EP1575992A2 - Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof - Google Patents
Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereofInfo
- Publication number
- EP1575992A2 EP1575992A2 EP03767199A EP03767199A EP1575992A2 EP 1575992 A2 EP1575992 A2 EP 1575992A2 EP 03767199 A EP03767199 A EP 03767199A EP 03767199 A EP03767199 A EP 03767199A EP 1575992 A2 EP1575992 A2 EP 1575992A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- chimeric protein
- protein
- deaminase
- domain
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/62—DNA sequences coding for fusion proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/64—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue
- C12N9/6421—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from animal tissue from mammals
- C12N9/6424—Serine endopeptidases (3.4.21)
- C12N9/6429—Thrombin (3.4.21.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/78—Hydrolases (3) acting on carbon to nitrogen bonds other than peptide bonds (3.5)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y304/00—Hydrolases acting on peptide bonds, i.e. peptidases (3.4)
- C12Y304/21—Serine endopeptidases (3.4.21)
- C12Y304/21005—Thrombin (3.4.21.5)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
Definitions
- ADARs typically have two or more double stranded RNA binding motifs (DRBM) in addition to a catalytic domain whose tertiary structure positions a histidine and two cysteines for zinc ion coordination and a glutamic acid residue as a proton donor.
- DRBM double stranded RNA binding motifs
- the catalytic domain is conserved at the level of secondary and tertiary structure among ADARs, cytidine nucleoside/nucleotide deaminases and
- RNA secondary structure encompassing the adenosine(s) to be edited.
- RNA secondary structure is formed between the exon and a 3 ' proximal sequence with the downstream intron (Grosjean and Benne (1998); Smith (1997) RNA 3: 1105- 23; Smith (1996) Trends in Genetics 12:418-24; Maas (1996) J. Biol. Chem.
- ADAR mRNA substrates frequently contain multiple A to I editing sites and each site is selectively edited by an ADAR, such as ADAR1 or ADAR2.
- ADARs typically function autonomously in editing mRNAs. ADARs bind secondary structure at the editing site through their double stranded RNA binding motifs or DRBMs and perform hydrolytic deamination of adenosine through their catalytic domain.
- Deaminases play an important role in various disease processes.
- An example of a cytidine deaminase molecule is Activation Induced Deaminase (AID).
- AID plays a prominent role in class switch recombination and somatic hypermutation, amongst other functions.
- SHM Activation Induced Deaminase
- Several genetic defects in SHM, which lead to hyper-IgM syndrome, have been described in humans (Durandy Biochemical Society p. 815-818, 2002).
- these pathologies demonstrate definitively the requirement of CD40- mediated nuclear factor KB activation and the essential role of AID in an efficient humoral response, which includes class switch recombination and the production of high-affinity antibodies.
- the present invention is directed to overcoming these deficiencies in the art by providing a chimeric protein capable of transduction into B cells for purposes of treating CSR and SHM, as well as other conditions such as B cell lymphoma.
- CEM15/APOBEC-3G is another cytidine deaminase and APOBEC-1 homolog. CEM15 has been shown to posess antiviral activity.
- Current therapies for HIV infected patients target the production of new virus by antiviral agents that prevent replication of the viral RNA genomes into DNA prior to integration of the HIV DNA into chromosomal DNA or the disruption of the production or function of viral encoded proteins that are necessary for production of infectious viral particles.
- Antiviral agents that target viral replication have blunted the course of disease in patients already infected with HIV but these drugs have side effects due to toxicity and, while extending life for many patients, ultimately fail due to the high mutation frequency of HIV-1.
- Disruption of viral encoded protein production has not been as effective due largely to the high mutation rate of HTV and its consequence of changing the viral protein to one that retains function but no longer is a target for the therapy.
- a combination of therapies together with better screening of blood supplies and blood products, improved public education and safe-sex practices has curbed the spread of disease only in developed countries but, even in these countries, exhibit incomplete control over the spread of the virus.
- Needed in the art is a means of editing RNA or DNA involved in disease processes, like HTV, hyper-IgM syndrome, and other cytidine deaminase related diseases, thus preventing or ameliorating the symptoms, and in the case of retroviral-based diseases, eventually irradicating these diseases.
- this invention in one aspect, relates to chimeric proteins comprising a protein transduction domain and a deaminase domain and methods of making and using such chimeric proteins.
- the present invention is an important improvement over the prior art because of the advantages of protein therapy and delivery as compared to gene therapy.
- Figure 1 shows the effect of introns on editing efficiency.
- A Diagram of the chimeric apoB expression constructs. The intron sequence (TVS) is derived from the adenovirus late leader sequence. Coordinates of the human apoB sequence are shown and the location of PCR amplimers are indicated. X indicates the deleted 5' splice donor or 3' splice acceptor sequences. CMV, cytomegalovirus.
- B Poisoned-primer-extension assays of amplified apoB RNAs. Pre-mRNA and mRNA were amplified with the MS 1/MS2 or SP6/T7 amplimers respectively.
- Editing efficiencies an average for triplicate transfections, for each RNA are shown beneath. Editing efficiency was determined as the number of counts in edited apoB mRNA (UAA) divided by the sum of counts in UAA plus those in unedited apoB mRNA (CAA) and multiplied by 100. 9. Figure 2 shows the effect of intron proximity on editing efficiency.
- FIG. 2a shows a diagram of the chimeric apoB expression constructs.
- IVS- (IVS ⁇ 3'5')-a ⁇ oB and ⁇ VS-(JVS ⁇ 3'5') 2 -apoB were created by the insertion of one or two copies respectively of the IVS ⁇ 3'5' intron cassette into IVS-apoB.
- Human apoB coordinates and amplimer annealing sites are indicated (see Figure 1).
- Figure 2b shows poisoned-primer-extension assays of amplified apoB RNAs. Pre-mRNA and mRNA were amplified with the MS7/MS2 or SP6/T7 amplimers respectively. Editing efficiencies, an average for duplicate transfections, for each RNA are shown beneath.
- Figure 3 shows that the editing sites within introns are poorly utilized.
- Panel A shows a diagram of the chimeric apoB expression constructs. The apoB editing cassette was inserted as a PCR product into a unique HindHI site 5' of the polypyrimidine tract in IVS-apoB and IVS- ⁇ 3'5'apoB (see Figure 1). Amplimer annealing sites are indicated.
- Panel B shows poisoned primer extension assays of amplified apoB RNAs. Unspliced pre-mRNA and intron containing RNA were amplified with the Exl/Ex2 or MS D5/MS D6 amplimers respectively. Editing efficiencies, an average for duplicate transfections, for each RNA are shown beneath.
- Figure 4 shows that editing is regulated by RNA splicing.
- Figure 4A shows a diagram of the modified CAT reporter construct (CMV128) used in the Rev complementation assay; a gift from Dr Thomas J. Hope of the Salk Institute.
- the splice donor (SD), splice acceptor (SA), RRE, intron and 3 ' long tandem repeat (LTR) are from the HIV-1 genome.
- CMV128 was modified by insertion of the apoB editing cassette as a PCR product into the BamHI site 3 ' of the CAT gene. Amplimer annealing sites are indicated.
- Figure 4B shows McArdle cell CAT activity in the absence (Vector) or presence of the Rev transactivator. Values are averages for duplicate experiments.
- CMVCAT was an assay control transfection.
- Figure 4C shows poisoned-primer-extension assays of amplified apoB RNAs. 'Intron and exon RNA' was amplified using the EF/MS2 amplimers. Editing efficiencies for each RNA are shown beneath. Promiscuous editing is indicated by T.
- Figure 5 shows the adenosine deaminases, cytidine deaminase and cognate RNA binding protein.
- conserved residues within the zinc-dependent deaminase domain ZDD
- the catalytic domain of APOBEC-1 is characterized by a ZDD with three zinc ligands (either His or Cys), a glutamic acid, a proline residue and a conserved primary sequence spacing (Mian, IS., (1998) J Comput Biol. 5:57-72.).
- ADARs bind to their editing sites through double stranded
- RNA binding domains (DRBM) (Keegan, L.P., (2001) Nat Rev Genet. 2:869-78) and may be catalytically active as homodimer.
- the indicated residues in the catalytic site of APOBEC-1 bind AU-rich RNA with weak affinity.
- the leucine rich region (LRR) of APOBEC-1 has been implicated in APOBEC-1 dimerization and shown to be required for editing (Lau, P.P., (1994) Proc Natl Acad Sci USA,
- RNA recognition motifs are required for mooring sequence-specific RNA binding and these domains plus sequence flanking them are required for APOBEC-1 interaction and complementation (Blanc, V., (2001) J Biol Chem. 276:46386-93.; Mehta, A., (2002) RNA. 8:69-82).
- APOBEC-1 complementation activity minimally depends on ACF binding to both APOBEC-1 and mooring sequence RNA.
- a broad APOBEC-1 complementation region is indicated that is inclusive of all regions implicated in this activity (Blanc, V (2001) J Biol Chem. 276:46386-93.; Mehta, A., (2002) RNA. 8:69-82.).
- FIG. 13 shows schematic depictions and structure-based alignments of APOBEC-1 in relation to its related proteins (ARPs).
- Panel A shows the gene duplication model for cytidine deaminases.
- CDDl belongs to the tetrameric class of cytidine deaminases with a quaternary fold nearly identical to that of the tetrameric cytidine deaminase from 5. subtilis (Johansson, E., (2002) Biochemistry. 41:2563- 70).
- Such tetrameric enzymes exhibit the classical ⁇ topology of the Zinc Dependent Deaminase Domain (ZDD) observed first in the Catalytic Domain (CD) of the dimeric enzyme from E. coli (Betts, L. (1994) J Mol Biol. 235:635-56).
- ZDD Zinc Dependent Deaminase Domain
- an ancestral CDDl -like monomer (upper left ribbon) duplicated and fused to produce a bipartite monomer.
- a C- terminal Pseudo-Catalytic Domain (PCD) arose that lost substrate and Zn 2+ binding abilities (upper right ribbon).
- the interdomain CD-PCD junction is characterized by a linker that features conserved Gly residues necessary for editing.
- the putative function of the PCD is to stabilize the hydrophobic monomer core and to engage in auxiliary factor binding. Modern representatives of this fold include APOBEC-1 and AID.
- ARPs such as APOBEC-3B may have arisen through a second gene duplication to produce a pseudo-homodimer on a single polypeptide chain (lower ribbon); properties of the connector polypeptide are unknown.
- Signature sequences compiled from strict structure-based alignments (upper) and relaxed computational searches (lower) are shown below respective ribbon diagrams, where X represents any amino acid. Linker regions (lines) and the location of Zn 2+ binding (spheres) are depicted.
- experimental evidence suggests APOBEC- 3B has reduced Zn 2+ binding and exists as a dimer (Jarmuz, A., (2002) Genomics 79:285-96), modeling studies suggest it binds Zn 2+ as shown and may function as a monomer.
- Inset spheres represent the proper (222) CDDl -like quaternary structure symmetry whereas APOBEC-1 -like enzymes exhibit pseudo-symmetry relating CD and PCD subunits.
- Panel B shows the structure based sequence alignment for ARPs. Sequences from human APOBEC- 1 , AID, and APOBEC-3B were aligned with the known cytidine deaminase structures from E. coli, B. subtilis and S. cerevisiae. Alignments were optimized to minimize gaps in major secondary structure elements depicted as red tubes ( ⁇ -helices) and arrows ( ⁇ -strands); loops, turns, and insertions are marked L and T and i, respectively.
- L-Cl and L-C2 represent distinct loop structures in the dimeric versus tetrameric cytidine deaminases; ARP enzymes were modeled according to the dimeric conformation (L-C2). Sections of basic residues that overlap the bipartite NLS are marked BP-1 and BP-2.
- Panel C shows a schematic diagram of the domain structure observed in APOBEC-1 and related ARPs based upon computer-based sequence alignments using the ZDD signature sequence shown in the lower panel of A.
- Figure 7 shows antibody diversity generated during B-cell development and maturation by multiple genetic mechanisms; namely Ig gene rearrangement, somatic hypermutation and gene conversion.
- immature B lymphocytes developing in fetal liver or adult bone marrow use RAG1 and RAG2 proteins to generate DNA double strand breaks whose ends are rejoined by non-homologous end joining.
- the rearranged immunoglobulin V (variable), D (diversity) and J (joining) gene segments at the Ig heavy chain locus encode a variable region that is expressed initially with the ⁇ constant region (C ⁇ ) to form a primary antibody repertoire composed of IgM antibodies (Figure 7a).
- the system developed for the identification of single nucleotide polymorphisms in DNA, is used to identify mRNA editing substrates as well as sites of DNA mutation.
- Double- stranded cDNA are synthesized and PCR amplified from mRNA isolated from wild type NIH3T3 cells and from transfected NIH3T3 cells that have expressed AID for 48-72 h (a time period in which CSR was observed on an artificial switch construct).
- the two separate double stranded cDNA pools are digested with DpnJJ to generate approximately 300 bp fragments with GATC overhangs.
- cDNAs from wild type NTH3T3 cells are cloned into BamHI digested (GATC overhang) Cre expression vector (pCrelOO), transformed into dam minus ⁇ .coli and unmethylated, single-stranded DNA isolated using helper phage M13K07.
- the pool of cDNA fragments prepared from RNA isolated from AJD-transfected NIH3T3 cells are methylated using Taql methylase (N ⁇ B) and then combined with BamHI linearized, methylated pCre200 (identical to pCrelOO except for an inactivating 5 bp deletion within the Cre recombinase gene).
- the resultant methylated, Cre-deficient, edited cDNA pool is combined with the single-stranded, unmethylated, active-Cre+, unedited cDNA library, denatured and then reannealed to form heteroduplexes.
- Taq DNA ligase N ⁇ B is used to form closed circles of hemi-methylated heteroduplexes. Addition of exonuclease HI converts DNA that has not been closed with Taq ligase to single stranded DNA, which is then removed.
- the heteroduplex mixture is transformed into an electrocompetentE.co/t strain (Editing Site Identifier; ESI) engineered to carry on its episome (F' factor) a tetracycline resistance gene flanked by two lox sites.
- the heteroduplex mixture contains: (i) perfect cDNA homoduplexes from mRNAs that are not AID substrates from the two cell sources (not shown) and (ii) four different possible cDNA duplexes resulting from AID mRNA substrates in their unedited (homoduplex) and edited (heteroduplex) forms (shown).
- the selection mismatch repair and cre recombinant system of Figure 8 can be used to identify mutated DNA sequences. This system can be applied for evaluating mRNA editing sites or DNA mutation sites due to APOBEC-1, AID, CEM15 and any other ARP.
- Figure 9 shows the selection scheme and verification of true positives from Example 7, using cDNAs encoding APOBEC-and ACF. Success with this system in selecting appropriate interactions is evident as robust growth under his- selection (left) and appearance of colonies on filter 'lifts' (right) for APOBEC-1 interaction as homodimers and heterodimers with ACF.
- the positive control p53 binds to S V40T antigen
- negative control lamin C does not bind to APOBEC- 1 confirmed the stringency of the selection system.
- Figure 10 shows homology models of ARP enzymes.
- the linker appears in all ARPs and can provide an important flexibility element that sequesters the single-stranded substrate in an active site cleft where it is edited or mutated, respectively.
- E. coli exhibits a comparable linker in its three-dimensional structure, the linker is long ⁇ 19 amino acids and appears well-ordered in the structure. This indicates some degree of rigidity that can preclude large polymeric substrates such as RNA or DNA from entering into its active site.
- CEM15's general structure is expected to be analogous to APOBEC-1 and ADD (above - right).
- Figure 11 shows Poisened primer extension assays and western analysis for Cddl mutants and chimeric proteins.
- Cddl In the context of late log phase growth in yeast with galactose feeding, overexpressed Cddl is capable of C to U specific editing of reporter apoB mRNA at site C6666 at a level of 6.7%, which is ⁇ 1 Ox times greater than the negative control (empty vector - compare lanes 1 and 2, above).
- the CDA from E. coli (equivalent to PDB entry 1AF2) is incapable of editing on the reporter substrate (lane 3).
- the active site mutants E61A and G137A abolish detectable Cddl activity (lanes 4 and 5).
- Figure 12 shows an ARP model that shows a restructuring of the active site linker that makes the entire region spanning from 130 to 142 (human APOBEC- 1 numbering) flexible in a manner that moves to accommodate large polymeric substrates such as RNA or DNA.
- FIG. 13 shows the model for CEM15.
- the CEM15 sequence was modeled manually using the computer graphics package O (Jones Acta Crystallogr
- CEM15 can be accommodated by a dimeric CDA quaternary fold (analogous to the E. coli CDA or APOBEC-1 with 2 x 236 amino acids).
- FIG. 14 shows an APOBEC-1 structural model compared to a CEM15 structural model.
- CEM15 adopts a CD1-PCD1-CD2-PCD2 tertiary structure with pseudo-222 symmetry (Fig. 14a) on a single polypeptide chain (Fig. 14b).
- Figure 15 shows possible CEM15 oligomers. These mutants address whether the CEM15 functions as a monomer, or as a dimer that dictates substrate specificity.
- Dimeric CEM15 structures (Figs. 15c & 15d) show mutually exclusive intermolecular contacts. The salient feature of interaction 15c, is that each CD pairs with itself, and similarly for each PCD. In contrast, every domain in 15d falls in a unique environment (i.e. no CD or PCD pairs with itself). Therefore, to evaluate the need for either single or dual catalytic domain requirements for the anti- viral effect, express truncations are expressed.
- the invention provides a means of delivery of deaminases, which avoids the problems of unregulated protein expression and the risk that over-expression can induce aberrant mRNA editing or unwanted nonspecific DNA mutations associated with delivery and expression of these proteins via gene therapy.
- deaminases are useful in a variety of diseases, such as those where the lack of enzyme expression or mutations within the endogenous genes encoding these enzymes are responsible for the absence, or reduction of, appropriate levels of enzyme activity.
- Cytosine Deaminase Active on RNA is APOBEC-1 (apolipoprotein B mRNA editing catalytic subunit 1) (accession # NM_005889) encoded on human chromosome 12. (Grosjean and Benne (1998); Lau (1994) PNAS 91:8522-26; Teng (1993) Science 260:1816-19).
- APOBEC-1 edits apoB mRNA primarily at nucleotide 6666 (C 6666 ) and to a lesser extent at
- apoB mRNA editing results in increased production and secretion of B48 containing very low density lipoproteins and, correspondingly, a decrease in the abundance of the atherogenic apoBlOO containing low density lipoproteins in serum (Davidson (1988) JBC 262:13482-85; Baum (1990) JBC 265:19263-70; Wu (1990) JBC 265:12312-12316; Harris and Smith (1992)
- ApoB is translated from a 14 kb mRNA that is transcribed from a single copy gene located on human chromosome 2 (Scott (1989) J. Mol. Med. 6:65- 80).
- ApoB protein is a non-exchangeable structural component of chylomicrons and of very low density (VLDL) and low density (LDL) lipoprotein particles.
- RNA secondary structure does not appear to be required for apoB RNA editing. Instead, apoB mRNA editing requires an 11 nucleotide motif known as the mooring sequence. Placement of the mooring sequence 4-8 nucleotides 3' of a cytidine within reporter RNAs is frequently sufficient for that RNA to support editing (Smith (1993) Seminars in Cell Biol. 4:267-78; Sowden (1998) Nucl. Acids Res. 26:1644-1652; Backus and Smith (1992) Nucl. Acids Res. 22:6007-14; Backus and Smith (1991) Nucl. Acids Res. 19:6781-86; Backus and Smith (1994) Biochim. Biophys.
- RNA 2:274-88 The mooring sequence is left intact in edited mRNA and therefore its occurrence downstream of a cytidine is predictive of an editing site.
- APOBEC-1 relies on auxiliary proteins for RNA recognition (Grosjean and Benne (1998); Teng (1993) Science 260:1816-19; Sowden (1998) Nucl. Acids Res. 26:1644-52; Inui (1994) J. Lipid Res. 35:1477-89; Dance (2001) Nucl. Acids
- APOBEC-1 only has weak RNA binding activity of low specificity (Anant (1995) JBC 270:14768-75; MacGinnitie (1995) JBC 270:14768- 75).
- APOBEC-1 requires, in addition to the mooring sequence described above, RNA binding proteins that bind apoB mRNA and to which APOBEC-1 can bind and orient itself to C6666.
- apoB RNA, recombinant APOBEC-1 and proteins known as ACF/ASP APOBEC-1 Complementing Factor/APOBEC-1 Stimulating Protein
- ACF/ASP APOBEC-1 Complementing Factor/APOBEC-1 Stimulating Protein
- ACF was isolated and cloned using biochemical fractionation and yeast two hybrid genetic selection (Mehta (2000) Mol. Cell Biol. 20:1846-54; Lellek (2000) JBC 275:19848-56).
- Overexpression of 6His-tagged APOBEC-1 in mammalian cells enabled the intracellular assembled editosome to be affinity purified (Yang ( 1997) JBC 272 :27700-06) .
- These studies demonstrated that ACF associated with APOBEC-1 through IM NaCl resistant interactions and that three other RNA binding proteins (100 kDa, 55 kDa and 44 kDa) with affinity for the mooring sequence co-purified with the editosome (Yang (1997) JBC 272:27700- 06).
- PI 00 and p55 were both mooring sequence selective RNA binding proteins but p44 was a general RNA binding protein.
- Additional studies utilizing yeast two hybrid analyses using APOBEC-1 affinity and antibodies developed against the editosome and ACF have demonstrated proteins such as hnRNP ABBP1 (Lau (1997) JBC 272: 1452-55), the alternative splicing factor KSRP (Lellek (2000) JBC 275:19848-56) and ⁇ I3 serum proteinase inhibitor as positive modulators of editing activity (Schock (1996) PNAS 93:1097-1102) and hnRNP protein C (Greeve (1998) Biol. Chem. 379:1063-73) and GRY-RBP (Blanc (2001) JBC 276: 10272-83; Lau
- APOBEC-1 Structure-based homology modeling has provided insight into the fold of APOBEC-1 ( Figure 6), and the modeling of APOBEC-1 has been corroborated by protein engineering, site-directed mutagenesis, and functional analyses.
- the current model for APOBEC-1 is a two domain structure comprising a catalytic domain (CD) (used interchangeably throughout with Cddl) and a pseudo-catalytic domain (PCD) joined by a central linker, which folds over the active site ( Figure 6).
- CD catalytic domain
- PCD pseudo-catalytic domain
- the APOBEC-1 model also provides a rationale for losses in editing due to surface point mutations, such as F156L (Navaratnam Cell 81(2): 187-95), located 25 A from the active site. Such a change can influence auxiliary factor binding. Other mutations such as K33A/K34A abolish activity (Teng (1999) J Lipid Res, 40(4) 623-35).
- CDARs have attracted interest because they share homology with the catalytic domain found in APOBEC-1 and the ADARs and they also have interesting physiological circumstances for their expression.
- One characteristic of the catalytic domain in ARPs and ADARs is the occurrence and spacing of a histidine and two cysteines (or three cysteines), required for the coordination of a zinc atom, also known as the zinc binding domain or ZBD (Grosjean and Benne; Mian (1998) J. Comput. Biol. 5:57-72).
- the ZBD of ADARs is distinguishable from that found in cytidine deaminases because the third cysteine in ADARs is located significantly further in primary sequence from the second conserved cysteine residue (Mian (1998) J. Comput. Biol. 5:57-72; Gerber (2001) TIBS 26:376-84).
- the ZBD of APOBEC-1 is located in the N-terminal half of the protein and modeling has suggested that a pseudo- (nonfunctional) ZBD domain is repeated in the C-terminus (Mian (1998) J. Comput. Biol. 5:57-72).
- Table 1 shows APOBEC-1 and ARPS have been described previously (Anant, S., Am J Physiol Cell Physiol. 281:C1904-16.; Dance, G.S., (2001) Nucleic Acids Res. 29:1772-80.; Jarmuz, A., (2002) Genomics 79:285-96) and extended through amino acid similarity searches with the (1) hidden Markov modeling software SAM trained with CDD 1 , APOBEC- 1 , APOBEC-2, AID and Phorbolin 1 ,
- CDDlff rXU NP H334& ScCDAR-1
- Structural homology is derived from the fact that dimeric CD As arose from gene duplication of a CD precursor (Betts (1994) J Mol Biol 235(2):635-56;
- ADD GenBank accession # BC006296
- human chromosome 12 Muramatsu (1999) JBC 274:18740-76; Muramatsu (2000) Cell 102:553-64; Revy (2000) Cell 102:565-76).
- ADD has a zinc-dependent cytidine deaminase domain (ZDD) with characteristic sulfhydryl groups for zinc coordination, and glutamic acid for proton shuttling during hydrolytic deamination as well as a leucine-rich C-terminal domain for protein-protein interactions.
- ZDD zinc-dependent cytidine deaminase domain
- ADD has a 34% amino acid identity to APOBEC-1. This together with AID's in vitro cytidine deaminase activity (Muramatsu J. Biol. Chem.
- AID's homology with APOBEC-1 also suggests that it functions as an mRNA editing enzyme.
- AJJD's requirement in human B lymphocyte function is likely due to its role as the catalytic component of an enzyme complex that alters (edits) the sequence of an essential mRNA.
- ADD can deaminate (edit) cytidine to form uridine of mRNA(s).
- the novel protein variant(s) encoded by edited mRNA(s) (referred to as ADD-Editing-Target or AET) is proposed to promote class switch recombination (CSR) and somatic hypermutation (SHM) of Ig genes.
- CSR class switch recombination
- SHM somatic hypermutation
- the effect of mRNA editing may be to inactivate a protein(s) that is an inhibitor of
- ADD homologous knockout mice demonstrated that ADD expression was the rate limiting step for class switch recombination (CSR) and required for an appropriate level of somatic hypermutation (SHM) (Minegishi, Y., (2000) Clin Immunol. 97:203-10).
- CSR class switch recombination
- SHM somatic hypermutation
- the expression of ADD controls antibody diversity through multiple gene rearrangements involving mutation of DNA sequence and recombination.
- the initial expression of antibodies requires immunoglobulin (Ig) gene rearrangement that is AID-independent (Muramatsu, M., (2000) Cell 102:553- 63).
- ADD cannot substitute for APOBEC-1 in the editing of apoB mRNA (Lee, R.M. (1998) Gastroenterology. 115:1096-103) and, although this negative result may have been expected (given that most editing enzymes have substrate specificity (Grosjean and Benne (1998)), it did suggest that ADD may have another activity. Consistent with the findings that AID is an mRNA editing enzyme is the finding that de novo protein synthesis subsequent to AJJD activity was necessary for CSR. Therefore, a novel protein made from edited mRNA was essential for CSR.
- ADD overexpression in NIH 3T3 fibroblasts resulted in the deamination of deoxycytidine in DNA encoding a green fluorescent protein (GFP) (Petersen-Mahrt, S.K. (2002) Nature 418:99-104) and also in antibiotic resistance and metabolic genes when AID expression in bacteria was placed under selection for a 'mutator' phenotype (Rada, C. (2002) Proc. Natl. Acad. Sci USA. 99:7003-
- GFP green fluorescent protein
- the target hotspot for ADD is characterized by the motif RGYW (SEQ DD NO: 9) (R is A or G, Y is C or T and W is A or T) (Honjo Annu Rev Immunol 20: 165-96, 2002; Martin Nat Rev Immunol, 2(8):605-14, 2002).
- ADD appears to act processively on DNA, binding initially to SEQ DD NO: 9 and mutating dC to dU and then modifying multiple dC residues from that point along the same strand of DNA. ADD's ability to act on DNA would not negate the possibility that it also acts on RNA. Whether ADD is involved in DNA and/or RNA modification, its function clearly results in the diversification of expressed genomic sequences. These findings indicate that ADD, if unregulated, can induce DNA mutations leading to disease such as cancer.
- ADD is constitutively expressed in human B cell malignancies such as diffuse large B cell lymphomas (DLBCL) and some chronic lymphocityc leukemias
- CLL follicular and MALT lymphomas
- ADD expression is uncoupled from somatic hypermutation activity, a feature that correlates with more aggressive forms of these diseases. It appears that ADD function is aberrant in B cell cancers. In fact, oncogene mutations with patterns resembling SHM have been found at high frequency in B cell lymphomas. It appears that loss of targeting specificity of the SHM process is involved in the transformation and/or progression of B lymphoid malignancies.
- HNPCC hereditary non-polyposis colon cancer
- Human APOBEC-2 (Genbank Accession # XM004087) is encoded on chromosome 6 and is expressed uniquely in cardiac and skeletal muscle (Liao, Biochem Biophys. Res. Commun. 260:398-404). It shares homology with APOBEC-1 's catalytic domain, has a leucine/isoleucine-rich C-terminus and a tandem structural homology of the ZBD in its C-terminus. APOBEC-2 deaminated free nucleotides in vitro but did not have editing activity on apoB mRNA. D. CEM15/APOBEC-3
- Phorbolins 1, 2, 3, and Phorbolin- 1 related protein were identified in skin from patients suffering from psoriasis and were shown to be induced (in the case of Phorbolins 1 and 2) in skin treated with phorbol 12- myristate-1 -acetate (Muramatsu, M. (1999) J Biol Chem. 274:18470-6). The genes for these proteins were subsequently renamed as members of the APOBEC-3 or
- ARCD family locus (Table 1) (Madsen, P. (1999) J Invest Dermatol. 113:162-9). ' Bioinformatic studies revealed the presence of two additional APOBEC-1 related proteins in the human genome. One is an expressed gene (XM_092919) located just 2 kb away from APOBEC-3 G, and is thus likely to be an eighth member of the family. The other is at position 12q23, and has similarity to APOBEC-3G.
- APOBEC-3 variants show homology to cytidine deaminases (Figure 6c). As anticipated from the SBSA, some of these proteins bind zinc and have RNA binding capacities similar to APOBEC-1 (Madsen, P. (1999) J Invest Dermatol. 113:162-9). However, analysis of APOBEC-3A, -3B and -3G revealed them unable to edit apoB mRNA (Madsen, P. (1999) J invest Dermatol. 113: 162-9; Muramatsu,
- CEM15 antiviral activity is derived from effects on viral RNA or reverse transcripts. CEM15 deaminates dC to dU as the first strand of DNA is being made by reverse transcriptase or soon after its completion, and this results in dG to dA changes at the corresponding positions during second strand DNA synthesis.
- the infectivity assay in the context of Vif minus pseudotyped viruses and 293 T cells either lacking or expressing CEM15 is found in Example 10.
- VSV G-protein pseudotyped lentiviral particles that confirmed the inhibitory effect of CEM15 on the infectivity of Vif and Vif- particles and is amenable to the rapid demarcation of the regions of HIV-1 DNA (or RNA) that is the target for CEM15 catalytic activity.
- Human HIV-1 virus contains a 10-kb single-stranded, positive-sense RNA genome that encodes three major classes of gene products that include: (i) structural proteins such as Gag, Pol and Env; (ii) essential trans-acting proteins
- Vif is required for efficient virus replication in vivo, as well as in certain host cell types in vitro (Fisher, Science 237(4817):888-93, 1987; Strebel, Nature 328(6132):728-30, 1987) because of its ability to overcome the action of a cellular antiviral system (Madani, J Virol 72(12):10251-5, 1998; Simon, Nat Med 4(12): 1397-400, 1998).
- vz ⁇ deleted molecular clones of H ⁇ V-1 is strikingly different in vz/-permissive cells (e.g. 293T, SUPTl and CEM-SS T cell lines), as compared to vzjfrion-permissive cells (e.g.
- vz/-deleted HIV-1 clones replicate with an efficiency that is essentially identical to that of wild- type virus, whereas in the latter cells, replication of vz/-negative HIV-1 mutants is arrested due to a failure to accumulate reverse transcripts and inability to generate infectious proviral integrants in the host cell (Sova, J Virol 67(10):6322-6, 1993; von Schwedler, J Virol 67(8):4945-55, 1993; Simon, J Virol 70(8):5297-305, 1996; Courcoul J Virol 69(4):2068-74, 1995).
- CEM15 (Sheehy, A.M., (2002) Nature 418:646-650) in non- permissive cells for vz/mmus viruses.
- CEM 15 antiviral activity is derived from effects on viral RNA or reverse transcripts (Sheehy, A.M., (2002) Nature 418:646-
- CEM 15 deaminates dC to dU as the first strand of DNA is being made by reverse transcriptase or soon after its completion, and this results in dG to dA changes at the corresponding positions during second strand DNA synthesis (Harris, Cell 113:803-809, 2003).
- 50. Vif is known to have binding affinity for both viral RNA genomes and a variety of viral and cellular proteins (Simon, (1996) J. Virol. 70 (8):5297-5305; Khan, (2001) J. Virol. 75(16):7252-7265; Henzler, (2001) J. Gen Virol. 82: p. 561- 573).
- Vif also can forms homodimers and homotetramers through its proline rich domain (Yang, (2002) J. Biol Chem. 278(8):6596-6602).
- the infectivity assay in the context of Vif minus pseudotyped viruses and 293 T cells either lacking or expressing CEM 15 is found in Example 1.
- An assay was developed using VSV G- protein pseudotyped lentiviral particles that confirmed the inhibitory effect of CEM 15 on the infectivity of vif+ and vif- HIV-1 particles and is amenable to the rapid demarcation of the regions of HIV- 1 DNA (or RNA) that is the target for CEM 15 catalytic activity.
- CEM15 The premise of molecular modeling is that primary sequence analysis alone is insufficient to evaluate effectively the HTV-1 anti-infectivity activity of CEM15.
- the use of homology to model CEM 15 is based on three known CDA crystal structures (Betts J Mol Biol, (1994) 235(2): p. 635-56; Johansson, E. Biochemistry, (2002) 41(8): p. 2563-70) and knowledge gained from similar work with APOBEC-1.
- CEM15 modeling has been accomplished by threading its amino acid sequence onto a composite three : dimensional template derived by superposition (Winn J Synchrotron Radiat, 2003. 10(Pt 1): p. 23-5; Kabsch, W
- Albeit CEM15 adopts a CD1-PCD1-CD2-PCD2 tertiary structure with pseudo-222 symmetry (Fig. 14a) on a single polypeptide chain (Fig. 14b).
- the resulting CEM 15 model provides a rational basis for the design of four classes of mutants: (id) active site zinc (cyan sphere, Fig. 13) ligand changes His65Ala (257), Cys97Ala (288), and CyslOOAla (291), (CD2 residues are noted parenthetically) and (tb) active site proton shuttle Glu57Gln (259).
- Ranges may be expressed herein as from “about” one particular value, and/or to "about” another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about,” it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as “about” that particular value in addition to the value itself. For example, if the value "10" is disclosed, then “about
- subject is meant an individual.
- the subject is a mammal such as a primate, and, more preferably, a human.
- the term “subject” can include domesticated animals, such as cats, dogs, etc., livestock (e.g., cattle, horses, pigs, sheep, goats, etc.), and laboratory animals (e.g., mouse, rabbit, rat, guinea pig, etc.).
- contacting is meant an instance of exposure of at least one substance to another substance.
- contacting can include contacting a substance, such as a cell, or cell to a chimeric protein or analog described herein.
- a cell can be contacted with the chimeric protein or analog, for example, by adding the protein or analog to the culture medium (by continuous infusion, by bolus delivery, or by changing the medium to a medium that contains the agent) or by adding the agent to the extracellular fluid in vivo (by local delivery, systemic delivery, intravenous injection, bolus delivery, or continuous infusion).
- the duration of contact with a cell or group of cells is determined by the time the protein or analog is present at physiologically effective levels or at presumed physiologically effective levels in the medium or extracellular fluid bathing the cell.
- a virally infected cell e.g., an HIV infected cell
- a cell at risk for viral infection e.g., before, at about the same time, or shortly after HIV infection of the cell
- a chimeric protein or analog is contacted with a chimeric protein or analog.
- Treatment or “treating” means to administer a composition to a subject with an undesired condition or at risk for the condition.
- the condition can be any pathogenic disease, autoimmune disease, cancer or inflammatory condition.
- the effect of the administration of the composition to the subject can have the effect of but is not limited to reducing the symptoms of the condition, a reduction in the severity of the condition, or the complete ablation of the condition.
- an effective amount is meant a therapeutic amount needed to achieve the desired result or results, e.g., editing nucleic acids, interrupting CEM15-Vif binding, reducing viral infectivity, inducing class switch recombination, inducing somatic hypermutation, enhancing or blunting physiological functions, altering the qualitative or quantitative nature of the proteins expressed by cell or tissues, and eliminating or reducing disease causing molecules and/or the mRNA or DNA that encodes them, etc.
- inhibition means to reduce activity as compared to a control (e.g., activity in the absence of such inhibition). It is understood that inhibition can mean a slight reduction in activity to the complete ablation of all activity.
- An “inhibitor” can be anything that reduces activity.
- an inhibition of CEM15- binding by a disclosed composition can be determined by assaying the amount of CEM 15-Vif binding in the presence of the composition to the amount of CEM15-Vif binding in the absence of the composition.
- the composition can be said to inhibit the CEM15-Vif binding.
- the ADD molecule can also be inhibited. 63.
- Many methods disclosed herein refer to "systems.” It is understood that systems can, for example, be cells or, for example, columns or batch processing containers, or, for example, culture plates, or for example the combination of unique bacterial or mammalian cells together with recombinant molecules expressed therein such as in a genetic screening system used for the purpose of enriching and identifying macromolecules with sequences of specific interest.
- a system is a set of components, any set of components that allows for the steps of the method to performed.
- a system will comprise one or more components, such as a protein(s) or reagent(s).
- One type of system disclosed would be a cell that comprises both Vif and CEM15, for example.
- Another type of system would be , one that comprises a cell and an infective unit (e.g., an HTV unit).
- a third type of system might be a chromatography column that has CEM15, ADD, or other deaminase or putative deaminase, bound to the column.
- a fourth type of system might be a cell that comprises eitherADD or CEM15.
- viral infected mammalian cell system an in vitro or in vivo system infected by a virus.
- a system can include mammalian cellular components; mammalian cells, tissues, or organs; and whole animal systems.
- compositions can be labeled. Labeling can include covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the molecule being labeled, which can be determined empirically or through structure and structure-activity data and/or molecular modeling. Derivitization (e.g., labeling) of the compositions should not substantially interfere with the desired biological or pharmacological activity of the composition.
- a spacer e.g., an amide group
- deaminase refers to an enzyme in the ARP of ADAR family. Such an enzyme has the ability to remove an amine group from a cytidine/deoxycytidine or adenosie residue (respectively) through a hydrolytic elimination reaction, whether these substrates exist as free nucleosides/nucleotides or as part of the sequence of nucleotides with RNA or DNA.
- APOBEC-1, CEM15, and AID are discussed as the specific deaminases of interest and their expression as chimeric proteins and delivery into cells and tissues as TAT-deaminases are described, but also contemplated are other members of the ARP family.
- deaminases can be used for expression, purification and intracellular delivery. A lack of expression or a deficiency in the expression of these ARPs in cells and tissues resulting in disease or suboptimal function, or when an elevated level of deaminase enzyme and activity can be beneficial, these ARPs can be used with the methods described herein.
- F. Compositions
- chimeric proteins comprising a protein transduction domain; and a deaminase domain, wherein the deaminase edits viral RNA. Also disclosed are chimeric proteins comprising a protein transduction domain and a deaminase domain; wherein the deaminase can deaminate cytidine to form uridine in an RNA molecule, or deaminate cytidine to form thymidine in a DNA molecule.
- the present invention also relates to a chimeric protein that is capable of being used to transduce B cells, either in vitro or in vivo, for purposes of inducing antibody production in B cells and thereby treat CSR and/or SHM conditions as well as B cell lymphomas.
- chimeric protein is meant any single polypeptide unit that comprises two distinct polypeptide domains joined by a peptide bond, optionally by means of an amino acid linker, or a non-peptide bond, wherein the two domains are not naturally occurring within the same polypeptide unit.
- such chimeric proteins are made by expression of a cDNA construct but could be made by protein synthesis methods known in the art.
- the chimeric proteins of the present invention contain, as a first polypeptide domain, a protein transduction domain (e.g., poly- arginine, poly-lysine peptide, third alpha helix of Antennapedia homeodomain protein, HSV-1 virion protein (VP) 22, HIV-1 Vpr, or HTV TAT protein) and, as a second polypeptide domain, a deaminase domain (e.g., an RNA or DNA deaminase ' such as adenosine to inosine deaminase or a cytidine to uridine deaminase).
- a protein transduction domain e.g., poly- arginine, poly-lysine peptide, third alpha helix of Antennapedia homeodomain protein, HSV-1 virion protein (VP) 22, HIV-1 Vpr, or HTV TAT protein
- a deaminase domain e.g., an RNA
- Such a chimeric protein can comprise a fragment or derivative of a naturally occurring protein transduction domain or a fragment or derivative of a naturally occurring deaminase.
- the chimeric protein of the invention optionally contains a mimetic of the naturally occurring protein transduction domain or a mimetic of the naturally occurring deaminase.
- the distinct polypeptide domains can be in reverse orientation to those examples given herein, or in any order within the chimeric protein.
- Deaminases include deoxycytidine deaminase, cytidine deaminase, adenosine deaminase, RNA deaminase, DNA deaminase, and other deaminases.
- the deaminase is not APOBEC-1 (see international patent application designated PCT/US02/05824, which is incorporated herein by reference in its entirety for APOBEC-1, chimeric proteins related thereto, and uses thereof) (Gen Bank Accession # NP_001635), REE (see U.S. Pat. No.
- Deaminases as described herein can include the following structural features: three or more CD repeats, two or more functional CDrepeats, one or more zinc binding domains (ZBDs), binding site(s) for mooring sequences, or protein-protein interaction (binding sites) for auxiliary RNA binding proteins or protein-protein interaction sites for DNA binding proteins or protein- protein interaction sites for proteins that interact with the deaminase to stimulate or suppress their activities either on cytidines in RNA or deoxycytidines in DNA or free ribose or deoxyribose nucleosides or nucleotides.
- Deaminases optionally edit viral RNA, host cell mRNA, viral DNA, host cell DNA or any combination thereof.
- CEM15 is identical to Phorbolin or APOBEC-3G (see, for example, Accession #NP_068594.)
- APOBEC-3G and CEM 15 are used interchangeably throughout.
- CEM 15 reduces HTV infectivity as a DNA mutating (editing) enzyme.
- CEM15 mRNA substrates transcribed from either HIV-1 viral genomes or host cell genomes can be edited by CEM 15 as well.
- Another deaminase described herein is ADD. ADD induces CSR, SHM, and gene conversion by mutating DNA and/or editing RNA. 72.
- chimeric proteins comprising a protein transduction domain and a deaminase domain, wherein the deaminase edits viral RNA, and wherein the protein transduction domain is selected from the group consisting of poly-arginine, poly-lysine peptide, third alpha helix of Antennapedia homeodomain protein, HSV-1 virion protein (VP) 22, HIV-1 Vpr, and HIV TAT protein.
- chimeric proteins comprising a protein transduction domain; and a deaminase domain, wherein the deaminase edits viral RNA, and wherein the protein transduction domain is an HIV TAT domain.
- chimeric proteins wherein the TAT domain comprises SEQ DD NO: 43 or a variant thereof.
- protein transduction domains from several known proteins can be employed, including without limitation, HIV-1 TAT protein, Drosophila homeotic transcription factor (ANTP), HSV-1 VP22 transcription factor, membrane-permeable sequences of the SN50 peptide, the Grb2 SH2 domain, and integrin ⁇ 3) ⁇ i, and ⁇ b cytoplasmic domains (Schwarze, TiPS 21 :45-48 (2000), which is hereby incorporated by reference in its entirety), and others as described below.
- a preferred protein transduction domain is the protein transduction domain of the human immunodeficiency virus (HIV) TAT protein.
- HIV human immunodeficiency virus
- An exemplary HTV TAT protein transduction domain has an amino acid sequence of SEQ DD NO: 43 as follows:
- This protein transduction domain has also been noted to be a nuclear translocation domain CB1Y (Sequence Compendium 2000, Kuiken (eds.), Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, which is hereby incorporated by reference in its entirety.
- CB1Y nuclear translocation domain
- One DNA molecule which encodes the HTV TAT protein transduction domain has a nucleotide sequence of SEQ DD NO: 44 as follows:
- TAT sequences can also be employed. Such sequence variants have been reported in HIV Sequence Compendium 2000, Kuiken (eds.), Theoretical Biology and Biophysics Group, Los Alamos National Laboratory, which is hereby incorporated by reference in its entirety.
- the chimeric proteins comprising these variants described herein are useful with CEM15 or ADD.
- one or more glycine residues can be added between TAT and the deaminase to improve flexibility between the TAT and deaminase domain, thereby enabling improved function of each domain.
- ADD an example of a chimeric protein of the present invention which is suitable for use in humans is designated TAT-ADD-HA-6His.
- the 'X' designates the site where a proteolytic cleavage motif may be inserted in future versions of this protein.
- Regions 6His, TAT and HA are not drawn to scale and correspond to the protein transduction motif, hemagglutinin epitope tag (for detection) and six Histidine motif (for purification).
- the construct can optionally include a CMPK domain or other suitable peptide domains as described for TAT-
- the HA and 6His tags can be alternatively substituted with other appropriate detection of affinity purification tags as described above for TAT-CEM15-CMPK. Variations on the relative orientation of domains at the N- or C-terminus of the chimera are the same for the A D chimera as for the CEM 15 chimera, as described above.
- This chimeric protein includes: an N-terminal HTV TAT protein transduction domain, a polypeptide fragment of human ADD, a hemagglutinin domain, and a C-terminal His tag.
- the amino acid sequence (SEQ DD NO: 39) and encoding nucleotide sequence (SEQ DD NO: 40) of this exemplary chimeric protein (human) is set forth below.
- the 'X' designates the site where a proteolytic cleavage motif may be inserted in future versions of this protein, such as but not limited to thrombin or Tev proteinase recognition or cleavage sites.
- Domains 6His, TAT and HA are not drawn to scale and correspond to the protein transduction motif, haemagglutinin epitope tag (for detection) and six Histidine motif (for purification). The location of these domains relative to one another is meant as an example as described above, but can also be varied.
- the association of the CMPK (chicken muscle pyruvate kinase) peptide serves to improve yield and solubility of the expressed protein when expressed in bacteria.
- CMPK is meant as an example but can be substituted with a variety of other proteins that serve a similar purpose, such as (but not limited to)
- TAT-deaminase liberated from the associated peptide by proteolytic cleavage generates the therapeutic protein.
- the 6His tag is employed in the initial purification of the chimera, and the adsorption of the associated peptide following cleavage in the process yields purified TAT- deaminase.
- Any suitable affinity purification or detection tag such as GST, TAP, maltose binding protein or epitope are considered subtitutes for 6His or HA tags.
- This chimeric protein includes: an N-terminal HIV TAT protein transduction domain, a polypeptide fragment of human CEM15 (or alternatively a fragment of human ADD or any other of the ARPs), a hemagglutinin domain, a C- terminal His tag, and optionally, a CMPK domain.
- the amino acid sequence (SEQ DD NO: 1) and encoding nucleotide sequence (SEQ DD NO: 2) of the CEM15 protein (human) is set forth below.
- the chimeric CEM15 protein can be the same as the chimeric ADD protein described above, wherein the CEM 15 portion of the chimeric CEM15 protein can be substituted for the AID portion of the ADD chimeric protein found in SEQ DD NO: 39.
- VDHQG CPFQP WDG D EHSQD LSGRL RAILQ NQEN (SEQ ID NO: 1) atgaa gcctc acttc agaaa cacag tggag cgaat gtatc gagac acatt ctcct acaac tttta taata gaccc atcct ttctc gtcgg aatac cgtct 100 ggctg tgcta cgaag tgaaacaaa gggtc cctca aggcc cctt tggac gcaaa gatct ttcga ggcca ggtgt attcc gaact taagt accac ccaga 200 gatga gattc tcca ctggt tcagc aagtg gagga 200 gat
- a further aspect of the present invention relates to chimeric proteins formed following the identification of mRNA(s) that are edited by ADD, CEM15, or any other ARP.
- proteins translated from the edited mRNAs engineered with or without CMPK as shown in the diagram for suitable expression, purification, and TAT-mediated delivery (as described above) are designed as chimeras as shown below.
- the construct can optionally include a CMPK domain or other suitable peptide domains as described for TAT-ADD-CMPK-HA/6His.
- the HA and 6His tags can be alternatively substituted with other appropriate detection or affinity purification tags as described above. Variations on the relative orientation of domains at the N- or C- terminus of the chimera are considered herein as described for TAT-ADD-CMPK-HA/6His.
- the second polypeptide can be a full length human or other mammalian ADD protein or a polypeptide fragment thereof that maintains its utility as a deaminase.
- Human ADD has an amino acid sequence (SEQ DD NO: 3) as follows:
- This protein is encoded by a DNA molecule having a nucleotide sequence (SEQ DD NO: 4) as follows:
- deaminating function is meant a deamination of a nucleotide (e.g., cytidine, deoxycytidine, adenosine, or deoxyadenosine). Deaminating function is detected by measuring the amount of deaminated nucleotide, according to the methods taught herein.
- a nucleotide e.g., cytidine, deoxycytidine, adenosine, or deoxyadenosine.
- chimeric proteins comprising a protein transduction domain, and a deaminase domain, wherein the deaminase edits viral RNA, and wherein the deaminase domain comprises CEM15. Also disclosed are chimeric proteins, wherein the CEM 15 domain comprises SEQ DD NO: 1.
- chimeric proteins comprising a protein transduction domain; and a deaminase domain, wherein the deaminase edits mRNA or DNA, and wherein the deaminase domain comprises ADD. Also disclosed are chimeric proteins, wherein the ADD domain comprises SEQ DD NO: 3. 90.
- the chimeric proteins of the present invention can include full length domains (e.g., full length CEM15, ADD, or full length TAT protein) or fragments or derivatives of either or both domains.
- a "fragment” is a polypeptide that is less than the full length of a particular protein or functional domain.
- a fragment or derivative of a full length protein preferably retain at least one function of the full length protein.
- a fragment or derivative of a deaminase includes a fragment of a deaminase or a derivative deaminase (e.g., APOBEC-1, ADD, CEM 15, or any other ARP) that retains at least one binding or deaminating function of the full length protein.
- the fragment or derivative can include a Zinc-Dependent Cytidine Deaminase domain or can include 20, 30, 40, 50, 60, 70 80, 90% similarity with the full length deaminase.
- the fragment or derivative can include conservative or non-conservative amino acid substitutions.
- the fragment or derivative can include a linker sequence joining a catalytic domain (CD) to a pseudo-catalytic domain (PCD) and can have the domain structure CD-PCD-CD-PCD or any repeats thereof.
- the fragment or derivative can comprise a CD.
- Other fragments or derivatives are identified by structure-based sequence alignment (SBSA) as shown herein. See Figure 6B that reveals the consensus structural domain attributes of APOBEC-1 and ARPs ( Figure 6C).
- the fragment or derivative optionally can form a homodimer or a homotetramer.
- chimeric proteins wherein the deaminase domain is a fragment or derivative of CEM 15 or ADD having deamina
- chimeric proteins wherein the CEM 15 fragment or derivative has at least 20, 30, 40, 50, 60, 70, 80, or 90 % amino acid similarity with CEM15.
- chimeric proteins wherein the ADD fragment or derivative has at least 20, 30, 40, 50, 60, 70, 80, or 90 % amino acid similarity with ADD.
- chimeric proteins comprising a protein transduction domain and a deaminase domain and further comprising an epitope tag.
- epitope tag any tag useful in detecting the chimeric protein in biologic fluids or tissues. Examples include hemagglutinin and V5 (as well as other tags discussed above).
- the polypeptide that includes an epitope tag can be any epitope tag that is recognized with antibodies raised against the epitope tag.
- An exemplary epitope tag is a hemagglutinin (HA) domain. The HA domain is present only when it is desirable to examine, i.e., in vitro, localization of the first chimeric protein within cells that have translocated it.
- One suitable HA domain has an amino acid sequence of SEQ DD NO: 46.
- This HA sequence is encoded by a DNA molecule having a nucleotide sequence of SEQ ID NO: 47. 95.
- chimeric proteins comprising a protein transduction domain and a deaminase domain and further comprising a purification tag.
- purification tag is meant a tag that is useful in affinity purification of the chimeric protein.
- Such tags include for example, a GST tag (or other tags as discussed above), which includes 2, 3, 4, 5, 6, or more adjacent histidine residues, or a glutathione-S transferase tag.
- the polypeptide that includes a plurality of histidine residues preferably contains a sufficient number of histidine residues so as to allow the chimeric protein containing such histidine residues to be bound by an antibody which recognizes the plurality of histidine residues.
- One type of DNA molecule encoding H n is (cac) n , where n is greater than 1, but preferably greater than about 5. This His region can be used during immuno-purification, which is described in greater detail below.
- chimeric proteins comprising a protein transduction domain and a deaminase domain and further comprising a polypeptide domain that enhances solubility of the chimeric protein or promotes cytoplasmic or nuclear localization of the chimeric protein.
- enhances solubility is meant that the solubility of the chimeric protein is enhanced as compared to the solubility in the absence of the enhancing agent.
- the solubility can be enhanced in bacterial, yeast or baccolovirus expression systems.
- promoting cytoplasmic or nuclear localization is meant that the promoting polypeptide domain facilitates targeting of the chimeric protein to the nucleus (via nuclear localization signals or NLS) or to the cytoplasm (via nuclear export signals, NES, or cytoplasmic retention signals (CSRs)) by either moving the protein to the desired cellular compartment or by retaining the protein in the desired compartment.
- the promoting polypeptide can also affect the distribution of the chimeric protein between the cytoplasm and nucleus via a bulk protein effect such as the effect of CMPK on APOBEC-1 in the context of a chimeric protein.
- the chimeric protein of the present invention can also include one or more other polypeptide sequences, including without limitation: (i) a polypeptide that includes a cytoplasmic localization protein or a fragment thereof which, upon cellular uptake of the first chimeric protein, localizes the first chimeric protein to the cytoplasm; (ii) a polypeptide that includes a plurality of adjacent histidine residues; and (iii) a polypeptide that includes an epitope tag.
- the polypeptide that includes a cytoplasmic localization protein or a fragment thereof can be any protein, or fragment thereof, which can effectively retain the first chimeric protein within the cytoplasm of a cell into which the first chimeric protein has been translocated.
- CMPK chicken muscle pyruvate kinase
- a DNA molecule encoding the full length CMPK has a nucleotide sequence according to SEQ DD No: 42 as follows: atgtcgaagc accacgatgc agggaccgct ttcatccaga cccagcagct gcacgctgc 60 atggcagaca cctttctgga gcacatgtgc cgcctggaca tcgactccga gccaaccatt 120 gccagaaaca ccggcatcat ctgcaccatc ggcccagcct ccgctgt ggacaagctg 180 aaggaaatga ttaaatctgg aatgttt gccctca acttctcgca cggcacccac 240 gagtatcatg agggcacaat taagaa
- Fragments of CMPK which afford cytoplasmic retention of the first chimeric protein include, without limitation, polypeptides containing at a minimum residues 1 -479 of SEQ DD NO : 41.
- chimeric proteins comprising a protein transduction domain and a deaminase domain and further comprising a protein cleavage site.
- protein cleavage site is meant a proteolytic site or any variant thereof.
- chimeric proteins comprising a protein transducing domain and a deaminase domain that edits DNA.
- chimeric proteins wherein the deaminase domain edits viral DNA.
- chimeric proteins comprising a protein transducing domain and a deaminase domain that edits DNA, wherein the deaminase is a cytidine deaminase.
- a chimeric protein comprising a protein transducing domain; and a deaminase domain, wherein the deaminase is not APOBEC-1. Also disclosed are chimeric proteins, wherein the deaminase has less than 20, 30, 40, 50, 60, 70, 80, 90 % amino acid similarity with APOBEC-1.
- An amino acid sequence of APOBEC-1 is provided as SEQ DD NO: 5.
- chimeric proteins wherein the deaminase has more than 20, 30, 40, 50, 60, 70, 80, or 90 amino acid similarity with CEM 15 (SEQ ID NO: 1).
- chimeric proteins wherein the deaminase has more than 20, 30, 40, 50, 60, 70, 80, or 90 amino acid similarity with ADD (SEQ DD NO: 3).
- chimeric proteins comprising a protein transducing domain, and a deaminase, wherein the deaminase does not edit ApoBl mRNA.
- chimeric proteins comprising a protein transducing domain and a deaminase domain, wherein the deaminase comprises more than two CD repeats. Also disclosed are chimeric proteins, wherein more than one of the CD repeats has a deaminating function.
- anchor oligonucleotide an oligonucleotide that binds the deaminase to the nucleotide sequence in the specific site necessary for deamination to occur.
- chimeric proteins comprising a protein transducing domain, a deaminase domain, and an anchor oligonucleotide.
- CEM15 mimetics wherein the mimetic binds viral infectivity factor (e.g., Vif).
- chimeric proteins or peptides comprising a protein transducing domain and the CEM15 mimetic.
- auxiliary protein and Vif mimetics wherein the mimetic binds CEM 15 and regulates or determines the (i) subcellular localization of CEM 15 or (ii) its substrate specificity in terms of specific RNA or DNA sequence in which CEM 15 selects cytidines or deoxycytidines to deaminate or (iii) its function in terms of the level or efficiency of the deamination reaction.
- chimeric proteins or peptides comprising a protein transducing domain and the auxiliary protein or Vif mimetic.
- ADD mimetics wherein the mimetic binds to an auxiliary protein that either regulates or determines the (i) subcellular localization of AID or (ii) its substrate specificity in terms of specific RNA or DNA sequence in which ADD selects cytidines or deoxycytidines to deaminate or (iii) its function in terms of the level or efficiency of the deamination reaction.
- Mimetics of the auxiliary protein or of ADD itself that alter any or all of the three functions described above are also contemplated herein.
- chimeric proteins or peptides comprising a protein transducing domain and the auxiliary protein mimetic.
- ARP mimetics wherein the mimetic binds to an auxiliary protein that either regulates or determines the (i) subcellular localization of the
- ARP or (ii) its substrate specificity in terms of specific RNA or DNA sequence in which the ARP selects cytidines or deoxycytidines to deaminate or (iii) its function in terms of the level or efficiency of the deamination reaction.
- Mimetics of the auxiliary protein or of the ARP itself that alter any or all of the three functions described above are also contemplated herein.
- Disclosed are chimeric proteins or peptides comprising a protein transducing domain and the auxiliary protein mimetic. 116.
- isolated nucleotide sequences that encode the chimeric protein of the invention are also contemplated herein.
- the invention provides a nucleotide sequence that encodes a chimeric protein comprising a protein transduction domain and a deaminase domain, wherein the deaminase edits RNA or DNA.
- vectors comprising the nucleotide sequence that encodes a chimeric protein comprising a protein transduction domain and a deaminase domain.
- recombinant host cells comprising the vector comprising the nucleotide sequence that encodes a chimeric protein comprising a protein transduction domain and a deaminase domain, wherein the deaminase edits viral RNA, or cellular RNA or DNA.
- expression vectors wherein the expression vector is operable in prokaryotic or eukaryotic cells.
- nucleic acid sequences that selectively hybridize under stringent conditions with the nucleic acids that encode the chimeric proteins of the invention.
- the invention provides a composition comprising the chimeric protein and an auxiliary protein that is required to produce an editosome on RNA or a mutasome on DNA.
- variants of genes and proteins herein disclosed typically have at least, about 70, 71, 72, 73,
- SEQ DD NOs: 2, 4, 42, and 44 set forth particular nucleic acid sequences that encode a CEM 15, ADD, CMPK, and a TAT protein, respectively, and SEQ DD NOs: 1, 3, 41, and 43 set forth particular sequences of the proteins encoded by those nucleic acids.
- variants of these and other genes and proteins herein disclosed which have at least, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 percent similarity to the stated sequence.
- the similarity can be calculated after aligning the two sequences so that the similarity is at its highest level.
- a sequence recited as having a particular percent similarity to another sequence refers to sequences that have the recited homology as calculated by any one or more of the calculation methods described above.
- a first sequence has 80 percent similarity, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent similarity to the second sequence using the Zuker calculation method even if the first sequence does not have 80 percent similarity to the second sequence as calculated by any of the other calculation methods.
- a first sequence has 80 percent similarity, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent similarity to the second sequence using both the Zuker calculation method and the Pearson and Lipman calculation method even if the first sequence does not have 80 percent similarity to the second sequence as calculated by the Smith and Waterman calculation method, the Needleman and Wunsch calculation method, the Jaeger calculation methods, or any of the other calculation methods.
- a first sequence has 80 percent similarity, as defined herein, to a second sequence if the first sequence is calculated to have 80 percent similarity to the second sequence using each of calculation methods (although, in practice, the different calculation methods will often result in different calculated similarity percentages). 122.
- Other structural similarities, aside from sequence similarity are also disclosed.
- homology as noted by similar secondary and tertiary structure can be analyzed, as taught herein.
- Homologous proteins may have minimal sequence similarity but have a homologous catalytic domain.
- deaminases as used herein may be structurally similar based on the structure of the catalytic domain or other domain but have lower than 70% sequence similarity.
- hybridization typically means a sequence driven interaction between at least two nucleic acid molecules, such as a primer or a probe and a gene.
- Sequence driven interaction means an interaction that occurs between two nucleotides or nucleotide analogs or nucleotide derivatives in a nucleotide specific manner. For example, G interacting with C or A interacting with T are sequence driven interactions. Typically sequence driven interactions occur on the Watson-Crick face or Hoogsteen face of the nucleotide.
- the hybridization of two nucleic acids is affected by a number of conditions and parameters known to those of skill in the art. For example, the salt concentrations, pH, and temperature of the reaction all affect whether two nucleic acid molecules will hybridize.
- selective hybridization conditions can be defined as stringent hybridization conditions.
- stringency of hybridization is controlled by both temperature and salt concentration of either or both of the hybridization and washing steps.
- the conditions of hybridization to achieve selective hybridization may involve hybridization in high ionic strength solution (6X SSC or 6X SSPE) at a temperature that is about 5-25°C below the Tm (the melting temperature at which half of the molecules dissociate from their hybridization partners) followed by washing at a combination of temperature and salt concentration chosen so that the washing temperature is about 5°C to 20°C below the Tm.
- the temperature and salt conditions are readily determined empirically in preliminary experiments in which samples of reference DNA immobilized on filters are hybridized to a labeled nucleic acid of interest and then washed under conditions of different stringencies. Hybridization temperatures are typically higher for DNA- RNA and RNA-RNA hybridizations. The conditions can be used as described above to achieve stringency, or as is known in the art. (Sambrook, Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, 1989; Kunkel, Methods Enzymol. 1987:154:367, 1987 which is herein incorporated by reference for material at least related to hybridization of nucleic acids).
- a preferable stringent hybridization condition for a DNA:DNA hybridization can be at about 68°C (in aqueous solution) in 6X SSC or 6X SSPE followed by washing at 68°C.
- Stringency of hybridization and washing if desired, can be reduced accordingly as the degree of complementarity desired is decreased, and further, depending upon the G-C or A-T richness of any area wherein variability is searched for.
- stringency of hybridization and washing if desired, can be increased accordingly as homology desired is increased, and further, depending upon the G-C or A-T richness of any area wherein high homology is desired, all as known in the art.
- selective hybridization conditions are by looking at the amount (percentage) of one of the nucleic acids bound to the other nucleic acid. For example, in some embodiments selective hybridization conditions would be when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the limiting nucleic acid is bound to the non-limiting nucleic acid.
- the non-limiting primer is in for example, 10 or 100 or 1000 fold excess.
- This type of assay can be performed at under conditions where both the limiting and non-limiting primer are for example, 10 fold or 100 fold or 1000 fold below their k d , or where only one of the nucleic acid molecules is 10 fold or 100 fold or 1000 fold or where one or both nucleic acid molecules are above their kd.
- selective hybridization conditions are when at least about, 60, 65, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100 percent of the primer is enzymatically manipulated under conditions which promote the enzymatic manipulation, for example if the enzymatic manipulation is DNA extension, then selective hybridization conditions would be when at least about 60, 65, 70, 71, 72,
- Preferred conditions also include those suggested by the manufacturer or indicated in the art as being appropriate for the enzyme performing the manipulation. 127.
- methods herein disclosed for determining the level of hybridization between two nucleic acid molecules it is understood that there are a variety of methods herein disclosed for determining the level of hybridization between two nucleic acid molecules. It is understood that these methods and conditions may provide different percentages of hybridization between two nucleic acid molecules, but unless otherwise indicated meeting the parameters of any of the methods would be sufficient. For example if 80% hybridization was required and as long as hybridization occurs within the required parameters in any one of these methods it is considered disclosed herein.
- compositions identified by screening with disclosed compositions / combinatorial chemistry a) Combinatorial chemistry and protein mimetics
- compositions and methods of making these compositions that bind Vif, such that CEM15 binding is competitively inhibited indicates targets for identifying molecules that will affect SHM and CSR.
- this knowledge can be used along with, for example, combinatorial chemistry techniques, to identify molecules that function as desired, by for example, inhibiting CEM 15 and Vif binding, or enhancing or reducing ADD activity, or mimic other deaminases.
- compositions such as deaminases (e.g., ARPs such as CEM15 and ADD), Vif, or TAT can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way or mimic their function.
- deaminases e.g., ARPs such as CEM15 and ADD
- Vif, or TAT can be used as targets for any combinatorial technique to identify molecules or macromolecular molecules that interact with the disclosed compositions in a desired way or mimic their function.
- the nucleic acids, peptides, and related molecules disclosed herein can be used as targets for the combinatorial approaches.
- compositions that are identified through combinatorial techniques or screening techniques in which the compositions disclosed in SEQ DD NOS: 1, 3, 7, 43, or portions thereof, are used as the target in a combinatorial or screening protocol.
- compositions such as macromolecular molecules
- molecules such as macromolecular molecules
- the molecules identified and isolated when using the disclosed compositions are also disclosed.
- the products produced using the combinatorial or screening approaches that involve the disclosed compositions are also disclosed.
- Combinatorial chemistry includes but is not limited to all methods for isolating small molecules or macromolecules that are capable of binding either a small molecule or another macromolecule, typically in an iterative process.
- Proteins, oligonucleotides, and sugars are examples of macromolecules.
- oligonucleotide molecules with a given function, catalytic or ligand- binding can be isolated from a complex mixture of random oligonucleotides in what has been referred to as "in vitro genetics" (Szostak, TD3S 19:89, 1992).
- In vitro genetics Szostak, TD3S 19:89, 1992.
- phage display libraries have been used to isolate numerous peptides that interact with a specific target. (See for example, United States Patent No. 6,031,071; 5,824,520; 5,596,079; and 5,565,332 which are herein incorporated by reference in their entirety for their material related to phage display and methods relate to combinatorial chemistry)
- RNA molecule is generated in which a puromycm molecule is covalently attached to the 3 '-end of the RNA molecule.
- An in vitro translation of this modified RNA molecule causes the correct protein, encoded by the RNA to be translated.
- the growing peptide chain is attached to the puromycin which is attached to the RNA.
- the protein molecule is attached to the genetic material that encodes it. Normal in vitro selection procedures can now be done to isolate functional peptides. Once the selection procedure for peptide function is complete traditional nucleic acid manipulation procedures are performed to amplify the nucleic acid that codes for the selected functional peptides. After amplification of the genetic material, new RNA is transcribed with puromycin at the 3 '-end, new peptide is translated and another functional round of selection is performed. Thus, protein selection can be performed in an iterative manner just like nucleic acid selection techniques.
- the peptide which is translated is controlled by the sequence of the RNA attached to the puromycin.
- This sequence can be anything from a random sequence engineered for optimum translation (i.e. no stop codons etc.) or it can be a degenerate sequence of a known RNA molecule to look for improved or altered function of a known peptide.
- the conditions for nucleic acid amplification and in vitro translation are well known to those of ordinary skill in the art and are preferably performed as in Roberts and Szostak (Roberts R.W. and Szostak J.W. Proc. Natl. Acad. Sci. USA, 94(23)12997-302 (1997)).
- the benefit of this type of technology is that the selection is done in an intracellular environment.
- the method utilizes a library of peptide molecules that attached to an acidic activation domain.
- a peptide of choice for example a portion of Vif is attached to a DNA binding domain of a transcriptional activation protein, such as Gal 4.
- a transcriptional activation protein such as Gal 4.
- Combinatorial libraries can be made from a wide array of molecules using a number of different synthetic techniques. For example, libraries containing fused 2,4-pyrimidinediones (United States patent 6,025,371) dihydrobenzopyrans (United States Patent 6,017,768and 5,821,130), amide alcohols (United States Patent 5,976,894), hydroxy-amino acid amides (United States Patent 5,972,719) carbohydrates (United States patent 5,965,719), 1,4- benzodiazepin-2,5-diones (United States patent 5,962,337), cyclics (United States patent 5,958,792), biaryl amino acid amides (United States patent 5,948,696), thiophenes (United States patent 5,942,387), tricyclic tetrahydroquinolines (United States patent 5,925,527), benzofurans (United States patent 5,919,955), isoquino
- the disclosed compositions can be used as targets for any molecular modeling technique to identify either the structure of the disclosed compositions or to identify potential or actual molecules, such as small molecules, which interact in a desired way with the disclosed compositions.
- the nucleic acids, peptides, proteins and related molecules disclosed herein can be used as targets in any molecular modeling program or approach.
- QUANTA programs Polygen Corporation, Waltham, MA.
- CHARMm performs the energy minimization and molecular dynamics functions.
- QUANTA performs the construction, graphic modeling and analysis of molecular structure.
- QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
- a number of articles review computer modeling of drugs interactive with specific proteins, such as Rotivinen (1988) Acta Pharmaceutica Fennica 97, 159-166; Ripka, New Scientist 54-57 (June 16, 1988); McKinaly and Rossmann, 1989 Annu. Rev. Pharmacol._Toxiciol. 29, 111-122; Perry and Davies, QSAR: Quantitative Structure- Activity Relationships in Drug Design pp. 189-193
- Hypercube, Inc. Cambridge, Ontario. Although these are primarily designed for application to drugs specific to particular proteins, they can be adapted to design of molecules specifically interacting with specific regions of DNA or RNA, once that region is identified. 145. Although described above with reference to design and generation of compounds which could alter binding, one could also screen libraries of known compounds, including natural products or synthetic chemicals, and biologically active materials, including proteins, for compounds which alter substrate binding or enzymatic activity. 146.
- a compound that is identified or designed as a result of any of the disclosed methods can be obtained (or synthesized) and tested for its biological activity, e.g., competitive inhibition of CEM15-Vif binding or inhibition of HIV infectivity, or in the case of ADD, the ability to deaminate cytidine to form uridine in an mRNA molecule or deaminate cytidine to form deoxycytidine in a DNA molecule.
- biological activity e.g., competitive inhibition of CEM15-Vif binding or inhibition of HIV infectivity, or in the case of ADD, the ability to deaminate cytidine to form uridine in an mRNA molecule or deaminate cytidine to form deoxycytidine in a DNA molecule.
- cells that comprise an exogenous inhibitor of a CEM15-Vif interaction 148.
- cells that comprise an exogenous inhibitor of AID 148.
- cells that comprise an exogenous inhibitor of AID 148.
- cells that comprise an exogenous inhibitor of AID 148.
- This step of separation can be performed in a number of ways, including for example, through various chromatography means, including column chromatography, as well as using high through put mechanism, such as affinity sorting fluorescence analysis or fluorescence activated cell sorting
- TAT protein As discussed herein there are numerous variants of the TAT protein, CEM15 protein, ADD protein, and Vif protein that are known and herein contemplated.
- CEM15 protein As discussed herein there are numerous variants of the TAT protein, CEM15 protein, ADD protein, and Vif protein that are known and herein contemplated.
- Vif, CMPK, ADD, or TAT strain variants there are derivatives of the CEM15, Vif, CMPK, ADD or TAT proteins which also function in the disclosed methods and compositions. Protein variants and derivatives are well understood to those of skill in the art and it can involve amino acid sequence modifications. For example, amino acid sequence modifications typically fall into one or more of three classes: substitutional, insertional or deletional variants. Insertions include amino and/or carboxyl terminal fusions as well as intrasequence insertions of single or multiple amino acid residues.
- Insertions ordinarily will be smaller insertions than those of amino or carboxyl terminal fusions, for example, on the order of one to four residues.
- Immunogenic fusion protein derivatives such as those described in the examples, are made by fusing a polypeptide sufficiently large to confer immunogenicity to the target sequence by cross-linking in vitro or by recombinant cell culture transformed with DNA encoding the fusion. Deletions are characterized by the removal of one or more amino acid residues from the protein sequence. Typically, no more than about from 2 to 6 residues are deleted at any one site within the protein molecule.
- variants ordinarily are prepared by site specific mutagenesis of nucleotides in the DNA encoding the protein, thereby producing DNA encoding the variant, and thereafter expressing the DNA in recombinant cell culture.
- Techniques for making substitution mutations at predetermined sites in DNA having a known sequence are well known, for example Ml 3 primer mutagenesis and PCR mutagenesis.
- Amino acid substitutions are typically of single residues, but can occur at a number of different locations at once; insertions usually will be on the order of about from 1 to 10 amino acid residues; and deletions will range about from 1 to 30 residues.
- Deletions or insertions preferably are made in adjacent pairs, i.e. a deletion of 2 residues or insertion of 2 residues.
- substitutions, deletions, insertions or any combination thereof may be combined to arrive at a final construct.
- the mutations must not place the sequence out of reading frame and preferably will not create complementary regions that could produce secondary mRNA structure.
- substitutional variants are those in which at least one residue has been removed and a different residue inserted in its place. Such substitutions generally are made in accordance with the following Tables 2 and 3 and are referred to as conservative substitutions.
- Trp Tyr Tyr; Trp; Phe Val; De; Leu
- Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those in Table 3, i.e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site or (c) the bulk of the side chain.
- substitutions which in general are expected to produce the greatest changes in the protein properties will be those in which (a) a hydrophilic residue, e.g. seryl or threonyl, is substituted for (or by) a hydrophobic residue, e.g.
- an electropositive side chain e.g., lysyl, arginyl, or histidyl
- an electronegative residue e.g., glutamyl or aspartyl
- the replacement of one amino acid residue with another that is biologically and/or chemically similar is known to those skilled in the art as a conservative substitution.
- a conservative substitution would be replacing one hydrophobic residue for another, or one polar residue for another.
- the substitutions include combinations such as, for example, Gly, Ala; Val, De, Leu; Asp, Glu; Asn, Gin; Ser, Thr; Lys, Arg; and Phe, Tyr.
- Such conservatively substituted variations of each explicitly disclosed sequence are included within the mosaic polypeptides provided herein. 155.
- Substitutional or deletional mutagenesis can be employed to insert sites for N-glycosylation (Asn-X-Thr/Ser) or O-glycosylation (Ser or Thr).
- Deletions of cysteine or other labile residues also may be desirable.
- Deletions or substitutions of potential proteolysis sites, e.g. Arg is accomplished for example by deleting one of the basic residues or substituting one by glutaminyl or histidyl residues.
- Certain post-translational derivatizations are the result of the action of recombinant host cells on the expressed polypeptide. Glutaminyl and asparaginyl residues are frequently post-translationally deamidated to the corresponding glutamyl and asparyl residues. Alternatively, these residues are deamidated under mildly acidic conditions. Other post-translational modifications include hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the o-amino groups of lysine, arginine, and histidine side chains (T.E. Creighton, Proteins: Structure and Molecular Properties, W. H.
- SEQ DD NO: 43 sets forth a particular sequence of a TAT protein
- SEQ DD NO: 1 sets forth a particular sequence of a CEM 15 protein
- SEQ DD NO: 3 sets forth a particular sequence of an ADD protein
- SEQ DD NO: 41 seats forth a particular sequence for a CMPK protein.
- variants of these and other proteins herein disclosed which have at least, 70% or 75% or 80% or 85% or 90% or 95% similarity to the stated sequence.
- similarity can be calculated after aligning the two sequences so that the similarity is at its highest level or by a variety of methods described above.
- DD NOs: 1, 3, 7 and 43 is set forth in SEQ DD NO: 2, 4, 8 and 44, respectively.
- Provided herein are all degenerate variants of the nucleic acid sequences and all amino acids sequences with conservative amino acid substitutions.
- Molecules can be produced that resemble peptides, but which are not connected via a natural peptide linkage.
- a particularly preferred non-peptide linkage is - -CH2NH--. It is understood that peptide analogs can have more than one atom between the bond atoms, such as b-alanine, g-aminobutyric acid, and the like.
- Amino acid analogs and analogs and peptide analogs often have enhanced or desirable properties, such as, more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, and others.
- D-amino acids can be used to generate more stable peptides, because D amino acids are not recognized by peptidases and such.
- Systematic substitution of one or more amino acids of a consensus sequence with a D-amino acid of the same type e.g., D-lysine in place of L-lysine
- Cysteine residues can be used to cyclize or attach two or more peptides together. This can be beneficial to constrain peptides into particular conformations. (Rizo and Gierasch Ann. Rev. Biochem. 61:387 (1992), incorporated herein by reference). 5. Functional Nucleic Acids
- Functional nucleic acids are nucleic acid molecules that have a specific function, such as binding a target molecule or catalyzing a specific reaction.
- Functional nucleic acid molecules can be divided into the following categories, which are not meant to be limiting.
- functional nucleic acids include antisense molecules, aptamers, ribozymes, triplex forming molecules, and external guide sequences.
- the functional nucleic acid molecules can act as affectors, inhibitors, modulators, and stimulators of a specific activity possessed by a target molecule, or the functional nucleic acid molecules can possess a de novo activity independent of any other molecules .
- Functional nucleic acid molecules can interact with any macromolecule, such as DNA, RNA, polypeptides, or carbohydrate chains.
- functional nucleic acids can interact with, for example, the mRNA of CEM15, AID, Vif, or TAT, or any other disclosed molecule, or the genomic DNA of CEM 15, AID, Vif, or TAT, or any other disclosed molecule or they can interact with the polypeptide CEM15, ADD, Vif, or TAT, or any other disclosed molecule.
- Often functional nucleic acids are designed to interact with other nucleic acids based on sequence homology between the target molecule and the functional nucleic acid molecule.
- the specific recognition between the functional nucleic acid molecule and the target molecule is not based on sequence homology between the functional nucleic acid molecule and the target molecule, but rather is based on the formation of tertiary structure that allows specific recognition to take place.
- Antisense molecules are designed to interact with a target nucleic acid molecule through either canonical or non-canonical base pairing. The interaction of the antisense molecule and the target molecule is designed to promote the destruction of the target molecule through, for example, RNAseH mediated RNA-DNA hybrid degradation. Alternatively the antisense molecule is designed to interrupt a processing function that normally would take place on the target molecule, such as transcription or replication. Antisense molecules can be designed based on the sequence of the target molecule. Numerous methods for optimization of antisense efficiency by finding the most accessible regions of the target molecule exist. Exemplary methods would be in vitro selection experiments and DNA modification studies using DMS and DEPC.
- antisense molecules bind the target molecule with a dissociation constant (kD) less than 10-6. It is more preferred that antisense molecules bind with a kD less than 10-8. It is also more preferred that the antisense molecules bind the target moelcule with a kD less than 10-10. It is also preferred that the antisense molecules bind the target molecule with a kD less than 10-12.
- kD dissociation constant
- Aptamers are molecules that interact with a target molecule, preferably in a specific way.
- aptamers are small nucleic acids ranging from 15-50 bases in length that fold into defined secondary and tertiary structures, such as stem-loops or G-quartets.
- Aptamers can bind small molecules, such as ATP (United States patent 5,631,146) and theophiline (United States patent 5,580,737), as well as large molecules, such as reverse transcriptase (United States patent
- Aptamers can bind very tightly with kDs from the target molecule of less than 10-12 M. It is preferred that the aptamers bind the target molecule with a kD less than 10-6. It is more preferred that the aptamers bind the target molecule with a kD less than 10-8. It is also more preferred that the aptamers bind the target molecule with a kD less than 10-10. It is also preferred that the aptamers bind the target molecule with a kD less than 10-12. Aptamers can bind the target molecule with a very high degree of specificity.
- aptamers have been isolated that have greater than a 10000 fold difference in binding affinities between the target molecule and another molecule that differ at only a single position on the molecule (United States patent 5,543,293). It is preferred that the aptamer have a kD with the target molecule at least 10 fold lower than the kD with a background binding molecule. It is more preferred that the aptamer have a kD with the target molecule at least 100 fold lower than the kD with a background binding molecule. It is more preferred that the aptamer have a kD with the target molecule at least 1000 fold lower than the kD with a background binding molecule.
- the aptamer have a kD with the target molecule at least 10000 fold lower than the kD with a background binding molecule. It is preferred when doing the comparison for a polypeptide for example, that the background molecule be a different polypeptide.
- the background protein could be serum albumin.
- Ribozymes are nucleic acid molecules that are capable of catalyzing a chemical reaction, either intramolecularly or intermolecularly. Ribozymes are thus catalytic nucleic acid. It is preferred that the ribozymes catalyze intermolecular reactions.
- ribozymes that catalyze nuclease or nucleic acid polymerase type reactions which are based on ribozymes found in natural systems, such as hammerhead ribozymes, (for example, but not limited to the following United States patents: 5,334,711, 5,436,330, 5,616,466, 5,633,133, 5,646,020, 5,652,094, 5,712,384, 5,770,715, 5,856,463, 5,861,288, 5,891,683, 5,891,684, 5,985,621, 5,989,908, 5,998,193,
- ribozymes that are not found in natural systems, but which have been engineered to catalyze specific reactions de novo (for example, but not limited to the following United States patents: 5,580,967, 5,688,670, 5,807,718, and 5,910,408).
- Preferred ribozymes cleave RNA or DNA substrates, and more preferably cleave RNA substrates.
- Ribozymes typically cleave nucleic acid substrates through recognition and binding of the target substrate with subsequent cleavage. This recognition is often based mostly on canonical or non-canonical base pair interactions. This property makes ribozymes particularly good candidates for target specific cleavage of nucleic acids because recognition of the target substrate is based on the target substrates sequence.
- Triplex forming functional nucleic acid molecules are molecules that can interact with either double-stranded or single-stranded nucleic acid.
- triplex molecules When triplex molecules interact with a target region, a structure called a triplex is formed, in which there are three strands of DNA forming a complex dependant on both Watson-Crick and Hoogsteen base-pairing. Triplex molecules are preferred because they can bind target regions with high affinity and specificity. It is preferred that the triplex forming molecules bind the target molecule with a kD less than 10-6. It is more preferred that the triplex forming molecules bind with a kD less than 10-8. It is also more preferred that the triplex forming molecules bind the target moelcule with a kD less than 10-10. It is also preferred that the triplex forming molecules bind the target molecule with a kD less than 10-12.
- EGSs External guide sequences
- RNase P RNase P
- RNAse P aids in processing transfer RNA (tRNA) within a cell.
- RNAse P Bacterial RNAse P can be recruited to cleave virtually any RNA sequence by using an EGS that causes the target RNA:EGS complex to mimic the natural tRNA substrate. (WO 92/03566 by Yale, and Forster and Altman, Science 238:407-409 (1990)).
- RNAse P-directed cleavage of RNA can be utilized to cleave desired targets within eukaryotic cells.
- the disclosed chimeric proteins and compositions can be delivered to the target cells in a variety of ways.
- TAT-deaminase can be added directly to cells in culture or injected into the body, whereupon the TAT-deaminase transduces through the cell membrane and into the cell's interior.
- the compositions can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation. The delivery mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example in vivo or in vitro.
- compositions can comprise, for example, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes.
- liposomes can further comprise proteins to facilitate targeting a particular cell, if desired.
- Administration of a composition comprising a compound and a cationic liposome can be administered to the blood afferent to a target organ or inhaled into the respiratory tract to target cells of the respiratory tract.
- liposomes see, e.g., Brigham, Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Feigner, Proc. Natl. Acad.
- the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage. 7. Nucleic acids
- nucleic acid based there are a variety of molecules disclosed herein that are nucleic acid based, including for example the nucleic acids that encode the chimeric proteins or domains thereof, for example CEM 15 and TAT, or ADD and TAT, as well as various functional nucleic acids.
- the disclosed nucleic acids are made up of for example, nucleotides, nucleotide analogs, or nucleotide substitutes. Non- limiting examples of these and other molecules are discussed herein. It is understood that for example, when a vector is expressed in a cell, that the expressed mRNA will typically be made up of A, C, G, and U.
- an antisense molecule is introduced into a cell or cell environment through for example exogenous delivery, it is advantageous that the antisense molecule be made up of nucleotide analogs that reduce the degradation of the antisense molecule in the cellular environment.
- a nucleotide is a molecule that contains a base moiety, a sugar moiety and a phosphate moiety. Nucleotides can be linked together through their phosphate moieties and sugar moieties creating an internucleoside linkage.
- the base moiety of a nucleotide can be adenine-9-yl (A), cytosine-1-yl (C), guanine-9-yl
- the sugar moiety of a nucleotide is a ribose or a deoxyribose.
- the phosphate moiety of a nucleotide is pentavalent phosphate.
- a non-limiting example of a nucleotide would be 3 '-AMP (3'- adenosine monophosphate) or 5'-GMP (5'-guanosine monophosphate). 178.
- a nucleotide analog is a nucleotide that contains some type of modification to either the base, sugar, or phosphate moieties.
- Modifications to the base moiety would include natural and synthetic modifications of A, C, G, and T/U as well as different purine or pyrimidine bases, such as uracil-5-yl (.psi.), hypoxanthine-9-yl (I), and 2-aminoadenine-9-yl.
- a modified base includes but is not limited to 5-methylcytosine (5-me-C), 5-hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-pro ⁇ yl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5 -uracil (pseudouracil), 4-thiouracil,
- 5-propynyluracil and 5-propynylcytosine can increase the stability of duplex formation.
- time base modifications can be combined with for example a sugar modification, such as 2'-O-methoxyethyl, to achieve unique properties such as increased duplex stability.
- sugar modification such as 2'-O-methoxyethyl
- Nucleotide analogs can also include modifications of the sugar moiety. Modifications to the sugar moiety would include natural modifications of the ribose and deoxy ribose as well as synthetic modifications. Sugar modifications include but are not limited to the following modifications at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, orN-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl maybe substituted or unsubstituted Ci to Cio, alkyl or C 2 to Cio alkenyl and alkynyl.
- 2' sugar modifications also include but are not limited to -O[(CH 2 ) remind O] m CH 3 , -O(CH 2 ) n OCH 3 , -O(CH 2 ) n NH 2 , -O(CH 2 ) rule CH 3 , -O(CH 2 ) n -ONH 2 , and -O(CH 2 ) n ON[(CH 2 ) n CFI 3 )] 2 , where n and m are from 1 to about 10.
- O-aralkyl SH, SCH 3 , OCN, Cl, Br, CN, CF 3 , OCF 3 , SOCH 3 , SO 2 CH 3 , ONO 2 , N0 2 , N 3 , NH 2 , heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
- Similar modifications may also be made at other positions on the sugar, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2 '-5' linked oligonucleotides and the 5' position of 5' terminal nucleotide.
- Modified sugars would also include those that contain modifications at the bridging ring oxygen, such as CH 2 and S.
- Nucleotide sugar analogs may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.
- Nucleotide analogs can also be modified at the phosphate moiety.
- Modified phosphate moieties include but are not limited to those that can be modified so that the linkage between two nucleotides contains a phosphorothioate, chiral phosphorothioate, phosphorodithioate, phosphotriester, ammoalkylphosphotriester, methyl and other alkyl phosphonates including 3'-alkylene phosphonate and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates.
- these phosphate or modified phosphate linkage between two nucleotides can be through a 3 '-5' linkage or a 2 '-5' linkage, and the linkage can contain inverted polarity such as 3'-5' to 5'-3' or 2'-5' to 5'-2'.
- Various salts, mixed salts and free acid forms are also included.
- nucleotides containing modified phosphates include but are not limited to, 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; and 5,625,050, each of which is herein incorporated by reference.
- nucleotide analogs need only contain a single modification but may also contain multiple modifications within one of the moieties or between different moieties.
- Nucleotide substitutes are molecules having similar functional properties to nucleotides, but which do not contain a phosphate moiety, such as peptide nucleic acid (PNA). Nucleotide substitutes are molecules that will recognize nucleic acids in a Watson-Crick or Hoogsteen manner, but which are linked together through a moiety other than a phosphate moiety. Nucleotide substitutes are able to conform to a double helix type structure when interacting with the appropriate target nucleic acid.
- PNA peptide nucleic acid
- Nucleotide substitutes are nucleotides or nucleotide analogs that have had the phosphate moiety and/or sugar moieties replaced. Nucleotide substitutes do not contain a standard phosphorus atom. Substitutes for the phosphate can be for example, short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
- morpholino linkages formed in part from the sugar portion of a nucleoside
- siloxane backbones sulfide, sulfoxide and sulfone backbones
- formacetyl and thioformacetyl backbones methylene formacetyl and thioformacetyl backbones
- alkene containing backbones sulfamate backbones
- sulfonate and sulfonamide backbones amide backbones; and others having mixed N, O, S and CH 2 component parts.
- conjugates can be link other types of molecules to nucleotides or nucleotide analogs to enhance for example, cellular uptake.
- Conjugates can be chemically linked to the nucleotide or nucleotide analogs.
- conjugates include but are not limited to lipid moieties such as a cholesterol moiety (Letsinger, Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid
- Acids Res., 1992, 20, 533-538 an aliphatic chain, e.g., dodecandiol or undecyl residues (Saison-Behmoaras, EMBO J., 1991, 10, 1111-1118; Kabanov, FEBS Lett., 1990, 259, 327-330; Svinarchuk, Biochimie, 1993, 75, 49-54), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-rac-glycero-3-H-phosphonate (Manoharan, Tetrahedron Lett., 1995, 36, 3651-3654; Shea., Nucl.
- a phospholipid e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl-
- a Watson-Crick interaction is at least one interaction with the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute.
- the Watson-Crick face of a nucleotide, nucleotide analog, or nucleotide substitute includes the C2, Nl, and C6 positions of a purine based nucleotide, nucleotide analog, or nucleotide substitute and the C2, N3, C4 positions of a pyrimidine based nucleotide, nucleotide analog, or nucleotide substitute.
- a Hoogsteen interaction is the interaction that takes place on the Hoogsteen face of a nucleotide or nucleotide analog, which is exposed in the major groove of duplex DNA.
- the Hoogsteen face includes the N7 position and reactive groups (NH2 or O) at the C6 position of purine nucleotides.
- the invention further provides antibodies to the chimeric proteins or any portion thereof.
- antibody encompasses, but is not limited to, whole immunoglobulin (i.e., an intact antibody) of any class.
- Native antibodies are usually heterotetrameric glycoproteins, composed of two identical light (L) chains and two identical heavy (H) chains.
- L light
- H heavy
- each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies between the heavy chains of different immunoglobulin isotypes.
- Each heavy and light chain also has regularly spaced intrachain disulfide bridges.
- Each heavy chain has at one end a variable domain (V(H)) followed by a number of constant domains.
- Each light chain has a variable domain at one end (V(L)) and a constant domain at its other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain, and the light chain variable domain is aligned with the variable domain of the heavy chain.
- Particular amino acid residues are believed to form an interface between the light and heavy chain variable domains.
- the light chains of antibodies from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (k) and lambda (1), based on the amino acid sequences of their constant domains.
- immunoglobulins can be assigned to different classes.
- IgA human immunoglobulins
- IgD immunoglobulins
- IgE immunoglobulins
- IgG immunoglobulins
- variable is used herein to describe certain portions of the variable domains that differ in sequence among antibodies and are used in the binding and specificity of each particular antibody for its particular antigen. However, the variability is not usually evenly distributed through the variable domains of antibodies. It is typically concentrated in three segments called complementarity determining regions (CDRs) or hypervariable regions both in the light chain and the heavy chain variable domains. The more highly conserved portions of the variable domains are called the framework (FR).
- CDRs complementarity determining regions
- FR framework
- the variable domains of native heavy and light chains each comprise four FR regions, largely adopting a b-sheet configuration, connected by three CDRs, which form loops connecting, and in some cases forming part of, the b-sheet structure.
- the CDRs in each chain are held together in close proximity by the FR regions and, with the CDRs from the other chain, contribute to the formation of the antigen binding site of antibodies (see Kabat E. A. et al., "Sequences of Proteins of hnmunological Interest," National Institutes of Health, Bethesda, Md. (1987)).
- the constant domains are not involved directly in binding an antibody to an antigen, but exhibit various effector functions, such as participation of the antibody in antibody- dependent cellular toxicity.
- antibody or fragments thereof encompasses chimeric antibodies and hybrid antibodies, with dual or multiple antigen or epitope specificities, and fragments, such as scFv, sFv, F(ab')2, Fab', Fab and the like, including hybrid fragments.
- fragments of the antibodies that retain the ability to bind their specific antigens are provided.
- antibody or fragment thereof fragments of antibodies which maintain Vif binding activity are included within the meaning of the term "antibody or fragment thereof.”
- Such antibodies and fragments can be made by techniques known in the art and can be screened for specificity and activity according to the methods set forth in the Examples and in general methods for producing antibodies and screening antibodies for specificity and activity (See Harlow and Lane, Antibodies, A Laboratory Manual. Cold Spring Harbor Publications, New York, (1988)).
- antibody or fragments thereof conjugates of antibody fragments and antigen binding proteins (single chain antibodies) as described, for example, in U.S. Pat. No. 4,704,692, the contents of which are hereby incorporated by reference. 194.
- Transgenic animals e.g., mice
- J(H) antibody heavy chain joining region
- Human antibodies can also be produced in phage display libraries (Hoogenboom, J. Mol. Biol., 227:381 (1991);
- the techniques of Cole and Boerner are also available for the preparation of human monoclonal antibodies (Cole, Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985); Boerner, J. Immunol. , 147(l):86-95 (1991)). 195.
- the present invention further provides a hybidoma cell that produces the monoclonal antibody of the invention.
- the term "monoclonal antibody” as used herein refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts.
- the monoclonal antibodies herein specifically include "chimeric" antibodies in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular antibody class or subclass, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another antibody class or subclass, as well as fragments of such antibodies, so long as they exhibit the desired activity (See, U.S. Pat. No. 4,816,567 and Morrison, Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)).
- peripheral blood lymphocytes are used in methods of producing monoclonal antibodies if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired.
- the lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell (Goding, "Monoclonal Antibodies: Principles and Practice” Academic Press, (1986) pp. 59-103).
- Immortalized cell lines are usually transformed mammalian cells, including myeloma cells of rodent, bovine, equine, and human origin.
- rat or mouse myeloma cell lines are employed.
- the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
- the parental cells lack the enzyme hypoxanthine guanine phosphoribosyl fransferase
- HGPRT the culture medium for the hybridomas typically will include hypoxanthine, aminopterin, and thymidine ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
- Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody-producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, Calif, and the American Type Culture Collection, Rockville, Md. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies (Kozbor, J.
- the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against Vif.
- the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vitro binding assay, such as radioimmunoassay (RIA) or enzyme-linked immunoabsorbent assay (ELISA).
- RIA radioimmunoassay
- ELISA enzyme-linked immunoabsorbent assay
- the clones may be subcloned by limiting dilution or FACS sorting procedures and grown by standard methods. Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium. Alternatively, the hybridoma cells may be grown in vivo as ascites in a mammal.
- the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A-Sepharose, protein G, hydroxylapatite chromatography, gel electrophoresis, dialysis, or affinity chromatography. 198.
- the monoclonal antibodies may also be made by recombinant
- DNA methods such as those described in U.S. Pat. No. 4,816,567.
- DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies).
- the hybridoma cells of the invention serve as a preferred source of such DNA.
- the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, plasmacytoma cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
- host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, plasmacytoma cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies in the recombinant host cells.
- the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains in place of the homologous murine sequences (U.S. Pat. No. 4,816,567) or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non-immunoglobulin polypeptide.
- non-immunoglobulin polypeptide is substituted for the constant domains of an antibody of the invention or substituted for the variable domains of one antigen-combining site of an antibody of the invention to create a chimeric bivalent antibody comprising one antigen-combining site having specificity for Vif and another antigen-combining site having specificity for a different antigen.
- In vitro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described in WO 94/29348 published Dec. 22, 1994, U.S. Pat. No. 4,342,566, and Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor
- Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment.
- Pepsin treatment yields a fragment, called the F(ab')2 fragment, that has two antigen combining sites and is still capable of cross-linking antigen.
- the Fab fragments produced in the antibody digestion also contain the constant domains of the light chain and the first constant domain of the heavy chain.
- Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain domain including one or more cysteines from the antibody hinge region.
- the F(ab')2 fragment is a bivalent fragment comprising two Fab' fragments linked by a disulfide bridge at the hinge region.
- Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains bear a free thiol group.
- Antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. 201.
- An isolated immunogenically specific paratope or fragment of the antibody is also provided.
- a specific immunogenic epitope of the antibody can be isolated from the whole antibody by chemical or mechanical disruption of the molecule. The purified fragments thus obtained are tested to determine their immunogenicity and specificity by the methods taught herein.
- Immunoreactive paratopes of the antibody optionally, are synthesized directly.
- An immunoreactive fragment is defined as an amino acid sequence of at least about two to five consecutive amino acids derived from the antibody amino acid sequence.
- One method of producing proteins comprising the antibodies or chimeric proteins of the present invention is to link two or more peptides or polypeptides together by protein chemistry techniques described herein.
- immunoassay formats may be used to select antibodies that selectively bind with a particular protein, variant, or fragment.
- solid-phase ELISA immunoassays are routinely used to select antibodies selectively immunoreactive with a protein, protein variant, or fragment thereof. See
- the binding affinity of a monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson, Anal. Biochem., 107:220 (1980).
- an antibody reagent kit comprising containers of the monoclonal antibody or fragment thereof of the invention and one or more reagents for detecting binding of the antibody or fragment thereof to the Vif.
- the reagents can include, for example, fluorescent tags, enzymatic tags, or other tags.
- the reagents can also include secondary or tertiary antibodies or reagents for enzymatic reactions, wherein the enzymatic reactions produce a product that can be visualized.
- the fragments can also include insertions, deletions, substitutions, or other selected modifications of particular regions or specific amino acids residues, provided the activity of the antibody or antibody fragment is not significantly altered or impaired compared to the non-modified antibody or antibody fragment. These modifications can provide for some additional property, such as to remove/add amino acids capable of disulfide bonding, to increase its bio-longevity, to alter its secretory characteristics, etc.
- the antibody or antibody fragment must possess a bioactive property, such as specific binding to its cognate antigen.
- Functional or active regions of the antibody or antibody fragment may be identified by mutagenesis of a specific region of the protein, followed by expression and testing of the expressed polypeptide.
- Human antibodies 206 can be prepared using any technique. Examples of techniques for human monoclonal antibody production include those described by Cole (Monoclonal Antibodies and Cancer Therapy, Alan
- Human antibodies of the invention can also be produced using phage display libraries (Hoogenboom, j. Mol. Biol., 227:381, 1991; Marks, j. Mol. Biol., 222:581, 1991).
- the human antibodies of the invention can also be obtained from transgenic animals. For example, transgenic, mutant mice that are capable of producing a full repertoire of human antibodies, in response to immunization, have been described (see, e.g., Jakobovits, Proc. Natl. Acad. Sci.
- Antibody humanization techniques generally involve the use of recombinant DNA technology to manipulate the DNA sequence encoding one or more polypeptide chains of an antibody molecule.
- a humanized form of a non-human antibody is a chimeric antibody or antibody chain (or a fragment thereof, such as an Fc, Fv, Fab, Fab', or other antigen-binding portion of an antibody) which contains a portion of an antigen binding site from a non-human (donor) antibody integrated into the framework of a human (recipient) antibody.
- CDRs complementarity determining regions
- Fv framework (FR) residues of the human antibody are replaced by corresponding non-human residues.
- Humanized antibodies may also contain residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. Generally, a humanized antibody has one or more amino acid residues introduced into it from a source which is non-human. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies. Humanized antibodies generally contain at least a portion of an antibody constant region (Fc), typically that of a human antibody (Jones, Nature,
- humanized antibodies can be generated according to the methods of Winter and co-workers (Jones, Nature, 321 :522-525 (1986), Riechmann, Nature, 332:323-327 (1988), Verhoeyen, Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Methods that can be used to produce humanized antibodies are also described in U.S. Patent No. 4,816,567 (Cabilly), U.S. Patent No. 5,565,332 (Hoogenboom), U.S. Patent No. 5,721,367 (Kay), U.S. Patent No.
- Antibodies of the invention are preferably administered to a subject in a pharmaceutically acceptable carrier.
- Suitable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995.
- an appropriate amount of a pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic.
- the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution.
- the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
- Further carriers include sustained release preparations such as semipermeable matrices of solid hydrophobic polymers containing the antibody, which matrices are in the form of shaped articles, e.g., films, liposomes or microparticles. It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of antibody being administered.
- the antibodies can be administered to the subject, patient, or cell by injection (e.g., intravenous, intraperitoneal, subcutaneous, intramuscular), or by other methods such as infusion that ensure its delivery to the bloodstream in an effective form. Local or intravenous injection is preferred.
- ex vivo administration can be used wherein cells or tissues are isolated, treated, and returned to the subject to be treated.
- Effective dosages and schedules for administering the antibodies may be determined empirically, and making such determinations is within the skill in the art. Those skilled in the art will understand that the dosage of antibodies that must be administered will vary depending on, for example, the subject that will receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered. Guidance in selecting appropriate doses for antibodies is found in the literature on therapeutic uses of antibodies, e.g.,
- a typical daily dosage of the antibody used alone might range from about 1 ⁇ g/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above.
- an antibody of the invention is efficacious in treating or inhibiting an HIV infection in a subject by observing that the antibody reduces viral load or prevents a further increase in viral load.
- Viral loads can be measured by methods that are known in the art, for example, using polymerase chain reaction assays to detect the presence of HIV nucleic acid or antibody assays to detect the presence of HTV protein in a sample (e.g., but not limited to, blood) from a subject or patient, or by measuring the level of circulating anti-HIV antibody levels in the patient.
- Efficacy of the antibody treatment may also be determined by measuring the number of CD4 + T cells in the HlV-infected subject.
- An antibody treatment that inhibits an initial or further decrease in CD4 + T cells in an HIV-positive subject or patient, or that results in an increase in the number of CD4 T cells in the HIV-positive subject, is an efficacious antibody treatment.
- Antibodies disclosed herein can also be used to detect various compounds of the invention. Such antibodies can be used for research and clinical' purposes. 9. Pharmaceutical carriers/Delivery of pharmaceutical products
- compositions can also be administered in vivo in a pharmaceutically acceptable carrier.
- pharmaceutically acceptable is meant a material that is not biologically or otherwise undesirable, i.e., the material may be administered to a subject, along with the nucleic acid or vector, without causing any undesirable biological effects or interacting in a deleterious manner with any of the other components of the pharmaceutical composition in which it is contained.
- the carrier would naturally be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art.
- compositions may be administered orally, parenterally (e.g., intravenously), by intramuscular injection, by intraperitoneal injection, transdermally, extracorporeally, topically or the like, although topical intranasal administration or administration by inhalant is typically preferred.
- topical intranasal administration means delivery of the compositions into the nose and nasal passages through one or both of the nares and can comprise delivery by a spraying mechanism or droplet mechanism, or through aerosolization of the nucleic acid or vector. The latter may be effective when a large number of animals is to be treated simultaneously.
- Administration of the compositions by inhalant can be through the nose or mouth via delivery by a spraying or droplet mechanism.
- compositions can also be directly to any area of the respiratory system (e.g., lungs) via intubation.
- the exact amount of the compositions required will vary from subject to subject, depending on the species, age, weight and general condition of the subject, the severity of the allergic disorder being treated, the particular nucleic acid or vector used, its mode of administration and the like. Thus, it is not possible to specify an exact amount for every composition. However, an appropriate amount can be determined by one of ordinary skill in the art using only routine experimentation given the teachings herein.
- Parenteral administration of the composition is generally characterized by injection.
- Injectables can be prepared in conventional forms, either as liquid solutions or suspensions, solid forms suitable for solution of suspension in liquid prior to injection, or as emulsions.
- a more recently revised approach for parenteral administration involves use of a slow release or sustained release system such that a constant dosage is maintained. See, e.g., U.S. Patent No. 3,610,795, which is incorporated by reference herein.
- the materials may be in solution, suspension (for example, incorporated into microparticles, liposomes, or cells). These maybe targeted to a particular cell type via antibodies, receptors, or receptor ligands.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Senter, Bioconjugate Chem., 2:447-451, (1991); Bagshawe, K.D., Br.
- Vehicles such as "stealth” and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- stealth and other antibody conjugated liposomes (including lipid mediated drug targeting to colonic carcinoma), receptor mediated targeting of DNA through cell specific ligands, lymphocyte directed tumor targeting, and highly specific therapeutic retroviral targeting of murine glioma cells in vivo.
- the following references are examples of the use of this technology to target specific proteins to tumor tissue (Hughes, Cancer Research, 49:6214-6220, (1989); and Litzinger and
- receptors are involved in pathways of endocytosis, either constitutive or ligand induced. These receptors cluster in clathrin-coated pits, enter the cell via clathrin- coated vesicles, pass through an acidified endosome in which the receptors are sorted, and then either recycle to the cell surface, become stored intracellularly, or are degraded in lysosomes.
- the internalization pathways serve a variety of functions, such as nutrient uptake, removal of activated proteins, clearance of macromolecules, opportunistic entry of viruses and toxins, dissociation and degradation of ligand, and receptor-level regulation.
- receptors follow more than one intracellular pathway, depending on the cell type, receptor concentration, type of ligand, ligand valency, and ligand concentration. Molecular and cellular mechanisms of receptor-mediated endocytosis has been reviewed (Brown and Greene, DNA and Cell Biology 10:6, 399-409 (1991)).
- Liposomes are vesicles comprised of one or more concentrically ordered lipid bilayers which encapsulate an aqueous phase. They are normally not leaky, but can become leaky if a hole or pore occurs in the membrane, if the membrane is dissolved or degrades, or if the membrane temperature is increased to the phase transition temperature.
- Current methods of drug delivery via liposomes require that the liposome carrier ultimately become permeable and release the encapsulated drug at the target site. This can be accomplished, for example, in a passive manner wherein the liposome bilayer degrades over time through the action of various agents in the body. Every liposome composition will have a characteristic half-life in the circulation or at other sites in the body and, thus, by controlling the half-life of the liposome composition, the rate at which the bilayer degrades can be somewhat regulated.
- liposome membranes can be constructed so that they become destabilized when the environment becomes acidic near the liposome membrane (see, e.g., Proc. Natl. Acad. Sci. USA 84:7851 (1987); Biochemistry 28:908 (1989), which is hereby incorporated by reference in its entirety).
- liposomes When liposomes are endocytosed by a target cell, for example, they can be routed to acidic endosomes which will destabilize the liposome and result in drug release.
- the liposome membrane can be chemically modified such that an enzyme is placed as a coating on the membrane which slowly destabilizes the liposome. Since control of drug release depends on the concentration of enzyme initially placed in the membrane, there is no real effective way to modulate or alter drag release to achieve "on demand” drug delivery. The same problem exists for pH-sensitive liposomes in that as soon as the liposome vesicle comes into contact with a target cell, it will be engulfed and a drop in pH will lead to drug release.
- This liposome delivery system can also be made to target B cells by incorporating into the liposome structure a ligand having an affinity for B cell-specific receptors.
- compositions including the liposomes in a pharmaceutically acceptable carrier are also contemplated.
- Transdermal delivery devices have been employed for delivery of low molecular weight proteins by using lipid-based compositions (i.e., in the form of a patch) in combination with sonophoresis.
- transdermal delivery can be further enhanced by the application of an electric field, for example, by ionophoresis or electroporation.
- an electric field for example, by ionophoresis or electroporation.
- Using low frequency ultrasound which induces cavitation of the lipid layers of the stratum corneum higher transdermal fluxes, rapid control of transdermal fluxes, and drag delivery at lower ultrasound intensities can be achieved.
- Still further enhancement can be obtained using a combination of chemical enhancers and/or magnetic field along with the electric field and ultrasound.
- Implantable or injectable protein depot compositions can also be employed, providing long-term delivery of, e.g., the first and second chimeric proteins.
- implantable or injectable protein depot compositions can also be employed, providing long-term delivery of, e.g., the first and second chimeric proteins.
- U.S. Patent No. 6,331,311 to Brodbeck which is hereby incorporated by reference in its entirety, reports an injectable depot gel composition which includes a biocompatible polymer, a solvent that dissolves the polymer and forms a viscous gel, and an emulsifying agent in the form of a dispersed droplet phase in the viscous gel.
- such a gel composition can provide a relatively continuous rate of dispersion of the agent to be delivered, thereby avoiding an initial burst of the agent to be delivered.
- Yet another approach for targeting B cells with the chimeric protein or the composition of the present invention is to remove B cells from a subject and then expose the B cells to the chimeric protein or composition under conditions effective to cause B cells to transduce the chimeric protein. Thereafter, the transduced B cells can be returned or administered to the subject in need thereof. 227. Either administration of the chimeric protein or administration of in vitro transduced B cells can be utilized to correct a condition associated with improper ADD function in B cells, affording a patient with sufficient B cell liters to treat CSR, SHM, or B cell lymphoma in accordance with the presently claimed invention.
- delivery of the chimeric protein into a cell is meant contacting the cell with the chimeric protein under conditions effective for cellular uptake of the chimeric protein. Such delivery occurs in the absence of genetically modifying the cell.
- administration of the chimeric protein of the invention provides a transient, dose-dependent delivery of the deaminase, thereby avoiding promiscuous editing and minimizing other potential undesirable side affects resulting from sustained enhanced RNA editing or DNA mutating activity. This provides a significant advantage over gene therapy as the delivery can be controlled in a dose-dependent fashion, is adaptable to variations in the subject's needs, protein administration is reversible, and is generally more acceptable to a subject.
- compositions comprising the chimeric protein and a pharmaceutical carrier. Such compositions can be used therapeutically in combination with a pharmaceutically acceptable carrier.
- compositions can be administered intramuscularly or subcutaneously. Other compounds will be administered according to standard procedures used by those skilled in the art.
- compositions may include carriers, thickeners, diluents, buffers, preservatives, surface active agents and the like in addition to the molecule of choice.
- Pharmaceutical compositions may also include one or more active ingredients such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like.
- the pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated. Administration may be topically (including opthamalically, vaginally, rectally, intranasally), orally, by inhalation, or parenterally, for example by intravenous drip, subcutaneous, intraperitoneal or intramuscular injection.
- the disclosed antibodies can be administered intravenously, intraperitoneally, intramuscularly, subcutaneously, intracavity, or transdermally. 234. Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- non-aqueous solvents examples include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
- Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer's, or fixed oils.
- Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
- Formulations for topical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
- Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids or binders maybe desirable. 237.
- compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such as formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyravic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mono-, di-, trialkyl and aryl amines and substituted ethanolamines.
- inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid
- organic acids such as formic acid, acetic acid, propionic acid, glyco
- the dosage ranges for the administration of the compositions are those large enough to produce the desired effect in which the symptoms disorder are affected.
- the dosage should not be so large as to cause adverse side effects, such as unwanted cross-reactions, anaphylactic reactions, and the like.
- the dosage will vary with the age, condition, sex and extent of the disease in the patient and can be determined by one of skill in the art.
- the dosage can be adjusted by the individual physician in the event of any contraindications. Dosage can vary, and can be administered in one or more dose administrations daily, for one or several days. While individual needs vary, determination of optimal ranges of effective amounts of each of the first and second chimeric proteins is within the skill of the art.
- Typical dosages comprise about 0.01 to about 100 mg/kg-body wt.
- the preferred dosages comprise about 0.1 to about 100 mg/kg-body wt.
- the most preferred dosages comprise about 1 to about 100 mg/kg-body wt.
- chimeric proteins or mimetics which do not have a specific pharmaceutical function, but which may be used for tracking changes within cellular chromosomes or for the delivery of diagnostic tools for example can be delivered in ways similar to those described for the pharmaceutical products.
- the chimeric proteins can also be used for example as tools to isolate and test new drug candidates for a variety of diseases. 10. Chips and micro arrays
- chips where at least one address is the sequences or part of the sequences set forth in any of the nucleic acid sequences disclosed herein.
- chips where at least one address is the sequences or portion of sequences set forth in any of the peptide sequences disclosed herein. 242. Also disclosed are chips where at least one address is a variant of the sequences or part of the sequences set forth in any of the nucleic acid sequences disclosed herein. Also disclosed are chips where at least one address is a variant of the sequences or portion of sequences set forth in any of the peptide sequences disclosed herein. 11. Computer readable media
- nucleic acids and proteins can be represented as a sequence consisting of the nucleotides or amino acids. There are a variety of ways to display these sequences, for example the nucleotide guanosine can be represented by G or g. Likewise the amino acid valine can be represented by Val or V. Those of skill in the art understand how to display and express any nucleic acid or protein sequence in any of the variety of ways that exist, each of which is considered herein disclosed. Specifically contemplated herein is the display of these sequences on computer readable mediums, such as, commercially available floppy disks, tapes, chips, hard drives, compact disks, and video disks, or other computer readable mediums. Also disclosed are the binary code representations of the disclosed sequences. Those of skill in the art understand what computer readable mediums. Thus, computer readable mediums on which the nucleic acids or protein sequences are recorded, stored, or saved.
- Kits Disclosed are computer readable mediums comprising the sequences and information regarding the sequences set forth herein. 12. Kits
- kits that are drawn to reagents (e.g., chimeric proteins or mimetics) that can be used in practicing the methods disclosed herein.
- the kits can include any reagent or combination of reagent discussed herein or that would be understood to be required or beneficial in the practice of the disclosed methods.
- compositions disclosed herein have certain functions, for example, RNA editing and/or DNA mutation (editing), blocking Vif binding of endogenous CEM 15, or binding Vif.
- ADD > the function of the composition includes deaminating cytidine to form uridine in an mRNA molecule or deaminating deoxycytidine to form deoxyuridine in a DNA molecule, inducing immunoglobulin production, inducing CSR and/or SHM, inducing an immune response, treating hyper-IgM syndrome, and treating B- lymphocyte lymphoma.
- Disclosed are methods of treating a subject comprising administering to the subject an inhibitor of viral infectivity (e.g., HTV infectivity), wherein the inhibitor reduces the interaction between a deaminase (e.g., CEM15) and a viral infectivity factor (Vif), and wherein the subject is in need of such treatment.
- an inhibitor of viral infectivity e.g., HTV infectivity
- the inhibitor reduces the interaction between a deaminase (e.g., CEM15) and a viral infectivity factor (Vif)
- Vif viral infectivity factor
- An isolating step can comprise incubating the mixture with molecule comprising Vif or a fragment or derivative thereof.
- Disclosed are methods of identifying an inhibitor of an interaction between a deaminase and a viral infectivity factor (e.g., CEM15 and Vif, respectively) comprising incubating a library of molecules with the viral infectivity factor to form a mixture, and identifying the molecules that disrupt the interaction between the deaminase and the viral infectivity factor.
- the interaction disrupted can comprise an interaction between the viral infectivity factor and an amino acid of deaminase.
- An isolation step can comprises incubating the mixture with a molecule comprising a CEM 15 or fragment or derivative thereof.
- interrupting viral infectivity is meant stopping or reducing the production of infective viral genomes.
- HIV infectivity for example, is known to depend on a variety of proteins leading to the synthesis of double stranded DNA from single stranded HTV RNA genome and the integration of HTV DNA into the host cell's chromosomal DNA from where it is expressed to form viral genomes and viral proteins necessary for virion production.
- Viral infectivity factor or Vif is a viral protein that enters the host cell as part of the infectious virion and assists the virus in establishing itself as an integrated DNA sequence.
- Vif has been proposed to be its ability to bind to a cellular protein, CEM 15, and inactivate cellular processes that would otherwise reduce viral infectivity (Sheehy, A.M., (2002) Nature 418:656-650).
- TAT- CEM15 mimetic peptide delivery into cells provides excess CEM15 interaction sites for Vif to bind to, beyond the capacity of virion Vif to adsorb, thus effectively freeing the cellular CEM 15 deaminase from inhibition and enabling it to act on (mutate) HIV-1 to suppress its infectivity.
- Disclosed are methods of interrupting viral infectivity comprising contacting an infected cell or a cell prior to infection with the chimeric protein comprising a protein transduction domain and a deaminase domain, under conditions that allow delivery of the chimeric protein into the cell, wherein the chimeric protein binds with a viral infectivity factor (Vif) to interrupt viral infectivity.
- Interruption of viral infectivity may occur at the different level, including, for example, at the level of RNA on the incoming viras, on first or second strand cDNA, after dsDNA integration and/or on transcripts from the viral integrin.
- Disclosed are methods of treating a subject with a viral infection (e.g., HIV infection) or at risk for an infection comprising administering to the subject an effective amount of a chimeric protein comprising a protein transduction domain and a deaminase domain.
- a viral infection e.g., HIV infection
- the administration step is dose- dependent and transient.
- administration of a protein or agent described herein can be combined with various others therapies.
- a subject with HIV may be treated concomitantly with protease inhibitors and other agents.
- Disclosed are methods of inhibiting infectivity comprising administering an agent that prevents or reduces infectivity,
- the system supports infectivity via a deaminase interaction; assaying the effect of the agent on the amount of infectivity in the system; and selecting an agent that causes a decrease in the amount of infectivity present in the system because of an inhibition of the deaminase interaction relative to the system without the addition of the composition.
- Also disclosed are methods of inhibiting HTV infectivity comprising administering a composition that reduces an interaction between CEM15 and Vif.
- Also disclosed are methods of inducing production of immunoglobulins of the various classes and their subtypes comprising contacting a B lymphoblast with a chimeric ADD protein, under conditions effective to cause cellular uptake of the chimeric protein, and thereby induce antibody production in the B lymphoblast.
- the B lymphoblast can be in vitro or in vivo.
- Antibody production can include IgG, IgE, or IgA production. 257.
- Also disclosed are methods of inducing class switch recombination in a B lymphocyte cell comprising contacting a B lymphocyte cell with a chimeric ADD protein, under conditions effective to cause cellular uptake of the chimeric protein, and thereby induce class switch recombination during antibody production in the B lymphocyte cell.
- the B lymphoblast can be in vitro or in vivo.
- the B lymphocyte cell, prior to contacting, can exhibit normal or deficient levels of CSR during antibody production.
- Also disclosed are methods of inducing somatic hypermutation in a B lymphocyte cell comprising contacting a B lymphocyte cell with a chimeric AID protein, under conditions effective to cause cellular uptake of the chimeric protein, and thereby induce somatic hypermutation during antibody production in the B lymphocyte cell.
- the contacting step can be in vitro or in vivo.
- the B lymphocyte cell, prior to contacting, can exhibit normal or deficient levels of SHM during antibody production.
- Also disclosed are methods of inducing an immune response to an antigen in a subject comprising contacting a B lymphocyte cell with a chimeric protein under conditions effective to cause cellular uptake of the chimeric protein, and thereby induce antibody production in the B lymphocyte cell to afford a stronger immune response to an antigen in the subject.
- the B lymphoblast can be in vitro or in vivo.
- Antibody production can include IgG, IgE, or IgA production.
- the contacting is carried out in vitro, and the method further comprises introducing a B lymphocyte cell into a subject. Such methods are useful when employed concomitantly with vaccines.
- Disclosed are methods of treating a subject for hyper-IgM syndrome comprising administering to a subject with hyper-IgM syndrome an effective amount of a chimeric protein, wherein the chimeric protein is taken up by B lymphocyte cell and induces antibody production sufficient to treat the hyper-IgM syndrome.
- Antibody production can include IgG, IgE, or IgA production.
- Also disclosed are methods of treating a subject for hyper-IgM syndrome comprising administering to a subject with hyper-IgM syndrome a population of B lymphocyte cells, wherein the B lymphocyte is contacted with a therapeutic amount of the chimeric protein of the invention, wherein the administered B lymphocyte cells exhibit antibody production sufficient to treat the hyper-IgM syndrome.
- Antibody production can include IgG, IgE, or IgA production.
- Disclosed are methods for treating a subject for B cell lymphoma comprising administering to a subject exhibiting B lymphocyte cell lymphoma an effective amount of a chimeric protein, wherein the chimeric protein is taken up by cancerous B lymphocyte cells, and inhibits or blunts cell growth thereof, thereby treating the lymphoma.
- an agent that enhances the efficiency of editing is meant a genetic, pharmacologic, or metabolic agent or condition that increases the RNA or
- DNA editing or mutating function of the chimeric protein as compared to the amount of editing that occurs in the absence of the agent.
- Some of the conditions and agents that modulate editing activity include: (i) changes in the diet, (ii) hormonal changes (e.g., levels of insulin or thyroid hormone), (iv) osmolarity (e.g., hyper or hypo osmolarity), (v) ethanol, (vi) inhibitors of RNA or protein synthesis and (vii) conditions that promote liver proliferation.
- the methods of the invention can further comprise administering to the subject an agent that enhances the efficiency of mRNA editing function of the chimeric protein.
- the cytidine deaminase can be ADD, CEM 15, or APOBEC-1.
- Disclosed are methods of treating a condition in a subject comprising administering to the subject a chimeric protein comprising a protein transduction domain and a deaminase domain. It is understood that the effect of the administration of the composition to the subject can have the effect of but is not limited to reducing the symptoms of the condition, a reduction in the severity of the condition, or the complete ablation of the condition.
- the cancer can be selected from the group consisting of lymphomas (Hodgkins and non-Hodgkins), B cell lymphoma, T cell lymphoma, myeloid leukemia, leukemias, mycosis fungoides, carcinomas, carcinomas of solid tissues, squamous cell carcinomas, adenocarcinomas, sarcomas, gliomas, blastomas, neuroblastomas, plasmacytomas, histiocytomas, melanomas, adenomas, hypoxic tumours, myelomas, ADDS-related lymphomas or sarcomas, metastatic cancers, bladder cancer, brain cancer, nervous system cancer, squamous cell carcinoma of head and neck, neuroblastoma/glioblastoma, ovarian cancer, skin cancer, liver cancer, melanoma, squamous cell carcinomas of the mouth, throat, larynx,
- lymphomas Hodgkins and non-Hodgkins
- the condition is a, infectious disease (e.g., a viral disease).
- the viral infection can be selected from the list of viruses consisting of Herpes simplex viras type-1, Herpes simplex virus type-2, Cytomegalovirus, Epstein-Barr viras, Varicella-zoster virus, Human herpesvirus 6, Human herpesvirus 7, Human herpesvirus 8, Variola viras, Vesicular stomatitis virus, Hepatitis A virus, Hepatitis B virus, Hepatitis C virus, Hepatitis D viras, Hepatitis E virus, Rhinoviras, Coronavirus, Influenza virus A, Influenza viras B, Measles viras, Polyomavirus,
- the bacterial infection can include M. tuberculosis, M. bovis, M. bovis strain BCG, BCG substrains, M. avium, M. intracellulare, M.
- Yersinia pestis Pasteurella haemolytica, Pasteurella multocida, other Pasteurella species, Actinobac ⁇ llus pleuropneumoniae, Listeria monocytogenes, Listeria ivanovii, Brucella abortus, other Brucella species, Cowdria ruminantium, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia psittaci, Coxiella burnetti, other Rickettsial species, Ehrlichia species, Staphylococcus aureus,
- Staphylococcus epidermidis Streptococcus pyogenes, Streptococcus agalactiae, Bacillus anthracis, Escherichia coli, Vibrio cholerae, Campylobacter species, Neiserria meningitidis, Neiserria gonorrhea, Pseudomonas aeruginosa, other Pseudomonas species, Haemophilus influenzae, Haemophilus ducreyi, other Hemophilus species, Clostridium tetani, other Clostridium species, Yersinia enterolitica, and other Yersinia species.
- the parasitic infection can include Toxoplasma gondii, Plasmodium falciparum, Plasmodium vivax, Plasmodium malariae, other Plasmodium species., Trypanosoma brucei, Trypanosoma cruzi, Leishmania major, other Leishmania species., Schistosoma mansoni, other Schistosoma species., and Entamoeba histolytica.
- the fungal infection can include Candida albicans, Cryptococcus neoformans, Histoplama capsulatum, Aspergillus fumigatus, Coccidiodes immitis, Paracoccidiodes brasiliensis, Blastomyces dermitidis, Pneomocystis carnii, Penicillium marneffi, and Alternaria alternata.
- compositions can be used in a variety of ways as research tools.
- the disclosed compositions such as the TAT-CEM15, or the TAT- ADD chimeric protein, can be used to study the interactions between Vif and CEM 15 in virions or T-cells, or ADD and B-cells, respectively, by, for example, acting as inhibitors of binding or enhancers of production, respectively.
- compositions can be used for example as targets in combinatorial chemistry protocols or other screening protocols to isolate molecules that possess desired functional properties related to inhibition of the CEM15-Vif interaction.
- compositions can also be used for example as targets in combinatorial chemistry protocols or other screening protocols to isolate molecules that possess desired functional properties related to ADD.
- compositions can also be used diagnostic tools related to diseases that are related to RNA or DNA editing, such as HTV, B-cell lymphoma, CSR or SHM disorders.
- the disclosed compositions can be used as discussed herein as either reagents in microarrays or as reagents to probe or analyze existing microarrays.
- the disclosed compositions can be used in any known method for isolating or identifying single nucleotide polymorphisms.
- the compositions can also be used in any method for determining allelic analysis.
- the compositions can also be used in any known method of screening assays, related to chip/micro arrays.
- the compositions can also be used in any known way of using the computer readable embodiments of the disclosed compositions, for example, to study relatedness or to perform molecular modeling analysis related to the disclosed compositions.
- Disclosed are methods of screening for a viral RNA deaminase mimetic comprising adding the agent to be screened to a virally infected mammalian system and detecting levels of edited viral RNA and/or mutated (edited) viral DNA, elevated levels of edited viral RNA or mutated (edited) viral DNA indicating a viral RNA deaminase mimetic or a viral DNA deaminase mimetic.
- the method can further comprise detecting binding of the agent to be screened to a viral integration factor.
- Also disclosed are methods of screening for cellular RNA and DNA deaminases comprising adding the agent to be screened to a virally infected mammalian system; and detecting levels of edited cellular RNA and/or mutated (edited) cellular DNA, elevated levels of edited cellular RNA or mutated (edited) cellular DNA indicating a cellular RNA or DNA deaminase mimetic.
- a composition such as CEM 15-Vif interactions, or ADD-B cell interaction
- Also disclosed are methods of identifying inhibitors of viral infectivity comprising, (a) administering an agent to a system, wherein the system supports infectivity via a deaminase interaction (e.g., CEM15-
- Disclosed are methods of identifying an inhibitor of an interaction between CEM 15 and Vif comprising (a) administering a composition to a system, wherein the system comprises CEM15, (b) assaying the effect of the composition on a CEM15-Vif interaction, and (c) selecting a composition which inhibits a CEM 15-Vif interaction. 281.
- Also disclosed are methods of screening for inhibitors of ADD comprising adding the agent to be screened to cells expressing ADD; and detecting levels of ADD and/or RNA or DNA mutation rates and/or antibody production rates; reduced levels of ADD and/or RNA or DNA mutation rates and/or antibody production rates indicating an ADD inhibitor.
- the viras can be a retroviras (e.g., HTV).
- the virus can be an RNA virus.
- the RNA virus can be selected from the list of viruses consisting of Vesicular stomatitis viras, Hepatitis A virus, Hepatitis C virus, Rhinovirus, Coronavirus, Influenza viras A, Influenza viras B, Measles virus, Respiratory syncytial viras, Adenoviras, Coxsackie virus, Dengue virus, Mumps virus, Polioviras, Rabies virus, Rous sarcoma viras, Yellow fever virus, Ebola virus, Marburg virus, Lassa fever virus, Eastern Equine Encephalitis virus, Japanese Encephalitis virus, St. Louis Encephalitis virus, Murray Valley fever virus, West Nile viras, Rift Valley fever virus, Rotaviras A, Rotavirus B, Rotaviras C, Sind
- RNA deaminase mimetic is a CEM15 mimetic.
- Disclosed are methods of screening for a viral DNA deaminase mimetic comprising adding the agent to be screened to a virally infected mammalian system; and detecting levels of edited viral DNA, elevated levels of edited viral RNA indicating a viral RNA deaminase mimetic.
- the method can further comprise detecting binding of the agent to be screened to a viral integration factor.
- viral DNA deaminase mimetic is a CEM15 mimetic. Also disclosed are methods, wherein the virus is a
- the DNA viras can be selected from the list of viruses consisting of Herpes simplex virus type-1, Herpes simplex virus type-2, Cytomegalovirus, Epstein-Barr viras, Varicella-zoster virus, Human herpesvirus 6, Human herpesvirus 7, Human herpesvirus 8, Variola virus, Hepatitis B virus, Hepatitis D virus, Polyomavirus, and Human Papilomaviras. 286.
- the present invention also discloses methods of using computer readable media to analyze a comparison sequence.
- compositions disclosed herein and the compositions necessary to perform the disclosed methods can be made using any method known to those of skill in the art for that particular reagent or compound unless otherwise specifically noted.
- a deaminase e.g., CEM15
- Vif viral infectivity factor
- Disclosed are methods of making a composition capable of inhibiting infectivity comprising admixing a compound with a pharmaceutically acceptable carrier, wherein the compound is identified by administering the compound to a system, wherein the system supports infectivity via a deaminase interaction, assaying the effect of the compound on the amount of infectivity in the system, and selecting a compound which causes a decrease in the amount of infectivity in the system because of an inhibition of the deaminase interaction, relative to the system without the addition of the compound.
- infectivity e.g., HIV infectivity
- Disclosed are methods of manufacturing an inhibitor to viral budding comprising (a) administering a composition to a system, wherein the system supports viral infectivity via a deaminase interaction, (b) assaying the effect of the composition on the amount of infectivity in the system, (c) selecting a composition which cause a decrease in the amount of infectivity present in the system because of an inhibition of the deaminase interaction, relative to the system with the addition of the composition, and (d) synthesizing the composition. Also disclosed are methods further comprising the step of admixing the composition with a pharmaceutical carrier.
- the nucleic acids such as, the oligonucleotides to be used as primers can be made using standard chemical synthesis methods or can be produced using enzymatic methods or any other known method. Such methods can range from standard enzymatic digestion followed by nucleotide fragment isolation (see for example, Sambrook Molecular Cloning: A Laboratory Manual, 2nd Edition (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989, Chapters 5, 6) to purely synthetic methods, for example, by the cyanoethyl phosphoramidite method using a Milligen or Beckman System lPlus DNA synthesizer (for example, Model 8700 automated synthesizer of Milligen-Biosearch, Burlington, MA or ABI Model 380B). Synthetic methods useful for making oligonucleotides are also described by Ucuta, Ann. Rev. Biochem. 53:323-356 (1984), (phosphotriester and phosphite-triester methods), and Narang, Methods
- Protein nucleic acid molecules can be made using known methods such as those described by Nielsen, Bioconjug. Chem. 5:3-7 (1994).
- One method of producing the disclosed proteins is to link two or more peptides or polypeptides together by protein chemistry techniques.
- peptides or polypeptides can be chemically synthesized using currently available laboratory equipment using either Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert -butyloxycarbonoyl) chemistry. (Applied Biosystems, Inc., Foster City, CA).
- Fmoc (9-fluorenylmethyloxycarbonyl) or Boc (tert -butyloxycarbonoyl) chemistry Applied Biosystems, Inc., Foster City, CA.
- a peptide or polypeptide corresponding to the disclosed proteins for example, can be synthesized by standard chemical reactions.
- a peptide or polypeptide can be synthesized and not cleaved from its synthesis resin whereas the other fragment of a peptide or protein can be synthesized and subsequently cleaved from the resin, thereby exposing a terminal group which is functionally blocked on the other fragment.
- peptide condensation reactions these two fragments can be covalently joined via a peptide bond at their carboxyl and amino termini, respectively, to form an antibody, or fragment thereof.
- peptide or polypeptide is independently synthesized in vivo as described herein. Once isolated, these independent peptides or polypeptides may be linked to form a peptide or fragment thereof via similar peptide condensation reactions.
- enzymatic ligation of cloned or synthetic peptide segments allow relatively short peptide fragments to be joined to produce larger peptide fragments, polypeptides or whole protein domains (Abrahmsen L, Biochemistry, 30:4151 (1991)).
- native chemical ligation of synthetic peptides can be utilized to synthetically construct large peptides or polypeptides from shorter peptide fragments. This method consists of a two step chemical reaction (Dawson, Science, 266:776-779 (1994)).
- the first step is the chemoselective reaction of an unprotected synthetic peptide—thioester with another unprotected peptide segment containing an amino-terminal Cys residue to give a thioester-linked intermediate as the initial covalent product. Without a change in the reaction conditions, this intermediate undergoes spontaneous, rapid intramolecular reaction to form a native peptide bond at the ligation site (Baggiolini M (1992) FEBS Lett. 307:97-101; Clark-Lewis I, J.Biol.Chem., 269:16075 (1994); Clark-Lewis I., Biochemistry, 30:3128 (1991); Rajarathnam K., Biochemistry 33:6623-30 (1994)).
- unprotected peptide segments are chemically linked where the bond formed between the peptide segments as a result of the chemical ligation is an unnatural (non-peptide) bond (Schnolzer, M Science, 256:221 (1992)).
- This technique has been used to synthesize analogs of protein domains as well as large amounts of relatively pure proteins with full biological activity (deLisle Milton RC, Techniques in Protein Chemistry IV. Academic Press, New York, pp. 257-267 (1992)).
- a cDNA construct can be assembled that includes the sequences of SEQ DD NOs: 2 and 44, and, optionally, further includes the sequence of SEQ DD NO: 42.
- Such cDNA constructs can further include additional elements including, for example, a hemagglutin ("HA") domain.
- HA hemagglutin
- An exemplary HA domain is provided as SEQ DD NO: 46; and an exemplary nucleic acid that encodes it is provided as SEQ DD NO: 47.
- a cDNA construct can be assembled that includes the sequences of SEQ DD NOs: 2, 44, and, optionally, further includes the sequence of SEQ DD NO: 42 and or 47, or SEQ DD NOS: 4 and/or 44 such a cDNA construct could also include a nucleic acid sequence that encodes a polyhistidine tag.
- methods that can be used for making these compositions, such as synthetic chemical methods and standard molecular biology methods. It is understood that the methods of making these and the other disclosed compositions are specifically disclosed.
- nucleic acid molecules produced by the process comprising linking, in an operative way, a nucleic acid comprising the sequences set forth in SEQ DD NOs: 2 (or 4), 44, 47, and/or 42, and a sequence controlling the expression of the nucleic acid.
- nucleic acid molecules produced by the process comprising linking in an operative way a nucleic acid molecule comprising a sequence having 80% identity to a sequence comprising SEQ DD NOs: 2 (or 4),
- nucleic acid 44, 47, and/or 42, and a sequence controlling the expression of the nucleic acid.
- nucleic acid molecules produced by the process comprising linking in an operative way a nucleic acid molecule comprising a sequence that hybridizes under stringent hybridization conditions to a sequence that comprises SEQ DD NOs: 2 (or 4), 44, 47, and/or 42 and a sequence controlling the expression of the nucleic acid.
- nucleic acid molecules produced by the process comprising linking in an operative way a nucleic acid molecule comprising a sequence encoding a combination of peptides set forth in SEQ DD NOs: 2 and 44, in the presence or absence a sequence encoding a peptide of SEQ DD NO: 42 and 47, and a sequence controlling an expression of the nucleic acid molecule.
- nucleic acid molecules produced by the process comprising linking in an operative way a nucleic acid molecule comprising a sequence encoding a peptide having 80% identity to a peptide combinations set forth herein and a sequence controlling an expression of the nucleic acid molecule.
- nucleic acids produced by the process comprising linking in an operative way a nucleic acid molecule comprising a sequence encoding a peptide having 80% identity to a peptide combination set forth herein, wherein any change from the provided peptide sequences are conservative changes, and a sequence controlling expression of the nucleic acid molecule.
- Example 1 a) Methods for obtaining the CEM15 cDNA and for cloning it into two different systems
- Human CEM15 (NP-068594; also known as MDS019, AAH24268) was amplified from total cellular RNA of the NALM-6 cell line
- Oligo-dT primed first-strand cDNA was amplified using Expand HiFi Taq DNA polymerase (Roche) with the following primers; '5'A' CACTTTAGGGAGGGCTGTCC (SEQ DD NO: 10) and '3 'A' CTGTGATCAGCTGGAGATGG (SEQ DD NO: 11).
- Thel366 bp product was reamplified with CEM 15 specific PCR primers that included Ncol and Xhol restriction sites on the 5' and 3 ' primer respectively; '5'B' CTCCCATGGCAAAGCCTCACTTCAGAAACACAG (SEQ DD NO: 12) and '3'B' CTCCTCGAGGTTTTCCTGATTCTGGAGAATGGCCC (SEQ DD NO: 13).
- the 1154bp PCR product was digested with Ec ⁇ RI to remove potentially co-amplified highly homologous APOB ⁇ C3B/Phorbolin 3 (Q9UH17) sequences and the Ncol/Xhol digested product subcloned into a modified pET28a (Novagen) plasmid such that a CEM15-thrombin-HA-6His fusion protein could be expressed.
- the full-length human CEM15 cDNA was subcloned by PCR into a mammalian expression vector (pcDNA3) such that it is expressed with an amino terminal haemagglutinin (HA) epitope. It was also subcloned into pET28a (Novagen) to express a 6His-thrombin-CEM15 fusion protein.
- the construction of the new APOBEC-1 model is based upon the hypothesis that enzymes with a common catalytic function (i.e. hydrolytic deamination of a nucleoside base) exhibit a common three-dimensional fold despite a low overall amino acid sequence identity (-30%). This level of homology is often cited as the lower limit upon which one can reliably model the fold of a given polypeptide sequence (Burley, S.K. (2000) N ⁇ twre Struct. Biol. 7:932-934.).
- experimentally derived three-dimensional structures are available for three cytidine deaminases (CD As) whose role in pyrimidine metabolism has been firmly established. These enzymes encompass the dimeric CDA from E.
- Cddl was amplified by PCR from Baker's yeast. The product was cloned into a pET-28a vector (Novagen) containing N-terminal 6xHis using Ndel and EcoRI restriction sites; constructs were verified by DNA sequencing.
- BL21 CodonPlus (Stratagene) cells transformed with vector were grown at 37 C to an OD600 of 0.7 and induced with 1 mM EPTG at 30°C for 3 hours.
- Bacterial pellets were resuspended in lysis buffer (50 mM Tris-Cl pH 8.0, 10 mM ⁇ - mercaptoethanol, 1 mg/ml lysozyme, lmM PMSF, 2 mM benzamidine and 5 ⁇ g/ml each of aprotinin, leupeptin and pepstatin A), lysed, and nuclease digested (0.5%
- the 6xHis tagged protein was purified in batch with NiNTA agarose (Qiagen) utilizing the following wash, elution, and dialysis scheme: wash 1, 10 mM Tris-Cl pH 8.0, 100 mM KC1, 20 mM imidazole, 10% glycerol; wash 2, same as wash 1 including 1 M KC1; wash 3, repeat wash 1; elution, 10 mM Tris-Cl pH 8.0,
- Crystallization 316 Crystals were grown at 20°C by use of the hanging drop vapor diffusion method (McPherson (1990) European J. Biochem 189, 1-23) from well solutions of 16.5% (w/v) PEG monomethylether (MME) 5K, 450 mM NH4C1, 100 mM Na-succinate pH 5.5, 10 mM DTT and 1 mM NaN 3 .
- MME PEG monomethylether
- the positions of four zinc atoms were located by use of the software package SOLVE v2.0 (Terwilliger (2001) Acta Crystallogr. D.
- the edited nucleotide was modeled according to constraints derived from the known locations of CDA inhibitors in the template X-ray crystal structures: 1 JKT (tetrahydrouridine ) and 1AF2 (3,4 dihydrouridine). Due to the known substrates of ADD and APOBEC-1, DNA and RNA sequences were modeled as single-stranded. Additionally, the restraint that nucleotide bases flanking the edited/mutated sites maintain modest base stacking was imposed by adding additional distance restraints in the model calculation. Each monomer of a respective ARP model was also restrained to be symmetric. This method of modeling far exceeds previous standards employed to model APOBEC-1 (Navaratnam, N.
- Cddl was employed as a model compound to examine: (i) the feasibility of the predicted APOBEC-1 fold, and (ii) the role of key functional elements predicted to be in the active site linker or other active site locations necessary for catalysis. (Note: mutations can be divided into two classes: those that stabilize/destabilize the structure through insertions or changes of large streches of amino acids; and those that effect function by modest changes to amino acids). A series of mutants were constructed in a manner analogous to the following method. In order to assess the importance of the predicted C-terminal "tail" of Cddl upon the ability to edit RNA, a 19 amino acid linker from E. coli was added after residue 142.
- Cddl was PCR amplified using a 5' Cddl -specific primer and a 3' primer encoding the 19 amino acid E. coli "linker" extension and subcloned into the Ndel and EcoRI sites of pET28a (Novagen).
- Glyl37 was converted to Ala using the QuikChange mutagenesis system (Stratagene) according to the manufacturer's protocols; other point mutations were constructed similarly.
- PDB #1 AF2 was competent to edit under conditions similar to APOBEC-1 and Cddl in yeast (Dance et al., 2001 Nucleic Acid Res.
- the E. coli CDA was PCR amplified from genomic DNA and subcloned for yeast expression as described below.
- a series of Cddl chimeras were assembled by fusing together two Cddl polypeptide chains joined by a linker. The 5' monomers containing the appropriate C-terminal Apobec-
- E. coli 19 amino acid linker were amplified and subcloned as described above.
- the amino terminally foreshortened C-terminal monomer (missing helix ocl based upon homology modeling) was PCR amplified using the wild type or Glu63 to Ala Cddl template and ligated as an EcoRI/XhoI fragment to the appropriate 5' monomer in pET28a.
- the linking EcoRI site was mutagenized to restore the reading frame of the Cddl chimeras.
- Cddl In the context of late log phase growth in yeast with galactose feeding, overexpressed Cddl is capable of C to U specific editing of reporter apoB mRNA at site C6666 at a level of 6.7%, which is ⁇ 10x times greater than the negative control (empty vector - compare lanes 1 and 2, above).
- CDA from E. coli (equivalent to PDB entry 1 AF2) is incapable of editing on the reporter substrate (lane 3).
- the active site mutants E61 A and G137A abolish detectable Cddl activity (lanes 4 and 5).
- the addition of the E. coli linker sequence (lane 6) impairs editing function as well.
- the linker flexibility suggests that these components are not an important part of the linker flexibility, or that the new chimera adopts a different fold in this region compared to that of the pyrimidine metabolism enzymes.
- the ARP models suggest a restructuring of the active site linker that makes the entire region spanning from 130 to 142 (human APOBEC-1 numbering) flexible in a manner that moves to accommodate large polymeric substrates such as RNA or DNA (see Figure 12). Additional evidence of the importance of the linker sequence comes from mutagenesis on rat APOBEC-1 (highly homologous to human). When the 8 amino acid linker sequence of rat APOBEC-1 is replaced with the first 8 amino acids of the E.
- the APOBEC-1 construct is unable to edit reporter apoB mRNA in the human hepatoma cell line HepG2.
- the hidden Markov modeling software SAM was trained with CDDl, APOBECl, APOBEC2, ADD and phorbolin 1. This identified APOBEC3A, 3B, 3C, 3E, 3F, 3G, XP_092919, PHB1, XP_115170/XP_062365.
- PHI-BLAST using the target pattern H[VA]-E-x-x-F-(x)19- [I7V]-[T/V]-[W/C]-x-x-S-W-[ST]-P-C-x-x-C limited the search more and misses only the 3B (Phorbolin 2) variant AAD00089 in which a single codon change GAC/T to GAA/G changes the ZDD center HxE to HxA. This is either a sequencing error or a significant SNP for psoriasis.
- mice Also identified is a mouse gene homologous to hu APOBEC3G (CEM 15). On Chro 15, position 15E2. This is highly homologous to APOBEC3B, D+E, G. There are 9 exons. Both ZDDs fall in their own exons. On the mouse gene, the start of the linker is an exon junction. 325. The multiple sequence alignment results are shown below in
- K APOBEC3D NPQIRNPMERMYRDTIYDNIEIEPI 25
- APOBEC2 SSG RNKTFj ⁇ w: EAQGKGGQVQASRGY ED- -EHAAAMAIEAI 102
- MGC:7002; hypothetical protein MGC7002 [Mus musculusj Length 429
- IVS- ⁇ 3'5'apoB was created by ligation of the appropriate halves of the above molecules.
- McArdle RH7777 cells were maintained as previously described (Sowden, M.P. (1996) J. Biol. Chem. 271:3011-3017) and transfected in six-well clusters with 2 ⁇ g of DNA using lipofectAMINE ® (Gibco BRL) according to the manufacturer's recommendations.
- RNAs were harvested 48 h post-transfection in TriReagent (Molecular Research Center, Cincinnati, OH, U.S.A.) and subjected to reverse-transcriptase (RT)-PCR for amplification of intron-containing or exonic apoB specific transcripts using appropriate PCR primers as previously described (Sowden, M., (1996) RNA 2, 274-288) and outlined in the Figure legends.
- the poisoned-primer-extension assay relies on the annealing of a 32 P-end-labelled primer 3 ' of the editing site to the heat-denatured single-stranded
- extension product eight nucleotides longer if the cytidine has not been edited (CAA in the Figures); that is, incorporation of ddGTP causes chain termination. If editing has created a uridine, then primer extension continues a further 11 nucleotides to the next 5' cytidine, where chain termination then occurs (UAA in the Figures). Quantification of the level of editing is accurately determined using laser scanning densitometry.
- the linear exposure range of the Phosphorhnager screen is sufficiently great to permit precise determination of low counts in the UAA bands whilst the high levels of counts in the CAA band remain in the linear range. Editing percentages were calculated as the counts in the UAA band divided by the total counts in the CAA plus UAA bands times 100. This assay has a lower level of detection of 0.1% editing and remains linear up to 99.5% and is independent, between 1 ng and 500 ng, of the total amount of template PCR product used (M. P. Sowden, unpublished work).
- the apoB pre-mRNA reporter construct contained an abbreviated splicing cassette from the adenovirus late leader sequence fused to 450 nt of wild- type apoB mRNA (Figure 1A). Unspliced pre-mRNA and spliced mRNA were amplified from total cellular McArdle cell mRNA using the MS1/MS2 and SP6/T7 amplimer pairs respectively ( Figure 1 A). Consistent with previous results, the splicing cassette impaired the ability of the IVS-apoB RNA transcript to be edited, either before (pre-mRNA) or after (mRNA) it was spliced relative to a control transcript (pRc-apoB) that contained only apoB sequence ( Figure IB).
- C 6666 is located in the middle of the 7.5 kb exon 26, significantly further from a 5' or 3' intron than in the chimeric constructs described above. Therefore it was evaluated whether the proximity of the splice donor and acceptor sites to the tripartite motif affected editing efficiency.
- Insertion of a monomer or a dimer of the splicing-defective intron cassette increased the distance between the active intron and the editing site by 425 and 850 nt respectively ( Figure 2A). This increased the effective size of the chimeric exon to nearly 1 kb or 1.4 kb respectively; the average size of an internal exon being only 200-300 nt in mammals (Robberson, B.L., (1990) Mol. Cell. Biol.
- Intron-containing transcripts were amplified using the MS ⁇ 5/MS ⁇ 6 amplimers followed by nested PCR with the MS2/MS3 amplimer pair and were edited at an efficiency of 0.5 % ( Figure 3B).
- the use of the MS ⁇ 5/MS ⁇ 6 amplimer pair in the initial PCR would not distinguish between unspliced pre-mRNA or spliced-out lariat RNA, but given the rapid degradation of lariat RNA, it is unlikely that the amplified PCR products represent lariat RNA species. If, however, there were amplified lariat species present, the difference of 0.1 % between intron-containing and unspliced pre- mRNA suggests that lariat RNAs containing apoB editing sites are not efficient editing substrates.
- RNA splicing and RNA nuclear export were separated by utilizing a modification of the Rev complementation assay that has been employed to identify HIV-1 Rev-like nuclear export sequences (Taagepera, S., (1998) Proc. Natl. Acad. Sci. U.S.A. 95:7457-7462).
- Rev functions, by interaction with an RRE, to export unspliced RNA out of the nucleus.
- a reporter plasmid was constructed which contained an intron interrupted by the CAT gene and a functional apoB RNA editing cassette ( Figure 4A). CAT activity could only be expressed if unspliced
- the unspliced CAT- apoB RNA was also promiscuously edited (additional primer extension stop labeled ' 1 ', Figure 4C). Promiscuous editing does not occur under physiological expression levels of APOBEC-1 in McArdle cells (Sowden, M., (1996) RNA 2, 274-288.; Sowden, M.P. (1996) J. Biol. Chem. 271:3011-3017.; Siddiqui, J.F., (1999) Exp Cell Res. 252: 154-164), in rat tissues or under biological conditions where editing efficiencies are greater than 90%, e.g. rat intestine (Greeve, J., (1993) J. Lipid Res.
- the components of the minimal editosome from defined in vitro system analyses are APOBEC-1 as a homodimeric cytidine deaminase (Lau, P.P., (1994) Proc. Natl. Acad. Sci. U.S.A. 91 :8522-8526) bound to the auxiliary protein ACF/ASP that serves as the editing-site recognition factor through its mooring- sequence-selective RNA-binding activity (Mehta, A., (2000) Mol. Cell. Biol.
- RNA structure and/or splicing have also been implicated in RNA editing as auxiliary factors. These include hnRNP C, hnRNP D, APOBEC-1 -binding protein (which has homology with hnRNP A and B) and KSRP, a protein involved in alternative splice site utilization (Lellek, H., (2000) J. Biol. Chem. 275:19848- 19856; Greeve, J., (1998) J. Biol. Chem. 379:1063-1073; Anant, S.G., (1997)
- RNA splicing and editing The description of the relationship of RNA splicing and editing is unique for apoB cytidine-to-uridine mRNA editing.
- an emerging theme in RNA processing is an interdependence of multiple steps in RNA maturation.
- apoB editing is the adenine-to-inosine editing of glutamate and 5-hydroxytryptamine receptors, hi contrast with apoB mRNA editing, mRNA substrates that undergo adenine-to-inosine editing all require the presence of a complementary intron sequence to form a partially double- stranded RNA structure that is recognized by the appropriate ADARl or ADAR2 enzyme Simpson, L., (1996) Annu. Re. Neurosci.
- 91:10270- 10274 suggests that the level of editing maybe influenced by interference or interaction with RNA splicing.
- endogenously expressed GluR2 mRNA from neuronal cell lines is always edited to 100% at the Gln/Arg site, whereas unspliced GluR2 transcripts are edited to only 70-90% (Higuchi, M., (1993) Cell 75:1361-1370.), indicating a partial inhibition of splicing until editing has occurred.
- the transcript of the Glu-R6 gene contains three exonic editing sites (Ile/Val, Tyr/Cys and Gln/Arg) which are edited to different extents, indicating that there must be a tightly regulated and coordinated action of the appropriate ADAR and the spliceosome at each editing site (Kohler, M., (1993) Neuron 10:491-500; Seeburg, P.H., (1998) Brain Res. Rev. 26:217-229).
- RNA processing has attempted to identify active versus inactive populations of processing factors and have postulated that the greatest concentration of factors may or may not correspond to sites of function, dependent upon metabolic activity (Spector, D. (1993) Annu. Rev. Cell. Biol. 9:265-315). Specifically, recent photobleaching studies (Lewis, J.D., (2000) Science 288:1385-1389. and references cited therein) suggested that 'speckles' correspond to sites where free small nuclear RNPs transiently assemble before recruitment by the C-terminal domain of RNA polymerase ⁇ and transfer to nascent transcripts.
- RNA editing and RNA splicing should be tightly coordinated, and the observation of nuclear and cytoplasmically localized APOBEC-1 and ACF corresponds to active and inactive complexes respectively.
- APOBEC-1 and ACF corresponds to active and inactive complexes respectively.
- RNA processing reactions can occur in vitro, but they are not as efficient as in vivo. This is also true for in vitro apoB RNA editing reactions.
- IVS-apoB RNA transcripts were edited with the same efficiency as intronless apoB transcripts in vitro. This indicates that the presence of an intron per se does not interfere with editing, but, as was shown, there is a clear interdependence of splicing and editing for editing site regulation and fidelity in vivo.
- RNAs that contain nonsense codons and that have passed through the spliceosome are 'marked' and targeted for decay (Le Hir, H., (2000) EMBO J. 19:6860-6869).
- 'NMD' mammalian nonsense-mediated decay
- This imprinting of nuclear pre-mRNA by proteins that remain bound in the cytoplasm is a means of mRNAs 'communicating their history' (Kataoka, N., (2000) Mol. Cell. 6:673-682) and/or perhaps ensuring that no further RNA processing/editing occurs in the cytoplasm (Maquat, L., (2001) Cell 104:173-176).
- Edited mRNA or mutated DNA is identified through an adaptation of a bacterial DNA mismatch detection system (Faham et al. Hum. Mol. Genet. (2001) which was originally developed to detect single nucleotide polymorphisms in genomic DNA. In this system, DNA repair confers a positive selection through antibiotic resistance for clones containing an insert bearing the edited or mutated nucleotide (Faham et al., 2001).
- Unedited and edited cDNA prepared from mRNA (or restriction endonuclease fragments of genomic DNA) isolated from wild type and AID-expressing NTH3T3 is used to form heteroduplexes that go into the selection system.
- the identity of the tetracycline resistant (selected) clone(s) is determined by DNA sequencing.
- the location of the edited nucleotide(s) will be determined by comparing selected cDNA(s) to genomic and EST sequence databases. Similar selection for edited or mutated mRNA or DNA sequences are carried out on appropriate material isolated from CEM15 expressing 293T cells infected with Vif- or Vif+ HiN-l pseudotyped virus.
- Edited mRNAs are also identified through a complementary approach that selects for mRNAs associated with affinity purified AID editing complexes.
- 6His-tagged AID is expressed in NTH3T3 cells (or 6His tagged CEM 15 expressed in 293 T cells infected with Vif- pseudotyped HTV-1) to promote editing complex assembly on mRNA and then affinity purified on nickel resin.
- the associated mRNA substrates are isolated and cDNAs cloned. The identity of the selected mRNAs is determined by DNA sequencing and the location of edited nucleotides in the candidate mRNA(s) is determined.
- a similar approach can be used to select for mutated DNA and can be applied to identify RNA or DNA associated with all members of the ARP family when expressed in a relevant cell context.
- Mouse and human homologs of mRNAs that are edited are expressed in wild type and AID expressing NIH3T3 cells.
- RT-PCR products containing the predicted editing sites are amplified and sequenced for C/U changes by primer extension.
- the relevant region encompassing the editing site is amplified by RT-PCR from human tonsil B cell mRNA and DNA (cells in which AID has already acted on mRNA and/or DNA) and verified to have C/U changes by primer extension DNA sequencing.
- RNA binding proteins (RBP) involved in apoB mRNA editing were first identified through ultraviolet light (UV) crosslinking of RNA-protein interactions in liver and intestinal cell extracts (Navaratnam Proc Natl Acad Sci U S A, 1993. 90(1): p. 222-6; Harris J. Biol. Chem., 1993. 268(10):7382-921; Smith Methods (1998)15(l):27-39). Subsequently, ACF was isolated and cloned using biochemical fractionation and yeast two hybrid genetic selection.
- UV ultraviolet light
- PI 00, p66 and p55 were mooring sequence selective RBP that remained bound to apoB mRNA even in the presence of a 100-fold molar excess of competitor RNA lacking a mooring sequence (Steinburg, Biochem Biophys Res Commun (1999) 263(l):81-6). P44 was more readily displaced in RNA excess competition analyses. P66 has been shown to be ACF (Blanc, RNA, 2002) and ACF pre-mRNA has been shown to code for multiple RBP (including the 44 kDa RBP) through alternative mRNA splicing (Dance, J. Biol. Chem. (2002) 277:12703-9). Novel edited mRNAs are identified using AID or CEM 15 to affinity select editosomes (mutasomes) in which RBP are selectively bound to mRNAs or DNA (respectively) of interest.
- the high throughput bacterial genetic selection of this example represents the primary approach for identifying edited mRNAs (or mutated DNAs) and determining the nucleotides that are edited and has been modified from that described by Faham et al. (2001).
- the bacterial selection system relies upon the high specificity and sensitivity of the E. coli DNA mismatch repair.
- the system is adapted from an approach developed to localize DNA variations associated with human disease susceptibility alleles.
- C-»U mRNA editing events (but also A-»I if present) generates single nucleotide mismatches within in vitro constructed heteroduplexes whose complementary strands are derived from cDNAs amplified from mRNA that has been isolated from cells that either do or do not express AID (see Figure 9). Consequently, the cellular context from which the mRNAs are isolated is an important consideration. The single nucleotide polymo ⁇ hism between individual mice of the same strain are significant and therefore can cause high backgrounds in the DNA mismatch selection systems.
- NIH3T3 fibroblasts serve as the cell context (rather than ATD-/- mouse splenic cells) because they have been shown to support CSR upon transfection with AID expression vectors (Okazaki,
- Double-stranded cDNA are synthesized and PCR amplified (SMART PCR cDNA synthesis kit; Clontech) from mRNA isolated from wild type NTH3T3 cells and from transfected NTH3T3 cells that have expressed AID for 48-72 h (a time period in which CSR was observed on an artificial switch construct. Control experiments with APOBEC-1 have shown that mRNA expression begins from the transgene within 6 h and continues linearly for 48 h. The two separate double stranded cDNA pools are digested with Dpnll to generate approximately 300 bp fragments with GATC overhangs.
- cDNAs from wild type NTH3T3 cells are cloned into BamHI digested (GATC overhang) Cre expression vector (pCrelOO), transformed into dam minus E. coli and unmethylated, single-stranded DNA isolated using helper phage M13K07 (New England Biolabs), according to the manufacturer's recommendations.
- the pool of cDNA fragments prepared from RNA isolated from AID-transfected NIH3T3 cells are methylated using Taql methylase (NEB) and then combined with BamHI linearized, methylated pCre200
- the resultant methylated, Cre-deficient, edited cDNA pool is combined with the single-stranded, unmethylated, active-Cre+, unedited cDNA library, denatured and then reannealed to form heteroduplexes.
- Taq DNA ligase (NEB) is used to form closed circles of hemi-methylated heteroduplexes. Addition of exonuclease m converts DNA that has not been closed with Taq ligase to single stranded DNA, which is then removed.
- the heteroduplex mixture is transformed into an electrocompetent E .coli strain (Editing Site Identifier; ESI) engineered to carry on its episome (F' factor) a tetracycline resistance gene flanked by two lox sites.
- the heteroduplex mixture contains: (i) perfect cDNA homoduplexes from mRNAs that are not AID substrates from the two cell sources (not shown) and (ii) four different possible cDNA duplexes resulting from AID mRNA or DNA substrates in their unedited (homoduplex) and edited/mutated (heteroduplex) forms (shown). These appear in Fig. 8 as two homoduplexes with C:G and G:C base pairs at the editing site and two heteroduplexes with mismatched base pairs at the editing site corresponding to A:C and T:G.
- the mismatch repair detection method was selected after an extensive search of techniques for detecting single nucleotide polymo ⁇ hisms (SNPs).
- SNPs single nucleotide polymo ⁇ hisms
- the bacterial selection system involves a robust biological selection for edited sequences, does not rely upon knowledge of the editing mechanism or edited sequences a priori and has the capacity for high throughput.
- the selected clones are Dpnll restriction fragments from cDNAs of edited mRNAs.
- the number of different edited mRNAs (or mutated DNAs), their relative expression level, the number of editing sites per mRNA (or genome) and the efficiency of AID's (or other ARP's) editing/mutating activity are variables that can affect the number of positive clones. Given the precedent of APOBEC-1 having few known mRNA substrates, only a limited number of mRNAs or mutated DNAs are edited by AID in NIH3T3 cells (and other ARPs in relevant cell context) and therefore only a very few clones are selected.
- heteroduplexes are formed from wild type NTH3T3 cells alone and processed through the bacterial mismatched detection system. This yields a low number or no clones. If a high background is observed then an NIH3T3 line can be cloned and re-tested. A high background can also be due to inefficient mismatch repair activity and/or the failure to express sufficient Cre recombinase. This potential problem can be avoided by utilizing a new generation of plasmids that express higher levels of Cre.
- the APOBEC-1 editing system serves as a control for the selection of true positives and to assess the background in the system.
- the human liver cell line HepG2 is used because it does not express APOBEC-1 and hence no editing of the endogenous apoB mRNA occurs.
- An APOBEC-1 overexpressing HepG2 cell line edits approximately 50% of its apoB mRNAs and is used as a source of edited mRNAs.
- cDNAs synthesized from RNA isolated from these two cell lines are prepared, heteroduplexed and analyzed in the mismatch selection system as described in Figure 8.
- the control selection contains clones representing the primary (cytidine 6666) and secondary (cytidine 6802) apoB mRNA editing sites and known promiscuous editing sites (Sowden, Nuc. Acid Res. (1998) 26(7): 1644-52).
- MutS heteroduplex single base mismatches
- the MutS protein binds to base mismatches with high affinity and when coupled to paramagnetic beads (GeneCheck, Fort Collins, CO) can be used to select for mismatched heteroduplexes from cDNAs prepared from NTH3T3 in which AID is or is not expressed.
- mRNA is harvested for NIH3T3 cells 48-72 h following transfection with AID.
- AID expressed in NIH3T3 cells has a V5 epitope tag so that the level of expression of full length protein can be assessed by western blotting of whole cell protein lysates.
- APOBEC-1 expression kinetics demonstrated that high levels of editing occurred within 48h.
- the detection of edited mRNAs in the bacterial selection system does not require that all the mRNA molecules of a given type be edited because positive clones are selected for growth and edited cDNA is identified from literally thousands of cfu plated onto selection media. 361. If the bacterial selection system does not yield positive clones, higher levels of editing activity or greater transfection efficiencies can be necessary.
- APOBEC-1 -GFP chimera retained editing activity (Siddiqui, Exp Cell Res 252:154) and GFP-ATD has been shown to induce SHM in Ramos cells (Rada, Proc. Natl Acad Sci 99(10):7003-5).
- Fluorescence activated cell sorting FACS distinguished transfected from non-transfected cells, yielding cell populations with distinct levels of APOBEC-1 -GFP or AID-GFP expression with corresponding levels of editing activity or SHM rate (respectively).
- FACS Fluorescence activated cell sorting
- a sufficient number of cells transiently expressing a high level of AID-GFP can be isolated by FACS from which to make RNA. 362.
- AID and other ARPs can also be overexpressed in NIH3T3 cells
- Candidate edited mRNAs are isolated from affinity purified editosomes assembled in NIH3T3 cells expressing 6His-tagged AID (or other similarly tagged ARPs in appropriate cell contexts). Editosome-associated RNAs are evaluated for AID editing.
- the AID editosome affinity approach for isolating candidate edited mRNAs has been selected because it requires no prior knowledge of which RNA binding protein (RBP) complements AID editing activity and is based only on the assumption that AID must interact (directly or through an RBP) with mRNAs to carry out site-specific editing.
- RBP RNA binding protein
- APOBEC-1 editing is a nuclear event but proteins involved in editing were distributed throughout the cell and were bound to substrate mRNA in both compartments of the cell when
- Extracts are prepared using a hypotonic cell lysis method, followed by nonionic detergent disruption of membranes, addition of KC1 to 300 mM and clearing of particulate material by centrifugation at 100,000 x g, 20 min.
- the editosome is eluted with 300 mM imidazole and extracted with TriReagent (MRC, hie) to liberate the associated mRNA(s).
- Oligo dT primer cDNA is synthesized and if specific mRNA sequences have been identified as candidate editing substrates from studies in Example 6, then appropriate primer pairs will be used to RT-PCR amplify a region conesponding to the editing site.
- Poisoned primer extension is used to determine the occurrence of edited mRNA. The analysis therefore provides confirmatory information.
- the mRNAs extracted from AID-affinity purified editosomes can be used to synthesize double stranded DNA, heteroduplexed to control NTH3T3 cDNA and selected for edited nucleotides as described in Figure 8. 367.
- yeast two hybrid (Y2H) selection strategy can be used, based on the hypothesis that AID (or other ARP) editing/mutational activity requires an RBP (or DNA binding protein) editing/mutation site interaction.
- Y2H selection has been successful used to identify RBP for APOBEC-1 (Blanc, J. Biol. Chem. 276:46386; Lellek, J. Biol. Chem. 275(26): 19848-56).
- AID serves as 'bait' in the MatchMaker two hybrid system (Clontech) and the cognate RBP ('prey') will be expressed from a mouse spleen cDNA library (Clontech).
- This selection system robust growth of yeast via histidine protofrophy and lacZ reporter gene expression (blue colonies) is dependent on the activation of transcription through the interaction of the bait DNA binding domain gene fusion with a prey transactivating domain gene fusion.
- the expression of full length epitope-tagged AID in the yeast strain expressing the bait plasmid is confirmed by western blotting. Additionally, the inability of AID alone to activate transcription will be evaluated as an important negative control. 369.
- the MatchMaker system includes specific protocols for setting up the yeast two hybrid selection, for verifying true His+, LacZ+ transformants and ruling out false positives. Both the selection scheme and verification of true positives follow the manufacturer's recommendations using cDNAs encoding APOBEC-and ACF ( Figure 9). Success with this system in selecting appropriate interactions is evident as robust growth under his- selection (left) and appearance of blue colonies on filter 'lifts' (right) for APOBEC-1 interaction as homodimers and heterodimers with ACF.
- the positive control p53 binds to SV40T antigen
- negative control lamin C does not bind to APOBEC-1
- a mouse spleen cDNA library has been obtained for the MatchMaker system.
- SHM As AID can activate SHM in fibroblasts (Okazaki, Nature (2002) 416(6878):921-6), the RBP of interest is broadly and constitutively expressed and therefore if no cDNAs are isolated from spleen libraries, then a fibroblast library can be evaluated.
- candidate RBPs for AID have been selected by yeast two hybrid analysis and verified for their affinity for AID, their cDNAs are isolated from yeast, amplified through E. coli using protocols provided by Clontech, and sequenced. The cDNA's identity is established through DNA database BLAST search analysis. A variety of protein motifs serve as RNA binding domains. These are identified as a routine feature of Genbank and SwissProt databases searches and are readily apparent if they occur in the selected RBPs for AID.
- mRNA isolated from AID transfected NTH3T3 cells is bound to all candidate RBPs for 1 hour at 30 °C in editosome assembly buffer containing an RNase inhibitor (Promega) as described for the assembly of apoB RNA- ACF complexes (Hanis, Biochem Biophys Res Commun 183(2): 899-903) and then slowly filtered through nitrocellulose.
- Nondenatured RNAs are only retained by the nitrocellulose filter if they are bound to protein (Economidis, Proc Natl Acad Sci (1983) 80(14):4296-300).
- Non-specific, low affinity interactions in this assay are blocked by the inclusion of 100-fold mass excess of yeast tRNA.
- the filter binding assay (commercially available acetylated bovine serum albumin) is used as a non- binding, negative control protein and recombinant ACF as a positive control for the amount of RNA that is expected from a bona ⁇ de interaction with hepatocyte mRNA or in vitro apoB transcript.
- RNA retained on the filter by ACF (or RBPs selected through AID affinity) is eluted in TriReagent and analyzed for edited mRNA as described in Example 6.
- RBPs bind to only a few unique mRNA sequences and therefore the bulk of the mRNA flow through the nitrocellulose filter.
- the amount of mRNA retained on the filter by RBPs falls between the baseline established with BSA and a significant signal seen from ACF interaction with apoB mRNA.
- the bacterial mismatch detection system has selected DpnR fragments of cDNAs that contained heteroduplex mismatches. Those C/U polymo ⁇ hisms that are due to AID mRNA editing and not genomic polymo ⁇ hism are confirmed by comparing the sequence of the selected fragments to the mouse and human genomic and EST sequence databases. The presumption that these C/U polymo ⁇ hisms are due to AID-specific mRNA editing is validated by expressing the unedited mRNA candidate in NTH3T3 cells that either express AID or do not (a negative control for nonspecific base modifications). RNA is isolated and RT-PCR amplified using cDNA- and vector-specific primers.
- Editing of the target C is determined by 'poisoned' primer extension sequencing of the RT-PCR products and comparing the results obtained from NTH3T3 cells that either express AID or do not.
- This method uses reverse transcriptase to extend a -end-labeled primer (that anneals to the PCR product downstream and proximal to the editing site) with dATP, dCTP, TTP and ddGTP.
- This method is widely used for detecting edited nucleotides due to its high specificity, sensitivity and linearity (Smith, H.C. Methods (1998) 15(l):27-39).
- the next step in verification is to determine whether the identified mRNA(s) is edited in human B cells that are undergoing CSR and SHM.
- Purified human tonsil B lymphocytes is isolated and then fluorescence- activated cell sorted (FACS) into populations of na ⁇ ve, germinal center, and memory B cells using the cell surface markers IgD, CD38, and CD 19, respectively (Hu, J Immunol
- the editing site within the mRNA(s) of interest is amplified by RT-PCR from oligo dT-primed first strand cDNA synthesized from RNA isolated from the B cell subpopulations.
- Primers specific for the mRNA of interest are designed to amplify a PCR 400-500 bp product that encompasses the editing site (modeled after the apoB editing analysis).
- the poisoned primer extension assay is used to determine the proportion of PCR products that contained the edited nucleotide.
- the poisoned primer extension assay has a detection limit of 0.3% edited mRNA (Sowden, Nuc Acids Res (1999) 26(7): 1644-52) and therefore even low levels of editing can be detected. Edited transcripts are only be detected in the IgD-CD38+, CD 19+ germinal center B cells.
- the poisoned primer extension data from mRNAs isolated from na ⁇ ve B lymphocytes serves as an important negative control for mRNA modification, and is important for establishing the background at the predicted editing, which can be due to very low levels of dGTP contamination of some commercially available deoxyribonucleotide stocks.
- CSR and SHM are induced and editing of select mRNAs determined as described above.
- Human na ⁇ ve peripheral blood and tonsil B cells is activated in vitro by culturing with CD40 ligand-transfected fibroblasts in the presence of JJ -4, which activates AID expression and SHM.
- Transcripts expressed by pre- and post- activated B cells is compared for editing, as described above.
- the Quickchange® mutagenesis system from Stratagene is used to mutate the C at the editing site to a T in full length cDNAs encoding the edited mRNAs. These 'pre-edited' cDNAs are expressed in the N89 and Nl 14 mouse hybridoma lines and the ability of these cells to carry out SHM is determined.
- SHM a minor modification of the methods described in the literature (Martin, Nature (2002) 415(6873):802-6) is used wherein N89 and Nl 14 mouse hybridoma lines, bearing early stop codons in the variable region segments of their heavy chain genes, revert to normal Ig production at detectable frequency upon expression of exogenous AID.
- a retroviral system based on the pMIG vector (Van Parijs, Immunity (1999) 11(3):281-8) is used to express complete cDNAs encoding the edited candidate transcript in conjunction with a green fluorescent protein (GFP) marker gene in the N89 and Nl 14 hybridomas.
- GFP green fluorescent protein
- An ATD-expressing pMIG vector is used as a positive control for SHM induction and transduction with pMIG containing the unedited cDNA serves as the negative control. 379.
- hybridomas are cultured in 5 ⁇ g/ml polybrene-supplemented medium with virus-containing supernatant from the Phoenix packaging cell line (virus/cell multiplicity of 10:1), and cells analyzed for GFP expression by FACS at 48-72 br. Retrovirus-infected hybridomas are sorted on the basis of GFP co-expression, and tested for IgM secretion after 2 weeks from infection by standard ELISA and ELISPOT assays.
- AID-deficient and control mice are transduced with AID- or candidate AID substrate-expressing retroviruses by supplementing the culture medium with 5 ⁇ g/ml polybrene and viral supernatants (10:1 multiplicity) at day 1.5 of culture. Under these conditions, >5% of B cells are transduced (GFP-positive by FACS at day 5 of culture). Cells are stained at day 5 for secondary Ig isotypes (IgG2b and
- IgG3 using phycoerythrin-labeled monoclonal antibodies (Pharmingen), and the expression of secondary isotypes in GFP-positive and -negative cells is evaluated by 2-color flow cytometry. Since normal LPS-stimulated B cells switch to IgG production at a rate of 10-20% by day 5, while AID-deficient cells are completely blocked (Muramatsu, Cell (2000) 102(5):553-63), detectable IgG expression in retrovirally-transduced, GFP-positive AID-deficient cells provide unequivocal evidence of complementation of the switch defect in these cells.
- genomic DNA from target cells in this case, sorted GFP- positive AID-deficient and control LPS-activated B cells
- target cells in this case, sorted GFP- positive AID-deficient and control LPS-activated B cells
- Edited mRNAs confirmed to mediate CSR and SHM in mouse B cells are ideal candidates for transfection into chicken DT40 AID " ⁇ cells in which
- AID has been disrupted (Arakawa, Science (2000) 295(5558):1301-6). This cell line was derived from a DT40 variant that does not express slgM. This allows slgM reversion that is mediated by AID-induced Ig light chain gene conversion to be readily quantified.
- DT40 AID " ⁇ cells and the positive control AID knock-in AID 7"11 cell line. The AID knock-in cell induces GC in this cell background. Induction of
- Ig light chain gene conversion by chicken substrate candidates is evaluated after transfection of pre-edited candidate cDNAs by analyzing slgM reversion rates by FACS, as described (Arakawa, Science (2000) 295(5558): 1301-6).
- the edited form rescues the AID " " phenotype with respect to gene conversion, whereas the unedited form does not.
- Revertant clones are sequenced to confirm the presence of gene conversion. Whenever possible, the chicken homolog to the mouse or human cDNA is identified, its editing site confirmed and used in the DT40 cell transfections. e) Results
- the mRNA edited by AID can be identified and their ability to be edited in mouse and human B lymphocytes can reveal whether one or more mRNAs are edited at single or multiple sites each. Theoretically, C-»U editing could occur anywhere along the length of pre-mRNA. Sowden, Biochem J (2001)
- C- U editing could change a CAA or CGA codon to a translation stop codon (nonsense codon). If a stop codon is introduced >50 nucleotides of the terminal exon junction, referred to as a premature stop codon, cellular surveillance mechanisms identify the messages as aberrant and the mRNA is destroyed through a process known as nonsense mediated decay (NMD).
- NMD nonsense mediated decay
- Edited apoB mRNA (CAA ⁇ UAA occurs in the middle of the mRNA) does not undergo NMD in liver and in fact the protein encoded by edited mRNA is preferentially expressed and secreted (Greeve, J Lipid Res (1993) 34(8)1367-83).
- the CGA— »UGA editing event in NF1 mRNA also occurs within its coding region
- RNAi vectors are the cunent technology of choice as mRNA ablation does not depend on the expression of RNase H nor the empirical positioning of antisense oligonucleotides along the target sequence
- RNAi expression vector is constructed to express short targeting RNAs (shRNA) for the mRNA of interest. Ablation of the target mRNA is confirmed by RPA (using RNA from cells transfected with empty vector alone as a negative control).
- RPA using RNA from cells transfected with empty vector alone as a negative control.
- SHM end points are assessed in RNAi treated cells as described above.
- Co-expression of multiple cDNAs is required if editing of more than one mRNA is necessary for any given function. Co-expression can be achieved by modified retroviral vectors or co-transfection experiments. The efficiency of each edited mRNA (or combinations thereof) to rescue the AID-/- phenotype in
- Suitable vectors containing the immunoglobulin 3' IgH enhancer elements able to drive restricted transgene expression in activated B cells are available in the Bottaro lab, which also has extensive experience with the generation of transgenic lines.
- An anay of gene-targeting techniques can be used, including the RAG2-/- blastocyst complementation system, which allows rapid and efficient analysis of targeted mutations in mature lymphocytes.
- Example 9 Molecular identification of non-Ig gene AID targets in lymphomas.
- the selection system is used as it was originally intended for screen mismatches in genomic DNA sequences. 390.
- Genomic DNA isolated from a non-B cell source e.g. fibroblasts
- lymphomas from AID-transgenic mice is digested with DpnH (average size ⁇ 0.3kb) and cloned separately into two different plasmids.
- Unmethylated plasmids grown in a dam methylase-deficient E.
- coli strain containing the 'control' inserts (from normal tissue DNA) also encode an intact Cre recombinase, whereas the methylated plasmids contain putative mutated fragments from lymphoma cells and encode an inactive 5 nucleotide deletion mutant of Cre.
- Heteroduplexes formed in vitro between the two plasmid libraries by melting and reannealing are transformed into a bacterial strain that harbors an F' episome carrying a 'floxed' tetracycline resistance gene. Repair of the mismatch uses the methylated strand as template, resulting in loss of the functional Cre recombinase gene and retention of the 'floxed' tetracycline resistance gene.
- Non-mismatched heteroduplexes instead, induce no repair, express functional Cre, and result in Tet R LoxP-mediated deletion.
- the Tet 11 clones obtained through the MRD process therefore contain exclusively fragments displaying sequence heterogeneity between the original samples, and are subject to further selection and identification steps.
- Example 10 CEM15 a) Expression of proteins and the nucleoside/nucleotide deaminase assay 391. Wild type and mutant CEM15 can be expressed from cloned cDNAs in a coupled transcription-translation system (Promega's® TNTTM). APOBEC-1 serves as a positive control; when translated in vitro it retains both deaminase activity as described below, and when added to a source of auxiliary factors, supports apoB mRNA editing (Muramatsu, M., J Biol Chem, (1999)
- Deaminase activity of in vitro translated APOBEC-1 and CEM15 was determined in 25 mM Tris pH 7 with 1 mM nucleotide or nucleoside at 30°C followed by precipitation of the protein with 0.5 M perchloric acid (Neuhard, J J Bacteriol, 1968. 96(5): p. 1519-27). Deaminase activity can be monitored as the reduction in absorbance at 280 nm or 290 nm for C and dC or CMP and dCMP, respectively. CEM 15 and APOBEC-1 deaminated 180 pmols and 25 pmols of CMP per hour, respectively.
- Assaying mutant CEM 15 in parallel with wild type determines the effects of mutations in CEM 15 on deaminase activity.
- the expression of each protein is determined from 35S methionine inco ⁇ oration calculations (normalizing for the number of methionines in each protein).
- Mutations that inhibit CEM 15 nucleoside/nucleotide deaminase activity are, by analogy to APOBEC-1 predicted to inhibit CEM15's deaminase activities on DNA or RNA substrates as well.
- in vitro translated Vif is titrated into the assays. The molar ratios of Vif to
- CEM15 are determined by quantifying protein expression as described above. b) The role of CEM15 deaminase activity in HTV infectivity suppression and the ability of Vif to suppress deaminase activity in vivo 392. The inhibitory effect of CEM15 on the infectivity of vif+ and vif- HTV-1 particles by transient cotransfection of appropriate HTV-1 proviral DNA and CEM 15 expression plasmids has been established (Sheehy Nature, (2002) 418: p. 646-650).
- VSV G-protein pseudotyped lentiviral particles that (1) confirmed this result and (2) is amenable to the rapid demarcation of the regions of HTV-1 DNA (or RNA) that is the target for CEM15 catalytic activity.
- an Env-deleted HIV-1 proviral DNA vector (derived from pNL43; AIDs Reagent Repository) was modified by replacement of Nef with a GFP reporter gene and two in-frame stop codons were inserted that abolished vif production (pHR-GFP ⁇ Vif) (confirmed by western blotting with anti-Vif antibodies (ALDs Reagent Repository).
- Stable, HA-tagged CEM15 expressing 293T cell lines were selected with puromycin and verified by western blotting with a HA specific monoclonal antibody (HA.l 1; BabCo).
- HA.l 1 HA specific monoclonal antibody
- the expression of similar levels of full- length HA-tagged CEM 15 (or mutant derivative thereof) can be assayed in future stable cell lines.
- the addition of this epitope tag has no effect on the ability of CEM 15 to suppress infectivity.
- Isogenic HIV-1 pro-viral DNAs are packaged into pseudotyped lentiviral particles by'cotransfection with a plasmid encoding the VSV G-protein into 293T cells that lack endogenous CEM15 (-) or expressed wild type CEM 15 (+).
- the resulting pseudotyped particles contain HIV-1 RNA of near full- length (with only a ⁇ 2kb deletion) were quantitated by reverse transcriptase (RT) assay.
- p24Gag protein content can also be assayed by ELISA to normalize viral particles.
- a defined number (lxlO 5 cpm of RT activity) of these particles were added to target, virus susceptible MT2 cells (5x10 5 ).
- virus susceptible MT2 cells 5x10 5
- the percentage of cells that expressed the GFP indicator gene encoded by the packaged recombinant HIV-1 genome was quantified 24 hours later by flow cytometry (University of Rochester Core Facility). The results indicate that the expression of
- CEM15 in 293T cells resulted in at least a 100-fold decrease in Vif- viral infectivity compared to particles generated in parental 293T cells.
- the low level of GFP expression from vif-, CEM 15+ particles is indistinguishable from background fluorescence in control cells [0.2%].
- This assay can be extended to include Vif + proviral DNA controls and the use of deaminase inactivated CEM15 mutants in stable 293 T cell lines. Most significantly however, the assay is amenable to the use of several existing HIV-1 proviral isotyped vectors that are deleted for different regions and different amounts of the HIV-1 genome. Deleted genes can be provided in trans by cotransfection of suitable expression plasmids.
- RNA substrate(s) for CEM15 Determine the DNA and/or RNA substrate(s) for CEM15 and determine the effect of Vif expression on substrate utilization 393. Evaluate the ability of CEM15 to deaminate dC on HTV-l DNA substrates using an Apyrimidinic Endonuclease (APE) DNA cleavage assay in which apyrimidinic sites are created by DNA Uracil N-Glycosylase (UNG) activity at sites of dC to dU mutation (Tom, S., J Biol Chem, (2001) 276(52): p. 48781-9).
- APE Apyrimidinic Endonuclease
- CEMl 5 can exhibit activity on ssDNA subsfrates.
- ssDNA subsfrates conesponding to either strand of the HTV-1 genome is prepared by asymmetric PCR using 32 P end labeled primers from a series of plasmids containing overlapping fragments (derived from pBRU3; of the regions of HTV-1 DNA that respond to CEMl 5 inhibition).
- Purified ssDNA is treated with in vitro translated wild type or mutant CEMl 5 and repurified.
- DNAs digested from the plasmid series described above are 32 P end-labeled using T4 polynucleotide kinase and incubated with CEMl 5.
- Purified DNAs is treated with recombinant UNG and APE and 5' end- labeled cleavage products analyzed by agarose gel electrophoresis and by comparison to untreated DNA controls.
- Cleaved fragments are isolated, 3' A-tails added by Taq DNA polymerase and inserted into a TA cloning plasmid (Invitrogen, CA).
- Sequencing of the junctions at the cloning sites identifies the ends of fragment(s), thereby locating the site of dC to dU modification in the HTV-1 DNA. If CEM 15 requires auxiliary proteins (like APOBEC-1 for apoB mRNA editing), cellular extracts that provide auxiliary protein(s) can be added to the DNA cleavage assay. Their source is 293T cells or derivatives that express high levels of CEMl 5. The APE assay is specific to DNA substrates; consequently, analysis of CEMl 5- mediated editing/modification events on HTV-1 genomic RNA can be assessed via a high-throughput screening assay.
- auxiliary proteins like APOBEC-1 for apoB mRNA editing
- tRNA lys3 C to U is edited by CEMl 5 in vitro and map the sites of modification by the poisoned primer extension analysis established for quantifying apoB mRNA editing.
- tRNA Iys3 is transcribed in vitro (MEGAshortscript, Ambion) purified, boiled and renatured.
- An aliquot of CEMl 5 known to support in vitro deamination (and a mutant thereof as control) is added to twenty fmols tRNA lys3 in editing buffer (10 mM Hepes pH 8, 10% glycerol, 50 mM KC1, 30 mM EDTA and 0.25 mM DTT; or its optimized derivative) at 30 ⁇ >C for 1-3 h [96].
- C to U editing of tRNA Iys3 purified from the reaction is determined using 32p end labeled deoxyoligonucleotide primers complementary to sequences of tRNA lys3 immediately 3 ' of C residues in separate poisoned primer extension assays.
- Primer extension products are resolved by 12% PAGE and quantified by Phosphorimager analysis.
- the ability of Vif to block fRNA Iys3 editing is determined by titration of Vif into the editing assay.
- fRNAs are highly modified and it is conceivable that CEM 15 dependent deamination relies on a pre-existing modification of tRNA lys3
- the in vitro editing assay can also be performed on purified human fRNA lys3 (BioS&T, Canada) that contains all appropriate modifications. Many of these modifications cause reverse transcriptase to stall, thereby precluding the RT-PCR amplification of tRNA lys3 from CEMl 5 transfected cells and sequencing of the products to identify sites of C to U conversion.
- HTV-1 genomic RNA and HTV-1 dsDNA since their modification most likely explains CEMl 5 's inhibition of viral replication.
- the following HTV-1 genomic RNA species are isolated from cell-free pseudotyped virions produced in the 293T/CEM15 transfection system: vif-minus genomes generated in the absence (A) or presence (B) of CEM 15, (representing unmodified or modified HTV-1 genomic RNA respectively) and (C) vif+ genomes generated in the presence of CEMl 5 (a control also representing unmodified HTV-1 genomes).
- Full-length cDNAs are synthesized using SuperscriptTM in RT
- the high throughput bacterial DNA repair screen DNAs (or cDNAs) prepared from the transfections described above are digested with Dpnll (average size ⁇ 0.3kb) and cloned separately into two different plasmids. Unmethylated plasmids containing the control (A or C) inserts encode an intact Cre recombinase whereas the methylated plasmids containing methylated putative CEM 15 modified (dC to dU in DNA or C to U in RNA inserts (B) encode an inactive 5 nucleotide deletion mutant of Cre.
- Heteroduplexes formed in vitro between the two plasmid libraries by melting and reannealing are transformed into a bacterial strain that harbors an F' episome carrying a 'floxed' tetracycline resistance gene. Repair of the mismatch to the strand with the modified base results in retention of the plasmid borne inactive Cre recombinase and the 'floxed' tetracycline resistance gene is retained and expressed. Non-mismatched heteroduplexes express functional Cre and Tet R is lost. HTV-1 DNA inserts from resulting clones are sequenced and compared to the wild type viral DNA.
- CEMl 5-induced mutations are largely site-specific. Statistical analysis of the number of site-specific dC to dU (or dG to dA) changes observed identifies sites of CEMl 5 dependent modification. CEMl 5 could block viral integration by recruitment of CEMl 5 not to a specific sequence, but to a specific DNA conformation or structure (e.g. the unique structure formed during viral DNA integration).
- HTV genomic RNA, proviral DNA (dsDNA) and host cell mRNA and genomic DNA can also be analyzed for CEM15-dependent modifications. This experiment exploits a high throughput, bacterial positive genetic selection strategy for human disease related SNPs.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP09167071A EP2116604A1 (en) | 2002-08-05 | 2003-08-05 | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US40129302P | 2002-08-05 | 2002-08-05 | |
| US401293P | 2002-08-05 | ||
| US41998202P | 2002-10-21 | 2002-10-21 | |
| US419982P | 2002-10-21 | ||
| PCT/US2003/024458 WO2004013160A2 (en) | 2002-08-05 | 2003-08-05 | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09167071A Division EP2116604A1 (en) | 2002-08-05 | 2003-08-05 | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1575992A2 true EP1575992A2 (en) | 2005-09-21 |
| EP1575992A4 EP1575992A4 (en) | 2007-02-21 |
Family
ID=31498668
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03767199A Withdrawn EP1575992A4 (en) | 2002-08-05 | 2003-08-05 | CHIMERIC PROTEINS WITH PROTEIN TRANSDUCTION FIELD / DOMAINE DESAMINASE, ASSOCIATED COMPOUNDS AND CORRESPONDING USES |
| EP09167071A Withdrawn EP2116604A1 (en) | 2002-08-05 | 2003-08-05 | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09167071A Withdrawn EP2116604A1 (en) | 2002-08-05 | 2003-08-05 | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof |
Country Status (5)
| Country | Link |
|---|---|
| US (2) | US20050287648A1 (en) |
| EP (2) | EP1575992A4 (en) |
| AU (1) | AU2003257181A1 (en) |
| CA (1) | CA2495478A1 (en) |
| WO (1) | WO2004013160A2 (en) |
Families Citing this family (24)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2002068676A2 (en) * | 2001-02-27 | 2002-09-06 | University Of Rochester | METHODS AND COMPOSITIONS FOR MODIFYING APOLIPOPROTEIN B mRNA EDITING |
| US7220554B2 (en) | 2003-05-23 | 2007-05-22 | Oregon Health And Science University | Methods for identifying inhibitors |
| ATE506456T1 (en) | 2003-06-10 | 2011-05-15 | David Gladstone Inst | METHOD FOR TREATING LENTIVIRUS INFECTIONS |
| CA2537798A1 (en) * | 2003-09-03 | 2005-03-17 | University Of Rochester | Cytidine deaminase activators, deoxycytidine deaminase activators, vif antagonists, and methods of screening for molecules thereof |
| US20050143919A1 (en) * | 2003-11-14 | 2005-06-30 | Williams Robert E. | Unified method and system for multi-dimensional mapping of spatial-energy relationships among micro and macro-events in the universe |
| US8158770B2 (en) * | 2004-05-06 | 2012-04-17 | University Of Rochester | Content dependent inhibitors of cytidine deaminases and uses thereof |
| KR100897915B1 (en) * | 2004-11-03 | 2009-05-18 | 포휴먼텍(주) | Pharmaceutical compositions for transdermal delivery |
| EP2059122B1 (en) * | 2006-08-28 | 2012-06-20 | University of Rochester | Methods and compositions related to apobec-1 expression |
| US8999317B2 (en) * | 2006-11-01 | 2015-04-07 | University Of Rochester | Methods and compositions related to the structure and function of APOBEC3G |
| CA2671410C (en) * | 2006-12-06 | 2016-11-22 | Thomas Jefferson University | Peptide and treatment for hiv-1 infection |
| WO2009058712A1 (en) * | 2007-10-29 | 2009-05-07 | Trustees Of Dartmouth College | Toxoplasma gondii mutant with enhanced homologous recombination and uses thereof |
| US8282942B2 (en) * | 2007-10-29 | 2012-10-09 | Trustees Of Dartmouth College | Toxoplasma gondii vaccines and uses thereof |
| US9757440B2 (en) | 2007-10-29 | 2017-09-12 | Trustees Of Dartmouth College | Method for treating cancer with Toxoplasma gondii vaccine |
| CN101343327B (en) * | 2008-08-13 | 2012-05-23 | 汕头大学医学院 | Antiviral protein and application thereof |
| US20110218158A1 (en) * | 2008-09-22 | 2011-09-08 | Harris Reuben S | Dna cytosine deaminase inhibitors |
| CA2750379A1 (en) | 2009-01-14 | 2010-07-22 | Gordon J. Lutz | Modulation of pre-mrna using splice modulating oligonucleotides as therapeutic agents in the treatment of disease |
| EP2414507B1 (en) * | 2009-04-03 | 2014-07-02 | Medical Research Council | Mutants of activation-induced cytidine deaminase (aid) and methods of use |
| US9932560B2 (en) | 2011-05-13 | 2018-04-03 | Elixirgen, Llc | Use of Zscan4 and Zscan4-dependent genes for direct reprogramming of somatic cells |
| US20150018380A1 (en) * | 2012-02-07 | 2015-01-15 | University Of Rochester | Methods of Screening for Activation Deaminase Inhibitors Through Nuclear Import Inhibitors |
| PL225333B1 (en) * | 2013-01-14 | 2017-03-31 | Inst Chemii Bioorganicznej Polskiej Akademii Nauk | Modified human gene activation induced cytidine deaminase B cells (AID), a modification of the human AID gene, preparation having an activity of AID and methods of preparing this formulation in a bacterial system |
| EP3782628B1 (en) | 2013-03-15 | 2024-08-07 | Elixirgen Therapeutics, Inc. | Methods of using zscan4 for rejuvenating human cells |
| WO2019071274A1 (en) * | 2017-10-06 | 2019-04-11 | Oregon Health & Science University | COMPOSITIONS AND METHODS FOR EDITING RNA |
| CN109901213B (en) * | 2019-03-05 | 2022-06-07 | 中国辐射防护研究院 | Method and system for generating gamma scanning scheme based on Router grid |
| WO2024220505A2 (en) * | 2023-04-18 | 2024-10-24 | Ladder Therapeutics, Inc. | Methods |
Family Cites Families (319)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR1601438A (en) | 1968-10-17 | 1970-08-24 | ||
| US3687808A (en) | 1969-08-14 | 1972-08-29 | Univ Leland Stanford Junior | Synthetic polynucleotides |
| US4342566A (en) | 1980-02-22 | 1982-08-03 | Scripps Clinic & Research Foundation | Solid phase anti-C3 assay for detection of immune complexes |
| US4469863A (en) | 1980-11-12 | 1984-09-04 | Ts O Paul O P | Nonionic nucleic acid alkyl and aryl phosphonates and processes for manufacture and use thereof |
| US5023243A (en) | 1981-10-23 | 1991-06-11 | Molecular Biosystems, Inc. | Oligonucleotide therapeutic agent and method of making same |
| US4476301A (en) | 1982-04-29 | 1984-10-09 | Centre National De La Recherche Scientifique | Oligonucleotides, a process for preparing the same and their application as mediators of the action of interferon |
| JPS5927900A (en) | 1982-08-09 | 1984-02-14 | Wakunaga Seiyaku Kk | Oligonucleotide derivative and its preparation |
| FR2540122B1 (en) | 1983-01-27 | 1985-11-29 | Centre Nat Rech Scient | NOVEL COMPOUNDS COMPRISING A SEQUENCE OF OLIGONUCLEOTIDE LINKED TO AN INTERCALATION AGENT, THEIR SYNTHESIS PROCESS AND THEIR APPLICATION |
| US4605735A (en) | 1983-02-14 | 1986-08-12 | Wakunaga Seiyaku Kabushiki Kaisha | Oligonucleotide derivatives |
| US4948882A (en) | 1983-02-22 | 1990-08-14 | Syngene, Inc. | Single-stranded labelled oligonucleotides, reactive monomers and methods of synthesis |
| US4824941A (en) | 1983-03-10 | 1989-04-25 | Julian Gordon | Specific antibody to the native form of 2'5'-oligonucleotides, the method of preparation and the use as reagents in immunoassays or for binding 2'5'-oligonucleotides in biological systems |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4587044A (en) | 1983-09-01 | 1986-05-06 | The Johns Hopkins University | Linkage of proteins to nucleic acids |
| US5118800A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | Oligonucleotides possessing a primary amino group in the terminal nucleotide |
| US5118802A (en) | 1983-12-20 | 1992-06-02 | California Institute Of Technology | DNA-reporter conjugates linked via the 2' or 5'-primary amino group of the 5'-terminal nucleoside |
| US5550111A (en) | 1984-07-11 | 1996-08-27 | Temple University-Of The Commonwealth System Of Higher Education | Dual action 2',5'-oligoadenylate antiviral derivatives and uses thereof |
| FR2567892B1 (en) | 1984-07-19 | 1989-02-17 | Centre Nat Rech Scient | NOVEL OLIGONUCLEOTIDES, THEIR PREPARATION PROCESS AND THEIR APPLICATIONS AS MEDIATORS IN DEVELOPING THE EFFECTS OF INTERFERONS |
| US5367066A (en) | 1984-10-16 | 1994-11-22 | Chiron Corporation | Oligonucleotides with selectably cleavable and/or abasic sites |
| US5258506A (en) | 1984-10-16 | 1993-11-02 | Chiron Corporation | Photolabile reagents for incorporation into oligonucleotide chains |
| US5430136A (en) | 1984-10-16 | 1995-07-04 | Chiron Corporation | Oligonucleotides having selectably cleavable and/or abasic sites |
| US4828979A (en) | 1984-11-08 | 1989-05-09 | Life Technologies, Inc. | Nucleotide analogs for nucleic acid labeling and detection |
| US4897355A (en) | 1985-01-07 | 1990-01-30 | Syntex (U.S.A.) Inc. | N[ω,(ω-1)-dialkyloxy]- and N-[ω,(ω-1)-dialkenyloxy]-alk-1-yl-N,N,N-tetrasubstituted ammonium lipids and uses therefor |
| FR2575751B1 (en) | 1985-01-08 | 1987-04-03 | Pasteur Institut | NOVEL ADENOSINE DERIVATIVE NUCLEOSIDES, THEIR PREPARATION AND THEIR BIOLOGICAL APPLICATIONS |
| US5405938A (en) | 1989-12-20 | 1995-04-11 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US5185444A (en) | 1985-03-15 | 1993-02-09 | Anti-Gene Deveopment Group | Uncharged morpolino-based polymers having phosphorous containing chiral intersubunit linkages |
| US5506337A (en) | 1985-03-15 | 1996-04-09 | Antivirals Inc. | Morpholino-subunit combinatorial library and method |
| US5034506A (en) | 1985-03-15 | 1991-07-23 | Anti-Gene Development Group | Uncharged morpholino-based polymers having achiral intersubunit linkages |
| US5235033A (en) | 1985-03-15 | 1993-08-10 | Anti-Gene Development Group | Alpha-morpholino ribonucleoside derivatives and polymers thereof |
| US5166315A (en) | 1989-12-20 | 1992-11-24 | Anti-Gene Development Group | Sequence-specific binding polymers for duplex nucleic acids |
| US4762779A (en) | 1985-06-13 | 1988-08-09 | Amgen Inc. | Compositions and methods for functionalizing nucleic acids |
| US5317098A (en) | 1986-03-17 | 1994-05-31 | Hiroaki Shizuya | Non-radioisotope tagging of fragments |
| JPS638396A (en) | 1986-06-30 | 1988-01-14 | Wakunaga Pharmaceut Co Ltd | Poly-labeled oligonucleotide derivative |
| US4704692A (en) | 1986-09-02 | 1987-11-03 | Ladner Robert C | Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides |
| US5834185A (en) | 1986-10-28 | 1998-11-10 | Johns Hopkins University | Formation of triple helix complexes of single stranded nucleic acids using nucleoside oligomers which comprise pyrimidine analogs, triple helix complexes formed thereby and oligomers used in their formation |
| US5276019A (en) | 1987-03-25 | 1994-01-04 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US5264423A (en) | 1987-03-25 | 1993-11-23 | The United States Of America As Represented By The Department Of Health And Human Services | Inhibitors for replication of retroviruses and for the expression of oncogene products |
| US4904582A (en) | 1987-06-11 | 1990-02-27 | Synthetic Genetics | Novel amphiphilic nucleic acid conjugates |
| EP0366685B1 (en) | 1987-06-24 | 1994-10-19 | Howard Florey Institute Of Experimental Physiology And Medicine | Nucleoside derivatives |
| US5585481A (en) | 1987-09-21 | 1996-12-17 | Gen-Probe Incorporated | Linking reagents for nucleotide probes |
| US4924624A (en) | 1987-10-22 | 1990-05-15 | Temple University-Of The Commonwealth System Of Higher Education | 2,',5'-phosphorothioate oligoadenylates and plant antiviral uses thereof |
| US5188897A (en) | 1987-10-22 | 1993-02-23 | Temple University Of The Commonwealth System Of Higher Education | Encapsulated 2',5'-phosphorothioate oligoadenylates |
| US5525465A (en) | 1987-10-28 | 1996-06-11 | Howard Florey Institute Of Experimental Physiology And Medicine | Oligonucleotide-polyamide conjugates and methods of production and applications of the same |
| DE3738460A1 (en) | 1987-11-12 | 1989-05-24 | Max Planck Gesellschaft | MODIFIED OLIGONUCLEOTIDS |
| US5082830A (en) | 1988-02-26 | 1992-01-21 | Enzo Biochem, Inc. | End labeled nucleotide probe |
| JPH03503894A (en) | 1988-03-25 | 1991-08-29 | ユニバーシィティ オブ バージニア アランミ パテンツ ファウンデイション | Oligonucleotide N-alkylphosphoramidate |
| US5278302A (en) | 1988-05-26 | 1994-01-11 | University Patents, Inc. | Polynucleotide phosphorodithioates |
| US5109124A (en) | 1988-06-01 | 1992-04-28 | Biogen, Inc. | Nucleic acid probe linked to a label having a terminal cysteine |
| US5216141A (en) | 1988-06-06 | 1993-06-01 | Benner Steven A | Oligonucleotide analogs containing sulfur linkages |
| US5175273A (en) | 1988-07-01 | 1992-12-29 | Genentech, Inc. | Nucleic acid intercalating agents |
| US5294533A (en) | 1988-07-05 | 1994-03-15 | Baylor College Of Medicine | Antisense oligonucleotide antibiotics complementary to the macromolecular synthesis operon, methods of treating bacterial infections and methods for identification of bacteria |
| US5262536A (en) | 1988-09-15 | 1993-11-16 | E. I. Du Pont De Nemours And Company | Reagents for the preparation of 5'-tagged oligonucleotides |
| US5866701A (en) | 1988-09-20 | 1999-02-02 | The Board Of Regents For Northern Illinois University Of Dekalb | HIV targeted hairpin ribozymes |
| US5512439A (en) | 1988-11-21 | 1996-04-30 | Dynal As | Oligonucleotide-linked magnetic particles and uses thereof |
| US5176996A (en) | 1988-12-20 | 1993-01-05 | Baylor College Of Medicine | Method for making synthetic oligonucleotides which bind specifically to target sites on duplex DNA molecules, by forming a colinear triplex, the synthetic oligonucleotides and methods of use |
| US5457183A (en) | 1989-03-06 | 1995-10-10 | Board Of Regents, The University Of Texas System | Hydroxylated texaphyrins |
| US5599923A (en) | 1989-03-06 | 1997-02-04 | Board Of Regents, University Of Tx | Texaphyrin metal complexes having improved functionalization |
| US5168053A (en) | 1989-03-24 | 1992-12-01 | Yale University | Cleavage of targeted RNA by RNAase P |
| US5624824A (en) | 1989-03-24 | 1997-04-29 | Yale University | Targeted cleavage of RNA using eukaryotic ribonuclease P and external guide sequence |
| US5391723A (en) | 1989-05-31 | 1995-02-21 | Neorx Corporation | Oligonucleotide conjugates |
| US4958013A (en) | 1989-06-06 | 1990-09-18 | Northwestern University | Cholesteryl modified oligonucleotides |
| US5451463A (en) | 1989-08-28 | 1995-09-19 | Clontech Laboratories, Inc. | Non-nucleoside 1,3-diol reagents for labeling synthetic oligonucleotides |
| US5134066A (en) | 1989-08-29 | 1992-07-28 | Monsanto Company | Improved probes using nucleosides containing 3-dezauracil analogs |
| US5254469A (en) | 1989-09-12 | 1993-10-19 | Eastman Kodak Company | Oligonucleotide-enzyme conjugate that can be used as a probe in hybridization assays and polymerase chain reaction procedures |
| US5591722A (en) | 1989-09-15 | 1997-01-07 | Southern Research Institute | 2'-deoxy-4'-thioribonucleosides and their antiviral activity |
| US5399676A (en) | 1989-10-23 | 1995-03-21 | Gilead Sciences | Oligonucleotides with inverted polarity |
| DE69034150T2 (en) | 1989-10-24 | 2005-08-25 | Isis Pharmaceuticals, Inc., Carlsbad | 2'-modified oligonucleotides |
| US5264564A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences | Oligonucleotide analogs with novel linkages |
| US5264562A (en) | 1989-10-24 | 1993-11-23 | Gilead Sciences, Inc. | Oligonucleotide analogs with novel linkages |
| US5292873A (en) | 1989-11-29 | 1994-03-08 | The Research Foundation Of State University Of New York | Nucleic acids labeled with naphthoquinone probe |
| US5177198A (en) | 1989-11-30 | 1993-01-05 | University Of N.C. At Chapel Hill | Process for preparing oligoribonucleoside and oligodeoxyribonucleoside boranophosphates |
| JP2507895B2 (en) | 1989-12-19 | 1996-06-19 | 工業技術院長 | New synthesis system of ribozyme |
| US5130302A (en) | 1989-12-20 | 1992-07-14 | Boron Bilogicals, Inc. | Boronated nucleoside, nucleotide and oligonucleotide compounds, compositions and methods for using same |
| US5486603A (en) | 1990-01-08 | 1996-01-23 | Gilead Sciences, Inc. | Oligonucleotide having enhanced binding affinity |
| US5646265A (en) | 1990-01-11 | 1997-07-08 | Isis Pharmceuticals, Inc. | Process for the preparation of 2'-O-alkyl purine phosphoramidites |
| US5681941A (en) | 1990-01-11 | 1997-10-28 | Isis Pharmaceuticals, Inc. | Substituted purines and oligonucleotide cross-linking |
| US5670633A (en) | 1990-01-11 | 1997-09-23 | Isis Pharmaceuticals, Inc. | Sugar modified oligonucleotides that detect and modulate gene expression |
| US5587361A (en) | 1991-10-15 | 1996-12-24 | Isis Pharmaceuticals, Inc. | Oligonucleotides having phosphorothioate linkages of high chiral purity |
| US5459255A (en) | 1990-01-11 | 1995-10-17 | Isis Pharmaceuticals, Inc. | N-2 substituted purines |
| US5578718A (en) | 1990-01-11 | 1996-11-26 | Isis Pharmaceuticals, Inc. | Thiol-derivatized nucleosides |
| DE69120146T2 (en) | 1990-01-12 | 1996-12-12 | Cell Genesys Inc | GENERATION OF XENOGENIC ANTIBODIES |
| US5214136A (en) | 1990-02-20 | 1993-05-25 | Gilead Sciences, Inc. | Anthraquinone-derivatives oligonucleotides |
| AU7579991A (en) | 1990-02-20 | 1991-09-18 | Gilead Sciences, Inc. | Pseudonucleosides and pseudonucleotides and their polymers |
| US5321131A (en) | 1990-03-08 | 1994-06-14 | Hybridon, Inc. | Site-specific functionalization of oligodeoxynucleotides for non-radioactive labelling |
| US5084824A (en) | 1990-03-29 | 1992-01-28 | National Semiconductor Corporation | Simulation model generation from a physical data base of a combinatorial circuit |
| US5470967A (en) | 1990-04-10 | 1995-11-28 | The Dupont Merck Pharmaceutical Company | Oligonucleotide analogs with sulfamate linkages |
| GB9009980D0 (en) | 1990-05-03 | 1990-06-27 | Amersham Int Plc | Phosphoramidite derivatives,their preparation and the use thereof in the incorporation of reporter groups on synthetic oligonucleotides |
| ES2116977T3 (en) | 1990-05-11 | 1998-08-01 | Microprobe Corp | SOLID SUPPORTS FOR NUCLEIC ACID HYBRIDIZATION TESTS AND METHODS TO IMMOBILIZE OLIGONUCLEOTIDES IN A COVALENT WAY. |
| US5503978A (en) | 1990-06-11 | 1996-04-02 | University Research Corporation | Method for identification of high affinity DNA ligands of HIV-1 reverse transcriptase |
| US5731424A (en) | 1990-06-11 | 1998-03-24 | Nexstar Pharmaceuticals, Inc. | High affinity TGFβ nucleic acid ligands and inhibitors |
| US6001988A (en) | 1990-06-11 | 1999-12-14 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands to lectins |
| US5543293A (en) | 1990-06-11 | 1996-08-06 | Nexstar Pharmaceuticals, Inc. | DNA ligands of thrombin |
| US5864026A (en) | 1990-06-11 | 1999-01-26 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: tissue selex |
| US5869641A (en) | 1990-06-11 | 1999-02-09 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands of CD4 |
| US5660985A (en) | 1990-06-11 | 1997-08-26 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands containing modified nucleotides |
| US5476766A (en) | 1990-06-11 | 1995-12-19 | Nexstar Pharmaceuticals, Inc. | Ligands of thrombin |
| US5723289A (en) | 1990-06-11 | 1998-03-03 | Nexstar Pharmaceuticals, Inc. | Parallel selex |
| US6030776A (en) | 1990-06-11 | 2000-02-29 | Nexstar Pharmaceuticals, Inc. | Parallel SELEX |
| US5795721A (en) | 1990-06-11 | 1998-08-18 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands of ICP4 |
| US5861254A (en) | 1997-01-31 | 1999-01-19 | Nexstar Pharmaceuticals, Inc. | Flow cell SELEX |
| US6011020A (en) | 1990-06-11 | 2000-01-04 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligand complexes |
| US5780228A (en) | 1990-06-11 | 1998-07-14 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands to lectins |
| US5580737A (en) | 1990-06-11 | 1996-12-03 | Nexstar Pharmaceuticals, Inc. | High-affinity nucleic acid ligands that discriminate between theophylline and caffeine |
| US5846713A (en) | 1990-06-11 | 1998-12-08 | Nexstar Pharmaceuticals, Inc. | High affinity HKGF nucleic acid ligands and inhibitors |
| US5135917A (en) | 1990-07-12 | 1992-08-04 | Nova Pharmaceutical Corporation | Interleukin receptor expression inhibiting antisense oligonucleotides |
| US5608046A (en) | 1990-07-27 | 1997-03-04 | Isis Pharmaceuticals, Inc. | Conjugated 4'-desmethyl nucleoside analog compounds |
| US5218105A (en) | 1990-07-27 | 1993-06-08 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| JPH0874B2 (en) | 1990-07-27 | 1996-01-10 | アイシス・ファーマシューティカルス・インコーポレーテッド | Nuclease-resistant, pyrimidine-modified oligonucleotides that detect and modulate gene expression |
| US5489677A (en) | 1990-07-27 | 1996-02-06 | Isis Pharmaceuticals, Inc. | Oligonucleoside linkages containing adjacent oxygen and nitrogen atoms |
| US5138045A (en) | 1990-07-27 | 1992-08-11 | Isis Pharmaceuticals | Polyamine conjugated oligonucleotides |
| US5610289A (en) | 1990-07-27 | 1997-03-11 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogues |
| US5677437A (en) | 1990-07-27 | 1997-10-14 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5688941A (en) | 1990-07-27 | 1997-11-18 | Isis Pharmaceuticals, Inc. | Methods of making conjugated 4' desmethyl nucleoside analog compounds |
| US5618704A (en) | 1990-07-27 | 1997-04-08 | Isis Pharmacueticals, Inc. | Backbone-modified oligonucleotide analogs and preparation thereof through radical coupling |
| US5602240A (en) | 1990-07-27 | 1997-02-11 | Ciba Geigy Ag. | Backbone modified oligonucleotide analogs |
| US5623070A (en) | 1990-07-27 | 1997-04-22 | Isis Pharmaceuticals, Inc. | Heteroatomic oligonucleoside linkages |
| US5541307A (en) | 1990-07-27 | 1996-07-30 | Isis Pharmaceuticals, Inc. | Backbone modified oligonucleotide analogs and solid phase synthesis thereof |
| MY107332A (en) | 1990-08-03 | 1995-11-30 | Sterling Drug Inc | Compounds and methods for inhibiting gene expression. |
| US5245022A (en) | 1990-08-03 | 1993-09-14 | Sterling Drug, Inc. | Exonuclease resistant terminally substituted oligonucleotides |
| US5177196A (en) | 1990-08-16 | 1993-01-05 | Microprobe Corporation | Oligo (α-arabinofuranosyl nucleotides) and α-arabinofuranosyl precursors thereof |
| US5512667A (en) | 1990-08-28 | 1996-04-30 | Reed; Michael W. | Trifunctional intermediates for preparing 3'-tailed oligonucleotides |
| DE69133557D1 (en) | 1990-08-29 | 2007-03-15 | Pharming Intellectual Pty Bv | HOMOLOGOUS RECOMBINATION IN MAMMALIAN CELLS |
| US5214134A (en) | 1990-09-12 | 1993-05-25 | Sterling Winthrop Inc. | Process of linking nucleosides with a siloxane bridge |
| US5561225A (en) | 1990-09-19 | 1996-10-01 | Southern Research Institute | Polynucleotide analogs containing sulfonate and sulfonamide internucleoside linkages |
| JPH06505704A (en) | 1990-09-20 | 1994-06-30 | ギリアド サイエンシズ,インコーポレイテッド | Modified internucleoside linkages |
| US5432272A (en) | 1990-10-09 | 1995-07-11 | Benner; Steven A. | Method for incorporating into a DNA or RNA oligonucleotide using nucleotides bearing heterocyclic bases |
| US5271941A (en) | 1990-11-02 | 1993-12-21 | Cho Chung Yoon S | Antisense oligonucleotides of human regulatory subunit RI.sub.α of cAMP-dependent protein kinases |
| KR930702373A (en) | 1990-11-08 | 1993-09-08 | 안토니 제이. 페이네 | Addition of Multiple Reporter Groups to Synthetic Oligonucleotides |
| AU668347B2 (en) | 1990-11-21 | 1996-05-02 | Torrey Pines Institute For Molecular Studies | Synthesis of equimolar multiple oligomer mixtures, especially of oligopeptide mixtures |
| US5683874A (en) | 1991-03-27 | 1997-11-04 | Research Corporation Technologies, Inc. | Single-stranded circular oligonucleotides capable of forming a triplex with a target sequence |
| US5539082A (en) | 1993-04-26 | 1996-07-23 | Nielsen; Peter E. | Peptide nucleic acids |
| US5719262A (en) | 1993-11-22 | 1998-02-17 | Buchardt, Deceased; Ole | Peptide nucleic acids having amino acid side chains |
| US5714331A (en) | 1991-05-24 | 1998-02-03 | Buchardt, Deceased; Ole | Peptide nucleic acids having enhanced binding affinity, sequence specificity and solubility |
| US6028186A (en) | 1991-06-10 | 2000-02-22 | Nexstar Pharmaceuticals, Inc. | High affinity nucleic acid ligands of cytokines |
| DE4216134A1 (en) | 1991-06-20 | 1992-12-24 | Europ Lab Molekularbiolog | SYNTHETIC CATALYTIC OLIGONUCLEOTIDE STRUCTURES |
| US5371241A (en) | 1991-07-19 | 1994-12-06 | Pharmacia P-L Biochemicals Inc. | Fluorescein labelled phosphoramidites |
| US5449754A (en) | 1991-08-07 | 1995-09-12 | H & N Instruments, Inc. | Generation of combinatorial libraries |
| US5571799A (en) | 1991-08-12 | 1996-11-05 | Basco, Ltd. | (2'-5') oligoadenylate analogues useful as inhibitors of host-v5.-graft response |
| US5565332A (en) | 1991-09-23 | 1996-10-15 | Medical Research Council | Production of chimeric antibodies - a combinatorial approach |
| EP0538194B1 (en) | 1991-10-17 | 1997-06-04 | Novartis AG | Bicyclic nucleosides, oligonucleotides, their method of preparation and intermediates therein |
| US5594121A (en) | 1991-11-07 | 1997-01-14 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified purines |
| CA2124087C (en) | 1991-11-22 | 2002-10-01 | James L. Winkler | Combinatorial strategies for polymer synthesis |
| AU3222793A (en) | 1991-11-26 | 1993-06-28 | Gilead Sciences, Inc. | Enhanced triple-helix and double-helix formation with oligomers containing modified pyrimidines |
| US5484908A (en) | 1991-11-26 | 1996-01-16 | Gilead Sciences, Inc. | Oligonucleotides containing 5-propynyl pyrimidines |
| US5359044A (en) | 1991-12-13 | 1994-10-25 | Isis Pharmaceuticals | Cyclobutyl oligonucleotide surrogates |
| US5596079A (en) | 1991-12-16 | 1997-01-21 | Smith; James R. | Mimetics of senescent cell derived inhibitors of DNA synthesis |
| US5595726A (en) | 1992-01-21 | 1997-01-21 | Pharmacyclics, Inc. | Chromophore probe for detection of nucleic acid |
| US5565552A (en) | 1992-01-21 | 1996-10-15 | Pharmacyclics, Inc. | Method of expanded porphyrin-oligonucleotide conjugate synthesis |
| US5652094A (en) | 1992-01-31 | 1997-07-29 | University Of Montreal | Nucleozymes |
| FR2687679B1 (en) | 1992-02-05 | 1994-10-28 | Centre Nat Rech Scient | OLIGOTHIONUCLEOTIDES. |
| US5573905A (en) | 1992-03-30 | 1996-11-12 | The Scripps Research Institute | Encoded combinatorial chemical libraries |
| US5633360A (en) | 1992-04-14 | 1997-05-27 | Gilead Sciences, Inc. | Oligonucleotide analogs capable of passive cell membrane permeation |
| AU669367B2 (en) | 1992-04-28 | 1996-06-06 | Yale University | Targeted cleavage of RNA using eukaryotic ribonuclease P and external guide sequence |
| US5610054A (en) | 1992-05-14 | 1997-03-11 | Ribozyme Pharmaceuticals, Inc. | Enzymatic RNA molecule targeted against Hepatitis C virus |
| US5972699A (en) | 1992-05-14 | 1999-10-26 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting herpes simplex virus replication |
| US5646020A (en) | 1992-05-14 | 1997-07-08 | Ribozyme Pharmaceuticals, Inc. | Hammerhead ribozymes for preferred targets |
| US5989906A (en) | 1992-05-14 | 1999-11-23 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting P-glycoprotein (mdr-1-gene) |
| US6017756A (en) | 1992-05-14 | 2000-01-25 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting hepatitis B virus replication |
| US5693535A (en) | 1992-05-14 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | HIV targeted ribozymes |
| US5434257A (en) | 1992-06-01 | 1995-07-18 | Gilead Sciences, Inc. | Binding compentent oligomers containing unsaturated 3',5' and 2',5' linkages |
| EP0577558A2 (en) | 1992-07-01 | 1994-01-05 | Ciba-Geigy Ag | Carbocyclic nucleosides having bicyclic rings, oligonucleotides therefrom, process for their preparation, their use and intermediates |
| AU672018B2 (en) | 1992-07-02 | 1996-09-19 | Sankyo Company Limited | Looped, hairpin ribozyme |
| US5272250A (en) | 1992-07-10 | 1993-12-21 | Spielvogel Bernard F | Boronated phosphoramidate compounds |
| US5646042A (en) | 1992-08-26 | 1997-07-08 | Ribozyme Pharmaceuticals, Inc. | C-myb targeted ribozymes |
| US5288514A (en) | 1992-09-14 | 1994-02-22 | The Regents Of The University Of California | Solid phase and combinatorial synthesis of benzodiazepine compounds on a solid support |
| US5721099A (en) | 1992-10-01 | 1998-02-24 | Trustees Of Columbia University In The City Of New York | Complex combinatorial chemical libraries encoded with tags |
| US5565324A (en) | 1992-10-01 | 1996-10-15 | The Trustees Of Columbia University In The City Of New York | Complex combinatorial chemical libraries encoded with tags |
| US5891684A (en) | 1992-10-15 | 1999-04-06 | Ribozyme Pharmaceuticals, Inc. | Base-modified enzymatic nucleic acid |
| US5807683A (en) | 1992-11-19 | 1998-09-15 | Combichem, Inc. | Combinatorial libraries and methods for their use |
| US5811300A (en) | 1992-12-07 | 1998-09-22 | Ribozyme Pharmaceuticals, Inc. | TNF-α ribozymes |
| US5612215A (en) | 1992-12-07 | 1997-03-18 | Ribozyme Pharmaceuticals, Inc. | Stromelysin targeted ribozymes |
| US5574142A (en) | 1992-12-15 | 1996-11-12 | Microprobe Corporation | Peptide linkers for improved oligonucleotide delivery |
| AU6088094A (en) | 1993-01-15 | 1994-08-15 | General Hospital Corporation, The | Rna assays using rna binary probes and ribozyme ligase |
| US5786138A (en) | 1993-01-29 | 1998-07-28 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Hyperstabilizing antisense nucleic acid binding agents |
| US5476925A (en) | 1993-02-01 | 1995-12-19 | Northwestern University | Oligodeoxyribonucleotides including 3'-aminonucleoside-phosphoramidate linkages and terminal 3'-amino groups |
| GB9304618D0 (en) | 1993-03-06 | 1993-04-21 | Ciba Geigy Ag | Chemical compounds |
| CA2159631A1 (en) | 1993-03-30 | 1994-10-13 | Sanofi | Acyclic nucleoside analogs and oligonucleotide sequences containing them |
| HU9501974D0 (en) | 1993-03-31 | 1995-09-28 | Sterling Winthrop Inc | Oligonucleotides with amide linkages replacing phosphodiester linkages |
| DE4311944A1 (en) | 1993-04-10 | 1994-10-13 | Degussa | Coated sodium percarbonate particles, process for their preparation and detergent, cleaning and bleaching compositions containing them |
| ATE183513T1 (en) | 1993-06-03 | 1999-09-15 | Therapeutic Antibodies Inc | PREPARATION OF ANTIBODY FRAGMENTS |
| CA2164288A1 (en) | 1993-06-04 | 1994-12-22 | Barbara Ensoli | Method for treating kaposi's sarcoma with antisense oligonucleotides |
| US6180377B1 (en) | 1993-06-16 | 2001-01-30 | Celltech Therapeutics Limited | Humanized antibodies |
| US5962426A (en) | 1993-06-25 | 1999-10-05 | Yale University | Triple-helix forming oligonucleotides for targeted mutagenesis |
| ATE227342T1 (en) | 1993-09-02 | 2002-11-15 | Ribozyme Pharm Inc | ENZYMATIC NUCLEIC ACID CONTAINING NON-NUCLEOTIDES |
| US5502177A (en) | 1993-09-17 | 1996-03-26 | Gilead Sciences, Inc. | Pyrimidine derivatives for labeled binding partners |
| US5712146A (en) | 1993-09-20 | 1998-01-27 | The Leland Stanford Junior University | Recombinant combinatorial genetic library for the production of novel polyketides |
| CN1154640C (en) | 1993-10-01 | 2004-06-23 | 纽约市哥伦比亚大学理事 | Multiple combinatorial chemistry libraries encoded with markers |
| US5861288A (en) | 1993-10-18 | 1999-01-19 | Ribozyme Pharmaceuticals, Inc. | Catalytic DNA |
| US5616466A (en) | 1993-11-05 | 1997-04-01 | Cantor; Glenn H. | Ribozyme-mediated inhibition of bovine leukemia virus |
| US5578716A (en) | 1993-12-01 | 1996-11-26 | Mcgill University | DNA methyltransferase antisense oligonucleotides |
| US5457187A (en) | 1993-12-08 | 1995-10-10 | Board Of Regents University Of Nebraska | Oligonucleotides containing 5-fluorouracil |
| US5446137B1 (en) | 1993-12-09 | 1998-10-06 | Behringwerke Ag | Oligonucleotides containing 4'-substituted nucleotides |
| US5712384A (en) | 1994-01-05 | 1998-01-27 | Gene Shears Pty Ltd. | Ribozymes targeting retroviral packaging sequence expression constructs and recombinant retroviruses containing such constructs |
| US5641754A (en) | 1994-01-10 | 1997-06-24 | The Board Of Regents Of The University Of Nebraska | Antisense oligonucleotide compositions for selectively killing cancer cells |
| US5519134A (en) | 1994-01-11 | 1996-05-21 | Isis Pharmaceuticals, Inc. | Pyrrolidine-containing monomers and oligomers |
| US5683899A (en) | 1994-02-03 | 1997-11-04 | University Of Hawaii | Methods and compositions for combinatorial-based discovery of new multimeric molecules |
| US5631359A (en) | 1994-10-11 | 1997-05-20 | Ribozyme Pharmaceuticals, Inc. | Hairpin ribozymes |
| US5539083A (en) | 1994-02-23 | 1996-07-23 | Isis Pharmaceuticals, Inc. | Peptide nucleic acid combinatorial libraries and improved methods of synthesis |
| US5639647A (en) | 1994-03-29 | 1997-06-17 | Ribozyme Pharmaceuticals, Inc. | 2'-deoxy-2'alkylnucleotide containing nucleic acid |
| US5869248A (en) | 1994-03-07 | 1999-02-09 | Yale University | Targeted cleavage of RNA using ribonuclease P targeting and cleavage sequences |
| US5756810A (en) | 1994-03-11 | 1998-05-26 | Pharmacopeia, Inc. | Process of preparing 3-nitro benzoate compounds in lower alkanol |
| US5596091A (en) | 1994-03-18 | 1997-01-21 | The Regents Of The University Of California | Antisense oligonucleotides comprising 5-aminoalkyl pyrimidine nucleotides |
| WO1995025737A1 (en) | 1994-03-23 | 1995-09-28 | The Penn State Research Foundation | Method for identifying members of combinatorial libraries |
| US5627053A (en) | 1994-03-29 | 1997-05-06 | Ribozyme Pharmaceuticals, Inc. | 2'deoxy-2'-alkylnucleotide containing nucleic acid |
| US5625050A (en) | 1994-03-31 | 1997-04-29 | Amgen Inc. | Modified oligonucleotides and intermediates useful in nucleic acid therapeutics |
| EP0754238A4 (en) | 1994-04-05 | 1998-01-28 | Pharmagenics Inc | Determination and identification of active compounds in a compound library |
| US6017768A (en) | 1994-05-06 | 2000-01-25 | Pharmacopeia, Inc. | Combinatorial dihydrobenzopyran library |
| US5688997A (en) | 1994-05-06 | 1997-11-18 | Pharmacopeia, Inc. | Process for preparing intermediates for a combinatorial dihydrobenzopyran library |
| US5595873A (en) | 1994-05-13 | 1997-01-21 | The Scripps Research Institute | T. thermophila group I introns that cleave amide bonds |
| US5580967A (en) | 1994-05-13 | 1996-12-03 | The Scripps Research Institute | Optimized catalytic DNA-cleaving ribozymes |
| US5683902A (en) | 1994-05-13 | 1997-11-04 | Northern Illinois University | Human papilloma virus inhibition by a hairpin ribozyme |
| US5525711A (en) | 1994-05-18 | 1996-06-11 | The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services | Pteridine nucleotide analogs as fluorescent DNA probes |
| US5650316A (en) | 1994-06-06 | 1997-07-22 | Research Development Foundation | Uses of triplex forming oligonucleotides for the treatment of human diseases |
| US5468022A (en) * | 1994-06-14 | 1995-11-21 | Massachusetts Institute Of Technology | Sample tube identification flag |
| US5663046A (en) | 1994-06-22 | 1997-09-02 | Pharmacopeia, Inc. | Synthesis of combinatorial libraries |
| US5998193A (en) | 1994-06-24 | 1999-12-07 | Gene Shears Pty., Ltd. | Ribozymes with optimized hybridizing arms, stems, and loops, tRNA embedded ribozymes and compositions thereof |
| US5633133A (en) | 1994-07-14 | 1997-05-27 | Long; David M. | Ligation with hammerhead ribozymes |
| US5597696A (en) | 1994-07-18 | 1997-01-28 | Becton Dickinson And Company | Covalent cyanine dye oligonucleotide conjugates |
| US5939268A (en) | 1994-07-26 | 1999-08-17 | The Scripps Research Institute | Combinatorial libraries of molecules and methods for producing same |
| EP0775204A1 (en) | 1994-08-09 | 1997-05-28 | Novartis AG | Antitumor antisense oligonucleotides |
| US5580731A (en) | 1994-08-25 | 1996-12-03 | Chiron Corporation | N-4 modified pyrimidine deoxynucleotides and oligonucleotide probes synthesized therewith |
| US5597909A (en) | 1994-08-25 | 1997-01-28 | Chiron Corporation | Polynucleotide reagents containing modified deoxyribose moieties, and associated methods of synthesis and use |
| US5688670A (en) | 1994-09-01 | 1997-11-18 | The General Hospital Corporation | Self-modifying RNA molecules and methods of making |
| AU7954794A (en) | 1994-09-12 | 1996-03-29 | City Of Hope | Modulation of drug radiation resistant genes |
| US5599706A (en) | 1994-09-23 | 1997-02-04 | Stinchcomb; Dan T. | Ribozymes targeted to apo(a) mRNA |
| US5856103A (en) | 1994-10-07 | 1999-01-05 | Board Of Regents The University Of Texas | Method for selectively ranking sequences for antisense targeting |
| JPH08113591A (en) | 1994-10-14 | 1996-05-07 | Taiho Yakuhin Kogyo Kk | Oligonucleotide and anticancer drug containing the same as active ingredient |
| US6004617A (en) | 1994-10-18 | 1999-12-21 | The Regents Of The University Of California | Combinatorial synthesis of novel materials |
| US6045671A (en) | 1994-10-18 | 2000-04-04 | Symyx Technologies, Inc. | Systems and methods for the combinatorial synthesis of novel materials |
| US6030917A (en) | 1996-07-23 | 2000-02-29 | Symyx Technologies, Inc. | Combinatorial synthesis and analysis of organometallic compounds and catalysts |
| US5985356A (en) | 1994-10-18 | 1999-11-16 | The Regents Of The University Of California | Combinatorial synthesis of novel materials |
| US5603351A (en) | 1995-06-07 | 1997-02-18 | David Sarnoff Research Center, Inc. | Method and system for inhibiting cross-contamination in fluids of combinatorial chemistry device |
| US5619680A (en) | 1994-11-25 | 1997-04-08 | Berkovich; Semyon | Methods and apparatus for concurrent execution of serial computing instructions using combinatorial architecture for program partitioning |
| US5807718A (en) | 1994-12-02 | 1998-09-15 | The Scripps Research Institute | Enzymatic DNA molecules |
| US5688696A (en) | 1994-12-12 | 1997-11-18 | Selectide Corporation | Combinatorial libraries having a predetermined frequency of each species of test compound |
| US5683873A (en) | 1995-01-13 | 1997-11-04 | Innovir Laboratories, Inc. | EGS-mediated inactivation of target RNA |
| US5631146A (en) | 1995-01-19 | 1997-05-20 | The General Hospital Corporation | DNA aptamers and catalysts that bind adenosine or adenosine-5'-phosphates and methods for isolation thereof |
| US5627210A (en) | 1995-02-06 | 1997-05-06 | Chiron Corporation | Branched combinatorial libraries |
| US5994320A (en) | 1995-02-06 | 1999-11-30 | Regents Of The University Of Minnesota | Antisense oligonucleotides and methods for treating central nervous system tumors |
| US5958702A (en) | 1995-02-06 | 1999-09-28 | Benner; Steven Albert | Receptor-assisted combinatorial chemistry |
| IT1275862B1 (en) | 1995-03-03 | 1997-10-24 | Consiglio Nazionale Ricerche | ANTI-SENSE TRANSCRIPT ASSOCIATED WITH SOME TYPES OF TUMOR CELLS AND SYNTHETIC OLIGODEOXYNUCLEOTIDES USEFUL IN DIAGNOSIS AND TREATMENT |
| US5770715A (en) | 1995-03-22 | 1998-06-23 | Toagosei Co., Ltd. | Hammerhead-like nucleic acid analogues and their synthesis |
| US6130364A (en) | 1995-03-29 | 2000-10-10 | Abgenix, Inc. | Production of antibodies using Cre-mediated site-specific recombination |
| US6013443A (en) | 1995-05-03 | 2000-01-11 | Nexstar Pharmaceuticals, Inc. | Systematic evolution of ligands by exponential enrichment: tissue SELEX |
| US5702892A (en) | 1995-05-09 | 1997-12-30 | The United States Of America As Represented By The Department Of Health And Human Services | Phage-display of immunoglobulin heavy chain libraries |
| US5834318A (en) | 1995-05-10 | 1998-11-10 | Bayer Corporation | Screening of combinatorial peptide libraries for selection of peptide ligand useful in affinity purification of target proteins |
| US5807754A (en) | 1995-05-11 | 1998-09-15 | Arqule, Inc. | Combinatorial synthesis and high-throughput screening of a Rev-inhibiting arylidenediamide array |
| US5646031A (en) | 1995-05-16 | 1997-07-08 | Northern Illinois University | SArMV and sCYMVI hairpin ribozymes |
| US5891737A (en) | 1995-06-07 | 1999-04-06 | Zymogenetics, Inc. | Combinatorial non-peptide libraries |
| US6410690B1 (en) | 1995-06-07 | 2002-06-25 | Medarex, Inc. | Therapeutic compounds comprised of anti-Fc receptor antibodies |
| US5910408A (en) | 1995-06-07 | 1999-06-08 | The General Hospital Corporation | Catalytic DNA having ligase activity |
| US5646285A (en) | 1995-06-07 | 1997-07-08 | Zymogenetics, Inc. | Combinatorial non-peptide libraries |
| US5958792A (en) | 1995-06-07 | 1999-09-28 | Chiron Corporation | Combinatorial libraries of substrate-bound cyclic organic compounds |
| US6020130A (en) | 1995-06-07 | 2000-02-01 | Nexstar Pharmaceuticals, Inc. | Nucleic acid ligands that bind to and inhibit DNA polymerases |
| US6040296A (en) | 1995-06-07 | 2000-03-21 | East Carolina University | Specific antisense oligonucleotide composition & method for treatment of disorders associated with bronchoconstriction and lung inflammation |
| US5693773A (en) | 1995-06-07 | 1997-12-02 | Hybridon Incorporated | Triplex-forming antisense oligonucleotides having abasic linkers targeting nucleic acids comprising mixed sequences of purines and pyrimidines |
| WO1997000887A1 (en) | 1995-06-21 | 1997-01-09 | Martek Biosciences Corporation | Combinatorial libraries of labeled biochemical compounds and methods for producing same |
| US5962337A (en) | 1995-06-29 | 1999-10-05 | Pharmacopeia, Inc. | Combinatorial 1,4-benzodiazepin-2,5-dione library |
| US5877021A (en) | 1995-07-07 | 1999-03-02 | Ribozyme Pharmaceuticals, Inc. | B7-1 targeted ribozymes |
| US5834588A (en) | 1995-07-14 | 1998-11-10 | Yale University | (Cyanomethylene) phosphoranes as carbonyl 1,1-dipole synthons for use in constructing combinatorial libraries |
| US6041253A (en) | 1995-12-18 | 2000-03-21 | Massachusetts Institute Of Technology | Effect of electric field and ultrasound for transdermal drug delivery |
| NO953680D0 (en) | 1995-09-18 | 1995-09-18 | Hans Prydz | Cell cycle Enzymes |
| AU7286696A (en) | 1995-10-13 | 1997-05-07 | F. Hoffmann-La Roche Ag | Antisense oligomers |
| US5874443A (en) | 1995-10-19 | 1999-02-23 | Trega Biosciences, Inc. | Isoquinoline derivatives and isoquinoline combinatorial libraries |
| WO1997018312A1 (en) | 1995-11-14 | 1997-05-22 | Vimrx Holdings, Ltd. | Chimeric oligomers having an rna-cleavage activity |
| CZ154898A3 (en) | 1995-11-21 | 1998-09-16 | Icn Pharmaceuticals, Inc. | Oligonucleotides for inhibiting IL-8 mediated tumor growth and IL-8 receptor |
| US5998203A (en) | 1996-04-16 | 1999-12-07 | Ribozyme Pharmaceuticals, Inc. | Enzymatic nucleic acids containing 5'-and/or 3'-cap structures |
| US6031071A (en) | 1996-01-24 | 2000-02-29 | Biophage, Inc. | Methods of generating novel peptides |
| CN1215994A (en) | 1996-02-15 | 1999-05-05 | 国家健康学会 | Rnase L activators and antisense oligonucleotides effective to treat RSV infections |
| US5880972A (en) | 1996-02-26 | 1999-03-09 | Pharmacopeia, Inc. | Method and apparatus for generating and representing combinatorial chemistry libraries |
| US5866333A (en) * | 1996-03-01 | 1999-02-02 | Regents Of The University Of California | Screening methods to detect mRNA targets of editing enzymes |
| US5877162A (en) | 1996-03-14 | 1999-03-02 | Innovir Laboratories, Inc. | Short external guide sequences |
| US5847150A (en) | 1996-04-24 | 1998-12-08 | Novo Nordisk A/S | Solid phase and combinatorial synthesis of substituted 2-methylene-2, 3-dihydrothiazoles and of arrays of substituted 2-methylene-2, 3-dihydrothiazoles |
| GB9610813D0 (en) | 1996-05-23 | 1996-07-31 | Pharmacia Spa | Combinatorial solid phase synthesis of a library of benzufuran derivatives |
| GB9610811D0 (en) | 1996-05-23 | 1996-07-31 | Pharmacia Spa | Combinatorial solid phase synthesis of a library of indole derivatives |
| US5792431A (en) | 1996-05-30 | 1998-08-11 | Smithkline Beecham Corporation | Multi-reactor synthesizer and method for combinatorial chemistry |
| US5792613A (en) | 1996-06-12 | 1998-08-11 | The Curators Of The University Of Missouri | Method for obtaining RNA aptamers based on shape selection |
| US5840500A (en) | 1996-07-11 | 1998-11-24 | Trega Biosciences, Inc. | Quinoline derivatives and quinoline combinatorial libraries |
| US5955590A (en) | 1996-07-15 | 1999-09-21 | Worcester Foundation For Biomedical Research | Conjugates of minor groove DNA binders with antisense oligonucleotides |
| US5747319A (en) * | 1996-07-25 | 1998-05-05 | Incyte Pharmaceuticals, Inc. | Human mRNA editing enzyme |
| WO1998008839A1 (en) | 1996-08-26 | 1998-03-05 | Eli Lilly And Company | Combinatorial process for preparing substituted thiophene libraries |
| US5886126A (en) | 1996-08-28 | 1999-03-23 | University Of South Florida | Combinatorial method of forming cascade polymer surfaces |
| US5886127A (en) | 1996-08-28 | 1999-03-23 | University Of South Florida | Combinatorial method of forming cascade polymer surfaces |
| US5877214A (en) | 1996-09-12 | 1999-03-02 | Merck & Co., Inc. | Polyaryl-poly(ethylene glycol) supports for solution-phase combinatorial synthesis |
| DE19639937C1 (en) | 1996-09-27 | 1998-03-12 | Siemens Ag | Circuit arrangement with combinatorial blocks arranged between registers |
| US5916899A (en) | 1996-10-18 | 1999-06-29 | Trega Biosciences, Inc. | Isoquinoline derivatives and isoquinoline combinatorial libraries |
| US5874566A (en) | 1996-10-25 | 1999-02-23 | Hisamitsu Pharmaceutical Co. Inc. | Il-15 triplex oligonucleotides |
| US6051698A (en) | 1997-06-06 | 2000-04-18 | Janjic; Nebojsa | Vascular endothelial growth factor (VEGF) nucleic acid ligand complexes |
| US6025371A (en) | 1996-10-28 | 2000-02-15 | Versicor, Inc. | Solid phase and combinatorial library syntheses of fused 2,4-pyrimidinediones |
| US5945070A (en) | 1996-10-31 | 1999-08-31 | Merck & Co., Inc. | Reaction vessel filter for combinatorial chemistry or biological use |
| US5972719A (en) | 1996-11-05 | 1999-10-26 | Pharmacopeia, Inc. | Combinatorial hydroxy-amino acid amide libraries |
| US5965719A (en) | 1996-11-15 | 1999-10-12 | Sunsorb Biotech, Inc. | Combinatorial synthesis of carbohydrate libraries |
| JP4642946B2 (en) | 1996-12-20 | 2011-03-02 | アルザ コーポレイション | Gel composition and method |
| US5859190A (en) | 1997-02-04 | 1999-01-12 | Trega Biosciences, Inc. | Combinatorial libraries of hydantoin and thiohydantoin derivatives, methods of making the libraries and compounds therein |
| US5856107A (en) | 1997-02-04 | 1999-01-05 | Trega Biosciences, Inc. | Combinatorial libraries of imidazol-pyrido-indole and imidazol-pyrido-benzothiophene derivatives, methods of making the libraries and compounds therein |
| US5925527A (en) | 1997-02-04 | 1999-07-20 | Trega Biosciences, Inc. | Tricyclic Tetrahydroquinoline derivatives and tricyclic tetrahydroquinoline combinatorial libraries |
| US6046004A (en) | 1997-02-27 | 2000-04-04 | Lorne Park Research, Inc. | Solution hybridization of nucleic acids with antisense probes having modified backbones |
| US6045755A (en) | 1997-03-10 | 2000-04-04 | Trega Biosciences,, Inc. | Apparatus and method for combinatorial chemistry synthesis |
| US5804185A (en) * | 1997-03-13 | 1998-09-08 | Incyte Pharmaceuticals, Inc. | RNA editing enzyme REE-2 |
| US5976894A (en) | 1997-04-14 | 1999-11-02 | Pharmacopeia, Inc. | Combinatorial amide alcohol libraries |
| US6150088A (en) * | 1997-04-17 | 2000-11-21 | Whitehead Institute For Biomedical Research | Core structure of gp41 from the HIV envelope glycoprotein |
| US5948696A (en) | 1997-06-16 | 1999-09-07 | Pharmacopeia, Inc. | Combinatorial biaryl amino acid amide libraries |
| AU7976198A (en) | 1997-06-19 | 1999-01-04 | Ribozyme Pharmaceuticals, Inc. | Hammerhead ribozymes with extended cleavage rule |
| US6300483B1 (en) | 1997-06-19 | 2001-10-09 | Ribozyme Pharmaceuticals, Inc. | Compositions inducing cleavage of RNA motifs |
| JPH1142091A (en) | 1997-07-25 | 1999-02-16 | Toagosei Co Ltd | Anti-sense nucleic acid compound |
| CA2248762A1 (en) | 1997-10-22 | 1999-04-22 | University Technologies International, Inc. | Antisense oligodeoxynucleotides regulating expression of tnf-.alpha. |
| WO1999029721A1 (en) * | 1997-12-10 | 1999-06-17 | Washington University | Anti-pathogen system and methods of use thereof |
| FR2773079B1 (en) * | 1997-12-30 | 2002-05-17 | Itzik Harosh | TREATMENT TARGET FOR ATHEROSCLEROSIS, OBESITY AND TYPE II DIABETES |
| US6008321A (en) | 1998-03-16 | 1999-12-28 | Pharmacopeia, Inc. | Universal linker for combinatorial synthesis |
| US6007995A (en) | 1998-06-26 | 1999-12-28 | Isis Pharmaceuticals Inc. | Antisense inhibition of TNFR1 expression |
| US6013522A (en) | 1999-02-23 | 2000-01-11 | Isis Pharmaceuticals Inc. | Antisense inhibition of human Smad1 expression |
| WO2000058480A1 (en) * | 1999-03-29 | 2000-10-05 | Kansai Technology Licensing Organization Co., Ltd. | Novel cytidine deaminase |
| US6025198A (en) | 1999-06-25 | 2000-02-15 | Isis Pharmaceuticals Inc. | Antisense modulation of Ship-2 expression |
| US6033910A (en) | 1999-07-19 | 2000-03-07 | Isis Pharmaceuticals Inc. | Antisense inhibition of MAP kinase kinase 6 expression |
| WO2002068676A2 (en) * | 2001-02-27 | 2002-09-06 | University Of Rochester | METHODS AND COMPOSITIONS FOR MODIFYING APOLIPOPROTEIN B mRNA EDITING |
| EP1373308B1 (en) * | 2001-04-06 | 2006-10-25 | Thomas Jefferson University | Antagonist for multimerization of hiv-1 vif protein |
| US20040009951A1 (en) * | 2002-06-13 | 2004-01-15 | Malim Michael H | DNA deamination mediates innate immunity to (retro)viral infection |
| US7220554B2 (en) * | 2003-05-23 | 2007-05-22 | Oregon Health And Science University | Methods for identifying inhibitors |
| ATE506456T1 (en) * | 2003-06-10 | 2011-05-15 | David Gladstone Inst | METHOD FOR TREATING LENTIVIRUS INFECTIONS |
| CA2537798A1 (en) * | 2003-09-03 | 2005-03-17 | University Of Rochester | Cytidine deaminase activators, deoxycytidine deaminase activators, vif antagonists, and methods of screening for molecules thereof |
-
2003
- 2003-08-05 EP EP03767199A patent/EP1575992A4/en not_active Withdrawn
- 2003-08-05 AU AU2003257181A patent/AU2003257181A1/en not_active Abandoned
- 2003-08-05 US US10/523,038 patent/US20050287648A1/en not_active Abandoned
- 2003-08-05 CA CA002495478A patent/CA2495478A1/en not_active Abandoned
- 2003-08-05 WO PCT/US2003/024458 patent/WO2004013160A2/en not_active Ceased
- 2003-08-05 EP EP09167071A patent/EP2116604A1/en not_active Withdrawn
-
2009
- 2009-07-27 US US12/510,054 patent/US20100160174A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| EP1575992A4 (en) | 2007-02-21 |
| AU2003257181A1 (en) | 2004-02-23 |
| EP2116604A1 (en) | 2009-11-11 |
| US20100160174A1 (en) | 2010-06-24 |
| WO2004013160A2 (en) | 2004-02-12 |
| US20050287648A1 (en) | 2005-12-29 |
| CA2495478A1 (en) | 2004-02-12 |
| WO2004013160A3 (en) | 2006-01-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20100160174A1 (en) | Protein transducing domain/deaminase chimeric proteins, related compounds, and uses thereof | |
| US11384353B2 (en) | Inhibition of unintended mutations in gene editing | |
| US20220133790A1 (en) | Modified immune cells having enhanced anti-neoplasia activity and immunosuppression resistance | |
| Adolph et al. | Enzyme cycling contributes to efficient induction of genome mutagenesis by the cytidine deaminase APOBEC3B | |
| EP2915564B1 (en) | Antidotes for factor XA inhibitors and methods of using the same | |
| EP2453910B1 (en) | Unit dose formulation of antidote for factor xa inhibitors for use in preventing bleeding | |
| CA3108281A1 (en) | Multi-effector nucleobase editors and methods of using same to modify a nucleic acid target sequence | |
| KR20180088926A (en) | Mutations associated with resistance to inhibitors of bruton's tyrosine kinase (btk) | |
| US20240360427A1 (en) | Targeting oncogenic mutations with dual-cleaving endonuclease | |
| Chen et al. | Soluble apyrases release ADP during ATP hydrolysis | |
| Ruiz et al. | DNA polymerase mu, a candidate hypermutase? | |
| US20090238813A1 (en) | Compositions And Methods For Engineered Human Arginine Deiminases | |
| Rausch et al. | Substituting a conserved residue of the ribonuclease H domain alters substrate hydrolysis by retroviral reverse transcriptase | |
| Class et al. | Patent application title: PROTEIN TRANSDUCING DOMAIN/DEAMINASE CHIMERIC PROTEINS, RELATED COMPOUNDS, AND USES THEREOF Inventors: Harold C. Smith (Rochester, NY, US) Harold C. Smith (Rochester, NY, US) Mark P. Sowden (Penfield, NY, US) Stephen Dewhurst (Rochester, NY, US) Baek Kim (Rochester, NY, US) Joseph Wedekind (Rochester, NY, US) Assignees: University of Rochester Medical Center | |
| EP3241904B1 (en) | Factor xia-specific aptamers | |
| US20050112555A1 (en) | Cytidine deaminase activators, deoxycytidine deaminase activators, Vif antagonists, and methods of screening for molecules thereof | |
| US20180216094A1 (en) | REVERSAL AGENTS FOR FXIa INHIBITORS | |
| JP6021018B2 (en) | Improved oligonucleotide and pharmaceutical composition comprising the oligonucleotide | |
| HK40052336A (en) | Antidotes for factor xa inhibitors and methods of using the same | |
| Huang | The mechanism of mammalian immunoglobulin class switch recombination: R-loop structures and activation-induced deaminase site preferences | |
| Bothmer | The Role of 53BP1 in DNA Double-Strand Break Repair | |
| HK1229844A1 (en) | Antidotes for factor xa inhibitors and methods of using the same | |
| HK1210443B (en) | Antidotes for factor xa inhibitors and methods of using the same | |
| HK1167346B (en) | Unit dose formulation of antidote for factor xa inhibitors for use in preventing bleeding |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20050203 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT RO SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK |
|
| DAX | Request for extension of the european patent (deleted) | ||
| PUAK | Availability of information related to the publication of the international search report |
Free format text: ORIGINAL CODE: 0009015 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: C12N 9/78 20060101ALI20061012BHEP Ipc: C12N 15/62 20060101AFI20061012BHEP |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20070123 |
|
| 17Q | First examination report despatched |
Effective date: 20070531 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20090914 |