 amino acid sequence shown in position 1-893 in SEQ ID NO 4 as reference sequence gave relatively limited conclusive results in relation to published homologous sequences.
However, without being limited to theory, it is believed that an orfF3 gene as described in this section encodes a cell wall proteinase. Consequently, in a preferred embodiment the orfF3 gene as described in this section encodes a cell wall proteinase. orfF4:
Preferably, beside a prtH200 gene sequence the LAB also comprises a gene comprising an open reading frame herein termed orfF4.
The DNA and amino acid sequence of orfF4 of Lactobacillus helveticus DSM 14998 is shown in SEQ ID NO 5 and SEQ ID NO 6.
Accordingly in a preferred embodiment, a lactic acid bacterium, as described in this section, comprises the prtH200 gene and a gene sequence (termed orfF4) encoding an open reading frame wherein the gene sequences is identifiable by PCR amplification of genomic DNA of the lactic acid bacterium using sets of PCR primers selected from the group consisting of [sense sequence (S); antisense sequence (A)]: orfF4: (a): (S): 5 ' GGTGTTGCTCCTGAAGC 3 '
(A): 5' ACTCTAGCACCAGCTAATTGAACATCATG 3'.
As said above suitable PCR primers may be identified based on the sequences disclosed herein. Accordingly, in a preferred embodiment, a lactic acid bacterium, as described in this section, comprises the prtH200 gene and a gene sequence encoding an open reading frame (termed orfF4), wherein the gene sequence is defined as orfF4 is a DNA sequence encoding an open reading frame, which DNA sequence is selected from the group comprising of: (a) The DNA sequence shown in positions 1-4881 in SEQ ID NO 5;
(b) A DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 40% identical to a corresponding fragment of the DNA sequence defined in (a);
(c) A DNA sequence that encodes a polypeptide comprising a frag- ment of at least 200 amino acids (aa) that is at least 30% identical to a corresponding fragment of the polypeptide sequence shown in positions 1-1627 of SEQ ID NO 6; (d) A DNA sequence which hybridises with a double-stranded DNA probe comprising the DNA sequence shown in positions 1-4881 in SEQ ID NO 5 at low stringency; and
(e) A DNA sequence which is a fragment of the DNA sequences specified in (a), (b), (c), or (d).
At the filing date of the present application, a standard protein-protein BLAST [blastp] search using the deduced orfF4 amino acid sequence shown in position 1-1627 in SEQ ID NO 6 as reference sequence gave relatively limited conclusive results in relation to pub- lished homologous sequences.
However, without being limited to theory, it is believed that an orfF4 gene as described in this section encodes a cell wall proteinase. Consequently, in a preferred embodiment the orfF4 gene as described in this section encodes a cell wall proteinase.
Preferably, a lactic acid bacterium, as described in this section, comprises the prtH200 gene, the orfF3 gene and the orf4 gene as described in this section.
PCR amplification
As said above, the presence of the gene sequences, as described in this section, may preferably be verified by PCR amplification using PCR primers designed according to the teaching herein. When the skilled person has suitable designed PCR primers it is easy for him to ver- ify the presence or not of these genes in a lactic acid bacterium using his general knowledge to make a specific suitable PCR amplification protocol.
Preferably the PCR amplification protocol (reaction) is made according to the description of Example 2 herein.
Once the PCR have been performed it is routine for the skilled person to investigate whether or not the resulting PCR amplified fragments corresponds to fragments of genes as described in this section. Normally this may be identified already based on the size of the PCR fragment, since the skilled person generally roughly knows how big the size of a positive PCR fragment would be. A positive PCR fragment relates to a PCR fragment of a gene as described in this section. Alternatively, the PCR fragment may be DNA sequenced and the re- suiting DNA sequence may then be compared with the sequences disclosed herein. Further, a lactic acid bacterium with a lethal mutation in the gene corresponding to the PCR fragment could be constructed. The proteolytic activity (see below) of this constructed bacterium could then be compared with the corresponding wildtype bacterium and a measurable change in proteolytic activity between the two cells would experimentally confirm whether or not the gene corresponding to the amplified PCR fragment is a gene encoding a lactic acid cell wall proteinase as described in this section.
In summary, the skilled person can routinely identify whether or not a specific lactic acid bacterium comprises gene(s) capable of giving corresponding positive PCR fragments using PCR primers designed according to the teaching herein.
PCR is the preferred way to investigate the presence or not in the lactic acid bacteria of the genes as described in this section. However, it may be done in other ways such as e.g. by Southern blot analysis. PCR primers
As explained above suitable PCR primers in relation to the PrtH200 gene are: PrtH200: (a): (S): 5' CGATGATAATCCTAGCGAGC3', (A): 5' TGGCAGAACCTGTGCCTA 3'; (b): (S): 5' GCCAAGACGCCTCTGGTA 3', (A): 5 ' TAGGTATAGTTTCCATCAGGA 3 ' ; and
(c): (S): 5' AARGTWCCWTAYGGYYWYAAYTA 3', (A): 5' GCCATDSWDGTRCCDSWCATDTK 3'.
PrtH200 (a) (S) is shown in SEQ ID NO 7; PrtH200: (a): (A) is shown in SEQ ID NO 8; PrtH200 (b) (S) is shown in SEQ ID NO 9; PrtH200: (b): (A) is shown in SEQ ID NO 10;
PrtH200 (c) (S) is shown in SEQ ID NO 11 ; PrtH200: (c): (A) is shown in SEQ ID NO 12. When using the primer set (a) the amplified PrtH200 PCR fragment should preferably be of a size between 400 bp and 800 bp, more preferably of a size between 500 bp and 700 bp. When using the primer set (b) the amplified PrtH200 PCR fragment should preferably be of a size between 200 bp and 500 bp, more preferably of a size between 250 bp and 375 bp. When using the primer set (c) the amplified PrtH200 PCR fragment should preferably be of a size between 400 bp and 800 bp, more preferably of a size between 500 bp and 700 bp.
The most preferred PrtH200 related PCR primers are primer set (a) and primer set (b).
As said above suitable PCR primers in relation to orfF3 are: orfF3: (a): (S): 5' CGAAGGCGATAAGTCAAACTTTGATAATGC 3', (A): 5' CCCGGTTCTGTAAGATAATTTGGATCG 3'; and (b): (S): 5' ASTCWRRYTTYGATRATGCW 3', (A): 5' BHKYAMSAWARTTTGGATCR 3'.
orfF3: (a): (S) is shown in SEQ ID NO 13; orfF3: (a): (A) is shown in SEQ ID NO 14; orfF3: (b): (S) is shown in SEQ ID NO 15; orfF3: (b): (A) is shown in SEQ ID NO 16. When using the primer set (a) the amplified orfF3 PCR fragment should preferably be of a size between 1250 bp and 1900 bp, more preferably of a size between 1500 bp and 1725 bp . When using the primer set (b) the amplified orfF3 PCR fragment should preferably be of a size between 1250 bp and 1900 bp, more preferably of a size between 1500 bp and 1725 bp.
The most preferred orfF3 related PCR primers are the primer set (a).
As said above suitable PCR primers in relation to orfF4 is: orfF4: (a): (S): 5' GGTGTTGCTCCTGAAGC 3'
(A): 5' ACTCTAGCACCAGCTAATTGAACATCATG 3'.
orfF4: (a): (S) is shown in SEQ ID NO 17; orfF4: (a): (A) is shown in SEQ ID NO 18.
When using the primer set (a) the amplified orfF4 PCR fragment should preferably be of a size between 700 bp and 1150 bp, more preferably of a size between 875 bp and 1025 bp. Homology/identity of DNA sequences
The DNA sequence homology/identity referred to above is determined as the degree of identity between two sequences indicating a deviation of the first sequence from the second.
At the filing date of the present invention, the National Center for Biotechnology Information (NCBI) offered at it Internet site (http://www.ncbi.nlm.nih.gov/) the possibility of making a standard BLAST computer sequence homology search.
BLAST program is described in [Altschul et al (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402].
In the present context, a preferred computer homology search program is a "Standard nu- cleotide-nucleotide BLAST [blastn]" search as specified, at the filing date of the present ap- plication, at the NCBI Internet site with setting filter: Low complexity; Expect: 10, Word Size: 11.
The reference sequence is introduced into the program and the program identifies fragments of published sequences together the identity percentage to a corresponding fragment of the reference sequence.
Using this Standard nucleotide-nucleotide BLAST computer program, a prtH200 sequence as described in this section is preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 60% identical to a corresponding fragment of the prtH200 DNA sequence shown in position 1-5550 of SEQ ID NO 1, more preferably a DNA se- quence comprising a fragment of at least 75 base pairs (bp) that is at least 70%) identical to a corresponding fragment of the prtH200 DNA sequence shown in position 1-5550 of SEQ ID NO 1, and even more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 80% identical to a corresponding fragment of the prtH200 DNA sequence shown in position 1-5550 of SEQ ID NO 1.
With the identity percentages given above, it is preferred that the fragment is at least 100 bp pairs (bp), more preferably that the fragment is at least 200 bp pairs (bp), even more pref- erably that the fragment is at least 400 bp pairs (bp), and most preferably that the fragment is at least 1500 bp pairs (bp).
Using this Standard nucleotide-nucleotide BLAST computer program, a orfF3 sequence as described in this section is preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 60% identical to a corresponding fragment of the orfF3 DNA sequence shown in position 1-2679 of SEQ ID NO 3, more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 70% identical to a corresponding fragment of the orfF3 DNA sequence shown in position 1-2679 of SEQ ID NO 3, and even more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 80% identical to a cooesponding fragment of the orfF3 DNA sequence shown in position 1-2679 of SEQ ID NO 3.
With the identity percentages given above, it is prefeoed that the fragment is at least 100 bp pairs (bp), more preferably that the fragment is at least 200 bp pairs (bp), even more preferably that the fragment is at least 400 bp pairs (bp), and most preferably that the fragment is at least 1500 bp pairs (bp).
Using this Standard nucleotide-nucleotide BLAST computer program, a orfF4 sequence as described in this section is preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 60% identical to a corresponding fragment of the orfF4 DNA sequence shown in position 1-4881 of SEQ ID NO 5, more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 70% identical to a corresponding fragment of the orfF4 DNA sequence shown in position 1-4881 of SEQ ID NO 5, and even more preferably a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 80% identical to a corresponding fragment of the orfF4 DNA sequence shown in position 1-4881 of SEQ ID NO 5.
With the identity percentages given above, it is prefeoed that the fragment is at least 100 bp pairs (bp), more preferably that the fragment is at least 200 bp pairs (bp), even more preferably that the fragment is at least 400 bp pairs (bp), and most preferably that the fragment is at least 1500 bp pairs (bp). Alternatively, the homology/identity may suitably be determined by means of computer programs known in the art, such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 5371 l)(Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453).
Using GAP with the following settings for DNA sequence comparison, GAP creation penalty of 5.0 and GAP extension penalty of 0.3, the preferred identity percentages given above in relation to the BLAST program are also the prefeoed identities when using GAP.
Homology to amino acid sequences
Similar to the nucleotide homology analysis, in the present context, a preferred computer homology search program is a "Standard protein-protein BLAST [blastp]" search as speci- fied, at the filing date of the present application, at the NCBI Internet site with settings
Composition-based statistics: yes, filter: Low complexity; Expect: 10, Word Size: 3, Matrix: BLOSUM 62, Gap Costs: Existence 11 Extension 1.
Using this standard protein-protein BLAST computer program, a prtH200 sequence as de- scribed in this section is preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 40% identical to a cooesponding fragment of the prtH200 polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2, more preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 50% identical to a cooesponding fragment of the prtH200 polypeptide sequence shown in positions 1-1849 of SEQ LD NO 2, even more preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 65% identical to a corresponding fragment of the prtH200 polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2, and most preferably a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 80% identical to a corresponding fragment of the prtH200 polypeptide sequence shown in positions 1-1849 of SEQ LD NO 2.
With the identity percentages given above, it is preferred that the fragment is at least 300 amino acids (aa), more preferably that the fragment is at least 400 amino acids (aa), even more preferably that the fragment is at least 800 amino acids (aa), and most preferably that the fragment is at least 1200 amino acids (aa).
Using this standard protein-protein BLAST computer program, a orfF3 sequence as de- scribed in this section is preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 40% identical to a cooesponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4, more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 50% identical to a cooesponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4, even more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 65% identical to a cooesponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4, and most preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 80% identical to a corresponding fragment of the orfF3 polypeptide sequence shown in positions 1-893 of SEQ ID NO 4.
With the identity percentages given above, it is preferred that the fragment is at least 300 amino acids (aa), more preferably that the fragment is at least 400 amino acids (aa), even more preferably that the fragment is at least 800 amino acids (aa), and most preferably that the fragment is at least 1200 amino acids (aa).
Using this standard protein-protein BLAST computer program, a orfF4 sequence as described in this section is preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 40% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ ID NO 6, more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 50% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ LD NO 6, even more preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 65% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ ID NO 6, and most preferably a DNA sequence that encodes a polypeptide comprising a fragment of at least 200 amino acids (aa) that is at least 80% identical to a cooesponding fragment of the orfF4 polypeptide sequence shown in positions 1-1627 of SEQ ID NO 6.
With the identity percentages given above, it is preferred that the fragment is at least 300 amino acids (aa), more preferably that the fragment is at least 400 amino acids (aa), even more preferably that the fragment is at least 800 amino acids (aa), and most preferably that the fragment is at least 1200 amino acids (aa).
Alternatively, the homology may suitably be determined by means of computer programs known in the art such as GAP provided in the GCG program package (Program Manual for the Wisconsin Package, Version 8, August 1994, Genetics Computer Group, 575 Science Drive, Madison, Wisconsin, USA 53711) (Needleman, S.B. and Wunsch, CD., (1970), Journal of Molecular Biology, 48, 443-453.
Using GAP with the following settings for polypeptide sequence comparison: GAP creation penalty of 3.0 and GAP extension penalty of 0.1, the prefeoed identity percentages given above in relation to the BLAST program are also the prefeoed identities when using GAP
Hybridisation
The hybridisation refeoed to above is intended to comprise an analogous DNA sequence, which hybridises to a double-stranded DNA probe. Suitable experimental conditions for de- termining hybridisation at low, medium, or high stringency between a nucleotide probe and a homologous DNA or RNA sequence involve pre-soaking of the filter containing the DNA fragments or RNA to hybridise in 5 x SSC (Sodium chloride/Sodium citrate, Sambrook et al. 1989) for 10 min, and prehybridization of the filter in a solution of 5 x SSC, 5 x Denhardt's solution (Sambrook et al. 1989), 0.5 % SDS and 100 mu g/ml of denatured sonicated salmon sperm DNA (Sambrook et al. 1989), followed by hybridisation in the same solution containing 10 ng/ml of a random-primed (Feinberg, A. P. and Vogelstein, B. (1983) Anal. Biochem. 132:6-13), P-dCTP-labeled (specific activity > 1 x 10 cpm/ mu g) probe for 12 hours at 45°CThe filter is then washed twice for 30 minutes in 2 x SSC, 0.5 % SDS at a temperature of at least 55°C (low stringency), more preferably at least 60°C (medium stringency), still more preferably at least 65°C (medium/high stringency), even more preferably at least 70°C (high stringency), even more preferably at least 75°C (very high stringency).
Molecules to which the ohgonucleotide probe hybridises under these conditions are detected using an X-ray film.
Legends to Figures:
Figure 1. Heart rate measurements in animals treated with concentration 3 (whey compositions containing solid whey components concentrated factor of 14.3 times) or placebo. Each data point is representing the average value from 8 animals. Note that the activity period of the animals is coincident with the period without light, i.e. the period indicated by the black bar.
Figure 2. The reduction in heart rate in animals in the period 12-15 hours after the animals received whey compositions containing solid whey components concentrated 2, 6, 14.3 and 21 times relatively to the amount of solid components in whey obtained after fermentation of milk. The animals was given the whey products by gavage, i.e. feeding by a stomach tube. (O) indicates placebo. The heart rate was determined in animals as described in Example 1 and compared to the heat rate in untreated animals.
Examples:
Example 1 : In vivo test of heart rate reducing properties
Materials and Methods
Strains and cultivation
Strains were streaked on MRS agar and incubated anaerobically for 48 h at 37°C. A single colony was picked, inoculated into MRS broth and grown overnight at 37°C Stock cultures were prepared from this overnight culture and were stored at -80°C in 20% glycerol. The strains were precultivated in milk overnight and inoculated 1% (v/v) in fresh milk for the fermentation.
Preparation of the samples
Whey: sample 1
The milk (9.5%> of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1 % (v/v). The fermented product was centrifuged, the pellet was discarded and the whey was filtered through a 0,45 mm filter and freeze-dried. A second fermentation, fermented under the same conditions as the first one, was centrifuged and the whey fraction obtained. The pellet was discarded and the whey was filtered through a 0,45 mm filter and frozen. The whey was used to solubilize the freeze-dried whey powder to concentrate it with a factor 21 before feeding the rats.
Freeze-dried fermented milk dissolved in whey: sample 2
The milk (9.5% of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1% (v/v). The total product was freeze-dried. A second fermentation, with the same conditions as the first one, was centrifuged. The pellet was discarded and the whey was filtered through a 0,45 mm filter and frozen. The whey was used to solubilize the freeze-dried fermented milk powder to concentrate it with a factor 5 before feeding the rats.
Freeze-dried fermented milk dissolved in milk: Sample 3 The milk (9.5% of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1%> (v/v). The total product was freeze-dried. Milk (9.5% of protein content) was used to solubilize the freeze-dried powder to concentrate it with a factor 5 before feeding the rats.
Overnight milk fermentation product: sample 4
The milk (9.5% of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1% (v/v).
Overnight milk fermentation product heat-treated: sample 5 The milk (9.5%> of protein content) was fermented with the strain of single culture for 16 hours with an inoculation level of 1% (v/v).
Spontaneously Hypertensive Rats
Spontaneously Hypertensive Rats (SHR) was obtained from LFFA CREDO (a Charles River company), Lyon, France.
Each treatment was administered between 9:15 h and 9:30 h by gavage and each animal received a total volume of 2.5 ml per animal.
Experimental design Three groups were formed:
Group 1 (n=16): receiving treatment 1 (milk; n=16)
Group 2 (n=12): receiving successive treatments, each administration separated by a 3-day washout period
Groups: 1) Placebo (Milk)
2) Sample 1 (Freeze-dried whey suspended in whey. Administered concentrated by factor 21) 2) Sample 2 (freeze-dried fermented milk suspended in whey, administered concentrated by factor 5)
3) Sample 3 (freeze-dried fermented milk suspended in neutral pH milk Administered concentrated by factor 5) 4) Sample 4 (just the fermented milk product)
5) Sample 5 (Fermented milk that was heat treated after fermentation)
6) Sample 6 (milk that had not been fermented but it included the live bacteria).
Prior to the experiments all SHR were acclimated to the animal facilities for 9 weeks. Moreover, all animals were accustomed to gavage and measurement of systolic blood pressure 3 days before the first gavage.
Investigated parameters Systolic blood pressure and heart rate were determined for 24 hours after gavage by telemetry (Data Sciences Int.) in conscious SHR at different time points. In brief, the mean (over a 1 minute period) of systolic, diastolic blood pressures and heart rate were recorded every 15 minutes, during the 24 hours before administration and the 48 hours after administration. From these tracings, 24 hours mean of systolic and diastolic blood pressures as well as heart rate were calculated in each group.
Furthermore, the variations in systolic and diastolic blood pressures induced by each substance compared to the untreated values were calculated throughout the 24 hours following gavage, and during the 3 to 6, the 12 to 15 and the 21 to 24 hours periods of time after gavage.
Statistics
All results are expressed as mean ± standard eoor of mean. Differences between the untreated value and the value obtained after gavage of each substance were evaluated using a paired student's t-test, where the calculation was done by using the program SISTAT 8.0. Results
In table 1 is shown the variation of the heart rate determined. Tablel :
Table 1. Heart rate (beats/min) after gavage.
Group Period Variation vs. Untreated
0-24 3-6 12-15 21-24 0-24 3-6 12-15 21-24
Un- 320±1 291±1 343±1 319±1
S ample 1 297±2* 268±2* 326±8 294±3* -26.4±3.4 -26.4±5.5 -19.8±9.3 -29.7±3.6
Untreated2 330±4 291±6 361±5 289±5
Sample 2 307±6* 282±6 333±11* 265±4* -21±3 -9±5 -27±8 -24±4
Sample 3 312±6* 272±8* 344±5* 272±5* -16±1 -19±5 -17±4 -18±4
Sample 4 318±6 297±6 335±6 279±7 -10±3 7±6 -26±4 -10±6
Sample 5 313±5* 290±6 337±6* 280±5 -15±4 -1±7 -23±5 -9±4
Sample 6 343±9 330±17 359±9 305±5* 14±9 38±17 -2±7 16±7
*: p<0.05 vs. Untreated
Untreated ' and untreated 2 are the controls of study 1 and study number 2, respectively. Untreated 1 was the placebo for the sample 1 and untreated 2 was the placebo for all the other samples. We had two placebos be- cause the studies were done independently in two different in vivo studies.
The results demonstrate that the whey product concentrated by a factor 21 (sample 1) has the strongest heart rate reducing properties.
The results demonstrate also that there is no need to up-concentrate the fermented milk product to have already a significant heart rate reducer effect. Samples 4 and 5 are fermented milk products fermented overnight and they have a heart rate reducing effects. However, the heart rate reducer effect is proportional to the concentration factor of the product.
Obviously, the whey part of the product that contains the peptides or other active components is determinant in the heart rate reducer effect. One does observe a dose-heart rate reducing effect of the product. Sample 3 is freeze-dried fermented milk suspended in neutral pH milk. It reduces the heart rate significantly. This demonstrates the wide application of a fermented product as described herein since it may be dissolved in different liquids to get a required final appropriate use. Characteristic such as different pH are not affecting the heart rate reducer activity of the product.
Sample 5 with heat treatment after fermentation reduces also the heart rate. Substantially all bacteria are killed in this sample. Accordingly, this demonstrates that there is no need to have live bacteria in the final product.
Sample 6 has not been fermented but it includes the live bacteria. It does not reduce the heart rate. It demonstrates that the fermentation step is required.
Example 2: PCR amplification reaction
Template DNA was obtained by phenol-chloroform extraction as previously described (Marmur (1961, Journal of Molecular Biology, 3, 208-218). The final preparation was genomic template DNA in a TE buffer + RNAse.
The PCR reaction was prepared as follows: (i) 1.0 μl of template DNA
1.0 μl of forward primer (5 pmol/μl) 1.0 μl of reverse primer (5 pmol/μl)
1.0 μl 2.5 mM dNTD (mixture of dATP, dCTP, dGTP, dTTP) 5.0 μl Mg buffer (20 mM MgS04)
0.5 μl DNA polymerase (Pwo, 100 TJ) 10.5 μl H20 (ii) The thermal program for the PCR amplification was 30 cycles of 1 min at 94°C, 90 s at 50°C (when primers Tm was around 55°C), 90 s at 55°C (when primers Tm was around 62°C), 90 s at 45°C (when primers Tm was around 50°C) and 1 min at 72°C The samples were cooled to 4°C after the 30 cycles were completed. (iii) The PCR products were run on a 1.5% agarose gel at 60 V, excised from the gel under UV light and purified using a QIAquick Gel Extraction Kit according to the manufacturer's instructions (Qiagen, Cat. No. 28704).
Example 3 : Proteolytic (ACE) activity assay
Preparation of stock culture
Lactobacillus species were streaked on MRS agar and incubated anaerobically for 48 h at 37°C. A single colony was picked, inoculated into MRS broth and grown overnight at 37°C. Lactococcus species were streaked on M17 agar and incubated aerobically for 48 h at 30°C A single colony was picked, inoculated into Ml 7 broth and grown overnight at 30°C Stock cultures were prepared from these overnight cultures and were stored at -80°C in 20% glycerol.
Preparation of fermented milk and extraction of peptides or other active components
Fermentation is performed by inoculate 200 ml of fresh milk with an overnight stock culture of example 1 (1% v/v) and maintain overnight at 37°C or 30°C dependent on the strain used.
From the fermented milk, extraction of the peptides or other active components may be achieved by using the following protocol:
- Centrifuge at 3000 g for 10 min at room temperature.
- Withdraw the supernatant and adjust to pH 8.3 (optimal pH for ACE activity test) with NaOH.
- Centrifuge the obtained supernatant at 3000 g for 10 min at room temperature.
- Withdraw the supernatant (whey), which comprises the peptides or other active components.
- Determine the concentration of peptides in the whey by the Lowry test (mg peptide / ml whey) (Lowry et al, 1951. J Biol. Chem., 193:265-275). The whey may be used directly for ACE assay or freeze at -20°C The whey comprising the peptides or other active components is termed "peptide solution" in example 3. ACE activity assay
The peptide pools of milk fermented are tested for ACE activity in vitro. The DL50 (mg/ml) is the peptidic concentration, which inhibits 50% of ACE activity. The lower this value is, the better the anti-hypertensive effect of the fermented milk. The ACE activity of the extracted peptides or other active components is measured by the following protocol:
The essence of the assay is that ACE degrades a hippuryl-L-histidyl-L-leucine (HHL) substrate and adding a color agent develops a color. If peptides or other active components are present the peptides or other active components inhibit ACE and less HHL substrate is degraded. This means less color is developed after addition of the color agent.
Solution preparation:
Incubation buffer: 188 mmol/1 boric acid pH 8.3, 1.375 mmol/1 potassium chloride. (Dissolve 2.91 g of boric acid and 25.63 g potassium chloride in 200 ml of distilled water. Ad- just the pH to 8.3 with 1 mol/1 potassium hydroxide and dilute to 250 ml with distilled water. Store at room temperature).
Substrate solution: 5.8 mmol/1 hippuryl-L-histidyl-L-leucine (HHL). (Dissolve 250 mg hippuryl-L-histidyl-L-leucine in about 90 ml incubation buffer and fill up to 100 ml with the same buffer. Store at 40°C The substrate solution can be used for at least 2 weeks).
Stop solution: 100 mmol/1 HEPES pH 9, 2.5 mmol EDTA.
(Dissolve 23.83 g HEPES and 0.93 g EDTA in 800 ml distilled water. Adjust to pH 9 with 1 mol/1 sodium hydroxide and dilute to 1 1 with distilled water. Store at room temperature). Color reagent: 136 mmol/1 cyanuric chloride in 1, 4-dioxane.
(Dissolve 12.50 g cyanuric chloride in about 400 ml of 1, 4-dioxane and fill up with 1, 4- dioxane to 500 ml. Store at room temperature in dark-brown glass bottle).
Assay: (all solutions are equilibrated to room temperature)
- Make a dilution series of the peptide solution with incubation buffer. The series consist of 6 dilutions going from the undiluted peptide solution to a blank (only incubation buffer)
- For each of the dilutions, place 10 μl of peptide solution, 40 μl of substrate (HHL) solution (2.5 g/1) and 2.5 μl of ACE (0.25 Units/ml) in a glass tube. - The positive control comprises 2.5 μl ACE, 10 μl of incubation and 40 μl of substrate
(HHL)
- The negative control comprises 12 μl of incubation buffer and 40 μl of substrate (HHL)
- Incubate at 37°C for 1 hour.
- Stop the reaction by adding 300 μl of stop solution, followed by 150 μl of color reagent - Mix vigorously.
- Allow to stand for 5 minutes and centrifuge at 3300 g for 30 min at room temperature to remove denatured protein and excess cyanuric chloride.
- Transfer 300 μl of supernatant of each sample to microtiter plate hole.
- Read at 405 nm against water as a blank.
The ACE inhibition percentage is expressed by the formula :
OD405nm positive control- OD405nm sample ACE inhibition activity = OD405nm positive control- OD405nm negative control
Each dilution has its own ACE inhibition percentage value that gives a curve expressing the ACE inhibition percentage in function of the peptide concentration of the whey. DL50 (peptidic concentration that inhibits 50 % of ACE activity) is obtained by reading the peptidic concentration at the intersection point between the curve and the cooesponding 50 % ACE inhibition point on the axe. Example 4: Dose-response experiment
To further substantiate the results presented in Example 1, a dose response experiment was performed by administering compositions containing variable amounts of freeze-dried whey obtained from fermented milk suspended in whey from fermented milk to Spontaneously Hypertensive Rats (SHR).
In general, materials and methods and experimental design were as described in Example 1.
In brief, milk was fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998) for 16 hours with an inoculation level of 1% (v/v). The fermented milk was centrifuged, the pellet discarded and the whey freeze-dried. A second fermentation with the same conditions as the first one was centrifuged. The pellet was discarded and the whey was placed at 4°C. The whey was used to solubilize the freeze-dried whey powder resulting in compositions containing solid whey components concentrated 2, 6 and 14.3 times relatively to the amount of solid components in whey obtained in the second fermentation. The final step of the s lu- bilization was done shortly before feeding the composition to the rats.
As in Example 1, unfermented milk was used as placebo.
Starting with the lowest concentration the doses were tested on the same experimental animals in three separate testing-periods. Each testing-period was separated by a "wash out" period of three days in which animals did not received fermented whey product in order to eliminate the activity of the previous dose.
The result is shown in tabular form in table 2. Table 2. Heart rate (beats/min) after gavage.
Period Variation relative to Placebo 0-24 3-6 12-15 21-24 0-24 3-6 12-15 21-24
Untreated 306±2 265±5 337±5 273±2
Placebo 304+-2 268±2 333±3 278±4 -2 +3 -4 +5
Placebo 314+11 282±12 335±12 295±14
Concentration 1 302+-7 278±10 324+7 274±7 -12 -4 -11 -21
Placebo 314±9 278±8 346±9 288±8
Concentration 2 309+-9 287±10 334±9 289±11 -5 +8 -12 1
Placebo 311±9 278±9 337±11 279±8
Concentration 3 297±9 279+-15 314±7 277+-10 -14 +1 -24 -2
Note to Table: Untreated rats were not receiving neither milk nor whey product. Placebo is non- fermented milk. Concentration 1 , 2 and 3 are whey compositions containing solid whey components concentrated 2, 6 and 14.3 times, respectively. Note that the activity period of the animals is coinci- dent with the period without light, i.e. the time period from 9 to 21.
In figure 1 the results for one full period of concentration 3 (x 14.3 concentrated) is shown.
In addition freeze-dried whey powder resulting in compositions containing solid whey com- ponents concentrated 21 times relatively to the amount of solid components in whey obtained in the second fermentation. The results of feeding animals with a 2, 6, 14.3 as well as a 21 times concentrated whey product are shown in figure 2.
The results show a clear dosage dependent effect on the heart rate of the whey products con- centrated up to a factor of 21 times. The higher dose of whey products the larger the decrease of heart rate. It appears that a stationary or asymptotic level not was reached, indicating that compositions containing higher concentrations of the active compound(s) can be expected to have higher efficacy for lowering heart rate. Example 5: Fluctuations in heart rate during period of high activity is reduced
During the activity period of the animals the heart rate increase. The activity period of the animals of this investigation is almost coincident with the period without light, i.e. the pe- riod indicated by the black bar (see Figure 1). However, judged from the observations presented in figure 1 it appears that not only the heart rate but, suφrisingly, also the fluctuations in heart rate is larger in untreated animals compared to animals treated with the 14.3 times concentrated fermented whey product.
To quantify the fluctuations in heart rate the variance of the heart rate values observed in the time period between 12 and 15 h was estimated. The standard deviation was estimated for both treated as well as untreated animals by use of the SISTAT 8.0 program as described in Example 1, and used to calculate the variance ( (standard deviation)2 = Variance).
The standard deviation for the treated animals was estimated to 5.9, cooesponding to a variance of (5.9)2 = 34.8.
The standard deviation for the untreated animals was estimated to 10.4, corresponding to a variance of (10.4)2 = 108.2.
Assuming that the primary data are normally distributed a variance of 34.8 is statistically significantly different from a variance of 108.2 at the 95%> level.
Thus, it is possible to conclude that the fluctuations in the heart rate during the activity period (measured as variance) are significantly larger in untreated animals compared to the fluctuations in the heart rate of animals treated with the xl4.3 concentrated fermented whey product.
In conclusion, the heart rate fluctuations is stabilized by the whey product fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998). This may be an important feature of the product since it has been observed that changes in heart rate cooelated well with mortality in an experimental rabbit model (Zaza et al 2001) and since in particular in stressed situations significant heart rate fluctuations are frequently observed. Example 6: Comparison of milk products fermented with L. helveticus strain CHCC5951 with a similar commercial product fermented with a different strain.
The puφose of this example was to compare a commercial lactic acid bacterium fermented milk product that is claimed to have blood pressure reducing properties with the product fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998).
The effect on blood pressure and heart rat of the two products was evaluated by administering the two compositions to Wistar rats and measuring the systolic blood pressure, the dia- stolic blood pressure and the heart rate on anaesthetized animals.
If not specifically mentioned, materials and methods were as described in Example 1.
In brief, milk was fermented with Lactobacillus helveticus strain CHCC5951 (DSM 14998) for 16 hours with an inoculation level of 1% (v/v), and the resulting product was freeze- dried to obtain a freeze dried milk powder. A second fermentation, with the same conditions as the first one, was performed and centrifuged. The pellet was discarded and the whey was filtered through a 0.45 μm filter and frozen. Shortly before feeding it to the rats the freeze- dried milk powder was dissolved in the whey. The amount of powder dissolved corre- sponded to the amount obtained from a volume of fermented milk that was 5 times the volume of the whey it was dissolved in (in casu 4.28 g powder in 30 ml of whey). This composition we refer to as a x5 concentration in this example. The composition was administered to overnight fastened normotensive Wistar rats (300-320 grams) between 09:15 h and 09:30 h by gavage at a dose of 7.5 ml per kg of the x5 composition. The effect of the composition was evaluated between 14:30 h and 16:30 h, i.e. 5-7 hours after the oral administration by measuring the values of arterial blood pressure and heart rate on anaesthetized animals. The results obtained are shown in table 3.
Table 3. Effect of two different fermented products on blood pressure and heart rate.
CHCC5951
Commercial
Untreated fermented product milk product
Systolic blood pressure (mm Hg) 134±3 125±3* 125±3
Diastolic blood pressure (mm Hg) 107±3 98±4!| 96±2*
Mean blood pressure (mm Hg) 116±3 107±4* 106±2*
Heart Rate (Beats.min-1) 390±7 387±6 353±6"
Values (mean ± SEM) of systolic, diastolic, mean arterial blood pressure and heart rate in the three different groups, 5-7 hours after gavage.
* indicates a significant difference at the p<0.05 level between treated vs. untreated rats.
The statistical analysis was performed using ANOVA, followed by a Tukey test for multiple comparisons.
From the data it can be concluded that the commercial product and the CHCC5951 fermented product both reduce blood pressure, and furthermore do so to the same extent. However, suφrisingly the data in table 3 shows that only the CHCC5951 fermented products significantly reduce the heart rate.
References:
EP821968 (Calpis Food Industry)
EP 1016709 (Calpis Food Industry)
WO0132836 (Valio Ltd.).
Yamamoto et al. (1996) Am. J. Clin. Nurt., 64:767-71.
WO0185984 (Davisco International Foods, Inc.)
Fuglsang, A.; et al. (2002) Applied and Environmental Microbiology, 3566-3569.
Zaza, A. , T. Opthof, J. Camm, F. Lombardi and S. Hohnloser (2001) "Heart rate reduction: optimism with some caveats". nEwSCast Report presented to the XXIII'th Congress of the European Society of Cardiology, Stockholm 2001 (http://ftp.escardio.org/newscast/archivesstock.htm).

Claims

Claims:
1. Use of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable proteins, with a lactic acid bacterium to obtain a fer- merited food material which comprises active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate in a mammalian.
2. The use according to claim 1 of a composition obtainable by a process comprising fermenting a food material, comprising animal milk or vegetable proteins, with a lactic acid bacterium to obtain a fermented food material which comprises peptides or other active components with heart rate reducing properties for the manufacture of a product for reducing the heart rate in a mammalian.
3. The use according to claims 1 or 2 wherein the product is a food or feed product.
4. The use according to any of the preceding claims wherein the reduction of the heart rate is done for treatment or relief of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, aohythmia, tachyaoythmia, con- gestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyshpidemia, dyslipoproteinemia.
5. The use according to any of the preceding claims wherein the treatment results in the reduction of the heart rate fluctuations.
6. The use according to any of the preceding claims wherein the fermented food material is further processed in a way that purify or up-concentrate the active components with heart rate reducing properties obtainable by a process comprising following steps:
(i) Preparing a fermented food material according to a process for preparing ac- tive components with heart rate reducing properties according to any of the preceding claims, (ii) The fermented food material of step (i) is further processed in a way that purifies or up-concentrate the active components with heart rate reducing properties, (iii) Packing it in a suitable way to get the product.
7. The use according to claim 6 wherein the up-concentration according to step (ii) is done by centrifugation and the resulting supernatant comprising the active components is recovered.
8. The use according to claims 6-7 wherein the food material is milk and the product is whey.
9. The use according to any preceding claims wherein the lactic acid bacterium is a lactic acid bacterium selected from the group consisting of the genus Lactobacillus, genus Lacto- coccus, genus Streptococcus, genus Leuconostoc, genus Bifidobacterium and genus Pedio- coccus.
10. The use according to of claim 9 wherein the lactic acid bacterium of the genus Lactobacillus is in particular a Lactobacillus helveticus.
11. The use according to any of the preceding claims wherein the lactic acid bacterium comprises a gene sequence encoding a cell wall proteinase (termed prtH200), wherein the gene sequence is defined as prtH200 is a DNA sequence encoding an enzyme exhibiting cell wall proteinase ac- tivity, which DNA sequence is selected from the group consisting of:
(a) the DNA sequence shown in positions 1-5550 in SEQ ID NO 1;
(b) a DNA sequence comprising a fragment of at least 75 base pairs (bp) that is at least 50% identical to a cooesponding fragment of the DNA sequence defined in (a); (c) a DNA sequence that encodes a polypeptide, exhibiting cell wall proteinase activity, comprising a fragment of at least 200 amino acids (aa) that is at least 30% identical to a cooesponding fragment of the polypeptide sequence shown in positions 1-1849 of SEQ ID NO 2;
(d) a DNA sequence which hybridises with a double-stranded DNA probe comprising the DNA sequence shown in positions 1-5550 in SEQ ID NO 1 at low stringency; and
(e) a DNA sequence which is a fragment of the DNA sequences specified in (a), (b), (c), or (d).
12. The use according to any of the preceding claims wherein the lactic acid bacterium is a Lactobacillus helveticus bacterium with the registration number DSM 14998 or a mutant thereof.
13. A fermented food material having heart rate reducing properties in a mammalian and comprising active components produced by the fermentation of the food material with at least one lactic acid bacterium strain.
14. A fermented food material according to claim 13 wherein the lactic acid bacteria is one or more lactic acid bacteria selected from the group consisting of the genus Lactobacillus, genus Lactococcus, genus Streptococcus, genus Leuconostoc, genus Bifidobacterium and genus Pediococcus.
15. A fermented food material according to any of claims 13 or 14 wherein at least one of the lactic acid bacteria is a Lactobacillus helveticus bacterium.
16. A fermented food material according to any of claims 13 to 15 wherein at least one of the lactic acid bacteria is the Lactobacillus helveticus bacterium with the registration nunxber DSM 14998 or a mutant thereof.
17. A fermented food material having heart rate reducing properties in a mammalian and comprising dead or alive Lactobacillus helveticus strain DSM 14998 or a mutant thereof.
18. An isolated heart rate reducing component isolated from the fermented food material of any of the preceding claims.
19. The use of a fermented food material according to any of claims 13 -17 for the manufacture a medicament for the treatment or relief of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, aohythmia, tachyao-ythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyshpidemia, dyslipoproteinemia.
20. The use of isolated heart rate reducing active components isolated from the fermented food material for the manufacture a medicament for the treatment or relief of a coronary artery disease (CAD) or a coronary heart disease (CHD) such as angina pectoris, hypertension, atherosclerosis, stroke, myocardial infarcation, cerebral infarction, and restenosis following angioplasty, aohythmia, tachyaoythmia, congestive heart failure (CHF), aortic valve regurgitation, chronic renal failure, dyshpidemia, dyslipoproteinemia.
EP04725669A 2003-04-07 2004-04-05 Composition with heart rate reducing properties Withdrawn EP1613168A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP04725669A EP1613168A1 (en) 2003-04-07 2004-04-05 Composition with heart rate reducing properties

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
EP03076018A EP1466529A1 (en) 2003-04-07 2003-04-07 Composition with heart rate reducing properties
EP04725669A EP1613168A1 (en) 2003-04-07 2004-04-05 Composition with heart rate reducing properties
PCT/DK2004/000239 WO2004089097A1 (en) 2003-04-07 2004-04-05 Composition with heart rate reducing properties

Publications (1)

Publication Number Publication Date
EP1613168A1 true EP1613168A1 (en) 2006-01-11

Family

ID=32865019

Family Applications (2)

Application Number Title Priority Date Filing Date
EP03076018A Withdrawn EP1466529A1 (en) 2003-04-07 2003-04-07 Composition with heart rate reducing properties
EP04725669A Withdrawn EP1613168A1 (en) 2003-04-07 2004-04-05 Composition with heart rate reducing properties

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP03076018A Withdrawn EP1466529A1 (en) 2003-04-07 2003-04-07 Composition with heart rate reducing properties

Country Status (7)

Country Link
EP (2) EP1466529A1 (en)
KR (1) KR20060006804A (en)
CN (2) CN101890046A (en)
AU (1) AU2004228891A1 (en)
CA (1) CA2521631A1 (en)
TW (1) TW200511935A (en)
WO (1) WO2004089097A1 (en)

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DK2233011T3 (en) * 2008-06-11 2013-05-27 Morinaga Milk Industry Co Ltd Process for making fermented milk
WO2016182053A1 (en) * 2015-05-13 2016-11-17 アサヒカルピスウェルネス株式会社 Method for suppressing increase in heart rate during exercise, and composition for suppressing increase in heart rate
CN107858388A (en) * 2017-10-17 2018-03-30 陕西科技大学 A kind of method that sheep breast Antihypertensive Peptides are prepared using probiotic lactobacilli protease
CN109007397A (en) * 2018-08-23 2018-12-18 广东仁源生物科技有限公司 A kind of fodder compound and preparation method thereof that can improve mouse heart morphosis and function
EP4104844A4 (en) * 2019-12-13 2024-02-14 Meiji Co., Ltd COMPOSITION FOR LOWERING HEART RATE
CN111440835B (en) * 2020-04-03 2022-05-24 荣成海的故事调味食品有限公司 Method for extracting active peptide from low-value marine organism leftovers
CN112011607B (en) * 2020-09-19 2022-10-18 河北医科大学第二医院 Flora derived from intestinal tract and related to cerebral apoplexy diagnosis and treatment effects and application thereof

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5854029A (en) * 1996-08-02 1998-12-29 Calpis Co., Ltd. Method for preparing antihypertensive agent
JP4065038B2 (en) * 1996-08-07 2008-03-19 カルピス株式会社 Computational workload stress relievers
EP1287159A4 (en) * 2000-05-08 2005-02-09 Davisco Foods Int Inc ENZYMATIC TREATMENT OF LACTOSERUM PROTEINS FOR OBTAINING ANTI-HYPERTENSION PEPTIDES, PRODUCTS OBTAINED AND TREATMENT OF HYPERTENSION IN MAMMALS
WO2002071854A1 (en) * 2001-03-09 2002-09-19 Unilever N.V. Fermented milk product
AU2003214038A1 (en) * 2002-04-03 2003-10-13 Chr. Hansen A/S Peptides with anti-hypertensive properties

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO2004089097A1 *

Also Published As

Publication number Publication date
CN1802093A (en) 2006-07-12
TW200511935A (en) 2005-04-01
EP1466529A1 (en) 2004-10-13
AU2004228891A1 (en) 2004-10-21
CN100464639C (en) 2009-03-04
CA2521631A1 (en) 2004-10-21
KR20060006804A (en) 2006-01-19
CN101890046A (en) 2010-11-24
WO2004089097A1 (en) 2004-10-21

Similar Documents

Publication Publication Date Title
Donkor et al. Probiotic strains as starter cultures improve angiotensin‐converting enzyme inhibitory activity in soy yogurt
Minervini et al. Fermented goats’ milk produced with selected multiple starters as a potentially functional food
KR101108428B1 (en) Lactic acid bacteria isolated from mother&#39;s milk with probiotic activity and inhibitory activity against body weight augmentation
KR100718709B1 (en) Method of producing products containing antihypertensive tripeptides
JP5021720B2 (en) Method for producing peptides having antihypertensive properties
Rasika et al. ACE-inhibitory activity of milk fermented with Saccharomyces cerevisiae K7 and Lactococcus lactis subsp. lactis NBRC 12007
Otte et al. Influence of fermentation temperature and autolysis on ACE-inhibitory activity and peptide profiles of milk fermented by selected strains of Lactobacillus helveticus and Lactococcus lactis
TWI765563B (en) Lactobacillus amylovorus lam1345 isolate and uses of the same
Ahtesh et al. Effects of fermented skim milk drink by Kluyveromyces marxianus LAF 4 co‐cultured with lactic acid bacteria to release angiotensin‐converting enzyme inhibitory activities
US8367604B2 (en) Fermented milk or vegetable proteins comprising receptor ligand and uses thereof
US7718171B2 (en) Reducing heart rate in mammals using milk derived fermentation products produced using Lactobacillus helveticus
EP1613168A1 (en) Composition with heart rate reducing properties
Konkit et al. Alcohol dehydrogenase activity in Lactococcus chungangensis: Application in cream cheese to moderate alcohol uptake
JP4525754B2 (en) Protection of bioactive food ingredients using microorganisms with reduced metabolic capacity
US20050142166A1 (en) Peptides with anti-hypertensive properties
US20230180778A1 (en) Milk fermentation process
HK1145457A (en) Composition with heart rate reducing properties
AHTESH et al. RESEARCH Effects of fermented skim milk drink by Kluyveromyces marxianus LAF4 co-cultured with lactic acid bacteria to release angiotensin-converting enzyme inhibitory activities

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20051107

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PL PT RO SE SI SK TR

AX Request for extension of the european patent

Extension state: AL HR LT LV MK

DAX Request for extension of the european patent (deleted)
RIC1 Information provided on ipc code assigned before grant

Ipc: A61K 38/02 20060101ALI20140102BHEP

Ipc: A23C 9/123 20060101ALI20140102BHEP

Ipc: A23C 11/10 20060101ALI20140102BHEP

Ipc: A23K 1/16 20060101ALI20140102BHEP

Ipc: C12R 1/225 20060101ALI20140102BHEP

Ipc: A61K 38/01 20060101ALI20140102BHEP

Ipc: A61K 38/00 20060101ALI20140102BHEP

Ipc: C12P 21/06 20060101ALI20140102BHEP

Ipc: A61K 36/00 20060101ALI20140102BHEP

Ipc: C12P 21/00 20060101ALI20140102BHEP

Ipc: A61K 35/20 20060101ALI20140102BHEP

Ipc: C12N 9/52 20060101ALI20140102BHEP

Ipc: A23L 1/305 20060101AFI20140102BHEP

GRAJ Information related to disapproval of communication of intention to grant by the applicant or resumption of examination proceedings by the epo deleted

Free format text: ORIGINAL CODE: EPIDOSDIGR1

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: CHR. HANSEN A/S

INTG Intention to grant announced

Effective date: 20140319

RIN1 Information on inventor provided before grant (corrected)

Inventor name: FLAMBARD, BENEDICTE

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20140730