EP1549744A1 - Method and microorganism for the production of d-mannitol - Google Patents

Abstract

The invention relates to a method and an organism for the production of D-mannitol. The production of D-mannitol can be improved by providing said method and microorganism, using an organism expressing mannitol-2-dehydrogenase (MDH) and formate-dehydrogenase (FDH, for co-factor regeneration). The sugar substrates and/or sugar substrate precursors of MDH are transported via a non-phosphorylating sugar transport system into the organism. The sugar transport system is, advantageously, a glucose facilitator (GLF) from Zymomonas mobilis.

Description

 Description

Process and microorganism for the production of D-mannitol

The invention relates to a method and a microorganism for the production of D-mannitol.

The worldwide annual demand for the sugar alcohol D-mannitol (D-mannitol) amounts to 30,000 tons per year. D-mannitol is used in the food sector as a tooth-preserving sweetener, in medicine as a plasma expander and vasodilator (hexanitro derivative), and in the pharmaceutical industry for the production of tablets.

The large-scale production of D-mannitol has hitherto been carried out by catalytic hydrogenation on metal catalysts of glucose / fructose mixtures as starting materials. Due to the lack of stereospecificity of the catalytic hydrogenation, the yield of D-mannitol is only 25-30% with a triple excess of D-sorbitol (Makkee M, Kieboom APG, Van Bekkum H (1985), Production methods of D-mannitol. Starch / Thickness 37: 136-140).

D-mannitol and D-sorbitol differ only in their configuration at the carbon atom C-2 (stereoisomers), so that a separation of the unwanted sorbitol is difficult and time-consuming.

An alternative is the production of D-mannitol by enzymatic hydrogenation of D-fructose in a microbial biotransformation process in which a recombinant mannitol dehydrogenase (MDH) is isolated from Pseudomonas fluororescens and together with a formate dehydrogenase (FDH)

Candida boidinü and NADH is incubated in a membrane reactor (Slatner, M. et al. (1998) Biotransf. 16: 351-363). The use of formate dehydrogenase creates a reduction-oxidation cycle for NADH, which is retained by the membrane in the reaction vessel. As a result, only 70-90% of the fructose could be converted into D-mannitol. Furthermore, the mannitol dehydrogenase used has a poor stability (50 h half-life; after stabilization with dithiothreitol: 100 h), sensitivity against high temperatures> 30 ° C and against shear forces. Another major disadvantage is that membrane reactors are unsuitable for large-scale production due to the high cost of isolated enzymes, required cofactors and membranes.

A further possibility of D-mannitol production is offered by a fermentative process, where yields of approx. 85% using D-fructose / D-glucose mixtures as substrates and the heterofermentative lactic acid bacterium Leuconostoc mesenteroides ATCC 12291 as a catalyzing organism in a fermentation with growing Cells were obtained (Soetaert (1991) Synthesis of D-mannitol and L-sorbose by microbial hydrogenation and dehydrogenation of monosaccharides. PhD Thesis, University of Gent)). The gene of the MDH from Leuconostoc pseudomesenteroides and its characterization is also known (J. Aarnikunnas et. Al., Applied Microbiology and Biotechnology, July 13, 2002). The reduction equivalents required for the reduction of fructose to D-mannitol come from the oxidation of glucose to organic acids. In addition to the problem of only 85% conversion of the substrate fructose to D-mannitol, the use of D-glucose is disadvantageous since contamination of the target product with organic acids occurs during fermentation and these organic acids have to be removed by complex process steps. In fermentations with growing cells, a 100% conversion of the substrate to the product cannot be achieved, since part of the substrate is used for cell construction or for the new formation of biomass. In addition, the fermentation of Leuconostoc mesenteroides is difficult (slime formation) and expensive due to the complex media and the processing of the supernatant is therefore also complex.

Three further mannitol-2-dehydrogenases are known from the literature and are also described with regard to their biochemical properties and nucleotide / amino acid sequences. This includes the mannitol ¬

Dehydrogenase from Pseudomonas fluorescens DSM 50106 (Brünker P, Altenbuchner J, Mattes R (1998) Structure and function of the genes involved in mannitol, arabitol and glucitol utilization from Pseudomonas fluorescens DSM 50106. Gene 206: 117-126.), From Rhodobacter sphaeroides Si4 (Schneider KH, Giffhorn F, Kaplan S (1993) Cloning, nucleotide sequence and characterization of the mannitol dehydrogenase gene from Rhodobacter sphaeroides. J. Gen. Microbiology 139: 2475-2484) and from Agaricus bisporus (Stoop JM, Mooibroeck H (1998) Cloning and characterization of NADP-mannitol dehydrogenase cDNA from the button mushroom Agaricus bisporus, and its expression in response to NaCI stress. Appl. Environments. Microbiol 64: 4689-4696.). The first two belong to the group of the long-chain dehydrogenase / reductase protein family (LDR), the latter to the group of the short-chain dehydrogenase / reductase protein family (SDR).

It is therefore an object of the invention to provide an improved process for the preparation of D-mannitol which avoids the disadvantages of the prior art described.

The object is achieved by a process for the production of D-mannitol by means of an organism expressing mannitol-2-dehydrogenase (MDH), the sugar substrates and / or sugar substrate precursors of the MDH being transported via a non-phosphorylating sugar transport system Organism are transported, solved.

It is achieved by the method according to the invention that the sugar to be reacted with the MDH can be converted directly to D-mannitol by the MDH without prior phosphorylation. This direct implementation surprisingly enables improved yields and concentrations of the D-mannitol in the reaction supernatant compared to the prior art. In some cases, yields of up to 100% based on the substrate (glucose) are obtained with the process according to the invention. Furthermore, concentrations of up to 40 g / L are achieved with the method according to the invention.

Organism means both unicellular and multicellular organisms, in particular microorganisms.

The object is also achieved by a microorganism which expresses the enzymes MDH according to sequence No. 2 and FDH according to sequence No. 3 for the microbial production of D-mannitol and a non-phosphorylating sugar. Has transport system that transports the sugar substrates and / or sugar substrate precursors of the MDH into the microorganism.

The term D-mannitol is also to be understood below as D-mannitol.

In the context of this invention, all nucleotide sequences which code for a mannitol dehydrogenase are combined under the name "mαft gene sequence". The enzyme mannitol-2-dehydrogenase is summarized below under the name "MDH".

Accordingly, all nucleotide sequences that code for a formate dehydrogenase are summarized under the name "fcf j gene sequence". The enzyme formate dehydrogenase is summarized below under the name "FDH".

All nucleotide sequences which code for a glucose facilitator are also combined under the name "g / f gene sequence". The protein glucose facilitator is summarized below under the name "GLF".

Furthermore, nucleotide sequence is understood to mean all nucleotide sequences which (i) correspond exactly to the sequences shown; or (ii) comprise at least one nucleotide sequence that corresponds to the sequences shown within the range of degeneration of the genetic code; or (iii) comprises at least one nucleotide sequence which hybridizes with a nucleotide sequence which is complementary to the nucleotide sequence (i) or (ii), and optionally comprises (iiii) functionally neutral sense mutations in (i). The term function-neutral meaning mutations means the exchange of chemically similar amino acids, such as. B. glycine by alanine or serine by threonine.

According to the invention, the (5 'or upstream) and / or subsequent (3 "or downstream) sequence regions preceding the coding regions (structural genes) are also included. In particular, sequence regions with a regulatory function are included here. They can be used for transcription, RNA

Stability or affect RNA processing and translation. Examples regulatory sequences include promoters, enhancers, operators, terminators or translation enhancers.

The respective enzymes also include isoforms which are understood as enzymes with the same or comparable substrate and activity specificity, but which have a different primary structure.

According to the invention, modified forms are understood to mean enzymes in which there are changes in the sequence, for example at the N and / or C terminus of the polypeptide or in the region of conserved amino acids, but without impairing the function of the enzyme. These changes can be made in the form of amino acid exchanges using known methods.

Advantageously, the sugar transport system is the glucose facilitator (GLF) according to nucleotide sequence no. 1, which preferably consists of a eukaryote e.g. B. comes from a yeast. The GLF from Zymomonas mobilis, which was cloned by T. Conway et al (Journal of Bacteriology, Dec. 1990, p. 7227-7240), can also preferably be used.

From German patent application 198 18 541.3, a method for producing substances from the aromatic metabolism is known, in which a microorganism is used which has an increased activity of a glucose-oxidizing enzyme and which oxidizes glucose or glucose-containing substrates Gluconolakton or gluconate and converted by phosphorylation of the gluconate to 6-phosphogluconate, whereby in addition to increasing the enzyme activity of the oxidase and / or the phosphatase to increase the amount of PEP present, the activity of a PEP-independent glucose transport protein is increased, which is can trade the Zymomonas mobilis glucose facilitator (GLF). However, a process for the production of mannitol cannot be inferred from this.

In addition to fructose, the GLF can also transport glucose or xylose, of which glucose is particularly interesting as an inexpensive fructose precursor. The Glucose, as will be described, can be converted to fructose.

The sequence coding for MDH from microorganisms of the Lactobacteriaceae family, in particular Leuconostoc pseudomesenteroides, is particularly suitable for conversion to D-mannitol due to the high activity and stability of the MDH synthesized therefrom.

The organism preferably expresses sequence No. 2 coding for MDH.

Microorganisms from the genus Bacillus, Pseudomonas, Lactobacillus, Leuconostoc, Enterobacteriaceae or methylotrophic yeasts and fungi are particularly suitable as organisms. Furthermore, all microorganisms used in the food industry can also be used.

The organism used particularly preferably comes from the group Achromobacter parvolus, Methylobacterium organophilum, Mycobacterium formicum, Pseudomonas spec. 101, Pseudomonas oxalaticus, Moraxella sp., Agrobacterium sp., Paracoccus sp., Ancylobacter aquaticus, Maxcobacterium vaccae, Pseudomonas fluorescens, Rhodobacter sphaeroides, Rhodobacter capsulatus, Lactobacillus sp., Lactobacillus brevis, Glucentomoxides, Leuconostoc boidinii, Candida methylica or also Hansenula polymorpha, Aspergillus nidulans or Neurospora crassa or in particular Escherichia coli or Bacillus subtilis.

The analysis of the D-mannitol concentration can be carried out enzymatically / photometrically using the method of K. Horikoshi (Horikoshi K. (1963) Meth. Enzym. Analysis, 3rd ed. Vol. 6. HU Bergmeyer, ed., Verlag Chemie, Weinheim) , or by high pressure liquid chromatography (HPLC), as in Lindroth et al. (Lindroth et al. (1979) Analytical Chemistry 51: 1167-1174).

A sequence coding for formate dehydrogenase (FDH) can be used to establish an oxidation-reduction cycle. This preferably comes from Mycobacterium vaccae and has a nucleotide sequence according to sequence no. 3. This is seen in isolation from K. Soda et al, Appl. Microbiol. Biotechnol (1995) 44, 479-483. This enables a considerable increase in the yield or the conversion rate of the fructose to mannitol substrate by creating a cofactor regeneration system. The substrate for the provision of the reduction equivalents necessary for the reduction of fructose to mannitol is no longer used, but is provided by a second enzyme system. As a result, the coenzyme NADH is increasingly available for the conversion to mannitol. One of the most commonly used systems is regeneration with a formate dehydrogenase, e.g. B. from Mycobacterium vaccae. The use of this enzyme together with any MDH, preferably from Leuconostoc pseudomesenteroides, creates an oxidation-reduction cycle in which formate acts as an electron donor and D-fructose acts as an electron acceptor. The enzyme formate dehydrogenase catalyzes the oxidation of formate to CO ₂ and the enzyme MDH the reduction of D-fructose to D-mannitol (see FIG. 1). The intracellular nicotinic acid amide adenine dinucleotide (NAD) pool serves as an electron shuttle between the two enzymes. The oxidation of formate to CO ₂ is thermodynamically favorable, since the free standard formation energy ΔG ^{0 is} clearly negative for CO ₂ and the CO ₂ is removed from the reaction equilibrium by outgassing. The increased intracellular NADH concentration, resulting, among other things, from formate oxidation, increases the reducing power for the reduction of D-fructose to D-mannitol, catalyzed by MDH.

In a further advantageous embodiment of the method, D-glucose is used in addition to the carbon sources already mentioned as a substrate for the production. D-glucose can be converted to D-fructose by conversion with the enzyme D-glucose / xylose isomerase (EC 5.3.1.5) (2). The transformation is possible both inside and outside the organism. The use of D-glucose as a substrate in a process for the production of D-mannitol brings about a significant improvement in the economy of the process. Not only are microorganisms suitable for the described method, into which a formate dehydrogenase and an MDH are introduced and / or strengthened, but also microorganisms which already have a formate dehydrogenase or, if appropriate, an MDH, such as, for. B. Achromobacter parvolus, Methylobacterium organophilum, Mycobacterium formicum, Pseudomonas spec. 101, Pseudomonas oxalaticus, Moraxella sp., Agrobacterium sp., Paracoccus sp., Ancylobacter aquaticus. These include microorganisms such as Pseudomonas fluorescens, Rhodobacter sphaeroides, Rhodobacter capsulatus, Lactobacillus sp., Lactobacillus brevis, Gluconobacter oxydans and preferably also Leuconostoc pseudomesenteroides or microorganisms that already have both enzymes and are each enhanced in their activity. Also suitable are, for example, methylotrophic yeasts such as Candida boidinii, Candida methylica or also Hansenula polymorpha, fungi such as Aspergillus nidulans and Neurospora crassa and all microorganisms also used in the food industry.

With the method according to the invention and the microorganism, it is now possible to achieve an improved conversion of the substrate into the product D-mannitol. Compared to previously known processes, increased productivity and an increased yield (up to 100%) of D-mannitol are achieved. Concentrations of up to 40 g / L have already been achieved. The process is therefore particularly suitable for the large-scale production of D-mannitol. By creating the regeneration system with the help of formate dehydrogenase, an increased conversion of the substrate into the product D-mannitol can be made possible for NADH-consuming MDH to an increased extent without a disadvantageous formation of metabolic-related by-products with resting cells.

The invention also includes the use of nucleotide sequences according to sequences Nos. 1, 2 and 3 coding for GLF, MDH and FDH for use in one of the microorganisms described above.

The invention also includes a gene structure containing at least one or more of the above nucleotide sequences.

A vector containing at least one or more of the above nucleotide sequences or one or more of the aforementioned gene structures is also included in the invention.

The invention also includes the use of the aforementioned nucleotide sequences, gene structures and vectors in the microorganisms described or microorganisms that contain these nucleotide sequences, gene structures and vectors.

The drawings show examples of results of the method according to the invention and a schematic representation of the most important metabolic pathways that play a role in the method. It shows:

Fig. 1: Oxidoreduction cycle with formate dehydrogenase and MDH schematically in a cell. Fig. 2: Derivation of a degenerate 24 base oligonucleotide probe from the N-terminal amino acid sequence of the MDH subunit from Leuconostoc pseudomesenteroides ATCC 12291.

3: gene map of the 4.191 bp Eco Rl fragment isolated from the genomic DNA plasmid library from Leuconostoc pseudomesenteroides ATCC 12291 after immuno-screening of the mdh gene. The arrows indicate the direction of translation of the mdh ORF and 4 ORFs.

Sequence No. 1 shows the nucleotide sequence coding for GLF from Zymomonas mobilis. Sequence No. 2 shows the nucleotide sequence coding for MDH from Leuconostoc pseudomesenteroides.

Sequence No. 3 shows the nucleotide sequence coding for FDH from Mycobacterium vaccae N10.

The invention will be described below by way of example.

I) Mannitol-2-dehydrogenase from Leuconostoc pseudomesenteroides

ATCC 12291: purification and characterization of the enzyme; Cloning and functional expression of the mdh gene in Escherichia coli

a) Bacterial strains and plasmids

Leuconostoc pseudomesenteroides ATCC 12291 was used as the source for the isolation of the MDH. E. coli JM 109 (DE 3) (Promega) served as the host organism for the production of a partial plasmid bank for the isolation of the genomic DNA from Leuconostoc pseudomesenteroides ATCC 12291. A part of the plasmid bank was genomically made by ligation of a 4.0 - 4.5 kb Eco Rl fragment DNA prepared from Leuconostoc pseudomesenteroides ATCC 12291 in pUC18.

b) Cultivation conditions

The following cultivation medium was used to cultivate Leuconostoc pseudomesenteroides ATCC 12291:

Trypton 10 g / l, yeast extract 10 g / l, K ₂ HPO ₄ 10 g / l, D-fructose 20 g / l, D-glucose 10 g / l, vitamin / mineral solution 10 ml / l, in distilled water ; pH to 7.5 using orthophosphoric acid.

For subcloning and preparation of the plasmid library of the genomic Leuconostoc DNA, E. coli JM109 (DE 3) was run at 170 rpm at 37 ° C in Luria-Bertani medium with the addition of ampicillin (100 μg / ml) or carbenicillin (50 μg / ml) cultured.

c) Determination of the activity of MDH from Leuconostoc pseudomesenteroides ATCC 12291

In the present invention, the enzyme activity is measured photometrically via the decrease in the NADH concentration for the reduction reaction D-fructose + NADH + H ⁺ -> D-mannitol + NAD ⁺ certainly. The approach for measuring the activity of the MDH contained 200 μM NADH and 200 mM D-fructose in 100 mM potassium phosphate buffer at pH 6.5. The specific activities of the crude extracts and the partially purified enzyme isolates are given as units per milligram of protein (U / mg), 1 U being defined as 1 μmol substrate decrease per minute.

d) determination of protein concentrations

All protein concentration determinations were carried out using the Bradford method.

e) separation of proteins by means of polyacrylamide gel electrophoresis

Purity analyzes of crude extracts and partially purified enzyme isolates, as well as preparations preparing for Western blots, were carried out electrophoretically in discontinuous 12% SDS polyacrylamide gels according to the Lämmli method.

f) Isolation of mannitol-2-dehydrogenase from Leuconostoc pseudomesenteroides ATCC 12291

To isolate mannitol-2-dehydrogenase, the following process steps were carried out after cell disruption: ammonium sulfate precipitation, hydrophobic interaction chromatography, anion exchange chromatography I, anion exchange chromatography II, size exclusion chromatography, and chromato-focusing pH 5 - 4.

The specific activity of the MDH was 450 U / mg at pH = 5.35 for the reduction of D-fructose to D-mannitol

g) Molecular genetic methods

The isolation of genomic DNA from Leuconostoc pseudomesenteroides ATCC 12291, the isolation of DNA fragments from agarose gels, the labeling of DNA probes with digoxigenin-modified dUTP and immunological detection and DNA-DNA hybridization (Southern blot) were carried out. The amino-terminal sequencing of the 43 kDa enzyme subunit by Edman degradation and subsequent HPLC analysis gave the octameric amino acid sequence MEALVLTG. Using codon usage statistics for Leuconostoc pseudomesenteroides, a 2048-fold degenerate oligonucleotide probe for the detection of the mannitol-2-dehydrogenase gene on genomic DNA was derived from Leuconostoc pseudomesenteroides ATCC 12291 (see FIG. 2). The 24 bp DNA probe was provided with a digoxigenin-11 dUTP tail at the 3 'end and was used for the immunoscreening of partial plasmid banks of genomic DNA from L. pseudomesenteroides ATCC 12291. 2 kb DNA fragment isolated (Fig. 3). The mdh gene from this fragment was amplified with suitable primers, ligated into the vector pET24a (+) and transformed and expressed in E. coli BL21 (DE3). Cell extracts from E. coli BL21 (DE3) pET24a (+) Lmα77 showed a strong overexpression band at 43 kDa and specific activity of mannitol-2-dehydrogenase of 70 U / mg protein after induction in SDS polyacrylic electrophoresis, while the controls (cells without plasmid, cells with empty plasmid) showed no activity.

The nucleotide sequence of the mdh gene from L. pseudomesenteroides ATCC 12291 is shown in Sequence No. 2.

II) Biotransformation of D-fructose to D-mannitol with a recombinant E. coli strain

The enzymes formate dehydrogenase (EC 1.2.1.2) and mannitol 2-dehydrogenase (EC 1.1.1.67) were overexpressed in a recombinant E. coli strain in order to establish an oxidation-reduction cycle in the cells. In this oxidation-reduction cycle, hydrogen is transferred from formate via cellular NAD ⁺ to D-fructose, whereby D-fructose is reduced to D-mannitol (see FIG. 1). In addition, the glucose facilitator was expressed in the cells in order to improve the availability of the substrate fructose.

(a) Strains and Vectors

The strains E. coli BL21 (DE3) Star (Invitrogen) were used. The vectors used were pET-24a (+) fo ^, / 7 / md /?, Coding for the ORF of the formate Dehydrogenase from Mycobacterium vaccae, the mannitol-2-dehydrogenase from Leuconostoc pseudomesenteroides and coding for pZY507g / f for the glucose facilitator from Zymomonas mobilis.

For the biotransformation, chemically competent E. coli BL21 (DE 3) star was co-transformed with pET-24a (+) fα nα77 and pZY507g / f and selected on LB agar plates with 25 μg / ml chloramphenicol and 30 μg / ml kanamycin. As controls, E. coli BL21 (DE 3) Star was transformed with either pET-24a (+) fα nc / 7 or pZY507g / f alone. The transformants were selected on LB agar plates with either 25 μg / ml chloramphenicol (pZY507g / f) or with 50 μg / ml kanamycin (pET-24a (+) ft / Λ mcfh). LB agar plates for E. coli BL21 (DE 3) Star transformed with p pET-24a (+) fcftVrr? O77 additionally contained 1% (v / v) D-glucose to reduce the basal expression of mannitol-2-dehydrogenase and the formate -Dehydrogenas.

(b) Biotransformation

After overexpression of FDH, MDH and GLF in E. coli, non-growing cells are used in a biotransformation. 1.0 g each of induced cells from E. coli BL21 (DE 3) Star pET-24a (+) ft / ι / mc_7j / pZY507g / f ^~ were washed with 100 mM potassium phosphate buffer pH 7.0 and in 50 ml reaction solution resuspended with 500 mM D-fructose and 500 mM sodium formate in 100 mM potassium phosphate buffer pH 6.7. The batches were shaken in 100 ml flasks without baffle at 100-120 rpm and 30 ° C for 24 h. At times 0, 1, 2, 3, 4, 5, 6, 8, 17 and 23 h after the start of the reaction, 1-2 ml samples of the supernatant were taken to measure the concentrations of formate, D-fructose and D-mannitol. The samples were centrifuged at 5000 g for 1 min, the supernatant was filtered 0.2 μm and stored at -20 ° C. until measurement by HPLC. As a control, 1.0 g of uninduced cells of E. coli BL21 (DE 3) Star pET-24a (+) fdh / mdh I pZY507g / f were used in the same way in the biotransformation.

The concentration determinations of formate, D-fructose and D-mannitol in

The reaction supernatant and in the cell-free crude extract were carried out using an HPLC system (Merck / Hitachi). Table 1 shows examples of results that could be achieved with transformed microorganisms.

It could be shown that the parallel overexpression of formate dehydrogenase and mannitol-2-dehydrogenase and the glucose facilitator in E. coli leads to a very high production of D-mannitol by these cells in a reaction medium with D-fructose and formate. The up to 244 mM mannitol after 23 h contrast with the method without GLF with only 15 mM after 17 h and the method without FDH with 20 mM after 17 h. An improvement of approx. 12 - 15 times could be achieved.

Table 1

SEQUENCE No. 1:

ATGAGTTCTGAAAGTAGTCAGGGTCTAGTCACGCGACTAGCCCTAATCGCTGCTA TAGGCGGCTTGCTTTTCGGTTACGATTCAGCGGTTATCGCTGCAATCGGTACACC GGTTGATATCCATTTTATTGCCCCTCGTCACCTGTCTGCTACGGCTGCGGCTTCC CTTTCTGGGATGGTCGTTGTTGCTGTTTTGGTCGGTTGTGTTACCGGTTCTTTGC TGTCTGGCTGGATTGGTATTCGCTTCGGTCGTCGCGGCGGATTGTTGATGAGTTC CATTTGTTTCGTCGCCGCCGGTTTTGGTGCTGCGTTAACCGAAAAATTATTTGGA ACCGGTGGTTCGGCTTTACAAATTTTTTGCTTTTTCCGGTTTCTTGCCGGTTTAG GTATCGGTGTCGTTTCAACCTTGACCCCAACCTATATTGCTGAAATTCGTCCGCC AGACAAACGTGGTCAGATGGTTTCTGGTCAGCAGATGGCCATTGTGACGGGTGCT TTAACCGGTTATATCTTTACCTGGTTACTGGCTCATTTCGGTTCTATCGATTGGG TTAATGCCAGTGGTTGGTGCTGGTCTCCGGCTTCAGAAGGCCTGATCGGTATTGC CTTCTTATTGCTGCTGTTAACCGCACCGGATACGCCGCATTGGTTGGTGATGAAG GGAGGTCATTCCGAGGCTAGCAAAATCCTTGCTCGTCTGGAACCGCAAGCCGATC CTAATCTGACGATTCAAAAGATTAAAGCTGGCTTTGATAAAGCCATGGACAAAAG CAGCGCAGGTTTGTTTGCTTTTGGTATCACCGTTGTTTTTGCCGGTGTATCCGTT GCTGCCTTCCAGCAGTTAGTCGGTATTAACGCCGTGCTGTATTATGCACCGCAGA TGTTCCAGAATTTAGGTTTTGGAGCTGATACGGCATTATTGCAGACCATCTCTAT CGGTGTTGTGAACTTCATCTTCACCATGATTGCTTCCCGTGTTGTTGA CCGCTTC GGCCGTAAACCTCTGCTTATTTGGGGTGCTCTCGGTATGGCTGCAATGATGGCTG TTTTAGGCTGCTGTTTCTGGTTCAAAGTCGGTGGTGTTTTGCCTTTGGCTTCTGT GCTTCTTTATATTGCAGTCTTTGGTATGTCATGGGGCCCTGTCTGCTGGGTTGTT CTGTCAGAAATGTTCCCGAGTTCCATCAAGGGCGCAGCTATGCCTATCGCTGTTA CCGGACAATGGTTAGCTAATATCTTGGTTAACTTCCTGTTTAAGGTTGCCGATGG TTCTCCAGCATTGAATCAGACTTTCAACCACGGTTTCTCCTATCTCGTTTTCGCA GCATTAAGTATCTTAGGTGGCTTGATTGTTGCTCGCTTCGTGCCGGAAACCAAAG GTCGGAGCCTGGATGAAATCGAGGAGATGTGGCGCTCCCAGAAGTAG SEQUENCE No. 2:

TTAATATTCTATCACATGGTCTACTCCCCTTACTAAAATAAATGTGATAAACGTT TGACTTTATCTTGTTAAAGGTTTACCATTGTCCTCGTAAGTTAATTTAATCACAA AGTAAAAAGGAGAACAAAC

ATGGAAGCACTTGTGTTAACTGGTACAAAAAAATTAGAGGTTGAAAACATTGAAC AACCTGAGGTAAAGCCGAATGAAGTGTTGATTCATACAGCATTCGCTGGTATTTG CGGTACTGATCACGCTTTGTATGCCGGTCTTCCTGGCTCAGCCGATGCTGTGCCA CCAATCGTTTTGGGGCATGAAAATTCTGGTGTTGTAGCTGAAATTGGTTCTGATG TTACAAACGTTGCGGTGGGTGATCGTGTCACAATTGATCCCAATATTTACTGTGG TCAATGCAAGTATTGCCGTACAGCACGTCCAGAGCTTTGCGAAAACTTGTCTGCA GTTGGTGTAACACGCAATGGTGGCTTTGAAGAATACTTTACTGCGCCCGCATCAG TTGTTTACCAAATTCCAGATAATGTTTCACTTAAGTCAGCTGCCGTGGTTGAGCC GATTTCATGTGCTGTTCACGGTATTCAACTTCTTAAAGTGACACCATACCAAAAG GCATTAGTTATTGGTGACGGCTTCATGGGTGAACTCTTTGTTCAAATTCTGCAAG CTTATGGCATTCACCAAGTCGACTTGGCTGGTATTGTTCCTGAAAAGCTTGCTAT GAACAAAGAAAAGTTCGGCGTGAAAAATACGTACAATACAAAAGATGGCGACAAA ATTCCCGAAGGCACTTACGATGTTGTTGTTGAAGCAGTTGGCCTACCACAGACAC AAGAAGCCGCAATTGAAGCCTCAGCTCGTGGCGCTCAGGTTTTGATGTTTGGTGT TGGCGGTCCCGACGCAAAGTTCCAAATGAACACTTACGAAGTCTTCCAAAAGCAA TTGACGATTCAAGGATCATTTATCAATCCAAACGCATTTGAAGACTCATTGGCAT TGTTATCATCAGGCAAGTTAGACGTCGAATCGCTAATGTCACACGAATTAGATTA CCAGACTGTTGATGACTTTGTGAATGGCAAGTTAGGTGTCGTTTCAAA GGCAGTC GTTAAGGTTGGTGGCGAAGAGGCATAA

SEQUENCE No.3:

atggcaaaggtcctgtgcgttctttacgatgatccggtcgacggctacccgaa- gacctatgcccgcgacgatcttccgaa gatcgaccactatccgggcggccagatcttgccgacgccgaaggccatcgactt- cacgcccgggcagttgctcggctccgtctccggcgagctcggcctgcgcgaa- tatctcgaatccaacggccacaccctggtcgtgacctccgacaaggacggcccc- gactcggtgttcgagcgcgagctggtcgatgcggatgtcgtcatctcc- cagcccttctggccggcctatctgacgcccgagcgcatcgccaaggccaa- gaacctgaagctcgcgctcaccgccggcatcggttccgaccacgtcgatctt- cagtcggctatcgaccgcaacgtcaccgtggcggaagtcacctactgcaactc- gatcagcgtcgccgagcatgtggtgatgatgatcctg tcgctggtgcgcaactatctgccctcgcacgaatgggcgcggaagggcggctg- gaacatcgccgactgcgtctcccacgcctacgacctcgaggcgatgcatgtcgg- caccgtggccgccggccg- catcggtctcgcggtgctgcgccgtctggcgccgttcgacgtgcacctgcacta- caccgaccgtcaccgcctgccggaatcggtcgagaaggagctcaacct- cacctggcacgcgacccgcgaggacatgtatccggtttgcgacgtggtgacgct- gaactgcccgctgcaccccgaaaccgagcacatgatcaatgacgagacgct- gaagctgttcaagcgtggcgcctacatcgtcaacaccgcccgcgg- caagctgtgcgaccgcgatgccgtggcacgtgcgctc- gaatccggccggctggccggctatgccggcgacgtgtggttcccg- cagccggcgccgaaggaccaccc ctggcggacgatgccctataacggcat- gaccccgcacatctccggcaccacgctgaccgcgcaggcgcgttatgcggcggg- cacccgcgagatcctggagtgcttcttcgagggccgtccgatccgcgacgaa- tacctcatcgtgcagggcggcgctcttgccggcaccggcgcgcattcctactc- gaagggcaatgccaccggcggttcggaagaggccgccaagttcaa- gaaggcggtctga

Claims

Patent claims

1. Process for the production of D-mannitol using mannitol-2-dehydrogenase (MDH) expressing organisms, in which the sugar substrates and / or sugar substrate precursors of the MDH are transported into the organism via a non-phosphorylating sugar transport system.

2. The method according to claim 1, characterized in that organisms, the sugar transport system, the glucose facilitator (GLF) from one

Containing eukaryotes

3. The method according to claim 1 or 2, characterized in that organisms which contain the glucose facilitator (GLF) from Zymomonas mobilis as the sugar transport system are used.

4. The method according to claim 2 or 3, characterized in that organisms containing sequence number 1 coding for GLF are used.

5. The method according to any one of claims 1 to 4, characterized in that glucose and / or fructose are used as sugar.

6. The method according to any one of the preceding claims, characterized in that organisms containing a sequence coding for an MDH are used

7. The method according to claim 6, characterized in that organisms containing a coding sequence for MDH from microorganisms of the family of Lactobacteriaceae, in particular Leuconostoc pseudomesenteroides, are used.

8. The method according to claim 6 or 7, characterized in that organisms containing the sequence No. 2 coding for MDH are used.

, Method according to one of the preceding claims, characterized in that organisms which contain a sequence coding for a formate dehydrogenase (FDH) are used.

10. The method according to claim 9, characterized in that organisms containing a sequence coding for FDH from Mycobacterium vaccae are used.

11. The method according to claim 9 or 10, characterized in that organisms containing sequence number 3 coding for FDH are used.

12. The method according to any one of the preceding claims, characterized in that a microorganism is used as the organism.

13. The method according to any one of the preceding claims, characterized in that microorganisms of the genus Bacillus, Pseudomonas, Lactobacillus, Leuconostoc, Enterobacteriaceae or methylotrophic yeasts and fungi are used.

14. Microorganism which expresses the enzymes MDH according to sequence No. 2 and FDH according to sequence No. 3 for the microbial production of D-mannitol and has a non-phosphorylating sugar transport system which contains the sugar substrates and / or sugar substrate precursors of MDH transported into the microorganism.

15. Microorganism according to claim 14, characterized in that it is in the sugar transport system to the glucose facilitator (GLF) from a eukaryote

16. Microorganism according to claim 14 or 15, characterized in that it is in the sugar transport system to the glucose facilitator

(GLF) from Zymomonas mobilis.

17. Microorganism according to claim 16, characterized in that the organism has sequence number 1 coding for GLF.

18. Microorganism according to one of claims 14 to 17, characterized in that it converts glucose, fructose or mixtures thereof into D-mannitol.

19. Microorganism according to one of the preceding claims 14 to 18, characterized in that it comprises a sequence coding for MDH

Contains microorganisms of the Lactobacteriaceae family, in particular Leuconostoc pseudomesenteroides.

20. Microorganism according to one of the preceding claims 14 to 19, characterized in that it contains a sequence coding for FDH from Mycobacterium vaccae.

21. Microorganism according to one of the preceding claims 14 to 20, characterized in that it comes from the genus Bacillus, Lactobacillus, Leuconostoc, Enterobacteriaceae or methylotrophic yeasts and fungi and from all microorganisms also used in the food industry.

22. Use of a microorganism according to one of claims 14 to 21 for the production of D-mannitol.

23. Nucleotide sequence according to sequence no. 1 coding for GLF for use in a microorganism according to one of claims 14 to 21.

24. Nucleotide sequence according to sequence no. 2 coding for MDH for use in a microorganism according to one of claims 14 to 21.

25. Nucleotide sequence according to sequence no. 3 coding for FDH for use in a microorganism according to one of claims 14 to 21.

26. Gene structure containing at least one or more nucleotide sequences according to claims 23 to 25.

27. Vector containing at least one or more nucleotide sequences according to claims 23 to 25 or one or more gene structures according to claim 26.

28. Use of a nucleotide sequence according to one of claims 23 to 25 for transforming a microorganism according to one of claims 14 to 21.

29. A microorganism according to any one of claims 14 to 21 containing at least one gene structure according to claim 26.

30. Microorganism according to one of claims 14 to 21 containing at least one vector according to claim 27.