EP1554389A2

EP1554389A2 - Method for making recombinant proteins

Info

Publication number: EP1554389A2
Application number: EP03797190A
Authority: EP
Inventors: Ruth Buemann Simesen; Jan Eric Jensen; Anette Amstrup Pedersen; Steffen Faisst; Dietmar Weilguny
Original assignee: Novo Nordisk AS
Current assignee: Novo Nordisk AS
Priority date: 2002-09-20
Filing date: 2003-09-19
Publication date: 2005-07-20
Also published as: AU2003263161A8; WO2004027072A3; WO2004027072A2; AU2003263161A1

Abstract

The present invention relates to scaffold/matrix attachment regions isolated from hamster cells and their use for the industrial production of recombinant proteins and polypep-tides. In one embodiment the invention is related to a method for production of Factor VII polypeptides or Factor VII-related polypeptides comprising a) transfecting a mammalian cell with an expression vector comprising a nucleic acid molecule encoding Factor VII or a Factor VII-related polypeptide, expression control regions operatively linked to thereto and at least one S/MAR element; b) culturing the transfected cell under conditions for expression of Fac-tor VII or a Factor VII-related polypeptide and c) isolating the expressed polypeptide by suit-able means.

Description

METHOD FOR MAKING RECOMB1NANT PROTEINS

Field of the Invention

The present invention relates to scaffold/matrix attachment regions isolated from hamster cells and their use for the industrial production of recombinant proteins.

Background of the Invention Advances in cell culture and recombinant DNA technologies have facilitated the expression of a variety of proteins of therapeutic or other economic value using genetically engineered cells. The expression of many biologically active therapeutic proteins, which are derived from higher eukaryotic sources, often requires specific post-translational modifications which do not naturally occur in lower eukaryotic or prokaryotic cells, thus necessitating the use of cells derived from higher eukaryotic sources. For example, the expression of glycoproteins in mammalian cells has the advantage of providing proteins which contain natural glycosylation. Mammalian- produced glycoproteins contain outer chain carbohydrate moieties which are markedly different from the outer chain carbohydrate moieties present on glycoproteins produced from lower eukaryotes. The use of mammalian cells as hosts for the production of secreted mammalian proteins has the significant advantage over secretion from lower eukaryotes in that mammalian cells have a secretory system that readily recognizes and properly processes secretion-directed proteins, which is not necessarily true for lower eukaryotes.

Scaffold Attachment Regions (SAR), also called Matrix Attachment Regions (MAR) or Scaffold/Matrix Attachment Regions (S/MAR) are non-consensus-like AT-rich DNA ele- ments several hundred base pairs (bp) in length, which organize the nuclear DNA of the eukaryotic genome into some 60,000 chromatin domains, 4 - 200 kbp loops, by periodic attachment to the protein scaffold or matrix of the cell nucleus. S/MARs have been isolated from regions surrounding actively transcribed genes but also from introns, centromeres and teleomeric regions and have been found to collaborate with enhancers to help regulate tran- scription by controlling the chromatin state of DNA. The observations that S/MARs positively interact with enhancers, form loop domains and often are located at the borders of transcrip- tionally active domains have led to the idea of using S/MARs as flanking elements around transgenes, forming so called mini-domains, in order to protect transgenes or expression cassettes from transcriptional silencing and the effects of surrounding heterochromatin (tran- scriptionally inactive chromatin) as well as possibly increase gene expression. Several publications have shown that S/MARs in a flanking position can strongly stimulate expression of transgenes, as well as reduce expression variability between cell clones (position effects). Moreover, due to the character of a mini-domain, expression should be independent from the integration site.

US patent No. 5,985.607 discloses the use of certain SAR elements for expression of EPO and tPA . In Biochemistry, 30:1264-1270, 1991 the effect of other SAR elements on expression of the human interferon β is disclosed. Also Phi-Van et al. in Mol. Cell. Biol, 10:2302-2307, 1990 ("The chicken lysozyme 5' matrix attachment region increases transcription from a heterologous promoter in heterologous cells and dampens position effects on the expression of transfected genes") disclose the influence on gene expression of a MAR element located upstream of the chicken lysozyme gene. WO/9704122 disclosed a method for producing polypeptides in plants with possible use of nuclear scaffold attachment region sequences and WO 02/14525 discloses an animal expression vector comprising β-globulin MAR or SAR sequences.

The proteins involved in the clotting cascade, including, e.g., Factor VII, Factor VIII, Factor IX, Factor X, and Protein C, are proving to be useful therapeutic agents to treat a va- riety of pathological conditions. Because of the many disadvantages of using human plasma as a source of pharmaceutical products, it is preferred to produce these proteins in recombinant systems. The clotting proteins, however, are subject to a variety of co- and post- translational modifications, including, e.g., asparagine-linked (N-linked) glycosylation; O- linked glycosylation; and γ-carboxylation of Glu residues. For this reason, it is preferable to produce them in mammalian cells, which are able to modify the recombinant proteins appropriately. Production of recombinant proteins within mammalian cells can be difficult because of a low genetic stability of the recombinant gene and/or silencing of the recombinant gene. Several molecular mechanisms have been reported that may lead to gene silencing, a. o. DNA methylation and histone deacetylation. Thus, there is a need in the art to overcome the deficiencies of the known methods for making clotting proteins by providing mammalian production strains with a higher genetic stability in large-scale production to produce industrial quantities of the clotting proteins, particularly recombinant human Factor VII or Factor Vll-related polypeptides.

Summary of the Invention

The present invention is based on the discovery of new S/MAR elements from hamster-derived CHO and BHK cells, which may be used for increasing and stabilizing the expression yield of recombinant proteins in mammalian cells. The S/MAR elements are thought to increase the genetic stability of nearby transcription cassettes and to inhibit gene silencing tby interfering with mechanisms such as DNA methylation and histone deacetylation. Furthermore, the presence of S/MAR elements is thought to decrease clone-to-clone variability through decreasing position effects, thereby minimalizing the need of screening work to identify high-yielding producer cell clones.

The S/MAR elements will typically be inserted upstream and downstream to the DNA encoding the desired protein and will be introduced in the host mammalian cell line on expression vectors comprising the necessary elements for expression of heterologous proteins in transfected cells.

Thus in one embodiment the present invention relates to a method for production of Factor VII polypeptides or Factor Vll-related polypeptides comprising a) transfecting a mammalian cell with an expression vector comprising a nucleic acid molecule encoding Factor VII or a Factor Vll-related polypeptide, expression control regions operatively linked to thereto and at least one S/MAR element; b) culturing the transfected cell under conditions for expression of Factor VII or a Factor Vll-related polypeptide and c) isolating the expressed polypeptide by suitable means.

In one embodiment the vector comprises two S/MAR elements flanking the DNA en- coding Factor VII or a Factor Vll-related polypeptide and the expression control regions. The S/MAR elements may be selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2, functional fragments thereof and sequences being at least 70% homologous thereto as determined by pair wise DNA sequence alignment using matching methods like the BLAST (Basic Local Alignment Search Tool) algorithm (Altschul, S. F. et al., 1990, "Basic local alignment search tool". J. Mol. Biol. 215:403-410; and Altschul, S. F. et al., 1997, "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucl. Acids Res. 25:3389-3402).

In a further embodiment the S/MAR elements will be at least 75%; 80%, 85%, 90% or 95% homologous to SEQ ID NO:1 or 2, respectively as determined by pair wise DNA se- quence alignment using matching methods like the BLAST (Basic Local Alignment Search Tool) algorithm (Altschul, S. F. et al., 1990, "Basic local alignment search tool". J. Mol. Biol. 215:403-410; and Altschul, S. F. et al., 1997, "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucl. Acids Res. 25:3389-3402). Examples of S/MAR sequences homologuos to SEQ ID NO:1 and 2 are SEQ ID NO:3; 4 and 5. The S/MAR elements may be the same or different and may be located in a distance of from 0 to10 kb from the DNA encoding Factor VII or a Factor Vll-related polypeptide and the expression control regions.

In one embodiment the vector expressing Factor VII or a FVII-related polypeptide will comprise two identical S/MAR elements. In a further embodiment such S/MAR elements are selected from the group consisting of SEQ ID NO:1 ; 2; 3; 4; and 5. In a still further embodiment the vector expressing FVII or a FVII-related polypeptide comprises two S/MAR elements which are different from each other with respect to base pairs and numbers. Such S/MAR elements will preferably be selected from the group consisting of SEQ ID NO:1; 2; 3; 4; and 5. Any combination of SEQ ID NO:1 ; 2; 3; 4; and 5 can be used.

In another embodiment the present invention is related to a method for production of polypeptides or proteins in transfected mammalian cells comprising a) transfecting a mammalian cell with an expression vector comprising a nucleic acid molecule encoding a polypeptide or protein, expression control regions operatively linked thereto and at least one S/MAR element selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2, functional fragments thereof and sequences being at least 70% homologous thereto; b) culturing the transfected cell under conditions for expression of the desired polypeptides or protein and c) isolating the expressed product by suitable means.

The S/MAR elements will in be at least 75%; 80%, 85%, 90% or 95% homologous to SEQ ID NO:1 or 2, respectively as determined by pair wise DNA sequence alignment using matching methods like the BLAST (Basic Local Alignment Search Tool) algorithm (Altschul, S. F. et al., 1990, "Basic local alignment search tool". J. Mol. Biol. 215:403-410; and Altschul, S. F. et al., 1997, "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucl. Acids Res. 25:3389-3402). Examples of S/MAR sequences ho- mologuos to SEQ ID NO:1 and 2 are SEQ ID NO:3; 4 and 5.

The S/MAR elements may be the same or different and may be located in a distance of from 0 to10 kb from the DNA encoding the desired polypeptide and the expression control regions.

In one embodiment of the present invention the vector comprises two S/MAR ele- ments being the same and selected from the group consisting of SEQ ID NO:1; 2; 3; 4; and 5.

In a further embodiment the vector comprises two S/MAR elements which are different from each other with respect to base pairs and numbers. In this embodiment, the pair of S/MAR elements can be any combination of SEQ ID NO:1; 2; 3; 4; and 5. In a further embodiment the present invention is related to an isolated DNA molecule having a nucleotide sequence selected from the group consisting of SEQ ID NO:1 and 2 and sequences being at least 70% homologous thereto or sequences that hybridize to the isolated DNA under stringent conditions.

In a still further embodiment the present invention is related to mammalian cell lines transfected with an expression vector comprising a nucleic acid molecule encoding Factor VII or a Factor Vll-related polypeptide, expression control regions operatively linked to thereto and at least one S/MAR element.

In still a further embodiment the present invention is related to mammalian cell lines transfected with an expression vector comprising a nucleic acid molecule encoding a poly- peptide or protein expression control regions operatively linked to thereto and at least one S/MAR element selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2 , functional fragments thereof and sequences being at least 70% homologous thereto

Brief Description of the Drawings The invention is further explained with reference to the drawings in which:

Figure 1 shows plasmid pSEAP2-Hygro-MCS;

Figure 2 shows plasmid pSEAP2-CMVp;

Figure 3 shows plasmid pB4B1-SEAP2-B4B1 ;

Figure 4 shows plasmid pLRCA2-SEAP2-LRCA2; Figure 5 shows plasmid delta-LRCA2-SEAP2-LRCA2;

Figure 6 shows plasmid pFVII-CMVp;

Figure 7 shows plasmid delta-LRCA2-FVII-HYG-LRCA2; and

Figure 8 shows plasmid B4B1-FVII-HYG-B4B1

Figure 9 shows SEAP expression data from transfected CHO cells and Figure 10 is a box plot showing statistical values calculated from single cell clone

SEAP expressors

Detailed Description of the Invention Definitions The terms Scaffold Attachment Regions (SAR) or Matrix Attachment Regions (MAR) or Scaffold/Matrix Attachment Regions (S/MAR) as used herein refer to non-consensus-like AT-rich DNA elements several hundred base pairs (bp) in length, which organize the nuclear DNA of the eukaryotic genome into some 60,000 chromatin domains, 4 - 200 kbp loops, by periodic attachment to the protein scaffold or matrix of the cell nucleus. S/MAR elements are typically found in non coding regions such as flanking regions, such as regions upstream or downstream to a coding region, and introns.

The S/MAR elements according to the present inventions were isolated from BHK cells and CHO cells, e.g. CHO cell line DG44 (Urlaub, G. et al., 1983, "Deletion of the diploid dihydrofolate reductase locus from cultured mammalian cells". Cell 33:405-412). Methods for identifying S/MAR elements are computer prediction using MAR-

FINDER software to search for several sequence motifs, f. ex. origin of replication, AT-rich sequence, TG-rich sequence, and curved DNA sequence, (Singh, G. B., Kramer, J. A. and Krawetz, S. A. (1997). "Mathematical model to predict regions of chromatin attachment to the nuclear matrix". Nucl. Acids Res. 25:1419-1425).

With at least 70% homology is meant DNA wherein the nucleotide sequence is least 70% homologous to a defined sequence measured by pairwise DNA sequence alignment using matching methods like the BLAST (Basic Local Alignment Search Tool) algorithm (Altschul, S. F. et al., 1990, "Basic local alignment search tool". J. Mol. Biol. 215:403-410; and Altschul, S. F. et al., 1997, "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs". Nucl. Acids Res. 25:3389-3402). The term functional fragments of SEQ ID NO:1 and 2 as used herein means fragments of said sequences of a size large enough to have the desired effect on expression yields. The functional fragments will typically contain at least 300 bp of the full size of SEQ ID NO:1 and 2. The fragments will preferably be a consecutive sequence of the original sequence. Examples of such fragments are SEQ ID NO:3 from bp 543 to bp 2545 of SEQ ID NO:1; SEQ ID NO:4 from bp 437 to bp 2715 of SEQ ID NO:1 and SEQ ID NO:5 having a 12 base pair deletion in the GT rich region from bp 1551 to 1604 in SEQ ID NO:1.

The term flanking means that the sequences in question are either directly connected to the expression cassette or are connected by linking DNA sequences which may be up to 10 kb or more in length as long as such linking sequences do not interfere with the de- sired effect of the S/MAR elements. The expression cassette comprise at a minimum a gene of interest and expression control elements operatively linked thereto. Typically S/MAR elements will flank both sides, 5'-upstream and 3'-downstream, of the expression cassette. The orientation of the S/MAR elements is optional and expression cassette can be flanked by all possible combinations of the S/MAR sequences selected from group consisting of SEQ ID:1; SEQ NO:2; SEQ ID3; ID NO:4 and SEQ ID NO:5.

The control elements will comprise the usual regulatory elements such as transcrip- tional promoters, enhancers, RNA polymerase binding sites, polyadenylation sites, translation initiation signals, and termination signals and may be readily accomplished by one of ordinary skill in the art. The polypeptide or protein may be any polypeptide or protein, e.g. aprotinin, tissue factor pathway inhibitor or other protease inhibitors, insulin or insulin precursors, human or bovine growth hormone, interleukin, glucagon, GLP-1, GLP-2, IGF-I, IGF-II, tissue plasmi- nogen activator, transforming growth factor α or β, platelet-derived growth factor, GRF (growth hormone releasing factor), immunoglubolines, EPO, TPA, protein C, blood coagula- tion factors such as FVII, FVIII, FIV and FXIII, exendin-3, exentidin-4, and enzymes or functional analogues thereof. In the present context, the term "functional analogue" is meant to indicate a protein with a similar function as the native protein. The protein may be structurally similar to the native protein and may be derived from the native protein by addition of one or more amino acids to either or both the C- and N-terminal end of the native protein, substitution of one or more amino acids at one or a number of different sites in the native amino acid sequence, deletion of one or more amino acids at either or both ends of the native protein or at one or several sites in the amino acid sequence, or insertion of one or more amino acids at one or more sites in the native amino acid sequence.

By human Factor Vll polypeptides is meant polypeptides having the amino acid sequence disclosed in U.S. Patent No. 4,784,950 (wild-type Factor Vll). As used herein, "Fac- tor VII" or "Factor Vll polypeptide" encompasses wild-type Factor Vll, as well as variants of Factor Vll exhibiting substantially the same or improved biological activity relative to wild-type Factor Vll. The term "Factor VII" is intended to encompass Factor Vll polypeptides in their uncleaved (zymogen) form, as well as those that have been proteolytically processed to yield their respective bioactive forms, which may be designated Factor Vila. Typically, Factor Vll is cleaved between residues 152 and 153 to yield Factor Vila.

As used herein, "Factor Vll-related polypeptides" encompasses polypeptides, including variants, in which the Factor Vila biological activity has been substantially modified or reduced relative to the activity of wild-type Factor Vila. These polypeptides include, without limitation, Factor Vll or Factor Vila that has been chemically modified and Factor Vll variants into which specific amino acid sequence alterations have been introduced that modify or disrupt the bioactivity of the polypeptide.

The biological activity of Factor Vila in blood clotting derives from its ability to (i) bind to tissue factor (TF) and (ii) catalyze the proteolytic cleavage of Factor IX or Factor X to produce activated Factor IX or X (Factor IXa or Xa, respectively). For purposes of the invention, Factor Vila biological activity may be quantified by measuring the ability of a preparation to promote blood clotting using Factor Vll-deficient plasma and throm- boplastin, as described, e.g., in U.S. Patent No. 5,997,864. In this assay, biological activity is expressed as the reduction in clotting time relative to a control sample and is converted to "Factor Vll units" by comparison with a pooled human serum standard con- taining 1 unit/ml Factor Vll activity. Alternatively, Factor Vila biological activity may be quantified by (i) measuring the ability of Factor Vila to produce of Factor Xa in a system comprising TF embedded in a lipid membrane and Factor X. (Persson et al., J. Biol. Chem. 272:19919-19924, 1997); (ii) measuring Factor X hydrolysis in an aqueous system (see, Example 5 below); (iii) measuring its physical binding to TF using an instrument based on surface plasmon resonance (Persson, FEBS Letts. 413:359-363, 1997) (iv) measuring hydrolysis of a synthetic substrate and (v) measuring generation of thrombin in a TF-independent in vitro system.

Factor Vll variants having substantially the same or improved biological activity relative to wild-type Factor Vila encompass those that exhibit at least about 25%, pref- erably at least about 50%, more preferably at least about 75% and most preferably at least about 90% of the specific activity of wild-type Factor Vila that has been produced in the same cell type, when tested in one or more of a clotting assay, proteolysis assay, or TF binding assay as described above. Factor Vll variants having substantially reduced biological activity relative to wild-type Factor Vila are those that exhibit less than about 25%, preferably less than about 10%, more preferably less than about 5% and most preferably less than about 1% of the specific activity of wild-type Factor Vila that has been produced in the same cell type when tested in one or more of a clotting assay, proteolysis assay, or TF binding assay as described above. Factor Vll variants having a substantially modified biological activity relative to wild-type Factor Vll include, without limitation, Factor Vll variants that exhibit TF-independent Factor X proteolytic activity and those that bind TF but do not cleave Factor X.

Variants of Factor Vll, whether exhibiting substantially the same or better bioactivity than wild-type Factor Vll, or, alternatively, exhibiting substantially modified or reduced bioactivity relative to wild-type Factor Vll, include, without limitation, polypeptides having an amino acid sequence that differs from the sequence of wild-type Factor Vll by insertion, deletion, or substitution of one or more amino acids. Non-limiting examples of Factor Vll variants having substantially the same biological activity as wild-type Factor Vll include S52A-FVIIa, S60A- FVIIa (lino et al., Arch. Biochem. Biophys. 352: 182-192, 1998); FVIIa variants exhibiting increased proteolytic stability as disclosed in U.S. Patent No. 5,580,560; Factor Vila that has been proteolytically cleaved between residues 290 and 291 or between residues 315 and 316 (Mollerup et al., Biotechnol. Bioeng. 48:501-505, 1995); and oxidized forms of Factor Vila (Kornfelt et al., Arch. Biochem. Biophys. 363:43-54, 1999). FVII variants as disclosed in PCT/DK02/00189; and FVII variants exhibiting increased proteolytic stability as disclosed in WO 02/38162 (Scripps Research Institute); FVII variants having a modified Gla-domain and ex- hibiting an enhanced membrane binding as disclosed in WO 99/20767 (University of Minnesota); and FVII variants as disclosed in WO 01/58935 (Maxygen ApS).

Non-limiting examples of FVII variants having increased biological activity compared to wild-type FVIIa include FVII variants as disclosed in WO 01/83725, WO 02/22776, Danish patent application PA 2001 01413, Danish patent application PA 2001 01627; and FVIIa variants with enhanced activity as disclosed in JP 2001061479 (Chemo-Sero-Therapeutic Res Inst.). Non-limiting examples of Factor Vll variants having substantially reduced or modified biological activity relative to wild-type Factor Vll include R152E-FVIIa (Wildgoose et al., Biochem 29:3413-3420, 1990), S344A-FVIIa (Kazama et al., J. Biol. Chem. 270:66-72, 1995), FFR-FVIIa (Hoist et al., Eur. J. Vase. Endovasc. Surg. 15:515-520, 1998), and Factor Vila lacking the Gla domain, (Nicolaisen et al., FEBS Letts. 317:245-249, 1993). Non-limiting examples of chemically modified Factor Vll polypeptides and sequence variants are described, e.g., in U.S. Patent No. 5,997,864.

The vector may be any vector which may conveniently be subjected to recombinant DNA procedures, and the choice of vector will often depend on the host cell into which it is to be introduced. Thus, the vector may be an autonomously replicating vector, i.e. a vector which exists as an extra chromosomal entity, the replication of which is independent of chromosomal replication, e.g. a plasmid. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome(s) into which it has been integrated. The vector is preferably an expression vector in which the encoding DNA sequence is operably linked to additional segments required for transcription of the DNA. In general, the expression vector is derived from plasmid or viral DNA, or may contain elements of both. The term, "operably linked" indicates that the segments are arranged so that they function in concert for their intended purposes, e.g. transcription initiates in a promoter and proceeds through the DNA sequence coding for the polypeptide.

In case of FVII the vector system may comprise two separate vectors being capable of expressing FVII and an endoprotease, respectively. In this embodiment the mammalian cells are co-transfected with the two vectors and then cultured in a suitable culture medium. Alternatively an already established Factor Vll expression clone may be transfected with a vector capable of expressing the endoprotease. The vector system may also comprise one single vector comprising the FVII expression cassette and the endoprotease expression cassette. An example of suitable endoproteases is the KEX2 enzyme.

The mammalian cells may include Chinese hamster ovary (CHO) cells, HeLa cells, baby hamster kidney (BHK) cells, COS cells, HEK 293 cells or other immortalized cell lines available, e.g., from the American Type Culture Collection.

Examples of suitable mammalian cell lines are the COS (ATCC CRL 1650), BHK (ATCC CRL 1632, ATCC CCL 10), CHL (ATCC CCL39), HEK 293 (ATCC CRL 1573) or CHO (ATCC CCL 61) cell lines.

Methods of transfecting mammalian cells and expressing DNA sequences introduced in the cells are described in e.g. Kaufman and Sharp, J. Mol. Biol. 159 (1982), 601 - 621; Southern and Berg, J. Mol. APPI. Genet. 1 (1982), 327 - 341; Loyter et al., Proc. Natl. Acad. Sci. USA 79 (1982), 422 - 426; Wigler et al., CeN 14 (1978), 725; Corsaro and Pearson. Somatic Cell Genetics 7 (1981). 603, Graham and van der Eb, Virology 52 (1973). 456; and Neumann et al., EMBO J. 1 (1982), 841 - 845.

The promoter may be any DNA sequence which shows transcriptional activity in the host cell and may be derived from genes encoding proteins either homologous or heterologous to the host cell. Examples of suitable promoters for directing the transcription of the encoding DNA in mammalian cells are the SV40 promoter (Subramani, S. et al., 1981 ,

"Expression of the mouse dihydrofolate reductase complementary deoxyribonucleic acid I simian virus 40 vector", Mol. Cell. Biol. |ι854-864), the MT-1 (metallothionein gene) promoter (Palmiter, R. D. et al., 1983, "Metallothionein-human HG fusion genes stimulate growth of mice". Science 222:809-14) or the human cytomegalovirus immediate-early promoter

(Nelson, J. A and Groudine, M., 1986, "Transcriptional regulation of the human cytomegalovirus major immediate-early gene is associated with induction of DNase I hypersensitive sites". Mol. Cell. Biol 6:452-461). The encoding DNA sequence may also, be operably connected to a suitable terminator, such as the human growth hormone terminator or the ADH3 terminator.

The vector may further comprise elements such as polyadenylation signals (e.g. from SV40 or the adenovirus 5 Elb region), transcriptional enhancer sequences (e.g. the SV40 enhancer) and translational enhancer sequences (e.g. the ones encoding adenovirus VA RNAs).

The vector will also preferably contain a signal peptide coding region, which codes for an amino acid sequence linked to the amino terminus of the FVII polypeptide which can direct the expressed FVII polypeptide into the cell's secretory pathway of the host cell. The signal may be homologous or heterologous to the host mammalian cell line and it may be the natural signal peptide

Finally, the vector may comprise a DNA sequence enabling it to replicate in the host cell in question. An example of such a sequence in a mammalian cell is the SV40 origin of replication.

The transfected mammalian cells are cultured in a suitable nutrient medium under conditions permitting the co-expression of FVII and the endoprotease whereupon FVII is recovered from the culture medium. The medium used to culture the mammalian cells may be any medium suitable for growing mammalian cells, such as minimal or complex media containing appropriate supplements. Suitable media are available from commercial suppliers or may be prepared according to published recipes (e.g. in catalogues of the American Type Culture Collection). FVII produced by the cells may then be recovered from the culture medium by conventional procedures including separating the host cells from the medium by centrifugation or filtration, precipitating the proteinaceous components of the supernatant or filtrate by means of a salt, e.g. ammonium sulfate, purification by a variety of chromatographic procedures, e.g. ion exchange chromatography, gelfiltration chromatography, affinity chromatography, or the like, dependent on the type of polypeptide in question.

Separation of the expressed product from the cell culture may be achieved by any method known in the art, including, without limitation, removal of cell culture medium containing the desired product from an adherent cell culture; centrifugation or filtration to remove non-adherent cells; and the like. Purification of the crude product may be achieved using any method known in the art, including, without limitation, affinity chromatography. In the case of Factor Vll or FVII related products one or more of the following methods may be used: an anti-Factor Vll antibody column (see, e.g., Wakabayashi et al., J. Biol. Chem. 261:11097, 1986; and Thim et al., Biochem. 27:7785, 1988); hydrophobic interaction chromatography; ion-exchange chromatogra- phy; size exclusion chromatography; electrophoretic procedures (e.g., preparative isoelectric focusing (IEF), differential solubility (e.g., ammonium sulfate precipitation), or extraction and the like. See, generally, Scopes, Protein Purification, Springer-Verlag, New York, 1982; and Protein Purification, J.-C. Janson and Lars Ryden, editors, VCH Publishers, New York, 1989. Following purification, the preparation preferably contains less than about 10% by weight, more preferably less than about 5% and most preferably less than about 1%, of non-Factor Vll proteins derived from the host cell.

Factor Vll and Factor Vll-related polypeptides may be activated by proteolytic cleavage, using Factor Xlla or other proteases having trypsin-like specificity, such as, e.g., Factor IXa, kallikrein, Factor Xa, and thrombin. See, e.g., Osterud et al., Biochem. 11:2853 (1972); Thomas, U.S. Patent No. 4,456,591 ; and Hedner et al., J. Clin. Invest. 71 :1836 (1983). Alternatively, Factor Vll may be activated by passing it through an ion-exchange chromatography column, such as Mono Q® (Pharmacia) or the like. The resulting activated Factor Vll may then be formulated and administered as described below.

The Factor Vll or FVII related polypeptides produced by the present invention may be used to treat any Factor Vll-responsive syndrome, such as, e.g., bleeding disorders, including, without limitation, those caused by clotting factor deficiencies (e.g., haemophilia A and B or deficiency of coagulation factors XI or Vll); by thrombocytopenia or von Willebrand's disease, or by clotting factor inhibitors, or excessive bleeding from any cause. The preparations may also be administered to patients in association with surgery or other trauma or to patients receiving anticoagulant therapy. Preparations comprising Factor Vll-related polypeptides produced by the method according to the present invention, which have substantially reduced bioactivity relative to wild-type Factor Vll, may be used as anticoagulants, such as, e.g., in patients undergoing angioplasty or other surgical procedures that may increase the risk of thrombosis or occlu- sion of blood vessels as occurs, e.g., in restenosis. Other medical indications for which anticoagulants are prescribed include, without limitation, deep vein thrombosis, pulmonary embolism, stroke, disseminated intravascular coagulation (DIG), fibrin deposition in lungs and kidneys associated with gram-negative endotoxemia, myocardial infarction; Acute Respiratory Distress Syndrome (ARDS), Systemic Inflammatory Response Syndrome (SIRS), Hemo- lytic Uremic Syndrome (HUS), MOF, and TTP.

Pharmaceutical compositions comprising the Factor Vll and Factor Vll-related preparations produced according to the present invention are primarily intended for parenteral administration for prophylactic and/or therapeutic treatment. Preferably, the pharmaceutical compositions are administered parenterally, i.e., intravenously, subcutaneously, or intramuscularly. They may be administered by continuous or pulsatile infusion.

The following examples are intended as non-limiting illustrations of the present invention.

Example 1 : Cloning and characterization of SEQ ID NO:1, LRCA2

Subtractive PCR techniques have been used to identify genes which are expressed to high levels in Chinese Hamster (Chcetulus griseus) Ovary cells (CHO cells) (Puck, T. T, et al., 1958, "Genetics of somatic mammalian cells, III. Long-term cultivation of euploid cells from human and animal subjects". J. Exp. Med. 108:945-956; Kao F. T. and Puck T. T., 1968, "Genetics of somatic mammalian cells, Vll. Induction and isolation of nutritional mutants in Chinese hamster cells". Proc. Natl. Acad. Sci. USA 60:1275-1281). One of the PCR products obtained by this assay, a 2.7 kb fragment was cloned from EcoRV digested CHO DNA (CHO cell line DG44) by use of DNA oligonucleotides CLC394 AAAACTGGGAAC- CATTTGTG (SEQ ID NO:9) and CLC56LCTGCAGAAGAGGCGACAG (SEQ ID NO: 10) and the PCR-Select kit (CLONTECH). CLC394L and CLC56L are complementary to the CHO cyclophilin cDNA sequence (Genbank Accession no. X17105).

Subsequent analysis of the flanking sequences led to the isolation of a DNA fragment from the upstream region of the CHO cell cyclophilin gene (Bergsma, D. J. and Sylvester, D., 1990, "A Chinese hamster ovary cyclophilin cDNA sequence". Nucl. Acids Res. 18:200) promoter. This DNA fragment has been identified by computer-analysis (Singh, G. B., Kramer, J. A. and Krawetz, S. A., 1997, "Mathematical model to predict regions of chro- matin attachment to the nuclear matrix". Nucl. Acids Res. 25:1419-1425) as a putative S/MAR element, which was named LRCA2, SEQ ID NO:1.

Example 2: Cloning and characterization of SEQ ID NO: 2, B4B1 A recombinant Baby Hamster Kidney cell line expressing a recombinant protein was analyzed for the chromosomal DNA encompassing the integrated plasmid DNA. To this end, chromosomal DNA of the recombinant BHK cell line has been isolated by standard methods. The isolated DNA became subsequently subject of restriction enzyme digest. The restriction enzymes used were characterized as enzymes that did not digest sequences present within the integrated plasmid DNA. Such a restriction digest will give rise to DNA fragments containing all of the integrated plasmid and both up- and downstream flanking chromosomal DNA. Following digest, the generated DNA fragments were subjected to a ligation reaction, aiming at intra-molecular ligation giving raise to circular DNA molecules. These circular fragments were then transfected into bacteria, which subsequently were grown under antibiotic selec- tion pressure. Only bacteria that have been transfected with DNA fragments containing the integrated plasmid DNA, and therefore containing an antibiotic resistance gene, were growing under these circumstances. Analysis of clones resulting from digestion with distinct restriction enzymes revealed that digestion with restriction enzyme H/ndlll resulted in the largest DNA fragments with about 3,500 base pairs up- and about 3000 base pairs downstream of the integration site. These DNA fragments have been isolated, sequenced and analyzed. The upstream sequence has been identified by computer-analysis (Singh, G. B., Kramer, J. A. and Krawetz, S. A., 1997, "Mathematical model to predict regions of chromatin attachment to the nuclear matrix". Nucl. Acids Res. 25:1419-1425) as constituting a putative S/MAR element, which was named B4B1 , SEQ ID NO:2.

Example 3: Construction of reporter gene vectors for DNA transfection

In order to analyze the effect of the S/MAR elements LRCA2 and B4B1 on protein expression yields and expression stability, a series of plasmids has been constructed. These plasmids express a reporter gene Secreted Alkaline Phosphatase (SEAP), from an expres- sion cassette that is or is not flanked by S/MAR elements. These constructs have been cloned as follows:

The plasmid pSEAP2-Hygro-MCS (Figure 1) was made by cloning of the Hygromy- cin B resistance gene from plND(SP1)/Hygro (Invitrogen) as a 1.8 kb Ase\ (blunt, fill in) fragment in the unique Sa/I site (blunt, fill in) of pSEAP2-Basic (CLONTECH) and incorporation of a DNA MCS-linker GCTGGGCCCGATATCACCGGTTAATTAACTAGTTTAAAC (SEQ ID NO:6) in to the unique Eco47lll site. To create plasmid pSEAP2-CMVp (Figure 2) primer JO-252 TATTAAGATC-

TAGTTATTAATAGTAATCAATTAC (SEQ ID NO:7) and primer JO-253 TATA-

TAAGCTTGATCTGACGGTTCACTAAAC (SEQ ID NO:8) were used to generate a 0.6 kb

PCR amplified DNA fragment containing the human CMV IE promoter. The fragment was cut with BgiW and H/^'ndlll before cloning into pSEAP2-Hygro-MCS.

To create plasmid pB4B1-SEAP2-B4B1 (Figure 3) pB4B1-SEAP2 and pSEAP2- B4B1 were first made by inserting a 3.6 kb B4B1 BamHI-H/ndlll (blunt, fill in) fragment at two locations in the pSEAP2-CMVp vector, into the Mlu\ site (blunt, fill in) or into the EcoRV site which generated pB4B1-SEAP2 and pSEAP2-B4B1, respectively. pB4B1-SEAP2 and pSEAP2-B4B1 were cut with Hind\\\ and Age\ and the B4B1 containing DNA fragments from these digests were ligated to generate pB4B1-SEAP2-B4B1.

Plasmid pSEAP2-LRCA2 was made by inserting a 2.0 kb LRCA2 H/ndlll-EcoRI (blunt, fill in) fragment (SEQ ID NO:3) into the EcoRV site of pSEAP2-CMVp. pLRCA2- SEAP2 was made by cloning of a 2.3 kb LRCA2 Mlu\-Bcl\ fragment (SEQ ID NO:4) in to the ul-βg/ϊl sites of pSEAP2-CMVp. pLRCA2-SEAP2 and pSEAP2-LRCA2 were cut with Ssu36l and Age\ and the LRCA2 containing DNA fragments from these digests were ligated to generate pLRCA2-SEAP2-LRCA2 (Figure 4).

The Mlu\lSfu\ LRCA2-CMV fragment in pLRCA2-SEAP2-LRCA2 (Figure 4) was replaced with a PCR amplified 2.3 kb LRCA2 fragment containing Mlu\ and Sfu\ restriction sites at the 5'and 3^'ends, respectively, generating construct ΔLRCA2-SEAP2-LRCA2 (Figure 5). The PCR amplified LRCA2 fragment named ΔLRCA2 contains a 12 bp deletion in the large GT-repeat (SEQ ID NO:5).

Example 4: Construction of Factor Vll cDNA expression vectors for DNA transfec- tion

In order to analyze the effect of the S/MAR elements B4B1 and LRCA2 on clone-to- clone variability, expression levels and stability when expressing therapeutic proteins, a series of plasmids has been constructed. The plasmids express a therapeutic protein coagulation factor Vll (FVII), from an expression cassette that is or is not flanked by S/MAR ele- ments. The plasmids were made as follows:

To create pFVII-CMVp (Figure 6), a 1.7 kb H/ndlll-Sa/l (blunt, fill in) DNA fragment containing the human Factor Vll gene and the SV40 3" UTR/polyA signal was ligated into the H/^'ndlll and fel (blunt, fill in) sites of vector pSEAP2-CMVp and thereby replacing the SEAP gene. Factor Vll expression vector ΔLRCA2-FVII-HYG-LRCA2 (Figure 7) was made by cloning of a Nhe\ containing linker sequence at the Sfu\ site in ΔLRCA2-SEAP2-LRCA2 (Fig- ure 5). The modified ΔLRCA2-SEAP2-LRCA2 vector was afterwards digested with Apa\ and Nhel and the 7.0 kb LRCA2 fragment ligated to the 4.4 kb Nhel/Apal fragment from vector pFVII-CMVp (Figure 6) thus generating vector ΔLRCA2-FV I I-HYG-LRCA2 (Figure 7).

The CMV-SEAP-HYG Hindi ll/Sa/l fragment from the pB4B1-SEAP2-B4B1 (Figure 3) construct was replaced with the 3.5 kb H/^'ndlll/Sa/l fragment from the pFVII-CMVp (Figure 6) construct containing the CMV-FVII- HYG elements, generating the B4B1-FVII-HYG-B4B1 (Figure 8) construct.

CHO-K1 cells (ATCC CCL-61), cultured in growth medium (Dulbecco's modified Eagle's medium, 10% fetal calf serum, 100 IU penicillin and streptomycin, non-essential amino acids, and 5 mg/l vitamin K1), were transfected using Fugene 6 transfection reagent as per manufacturer's instructions (Roche, Basel, Switzerland). Stable pools of transfectants were obtained by Hygromycin selection as per manufacturer's instructions (Invitrogen, Carlsbad, CA). FVII protein yields in the culture medium were determined by standard sandwich ELISA technique (Novo Nordisk), well known to persons skilled in the art. From the pools of transfectants, a limiting dilution cloning was performed.

Briefly, 2 cells pr. well were seeded in 96-well microtiter tissue culture plates in growth medium containing Hygromycin. Following incubation for 13 days medium was replaced, and 24 hr later medium was harvested for FVII ELISA analysis. All samples were compared for FVII expression yields. Table 1 shows that flanking of the Factor Vll expression construct by either B4B1 or

LRCA2 leads to decreased variation in expression levels between different founder clones. The median values of the FVII expression levels are also shown where the expression levels obtained from the pCMV-FVII-HYG construct was set to 100% and the others calculated in relation to that. These values show that flanking of the Factor FVII expression construct by either B4B1 or LRCA2 leads to increased FVII expression levels.

Table 1

Example 5: Transfection of mammalian cells and SEAP assay

Chinese Hamster Ovary (CHO) DG44 cells maintained in MEM Alpha medium (Invi- trogen, Cat # 22571) supplemented with 5% heat inactivated fetal bovine serum (Invitrogen), 108 mg/L L-proline (Sigma), and penicillin (100 units/ml)/streptomycin (100 μg/ml) (Invitro- gen) at 37°C and 5% C0₂ were transfected using the GeneJammer transfection agent (Stratagene) according to the manufactures instructions. Briefly, cells seeded in 6-weII cell culture plates were approximately 40-50% confluent on the day of transfection and transfected with 2 μg of linearized plasmid DNA.

To generate hygromycin B resistant cell cultures, transfected cells was one day post transfection propagated in MEM Alpha growth medium containing 350 μg/ml hygromycin B (Roche). After 10 to 14 days of selection, where the cells were re-fed every 2^nd or 3^rd day with selective medium, hygromycin B resistant cells were confluent in the wells. From the day of 100% confluency and forward the cell cultures were split 1 :12 to 1 :30 every 3^rd or 4^th day. On day 29 post transfection cell cultures were split to growth medium without hygromycin. On day 32, 39, and 46 post transfection each cell culture was washed with PBS, trypzined and seeded to approximately 30% confluency in 200 μl growth medium in five wells in a 96-well cell culture plate. After 24 hours of growth at 37°C and 5% C0₂ 100 μl culture supernatant was withdrawn from each micro titer plate well and used for assaying Secreted Alkaline Phosphatase (SEAP) activity. In order to be able to measure specific SEAP production levels each well was assayed for relative cell numbers using Alamar Blue (BioSource International) cell proliferation assay according to the manufactures instructions.

SEAP levels were measured fluorometrically using 4-methylumbelliferyl as substrate. Briefly, the harvested medium was incubated at 65°C for 15 min to inactivate endogenous alkaline phosphatase and the medium was clarified by centrifugation at 4000 x g for 5 min at 4°C. 50 μl of culture supernatant and 2- to 10-fold diluted samples was pippeted into 96-well plates and development in fluorescence (Ex_{36o n}m and Em₄₅₀ „m) was followed as a function of time in a FLUOstar Galaxy (BMG Labtechnologies, Germany) fluorescence mi- croplate reader after addition of 225 μl of 4-methylumbelliferyl phosphate liquid substrate (Sigma). On day 33, 40, and 47 post transfection stable transfected cell pools transfected with plasmid pSEAP2-Hygro-MCS, pSEAP2-CMVp, pB4B1-SEAP2-B4B1, or pLRCA2- SEAP2-LRCA2 were assayed for SEAP production. In figure 9 are shown the results from one such experiment showing that flanking of the SEAP expression construct by either B4B1 or LRCA2 leads to increased expression levels. Additionally it is seen that SEAP expression is stable over time. In another experiment linearized SEAP expression plasmids, pSEAP2-Hygro-MCS, pSEAP2-CMVp, pB4B1-SEAP2-B4B1, or pLRCA2-SEAP2-LRCA2, were electroporated into CHO DG44 cells, according to Baer, et al., 2000 ("Transcriptional properties of genomic transgene integration sites marked by electroporation or retroviral infection". Biochemistry 39:7041-7049). From the pools of transfectants, a limiting dilution cloning was performed. Briefly, 2 cells pr. well were seeded in 96-well microtiter tissue culture plates in MEM Alpha growth medium (Invitrogen) containing hygromycin B (Roche, 350 μg/ml). Following incubation for 24 days medium was replaced, and 24 hours later 100 μl medium was harvested for SEAP analysis, as described above. Cell numbers was estimated using Alamar Blue (Bio- Source International).

Figure 10 shows a box plot of the SEAP expression data from DG44 cells transfected with four different expression plasmids. Upper and lower box boundaries indicate the 24^th and 75^th percentiles, respectively. Lines within the boxes mark the median and dashed lines show the mean. Whiskers above and below boxes indicate the 10^,h and 90^th percentiles. Outlying data points are indicated by filled ovals. Statistics were calculated from 140, 132, 144 and 128 data points, respectively.

Example 6: In Vitro Hydrolysis Assay

The following method can be used to assay Factor Vila bioactivity. The assay is car- ried out in a microtiter plate (MaxiSorp, Nunc, Denmark). The chromogenic substrate D-lle- Pro-Arg-p-nitroanilide (S-2288, Chromogenix, Sweden), at a final concentration of 1 mM, is added to Factor Vila (final concentration 100 nM) in 50 mM Hepes, pH 7.4, containing 0.1 M NaCI, 5 mM CaCI₂ and 1 mg/ml bovine serum albumin. The absorbance at 405 nm is measured continuously in a SpectraMax™ 340 plate reader (Molecular Devices, USA). The ab- sorbance developed during a 20-minute incubation, after subtraction of the absorbance in a blank well containing no enzyme, is used to calculate the ratio between the activities of a test and a reference Factor Vila.

Example 7: In Vitro Proteolysis Assay The following method can be used to assay Factor Vila bioactivity. The assay is carried out in a microtiter plate (MaxiSorp, Nunc, Denmark). Factor Vila (10 nM) and Factor X (0.8 microM) in 100 μl 50 mM Hepes, pH 7.4, containing 0.1 M NaCI, 5 mM CaCI₂ and 1 mg/ml bovine serum albumin, are incubated for 15 min. Factor X cleavage is then stopped by the addition of 50μl 50 mM Hepes, pH 7.4, containing 0.1 M NaCI, 20 mM EDTA and 1 mg/ml bovine serum albumin. The amount of Factor Xa generated is measured by addition of the chromogenic substrate Z-D-Arg-Gly-Arg-p-nitroanilide (S-2765, Chromogenix, Swe- den), final concentration 0.5 mM. The absorbance at 405 nm is measured continuously in a SpectraMax™ 340 plate reader (Molecular Devices, USA). The absorbance developed during 10 minutes, after subtraction of the absorbance in a blank well containing no FVIIa, is used to calculate the ratio between the proteolytic activities of a test and a reference Factor Vila.

All patents, patent applications, and literature references referred to herein are hereby incorporated by reference in their entirety.

Many variations of the present invention will suggest themselves to those skilled in the art in light of the above detailed description. Such obvious variations are within the full intended scope of the appended claims.

Claims

Claims:

I . A method for production of Factor Vll polypeptides or Factor Vll-related polypeptides comprising a) transfecting a mammalian cell with an expression vector comprising a nucleic acid molecule encoding Factor Vll or a Factor Vll-related polypeptide and expression control regions operatively linked to thereto and at least one S/MAR element; b) culturing the transfected cell under conditions for expression of Factor Vll or a Factor Vll-related polypeptide and c) isolating the expressed polypeptide by suitable means.

2 A method according to claim 1, wherein the expression vector comprises two S/MAR elements.

3. Method according to claim 1 or 2, wherein the S/MAR elements are selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2, functional fragments thereof and sequences being at least 70% homologous thereto.

4. A method according to claim 2, wherein the S/MAR elements are the same. 5. A method according to claim 4, wherein the S/MAR elements are SEQ ID NO:1.

6. A method according to claim 4, wherein the S/MAR elements are SEQ ID NO:2.

7. A method according to claim 4, wherein the S/MAR elements are SEQ ID NO:3.

8. A method according to claim 4, wherein the S/MAR elements are SEQ ID NO:4.

9. A method according to claim 4, wherein the S/MAR elements are SEQ ID NO:5. 10. A method according to claim 2, wherein the S/MAR elements are SEQ ID NO:1 and 2, respectively.

I I . A method according to claim 2, wherein the S/MAR elements are SEQ ID NO:2 and 3, respectively.

12. A method according to claim 2, wherein the S/MAR elements are SEQ ID NO:2 and 4, respectively.

13. A method according to claim 2, wherein the S/MAR elements are SEQ ID NO:2 and 5, respectively.

14. A method according to claim 1 , wherein the S/MAR elements are located in a distance of from 0 to10 kb from the DNA encoding Factor Vll or a Factor Vll-related polypeptide and the expression control regions.

15. Method for production of polypeptides or proteins in transfected mammalian cells comprising a) transfecting a mammalian cell with an expression vector comprising a nucleic acid molecule encoding the desired polypeptide or protein expression control regions operatively linked to thereto and at least one S/MAR element selected from the group consisting of SEQ ID NO:1 or SEQ ID NO:2, functional fragments thereof and sequence being at least 70% homologous thereto; b) culturing the transfected cell under conditions for expression of the desired polypeptides or protein and c) isolating the expressed product by suitable means. 16 A method according to claim 15, wherein the expression vector comprises two S/MAR elements. 17. Method according to claim 15 or 16, wherein the S/MAR elements are selected from the group consisting of SEQ ID NO:1 and SEQ ID NO:2, functional fragments thereof and sequences being at least 70% homologous thereto.

18. A method according to claim 18, wherein the S/MAR elements are the same.

19. A method according to claim 18, wherein the S/MAR elements are SEQ ID NO:1. 20. A method according to claim 18, wherein the S/MAR elements are SEQ ID NO:2.

21. A method according to claim 18, wherein the S/MAR elements are SEQ ID NO:3.

22. A method according to claim 18, wherein the S/MAR elements are SEQ ID NO:4.

23. A method according to claim 18, wherein the S/MAR elements are SEQ ID NO:5.

24. A method according to claim 16, wherein the S/MAR elements are SEQ ID NO:1 and 2, respectively.

24. A method according to claim 16, wherein the S/MAR elements are SEQ ID NO:2 and 3, respectively.

25. A method according to claim 16, wherein the S/MAR elements are SEQ ID NO:2 and 4, respectively. 26. A method according to claim 16, wherein the S/MAR elements are SEQ ID NO:2 and 5, respectively.

27. Isolated DNA sequence having the sequence SEQ ID NO:1.

28. Isolated DNA sequence having the sequence SEQ ID NO:2.

29. Isolated DNA sequence having the sequence SEQ ID NO:3. 30. Isolated DNA sequence having the sequence SEQ ID NO:4.

31. Isolated DNA sequence having the sequence SEQ ID NO:5.

32. Vector constructs comprising a nucleic acid molecule encoding Factor Vll or a Factor Vll-related polypeptide and expression control regions operatively linked to thereto and at least one S/MAR element. 33. Vector construct according to claim 32, wherein the S/MAR elemens are selected from the group consisting of SEQ ID NO:1 ; 2; 3; 4 and 5.

34. Vector constructs comprising a nucleic acid molecule encoding a desired polypeptide or protein, expression control regions operatively linked to thereto and at least one S/MAR element selected from the group consisting of SEQ ID NO:1 , 2, 3, 4 and 5. 35. Transfected mammalian cell lines comprising a vector construct according to any of claims 32 or 34.