EP1581635A2 - Sirna-mediated gene silencing - Google Patents
Sirna-mediated gene silencingInfo
- Publication number
- EP1581635A2 EP1581635A2 EP03814141A EP03814141A EP1581635A2 EP 1581635 A2 EP1581635 A2 EP 1581635A2 EP 03814141 A EP03814141 A EP 03814141A EP 03814141 A EP03814141 A EP 03814141A EP 1581635 A2 EP1581635 A2 EP 1581635A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- strand
- rna
- ofthe
- sirna
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1137—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against enzymes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
- C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
- C12Y302/01031—Beta-glucuronidase (3.2.1.31)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2330/00—Production
- C12N2330/30—Production chemically synthesised
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/022—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from an adenovirus
Definitions
- Double-stranded RNA can induce sequence-specific posttranscriptional gene silencing in many organisms by a process known as RNA interference (RNAi).
- RNAi RNA interference
- RNA fragments are the sequence-specific mediators of RNAi (Elbashir et al, 2001). Interference of gene expression by these small interfering RNA (siRNA) is now recognized as a naturally occurring strategy for silencing genes in C.
- the present invention provides a mammalian cell containing an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5' end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the cell.
- siRNA small interfering RNA
- the duplex formed by the two strands of RNA may be between 15 and 25 base pairs in length, such as 20 base pairs in length.
- the first strand may be 20 nucleotides in length
- the second strand may be 20 nucleotides in length.
- the 5' end of the second strand of RNA is operably linked to a G nucleotide. This G nucleotide may be directly linked to the second strand of RNA (i.e., no intervening nucleotides are present).
- the first strand is complementary to 19 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to one nucleotide of the targeted gene.
- the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5' end of the first strand of RNA.
- the one non-complementary nucleotide is at position 10, as measured from the 5' end of the first strand of RNA.
- the first strand is complementary to 18 out of 20 contiguous nucleotides of the targeted gene and is non-complementary to two nucleotides of the targeted gene.
- the two non-complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5' end of the first strand of RNA.
- the two non-complementary nucleotides are at nucleotide position 10 and 11, as measured from the 5' end of the first strand of RNA.
- the first and second strand of RNA may be operably linked together by means of an RNA loop strand to form a hairpin structure to form a "duplex structure" and a "loop structure.”
- These loop structures maybe from 4 to 10 nucleotides in length.
- the loop structure may be 4, 5 or 6 nucleotides long.
- the targeted gene may be a gene associated with a condition amenable to siRNA therapy.
- the gene encodes a transcript for Swedish double amyloid precursor protein (APPsw) mutation or a transcript for Tau.
- APPsw Swedish double amyloid precursor protein
- the present invention also provides a mammalian cell containing an expression cassette encoding an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5' end of the first strand of RNA is operably linked to a G nucleotide to form a first strand of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, and wherein at least 12 nucleotides of the first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA silences only one allele of the targeted gene in the cell.
- siRNA small interfering RNA
- These expression cassettes may further contain a promoter.
- Such promoters can be regulatable promoters or constitutive promoters. Examples of suitable promoters include a CMV, RSV, pol II or pol III promoter.
- the expression cassette may further contain a polyadenylation signal, such as a synthetic minimal polyadenylation signal.
- the expression cassette may further contain a marker gene.
- the expression cassette may be contained in a vector. Examples of appropriate vectors include adenoviral, lentiviral, adeno-associated viral (AAV), poliovirus, HSV, or murine Maloney-based viral vectors. In one embodiment, the vector is an adenoviral vector.
- the present invention further provides an isolated RNA duplex containing a first strand of RNA having a 5' end and a 3' end, and a second strand of RNA, -transcript encoded by siAlO GGTGGCCAGATGGAAGTAAA (SEQ ID NO:63), wherein the 5' end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and wherein the second strand is complementary to all the nucleotides of the first strand.
- the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- the present invention also provides an expression cassette comprising a nucleic acid encoding at least one strand of the RNA duplex described above.
- the term "encoded by” means that the DNA sequence in the SEQ ID NO is transcribed into the RNA of interest.
- the present invention provides a vector containing the expression cassette described above. Further, the vector may .contain two expression cassettes, a first expression cassette containing a nucleic acid encoding a first strand of the RNA duplex and a second expression cassette containing a nucleic • acid encoding a second strand of the RNA duplex.
- the present invention also provides cells containing these expression cassettes (such as a mammalian cell), and a non-human mammal that has a cell containing one of these expression cassettes.
- the present invention provides an isolated RNA duplex containing a first strand of RNA having a 5' end and a 3' end, and a second strand of RNA, wherein the first strand is made of 20 nucleotides complementary to Swedish double amyloid precursor protein (APPsw) mutation transcript encoded by siTlO/Cl 1 TGAAGTGAATCTGGATGCAG (SEQ ID NO:64) , wherein the 5' end of the first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and wherein the second strand is complementary to all the nucleotides of the first strand.
- APPsw Swedish double amyloid precursor protein
- the first strand and the second strand may be operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- the loop structure may contain from 4 to 10 nucleotides, such as 4, 5 or 6 nucleotides.
- the present invention provides an expression cassette containing a nucleic acid encoding at least one strand of the RNA duplex described above. It also provides a vector that contains this expression cassette. Further, the vector may contain two expression cassettes, a first expression cassette containing a nucleic acid encoding the first strand of the RNA duplex as described above and a second expression cassette containing a nucleic acid encoding the second strand of the RNA duplex.
- the present invention also provides a cell (such as a mammalian cell) containing this expression cassette.
- an expression cassette may contain a nucleic acid encoding at least one strand ofthe RNA duplex described above. Such an expression cassette may further contain a promoter.
- the expression cassette may be contained in a vector. These cassettes and vectors may be contained in a cell, such as a mammalian cell. A cell in a non-human mammal may contain the cassette or vector.
- the vector may contain two expression cassettes, the first expression cassette containing a nucleic acid encoding the first strand ofthe RNA duplex, and a second expression cassette containing a nucleic acid encoding the second strand ofthe RNA duplex.
- the present invention further provides a method of performing allele-specific gene silencing in a mammal by administering to the mammal an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5' end ofthe first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, and an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, wherein at least 12 nucleotides ofthe first and second strands are complementary to each other and form a small interfering RNA (siRNA) duplex under physiological conditions, and wherein the siRNA preferentially silences one allele ofthe targeted gene in the mammal.
- the duplex is between 15 and 25 base pairs in length.
- the duplex may be 20 base pairs in length.
- the first strand is 20 nucleotides in length
- the second strand is 20 nucleotides in length.
- the first strand is complementary to 19 out of 20 contiguous nucleotides ofthe targeted gene and is non-complementary to one nucleotide ofthe targeted gene.
- the one non- complementary nucleotide may be at position 9, 10, or 11, as measured from the 5' end ofthe first strand of RNA.
- the one non-complementary nucleotide is at position 10, as measured from the 5' end ofthe first strand of RNA.
- the first strand is complementary to 18 out of 20 contiguous nucleotides ofthe targeted gene and is non-complementary to two nucleotides ofthe targeted gene.
- the two non-complementary nucleotides may be at nucleotide position 9, 10, 11, or 12 as measured from the 5' end ofthe first strand of RNA.
- the two non-complementary nucleotides may be at nucleotide position 10 and 11, as measured from the 5' end ofthe first strand of RNA.
- the 5' end ofthe second strand of RNA maybe operably linked to a G nucleotide.
- the first strand and the second strand are operably linked by means of an RNA loop strand to form a hairpin structure comprising a duplex structure and a loop structure.
- the targeted gene is a gene associated with a condition amenable to siRNA therapy.
- gene may encode a transcript for Swedish double amyloid precursor protein (APPsw) mutation or a transcript for Tau.
- APPsw Swedish double amyloid precursor protein
- the targeted gene may be a gene associated with a condition amenable to siRNA therapy.
- the condition amenable to siRNA therapy could be a disabling neurological disorder.
- Neurological disease and “neurological disorder” refer to both hereditary and sporadic conditions that are characterized by nervous system dysfunction, and which may be associated with atrophy ofthe affected central or peripheral nervous system structures, or loss of function without atrophy.
- Neurodegenerative diseases and disorders include, but are not limited to, amyotrophic lateral sclerosis (ALS), hereditary spastic hemiplegia, primary lateral sclerosis, spinal muscular atrophy, Kennedy's disease, Alzheimer's disease, Parkinson's disease, multiple sclerosis, and repeat expansion neurodegenerative diseases, e.g., diseases associated with expansions of DNA repeats such as the polyglutamine (polyQ) repeat diseases, e.g., Huntington's disease (HD), specific spinocerebellar ataxias (SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17), spinal and bulbar muscular atrophy (SBMA), dentatorubropallidoluysian atrophy (DRPLA).
- ALS amyotrophic lateral sclerosis
- polyQ polyglutamine
- Huntington's disease HD
- specific spinocerebellar ataxias SCA1, SCA2, SCA3, SCA6, SCA7, and SCA17
- the present invention also provides a method of producing an RNA by (a) producing an isolated first strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, wherein the first strand is complementary to at least 15 nucleotides of a targeted gene of interest, and wherein the 5' end ofthe first strand of RNA is operably linked to a G nucleotide to form a first segment of RNA, (b) producing an isolated second strand of RNA of 15 to 30 nucleotides in length having a 5' end and a 3' end, and (c) contacting the first strand and the second strand under hybridizing conditions to form a siRNA duplex, wherein the siRNA silences only one allele ofthe targeted gene in the cell.
- the duplex maybe between 15 and 25 base pairs in length, such as 20 base pairs in length.
- the first strand is 20 nucleotides in length
- the second strand is 20 nucleotides in length.
- the first strand maybe complementary to 19 out of 20 contiguous nucleotides ofthe targeted gene and is non-complementary to one nucleotide ofthe targeted gene.
- the one non-complementary nucleotide is at position 9, 10, or 11, as measured from the 5' end ofthe first strand of RNA (such as at position 10).
- the first sfrand may be complementary to 18 out of 20 contiguous nucleotides ofthe targeted gene and is non-complementary to one nucleotide ofthe targeted gene.
- the two non- complementary nucleotides are at nucleotide position 9, 10, 11, or 12 as measured from the 5' end ofthe first sfrand of RNA (such as at nucleotide position 10 and 11).
- the 5' end ofthe second strand of RNA is operably linked (directly or indirectly) to a G nucleotide.
- FIG. 1 siRNA expressed from CMV promoter constructs and in vitro effects.
- A A cartoon ofthe expression plasmid used for expression of functional siRNA in cells. The CMV promoter was modified to allow close juxtaposition ofthe hairpin to the transcription initiation site, and a minimal polyadenylation signal containing cassette was constructed immediately 3' ofthe MCS (mCMV, modified CMV; mpA, minipA).
- B C) Fluorescence photomicrographs of HEK293 cells 72 h after transfection of pEGFPNl and pCMV ⁇ gal (control), or pEGFPNl and pmCMVsiGFPmpA, respectively.
- HEK293 cells were transfected with pEGFPNl and pmCMVsiGFPmpA, expressing siGFP, or plasmids expressing the control siRNA as indicated.
- pCMVeGFPx which expresses siGFPx, contains a large poly(A) cassette from SV40 large T and an unmodified CMV promoter, in contrast to pmCMVsiGFPmpA shown in (A).
- F Western blot with anti-GFP antibodies of cell lysates harvested 72 h after transfection with pEGFPNl and pCMVsiGFPmpA, or pEGFPNl and pmCMVsi ⁇ glucmpA.
- G, H Fluorescence photomicrographs of HEK293 cells 72 h after transfection of pEGFPNl and pCMVsiGFPx, or pEGFPNl and pmCMVsi ⁇ glucmpA, respectively.
- FIG. 1 Viral vectors expressing siRNA reduce expression from transgenic and endogenous alleles in vivo.
- Recombinant adenovirus vectors were prepared from the siGFP and si ⁇ gluc shuttle plasmids described in Fig. 1.
- RFP expression cassettes in E3 facilitate localization of gene transfer.
- FIG. 1 Representative photomicrographs of eGFP (left), RFP (middle), and merged images (right) of coronal sections from mice injected with adenoviruses expressing siGFP (top panels) or si ⁇ gluc (bottom panels) demonstrate siRNA specificity in eGFP transgenic mice striata after direct brain injection.
- B Full coronal brain sections (1 mm) harvested from AdsiGFP or Adsi ⁇ gluc injected mice were split into hemisections and both ipsilateral (il) and contralateral (cl) portions evaluated by western blot using antibodies to GFP. Actin was used as an internal control for each sample.
- siGFP gene transfer reduces Q19-eGFP expression in cell lines.
- PC 12 cells expressing the polyglutamine repeat Q19 fused to eGFP (eGFP-Q19) under tefracycline repression (A, bottom left) were washed and dox-free media added to allow eGFP-Ql 9 expression (A, top left).
- Adenoviruses were applied at the indicated multiplicity of infection (MOI) 3 days after dox removal.
- MOI multiplicity of infection
- A eGFP fluorescence 3 days after adenovirus- mediated gene transfer of Adsi ⁇ gluc (top panels) or AdsiGFP (bottom panels).
- B C
- Western blot analysis of cell lysates harvested 3 days after infection at the indicated MOIs demonstrate a dose-dependent decrease in GFP-Q19 protein levels.
- NV no virus.
- D Quantitation of eGFP fluorescence. Data represent mean total area fluorescence ⁇ standard deviation in 4 low power fields/well (3 wells/plate).
- FIG. 4 siRNA mediated reduction of expanded polyglutamine protein levels and infracellular aggregates.
- PC 12 cells expressing tet-repressible eGFP- Q80 fusion proteins were washed to remove doxycycline and adenovirus vectors expressing siRNA were applied 3 days later.
- A-D Representative punctate eGFP fluorescence of aggregates in mock-infected cells (A), or those infected with 100 MOI of Adsi ⁇ gluc (B), AdsiGFPx (C) or Adsi ⁇ gal (D).
- B Adsi ⁇ gluc
- B AdsiGFPx
- D Adsi ⁇ gal
- E Three days after infection of dox-free eGFP-Q80 PC 12 cells with AdsiGFP, aggregate size and number are notably reduced.
- FIG. 5 RNAi-mediated suppression of expanded CAG repeat containing genes. Expanded CAG repeats are not direct targets for preferential inactivation (A), but a linked SNP can be exploited to generate siRNA that selectively silences mutant ataxin-3 expression (B-F).
- A Schematic of cDNA encoding generalized polyQ-fluorescent protein fusions. Bars indicate regions targeted by siRNAs. HeLa cells co-fransfected with Q80-GFP, Q19-RFP and the indicated siRNA. Nuclei are visualized by DAPI staining (blue) in merged images.
- Tubulin immunostaining shown as a loading control in panels (D)-(F).
- Figure 6. Primer sequences (SEQ ID NOs: 11-40) for in vitro synthesis of siRNAs using T7 polymerase. All primers contain the following T7 promoter sequence at their 3' ends: 5'-TATAGTGAGTCGTATTA-3' (SEQ ID NO:9). The following primer was annealed to all oligos to synthesize siRNAs: 5'- TAATACGACTCACTATAG-3' (SEQ ID NO: 10).
- Figure 7. Inclusion of either two (siC7/8) or three (siCIO) CAG triplets at the 5' end of ataxin-3 siRNA does not inhibit expression of unrelated CAG repeat containing genes.
- A Western blot analysis of Cos-7 cells transfected with CAG repeat-GFP fusion proteins and the indicated siRNA. Immunostaining with monoclonal anti-GFP antibody (MBL) at 1:1000 dilution.
- B Western blot analysis of Cos-7 cells transfected with Flag-tagged ataxin-1- Q30, which is unrelated to ataxin-3, and the indicated siRNA. Immunostaining with anti-Flag monoclonal antibody (Sigma St. Louis, MO) at 1:1000 dilution, i panels (A) and (B), lysates were collected 24 hours after transfection. Tubulin immunostaining shown as a loading control.
- FIG. 8 shRNA-expressing adenovirus mediates allele-specific silencing in transiently transfected Cos-7 cells simulating the heterozygous state.
- A Representative images of cells cotransfected to express wild type and mutant ataxin-3 and infected with the indicated adenovirus at 50 multiplicities of infection (MOI). Atx-3-Q28-GFP (green) is directly visualized and Atx-3-Q166 (red) is detected by immunofluorescence with 1C2 antibody. Nuclei visualized with DAPI stain in merged images. An average of 73.1% of cells co-expressed both ataxin-3 proteins with siMiss.
- B Quantitation of mean fluorescence from 2 independent experiments performed as in (A).
- FIG. 9 Allele-specific siRNA suppression of a missense Tau mutation.
- A Schematic of human tau cDNA with bars indicating regions and mutations tested for siRNA suppression. Of these, the V337M region showed effective suppression and was further studied. Vertical bars represent microtubule binding repeat elements in Tau. In the displayed siRNAs, blue and red bars denote A and C respectively.
- GTGGCCAGATGGAAGTAAAATC is SEQ ID NO:35
- GTGGCCAGGTGGAAGTAAAATC is SEQ ID NO:41.
- B Western blot analysis of cells co-transfected with WT or V337M Tau-EGFP fusion proteins and the indicated siRNAs.
- Tubulin immunostaining is shown as a loading confrol.
- Figure 11 Schematic diagram of allele-specific silencing of mutant TorsinA by small interfering RNA (siRNA).
- siRNA small interfering RNA
- wild type and mutant alleles of TORI A are both transcribed into mRNA.
- siRNA with sequence identical to the mutant allele should bind mutant mRNA selectively and mediate its degradation by the RNA-induced silencing complex (RISC) (circle). Wild type mRNA, not recognized by the mutant-specific siRNA, will remain and continue to be translated into normal TorsinA (Fig. 11 A).
- RISC RNA-induced silencing complex
- Mis-siRNA (negative control; SEQ ID NOs:42-43) does not target TA; com-siRNA (SEQ ID NOs:44-45) targets a sequence present in wild type and mutant TA; wt-siRNA (SEQ ID NOs:47-48) targets only wild type TA; and three mutant-specific siRNAs (Mut A (SEQ ID NOs:49-50), B (SEQ ID NOs:51-52), C (SEQ ID NOs:53-54)) preferentially target mutant TA.
- the pair of GAG codons near the c-terminus of wild type mRNA (SEQ ID NO:46) are shown in underlined gray and black, with one codon deleted in mutant mRNA.
- FIG. 13 siRNA silencing of TAwt and TAmut in Cos-7 cells.
- A Western blot results showing the effect of different siRNAs on GFP-TAwt expression levels. Robust suppression is achieved with wt-siRNA and com- siRNA, while the mutant-specific siRNAs MutA, (B) and (C) have modest or no effect on GFP-TAwt expression. Tubulin loading controls are also shown.
- B Similar experiments with cells expressing HA-TAmut, showing significant suppression by mutant-specific siRNAs and com-siRNA but no suppression by the wild type-specific siRNA, wt-siRNA.
- C Quantification of results from at least three separate experiments as in A and B.
- FIG. 15 Allele-specific silencing of mutant huntingtin by siRNA.
- PC6-3 cells were co-transfected with plasmids expressing siRNA specific for the polymorphism encoding the transcript for mutant huntingtin.
- FIG. 16 Primer sequences for in vitro generation of siRNA duplexes using T7 polymerase (SEQ ID NOs:l 1-12, 13-14, 63-90). All primers used for T7 synthesis contain the following promoter sequence at their 3' ends: 5'- CTATAGTGAGTCGTATTA-3' (SEQ ID NO:62). The following primer was annealed to all templates to synthesize siRNA duplexes: 5'- TAATACGACTCACTATAG-3' (SEQ ID NO: 10).
- siRNA+G duplexes silence endogenous and reporter genes.
- A Schematic of siRNA synthesis depicting DNA template and structure of synthesized duplexes (SEQ ID NOs: 10 and 62). Blue indicates the RNA product synthesized from the DNA template (upper).
- gray indicates the region with perfect complementarity to the intended target while black depicts the antisense sequence and additional non-complementary nucleotides added by the synthesis method.
- N represents any ribonucleotide.
- B Comparison of GFP silencing by perfectly complementary siRNA versus siRNA ofthe "+G" design. Images depict Cos-7 transfected with a GFP expression construct and the indicated siRNA.
- FIG. 18 Optimization of allele-specific silencing of mutant tau.
- Cos-7 cells were cofransfected with expression constructs encoding mutant (V337M- GFP) and WT (Flag-WT) tau and the indicated siRNAs or shRNA plasmids.
- A Western blot results showing the efficacy of allele-specific silencing when varying the placement ofthe point mutation (G to A) in the siRNA from positions 9-12.
- FIG. 19 Optimization of allele-specific silencing of mutant APP.
- Cos- 7 cells were transfected with expression constructs encoding wild type APP (APP) or mutant (APPsw) and the indicated siRNAs or shRNA plasmids.
- APP wild type APP
- APPsw mutant
- siRNAs or shRNA plasmids shRNA plasmids.
- A Immunofluorescence of Cos-7 cells cofransfected with plasmids encoding APP or APPsw and the indicated siRNA+G. Representative images of fields (63 Ox) reveals that allele specificity is optimal when the double mismatch is placed at the central position (siTlO/Cl 1) ofthe targeted sequence.
- APP proteins are visualized with APP antibody followed by secondary antibody labeled with FITC (green). Nuclei are stained with DAPI (blue).
- Lanes 5-10 show a Western blot of cells transfected as in A, confirming preferential silencing of APPsw with siRNA containing central mismatches.
- Lane 4 is APP or APPsw transfected without siRNA.
- Lane 11 represents untransfected cells showing endogenous APP.
- Also shown in lanes 1-3 is comparable silencing of APP with siRNA or siRNA+G duplexes targeted to APP.
- Tubulin is shown as a loading control.
- C Western blot analysis of Cos-7 cells transfected with APP or APPsw and the indicated shRNA plasmids. tvAPP silences APP whereas tvTlO/Cl 1 selectively suppresses APPsw expression. Endogenous APP in untransfected cells is shown in the last lane. Tubulin loading confrol is also shown.
- RNA Modulation of gene expression by endogenous, noncoding RNAs is increasingly appreciated as a mechanism playing a role in eukaryotic development, maintenance of chromatin structure and genomic integrity
- RNA interference RNA interference
- Molarity Recently, techniques have been developed to trigger RNA interference (RNAi) against specific targets in mammalian cells by introducing exogenously produced or intracellularly expressed siRNAs (Elbashir, 2001; Brummelkamp, 2002). These methods have proven to be quick, inexpensive and effective for knockdown experiments in vitro and in vivo (2 Elbashir, 2001 ; Brummelkamp, 2002; McCaffrey, 2002; Xia, 2002). The ability to accomplish selective gene silencing has led to the hypothesis that siRNAs might be employed to suppress gene expression for therapeutic benefit (Xia, 2002; Jacque, 2002; Gitlin, 2002).
- RNA interference is now established as an important biological strategy for gene silencing, but its application to mammalian cells has been limited by nonspecific inhibitory effects of long double-stranded RNA on translation.
- interfering RNA has largely been limited to administration of RNA molecules. Hence, such administration must be performed repeatedly to have any sustained effect.
- the present inventors have developed a delivery mechanism that results in specific silencing of targeted genes through expression of small interfering RNA (siRNA).
- siRNA small interfering RNA
- the inventors have markedly diminished expression of exogenous and endogenous genes in vitro and in vivo in brain and liver, and further apply this novel strategy to a model system of a major class of neurodegenerative disorders, the polyglutamine diseases, to show reduced polyglutamine aggregation in cells.
- This strategy is generally useful in reducing expression of target genes in order to model biological processes or to provide therapy for dominant human diseases.
- Disclosed herein is a strategy that results in substantial silencing of targeted alleles via siRNA. Use of this strategy results in markedly diminished in vitro and in vivo expression of targeted alleles. This strategy is useful in reducing expression of targeted alleles in order to model biological processes or to provide therapy for human diseases. For example, this strategy can be applied to a major class of neurodegenerative disorders, the polyglutamine diseases, as is demonstrated by the reduction of polyglutamine aggregation in cells following application ofthe strategy.
- substantially silencing means that the mRNA ofthe targeted allele is inhibited and/or degraded by the presence ofthe introduced siRNA, such that expression ofthe targeted allele is reduced by about 10% to 100% as compared to the level of expression seen when the siRNA is not present.
- an allele when substantially silenced, it will have at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 91%, 98%, 99% or even 100% reduction expression as compared to when the siRNA is not present.
- substantially normal activity 04/058940
- Dominantly inherited diseases are ideal candidates for siRNA-based therapy.
- the present inventors employed cellular models to test whether mutant alleles responsible for these dominantly-inherited human disorders could be specifically targeted.
- polyQ polyglutamine
- FTDP-17 frontotemporal dementia with parkinsonism linked to chromosome 17
- Machado- Joseph disease is also known as Spinocerebellar Ataxia Type 3 (The HUGO official name is MJD).
- the gene involved is MJD1, which encodes for the protein ataxin-3 (also called Mjdlp).
- Huntington's disease is due to expansion ofthe CAG repeat motif in exon 1 of huntingtin. In 38% of patients a polymorphism exists in exon 58 of the huntingtin gene, allowing for allele specific targeting.
- Frontotemporal dementia (sometimes with parkinonism, and linked to chromosome 17, so sometimes called FTDP-17) is due to mutations in the MAPT1 gene that encodes the protein tau.
- the inventors also examined amyloid precursor protein (APP) as a target of RNAi.
- APP amyloid precursor protein
- AD Alzheimer's disease
- APP and tau were chosen as candidate RNAi targets because of their central role in inherited and acquired forms of age-related dementia, including Alzheimer's disease (AD) (Hardy et al., 2002; Lee et al., 2001; Mullan et al.,1992; Poorkaj et al., 1998; Hutton et al.,1998).
- AD is characterized by two major pathological hallmarks: senile plaques, which contain beta-amyloid (A ⁇ ) derived from cleavage of APP; and neurofibrillary tangles, which contain filamentous tau protein.
- a ⁇ beta-amyloid
- AD Alzheimer's disease
- siRNA might also have therapeutic value because RNAi-mediated silencing of APP should inhibit A ⁇ deposition.
- Tau the major component of neurofibrillary tangles, likewise plays a significant role in AD pathogenesis (Lee et al., 2001). Mutations in tau cause a similar dominantly inherited neurodegenerative disease, frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP-17). In FTDP-17, tau mutations either alter the tau protein sequence or lead to aberrant splicing ( Lee et al., 2001; Lewis et al., 2001; Oddo et al., 2003). Abnormalities of tau expression also contribute to several other important neurodegenerative disorders, including progressive supranuclear palsy and cortical-basal ganglionic degeneration (Houlden et al., 2001). Thus, efforts to reduce tau expression, either generally or in an allele-specific manner, may prove to be therapeutically useful in FTDP-17, AD or other tau-related diseases.
- the polyQ neurodegenerative disorders include at least nine diseases caused by CAG repeat expansions that encode polyQ in the disease protein.
- PolyQ expansion confers a dominant toxic property on the mutant protein that is associated with aberrant accumulation ofthe disease protein in neurons (Zoghbi, 2000).
- Tau mutations lead to the formation of neurofibrillary tangles accompanied by neuronal dysfunction and degeneration (Poorkaj, 1998; Hutton, 1998).
- the precise mechanisms by which these mutant proteins cause neuronal injury are unknown, but considerable evidence suggests that the abnormal proteins themselves initiate the pathogenic process (Zoghbi, 2000). Accordingly, eliminating expression ofthe mutant protein by siRNA or other means slows or prevents disease (Yamamoto, 2000).
- many dominant disease genes also encode essential proteins (e.g. Nasir, 1995) siRNA- mediated approaches were developed that selectively inactivate mutant alleles, while allowing continued expression ofthe wild type proteins ataxin-3 and huntingtin.
- DYT1 dystonia is also known as Torsion dystonia type 1, and is caused by a GAG deletion in the TORI A gene encoding torsinA.
- DYTl dystonia is the most common cause of primary generalized dystonia. DYTl usually presents in childhood as focal dystonia that progresses to severe generalized disease (Fahn, 1998; Klein, 2002a). With one possible exception (Leung, 2001; Doheny, 2002; Klein, 2002), all cases of DYTl result from a common GAG deletion in TORI A, eliminating one of two adjacent glutamic acids near the C-terminus ofthe protein TorsinA (TA) (Ozelius, 1997).
- mutant TA acts through a dominant-negative or dominant-toxic mechanism (Breakefield, 2001).
- TAmut acts through a dominant-negative or dominant-toxic mechanism.
- DYTl Several characteristics of DYTl make it an ideal disease in which to use siRNA-mediated gene silencing as therapy. Of greatest importance, the dominant nature ofthe disease suggests that a reduction in mutant TA, whatever the precise pathogenic mechanism proves to be, is helpful.
- the existence of a single common mutation that deletes a full three nucleotides suggested it might be feasible to design siRNA that specifically targets the mutant allele and is applicable to all affected persons.
- there is no effective therapy for DYTl a relentless and disabling disease.
- the inventors developed siRNA that would specifically eliminate production of protein from the mutant allele.
- the inventors successfully silenced expression ofthe mutant protein (TAmut) without interfering with expression ofthe wild type protein (TAwt). Because TAwt may be an essential protein it is critically important that efforts be made to silence only the mutant allele.
- This allele-specific strategy has obvious therapeutic potential for DYTl and represents a novel and powerful research tool with which to investigate the function of TA and its dysfunction in the disease state.
- Expansions of poly-glutamine tracts in proteins that are expressed in the central nervous system can cause neurodegenerative diseases.
- Some neurodegenerative diseases are caused by a (CAG) n repeat that encodes polyglutamine in a protein include Huntington disease (HD), spinocerebellar ataxia (SCA1, SCA2, SCA3, SCA6, SCA7), spinal and bulbar muscular atrophy (SBMA), and dentatorubropallidoluysian atrophy (DRPLA).
- HD Huntington disease
- SCA1, SCA2, SCA3, SCA6, SCA7 spinal and bulbar muscular atrophy
- DPLA dentatorubropallidoluysian atrophy
- the poly-glutamine expansion in a protein confers a novel toxic property upon the protein. Studies indicate that the toxic property is a tendency for the disease protein to misfold and form aggregates within neurons.
- the gene involved in Huntington's disease is located at the end of the short arm of chromosome 4. This gene is designated HD and encodes the protein huntingtin (also known as Htt). A mutation occurs in the coding region of this gene and produces an unstable expanded trinucleotide repeat (cytosine-adenosine-guanosine), resulting in a protein with an expanded glutamate sequence. The normal and abnormal functions of this protein (termed huntingtin) are unknown. The abnormal huntingtin protein appears to accumulate in neuronal nuclei of transgenic mice, but the causal relationship of this accumulation to neuronal death is uncertain.
- siRNA specific for other alleles can be selected additional target sites for generating siRNA specific for other alleles beyond those specifically described in the experimental examples.
- Such allele-specific siRNAs made be designed using the guidelines provided by Ambion (Austin, TX). Briefly, the target cDNA sequence is scanned for target sequences that had AA di-nucleotides. Sense and anti-sense oligonucleotides are generated to these targets (AA + 3' adjacent 19 nucleotides) that contained a G/C content of 35 to 55%. These sequences are then compared to others in the human genome database to minimize homology to other known coding sequences (BLAST search), (is this paragraph required?)
- an RNA molecule is constructed containing two complementary strands or a hairpin sequence (such as a 21-bp hairpin) representing sequences directed against the gene of interest.
- the siRNA, or a nucleic acid encoding the siRNA is introduced to the target cell, such as a diseased brain cell.
- the siRNA reduces target mRNA and protein expression.
- the construct encoding the therapeutic siRNA is configured such that the one or more strands ofthe siRNA are encoded by a nucleic acid that is immediately contiguous to a promoter.
- the promoter is a pol II promoter. If a pol II promoter is used in a particular construct, it is selected from readily available pol II promoters known in the art, depending on whether regulatable, inducible, tissue or cell-specific expression ofthe siRNA is desired.
- the construct is introduced into the target cell, such as by injection, allowing for diminished target-gene expression in the cell.
- Pol II promoter would be effective. While small RNAs with extensive secondary structure are routinely made from Pol III promoters, there is no a priori reason to assume that small interfering RNAs could be expressed from pol II promoters. Pol III promoters terminate in a short stretch of Ts (5 or 6), leaving a very small 3' end and allowing stabilization of secondary structure. Polymerase II transcription extends well past the coding and polyadenylation regions, after which the transcript is cleaved. Two adenylation steps occur, leaving a transcript with a tail of up to 200 As. This string of As would of course completely destabilize any small, 21 base pair hairpin.
- the inventors in addition to modifying the promoter to minimize sequences between the transcription start site and the siRNA sequence (thereby stabilizing the hairpin), the inventors also extensively modified the polyadenylation sequence to test if a very short polyadenylation could occur. The results, which were not predicted from prior literature, showed that it could.
- the present invention provides an expression cassette containing an isolated nucleic acid sequence encoding a small interfering RNA molecule (siRNA) targeted against a gene of interest.
- the siRNA may form a hairpin structure that contains a duplex structure and a loop structure.
- the loop structure may contain from 4 to 10 nucleotides, such as 4, 5 or 6 nucleotides.
- the duplex is less than 30 nucleotides in length, such as from 19 to 25 nucleotides.
- the siRNA may further contain an overhang region. Such an overhang may be a 3' overhang region or a 5' overhang region.
- the overhang region may be, for example, from 1 to 6 nucleotides in length.
- the expression cassette may further contain a pol II promoter, as described herein.
- pol II promoters include regulatable promoters and constitutive promoters.
- the promoter may be a CMV or RS V promoter.
- the expression cassette may further contain a polyadenylation signal, such as a synthetic minimal polyadenylation signal.
- the nucleic acid sequence may further contain a marker gene.
- the expression cassette may be contained in a viral vector.
- An appropriate viral vector for use in the present invention may be an adenoviral, lentiviral, adeno- associated viral (AAV), poliovirus, herpes simplex virus (HSV) or murine Maloney-based viral vector.
- the gene of interest may be a gene associated with a condition amenable to siRNA therapy.
- conditions include neurodegenerative diseases, such as a trinucleotide-repeat disease (e.g., polyglutamine repeat disease).
- these diseases include Huntington's disease, several spinocerebellar ataxias, and Alzheimer's disease.
- the gene of interest may encode a ligand for a chemokine involved in the migration of a cancer cell, or a chemokine receptor.
- the present invention also provides an expression cassette containing an isolated nucleic acid sequence encoding a first segment, a second segment located immediately 3' ofthe first segment, and a third segment located immediately 3' ofthe second segment, wherein the first and third segments are each less than 30 base pairs in length and each more than 10 base pairs in length, and wherein the sequence ofthe third segment is the complement ofthe sequence of he first segment, and wherein the isolated nucleic acid sequence functions as a small interfering RNA molecule (siRNA) targeted against a gene of interest.
- the expression cassette may be contained in a vector, such as a viral vector.
- the present invention provides a method of reducing the expression of a gene product in a cell by contacting a cell with an expression cassette described above. It also provides a method of treating a patient by administering to the patient a composition ofthe expression cassette described above.
- the present invention further provides a method of reducing the expression of a gene product in a cell by contacting a cell with an expression cassette containing an isolated nucleic acid sequence encoding a first segment, a second segment located immediately 3' ofthe first segment, and a third segment located immediately 3' ofthe second segment, wherein the first and third segments are each less than 30 base pairs in length and each more than 10 base pairs in length, and wherein the sequence ofthe third segment is the complement ofthe sequence ofthe first segment, and wherein the isolated nucleic acid sequence functions as a small interfering RNA molecule (siRNA) targeted against a gene of interest.
- siRNA small interfering RNA molecule
- the present invention also provides a method of treating a patient, by administering to the patient a composition containing an expression cassette, wherein the expression cassette contains an isolated nucleic acid sequence encoding a first segment, a second segment located immediately 3' ofthe first segment, and a third segment located immediately 3' ofthe second segment, wherein the first and third segments are each less than 30 bases in length and each more than 10 bases in length, and wherein the sequence ofthe third segment is the complement ofthe sequence ofthe first segment, and wherein the isolated nucleic acid sequence functions as a small interfering RNA molecule (siRNA) targeted against a gene of interest.
- siRNA small interfering RNA molecule
- RNAi holds promise as a potential therapy for human diseases. Yet a limitation to successfully developing gene-specific or allele-specific siRNAs is the selection and design of siRNAs with the desired silencing characteristics. Individual siRNAs targeted to different regions of a transcript often display striking differences in efficacy and specificity (Miller et al., 2003; Ding et al., 2003). Typically, several target sites and designs need to be tested before optimal silencing is achieved (Miller et al., 2003). Here the inventors have described a simple method that not only circumvents the time and cost disadvantages of chemically synthesizing siRNA duplexes but also removes the sequence restrictions imposed by in vitro transcription with T7 polymerase.
- siRNA duplex The insertion of a single G mismatch at the 5' ofthe siRNA duplex permitted efficient priming by T7 polymerase without compromising the silencing efficacy ofthe resultant siRNA.
- Such "+G" siRNAs can rapidly be generated to essentially any point in a targeted gene and tested for efficacy.
- This approach to siRNA design facilitates the in vitro generation of effective siRNAs. As demonstrated here for two important disease targets, tau and APP, these in vitro transcribed duplexes can then serve as guides for producing shRNA plasmids that retain silencing capability and allele specificity. This approach represents an improved, stepwise method for optimized silencing of essentially any gene of interest.
- the inventors have also discovered that central placement of mismatches is required for allelic discrimination. Using the present approach to in vitro siRNA production, the inventors systematically tested the effect of placing mismatches at each point along the guide strand of the siRNA. The inventors have found that central placement of mismatches resulted in optimal allele- specific silencing of mutant alleles.
- nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base that is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
- nucleic acid sequence also encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al, (1991); Ohtsuka et al, (1985); Rossolini et al, (1994)).
- a "nucleic acid fragment” is a portion of a given nucleic acid molecule.
- Deoxyribonucleic acid (DNA) in the majority of organisms is the genetic material while ribonucleic acid (RNA) is involved in the transfer of information contained within DNA into proteins.
- nucleotide sequence refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non- natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
- nucleic acid refers to any one of the following abbreviations: “nucleic acid”, “nucleic acid molecule”, “nucleic acid fragment”, “nucleic acid sequence or segment”, or “polynucleotide” are used interchangeably and may also be used interchangeably with gene, cDNA, DNA and RNA encoded by a gene.
- the invention encompasses isolated or substantially purified nucleic acid or protein compositions.
- an "isolated” or “purified” DNA molecule or RNA molecule or an “isolated” or “purified” polypeptide is a DNA molecule, RNA molecule, or polypeptide that exists apart from its native environment and is therefore not a product of nature.
- An isolated DNA molecule, RNA molecule or polypeptide may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell.
- an "isolated” or “purified” nucleic acid molecule or protein, or biologically active portion thereof is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- an "isolated" nucleic acid is free of sequences that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends ofthe nucleic acid) in the genomic DNA ofthe organism from which the nucleic acid is derived.
- the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA ofthe cell from which the nucleic acid is derived.
- a protein that is substantially free of cellular material includes preparations of protein or polypeptide having less than about 30%, 20%, 10%, or 5% (by dry weight) of contaminating protein.
- culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein-of-interest chemicals.
- Fragments and variants ofthe disclosed nucleotide sequences and proteins or partial-length proteins encoded thereby are also encompassed by the present invention.
- fragment or portion is meant a full length or less than full length ofthe nucleotide sequence encoding, or the amino acid sequence of, a polypeptide or protein.
- genes include coding sequences and/or the regulatory sequences required for their expression.
- gene refers to a nucleic acid fragment that expresses mRNA, functional RNA, or specific protein, including regulatory sequences.
- Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins.
- Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
- An “allele” is one of several alternative forms of a gene occupying a given locus on a chromosome.
- Naturally occurring is used to describe an object that can be found in nature as distinct from being artificially produced.
- a protein or nucleotide sequence present in an organism including a virus, which can be isolated from a source in nature and which has not been intentionally modified by a person in the laboratory, is naturally occurring.
- chimeric refers to a gene or DNA that contains 1) DNA sequences, including regulatory and coding sequences, that are not found together in nature, or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may include regulatory sequences and coding sequences that are derived from different sources, or include regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
- transgene refers to a gene that has been introduced into the genome by transformation.
- Transgenes include, for example, DNA that is either heterologous or homologous to the DNA of a particular cell to be transformed. Additionally, transgenes may include native genes inserted into a non-native organism, or chimeric genes.
- endogenous gene refers to a native gene in its natural location in the genome of an organism. 04/058940
- a “foreign” gene refers to a gene not normally found in the host organism that has been introduced by gene transfer.
- variants of a molecule is a sequence that is substantially similar to the sequence ofthe native molecule.
- variants include those sequences that, because ofthe degeneracy ofthe genetic code, encode the identical amino acid sequence ofthe native protein.
- Naturally occurring allelic variants such as these can be identified with the use of molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques.
- Variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis, which encode the native protein, as well as those that encode a polypeptide having amino acid substitutions.
- nucleotide sequence variants ofthe invention will have at least 40%, 50%, 60%, to 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98%, sequence identity to the native (endogenous) nucleotide sequence.
- Constantly modified variations" of a particular nucleic acid sequence refers to those nucleic acid sequences that encode identical or essentially identical amino acid sequences.
- nucleic acid variations are "silent variations," which are one species of “conservatively modified variations.” Every nucleic acid sequence described herein that encodes a polypeptide also describes every possible silent variation, except where otherwise noted.
- each codon in a nucleic acid can be modified to yield a functionally identical molecule by standard techniques. Accordingly, each "silent variation" of a nucleic acid that encodes a polypeptide is implicit in each described sequence.
- Recombinant DNA molecule is a combination of DNA sequences that are joined together using recombinant DNA technology and procedures used to join together DNA sequences as described, for example, in Sambrook and Russell (2001).
- heterologous gene each refer to a sequence that either originates from a source foreign to the particular host cell, or is from the same source but is modified from its original or native form.
- a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of DNA shuffling.
- the terms also include non-naturally occurring multiple copies of a naturally occurring DNA or RNA sequence.
- the terms refer to a DNA or RNA segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.
- a "homologous" DNA or RNA sequence is a sequence that is naturally associated with a host cell into which it is introduced.
- Wild-type refers to the normal gene or organism found in nature.
- Gene refers to the complete genetic material of an organism.
- a "vector” is defined to include, inter alia, any viral vector, as well as any plasmid, cosmid, phage or binary vector in double or single sfranded linear or circular form that may or may not be self transmissible or mobilizable, and that can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g., autonomous replicating plasmid with an origin of replication).
- “Expression cassette” as used herein means a nucleic acid sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, which may include a promoter operably linked to the nucleotide sequence of interest that may be operably linked to termination signals. It also may include sequences required for proper translation ofthe nucleotide sequence.
- the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example an antisense RNA, a nonfranslated RNA in the sense or antisense direction, or a siRNA.
- the expression cassette including the nucleotide sequence of interest may be chimeric.
- the expression cassette may also be one that is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
- the expression ofthe nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an regulatable promoter that initiates transcription only when the host cell is exposed to some particular stimulus.
- the promoter can also be specific to a particular tissue or organ or stage of development.
- Such expression cassettes can include a transcriptional initiation region linked to a nucleotide sequence of interest.
- Such an expression cassette is provided with a plurality of restriction sites for insertion ofthe gene of interest to be under the transcriptional regulation ofthe regulatory regions.
- the expression cassette may additionally contain selectable marker genes.
- Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA, or it may include one or more infrons bounded by appropriate splice junctions.
- An "infron” is a sequence of RNA that is contained in the primary transcript but is removed through cleavage and re-ligation ofthe RNA within the cell to create the mature mRNA that can be translated into a protein.
- the term “open reading frame” (ORF) refers to the sequence between translation initiation and termination codons of a coding sequence.
- initiation codon and “termination codon” refer to a unit of three adjacent nucleotides (a 'codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
- mRNA translation mRNA translation
- “Functional RNA” refers to sense RNA, antisense RNA, ribozyme RNA, siRNA, or other RNA that may not be translated but yet has an effect on at least one cellular process.
- RNA transcript refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence.
- the primary transcript When the RNA transcript is a perfect complementary copy ofthe DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing ofthe primary transcript and is referred to as the mature RNA.
- Messenger RNA (mRNA) refers to the RNA that is without infrons and that can be translated into protein by the cell.
- cDNA refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA.
- Regulatory sequences each refer to nucleotide sequences located upsfream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation ofthe associated coding sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, infrons, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences that may be a combination of synthetic and natural sequences. As is noted above, the term “suitable regulatory sequences” is not limited to promoters. However, some suitable regulatory sequences useful in the present invention will include, but are not limited to constitutive promoters, tissue-specific promoters, development-specific promoters, regulatable promoters and viral promoters.
- promoters examples include CMV, RSV, polll and polIII promoters.
- 5' non-coding sequence refers to a nucleotide sequence located 5' (upsfream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency (Turner et al, 1995).
- 3' non-coding sequence refers to nucleotide sequences located 3' (downstream) to a coding sequence and may include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
- translation leader sequence refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5') ofthe translation start codon.
- the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
- mature protein refers to a post-translationally processed polypeptide without its signal peptide.
- Precursor protein refers to the primary product of translation of an mRNA.
- Signal peptide refers to the amino terminal extension of a polypeptide, which is translated in conjunction with the polypeptide forming a precursor peptide and which is required for its enfrance into the secretory pathway.
- signal sequence refers to a nucleotide sequence that encodes the signal peptide.
- Promoter refers to a nucleotide sequence, usually upsfream (5') to its coding sequence, which directs and/or controls the expression ofthe coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
- Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA- box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for confrol of expression.
- Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA.
- promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
- an “enhancer” is a DNA sequence that can stimulate promoter activity and may be an innate element ofthe promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upsfream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects.
- Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments.
- a promoter may also contain DNA sequences that are involved in the binding of protein 04/058940
- the "initiation site” is the position surrounding the first nucleotide that is part ofthe transcribed sequence, which is also defined as position +1. With respect to this site all other sequences ofthe gene and its controlling regions are numbered. Downstream sequences (i.e., further protein encoding sequences in the 3' direction) are denominated positive, while upsfream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.
- Promoter elements particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters.”
- the minimal promoter functions to permit transcription.
- a “minimal or core promoter” thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and/or an initiator.
- Constutive expression refers to expression using a constitutive or regulated promoter.
- Consditional and “regulated expression” refer to expression controlled by a regulated promoter.
- “Operably-linked” refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one ofthe sequences is affected by another.
- a regulatory DNA sequence is said to be “operably linked to” or “associated with” a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression ofthe coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control ofthe promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
- “Expression” refers to the transcription and/or translation of an endogenous gene, heterologous gene or nucleic acid segment, or a transgene in cells.
- expression may refer to the transcription ofthe siRNA only.
- expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA.
- Expression may also refer to the production of protein.
- altered levels refers to the level of expression in transgenic cells or organisms that differs from that of normal or unfransformed cells or organisms.
- “Overexpression” refers to the level of expression in transgenic cells or organisms that exceeds levels of expression in normal or unfransformed cells or organisms.
- Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of protein from an endogenous gene or a transgene.
- Transcription stop fragment refers to nucleotide sequences that contain one or more regulatory signals, such as polyadenylation signal sequences, capable of terminating transcription. Examples include the 3' non-regulatory regions of genes encoding nopaline synthase and the small subunit of ribulose bisphosphate carboxylase.
- Translation stop fragment refers to nucleotide sequences that contain one or more regulatory signals, such as one or more termination codons in all three frames, capable of terminating translation. Insertion of a translation stop fragment adjacent to or near the initiation codon at the 5' end ofthe coding sequence will result in no translation or improper translation. Excision ofthe translation stop fragment by site-specific recombination will leave a site-specific sequence in the coding sequence that does not interfere with proper translation using the initiation codon.
- cz ' s-acting sequence and "czs-acting element” refer to DNA or RNA sequences whose functions require them to be on the same molecule.
- An example of a cz's-acting sequence on the replicon is the viral replication origin.
- tr ⁇ ns-acting sequence and “tr ⁇ ns-acting element” refer to DNA or RNA sequences whose function does not require them to be on the same molecule.
- Chrosomally-integrated refers to the integration of a foreign gene or nucleic acid construct into the host DNA by covalent bonds. Where genes are not “chromosomally integrated” they may be “transiently expressed.” Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
- sequence relationships between two or more nucleic acids or polynucleotides are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence”, (b) “comparison window”, (c) “sequence identity”, (d) “percentage of sequence identity”, and (e) “substantial identity”.
- reference sequence is a defined sequence used as a basis for sequence comparison.
- a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full-length cDNA or gene sequence, or the complete cDNA or gene sequence.
- comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment ofthe two sequences.
- the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer.
- Computer implementations of these mathematical algorithms can be utilized for comparison of sequences to determine sequence identity. Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Sof ware Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.
- the CLUSTAL program is well described by Higgins et al. (1988); Higgins et al. (1989); Corpet et al. (1988); Huang et al. (1992); and Pearson et al. (1994).
- the ALIGN program is based on the algorithm of Myers and Miller, supra.
- the BLAST programs of Altschul et al. (1990), are based on the algorithm of Karlin and Altschul supra.
- HSPs high scoring sequence pairs
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0).
- M forward score for a pair of matching residues
- N penalty score for mismatching residues; always ⁇ 0.
- a scoring matrix is used to calculate the cumulative score. Extension ofthe word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis ofthe similarity between two sequences.
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication ofthe probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison ofthe test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
- Gapped BLAST in BLAST 2.0 can be utilized as described in Altschul et al. (1997).
- PSI-BLAST in BLAST 2.0
- PSI-BLAST can be used to perform an iterated search that detects distant relationships between molecules. See Altschul et al, supra.
- the default parameters ofthe respective programs e.g. BLASTN for nucleotide sequences, BLASTX for proteins
- the BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix. See http://www.ncbi.nlm.nih.gov. Alignment may also be performed manually by inspection.
- comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program.
- equivalent program any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
- sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to a specified percentage of residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window, as measured by sequence comparison algorithms or by visual inspection.
- percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties ofthe molecule.
- sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature ofthe substitution.
- Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity.” Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
- percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion ofthe polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment ofthe two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
- polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, and most preferably at least 95%, 96%, 97%, 98%, or 99% sequence identity, compared to a reference sequence using one ofthe alignment programs described using standard parameters.
- nucleotide sequences can be appropriately adjusted to determine corresponding identity of proteins encoded by two nucleotide sequences by taking into account codon degeneracy, amino acid similarity, reading frame positioning, and the like.
- Substantial identity of amino acid sequences for these purposes normally means sequence identity of at least 70%, more preferably at least 80%, 90%, and most preferably at least 95%.
- stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
- stringent conditions encompass temperatures in the range of about 1°C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein.
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
- One indication that two nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
- substantially identical in the context of a peptide indicates that a peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, or 79%, preferably 80%, 81 %, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%, 92%, 93%, or 94%, or even more preferably, 95%, 96%, 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window.
- optimal alignment is conducted using the homology alignment algorithm of Needleman and Wunsch (1970).
- a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
- sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated.
- sequence comparison algorithm calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
- Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency ofthe hybridization media to achieve the desired detection ofthe target nucleic acid sequence.
- Stringent hybridization conditions and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as
- T m is the temperature (under defined ionic strength and pH) at which 50% ofthe target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post- hybridization washes, the critical factors being the ionic strength and temperature ofthe final wash solution.
- T m can be approximated from the equation of Meinkoth and Wahl (1984); T m 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length ofthe hybrid in base pairs.
- T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences ofthe desired identity.
- the T m can be decreased 10°C.
- stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- T m thermal melting point
- hybridization and/or wash conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point (T m ); moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (T m ); low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (T m ).
- T m thermal melting point
- moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point (T m )
- low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point (T m ).
- a high stringency wash is preceded by a low stringency wash to remove background probe signal.
- An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides, is IX SSC at 45°C for 15 minutes.
- An example low stringency wash for a duplex of, e.g., more than 100 nucleotides, is 4-6X SSC at 40°C for 15 minutes.
- stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C and at least about 60°C for long probes (e.g., >50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical. This occurs, e.g., 04/058940
- Very stringent conditions are selected to be equal to the T m for a particular probe.
- An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0.1X SSC at 60 to 65°C.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
- variant polypeptide is intended a polypeptide derived from the native protein by deletion (also called “truncation") or addition of one or more amino acids to the N-terminal and/or C-terminal end ofthe native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein.
- variants may results from, for example, genetic polymorphism or from human manipulation. Methods for such manipulations are generally known in the art.
- polypeptides ofthe invention may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art.
- amino acid sequence variants ofthe polypeptides can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel (1985); Kunkel et al. (1987); U. S. Patent No. 4,873,192; Walker and Gaastra (1983), and the references cited therein.
- Guidance as to appropriate amino acid substitutions that do not affect biological activity ofthe protein of interest may be found in the model of Dayhoff et al. (1978).
- the genes and nucleotide sequences ofthe invention include both the naturally occurring sequences as well as variant forms.
- the polypeptides ofthe invention encompass both naturally occurring proteins as well as variations and modified forms thereof. Such variants will continue to possess the desired activity.
- the deletions, insertions, and substitutions ofthe polypeptide sequence encompassed herein are not expected to produce radical changes in the characteristics ofthe polypeptide. However, when it is difficult to predict the exact effect ofthe substitution, deletion, or insertion in advance of doing so, one skilled in the art will appreciate that the effect will be evaluated by routine screening assays.
- transformation refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance.
- a "host cell” is a cell that has been transformed, or is capable of transformation, by an exogenous nucleic acid molecule.
- Host cells containing the transformed nucleic acid fragments are referred to as “fransgenic” cells, and organisms comprising fransgenic cells are referred to as “transgenic organisms”.
- Transformed”, “transduced”, “fransgenic”, and “recombinant” refer to a host cell or organism into which a heterologous nucleic acid molecule has been introduced.
- the nucleic acid molecule can be stably integrated into the genome generally known in the art and are disclosed in Sambrook and Russell, infra. See also Innis et al. (1995); and Gelfand (1995); and Innis and Gelfand (1999).
- Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene- specific primers, vector-specific primers, partially mismatched primers, and the like.
- “transformed,” “transformant,” and “transgenic” cells have been through the transformation process and contain a foreign gene integrated into their chromosome.
- the term “unfransformed” refers to normal cells that have not been through the transformation process.
- a "transgenic" organism is an organism having one or more cells that contain an expression vector.
- Genetically altered cells denotes cells which have been modified by the introduction of recombinant or heterologous nucleic acids (e.g., one or more DNA constructs or their RNA counterparts) and further includes the progeny of such cells which retain part or all of such genetic modification.
- recombinant or heterologous nucleic acids e.g., one or more DNA constructs or their RNA counterparts
- fusion protein is intended to describe at least two polypeptides, typically from different sources, which are operably linked.
- operably linked is intended to mean that the two polypeptides are connected in a manner such that each polypeptide can serve its intended function.
- the two polypeptides are covalently attached through peptide bonds.
- the fusion protein is preferably produced by standard recombinant DNA techniques. For example, a DNA molecule encoding the first polypeptide is ligated to another DNA molecule encoding the second polypeptide, and the resultant hybrid DNA molecule is expressed in a host cell to produce the fusion protein.
- the DNA molecules are ligated to each other in a 5' to 3' orientation such that, after ligation, the translational frame ofthe encoded polypeptides is not altered (i.e., the DNA molecules are ligated to each other in- frame).
- the term "derived” or “directed to” with respect to a nucleotide molecule means that the molecule has complementary sequence identity to a particular molecule of interest.
- “Gene silencing” refers to the suppression of gene expression, e.g., transgene, heterologous gene and/or endogenous gene expression. Gene silencing may be mediated through processes that affect transcription and/or through processes that affect post-franscriptional mechanisms.
- gene silencing occurs when siRNA initiates the degradation ofthe mRNA of a gene of interest in a sequence-specific manner via RNA interference (for a review, see Brantl, 2002).
- gene silencing may be allele-specific.
- Allele-specific gene silencing refers to the specific silencing of one allele of a gene.
- Knock-down “knock-down technology” refers to a technique of gene silencing in which the expression of a target gene is reduced as compared to the gene expression prior to the introduction ofthe siRNA, which can lead to the inhibition of production ofthe target gene product.
- the term “reduced” is used herein to indicate that the target gene expression is lowered by 1-100%.
- RNA interference which can involve the use of siRNA, has been successfully applied to knockdown the expression of specific genes in plants, D. melanogaster, C. elegans, trypanosomes, planaria, hydra, and several vertebrate species including the mouse.
- RNAi RNA interference
- the mechanisms proposed to mediate RNAi please refer to Bass et al, 2001, Elbashir et al, 2001 or Brantl 2002.
- RNA interference is the process of sequence-specific, post-franscriptional gene silencing initiated by siRNA. RNAi is seen in a number of organisms such as Drosophila, nematodes, fungi and plants, and is believed to be involved in anti-viral defense, modulation of transposon activity, and regulation of gene expression. During RNAi, siRNA induces degradation of target mRNA with consequent sequence-specific inhibition of gene expression.
- a "small interfering” or “short interfering RNA” or siRNA is a RNA duplex of nucleotides that is targeted to a gene interest. A “RNA duplex” refers to the structure formed by the complementary pairing between two regions of a RNA molecule.
- siRNA is "targeted" to a gene in that the nucleotide sequence of the duplex portion ofthe siRNA is complementary to a nucleotide sequence of the targeted gene.
- the length ofthe duplex of siRNAs is less than 30 nucleotides.
- the duplex can be 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11 or 10 nucleotides in length.
- the length ofthe duplex is 19 - 25 nucleotides in length.
- the RNA duplex portion ofthe siRNA can be part of a hairpin structure.
- the hairpin structure may contain a loop portion positioned between the two sequences that form the duplex. The loop can vary in length.
- the loop is 5, 6, 7, 8, 9, 10, 11, 12 or 13 nucleotides in length.
- the hairpin structure can also contain 3 ' or 5' overhang portions, hi some embodiments, the overhang is a 3' or a 5' overhang 0, 1, 2, 3, 4 or 5 nucleotides in length.
- the siRNA can be encoded by a nucleic acid sequence, and the nucleic acid sequence can also include a promoter.
- the nucleic acid sequence can also include a polyadenylation signal.
- the polyadenylation signal is a synthetic minimal polyadenylation signal.
- Treating refers to ameliorating at least one symptom of, curing and/or preventing the development of a disease or a condition.
- Neurological disease and “neurological disorder” refer to both hereditary and sporadic conditions that are characterized by nervous system dysfunction, and which may be associated with afrophy ofthe affected central or peripheral nervous system structures, or loss of function without afrophy.
- a neurological disease or disorder that results in afrophy is commonly called a “neurodegenerative disease” or “neurodegenerative disorder.”
- Neurodegenerative diseases and disorders include, but are not limited to, amyotrophic lateral sclerosis (ALS), hereditary spastic hemiplegia, primary lateral sclerosis, spinal muscular atrophy, Kennedy's disease, Alzheimer's disease, Parkinson's disease, multiple sclerosis, and repeat expansion neurodegenerative diseases, e.g., diseases associated with expansions of trinucleotide repeats such as polyglutamine (polyQ) repeat diseases, e.g., Huntington's disease (HD), spinocerebellar ataxia (SCAl, SCA2, SCA3, SCA6, SCA7, and SCAl 7), spinal and bulbar muscular atrophy (SBMA), dentatorubropallidoluysian atrophy (DRPLA).
- An example of a neurological disorder that does not appear to result in atrophy is DYTl dystonia.
- Sources of nucleotide sequences from which the present nucleic acid molecules can be obtained include any vertebrate, preferably mammalian, cellular source.
- isolated and/or purified refer to in vitro isolation of a nucleic acid, e.g., a DNA or RNA molecule from its natural cellular environment, and from association with other components ofthe cell, such as nucleic acid or polypeptide, so that it can be sequenced, replicated, and/or expressed.
- isolated nucleic acid may be a DNA molecule containing less than 31 sequential nucleotides that is transcribed into an siRNA.
- Such an isolated siRNA may, for example, form a hairpin structure with a duplex 21 base pairs in length that is complementary or hybridizes to a sequence in a gene of interest, and remains stably bound under stringent conditions (as defined by methods well known in the art, e.g., in Sambrook and Russell, 2001).
- the RNA or DNA is "isolated” in that it is free from at least one contaminating nucleic acid with which it is normally associated in the natural source ofthe RNA or DNA and is preferably substantially free of any other mammalian RNA or DNA.
- the phrase "free from at least one contaminating source nucleic acid with which it is normally associated" includes the case where the nucleic acid is reintroduced into the source or natural cell but is in a different chromosomal location or is otherwise flanked by nucleic acid sequences not normally found in the source cell, e.g., in a vector or plasmid.
- the nucleic acid molecules ofthe invention include double-stranded interfering RNA molecules, which are also useful to inhibit expression of a target gene.
- recombinant nucleic acid e.g., “recombinant DNA sequence or segment” refers to a nucleic acid, e.g., to DNA, that has been derived or isolated from any appropriate cellular source, that may be subsequently chemically altered in vitro, so that its sequence is not naturally occurring, or corresponds to naturally occurring sequences that are not positioned as they would be positioned in a genome which has not been transformed with exogenous DNA.
- An example of preselected DNA "derived” from a source would be a DNA sequence that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form.
- DNA "isolated" from a source would be a useful DNA sequence that is excised or removed from said source by chemical means, e.g. , by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.
- recovery or isolation of a given fragment of DNA from a restriction digest can employ separation ofthe digest on polyacrylamide or agarose gel by electrophoresis, identification of the fragment of interest by comparison of its mobility versus that of marker DNA fragments of known molecular weight, removal ofthe gel section containing the desired fragment, and separation ofthe gel from DNA.
- "recombinant DNA” includes completely synthetic DNA sequences, semi-synthetic DNA sequences, DNA sequences isolated from biological sources, and DNA sequences derived from RNA, as well as mixtures thereof.
- Nucleic acid molecules having base substitutions are prepared by a variety of methods known in the art. These methods include, but are not limited to, isolation from a natural source (in the case of naturally occurring sequence variants) or preparation by oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non- variant version ofthe nucleic acid molecule. Oligonucleotide-mediated mutagenesis is a method for preparing substitution variants. This technique is known in the art as described by
- nucleic acid encoding a siRNA can be altered by hybridizing an oligonucleotide encoding the desired mutation to a DNA template, where the template is the single-stranded form of a plasmid or bacteriophage containing the unaltered or native gene sequence. After hybridization, a DNA polymerase is used to synthesize an entire second complementary strand ofthe template that will thus incorporate the oligonucleotide primer, and will code for the selected alteration in the nucleic acid encoding siRNA. Generally, oligonucleotides of at least 25 nucleotides in length are used.
- An optimal oligonucleotide will have 12 to 15 nucleotides that are completely complementary to the template on either side ofthe nucleotide(s) coding for the mutation. This ensures that the oligonucleotide will hybridize properly to the single-stranded DNA template molecule.
- the oligonucleotides are readily synthesized using techniques known in the art such as that described by Crea e ⁇ /. (1978).
- the DNA template can be generated by those vectors that are either derived from bacteriophage Ml 3 vectors (the commercially available M13mpl8 and M13mpl9 vectors are suitable), or those vectors that contain a single-stranded phage origin of replication as described by Viera et al. (1987). Thus, the DNA that is to be mutated may be inserted into one of these vectors to generate single-sfranded template. Production ofthe single-sfranded template is described in Chapter 3 of Sambrook and Russell, 2001. Alternatively, single-sfranded DNA template may be generated by denaturing double-stranded plasmid (or other) DNA using standard techniques.
- the oligonucleotide is hybridized to the single-stranded template under suitable hybridization conditions.
- a DNA polymerizing enzyme usually the Klenow fragment of DNA polymerase I, is then added to synthesize the complementary sfrand ofthe template using the oligonucleotide as a primer for synthesis.
- a heteroduplex molecule is thus formed such that one strand of DNA encodes the mutated form ofthe DNA, and the other strand (the original template) encodes the native, unaltered sequence of the DNA.
- This heteroduplex molecule is then transformed into a suitable host cell, usually a prokaryote such as E. coli JMl 01.
- the cells are grown, they are plated onto agarose plates and screened using the oligonucleotide primer radiolabeled with 32-phosphate to identify the bacterial colonies that contain the mutated DNA.
- the mutated region is then removed and placed in an appropriate vector, generally an expression vector ofthe type typically employed for transformation of an appropriate host.
- the method described immediately above may be modified such that a homoduplex molecule is created wherein both strands ofthe plasmid contain the mutations(s).
- the modifications are as follows:
- the single-stranded oligonucleotide is annealed to the single-sfranded template as described above.
- a mixture of three deoxyribonucleotides, deoxyriboadenosine (dATP), deoxyriboguanosine (dGTP), and deoxyribothymidine (dTTP) is combined with a modified thiodeoxyribocytosine called dCTP-(*S) (which can be obtained from the Amersham Corporation). This mixture is added to the template-oligonucleotide complex.
- this new sfrand of DNA will contain dCTP-(*S) instead of dCTP, which serves to protect it from restriction endonuclease digestion.
- the template sfrand ofthe double-stranded heteroduplex is nicked with an appropriate restriction enzyme
- the template strand can be digested with ExoIII nuclease or another appropriate nuclease past the region that contains the site(s) to be mutagenized.
- the reaction is then stopped to leave a molecule that is only partially single-sfranded.
- a complete double-sfranded DNA homoduplex is then formed using DNA polymerase in the presence of all four deoxyribonucleotide triphosphates, ATP, and DNA ligase. This homoduplex molecule can then be transformed into a suitable host cell such as E. coli JM101.
- the recombinant DNA sequence or segment may be circular or linear, double-sfranded or single-sfranded.
- the DNA sequence or segment is in the form of chimeric DNA, such as plasmid DNA or a vector that can also contain coding regions flanked by confrol sequences that promote the expression ofthe recombinant DNA present in the resultant transformed cell.
- a "chimeric" vector or expression cassette means a vector or cassette including nucleic acid sequences from at least two different species, or has a nucleic acid sequence from the same species that is linked or associated in a manner that does not occur in the "native" or wild type ofthe species.
- the recombinant DNA may have a promoter that is active in mammalian cells.
- Other elements functional in the host cells such as infrons, enhancers, polyadenylation sequences and the like, may also be a part ofthe recombinant DNA. Such elements may or may not be necessary for the function ofthe DNA, but may provide improved expression ofthe DNA by affecting transcription, stability ofthe siRNA, or the like. Such elements may be included in the DNA as desired to obtain the optimal performance ofthe siRNA in the cell.
- Confrol sequences are DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
- the control sequences that are suitable for prokaryotic cells include a promoter, and optionally an operator sequence, and a ribosome binding site.
- Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
- Operably linked nucleic acids are nucleic acids placed in a functional relationship with another nucleic acid sequence. For example, a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
- operably linked DNA sequences are DNA sequences that are linked are contiguous. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites do not exist, the synthetic oligonucleotide adaptors or linkers are used in accord with conventional practice.
- the recombinant DNA to be introduced into the cells may contain either a selectable marker gene or a reporter gene or both to facilitate identification and selection of expressing cells from the population of cells sought to be transfected or infected through viral vectors.
- the selectable marker may be carried on a separate piece of DNA and used in a co-transfection procedure. Both selectable markers and reporter genes may be flanked with appropriate regulatory sequences to enable expression in the host cells.
- reporter genes are used for identifying potentially transfected cells and for evaluating the functionality of regulatory sequences. Reporter genes that encode for easily assayable proteins are well known in the art.
- a reporter gene is a gene that is not present in or expressed by the recipient organism or tissue and that encodes a protein whose expression is manifested by some easily detectable property, e.g., enzymatic activity.
- reporter genes include the chloramphenicol acetyl transfer ase gene (cat) from Tn9 of E. coli and the luciferase gene from firefly Photinus pyralis. Expression ofthe reporter gene is assayed at a suitable time after the DNA has been introduced into the recipient cells.
- the recombinant DNA can be readily introduced into the host cells, e.g., mammalian, bacterial, yeast or insect cells by transfection with an expression vector composed of DNA encoding the siRNA by any procedure useful for the introduction into a particular cell, e.g., physical or biological methods, to yield a cell having the recombinant DNA stably integrated into its genome or existing as a episomal element, so that the DNA molecules, or sequences ofthe present invention are expressed by the host cell.
- the DNA is introduced into host cells via a vector.
- the host cell is preferably of eukaryotic origin, e.g., plant, mammalian, insect, yeast or fungal sources, but host cells of non- eukaryotic origin may also be employed.
- Physical methods to introduce a preselected DNA into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, and the like.
- Biological methods to introduce the DNA of interest into a host cell include the use of DNA and RNA viral vectors.
- DNA and RNA viral vectors For mammalian gene therapy, as described hereinbelow, it is desirable to use an efficient means of inserting a copy gene into the host genome.
- Viral vectors, and especially retroviral vectors have become the most widely used method for inserting genes into mammalian, e.g., human cells.
- Other viral vectors can be derived from poxviruses, herpes simplex virus I, adenoviruses and adeno-associated viruses, and the like. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.
- a "transfected", “or “transduced” host cell or cell line is one in which the genome has been altered or augmented by the presence of at least one heterologous or recombinant nucleic acid sequence.
- the host cells ofthe present invention are typically produced by transfection with a DNA sequence in a plasmid expression vector, a viral expression vector, or as an isolated linear DNA sequence.
- the fransfected DNA can become a chromosomally integrated recombinant DNA sequence, which is composed of sequence encoding the siRNA.
- assays include, for example, "molecular biological” assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR; "biochemical” assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope ofthe invention.
- molecular biological assays well known to those of skill in the art, such as Southern and Northern blotting, RT-PCR and PCR
- biochemical assays, such as detecting the presence or absence of a particular peptide, e.g., by immunological means (ELISAs and Western blots) or by assays described herein to identify agents falling within the scope ofthe invention.
- RNA produced from introduced recombinant DNA segments may be employed.
- PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA.
- PCR techniques while useful, will not demonstrate integrity ofthe RNA product.
- Further information about the nature of the RNA product may be obtained by Northern blotting. This technique demonstrates the presence of an RNA species and gives information about the integrity of that RNA. The presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and only demonstrate the presence or absence of an RNA species.
- Southern blotting and PCR may be used to detect the recombinant DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed. Expression may be evaluated by specifically identifying the peptide products ofthe introduced recombinant DNA sequences or evaluating the phenotypic changes brought about by the expression ofthe introduced recombinant DNA segment in the host cell.
- the instant invention provides a cell expression system for expressing exogenous nucleic acid material in a mammalian recipient.
- the expression system also referred to as a "genetically modified cell" comprises a cell and an expression vector for expressing the exogenous nucleic acid material.
- the genetically modified cells are suitable for administration to a mammalian recipient, where they replace the endogenous cells ofthe recipient.
- the preferred genetically modified cells are non-immortalized and are non- tumorigenic.
- the cells are transfected or otherwise genetically modified ex vivo.
- the cells are isolated from a mammal (preferably a human), nucleic acid introduced (i.e., transduced or transfected in vitro) with a vector for expressing a heterologous (e.g., recombinant) gene encoding the therapeutic agent, and then administered to a mammalian recipient for delivery ofthe therapeutic agent in situ.
- the mammalian recipient may be a human and the cells to be modified are autologous cells, i.e., the cells are isolated from the mammalian recipient.
- the cells are transfected or transduced or otherwise genetically modified in vivo.
- the cells from the mammalian recipient are transduced or transfected in vivo with a vector containing exogenous nucleic acid material for expressing a heterologous (e.g., recombinant) gene encoding a therapeutic agent and the therapeutic agent is delivered in situ.
- a heterologous (e.g., recombinant) gene encoding a therapeutic agent and the therapeutic agent is delivered in situ.
- exogenous nucleic acid material refers to a nucleic acid or an oligonucleotide, either natural or synthetic, which is not naturally found in the cells; or if it is naturally found in the cells, is modified from its original or native form.
- exogenous nucleic acid material includes, for example, a non-naturally occurring nucleic acid that can be transcribed into an anti-sense RNA, a siRNA, as well as a "heterologous gene” (i.e., a gene encoding a protein that is not expressed or is expressed at biologically insignificant levels in a naturally-occurring cell ofthe same type).
- exogenous nucleic acid material a synthetic or natural gene encoding human erythropoietin (EPO) would be considered "exogenous nucleic acid material" with respect to human peritoneal mesothelial cells since the latter cells do not naturally express EPO.
- exogenous nucleic acid material is the introduction of only part of a gene to create a recombinant gene, such as combining an regulatable promoter with an endogenous coding sequence via homologous recombination.
- an expression cassette ofthe invention contains, inter alia, a promoter.
- promoters include the CMV promoter, as well as the RS V promoter, S V40 late promoter and retroviral LTRs (long terminal repeat elements), or brain cell specific promoters, although many other promoter elements well known to the art, such as tissue specific promoters or regulatable promoters may be employed in the practice ofthe invention.
- an expression cassette may contain a pol II promoter that is operably linked to a nucleic acid sequence encoding a siRNA.
- the pol II promoter i.e., a RNA polymerase II dependent promoter, initiates the franscription ofthe siRNA.
- the pol II promoter is regulatable.
- Three RNA polymerases transcribe nuclear genes in eukaryotes. RNA polymerase II (pol II) synthesizes mRNA, i.e., pol II transcribes the genes that encode proteins.
- RNA polymerase I (pol I) and RNA polymerase III (pol III) transcribe only a limited set of transcripts, synthesizing RNAs that have structural or catalytic roles.
- RNA polymerase I makes the large ribosomal RNAs (rRNA), which are under the control of pol I promoters.
- RNA polymerase III makes a variety of small, stable RNAs, including the small 5S rRNA and transfer RNAs (tRNA), the transcription of which is under the control of pol III promoters.
- pol II promoters are useful to direct franscription ofthe siRNA. This was surprising because, as discussed above, pol II promoters are thought to be responsible for transcription of messenger RNA, i.e., relatively long RNAs as compared to RNAs of 30 bases or less. 04/058940
- a pol II promoter may be used in its entirety, or a portion or fragment of the promoter sequence may be used in which the portion maintains the promoter activity.
- pol II promoters are known to a skilled person in the art and include the promoter of any protein-encoding gene, e.g., an endogenously regulated gene or a constitutively expressed gene.
- the promoters of genes regulated by cellular physiological events e.g., heat shock, oxygen levels and/or carbon monoxide levels, e.g., in hypoxia, may be used in the expression cassettes ofthe invention.
- the promoter of any gene regulated by the presence of a pharmacological agent, e.g., tetracycline and derivatives thereof, as well as heavy metal ions and hormones may be employed in the expression cassettes ofthe invention.
- the pol II promoter can be the CMV promoter or the RS V promoter. In another embodiment, the pol II promoter is the CMV promoter.
- a pol II promoter ofthe invention may be one naturally associated with an endogenously regulated gene or sequence, as may be obtained by isolating the 5' non-coding sequences located upsfream ofthe coding segment and/or exon.
- the pol II promoter ofthe expression cassette can be, for example, the same pol II promoter driving expression ofthe targeted gene of interest.
- the nucleic acid sequence encoding the siRNA may be placed under the control of a recombinant or heterologous pol II promoter, which refers to a promoter that is not normally associated with the targeted gene's natural environment.
- Such promoters include promoters isolated from any eukaryotic cell, and promoters not "naturally occurring," i.e., containing different elements of different transcriptional regulatory regions, and/or mutations that alter expression.
- sequences may be produced using recombinant cloning and/or nucleic acid amplification technology, including PCRTM, in connection with the compositions disclosed herein (see U.S. Patent 4,683,202, U.S. Patent 5,928,90.6, each incorporated herein by reference).
- a pol II promoter that effectively directs the expression ofthe siRNA in the cell type, organelle, and organism chosen for expression will be employed.
- promoters for protein expression, for example, see Sambrook and Russell (2001), incorporated herein by reference.
- the promoters employed may be constitutive, tissue-specific, inducible, and/or useful under the appropriate conditions to direct high level expression ofthe introduced DNA segment, such as is advantageous in the large-scale production of recombinant proteins and/or peptides.
- tissue-specific promoters, as well as assays to characterize their activity is well known to those of ordinary skill in the art.
- the condition amenable to gene inhibition therapy may be a prophylactic process, i.e., a process for preventing disease or an undesired medical condition.
- the instant invention embraces a system for delivering siRNA that has a prophylactic function (i.e., a prophylactic agent) to the mammalian recipient.
- the inhibitory nucleic acid material e.g. , an expression cassette encoding siRNA directed to a gene of interest
- Various expression vectors i.e., vehicles for facilitating delivery of exogenous nucleic acid into a target cell are known to one of ordinary skill in the art.
- transfection of cells refers to the acquisition by a cell of new nucleic acid material by incorporation of added DNA.
- transfection refers to the insertion of nucleic acid into a cell using physical or chemical methods.
- transfection techniques are known to those of ordinary skill in the art including: calcium phosphate DNA co-precipitation (Methods in
- RNA virus i.e., a retrovirus
- Exogenous nucleic acid material contained 04/058940
- a cell that has been transduced with a chimeric DNA virus e.g., an adenovirus carrying a cDNA encoding a therapeutic agent
- a chimeric DNA virus e.g., an adenovirus carrying a cDNA encoding a therapeutic agent
- the exogenous nucleic acid material can include the nucleic acid encoding the siRNA together with a promoter to control transcription.
- the promoter characteristically has a specific nucleotide sequence necessary to initiate franscription.
- the exogenous nucleic acid material may further include additional sequences (i.e., enhancers) required to obtain the desired gene transcription activity.
- enhancers i.e., an "enhancer” is simply any non-translated DNA sequence that works with the coding sequence (in cis) to change the basal transcription level dictated by the promoter.
- the exogenous nucleic acid material may be introduced into the cell genome immediately downstream from the promoter so that the promoter and coding sequence are operatively linked so as to permit franscription ofthe coding sequence.
- An expression vector can include an exogenous promoter element to control transcription ofthe inserted exogenous gene. Such exogenous promoters include both constitutive and regulatable promoters.
- constitutive promoters control the expression of essential cell functions. As a result, a nucleic acid sequence under the control of a constitutive promoter is expressed under all conditions of cell growth.
- Constitutive promoters include the promoters for the following genes which encode certain constitutive or "housekeeping" functions: hypoxanthine phosphoribosyl fransferase (HPRT), dihydrofolate reductase (DHFR) (Scharfmann et al. (1991)), adenosine deaminase, phosphoglycerol kinase (PGK), pyruvate kinase, phosphoglycerol mutase, the beta-actin promoter (Lai et al.
- viral promoters function constitutively in eukaryotic cells. These include: the early and late promoters of SV40; the long terminal repeats (LTRs) of Moloney Leukemia Virus and other retro viruses; and the thymidine kinase promoter of Herpes Simplex Virus, among many others. Nucleic acid sequences that are under the confrol of regulatable promoters are expressed only or to a greater or lesser degree in the presence of an inducing or repressing agent, (e.g., transcription under confrol ofthe metallothionein promoter is greatly increased in presence of certain metal ions).
- an inducing or repressing agent e.g., transcription under confrol ofthe metallothionein promoter is greatly increased in presence of certain metal ions.
- Regulatable promoters include responsive elements (REs) that stimulate franscription when their inducing factors are bound.
- REs responsive elements
- Promoters containing a particular RE can be chosen in order to obtain an regulatable response and in some cases, the RE itself may be attached to a different promoter, thereby conferring regulatability to the encoded nucleic acid sequence.
- nucleic acid sequence is under the control of an regulatable promoter
- delivery ofthe therapeutic agent in situ is triggered by exposing the genetically modified cell in situ to conditions for permitting franscription ofthe nucleic acid sequence, e.g., by infraperitoneal injection of specific inducers ofthe regulatable promoters which control franscription ofthe agent.
- in situ expression of a nucleic acid sequence under the confrol ofthe metallothionein promoter in genetically modified cells is enhanced by contacting the genetically modified cells with a solution containing the appropriate (i.e., inducing) metal ions in situ.
- the amount of siRNA generated in situ is regulated by controlling such factors as the nature ofthe promoter used to direct transcription ofthe nucleic acid sequence, (i.e., whether the promoter is constitutive or regulatable, strong or weak) and the number of copies ofthe exogenous nucleic acid sequence encoding a siRNA sequence that are in the cell.
- the expression vector may include a selection gene, for example, a neomycin resistance gene, for facilitating selection of cells that have been fransfected or transduced with the expression vector.
- a selection gene for example, a neomycin resistance gene, for facilitating selection of cells that have been fransfected or transduced with the expression vector.
- Cells can also be transfected with two or more expression vectors, at least one vector containing the nucleic acid sequence(s) encoding the siRNA(s), the other vector containing a selection gene.
- a suitable promoter, enhancer, selection gene and/or signal sequence is deemed to be within the scope of one of ordinary skill in the art without undue experimentation.
- the instant invention has utility as an expression system suitable for silencing the expression of gene(s) of interest.
- the instant invention also provides various methods for making and using the above-described genetically-modified cells.
- the instant invention also provides methods for genetically modifying cells of a mammalian recipient in vivo.
- the method comprises introducing an expression vector for expressing a siRNA sequence in cells ofthe mammalian recipient in situ by, for example, injecting the vector into the recipient.
- the selection and optimization of a particular expression vector for expressing a specific siRNA in a cell can be accomplished by obtaining the nucleic acid sequence ofthe siRNA, possibly with one or more appropriate confrol regions (e.g., promoter, insertion sequence); preparing a vector construct comprising the vector into which is inserted the nucleic acid sequence encoding the siRNA; fransfecting or transducing cultured cells in vitro with the vector construct; and determining whether the siRNA is present in the cultured cells.
- Vectors for cell gene therapy include viruses, such as replication- deficient viruses (described in detail below). Exemplary viral vectors are 04/058940
- Retroviruses are capable of directing synthesis of all virion proteins, but are incapable of making infectious particles. Accordingly, these genetically altered retroviral expression vectors have general utility for high-efficiency transduction of nucleic acid sequences in cultured cells, and specific utility for use in the method ofthe present invention. Such retroviruses further have utility for the efficient transduction of nucleic acid sequences into cells in vivo. Retroviruses have been used extensively for fransferring nucleic acid material into cells.
- An advantage of using retroviruses for gene therapy is that the viruses insert the nucleic acid sequence encoding the siRNA into the host cell genome, thereby permitting the nucleic acid sequence encoding the siRNA to be passed on to the progeny ofthe cell when it divides.
- Promoter sequences in the LTR region have been reported to enhance expression of an inserted coding sequence in a variety of cell types (see e.g., Hilberg et al. (1987); Holland et al. (1987); Valerio et al. (1989).
- Some disadvantages of using a retrovirus expression vector are (1) insertional mutagenesis, i.e., the insertion ofthe nucleic acid sequence encoding the siRNA into an undesirable position in the target cell genome which, for example, leads to unregulated cell growth and (2) the need for target cell proliferation in order for the nucleic acid sequence encoding the siRNA carried by the vector to be integrated into the target genome (Miller et al. (1990)).
- adenovirus a double-sfranded DNA virus.
- the adenovirus is infective in a wide range of cell types, including, for example, muscle and endothelial cells (Larrick and Burck (1991)).
- the adenovirus also has been used as an expression vector in muscle cells in vivo (Quantin et al. (1992)).
- Adenoviruses (Ad) are double-sfranded linear DNA viruses with a 36 kb genome.
- Recombinant adenovirus vectors have been shown to be capable of efficient in situ gene transfer to parenchymal cells of various organs, including the lung, brain, pancreas, gallbladder, and liver. This has allowed the use of these vectors in methods for treating inherited genetic diseases, such as cystic fibrosis, where vectors may be delivered to a target organ.
- inherited genetic diseases such as cystic fibrosis
- the ability ofthe adenovirus vector to accomplish in situ tumor transduction has allowed the development of a variety of anticancer gene therapy methods for non-disseminated disease. In these methods, vector containment favors tumor cell-specific transduction.
- the adenovirus genome is adaptable for use as an expression vector for gene therapy, i.e., by removing the genetic information that controls production of the virus itself (Rosenfeld et al. (1991)). Because the adenovirus functions in an extrachromosomal fashion, the recombinant adenovirus does not have the theoretical problem of insertional mutagenesis.
- adenovirus vectors are based on the adenovirus type 5 (Ad5) backbone in which an expression cassette containing the nucleic acid sequence of interest has been introduced in place ofthe early region 1 (El) or early region 3 (E3).
- Viruses in which El has been deleted are defective for replication and are propagated in human complementation cells (e.g., 293 or 911 cells), which supply the missing gene E 1 and pIX in trans .
- a suitable vector for this application is an FIV vector (Brooks et al. (2002); Alisky et al. (2000a)) or an AAV vector.
- AAV5 Davidson et al. (2000); Alisky et al. (2000a)
- poliovirus Bosoe et al. (2000)
- HS V vectors Alisky etal. (2000b)
- a variety of suitable viral expression vectors are available for transferring exogenous nucleic acid material into cells.
- the selection of an appropriate expression vector to express a therapeutic agent for a particular condition amenable to gene silencing therapy and the optimization ofthe conditions for insertion ofthe selected expression vector into the cell, are within the scope of one of ordinary skill in the art without the need for undue experimentation.
- the expression vector is in the form of a plasmid, which is transferred into the target cells by one of a variety of methods: physical (e.g., microinjection (Capecchi (1980)), electroporation (Andreason and Evans (1988), scrape loading, microparticle bombardment (Johnston (1990)) or by cellular uptake as a chemical complex (e.g., calcium or strontium co- precipitation, complexation with lipid, complexation with ligand) (Methods in Molecular Biology (1991)).
- a chemical complex e.g., calcium or strontium co- precipitation, complexation with lipid, complexation with ligand
- LipofectinTM Gibco-BRL, Gaithersburg, Md.
- a mammalian recipient to an expression cassette ofthe invention has a condition that is amenable to gene silencing therapy.
- gene silencing therapy refers to administration to the recipient exogenous nucleic acid material encoding a therapeutic siRNA and subsequent expression ofthe administered 04/058940
- condition amenable to siRNA therapy embraces conditions such as genetic diseases (i.e., a disease condition that is attributable to one or more gene defects), acquired pathologies (z ' .e., a pathological condition that is not attributable to an inborn defect), cancers, neurodegenerative diseases, e.g., trinucleotide repeat disorders, and prophylactic processes (i.e., prevention of a disease or of an undesired medical condition).
- a gene "associated with a condition” is a gene that is either the cause, or is part of the cause, ofthe condition to be treated.
- genes associated with a neurodegenerative disease e.g., a trinucleotide-repeat disease such as a disease associated with polyglutamine repeats, Huntington's disease, and several spinocerebellar ataxias
- genes encoding ligands for chemokines involved in the migration of a cancer cells, or chemokine receptor e.g., a trinucleotide-repeat disease such as a disease associated with polyglutamine repeats, Huntington's disease, and several spinocerebellar ataxias
- siRNA expressed from viral vectors may be used for in vivo antiviral therapy using the vector systems described. Accordingly, as used herein, the term “therapeutic siRNA” refers to any siRNA that has a beneficial effect on the recipient. Thus, “therapeutic siRNA” embraces both therapeutic and prophylactic siRNA.
- Differences between alleles that are amenable to targeting by siRNA include disease-causing mutations as well as polymorphisms that are not themselves mutations, but may be linked to a mutation or associated with a predisposition to a disease state.
- targetable disease mutations include tau mutations that cause frontotemporal dementia and the GAG deletion in the TORI A gene that causes DYTl dystonia.
- An example of a targetable polymorphism that is not itself a mutation is the C/G single nucleotide polymorphism (G987C)in the MJD1 gene immediately downstream ofthe mutation that causes spinocerebellar ataxia type 3 and the polymorphism in exon 58 associated with Huntington's disease.
- Single nucleotide polymorphisms comprise most ofthe genetic diversity between humans. Many disease genes, including the HD gene in Huntington's disease, contain numerous single nucleotide or multiple nucleotide polymo ⁇ hisms that could be separately targeted in one allele vs. the other, as shown in Figure 15. The major risk factor for developing Alzheimer's disease is the presence of a particular polymorphism in the apolipoprotein E gene. A. Gene defects
- this strategy can be applied to a major class of disabling neurological disorders.
- this strategy can be applied to the polyglutamine diseases, as is demonstrated by the reduction of polyglutamine aggregation in cells following application ofthe strategy.
- the neurodegenerative disease may be a trinucleotide-repeat disease, such as a disease associated with polyglutamine repeats, including Huntington's disease, and several spinocerebellar ataxias.
- this strategy can be applied to a non-degenerative neurological disorder, such as DYTl dystonia.
- abnormal pathology refers to a disease or syndrome manifested by an abnormal physiological, biochemical, cellular, structural, or molecular biological state.
- the disease could be a viral disease, such as hepatitis or AIDS.
- the condition amenable to gene silencing therapy alternatively can be a genetic disorder or an acquired pathology that is manifested by abnormal cell proliferation, e.g., cancer.
- the instant invention is useful for silencing a gene involved in neoplastic activity.
- the present invention can also be used to inhibit overexpression of one or several genes.
- the present invention can be used to treat neuroblastoma, medulloblastoma, or glioblastoma.
- agents of the invention are preferably administered so as to result in a reduction in at least one symptom associated with a disease.
- the amount administered will vary depending on various factors including, but not limited to, the composition chosen, the particular disease, the weight, the physical condition, and the age ofthe mammal, and whether prevention or treatment is to 04/058940
- siRNA may be accomplished through the administration ofthe nucleic acid molecule encoding the siRNA (see, for example, Feigner et al, U.S. Patent No. 5,580,859, Pardoll et al. 1995; Stevenson et al. 1995; Moiling 1997; Donnelly et al. 1995; Yang et al. II; Abdallah et al. 1995).
- Pharmaceutical formulations, dosages and routes of administration for nucleic acids are generally disclosed, for example, in Feigner et al, supra.
- the present invention envisions treating a disease, for example, a neurodegenerative disease, in a mammal by the administration of an agent, e.g., a nucleic acid composition, an expression vector, or a viral particle ofthe invention.
- Administration ofthe therapeutic agents in accordance with the present invention may be continuous or intermittent, depending, for example, upon the recipient's physiological condition, whether the purpose of the administration is therapeutic or prophylactic, and other factors known to skilled practitioners.
- the administration ofthe agents ofthe invention may be essentially continuous over a preselected period of time or may be in a series of spaced doses. Both local and systemic administration is contemplated.
- One or more suitable unit dosage forms having the therapeutic agent(s) of the invention can be administered by a variety of routes including parenteral, including by intravenous and intramuscular routes, as well as by direct injection into the diseased tissue.
- the therapeutic agent may be directly injected into the brain.
- the therapeutic agent may be introduced infrathecally for brain and spinal cord conditions.
- the therapeutic agent may be introduced intramuscularly for viruses that traffic back to affected neurons from muscle, such as AAV, lentivirus and adenovirus.
- the formulations may, where appropriate, be conveniently presented in discrete unit dosage forms and may be prepared by any ofthe methods well known to pharmacy. Such methods may include the step of bringing into association the therapeutic agent with liquid carriers, solid matrices, semi-solid carriers, finely divided solid carriers or combinations thereof, and then, if necessary, introducing or shaping the product into the desired delivery system.
- the therapeutic agents o the invention are prepared for administration, they are preferably combined with a pharmaceutically acceptable carrier, diluent or excipient to form a pharmaceutical formulation, or unit dosage form.
- a pharmaceutically acceptable carrier diluent or excipient to form a pharmaceutical formulation, or unit dosage form.
- the total active ingredients in such formulations include from 0.1 to 99.9% by weight ofthe formulation.
- a "pharmaceutically acceptable” is a carrier, diluent, excipient, and/or salt that is compatible with the other ingredients ofthe formulation, and not deleterious to the recipient thereof.
- the active ingredient for administration may be present as a powder or as granules; as a solution, a suspension or an emulsion.
- compositions containing the therapeutic agents ofthe invention can be prepared by procedures known in the art using well known and readily available ingredients.
- the therapeutic agents ofthe invention can also be formulated as solutions appropriate for parenteral administration, for instance by intramuscular, subcutaneous or intravenous routes.
- the pharmaceutical formulations ofthe therapeutic agents ofthe invention can also take the form of an aqueous or anhydrous solution or dispersion, or alternatively the form of an emulsion or suspension.
- the therapeutic agent may be formulated for parenteral adminisfration (e.g., by injection, for example, bolus injection or continuous infusion) and may be presented in unit dose form in ampules, pre-filled syringes, small volume infusion containers or in multi-dose containers with an added preservative.
- the active ingredients may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
- the active ingredients may be in powder form, obtained by aseptic isolation of sterile solid or by lyopbilization from solution, for constitution with a suitable vehicle, e.g., sterile, pyrogen-free water, before use.
- unit content of active ingredient or ingredients contained in an individual aerosol dose of each dosage form need not in itself constitute an effective amount for treating the particular indication or 04/058940
- the pharmaceutical formulations ofthe present invention may include, as optional ingredients, pharmaceutically acceptable carriers, diluents, solubilizing or emulsifying agents, and salts ofthe type that are well-known in the art.
- pharmaceutically acceptable carriers such as phosphate buffered saline solutions pH 7.0-8.0.
- the modified CMV (mCMV) promoter was made by PCR amplification of CMV by primers
- oligonucleotides contain Spe7 and Sail sites at the 5' and 3' ends, respectively.
- the synthesized polyA cassette was ligated into Spe/, Sail digested pmCMVKnpA.
- the resultant shuttle plasmid, pmCMVmpA was used for construction of head-to-head 21bp hairpins of eGFP (bp 418 to 438), human ⁇ - glucuronidase (bp 649 to 669), mouse ⁇ -glucuronidase (bp 646 to 666) or E. coli ⁇ -galactosidase (bp 1152-1172).
- the eGFP hairpins were also cloned into the Ad shuttle plasmid containing the commercially available CMV promoter and polyA cassette from SV40 large T antigen (pCMVsiGFPx).
- Shuttle plasmids were co-transfected into HEK293 cells along with the adenovirus backbones for generation of full-length Ad genomes. Viruses were harvested 6-10 days after transfection and amplified and purified as described (Anderson, R.D., et al., Gene Ther. 7:1034-1038 (2000)).
- Blots were probed with 32 P-labeled sense (5'-CACAAGCTGGAGTACAACTAC-3' (SEQ ID NO:5)) or antisense (5'-GTACTTGTACTCCAGCTTTGTG-3 ' (SEQ ID NO:6)) oligonucleotides at 37°C for 3h for evaluation of siRNA transcripts, or probed for target mRNAs at 42°C overnight. Blots were washed using standard 04/058940
- PC12 tet off cell lines (Clontech Inc., Palo Alto, CA) were stably transfected with a tetracycline regulatable plasmid into which was cloned GFPQ19 or GFPQ80 (Chai, Y. et al., J. Neurosci. 19:10338-10347 (1999)).
- GFP-Q80 clones were selected and clone 29 chosen for regulatable properties and inclusion formation.
- GFP-Q19 clone 15 was selected for uniformity of GFP expression following gene expression induction. In all studies 1.5 ⁇ g/ml dox was used to repress transcription. All experiments were done in triplicate and were repeated 4 times.
- siRNA hairpin targeted against eGFP was placed under the control ofthe CMV promoter and contained a full-length SV-40 polyadenylation (polyA) cassette (pCMVsiGFPx).
- polyA polyadenylation cassette
- the hairpin was juxtaposed almost immediate to the CMV transcription start site (within 6 bp) and was followed by a synthetic, minimal polyA cassette (Fig.
- pmCMVsiGFPmpA (Experimental Protocols), because we reasoned that functional siRNA would require minimal to no overhangs (Caplan, N.J., et al., Proc. Natl Acad. Sci. U. S. A. 98:9742-9747 (2001); Nykanen, A., et al., Cell 107:309-321 (2001)).
- pmCMVsiGFPmpA transfection led to the production of an approximately 63 bp RNA specific for eGFP (Fig.
- Recombinant adenoviruses were generated from the siGFP (pmCMVsiGFPmpA) and si ⁇ gluc (pmCMVsi ⁇ glucmpA) plasmids (Xia, H., et al., Nat. Biotechnol. 19:640-644 (2001); Anderson, R.D., et al., Gene Ther.
- HeLa cells are of human origin and contain moderate levels ofthe soluble lysosomal enzyme ⁇ -glucuronidase.
- Infection of HeLa cells with viruses expressing si ⁇ gluc caused a specific reduction in human ⁇ -glucuronidase mRNA (Fig. II) leading to a 60% decrease in ⁇ -glucuronidase activity relative to siGFP or control cells (Fig 1J).
- Optimization of siRNA sequences using methods to refine target mRNA accessible sequences Lee, N.S., et al., Nat. Biotechnol. 19:500- 505 (2002)) could improve further the diminution of ⁇ -glucuronidase transcript and protein levels.
- siRNA was synthesized infracellularly from readily available promoter constructs.
- the data support the utility of regulatable, tissue or cell-specific promoters for expression of siRNA when suitably modified for close juxtaposition ofthe hairpin to the transcriptional start site and inclusion of the minimal polyA sequence containing cassette (see, Methods above).
- fransgenic mice expressing eGFP (Okabe, M. et al., FEBSLett. 407:313-319 (1997)) were injected into the striatal region ofthe brain with 1 x 10 infectious units of recombinant adenovirus vectors expressing siGFP or control si ⁇ gluc.
- Viruses also contained a dsRed expression cassette in a distant region ofthe virus for unequivocal localization of the injection site.
- eGFP expression was confined to the injected hemisphere (Fig. 2B).
- the in vivo reduction is promising, particularly since transgenically expressed eGFP is a stable protein, making complete reduction in this short time frame unlikely.
- evaluation of eGFP levels was done 5 days after injection, when inflammatory changes induced by the adenovirus vector likely enhance transgenic eGFP expression from the CMV enhancer (Ooboshi, H., et al., Arterioscler. Thromb. Vase. Biol. 17:1786-1792 (1997)). It was next tested whether virus mediated siRNA could decrease expression from endogenous alleles in vivo.
- mice were injected via the tail vein with a construct expressing murine-specific si ⁇ gluc (AdsiMu ⁇ gluc), or the control viruses Adsi ⁇ gluc (specific for human ⁇ -glucuronidase) or Adsi ⁇ gal.
- AdsiMu ⁇ gluc murine-specific si ⁇ gluc
- Adsi ⁇ gluc specific for human ⁇ -glucuronidase
- Adsi ⁇ gal Adsi ⁇ gal
- siRNA is to reduce expression of toxic gene products in dominantly inherited diseases such as the polyglutamine (polyQ) neurodegenerative disorders (Margolis, R.L. & Ross, C.A. Trends Mol. Med. 7:479-482 (2001)).
- polyQ polyglutamine
- the molecular basis of polyQ diseases is a novel toxic property conferred upon the mutant protein by polyQ expansion. This toxic property is associated with disease protein aggregation.
- the ability of virally expressed siRNA to diminish expanded polyQ protein expression in neural PC- 12 clonal cell lines was evaluated.
- transcripts expressed from the modified CMV promoter and containing the minimal polyA cassette were capable of reducing gene expression in both plasmid and viral vector systems (Figs. 1 -4).
- the placement ofthe hairpin immediate to the franscription start site and use ofthe minimal polyadenylation cassette was of critical importance.
- RNA interference is initiated by the ATP-dependent, processive cleavage of long dsRNA into 21-25 bp double-sfranded siRNA, followed by incorporation of siRNA into a RNA-induced silencing complex that recognizes and cleaves the target (Nykanen, A., et al., Cell 107:309-321 (2001); Zamore, PD., et al., Cell 101:25-33 (2000); Bernstein, E., et al., Nature 409:363-366 (2001); Hamilton, A.J. & Baulcombe, D.C. Science 286:950-952 (1999); Hammond, S.M. et al., Nature 404:293-296 (2000)).
- Viral vectors expressing siRNA are useful in determining if similar mechanisms are involved in target RNA cleavage in mammalian cells in vivo.
- siRNA expressed from viral vectors in vitro and in vivo specifically reduce expression of stably expressed plasmids in cells, and endogenous transgenic targets in mice.
- the application of virally expressed siRNA to various target alleles in different cells and tissues in vitro and in vivo was demonstrated.
- the results show that it is possible to reduce polyglutamine protein levels in neurons, which is the cause of at least nine inherited neurodegenerative diseases, with a corresponding decrease in disease protein aggregation.
- the ability of viral vectors based on adeno-associated virus Davidson, B.L., et al., Proc. Natl. Acad. Sci. U. S. A.
- RNA interference RNA interference
- polyglutamine polyglutamine
- FTDP-17 frontotemporal dementia with parkinsonism linked to chromosome 17
- the polyQ neurodegenerative disorders consist of at least nine diseases caused by CAG repeat expansions that encode polyQ in the disease protein. PolyQ expansion confers a dominant toxic property on the mutant protein that is associated with aberrant accumulation ofthe disease protein in neurons.
- FTDP-17 Tau mutations lead to the formation of neurofibrillary tangles accompanied by neuronal dysfunction and degeneration. The precise mechanisms by which these mutant proteins cause neuronal injury are unknown, but considerable evidence suggests that the abnormal proteins 04/058940
- siRNA or other means should, in principle, slow or even prevent disease.
- many dominant disease genes may also encode essential proteins, the inventors sought to develop siRNA-mediated approaches that selectively inactivate mutant alleles while allowing continued expression ofthe wild type protein.
- siRNA Synthesis In vitro siRNA synthesis was previously described (Donze 2000). Reactions were performed with desalted DNA oligonucleotides (IDT Coralville, IA) and the Am ⁇ liScribeT7 High Yield Transcription Kit (Epicentre Madison, WI). Yield was determined by absorbance at 260nm. Annealed siRNAs were assessed for double sfranded character by agarose gel (1% w/v) electrophoresis and ethidium bromide staining. Note that for all siRNAs generated in this study the most 5' nucleotide in the targeted cDNA sequence is referred to as position 1 and each subsequent nucleotide is numbered in ascending order from 5' to 3'.
- the human ataxin-3 cDNA was expanded to 166 CAG's by PCR (Laccone 1999). PCR products were digested at Bamffl and Kpnl sites introduced during PCR and ligated into BgHI and Kpnl sites of pEGFP-Nl (Clontech) resulting in full-length expanded ataxin-3 fused to the N- terminus of EGFP. Untagged Ataxin-3-Q166 was constructed bydigating a PpuMI-Notl ataxin-3 fragment (3' ofthe CAG repeat) into Ataxin-3 -Q166-GFP cut with PpuMI and Notl to remove EGFP and replace the normal ataxin-3 stop codon.
- Ataxin-3-Q28-GFP was generated as above from pcDNA3.1 -ataxin-3 - Q28. Constructs were, sequence verified to ensure that no PCR mutations were present. Expression was verified by Western blot with anti-ataxin-3 (Paulson 1997) and GFP antibodies (MBL). The construct encoding a flag tagged, 352 residue tau isoform was previously described (Leger 1994).
- the pEGFP-tau plasmid was constructed by ligating the human tau cDNA into pEGFP-C2 (Clontech) and encodes tau with EGFP fused to the amino terminus.
- the pEGFP-tauV337M plasmid was derived using site-directed mutagenesis (QuikChange Kit, Stratagene) ofthe pEFGP-tau plasmid.
- Cell Culture and Transfections Culture of Cos-7 and HeLa cells has been described (Chai 1999b).
- Transfections with plasmids and siRNA were performed using Lipofectamine Plus (LifeTechnologies) according to the manufacturer's instructions.
- 1.5 ⁇ g plasmid was transfected with 5 ⁇ g in vitro synthesized siRNAs.
- For Tau experiments 1 ⁇ g plasmid was fransfected with 2.5 ⁇ g siRNA.
- Ataxin-3 expression plasmid was fransfected with 4 ⁇ g phU6-siC10i or phU6-siG10i.
- Cos-7 cells infected with siRNA-expressing adenovirus were fransfected with 0.5 ⁇ g of each expression plasmid.
- Stably fransfected, doxycycline-inducible cell lines were generated in a subclone of PC12 cells, PC6-3, because of its strong neural differentiation properties (Pittman 19938).
- a PC6-3 clone stably expressing Tet repressor plasmid (provided by S. Sfrack, Univ.
- Recombinant adenovirus expressing ataxin-3 specific shRNA were generated from phU6-C10i (encoding CIO hairpin siRNA) and phU6si-G10i (encoding G10 hairpin siRNA) as previously described (Xia 2002, Anderson 2000).
- Cos-7 cells expressing ataxin-3 were harvested 24-48 hours after transfection (Chai 1999b). Stably transfected, inducible cell lines were harvested 72 hours after infection with adenovirus. Lysates were assessed for ataxin-3 expression by Western blot analysis as previously described (Chai 1999b), using polyclonal rabbit anti- ataxin-3 antisera at a 1:15,000 dilution or 1C2 antibody specific for expanded polyQ tracts (Trottier 1995) at a 1:2,500 dilution. Cells expressing Tau were harvested 24 hours after transfection.
- Protein was detected with an affinity purified polyclonal antibody to a human tau peptide (residues 12-24) at a 1 :500 dilution.
- Anti-alpha-tubulin mouse monoclonal antibody (Sigma St. Louis, MO) was used at a 1 : 10,000 dilution and GAPDH mouse monoclonal antibody (Sigma St. Louis, MO) was used at a 1:1,000 dilution.
- Immunofluorescence for ataxin-3 (Chai 1999b) was carried out using
- 1C2 antibody (Chemicon International Temecula, CA) at 1:1,000 dilution 48 hours after transfection.
- Flag-tagged, wild type tau was detected using mouse monoclonal antibody (Sigma St. Louis, MO) at 1:1,000 dilution 24 hours after transfection. Both proteins were detected with rhodamine conjugated secondary antibody at a 1 : 1 ,000 dilution.
- Fluorescent Imaging and Quantification Fixed samples were observed with a Zeiss Axioplan fluorescence microscope. Digital images were collected on separate red, green and blue fluorescence channels using a SPOT digital camera. Images were assembled and overlaid using Adobe Photoshop 6.0. Live cell images were collected with a Kodak MDS 290 digital camera mounted to an Olympus (Tokyo, Japan) CK40 inverted microscope. Fluorescence was quantitated by collecting 3 non-overlapping images per well at low power (lOx). Pixel count and intensity for each image was determined using Bioquant Nova Prime software (BIOQUANT Image Analysis Corporation). Background was subtracted by quantitation of images from cells of equivalent density under identical fluorescent illumination.
- Mock transfected cells were used to assess background fluorescence for all experiments and were stained with appropriate primary and secondary antibodies for simulated heterozygous experiments. Average fluorescence is reported from 2 to 3 independent experiments. The mean of 2 to 3 independent experiments for cells transfected with the indicated expression plasmid and siMiss was set at one. Errors bars depict variation between experiments as standard error ofthe mean. In simulated heterozygous experiments, a blinded observer scored cells with a positive fluorescence signal for expression of wild type, mutant or both proteins in random fields at high power for two independent experiments. More than 100 cells were scored in each experiment and reported as number of cells with co-expression divided by total number of transfected cells. Results
- siRNAs were designed that target the transcript encoding ataxin-3, the disease protein in Machado-Joseph Disease, also known as Spinocerebellar Ataxia Type 3 (MJD/SCA3) (Zoghbi 2000) (Fig. 5b).
- MJD/SCA3 Spinocerebellar Ataxia Type 3
- siRNA directed against three separate regions — the CAG repeat, a distant 5' site, or a site just 5' to the CAG repeat (siN'CAG) ⁇ resulted in efficient, but not allele-specific, suppression of ataxin-3 containing normal or
- siRNAs were designed that included the last 2 CAG triplets ofthe repeat followed by the C variant at position 7 (siC7) ( Figure 6 and Fig. 5b), resulting in a perfect match only for expanded alleles. Despite the presence of a single mismatch to the wild type allele, siC7 strongly inhibited expression of both alleles (Fig. 5c,d). A second G- C mismatch was then introduced at position 8 such that the siRNA contained two mismatches as compared to wild type and only one mismatch as compared to mutant alleles (siC7/8).
- siC7/8 siRNA effectively suppressed mutant ataxin-3 expression, reducing total fluorescence to an average 8.6% of control levels, with only modest effects on wild type ataxin-3 (average 75.2% of control). siC7/8 also nearly eliminated the accumulation of aggregated mutant ataxin-3, a pathological hallmark of disease (Chan 2000) (Fig. 5d).
- siRNAs were designed containing a more centrally placed mismatch. Because the 1 center ofthe antisense strand directs cleavage of target mRNA in the RNA Induced Silencing Complex (RISC) complex (Elbashir 2001c), it was reasoned that central mismatches might more efficiently discriminate between wild type and mutant alleles.
- siRNAs were designed that place the C ofthe SNP at position 10 (siCIO), preceded by the final three triplets in the CAG repeat ( Figure 6 and Fig. 5b). In transfected cells, siCIO caused allele-specific suppression ofthe mutant protein (Fig. 5c,d).
- RNA-dependent RNA polymerase RNA-dependent RNA polymerase
- each siRNA retained the specificity observed in separate transfections: siC7 inhibited both alleles, siGlO inhibited only the wild type allele, and siC7/8 and siCl 0 inhibited only mutant allele expression.
- siRNA therapy for late onset disease will likely require sustained infracellular expression ofthe siRNA. Accordingly, the present experiments were extended to two infracellular methods of siRNA production and delivery: expression plasmids and recombinant virus (Brummelkamp 2002, Xia 2002). Plasmids were constructed expressing siG 10 or siC 10 siRNA from the human U6 promoter as a hairpin transcript that is processed infracellularly to produce siRNA (Brummelkamp 2002, Xia 2002).
- Viral mediated suppression was also assessed in differentiated PC 12 neural cell lines that inducibly express normal (Q28) or expanded (Q166) mutant ataxin-3.
- differentiated neural cells were placed in doxycycline for three days to induce maximal expression of ataxin-3.
- Western blot analysis of cell lysates confirmed that the Ad-Gl Oi virus suppressed only wild type ataxin-3, Ad-Cl Oi virus suppressed only mutant ataxin-3, and Ad-LacZi had no effect on either normal or mutant ataxin-3 expression (Fig. 8d).
- siRNA retains its efficacy and selectivity across different modes of production and delivery to achieve allele- specific silencing of ataxin-3.
- the point mutation was placed centrally, near the likely cleavage site in the RISC complex (position 9, 10 or 11) (Laccone 1999).
- a fifth siRNA designed to target a 5' sequence in all Tau transcripts was also tested.
- the inventors co-transfected GFP fusions of mutant and wild type Tau isoforms together with siRNA into Cos-7 cells.
- the inventors obtained robust suppression with siRNA corresponding to V337M ( Figure 6 and Fig. 9A) (Poorkaj 1998, Hutton 1998), and thus focused further analysis on this mutation.
- the V337M mutation is a G to A base change in the first position of the codon (GTG to ATG), and the corresponding V337M siRNA contains the A 04/058940
- siRNAs that contained the V337M (G to A) mutation at position 9 as well as a second introduced G-C mismatch immediately 5' to the mutation (siA9/C8) or three nucleotides 3' to the mutation (siA9/C12), such that the siRNA now contained two mismatches to the wild type but only one to the mutant allele.
- This strategy resulted in further preferential inactivation ofthe mutant allele.
- siRNA, siA9/C12 showed sfrong selectivity for the mutant tau allele, reducing fluorescence to 12.7% of control levels without detectable loss of wild type Tau (Fig. 9b, c).
- Fig. 10 we simulated the heterozygous state by co-transfecting V337M-GFP and flag-tagged WT-Tau expression plasmids.
- siA9/C12 silenced the mutant allele (16.7% of control levels) with minimal alteration of wild type expression assessed by fluorescence (Fig. 10a) and Western blot (Fig. 10b).
- siA9 and siA9/C8 displayed better allele discrimination than we had observed in separate transfections, but continued to suppress both wild type and mutant tau expression (Fig. 10a,b,c).
- siRNA can be engineered to silence expression of disease alleles differing from wild type alleles by as little as a single nucleotide.
- This approach can directly target missense mutations, as in frontotemporal dementia, or associated SNPs, as in MJD/SCA3.
- the present stepwise strategy for optimizing allele-specific targeting extends the utility of siRNA to a wide range of dominant diseases in which the disease gene normally plays an important or essential role.
- One such example is the polyglutamine disease, Huntington disease (HD), in which normal HD protein levels are developmentally essential (Nasir 1995).
- HD Huntington disease
- DYTl dystonia is the most common cause of primary generalized dystonia.
- a dominantly inherited disorder, DYTl usually presents in childhood as focal dystonia and progresses to severe generalized disease.
- all cases of DYTl result from a common GAG deletion in TOR1A, eliminating one of two adjacent glutamic acids near the C-terminus ofthe protein TorsinA (TA).
- TA TorsinA
- DYTl Several characteristics of DYTl make it an ideal disease in which to explore siRNA-mediated gene silencing as potential therapy. Of greatest importance, the dominant nature ofthe disease suggests that a reduction in mutant TA, whatever the precise pathogenic mechanism proves to be, will be helpful. Moreover, the existence of a single common mutation that deletes a full three nucleotides suggests it may be feasible to design siRNA that will specifically target the mutant allele and will be applicable to all affected persons. Finally, there is no effective therapy for DYTl, a relentless and disabling disease. Thus, any therapeutic approach with promise needs to be explored. Because TAwt may be an essential protein, however, it is critically important that efforts be made to silence only the mutant allele.
- the inventors explored the utility of siRNA for DYTl . As outlined in the strategy in Figure 11, the inventors sought to develop siRNA that would specifically eliminate production of protein from the mutant allele. By exploiting the three base pair difference between wild type and mutant alleles, the inventors successfully silenced expression of TAmut without interfering with expression ofthe wild type protein (TAwt).
- RNA duplexes were synthesized in vitro according to a previously described protocol (Donze 2002), using AmpliScribeT7 High Yield Transcription Kit (Epicentre Technologies) and desalted DNA oligonucleotides (IDT).
- siRNAs were designed to target different regions of human TA transcript: 1) an upsfream sequence common to both TAwt and TAmut (com-siRNA); 2) the area corresponding to the mutation with either the wild type sequence (wt-siRNA) or the mutant sequence positioned at three different places (mutA-siRNA, mutB-siRNA, mutC-siRNA); and 3) a negative control siRNA containing an irrelevant sequence that does not target any region of TA (mis-siRNA).
- the design ofthe primers and targeted sequences are shown schematically in Figure 12. After in vitro synthesis, the double stranded structure ofthe resultant RNA was confirmed in 1.5 % agarose gels and RNA concentration determined with a SmartSpect 3000 UV Spectrophotometer (BioRad).
- Plasmids pcDNA3 containing TAwt or TAmut cDNA were kindly provided by Xandra Breakefield (Mass General Hospital, Boston, MA). This construct was produced by cloning the entire coding sequences of human TorsinA (1-332), both wild-type and mutant (GAG deleted), into the mammalian expression vector, pcDNA3 (Clontech, Palo Alto, CA). Using PCR based strategies, an N-terminal hemagglutinin (HA) epitope tag was inserted into both constructs. pEGFP-C3-TAwt was kindly provided by Pullanipally Shashidharan (Mt Sinai Medical School, NY).
- This construct was made by inserting the full- length coding sequence of wild-type TorsinA into the EcoRI and BamHI restriction sites ofthe vector pEGFP-C3 (Clontech). This resulted in a fusion protein including eGFP, three "stuffer” amino acids and the 331 amino acids of TorsinA. HA-tagged TAmut was inserted into the Apal and Sail restriction sites of pEGFP-Cl vector (Clontech), resulting in a GFP-HA-TAmut construct.
- Anti-HA mouse monoclonal antibody 12CA5 (Roche) at 1 : 1,000 dilution
- monoclonal mouse anti-GFP antibody (MBL) at 1 : 1 ,000 dilution
- anti ⁇ -tubulin mouse monoclonal antibody (Sigma) at 1 :20,000 dilution.
- Fluorescence visualization of fixed cells expressing GFP-tagged TA was performed with a Zeiss Axioplan fluorescence microscope. Nuclei were visualized by staining with 5 ⁇ g/ml DAPI at room temperature for 10 minutes. Digital images were collected on separate red, green and blue fluorescence channels using a Diagnostics SPOT digital camera. Live cell images were collected with a Kodak MDS 290 digital camera mounted on an Olympus CK40 inverted microscope equipped for GFP fluorescence and phase contrast microscopy. Digitized images were assembled using Adobe Photoshop 6.0.
- siRNAs were designed to test the hypothesis that siRNA-mediated suppression of TA expression could be achieved in an allele-specific manner (figure 12). Because siRNA can display extraordinarily, the three base pair difference between mutant and wild type TORI A alleles might be sufficient to permit the design of siRNA that preferentially recognizes mRNA derived from the mutant allele. Two siRNAs were initially designed to target TAmut (mutA-siRNA and mutB-siRNA) and one to target TAwt (wt-siRNA).
- a positive control siRNA was designed to silence both alleles (com-siRNA) and a negative confrol siRNA of irrelevant sequence (mis-siRNA) was designed.
- Cos-7 cells were first cofransfected with siRNA and plasmids encoding either GFP-TAwt or untagged TAwt at a siRNA to plasmid ratio of 5:1.
- wt-siRNA potent silencing of TAwt expression was observed to less than 1 % of control levels, based on western blot analysis of cell lysates ( Figures 13A and 13C).
- TAwt expression was suppressed to -30 % of control levels.
- mutA- siRNA did not suppress TAwt and mutB-siRNA suppressed TAwt expression only modestly.
- a third siRNA was engineered to target TAmut (mutC-siRNA, Figure 12).
- MutC-siRNA places the GAG deletion more centrally in the siRNA duplex. Because the cenfral portion ofthe antisense sfrand of siRNA guides mRNA cleavage, it was reasoned that placing the GAG deletion more centrally might enhance specific suppression of TAmut.
- mutC-siRNA suppressed TAmut expression more specifically and robustly than the other mut-siRNAs tested. In transfected cells, mutC-siRNA suppressed TAmut to less than 0.5% of confrol levels, and had no effect on the expression of TAwt.
- the inventors succeeded in generating siRNA that specifically and robustly suppresses mutant TA, the defective protein responsible for the most common form of primary generalized dystonia.
- the results have several implications for the treatment of DYTl dystonia.
- the suppression achieved was remarkably allele-specific, even in cells simulating the heterozygous state.
- efficient suppression of mutant TA occurred without significant reduction in wild type TA.
- Homozygous TA knockout mice die shortly after birth, while the heterozygous mice are normal (Goodchild 2002) , suggesting an essential function for TA.
- the present inventors have developed huntingtin siRNA focused on two targets.
- One is non-allele specific (siHDexon2), the other is targeted to the exon 58 codon deletion, the only known common insetic polymorphism in linkage dysequilibirum with the disease mutation (Ambrose et al, 1994).
- 92%o of wild type huntingtin alleles have four GAGs in exon 58, while 38% of HD patients have 3 GAGs in exon 58.
- PC6-3 cells were transfected with a full-length huntingtin containing the exon 58 deletion.
- PC6-3 rat pheochromocytoma cells were co-fransfected with CMV-human Htt (37Qs) and U6 siRNA hairpin plasmids. Cell extracts were harvested 24 hours later and western blots were performed using 15 ⁇ g total protein extract.
- Primary antibody was an anti-huntingtin monoclonal antibody (MAB2166, Chemicon) that reacts with human, monkey, rat and mouse Htt proteins.
- a positive control a non-allele specific siRNA targeted to exon 2 ofthe huntingtin gene was used.
- siRNA directed against GFP was used as a negative control. Note that only siEx58# 2 is functional.
- RNA interference plays an important role in diverse aspects of biology (McManus et al., 2002). Techniques that exploit the power of RNAi to suppress target genes have already become indispensable tools in research and are therapeutically useful (McManus et al., 2002; Song et al., 2003 ). In particular, the production of small interfering RNAs (siRNAs) that silence specific disease-related genes have wide-ranging therapeutic applications.
- siRNAs small interfering RNAs
- siRNAs that selectively silence mutant alleles while retaining expression of normal alleles (Miller et al., 2003; Gonzalez-Alegre et al., 2003; Ding et al., 2003; Abdelgany et al., 2003; Martinez et al. 2002a).
- Such allele- specific suppression is important for disorders in which the defective gene normally plays an important or essential role.
- siRNAs for target genes are not always straightforward, however, particularly when designing siRNAs that selectively target mutant alleles (Miller et al. 2003; Ding et al. 2003).
- the present inventors describe a simple, novel approach for producing siRNAs that should facilitate the development of gene and allele-specific siRNAs. Using this sfrategy, the inventors then created allele-specific siRNA for mutations in two important neurodegenerative disease genes, the genes encoding amyloid precursor protein (APP) and tau.
- APP amyloid precursor protein
- siRNA Synthesis In vitro synthesis of siRNA was done using a previously described protocol (Miller et al., 2003; Donze et al., 2002). Desalted DNA oligonucleotides (Integrated DNA Technologies, Coralville, IA) encoding sense and antisense target sequences were used with the Am ⁇ liScribeT7 high- yield transcription kit (Epicentre Technologies, Madison, WI) to generate siRNA duplexes (Fig. 16). After measuring reaction yields through absorbance at 260nm, double-sfranded nature was confirmed by agarose gel (1% wt/vol) electrophoresis and ethidium bromide staining. Note that for all siRNAs used in this study the most 5' nucleotide in the targeted cDNA sequence is referred to as position 1 and each subsequent nucleotide is numbered in ascending order from
- Plasmids The plasmid used for GFP expression was pEGFP-Cl (BD Biosciences Clontech, Palo Alto, CA). Gloria Lee (University of Iowa, Iowa
- V337M-GFP tau (Miller et al., 2003). Constructs encoding APP and APPsw mutant proteins were kindly provided by R. Scott Turner (University of
- shRNA Plasmid Construction The tRNA-valine vector was constructed by annealing two primers, (forward 5'-
- APP tvAPP AAAAAATGAAGTGAAGATGGATGCAGCCAAGCTTCGCTGCATCCATC TTCACTTCACTTCGAACCGGGGACCTTTCG (SEQ ID NO:60)
- Lysates from Cos-7 cells expressing GFP and tau constructs were harvested 24 h after transfection, while APP and APPsw expressing cell lysates were harvested at 48 h.
- Lysates from HeLa cells expressing endogenous lamin were harvested at 72 h after fransfection of anti- lamin siRNA. Lysates were analyzed by Western blot as reported previously (Chai et al., 1999b). GFP and lamin were detected with anti-GFP mouse monoclonal antibody (1:1000 dilution; Medical and Biological Laboratories, Naka-ku Nagoya, Japan) and anti-lamin goat polyclonal antibody (1 :25 dilution; Santa Cruz Biotechnology, Santa Cruz, CA) respectively.
- Additional antibodies used in this study include anti-tau mouse monoclonal antibody at 1:500 dilution (Calbiochem, San Diego, CA), 22C11 anti-APP mouse monoclonal antibody at 1 :500 dilution (Chemicon International, Temecula, CA), and as a loading control, mouse monoclonal antibody to ⁇ -tubulin at 1 :20,000 dilution (Sigma, St. Louis, MO).
- Secondary antibodies were peroxidase-conjugated donkey anti- goat or peroxidase-conjugated donkey anti-mouse (Jackson hnmunoResearch Laboratories, West Grove, PA) at 1 : 15,000 dilution.
- siRNAs against a gene of interest An efficient way to create siRNAs against a gene of interest is to produce short RNA duplexes complementary to the target gene in in vitro transcription reactions employing T7 RNA polymerase.
- the priming requirements for T7 polymerase dictate that a G be the priming nucleotide initiating transcription (Kato et al., 2001). This limits the nucleotide positions in a target gene to which corresponding in vitro transcribed RNA duplexes can be generated.
- siRNAs were designed that contained a noncomplementary G nucleotide at the 5' ends.
- the resulting siRNA contains 20 complementary nucleotides on the antisense strand with a single 5' mismatch to the target (Fig. 16 and Fig. 17A). This incorporation of an initiating G allows dsRNAs to be generated in vitro against any twenty nucleotide segment of a targeted gene.
- the inventors compared the silencing capability of this novel "+G" configuration to in vitro synthesized siRNA that was perfectly complementary to the target.
- the inventors assessed suppression of a reporter gene product, green fluorescent protein (GFP), and of an endogenous gene product, lamin (Fig. 17B, 17C, 17D).
- GFP green fluorescent protein
- lamin an endogenous gene product
- Cos-7 cells were co-transfected with a plasmid encoding GFP and siRNAs containing either a perfect match to the GFP mRNA or the single 5' G mismatch.
- siRNAs containing multiple mismatches were used as negative controls for any non-specific effects ofthe transfection or siRNA.
- fluorescence microscopy and Western blot Fig. 17B, 17C
- the 5' mismatched siRNA displayed silencing efficiency similar to that of the perfectly matched siRNA targeted to the same region ofthe GFP mRNA.
- the inventors next investigated the ability of these novel siRNAs to inhibit expression of an endogenous gene product, lamin.
- the inventors fransfected HeLa cells with a negative confrol siRNA (siMiss) or a siRNA directed against endogenous lamin (Elbashir et al., 2001), and assessed expression 72 hr after transfection.
- Lamin expression was markedly reduced in cells transfected with siLamin+G, but remained robust in cells fransfected with siMiss+G (Fig 17D).
- “+G" siRNA remains an effective trigger of RNA interference.
- siRNAs with multiple internal mismatches may act by inhibiting translation (via a microRNA-like mechanism) rather than by cleaving the targeted mRNA (Zeng et al., 2003 ; Doench et al., 2003).
- the inventors took advantage ofthe new siRNA synthesis strategy in an effort to improve allele-specific silencing with the single mismatch.
- the inventors systematically tested the effect of placing the single nucleotide mismatch at each position near the predicted RISC cleavage site. Through this, it was hoped to identify siRNAs that would maximize allele specificity for V337M tau.
- the inventors co-transfected Cos-7 cells with flag epitope-tagged wild type tau, GFP-tagged mutant tau (V337M) and siRNAs in which the mutation had been placed at positions 9 through 12 ofthe targeted sequence. When the mismatch was placed at position 10 (siAlO), the mutant allele was strongly suppressed (Fig. 18 A).
- siRNA expression plasmids against tau were based on the inventors' most effective in vitro synthesized duplexes. Expression was driven by the tRNA-valine promoter (Kawasaki et al., 2003). The inventors again co-fransfected flag-WT-tau and V337M-GFP mutant tau together with shRNA plasmids designed to target either wild type or mutant tau.
- the tvAlO plasmid, based on the siAlO siRNA showed sfrong silencing ofthe mutant allele with only slight inhibition of wild type expression.
- siRNA designs can rapidly be generated and screened by the method described here in order to identify the best target sequence with which to create successful shRNA expression vectors. Once validated, these shRNAs can be incorporated into recombinant viral vectors for in vivo testing (Miller et al., 2003; Xia et al., 2002).
- the inventors systematically placed the tandem mismatch at each point in the central region of the siRNA duplexes to define the optimal placement for allele-specific suppression.
- APP silencing was assessed in Cos-7 cells cofransfected with constructs encoding wild type APP and APPsw together with the in vitro synthesized siRNAs. Similar to the results with tau, allelic discrimination was conferred only when the mismatches were placed centrally, as shown by APP immunofluorescence 48 hr after transfection (Fig. 19A).
- RNAi holds promise as a potential therapy for human diseases.
- Yet a limitation to successfully developing gene-specific or allele-specific siRNAs is the selection and design of siRNAs with the desired silencing characteristics. Individual siRNAs targeted to different regions of a transcript often display striking differences in efficacy and specificity (Miller et al, 2003; Ding et al, 2003). Typically, several target sites and designs need to be tested before optimal silencing is achieved (Miller et al., 2003).
- the inventors have described a simple method that not only circumvents the time and cost disadvantages of chemically synthesizing siRNA duplexes but also removes the sequence restrictions imposed by in vitro franscription with T7 polymerase.
- siRNA duplex The insertion of a single G mismatch at the 5' ofthe siRNA duplex permitted efficient priming by T7 polymerase without compromising the silencing efficacy ofthe resultant siRNA.
- Such "+G" siRNAs can rapidly be generated to essentially any point in a targeted gene and tested for efficacy.
- This approach to siRNA design facilitates the in vitro generation of effective siRNAs. As demonstrated here for two important disease targets, tau and APP, these in vitro transcribed duplexes can then serve as guides for producing shRNA plasmids that retain silencing capability and allele specificity. This approach represents an improved, stepwise method for optimized silencing of essentially any gene of interest.
- RNAi reagents developed here against tau and APP constitute an experimental and potential therapeutic advance for AD and related dementias. Although abnormal deposition of tau and the APP cleavage product A ⁇ are central to AD pathogenesis, the precise roles of these proteins in the brain remain to be elucidated (hardy et al., 2002; Lee et al., 2001). These siRNA reagents, which can be used to selectively silence expression of mutant or wild type tau and APP, should facilitate loss of function experiments aimed at identifying the neuronal functions of these proteins.
- siRNA For potential therapeutic applications of siRNA, the inventors have established expression vectors that silence mutant or wild type forms of tau and APP. For individuals with dominantly inherited AD or tauopathy, selective removal ofthe mutant protein might ameliorate or even prevent disease. The demonstration of specific silencing of mutant alleles extends the potential utility ofthe approach to genes with important or essential functions. For APP, specific silencing of either the widely studied Swedish double mutant or wild type APP was achieved. Reagents that suppress APPsw are useful in testing RNAi therapy in mouse models of AD, and reduction of wild type APP also has therapeutic potential for the common, sporadic form of AD.
- AD amyloid cascade hypothesis of AD
- a ⁇ production requires cleavage of APP by two proteases, the ⁇ site APP-cleaving enzyme BACE and the ⁇ -secretase complex, which contains presenilin (Sisodia et al., 2002).
- BACE the ⁇ site APP-cleaving enzyme
- ⁇ -secretase complex which contains presenilin (Sisodia et al., 2002).
- additional gene targets in AD include BACE and, for most familial AD, dominantly acting presenilin mutations.
- siRNA therapy A major challenge in applying siRNA therapy to the nervous system is achieving sustained, effective delivery of siRNA to the correct target cells in the brain.
- These data combined with in vivo results from other groups (Xia et al., 2002; Rubinson et al., 2003), suggest that siRNA will effectively suppress expression ofthe targeted gene, provided that it can be delivered efficiently to the appropriate neurons. Hope is offered by the observation here and elsewhere that sustained infracellular production of siRNA can be achieved with expression plasmids. These plasmids retain their silencing characteristics when incorporated into viral vectors that are known to transduce CNS neurons (Davidson et al., 2003).
Landscapes
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Virology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US32208602A | 2002-12-17 | 2002-12-17 | |
| US322086 | 2002-12-17 | ||
| US10/430,351 US20040023390A1 (en) | 2002-08-05 | 2003-05-05 | SiRNA-mediated gene silencing with viral vectors |
| US430351 | 2003-05-05 | ||
| WOPCT/US03/16887 | 2003-05-26 | ||
| PCT/US2003/016887 WO2004013280A2 (en) | 2002-08-05 | 2003-05-26 | ALLELE-SPECIFIC siRNA-MEDIATED GENE SILENCING |
| PCT/US2003/040292 WO2004058940A2 (en) | 2002-08-05 | 2003-12-16 | Sirna-mediated gene silencing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1581635A2 true EP1581635A2 (en) | 2005-10-05 |
| EP1581635A4 EP1581635A4 (en) | 2007-10-17 |
Family
ID=32685878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03814141A Withdrawn EP1581635A4 (en) | 2002-12-17 | 2003-12-16 | SILENCING MEDIA GENES BY SIRNA |
Country Status (2)
| Country | Link |
|---|---|
| EP (1) | EP1581635A4 (en) |
| AU (1) | AU2003301030A1 (en) |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20040023390A1 (en) * | 2002-08-05 | 2004-02-05 | Davidson Beverly L. | SiRNA-mediated gene silencing with viral vectors |
| US20050106731A1 (en) * | 2002-08-05 | 2005-05-19 | Davidson Beverly L. | siRNA-mediated gene silencing with viral vectors |
| US7605249B2 (en) * | 2002-11-26 | 2009-10-20 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of siRNA |
-
2003
- 2003-12-16 AU AU2003301030A patent/AU2003301030A1/en not_active Abandoned
- 2003-12-16 EP EP03814141A patent/EP1581635A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| EP1581635A4 (en) | 2007-10-17 |
| AU2003301030A1 (en) | 2004-07-22 |
| AU2003301030A8 (en) | 2004-07-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9487779B2 (en) | siRNA-mediated gene silencing | |
| AU2009202278B8 (en) | Allele-specific sirna-mediated gene silencing | |
| US10072264B2 (en) | RNA interference suppression of neurodegenerative diseases and methods of use | |
| US8524879B2 (en) | RNA interference suppresion of neurodegenerative diseases and methods of use thereof | |
| CA2596588C (en) | Nucleic acid silencing of huntington's disease gene | |
| US20050255086A1 (en) | Nucleic acid silencing of Huntington's Disease gene | |
| US20100190243A1 (en) | siRNA-MEDIATED GENE SILENCING WITH VIRAL VECTORS | |
| US20080176812A1 (en) | Allele-specific silencing of disease genes | |
| US20090105169A1 (en) | Allele-specific silencing of disease genes | |
| AU2005200827B2 (en) | Allele-specific siRNA-mediated gene silencing | |
| AU2005200828A1 (en) | siRNA-mediated gene silencing with viral vectors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20050715 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| PUAK | Availability of information related to the publication of the international search report |
Free format text: ORIGINAL CODE: 0009015 |
|
| DAX | Request for extension of the european patent (deleted) | ||
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C07H 21/04 20060101ALI20060530BHEP Ipc: C07H 21/02 20060101ALI20060530BHEP Ipc: A01N 47/40 20060101ALI20060530BHEP Ipc: C12N 15/63 20060101ALI20060530BHEP Ipc: C12N 15/00 20060101ALI20060530BHEP Ipc: C12P 19/34 20060101ALI20060530BHEP Ipc: C12Q 1/68 20060101AFI20060530BHEP |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20070914 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: A61K 48/00 20060101ALI20070910BHEP Ipc: A61K 38/00 20060101ALI20070910BHEP Ipc: C07H 21/04 20060101ALI20070910BHEP Ipc: C12N 15/11 20060101AFI20070910BHEP |
|
| 17Q | First examination report despatched |
Effective date: 20080310 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20090906 |