EP1549744A1 - Method and microorganism for the production of d-mannitol - Google Patents

Method and microorganism for the production of d-mannitol

Info

Publication number
EP1549744A1
EP1549744A1 EP03757939A EP03757939A EP1549744A1 EP 1549744 A1 EP1549744 A1 EP 1549744A1 EP 03757939 A EP03757939 A EP 03757939A EP 03757939 A EP03757939 A EP 03757939A EP 1549744 A1 EP1549744 A1 EP 1549744A1
Authority
EP
European Patent Office
Prior art keywords
sequence
microorganism
mannitol
mdh
coding
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP03757939A
Other languages
German (de)
French (fr)
Inventor
Hermann Sahm
Björn KAUP
Stephanie Bringer-Meyer
Claudia Hemmerling
Martin Walter
Dieter Wullbrandt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
INNOSWEET GMBH
Nordzucker InnoCenter GmbH
Forschungszentrum Juelich GmbH
Original Assignee
Nordzucker InnoCenter GmbH
Forschungszentrum Juelich GmbH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to DE10247147 priority Critical
Priority to DE10247147A priority patent/DE10247147A1/en
Application filed by Nordzucker InnoCenter GmbH, Forschungszentrum Juelich GmbH filed Critical Nordzucker InnoCenter GmbH
Priority to PCT/EP2003/011191 priority patent/WO2004033676A1/en
Publication of EP1549744A1 publication Critical patent/EP1549744A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004Oxidoreductases (1.)
    • C12N9/0006Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12PFERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00Preparation of oxygen-containing organic compounds
    • C12P7/02Preparation of oxygen-containing organic compounds containing a hydroxy group
    • C12P7/04Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic
    • C12P7/18Preparation of oxygen-containing organic compounds containing a hydroxy group acyclic polyhydric

Abstract

The invention relates to a method and an organism for the production of D-mannitol. The production of D-mannitol can be improved by providing said method and microorganism, using an organism expressing mannitol-2-dehydrogenase (MDH) and formate-dehydrogenase (FDH, for co-factor regeneration). The sugar substrates and/or sugar substrate precursors of MDH are transported via a non-phosphorylating sugar transport system into the organism. The sugar transport system is, advantageously, a glucose facilitator (GLF) from Zymomonas mobilis.

Description

B e s c h r e i b u n g Description
Verfahren sowie Mikroorganismus zur Herstellung von D-MannitolProcess and microorganism for the production of D-mannitol
Die Erfindung betrifft ein Verfahren sowie einen Mikroorganismus zur Herstellung von D-Mannitol.The invention relates to a method and a microorganism for the production of D-mannitol.
Der weltweite Jahresbedarf am Zuckeralkohol D-Mannitol (D-Mannit) beläuft sich auf 30.000 Tonnen im Jahr. D-Mannitol findet Verwendung im Lebensmittelbereich als zahnschonender Süßstoff, in der Medizin als Plasmaexpander und Va- sodilator (Hexanitroderivat), sowie in der pharmazeutischen Industrie zur Produktion von Tabletten.The worldwide annual demand for the sugar alcohol D-mannitol (D-mannitol) amounts to 30,000 tons per year. D-mannitol is used in the food sector as a tooth-preserving sweetener, in medicine as a plasma expander and vasodilator (hexanitro derivative), and in the pharmaceutical industry for the production of tablets.
Die großtechnische Produktion von D-Mannitol erfolgt bisher über die katalyti- sche Hydrierung an Metallkatalysatoren von Glucose/Fructose-Gemischen als Ausgangsmaterialien. Aufgrund der fehlenden Stereospezifität der katalytischen Hydrierung beträgt die Ausbeute an D-Mannitol nur 25-30% mit einem dreifachen Überschuß an D-Sorbitol (Makkee M, Kieboom APG, Van Bekkum H (1985), Production methods of D-mannitol. Starch/Stärke 37: 136-140).The large-scale production of D-mannitol has hitherto been carried out by catalytic hydrogenation on metal catalysts of glucose / fructose mixtures as starting materials. Due to the lack of stereospecificity of the catalytic hydrogenation, the yield of D-mannitol is only 25-30% with a triple excess of D-sorbitol (Makkee M, Kieboom APG, Van Bekkum H (1985), Production methods of D-mannitol. Starch / Thickness 37: 136-140).
D-Mannitol und D-Sorbitol unterscheiden sich nur durch ihre Konfiguration am Kohlenstoffatom C-2 (Stereoisomere), so dass eine Abtrennung des unerwünsch- ten Sorbitols mit Schwierigkeiten verbunden und aufwändig ist.D-mannitol and D-sorbitol differ only in their configuration at the carbon atom C-2 (stereoisomers), so that a separation of the unwanted sorbitol is difficult and time-consuming.
Eine Alternative bietet die Herstellung von D-Mannitol durch enzymatische Hydrierung von D-Fructose in einem mikrobiellen Biotransformationsverfahren, bei dem eine rekombinante Mannitol-Dehydrogenase (MDH) aus Pseudomonas fluo- rescens isoliert wird und zusammen mit einer Formiat-Dehydrogenase (FDH) ausAn alternative is the production of D-mannitol by enzymatic hydrogenation of D-fructose in a microbial biotransformation process in which a recombinant mannitol dehydrogenase (MDH) is isolated from Pseudomonas fluororescens and together with a formate dehydrogenase (FDH)
Candida boidinü und NADH in einem Membranreaktor inkubiert wird (Slatner, M. et al. (1998) Biotransf. 16: 351-363). Durch den Einsatz der Formiat- Dehydrogenase wird ein Reduktions-Oxidationszyklus für NADH geschaffen, welches durch die Membran im Reaktionsgefäß zurückgehalten wird. Dadurch konnten lediglich 70-90% der Fructose in D-Mannitol umgewandelt werden. Ferner besitzt die eingesetzte Mannitol-Dehydrogenase eine mangelnde Stabilität (50 h Halbwertszeit; nach Stabilisierung mit Dithiothreitol: 100h), Empfindlichkeit gegenüber hohen Temperaturen >30°C sowie gegenüber Scherkräften. Ein weiterer großer Nachteil liegt darin, dass Membranreaktoren auf Grund der hohen Kosten für isolierte Enzyme, benötigte Cofaktoren und Membranen für eine großtechnische Produktion ungeeignet sind.Candida boidinü and NADH is incubated in a membrane reactor (Slatner, M. et al. (1998) Biotransf. 16: 351-363). The use of formate dehydrogenase creates a reduction-oxidation cycle for NADH, which is retained by the membrane in the reaction vessel. As a result, only 70-90% of the fructose could be converted into D-mannitol. Furthermore, the mannitol dehydrogenase used has a poor stability (50 h half-life; after stabilization with dithiothreitol: 100 h), sensitivity against high temperatures> 30 ° C and against shear forces. Another major disadvantage is that membrane reactors are unsuitable for large-scale production due to the high cost of isolated enzymes, required cofactors and membranes.
Eine weitere Möglichkeit der D-Mannitol Produktion bietet ein fermentatives Verfahren, wobei Ausbeuten von ca. 85% unter Einsatz von D-Fructose/D-Glucose- Gemischen als Substrate und dem heterofermentativen Milchsäurebakterium Leuconostoc mesenteroides ATCC 12291 als katalysierenden Organismus in einer Fermentation mit wachsenden Zellen erhalten wurden (Soetaert (1991) Synthesis of D-mannitol and L-sorbose by microbial hydrogenation and dehydro- genation of monosaccharides. PhD Thesis, University of Gent)). Das Gen der MDH aus Leuconostoc pseudomesenteroides und dessen Charakterisierung ist ebenfalls bekannt (J. Aarnikunnas et. al., Applied Microbiology and Biotechnolo- gy, 13. Juli 2002). Die hierbei für die Reduktion von Fructose zu D-Mannitol notwendigen Reduktionsäquivalente stammen aus der Oxidation von Glucose zu organischen Säuren. Neben dem Problem der nur 85%igen Umsetzung des Substrates Fructose zu D-Mannitol ist der Einsatz von D-Glucose nachteilig, da eine Kontamination des Zielproduktes mit organischen Säuren während der Fermen- tation auftritt und diese organischen Säuren durch aufwendige Prozeßschritte entfernt werden müssen. Bei Fermentationen mit wachsenden Zellen kann keine 100%ige Umsetzung des Substrates zum Produkt erzielt werden, da ein Teil des Substrates zum Zellaufbau bzw. zur Neubildung von Biomasse verbraucht wird. Zudem ist die Fermentation von Leuconostoc mesenteroides schwierig (Schleim- bildung) und teuer aufgrund der komplexen Medien und die Aufarbeitung des Überstandes daher ebenfalls aufwändig.A further possibility of D-mannitol production is offered by a fermentative process, where yields of approx. 85% using D-fructose / D-glucose mixtures as substrates and the heterofermentative lactic acid bacterium Leuconostoc mesenteroides ATCC 12291 as a catalyzing organism in a fermentation with growing Cells were obtained (Soetaert (1991) Synthesis of D-mannitol and L-sorbose by microbial hydrogenation and dehydrogenation of monosaccharides. PhD Thesis, University of Gent)). The gene of the MDH from Leuconostoc pseudomesenteroides and its characterization is also known (J. Aarnikunnas et. Al., Applied Microbiology and Biotechnology, July 13, 2002). The reduction equivalents required for the reduction of fructose to D-mannitol come from the oxidation of glucose to organic acids. In addition to the problem of only 85% conversion of the substrate fructose to D-mannitol, the use of D-glucose is disadvantageous since contamination of the target product with organic acids occurs during fermentation and these organic acids have to be removed by complex process steps. In fermentations with growing cells, a 100% conversion of the substrate to the product cannot be achieved, since part of the substrate is used for cell construction or for the new formation of biomass. In addition, the fermentation of Leuconostoc mesenteroides is difficult (slime formation) and expensive due to the complex media and the processing of the supernatant is therefore also complex.
Aus der Literatur sind drei weitere Mannitol-2-Dehydrogenasen bekannt und auch hinsichtlich ihrer biochemischen Eigenschaften und Nukleotid- /Aminosäuresequenzen beschrieben. Hierzu gehört die Mannitol-¬Three further mannitol-2-dehydrogenases are known from the literature and are also described with regard to their biochemical properties and nucleotide / amino acid sequences. This includes the mannitol ¬
Dehydrogenase aus Pseudomonas fluorescens DSM 50106 (Brünker P, Altenbuchner J, Mattes R (1998) Structure and function of the genes involved in mannitol, arabitol and glucitol utilization from Pseudomonas fluorescens DSM 50106. Gene 206: 117-126.), aus Rhodobacter sphaeroides Si4 (Schneider KH, Giffhorn F, Kaplan S (1993) Cloning, nucleotide sequence and characterization of the mannitol dehydrogenase gene from Rhodobacter sphaeroides. J. Gen. Microbiology 139: 2475-2484) sowie aus Agaricus bisporus (Stoop JM, Mooibroeck H (1998) Cloning and characterization of NADP-mannitol dehydrogenase cDNA from the button mushroom Agaricus bisporus, and its expression in response to NaCI stress. Appl. Environ. Microbiol. 64: 4689 - 4696.). Die beiden Erstgenannten gehören zur Gruppe der langkettigen De- hydrogenase/Reduktase Protein Familie (LDR), die letztgenannte zur Gruppe der kurzkettigen Dehydrogenase/Reduktase Protein Familie (SDR).Dehydrogenase from Pseudomonas fluorescens DSM 50106 (Brünker P, Altenbuchner J, Mattes R (1998) Structure and function of the genes involved in mannitol, arabitol and glucitol utilization from Pseudomonas fluorescens DSM 50106. Gene 206: 117-126.), From Rhodobacter sphaeroides Si4 (Schneider KH, Giffhorn F, Kaplan S (1993) Cloning, nucleotide sequence and characterization of the mannitol dehydrogenase gene from Rhodobacter sphaeroides. J. Gen. Microbiology 139: 2475-2484) and from Agaricus bisporus (Stoop JM, Mooibroeck H (1998) Cloning and characterization of NADP-mannitol dehydrogenase cDNA from the button mushroom Agaricus bisporus, and its expression in response to NaCI stress. Appl. Environments. Microbiol 64: 4689-4696.). The first two belong to the group of the long-chain dehydrogenase / reductase protein family (LDR), the latter to the group of the short-chain dehydrogenase / reductase protein family (SDR).
Es ist daher Aufgabe der Erfindung, ein verbessertes Verfahren zur Herstellung von D-Mannitol bereitzustellen, das die beschriebenen Nachteile des Standes der Technik vermeidet.It is therefore an object of the invention to provide an improved process for the preparation of D-mannitol which avoids the disadvantages of the prior art described.
Die Aufgabe wird durch ein Verfahren zur Produktion von D-Mannitol mittels ei- nes Mannitol-2-Dehydrogenase (MDH) exprimierenden Organismus, wobei die Zucker-Substrate und/oder Zucker-Substratvorläufer der MDH über ein nicht- phosphorylierendes Zucker-Transportsystem in den Organismus transportiert werden, gelöst.The object is achieved by a process for the production of D-mannitol by means of an organism expressing mannitol-2-dehydrogenase (MDH), the sugar substrates and / or sugar substrate precursors of the MDH being transported via a non-phosphorylating sugar transport system Organism are transported, solved.
Durch das erfindungsgemäße Verfahren wird erreicht, dass der mit der MDH um- zusetzende Zucker ohne eine vorherige Phosphorylierung direkt durch die MDH zu D-Mannitol umgesetzt werden kann. Durch diese direkte Umsetzung werden überraschenderweise gegenüber dem bisherigen Stand der Technik verbesserte Ausbeuten und Konzentrationen des D-Mannitol im Reaktionsüberstand ermöglicht. Teilweise werden mit dem erfindungsgemäßen Verfahren schon Ausbeuten von bis 100 % bezogen auf das Substrat (Glukose) erhalten. Ferner werden Konzentrationen bis zu 40 g/L mit dem erfindungsgemäßen Verfahren erzielt.It is achieved by the method according to the invention that the sugar to be reacted with the MDH can be converted directly to D-mannitol by the MDH without prior phosphorylation. This direct implementation surprisingly enables improved yields and concentrations of the D-mannitol in the reaction supernatant compared to the prior art. In some cases, yields of up to 100% based on the substrate (glucose) are obtained with the process according to the invention. Furthermore, concentrations of up to 40 g / L are achieved with the method according to the invention.
Unter Organismus werden sowohl ein - als auch mehrzellige Organismen, insbesondere Mikroorganismen verstanden.Organism means both unicellular and multicellular organisms, in particular microorganisms.
Ferner wird die Aufgabe durch einen Mikroorganismus gelöst, der die Enzyme MDH gemäß Sequenz Nr. 2 und FDH gemäß Sequenz Nr. 3 zur mikrobiellen Herstellung von D-Mannitol exprimiert und ein nicht-phosphorylierendes Zucker- Transportsystem aufweist, das die Zucker-Substrate und/oder Zucker- Substratvorläufer der MDH in den Mikroorganismus transportiert.The object is also achieved by a microorganism which expresses the enzymes MDH according to sequence No. 2 and FDH according to sequence No. 3 for the microbial production of D-mannitol and a non-phosphorylating sugar. Has transport system that transports the sugar substrates and / or sugar substrate precursors of the MDH into the microorganism.
Unter der Bezeichnung D-Mannitol soll nachfolgend auch D-Mannit verstanden werden.The term D-mannitol is also to be understood below as D-mannitol.
Im Rahmen dieser Erfindung werden alle Nukleotidsequenzen, die für eine Mannitol-Dehydrogenase codieren unter der Bezeichnung "mαft-Gensequenz" zusammengefasst. Das Enzym Mannitol-2-Dehydrogenase wird im Folgenden unter der Bezeichnung „MDH" zusammengefasst.In the context of this invention, all nucleotide sequences which code for a mannitol dehydrogenase are combined under the name "mαft gene sequence". The enzyme mannitol-2-dehydrogenase is summarized below under the name "MDH".
Entsprechend werden alle Nukleotidsequenzen, die für eine Formiat- Dehydrogenase codieren unter der Bezeichnung "fcf j-Gensequenz" zusammengefasst. Das Enzym Formiat-Dehydrogenase wird im Folgenden unter der Bezeichnung „FDH" zusammengefasst.Accordingly, all nucleotide sequences that code for a formate dehydrogenase are summarized under the name "fcf j gene sequence". The enzyme formate dehydrogenase is summarized below under the name "FDH".
Auch werden alle Nukleotidsequenzen, die für einen Glukosefacilitator codieren unter der Bezeichnung "g/f-Gensequenz" zusammengefasst. Das Protein Glukosefacilitator wird im Folgenden unter der Bezeichnung „GLF" zusammengefasst.All nucleotide sequences which code for a glucose facilitator are also combined under the name "g / f gene sequence". The protein glucose facilitator is summarized below under the name "GLF".
Ferner werden unter Nukleotidsequenz alle Nukleotidsequenzen verstanden, die (i) exakt den dargestellten Sequenzen entsprechen; oder (ii) mindestens eine Nukleotidsequenz umfaßen, die innerhalb des Bereichs der Degeneration des genetischen Codes den dargestellten Sequenzen entspricht; oder (iii) mindestens eine Nukleotidsequenz umfasst, die mit einer zur Nukleotidsequenz (i) oder (ii) komplemetären Nukleotidsequenz hybridisiert, und gegebenenfalls (iiii) funktionsneutrale Sinnmutationen in (i) umfasst. Dabei bedeutet der Begriff funktionsneutrale Sinnmutationen den Austausch chemisch ähnlicher Aminosäuren, wie z. B. Glycin durch Alanin oder Serin durch Threonin.Furthermore, nucleotide sequence is understood to mean all nucleotide sequences which (i) correspond exactly to the sequences shown; or (ii) comprise at least one nucleotide sequence that corresponds to the sequences shown within the range of degeneration of the genetic code; or (iii) comprises at least one nucleotide sequence which hybridizes with a nucleotide sequence which is complementary to the nucleotide sequence (i) or (ii), and optionally comprises (iiii) functionally neutral sense mutations in (i). The term function-neutral meaning mutations means the exchange of chemically similar amino acids, such as. B. glycine by alanine or serine by threonine.
Erfindungsgemäß sind auch die den kodierenden Bereichen (Strukturgenen) vorausgehenden (5'-oder upstream) und/oder nachfolgenden (3"-oder downstream) Sequenzbereiche eingeschlossen. Insbesondere sind hierin Sequenzbereiche mit regulatorischer Funktion inbegriffen. Sie können die Transkription, die RNA-According to the invention, the (5 'or upstream) and / or subsequent (3 "or downstream) sequence regions preceding the coding regions (structural genes) are also included. In particular, sequence regions with a regulatory function are included here. They can be used for transcription, RNA
Stabilität oder das RNA Processing sowie die Translation beeinflussen. Beispiele für regulatorische Sequenzen sind u. a. Promotoren, Enhancer, Operatoren, Te- minatoren oder Translationsverstärker.Stability or affect RNA processing and translation. Examples regulatory sequences include promoters, enhancers, operators, terminators or translation enhancers.
Unter die jeweiligen Enzyme fallen auch Isoformen, die als Enzyme mit gleicher oder vergleichbarer Substrat- und Wirkungsspezifität verstanden werden, die jedoch eine unterschiedliche Primärstruktur aufweisen.The respective enzymes also include isoforms which are understood as enzymes with the same or comparable substrate and activity specificity, but which have a different primary structure.
Unter modifizierten Formen sind erfindungsgemäß Enzyme zu verstehen, bei denen Änderungen in der Sequenz, beispielsweise am N- und/oder C-Teminus des Polypeptids oder im Bereich konservierter Aminosäuren vorliegen, ohne jedoch die Funktion des Enzyms zu beeinträchtigen. Diese Veränderungen können in Form von Aminosäureaustauschen nach bekannten Methoden vorgenommen werden.According to the invention, modified forms are understood to mean enzymes in which there are changes in the sequence, for example at the N and / or C terminus of the polypeptide or in the region of conserved amino acids, but without impairing the function of the enzyme. These changes can be made in the form of amino acid exchanges using known methods.
Vorteilhafterweise handelt es sich bei dem Zucker-Transportsystem um den Glu- kosefacilitator (GLF) gemäß Nukleotidsequenz Nr. 1 , der bevorzugterweise aus einem Eukaryonten z. B. einer Hefe stammt. Bevorzugterweise kann auch der GLF aus Zymomonas mobilis eingesetzt werden, der von T. Conway et al (Journal of Bacteriology, Dec. 1990, p. 7227 - 7240) kloniert wurde.Advantageously, the sugar transport system is the glucose facilitator (GLF) according to nucleotide sequence no. 1, which preferably consists of a eukaryote e.g. B. comes from a yeast. The GLF from Zymomonas mobilis, which was cloned by T. Conway et al (Journal of Bacteriology, Dec. 1990, p. 7227-7240), can also preferably be used.
Aus der Deutschen Patentanmeldung 198 18 541.3 ist zwar ein Verfahren zur Herstellung von Substanzen aus dem aromatischen Stoffwechsel bekannt, bei dem ein Mikroorganismus eingesetzt wird, der eine erhöhte Aktivität eines Gluko- se-oxidierenden Enzyms aufweist und Glukose oder Glukose-haltige Substrate durch Oxidation zu Glukonolakton oder Glukonat sowie durch Phosphorylierung des Glukonats zu 6-Phosphoglukonat umgesetzt, wobei neben der Erhöhung der Enzymaktivität der Oxidase und / oder der Phosphatase zur Erhöhung der vorhandenen Menge PEP die Aktivität eines PEP-unabhängigen Glukose- Transportproteins erhöht werden, bei dem es sich um den Glukosefacilitator (GLF) aus Zymomonas mobilis handeln kann. Ein Verfahren zur Herstellung von Mannitol ist allerdings daraus nicht zu entnehmen.From German patent application 198 18 541.3, a method for producing substances from the aromatic metabolism is known, in which a microorganism is used which has an increased activity of a glucose-oxidizing enzyme and which oxidizes glucose or glucose-containing substrates Gluconolakton or gluconate and converted by phosphorylation of the gluconate to 6-phosphogluconate, whereby in addition to increasing the enzyme activity of the oxidase and / or the phosphatase to increase the amount of PEP present, the activity of a PEP-independent glucose transport protein is increased, which is can trade the Zymomonas mobilis glucose facilitator (GLF). However, a process for the production of mannitol cannot be inferred from this.
Der GLF kann neben Fructose auch Glukose oder Xylose transportieren, wovon insbesondere Glukose als preiswerter Fructose-Vorläufer interessant ist. Die Glukose kann, wie noch beschrieben werden wird, in Fructose umgewandelt werden.In addition to fructose, the GLF can also transport glucose or xylose, of which glucose is particularly interesting as an inexpensive fructose precursor. The Glucose, as will be described, can be converted to fructose.
Die für MDH codierende Sequenz aus Mikroorganismen der Familie der Lacto- bacteriaceae, insbesondere Leuconostoc pseudomesenteroides eignet sich be- sonders für die Umsetzung zu D-Mannitol aufgrund der hohen Aktivität und Stabilität der daraus synthetisierten MDH.The sequence coding for MDH from microorganisms of the Lactobacteriaceae family, in particular Leuconostoc pseudomesenteroides, is particularly suitable for conversion to D-mannitol due to the high activity and stability of the MDH synthesized therefrom.
Bevorzugt exprimiert der Organismus die Sequenz Nr. 2 codierend für MDH.The organism preferably expresses sequence No. 2 coding for MDH.
Als Organismus eignen sich besonders Mikroorganismen aus der Gattung Bacil- lus, Pseudomonas, Lactobacillus, Leuconostoc, den Enterobakteriaceae oder methylotrophen Hefen und Pilzen. Weiterhin können auch alle in der Lebensmittelindustrie verwendeten Mikroorganismen eingesetzt werden.Microorganisms from the genus Bacillus, Pseudomonas, Lactobacillus, Leuconostoc, Enterobacteriaceae or methylotrophic yeasts and fungi are particularly suitable as organisms. Furthermore, all microorganisms used in the food industry can also be used.
Besonders bevorzugt stammt der eingesetze Organismus aus der Gruppe Ach- romobacter parvolus, Methylobacterium organophilum, Mycobacterium formicum, Pseudomonas spec. 101, Pseudomonas oxalaticus, Moraxella sp., Agrobacteri- um sp., Paracoccus sp., Ancylobacter aquaticus, Maxcobacterium vaccae, Pseudomonas fluorescens, Rhodobacter sphaeroides, Rhodobacter capsulatus, Lactobacillus sp., Lactobacillus brevis, Leuconostoc pseudomesenteroides, Gluco- nobacter oxydans, Candida boidinii, Candida methylica oder auch Hansenula polymorpha, Aspergillus nidulans oder Neurospora crassa oder insbesondere Escherichia coli oder Bacillus subtilis.The organism used particularly preferably comes from the group Achromobacter parvolus, Methylobacterium organophilum, Mycobacterium formicum, Pseudomonas spec. 101, Pseudomonas oxalaticus, Moraxella sp., Agrobacterium sp., Paracoccus sp., Ancylobacter aquaticus, Maxcobacterium vaccae, Pseudomonas fluorescens, Rhodobacter sphaeroides, Rhodobacter capsulatus, Lactobacillus sp., Lactobacillus brevis, Glucentomoxides, Leuconostoc boidinii, Candida methylica or also Hansenula polymorpha, Aspergillus nidulans or Neurospora crassa or in particular Escherichia coli or Bacillus subtilis.
Die Analyse der D-Mannitol-Konzentration kann enzymatisch / photometrisch nach der Methode von K. Horikoshi (Horikoshi K. (1963) Meth. Enzym. Analysis, 3rd ed. Vol.6. H. U. Bergmeyer, Hrsg., Verlag Chemie, Weinheim), oder durch Hochdruck-Flüssigkeits-Chromatographie (HPLC) erfolgen, so wie bei Lindroth et al. (Lindroth et al. (1979) Analytical Chemistry 51 : 1167-1174) beschrieben.The analysis of the D-mannitol concentration can be carried out enzymatically / photometrically using the method of K. Horikoshi (Horikoshi K. (1963) Meth. Enzym. Analysis, 3rd ed. Vol. 6. HU Bergmeyer, ed., Verlag Chemie, Weinheim) , or by high pressure liquid chromatography (HPLC), as in Lindroth et al. (Lindroth et al. (1979) Analytical Chemistry 51: 1167-1174).
Zur Etablierung eines Oxidations-Reduktionszyklus kann eine Formiat- Dehydrogenase (FDH) codierende Sequenz eingesetzt werden. Vorzugsweise stammt diese aus Mycobacterium vaccae und besitzt eine Nukleotidsequenz gemäß Sequenz Nr. 3. Diese ist für sich gesehen aus K. Soda et al, Appl. Microbiol. Biotechnol (1995) 44, 479-483 bekannt. Hierdurch wird eine erhebliche Steigerung der Ausbeute bzw. der Umsatzrate des Substrates Fructose zu Mannitol durch Schaffung eines Cofaktor- Regenerationssystems ermöglicht. Dabei wird nicht mehr das Substrat für die Bereitstellung der für die Reduktion von Fructose zu Mannitol notwendigen Re- duktionsäquivalente verbraucht, sondern durch ein zweites Enzymsystem bereitgestellt. Folglich steht das Coenzym NADH in erhöhtem Maße für die Umsetzung zu Mannitol zur Verfügung. Eines der am häufigsten eingesetzten Systeme ist die Regenerierung mit einer Formiat-Dehydrogenase, z. B. aus Mycobacterium vaccae. Durch den Einsatz dieses Enzyms zusammen mit einer beliebigen MDH, bevorzugt aus Leuconostoc pseudomesenteroides, wird ein Oxidations- Reduktionszyklus geschaffen, in dem Formiat als Elektronendonator und D- Fructose als Elektronenakzeptor fungiert. Dabei katalysiert das Enzym Formiat- Dehydrogenase die Oxidation von Formiat zu CO2 und das Enzym MDH die Reduktion von D-Fructose zu D-Mannitol (s. Fig. 1). Der intrazelluläre Nicotinsäu- reamid-Adenin-Dinucleotid (NAD)-Pool dient als Elektronen-Shuttle zwischen beiden Enzymen. Die Oxidation von Formiat zu CO2 ist thermodynamisch günstig, da die freie Standardbildungsenergie ΔG0, für CO2 deutlich negativ ist und das CO2 durch Ausgasen aus dem Reaktionsgleichgewicht entfernt wird. Die erhöhte intrazelluläre NADH-Konzentration, resultierend u. a. aus der Formiatoxida- tion, steigert die Reduktionskraft für die Reduktion von D-Fructose zu D-Mannitol, katalysiert durch MDH.A sequence coding for formate dehydrogenase (FDH) can be used to establish an oxidation-reduction cycle. This preferably comes from Mycobacterium vaccae and has a nucleotide sequence according to sequence no. 3. This is seen in isolation from K. Soda et al, Appl. Microbiol. Biotechnol (1995) 44, 479-483. This enables a considerable increase in the yield or the conversion rate of the fructose to mannitol substrate by creating a cofactor regeneration system. The substrate for the provision of the reduction equivalents necessary for the reduction of fructose to mannitol is no longer used, but is provided by a second enzyme system. As a result, the coenzyme NADH is increasingly available for the conversion to mannitol. One of the most commonly used systems is regeneration with a formate dehydrogenase, e.g. B. from Mycobacterium vaccae. The use of this enzyme together with any MDH, preferably from Leuconostoc pseudomesenteroides, creates an oxidation-reduction cycle in which formate acts as an electron donor and D-fructose acts as an electron acceptor. The enzyme formate dehydrogenase catalyzes the oxidation of formate to CO 2 and the enzyme MDH the reduction of D-fructose to D-mannitol (see FIG. 1). The intracellular nicotinic acid amide adenine dinucleotide (NAD) pool serves as an electron shuttle between the two enzymes. The oxidation of formate to CO 2 is thermodynamically favorable, since the free standard formation energy ΔG 0 is clearly negative for CO 2 and the CO 2 is removed from the reaction equilibrium by outgassing. The increased intracellular NADH concentration, resulting, among other things, from formate oxidation, increases the reducing power for the reduction of D-fructose to D-mannitol, catalyzed by MDH.
In einer weiteren vorteilhaften Ausgestaltung des Verfahrens wird neben den bereits genannten Kohlenstoffquellen als Substrat für die Herstellung D-Glucose eingesetzt. D-Glucose kann durch Umwandlung mit dem Enzym D- Glucose/Xylose-Isomerase (EC 5.3.1.5) zu D-Fructose umgewandelt werden (2). Die Umwandlung ist sowohl innerhalb als auch außerhalb des Organismus möglich. Der Einsatz von D-Glucose als Substrat in einem Verfahren zur Produktion von D-Mannitol bewirkt eine deutliche Verbesserung der Wirtschaftlichkeit des Verfahrens. Für das beschπebene Verfahren eignen sich nicht nur Mikroorganismen, in die eine Formiat-Dehydrogenase und eine MDH eingebracht und/oder verstärkt wird, sondern auch Mikroorganismen, die bereits über eine Formiat-Dehydrogenase oder gegebenenfalls eine MDH verfügen, wie z. B. Achromobacter parvolus, Me- thylobacterium organophilum, Mycobacterium formicum, Pseudomonas spec. 101, Pseudomonas oxalaticus, Moraxella sp., Agrobacterium sp., Paracoccus sp., Ancylobacter aquaticus. Dazu gehören Mikroorganismen wie z.B. Pseudomonas fluorescens, Rhodobacter sphaeroides, Rhodobacter capsulatus, Lactobacillus sp., Lactobacillus brevis, Gluconobacter oxydans sowie bevorzugt auch Leuconostoc pseudomesenteroides oder Mikroorganismen, die bereits über bei- de Enzyme verfügen und jeweils in ihrer Aktivität verstärkt werden. Weiterhin geeignet sind beispielsweise auch methylotrophe Hefen wie Candida boidinii, Candida methylica oder auch Hansenula polymorpha, Pilze wie Aspergillus nidu- lans und Neurospora crassa sowie alle auch in der Lebensmittelindustrie verwendeten Mikroorganismen.In a further advantageous embodiment of the method, D-glucose is used in addition to the carbon sources already mentioned as a substrate for the production. D-glucose can be converted to D-fructose by conversion with the enzyme D-glucose / xylose isomerase (EC 5.3.1.5) (2). The transformation is possible both inside and outside the organism. The use of D-glucose as a substrate in a process for the production of D-mannitol brings about a significant improvement in the economy of the process. Not only are microorganisms suitable for the described method, into which a formate dehydrogenase and an MDH are introduced and / or strengthened, but also microorganisms which already have a formate dehydrogenase or, if appropriate, an MDH, such as, for. B. Achromobacter parvolus, Methylobacterium organophilum, Mycobacterium formicum, Pseudomonas spec. 101, Pseudomonas oxalaticus, Moraxella sp., Agrobacterium sp., Paracoccus sp., Ancylobacter aquaticus. These include microorganisms such as Pseudomonas fluorescens, Rhodobacter sphaeroides, Rhodobacter capsulatus, Lactobacillus sp., Lactobacillus brevis, Gluconobacter oxydans and preferably also Leuconostoc pseudomesenteroides or microorganisms that already have both enzymes and are each enhanced in their activity. Also suitable are, for example, methylotrophic yeasts such as Candida boidinii, Candida methylica or also Hansenula polymorpha, fungi such as Aspergillus nidulans and Neurospora crassa and all microorganisms also used in the food industry.
Mit dem erfindungsgemäßen Verfahren und dem Mikroorganismus ist es nunmehr möglich, eine verbesserte Umsetzung des Substrates in das Produkt D- Mannitol zu erreichen. Es wird gegenüber bisher bekannten Verfahren eine erhöhte Produktivität, sowie eine erhöhte Ausbeute (bis zu 100 %) an D-Mannitol erreicht. Es wurden schon Konzentrationen bis zu 40 g/L erzielt. Das Verfahren ist daher für eine großtechnisch rentable Herstellung von D-Mannitol besonders geeignet. Durch die Schaffung des Regenerationssystems mit Hilfe der Formiat- Dehydrogenase kann für die NADH verbrauchende MDH in erhöhtem Maße ohne eine nachteilige Bildung von stoffwechselbedingten Nebenprodukten mit ruhen- den Zellen eine erhöhte Umsetzung des Substrates in das Produkt D-Mannitol ermöglicht werden.With the method according to the invention and the microorganism, it is now possible to achieve an improved conversion of the substrate into the product D-mannitol. Compared to previously known processes, increased productivity and an increased yield (up to 100%) of D-mannitol are achieved. Concentrations of up to 40 g / L have already been achieved. The process is therefore particularly suitable for the large-scale production of D-mannitol. By creating the regeneration system with the help of formate dehydrogenase, an increased conversion of the substrate into the product D-mannitol can be made possible for NADH-consuming MDH to an increased extent without a disadvantageous formation of metabolic-related by-products with resting cells.
Unter die Erfindung fallen auch die Verwendung von Nukleotidsequenzen gemäß Sequenzen Nr. 1 , 2 und 3 codierend für GLF, MDH und FDH zur Verwendung in einem der oben beschriebenen Mikroorganismen.The invention also includes the use of nucleotide sequences according to sequences Nos. 1, 2 and 3 coding for GLF, MDH and FDH for use in one of the microorganisms described above.
Ebenso umfasst die Erfindung eine Genstruktur enthaltend mindestens eine oder mehrere der obigen Nukleotidsequenzen.The invention also includes a gene structure containing at least one or more of the above nucleotide sequences.
Ein Vektor enthaltend mindestens eine oder mehrere der obigen Nukleotidsequenzen oder eine oder mehrere der vorgenannten Genstrukturen ist ebenfalls in der Erfindung enthalten.A vector containing at least one or more of the above nucleotide sequences or one or more of the aforementioned gene structures is also included in the invention.
Die Erfindung umfasst auch die Verwendung der vorgenannten Nukleotidsequenzen, Genstrukturen und Vektoren in den beschriebenen Mikroorganismen bzw. Mikroorganismen, die diese Nukleotidsequenzen, Genstrukturen und Vektoren enthalten.The invention also includes the use of the aforementioned nucleotide sequences, gene structures and vectors in the microorganisms described or microorganisms that contain these nucleotide sequences, gene structures and vectors.
Die Zeichnungen zeigen beispielhaft Ergebnisse des erfindungsgemäßen Verfah- rens sowie eine schematische Darstellung der wichtigsten Stoffwechselwege, die für das Verfahren eine Rolle spielen. Es zeigt:The drawings show examples of results of the method according to the invention and a schematic representation of the most important metabolic pathways that play a role in the method. It shows:
Fig. 1 : Oxidoreduktionszyklus mit Formiat-Dehydrogenase und MDH schematisch in einer Zelle. Fig. 2: Ableitung einer degenerierten 24 Basen-Oligonukleotid-Sonde von der N-terminalen Aminosäuresequenz der MDH Untereinheit von Leuconostoc pseudomesenteroides ATCC 12291.Fig. 1: Oxidoreduction cycle with formate dehydrogenase and MDH schematically in a cell. Fig. 2: Derivation of a degenerate 24 base oligonucleotide probe from the N-terminal amino acid sequence of the MDH subunit from Leuconostoc pseudomesenteroides ATCC 12291.
Fig. 3: Genkarte des 4,191 bp Eco Rl Fragments isoliert aus der genomischen DNA-Plasmidbank von Leuconostoc pseudomesenteroides ATCC 12291 nach Immuno-Screeening des mdh-Gens. Die Pfeile zeigen die Richtung der Translation des mdh ORF sowie 4 ORFs an.3: gene map of the 4.191 bp Eco Rl fragment isolated from the genomic DNA plasmid library from Leuconostoc pseudomesenteroides ATCC 12291 after immuno-screening of the mdh gene. The arrows indicate the direction of translation of the mdh ORF and 4 ORFs.
Sequenz Nr. 1 zeigt die Nukleotidsequenz codierend für GLF aus Zymomonas mobilis. Sequenz Nr. 2 zeigt die Nukleotidsequenz codierend für MDH aus Leuconostoc pseudomesenteroides.Sequence No. 1 shows the nucleotide sequence coding for GLF from Zymomonas mobilis. Sequence No. 2 shows the nucleotide sequence coding for MDH from Leuconostoc pseudomesenteroides.
Sequenz Nr. 3 zeigt die Nukleotidsequenz codierend für FDH aus Mycobacterium vaccae N10.Sequence No. 3 shows the nucleotide sequence coding for FDH from Mycobacterium vaccae N10.
Im Folgenden soll die Erfindung beispielhaft beschrieben werden. The invention will be described below by way of example.
I) Mannitol-2-Dehydrogenase aus Leuconostoc pseudomesenteroidesI) Mannitol-2-dehydrogenase from Leuconostoc pseudomesenteroides
ATCC 12291: Reinigung und Charakterisierung des Enzyms; Klonie- rung und funktioneile Expression des mdh-Gens in Escherichia coliATCC 12291: purification and characterization of the enzyme; Cloning and functional expression of the mdh gene in Escherichia coli
a) Bakterienstämme und Plasmidea) Bacterial strains and plasmids
Als Quelle für die Isolierung der MDH wurde Leuconostoc pseudomesenteroides ATCC 12291 eingesetzt. E. coli JM 109 (DE 3) (Promega) diente als Wirtsorganismus zur Herstellung einer partiellen Plasmidbank für die Isolierung der geno- mischen DNA aus Leuconostoc pseudomesenteroides ATCC 12291. Ein Teil der Plasmidbank wurde durch Ligation eines 4.0 - 4.5 kb Eco Rl Fragments genomischer DNA aus Leuconostoc pseudomesenteroides ATCC 12291 in pUC18 hergestellt.Leuconostoc pseudomesenteroides ATCC 12291 was used as the source for the isolation of the MDH. E. coli JM 109 (DE 3) (Promega) served as the host organism for the production of a partial plasmid bank for the isolation of the genomic DNA from Leuconostoc pseudomesenteroides ATCC 12291. A part of the plasmid bank was genomically made by ligation of a 4.0 - 4.5 kb Eco Rl fragment DNA prepared from Leuconostoc pseudomesenteroides ATCC 12291 in pUC18.
b) Kultivierungsbedingungenb) Cultivation conditions
Zur Kultivierung von Leuconostoc pseudomesenteroides ATCC 12291 wurde folgendes Kultivierungsmedium verwendet:The following cultivation medium was used to cultivate Leuconostoc pseudomesenteroides ATCC 12291:
Trypton 10 g/l, Hefeextrakt 10 g/l, K2HPO4 10 g/l, D-Fructose 20 g/l, D-Glucose 10 g/l, Vitamin / Mineral-Lösung 10 ml/l, in destilliertem Wasser; pH-Wert auf 7,5 unter Verwendung von Ortho-Phosphorsäure.Trypton 10 g / l, yeast extract 10 g / l, K 2 HPO 4 10 g / l, D-fructose 20 g / l, D-glucose 10 g / l, vitamin / mineral solution 10 ml / l, in distilled water ; pH to 7.5 using orthophosphoric acid.
Zur Subklonierung und Präparation der Plasmidbank der genomischen Leuconostoc DNA, wurde E. coli JM109(DE 3) mit 170 Upm bei 37°C in Luria-Bertani Medium unter Zusatz von Ampicillin (100 μg/ml) oder Carbenicillin (50 μg/ml) kultiviert.For subcloning and preparation of the plasmid library of the genomic Leuconostoc DNA, E. coli JM109 (DE 3) was run at 170 rpm at 37 ° C in Luria-Bertani medium with the addition of ampicillin (100 μg / ml) or carbenicillin (50 μg / ml) cultured.
c) Bestimmung der Aktivität von MDH aus Leuconostoc pseudomesenteroides ATCC 12291c) Determination of the activity of MDH from Leuconostoc pseudomesenteroides ATCC 12291
Die Enzymaktivität wird in der vorliegenden Erfindung photometrisch über die Abnahme der NADH-Konzentration für die Reduktionsreaktion D-Fructose + NADH + H+ -> D-Mannitol + NAD+ bestimmt. Der Ansatz zur Messung der Aktivität der MDH enthielt 200 μM NADH und 200 mM D-Fructose in 100 mM Kaliumphosphat-Puffer bei pH 6,5. Die spezifischen Aktivitäten der Rohextrakte und der partiell gereinigten Enzymisolate werden als Units pro Milligramm Protein (U/mg) angegeben, wobei 1 U als 1 μmol Substratabnahme pro Minute definiert wird.In the present invention, the enzyme activity is measured photometrically via the decrease in the NADH concentration for the reduction reaction D-fructose + NADH + H + -> D-mannitol + NAD + certainly. The approach for measuring the activity of the MDH contained 200 μM NADH and 200 mM D-fructose in 100 mM potassium phosphate buffer at pH 6.5. The specific activities of the crude extracts and the partially purified enzyme isolates are given as units per milligram of protein (U / mg), 1 U being defined as 1 μmol substrate decrease per minute.
d) Bestimmung der Proteinkonzentrationend) determination of protein concentrations
Alle Proteinkonzentrationsbestimmungen wurden nach der Methode von Bradford durchgeführt.All protein concentration determinations were carried out using the Bradford method.
e) Auftrennung von Proteinen mittels Polyacrylamidgelelektrophoresee) separation of proteins by means of polyacrylamide gel electrophoresis
Reinheitsanalysen von Rohextrakten und partiell gereinigten Enzymisolaten, sowie Präparationen vorbereitend auf Western-Blots wurden elektrophoretisch in diskontinuierlichen 12 %igen SDS-Polyacrylamidgelen durchgeführt nach der Methode von Lämmli.Purity analyzes of crude extracts and partially purified enzyme isolates, as well as preparations preparing for Western blots, were carried out electrophoretically in discontinuous 12% SDS polyacrylamide gels according to the Lämmli method.
f) Isolierung der Mannitol-2-Dehydrogenase aus Leuconostoc pseudomesenteroides ATCC 12291f) Isolation of mannitol-2-dehydrogenase from Leuconostoc pseudomesenteroides ATCC 12291
Zur Isolierung der Mannitol-2-Dehydrogenase wurden nach einem Zellaufschluß folgende Verfahrensschritte durchgeführt: Ammoniumsulfat-Präzipitation, Hydrophobe Interaktionschromatographie, Anionentauscherchromatographie I, Anio- nentauscherchromatographie II, Größenausschlusschromatographie, sowie ein Chromato-focusing pH 5 - 4.To isolate mannitol-2-dehydrogenase, the following process steps were carried out after cell disruption: ammonium sulfate precipitation, hydrophobic interaction chromatography, anion exchange chromatography I, anion exchange chromatography II, size exclusion chromatography, and chromato-focusing pH 5 - 4.
Die spezifische Aktivität der MDH betrug bei pH = 5,35 für die Reduktion von D- Fructose zu D-Mannitol 450 U/mgThe specific activity of the MDH was 450 U / mg at pH = 5.35 for the reduction of D-fructose to D-mannitol
g) Molekulargenetische Methodeng) Molecular genetic methods
Die Isolierung von genomischer DNA aus Leuconostoc pseudomesenteroides ATCC 12291, die Isolierung von DNA-Fragmenten aus Agarosegelen, die Mar- kierung von DNA-Sonden mit Digoxigenin modifiziertem dUTP und immunologische Detektion und DNA-DNA-Hybridisierung (Southern Blot) wurden durchgeführt. Die aminoterminale Ansequenzierung der 43 kDa-Enzymuntereinheit mittels Ed- man-Abbau und anschließender HPLC-Analyse ergab die oktamere Aminosäureabfolge MEALVLTG. Unter Verwendung einer Codon usage-Statistik für Leuconostoc pseudomesenteroides, wurde eine 2048fach degenerierte Oligonukleo- tid-Sonde zur Detektion des Mannitol-2-Dehydrogenase-Gens an genomischer DNA von Leuconostoc pseudomesenteroides ATCC 12291 abgeleitet (siehe Fig. 2). Die 24 bp-DNA-Sonde wurde mit einem Digoxigenin-11-dUTP-Schwanz am 3'-Ende versehen und diente zum Immuno-Screening von partiellen Plasmidban- ken genomischer DNA von L. pseudomesenteroides ATCC 12291. Auf diesem Wege wurde ein 4,2 kb-DNA-Fragment isoliert (Fig. 3). Mit geeigneten Primern wurde das mdh-Gen von diesem Fragment amplifiziert, in den Vektor pET24a(+) ligiert und in E. coli BL21(DE3) transformiert und exprimiert. Zellextrakte von E. coli BL21(DE3)pET24a(+)Lmα77 zeigten nach Induktion in der SDS- Polyacrylelektrophorese eine starke Überexpressionsbande bei 43 kDa und eine spezifische Aktivität der Mannitol-2-Dehydrogenase von 70 U/mg Protein, während die Kontrollen (Zellen ohne Plasmid, Zellen mit leerem Plasmid) keine Aktivität zeigten.The isolation of genomic DNA from Leuconostoc pseudomesenteroides ATCC 12291, the isolation of DNA fragments from agarose gels, the labeling of DNA probes with digoxigenin-modified dUTP and immunological detection and DNA-DNA hybridization (Southern blot) were carried out. The amino-terminal sequencing of the 43 kDa enzyme subunit by Edman degradation and subsequent HPLC analysis gave the octameric amino acid sequence MEALVLTG. Using codon usage statistics for Leuconostoc pseudomesenteroides, a 2048-fold degenerate oligonucleotide probe for the detection of the mannitol-2-dehydrogenase gene on genomic DNA was derived from Leuconostoc pseudomesenteroides ATCC 12291 (see FIG. 2). The 24 bp DNA probe was provided with a digoxigenin-11 dUTP tail at the 3 'end and was used for the immunoscreening of partial plasmid banks of genomic DNA from L. pseudomesenteroides ATCC 12291. 2 kb DNA fragment isolated (Fig. 3). The mdh gene from this fragment was amplified with suitable primers, ligated into the vector pET24a (+) and transformed and expressed in E. coli BL21 (DE3). Cell extracts from E. coli BL21 (DE3) pET24a (+) Lmα77 showed a strong overexpression band at 43 kDa and specific activity of mannitol-2-dehydrogenase of 70 U / mg protein after induction in SDS polyacrylic electrophoresis, while the controls (cells without plasmid, cells with empty plasmid) showed no activity.
Die Nukleotidsequenz des mdh-Gens aus L. pseudomesenteroides ATCC 12291 ist in Sequenz Nr. 2 gezeigt.The nucleotide sequence of the mdh gene from L. pseudomesenteroides ATCC 12291 is shown in Sequence No. 2.
II) Biotransformation von D-Fructose zu D-Mannitol mit einem rekombinanten E. coli-StammII) Biotransformation of D-fructose to D-mannitol with a recombinant E. coli strain
In einem rekombinanten E. coli-Stamm wurden die Enzyme Formiat- Dehydrogenase (EC 1.2.1.2) und Mannitol-2-Dehydrogenase (EC 1.1.1.67) übe- rexprimiert, um in den Zellen einen Oxidations-Reduktionszyklus zu etablieren. In diesem Oxidations-Reduktionszyklus wird Wasserstoff von Formiat über zelluläres NAD+ auf D-Fructose übertragen, wobei D-Fructose zu D- Mannitol reduziert wird (s. Fig. 1). Zusätzlich wurde in den Zellen der Glukosefacilitator exprimiert, um die Verfügbarkeit des Substrats Fructose zu verbessern.The enzymes formate dehydrogenase (EC 1.2.1.2) and mannitol 2-dehydrogenase (EC 1.1.1.67) were overexpressed in a recombinant E. coli strain in order to establish an oxidation-reduction cycle in the cells. In this oxidation-reduction cycle, hydrogen is transferred from formate via cellular NAD + to D-fructose, whereby D-fructose is reduced to D-mannitol (see FIG. 1). In addition, the glucose facilitator was expressed in the cells in order to improve the availability of the substrate fructose.
(a) Stämme und Vektoren(a) Strains and Vectors
Es wurden die Stämme E. coli BL21 (DE3) Star (Invitrogen) verwendet. Als Vek- toren wurden pET-24a(+)fo,/7/md/?, kodierend für den ORF der Formiat- Dehydrogenase aus Mycobacterium vaccae, der Mannitol-2-Dehydrogenase aus Leuconostoc pseudomesenteroides und pZY507g/f kodierend für den Glukosefacilitator aus Zymomonas mobilis verwendet.The strains E. coli BL21 (DE3) Star (Invitrogen) were used. The vectors used were pET-24a (+) fo , / 7 / md /?, Coding for the ORF of the formate Dehydrogenase from Mycobacterium vaccae, the mannitol-2-dehydrogenase from Leuconostoc pseudomesenteroides and coding for pZY507g / f for the glucose facilitator from Zymomonas mobilis.
Für die Biotransformation wurden chemisch kompetente E. coli BL21 (DE 3) Star mit pET-24a(+)fα nα77 und pZY507g/f kotransformiert und auf LB-Agarplatten mit 25 μg/ml Chloramphenicol und 30 μg/ml Kanamycin selektiert. Als Kontrollen wurden E. coli BL21 (DE 3) Star entweder mit pET-24a(+)fα nc/7 oder pZY507g/f allein transformiert. Die Selektion der Transformanten erfolgte auf LB- Agarplatten mit entweder 25 μg/ml Chloramphenicol (pZY507g/f) oder mit 50 μg/ml Kanamycin (pET-24a(+)ft/Λ mcfh). LB-Agarplatten für E. coli BL21 (DE 3) Star transformiert mit p pET-24a(+)fcftVrr?o77 enthielten zusätzlich l% (v/v) D- Glucose zur Verminderung der Basalexpression der Mannitol-2-Dehydrogenase und der Formiat-Dehydrogenas.For the biotransformation, chemically competent E. coli BL21 (DE 3) star was co-transformed with pET-24a (+) fα nα77 and pZY507g / f and selected on LB agar plates with 25 μg / ml chloramphenicol and 30 μg / ml kanamycin. As controls, E. coli BL21 (DE 3) Star was transformed with either pET-24a (+) fα nc / 7 or pZY507g / f alone. The transformants were selected on LB agar plates with either 25 μg / ml chloramphenicol (pZY507g / f) or with 50 μg / ml kanamycin (pET-24a (+) ft / Λ mcfh). LB agar plates for E. coli BL21 (DE 3) Star transformed with p pET-24a (+) fcftVrr? O77 additionally contained 1% (v / v) D-glucose to reduce the basal expression of mannitol-2-dehydrogenase and the formate -Dehydrogenas.
(b) Biotransformation(b) Biotransformation
Nach der Überexpression von FDH, MDH und GLF in E. coli, werden nicht wachsende Zellen in einer Biotransformation eingesetzt. Je 1 ,0 g induzierte Zellen von E. coli BL21 (DE 3) Star pET-24a(+)ft /ι/mc_7j / pZY507g/f~ wurden mit 100 mM Kaliumphosphat-Puffer pH 7,0 gewaschen und in 50 ml Reaktionslösung mit 500 mM D-Fructose und 500 mM Natriumformiat in 100 mM Kaliumphosphat-Puffer pH 6,7 resuspendiert. Die Ansätze wurden in 100 ml-Kolben ohne Schikane bei 100 - 120 Upm und 30°C für 24 h geschüttelt. Zu den Zeitpunkten 0, 1 , 2, 3, 4, 5, 6, 8, 17 und 23 h nach Reaktionsstart wurden 1 - 2 ml-Proben des Überstandes genommen zur Messung der Konzentrationen von Formiat, D-Fructose und D- Mannitol. Die Proben wurden bei 5000g für 1 min zentrifugiert, der Überstand 0,2 μm-filtriert und bis zur Messung durch HPLC bei -20°C gelagert. Als Kontrolle wurden 1 ,0 g nicht induzierte Zellen von E. coli BL21 (DE 3) Star pET- 24a(+)fdh/mdh I pZY507g/f in gleicher weise in der Biotransformation eingesetzt.After overexpression of FDH, MDH and GLF in E. coli, non-growing cells are used in a biotransformation. 1.0 g each of induced cells from E. coli BL21 (DE 3) Star pET-24a (+) ft / ι / mc_7j / pZY507g / f ~ were washed with 100 mM potassium phosphate buffer pH 7.0 and in 50 ml reaction solution resuspended with 500 mM D-fructose and 500 mM sodium formate in 100 mM potassium phosphate buffer pH 6.7. The batches were shaken in 100 ml flasks without baffle at 100-120 rpm and 30 ° C for 24 h. At times 0, 1, 2, 3, 4, 5, 6, 8, 17 and 23 h after the start of the reaction, 1-2 ml samples of the supernatant were taken to measure the concentrations of formate, D-fructose and D-mannitol. The samples were centrifuged at 5000 g for 1 min, the supernatant was filtered 0.2 μm and stored at -20 ° C. until measurement by HPLC. As a control, 1.0 g of uninduced cells of E. coli BL21 (DE 3) Star pET-24a (+) fdh / mdh I pZY507g / f were used in the same way in the biotransformation.
Die Konzentrationsbestimmungen von Formiat, D-Fructose und D-Mannitol imThe concentration determinations of formate, D-fructose and D-mannitol in
Reaktionsüberstand und im zellfreien Rohextrakt wurden mit einer HPLC-Anlage (Merck/Hitachi) durchgeführt. Tabelle 1 zeigt beispielhaft Ergebnisse, die mit transformierten Mikroorganismen erreicht werden konnten.The reaction supernatant and in the cell-free crude extract were carried out using an HPLC system (Merck / Hitachi). Table 1 shows examples of results that could be achieved with transformed microorganisms.
Es konnte gezeigt werden, dass die parallele Überexpression der Formiat- Dehydrogenase und der Mannitol-2-Dehydrogenase und des Glukosefacilitators in E. coli zu einer sehr hohen Produktion von D-Mannitol durch diese Zellen in einem Reaktionsmedium mit D-Fructose und Formiat führt. Die bis zu 244 mM Mannitol nach 23 h stehen dem Verfahren ohne GLF mit nur 15 mM nach 17 h und dem Verfahren ohne FDH mit 20 mM nach 17 h gegenüber. Es konnte also eine ca. 12 - 15-fache Verbesserung erzielt werden.It could be shown that the parallel overexpression of formate dehydrogenase and mannitol-2-dehydrogenase and the glucose facilitator in E. coli leads to a very high production of D-mannitol by these cells in a reaction medium with D-fructose and formate. The up to 244 mM mannitol after 23 h contrast with the method without GLF with only 15 mM after 17 h and the method without FDH with 20 mM after 17 h. An improvement of approx. 12 - 15 times could be achieved.
Tabelle 1Table 1
SEQUENZ Nr. 1: SEQUENCE No. 1:
ATGAGTTCTGAAAGTAGTCAGGGTCTAGTCACGCGACTAGCCCTAATCGCTGCTA TAGGCGGCTTGCTTTTCGGTTACGATTCAGCGGTTATCGCTGCAATCGGTACACC GGTTGATATCCATTTTATTGCCCCTCGTCACCTGTCTGCTACGGCTGCGGCTTCC CTTTCTGGGATGGTCGTTGTTGCTGTTTTGGTCGGTTGTGTTACCGGTTCTTTGC TGTCTGGCTGGATTGGTATTCGCTTCGGTCGTCGCGGCGGATTGTTGATGAGTTC CATTTGTTTCGTCGCCGCCGGTTTTGGTGCTGCGTTAACCGAAAAATTATTTGGA ACCGGTGGTTCGGCTTTACAAATTTTTTGCTTTTTCCGGTTTCTTGCCGGTTTAG GTATCGGTGTCGTTTCAACCTTGACCCCAACCTATATTGCTGAAATTCGTCCGCC AGACAAACGTGGTCAGATGGTTTCTGGTCAGCAGATGGCCATTGTGACGGGTGCT TTAACCGGTTATATCTTTACCTGGTTACTGGCTCATTTCGGTTCTATCGATTGGG TTAATGCCAGTGGTTGGTGCTGGTCTCCGGCTTCAGAAGGCCTGATCGGTATTGC CTTCTTATTGCTGCTGTTAACCGCACCGGATACGCCGCATTGGTTGGTGATGAAG GGAGGTCATTCCGAGGCTAGCAAAATCCTTGCTCGTCTGGAACCGCAAGCCGATC CTAATCTGACGATTCAAAAGATTAAAGCTGGCTTTGATAAAGCCATGGACAAAAG CAGCGCAGGTTTGTTTGCTTTTGGTATCACCGTTGTTTTTGCCGGTGTATCCGTT GCTGCCTTCCAGCAGTTAGTCGGTATTAACGCCGTGCTGTATTATGCACCGCAGA TGTTCCAGAATTTAGGTTTTGGAGCTGATACGGCATTATTGCAGACCATCTCTAT CGGTGTTGTGAACTTCATCTTCACCATGATTGCTTCCCGTGTTGTTGACCGCTTC GGCCGTAAACCTCTGCTTATTTGGGGTGCTCTCGGTATGGCTGCAATGATGGCTG TTTTAGGCTGCTGTTTCTGGTTCAAAGTCGGTGGTGTTTTGCCTTTGGCTTCTGT GCTTCTTTATATTGCAGTCTTTGGTATGTCATGGGGCCCTGTCTGCTGGGTTGTT CTGTCAGAAATGTTCCCGAGTTCCATCAAGGGCGCAGCTATGCCTATCGCTGTTA CCGGACAATGGTTAGCTAATATCTTGGTTAACTTCCTGTTTAAGGTTGCCGATGG TTCTCCAGCATTGAATCAGACTTTCAACCACGGTTTCTCCTATCTCGTTTTCGCA GCATTAAGTATCTTAGGTGGCTTGATTGTTGCTCGCTTCGTGCCGGAAACCAAAG GTCGGAGCCTGGATGAAATCGAGGAGATGTGGCGCTCCCAGAAGTAG SEQUENZ Nr. 2:ATGAGTTCTGAAAGTAGTCAGGGTCTAGTCACGCGACTAGCCCTAATCGCTGCTA TAGGCGGCTTGCTTTTCGGTTACGATTCAGCGGTTATCGCTGCAATCGGTACACC GGTTGATATCCATTTTATTGCCCCTCGTCACCTGTCTGCTACGGCTGCGGCTTCC CTTTCTGGGATGGTCGTTGTTGCTGTTTTGGTCGGTTGTGTTACCGGTTCTTTGC TGTCTGGCTGGATTGGTATTCGCTTCGGTCGTCGCGGCGGATTGTTGATGAGTTC CATTTGTTTCGTCGCCGCCGGTTTTGGTGCTGCGTTAACCGAAAAATTATTTGGA ACCGGTGGTTCGGCTTTACAAATTTTTTGCTTTTTCCGGTTTCTTGCCGGTTTAG GTATCGGTGTCGTTTCAACCTTGACCCCAACCTATATTGCTGAAATTCGTCCGCC AGACAAACGTGGTCAGATGGTTTCTGGTCAGCAGATGGCCATTGTGACGGGTGCT TTAACCGGTTATATCTTTACCTGGTTACTGGCTCATTTCGGTTCTATCGATTGGG TTAATGCCAGTGGTTGGTGCTGGTCTCCGGCTTCAGAAGGCCTGATCGGTATTGC CTTCTTATTGCTGCTGTTAACCGCACCGGATACGCCGCATTGGTTGGTGATGAAG GGAGGTCATTCCGAGGCTAGCAAAATCCTTGCTCGTCTGGAACCGCAAGCCGATC CTAATCTGACGATTCAAAAGATTAAAGCTGGCTTTGATAAAGCCATGGACAAAAG CAGCGCAGGTTTGTTTGCTTTTGGTATCACCGTTGTTTTTGCCGGTGTATCCGTT GCTGCCTTCCAGCAGTTAGTCGGTATTAACGCCGTGCTGTATTATGCACCGCAGA TGTTCCAGAATTTAGGTTTTGGAGCTGATACGGCATTATTGCAGACCATCTCTAT CGGTGTTGTGAACTTCATCTTCACCATGATTGCTTCCCGTGTTGTTGA CCGCTTC GGCCGTAAACCTCTGCTTATTTGGGGTGCTCTCGGTATGGCTGCAATGATGGCTG TTTTAGGCTGCTGTTTCTGGTTCAAAGTCGGTGGTGTTTTGCCTTTGGCTTCTGT GCTTCTTTATATTGCAGTCTTTGGTATGTCATGGGGCCCTGTCTGCTGGGTTGTT CTGTCAGAAATGTTCCCGAGTTCCATCAAGGGCGCAGCTATGCCTATCGCTGTTA CCGGACAATGGTTAGCTAATATCTTGGTTAACTTCCTGTTTAAGGTTGCCGATGG TTCTCCAGCATTGAATCAGACTTTCAACCACGGTTTCTCCTATCTCGTTTTCGCA GCATTAAGTATCTTAGGTGGCTTGATTGTTGCTCGCTTCGTGCCGGAAACCAAAG GTCGGAGCCTGGATGAAATCGAGGAGATGTGGCGCTCCCAGAAGTAG SEQUENCE No. 2:
TTAATATTCTATCACATGGTCTACTCCCCTTACTAAAATAAATGTGATAAACGTT TGACTTTATCTTGTTAAAGGTTTACCATTGTCCTCGTAAGTTAATTTAATCACAA AGTAAAAAGGAGAACAAACTTAATATTCTATCACATGGTCTACTCCCCTTACTAAAATAAATGTGATAAACGTT TGACTTTATCTTGTTAAAGGTTTACCATTGTCCTCGTAAGTTAATTTAATCACAA AGTAAAAAGGAGAACAAAC
ATGGAAGCACTTGTGTTAACTGGTACAAAAAAATTAGAGGTTGAAAACATTGAAC AACCTGAGGTAAAGCCGAATGAAGTGTTGATTCATACAGCATTCGCTGGTATTTG CGGTACTGATCACGCTTTGTATGCCGGTCTTCCTGGCTCAGCCGATGCTGTGCCA CCAATCGTTTTGGGGCATGAAAATTCTGGTGTTGTAGCTGAAATTGGTTCTGATG TTACAAACGTTGCGGTGGGTGATCGTGTCACAATTGATCCCAATATTTACTGTGG TCAATGCAAGTATTGCCGTACAGCACGTCCAGAGCTTTGCGAAAACTTGTCTGCA GTTGGTGTAACACGCAATGGTGGCTTTGAAGAATACTTTACTGCGCCCGCATCAG TTGTTTACCAAATTCCAGATAATGTTTCACTTAAGTCAGCTGCCGTGGTTGAGCC GATTTCATGTGCTGTTCACGGTATTCAACTTCTTAAAGTGACACCATACCAAAAG GCATTAGTTATTGGTGACGGCTTCATGGGTGAACTCTTTGTTCAAATTCTGCAAG CTTATGGCATTCACCAAGTCGACTTGGCTGGTATTGTTCCTGAAAAGCTTGCTAT GAACAAAGAAAAGTTCGGCGTGAAAAATACGTACAATACAAAAGATGGCGACAAA ATTCCCGAAGGCACTTACGATGTTGTTGTTGAAGCAGTTGGCCTACCACAGACAC AAGAAGCCGCAATTGAAGCCTCAGCTCGTGGCGCTCAGGTTTTGATGTTTGGTGT TGGCGGTCCCGACGCAAAGTTCCAAATGAACACTTACGAAGTCTTCCAAAAGCAA TTGACGATTCAAGGATCATTTATCAATCCAAACGCATTTGAAGACTCATTGGCAT TGTTATCATCAGGCAAGTTAGACGTCGAATCGCTAATGTCACACGAATTAGATTA CCAGACTGTTGATGACTTTGTGAATGGCAAGTTAGGTGTCGTTTCAAAGGCAGTC GTTAAGGTTGGTGGCGAAGAGGCATAA ATGGAAGCACTTGTGTTAACTGGTACAAAAAAATTAGAGGTTGAAAACATTGAAC AACCTGAGGTAAAGCCGAATGAAGTGTTGATTCATACAGCATTCGCTGGTATTTG CGGTACTGATCACGCTTTGTATGCCGGTCTTCCTGGCTCAGCCGATGCTGTGCCA CCAATCGTTTTGGGGCATGAAAATTCTGGTGTTGTAGCTGAAATTGGTTCTGATG TTACAAACGTTGCGGTGGGTGATCGTGTCACAATTGATCCCAATATTTACTGTGG TCAATGCAAGTATTGCCGTACAGCACGTCCAGAGCTTTGCGAAAACTTGTCTGCA GTTGGTGTAACACGCAATGGTGGCTTTGAAGAATACTTTACTGCGCCCGCATCAG TTGTTTACCAAATTCCAGATAATGTTTCACTTAAGTCAGCTGCCGTGGTTGAGCC GATTTCATGTGCTGTTCACGGTATTCAACTTCTTAAAGTGACACCATACCAAAAG GCATTAGTTATTGGTGACGGCTTCATGGGTGAACTCTTTGTTCAAATTCTGCAAG CTTATGGCATTCACCAAGTCGACTTGGCTGGTATTGTTCCTGAAAAGCTTGCTAT GAACAAAGAAAAGTTCGGCGTGAAAAATACGTACAATACAAAAGATGGCGACAAA ATTCCCGAAGGCACTTACGATGTTGTTGTTGAAGCAGTTGGCCTACCACAGACAC AAGAAGCCGCAATTGAAGCCTCAGCTCGTGGCGCTCAGGTTTTGATGTTTGGTGT TGGCGGTCCCGACGCAAAGTTCCAAATGAACACTTACGAAGTCTTCCAAAAGCAA TTGACGATTCAAGGATCATTTATCAATCCAAACGCATTTGAAGACTCATTGGCAT TGTTATCATCAGGCAAGTTAGACGTCGAATCGCTAATGTCACACGAATTAGATTA CCAGACTGTTGATGACTTTGTGAATGGCAAGTTAGGTGTCGTTTCAAA GGCAGTC GTTAAGGTTGGTGGCGAAGAGGCATAA
SEQUENZ Nr.3:SEQUENCE No.3:
atggcaaaggtcctgtgcgttctttacgatgatccggtcgacggctacccgaa- gacctatgcccgcgacgatcttccgaa gatcgaccactatccgggcggccagatcttgccgacgccgaaggccatcgactt- cacgcccgggcagttgctcggctccgtctccggcgagctcggcctgcgcgaa- tatctcgaatccaacggccacaccctggtcgtgacctccgacaaggacggcccc- gactcggtgttcgagcgcgagctggtcgatgcggatgtcgtcatctcc- cagcccttctggccggcctatctgacgcccgagcgcatcgccaaggccaa- gaacctgaagctcgcgctcaccgccggcatcggttccgaccacgtcgatctt- cagtcggctatcgaccgcaacgtcaccgtggcggaagtcacctactgcaactc- gatcagcgtcgccgagcatgtggtgatgatgatcctg tcgctggtgcgcaactatctgccctcgcacgaatgggcgcggaagggcggctg- gaacatcgccgactgcgtctcccacgcctacgacctcgaggcgatgcatgtcgg- caccgtggccgccggccg- catcggtctcgcggtgctgcgccgtctggcgccgttcgacgtgcacctgcacta- caccgaccgtcaccgcctgccggaatcggtcgagaaggagctcaacct- cacctggcacgcgacccgcgaggacatgtatccggtttgcgacgtggtgacgct- gaactgcccgctgcaccccgaaaccgagcacatgatcaatgacgagacgct- gaagctgttcaagcgtggcgcctacatcgtcaacaccgcccgcgg- caagctgtgcgaccgcgatgccgtggcacgtgcgctc- gaatccggccggctggccggctatgccggcgacgtgtggttcccg- cagccggcgccgaaggaccacccctggcggacgatgccctataacggcat- gaccccgcacatctccggcaccacgctgaccgcgcaggcgcgttatgcggcggg- cacccgcgagatcctggagtgcttcttcgagggccgtccgatccgcgacgaa- tacctcatcgtgcagggcggcgctcttgccggcaccggcgcgcattcctactc- gaagggcaatgccaccggcggttcggaagaggccgccaagttcaa- gaaggcggtctga atggcaaaggtcctgtgcgttctttacgatgatccggtcgacggctacccgaa- gacctatgcccgcgacgatcttccgaa gatcgaccactatccgggcggccagatcttgccgacgccgaaggccatcgactt- cacgcccgggcagttgctcggctccgtctccggcgagctcggcctgcgcgaa- tatctcgaatccaacggccacaccctggtcgtgacctccgacaaggacggcccc- gactcggtgttcgagcgcgagctggtcgatgcggatgtcgtcatctcc- cagcccttctggccggcctatctgacgcccgagcgcatcgccaaggccaa- gaacctgaagctcgcgctcaccgccggcatcggttccgaccacgtcgatctt- cagtcggctatcgaccgcaacgtcaccgtggcggaagtcacctactgcaactc- gatcagcgtcgccgagcatgtggtgatgatgatcctg tcgctggtgcgcaactatctgccctcgcacgaatgggcgcggaagggcggctg- gaacatcgccgactgcgtctcccacgcctacgacctcgaggcgatgcatgtcgg- caccgtggccgccggccg- catcggtctcgcggtgctgcgccgtctggcgccgttcgacgtgcacctgcacta- caccgaccgtcaccgcctgccggaatcggtcgagaaggagctcaacct- cacctggcacgcgacccgcgaggacatgtatccggtttgcgacgtggtgacgct- gaactgcccgctgcaccccgaaaccgagcacatgatcaatgacgagacgct- gaagctgttcaagcgtggcgcctacatcgtcaacaccgcccgcgg- caagctgtgcgaccgcgatgccgtggcacgtgcgctc- gaatccggccggctggccggctatgccggcgacgtgtggttcccg- cagccggcgccgaaggaccaccc ctggcggacgatgccctataacggcat- gaccccgcacatctccggcaccacgctgaccgcgcaggcgcgttatgcggcggg- cacccgcgagatcctggagtgcttcttcgagggccgtccgatccgcgacgaa- tacctcatcgtgcagggcggcgctcttgccggcaccggcgcgcattcctactc- gaagggcaatgccaccggcggttcggaagaggccgccaagttcaa- gaaggcggtctga

Claims

P a t e n t a n s p r ü c h e Patent claims
1. Verfahren zur Produktion von D-Mannitol unter Einsatz Mannitol-2- Dehydrogenase (MDH) exprimierender Organismen, bei welchen die Zucker-Substrate und/oder Zucker-Substratvorläufer der MDH über ein nicht- phosphorylierendes Zucker-Transportsystem in den Organismus transportiert werden.1. Process for the production of D-mannitol using mannitol-2-dehydrogenase (MDH) expressing organisms, in which the sugar substrates and / or sugar substrate precursors of the MDH are transported into the organism via a non-phosphorylating sugar transport system.
2. Verfahren nach Anspruch 1 , dadurch gekennzeichnet, dass Organismen, die als Zucker-Transportsystem den Glukosefacilitator (GLF) aus einem2. The method according to claim 1, characterized in that organisms, the sugar transport system, the glucose facilitator (GLF) from one
Eukaryonten enthalten, eingesetzt werdenContaining eukaryotes
3. Verfahren nach Anspruch 1 oder 2, dadurch gekennzeichnet, dass Organismen, die als Zucker-Transportsystem den Glukosefacilitator (GLF) aus Zymomonas mobilis enthalten, eingesetzt werden.3. The method according to claim 1 or 2, characterized in that organisms which contain the glucose facilitator (GLF) from Zymomonas mobilis as the sugar transport system are used.
4. Verfahren nach Anspruch 2 oder 3, dadurch gekennzeichnet, dass Organismen, die die Sequenz Nr. 1 codierend für GLF enthalten, eingesetzt werden.4. The method according to claim 2 or 3, characterized in that organisms containing sequence number 1 coding for GLF are used.
5. Verfahren nach einem der Ansprüche 1 bis 4, dadurch gekennzeichnet, dass als Zucker Glukose und/oder Fructose eingesetzt werden.5. The method according to any one of claims 1 to 4, characterized in that glucose and / or fructose are used as sugar.
6. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass Organismen, die eine für eine MDH codierende Sequenz enthalten, eingesetzt werden6. The method according to any one of the preceding claims, characterized in that organisms containing a sequence coding for an MDH are used
7. Verfahren nach Anspruch 6, dadurch gekennzeichnet, dass Organismen, die eine für MDH codierende Sequenz aus Mikroorganismen der Familie der Lactobacteriaceae, insbesondere Leuconostoc pseudomesenteroides enthalten, eingesetzt werden.7. The method according to claim 6, characterized in that organisms containing a coding sequence for MDH from microorganisms of the family of Lactobacteriaceae, in particular Leuconostoc pseudomesenteroides, are used.
8. Verfahren nach Anspruch 6 oder 7, dadurch gekennzeichnet, dass Organismen, die die Sequenz Nr. 2 codierend für MDH enthalten, eingesetzt werden. 8. The method according to claim 6 or 7, characterized in that organisms containing the sequence No. 2 coding for MDH are used.
. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass Organismen, die eine für eine Formiat-Dehydrogenase (FDH) codierende Sequenz enthalten, eingesetzt werden., Method according to one of the preceding claims, characterized in that organisms which contain a sequence coding for a formate dehydrogenase (FDH) are used.
10. Verfahren nach Anspruch 9, dadurch gekennzeichnet, dass Organismen, die eine für FDH codierende Sequenz aus Mycobacterium vaccae enthalten, eingesetzt werden.10. The method according to claim 9, characterized in that organisms containing a sequence coding for FDH from Mycobacterium vaccae are used.
11. Verfahren nach Anspruch 9 oder 10, dadurch gekennzeichnet, dass Organismen, die die Sequenz Nr. 3 codierend für FDH enthalten, eingesetzt werden.11. The method according to claim 9 or 10, characterized in that organisms containing sequence number 3 coding for FDH are used.
12. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass als Organismus ein Mikroorganismus eingesetzt wird.12. The method according to any one of the preceding claims, characterized in that a microorganism is used as the organism.
13. Verfahren nach einem der vorhergehenden Ansprüche, dadurch gekennzeichnet, dass Mikroorganismen der Gattung Bacillus, Pseudomonas, Lactobacillus, Leuconostoc, den Enterobakteriaceae oder methylotrophen Hefen und Pilzen eingesetzt werden.13. The method according to any one of the preceding claims, characterized in that microorganisms of the genus Bacillus, Pseudomonas, Lactobacillus, Leuconostoc, Enterobacteriaceae or methylotrophic yeasts and fungi are used.
14. Mikroorganismus, der die Enzyme MDH gemäß Sequenz Nr. 2 und FDH gemäß Sequenz Nr. 3 zur mikrobiellen Herstellung von D-Mannitol exprimiert und ein nicht-phosphorylierendes Zucker-Transportsystem aufweist, das die Zucker-Substrate und/oder Zucker-Substratvorläufer der MDH in den Mikroorganismus transportiert.14. Microorganism which expresses the enzymes MDH according to sequence No. 2 and FDH according to sequence No. 3 for the microbial production of D-mannitol and has a non-phosphorylating sugar transport system which contains the sugar substrates and / or sugar substrate precursors of MDH transported into the microorganism.
15. Mikroorganismus nach Anspruch 14, dadurch gekennzeichnet, dass es sich bei dem Zucker-Transportsystem um den Glukosefacilitator (GLF) aus einem Eukaryonten handelt15. Microorganism according to claim 14, characterized in that it is in the sugar transport system to the glucose facilitator (GLF) from a eukaryote
16. Mikroorganismus nach Anspruch 14 oder 15, dadurch gekennzeichnet, dass es sich bei dem Zucker-Transportsystem um den Glukosefacilitator16. Microorganism according to claim 14 or 15, characterized in that it is in the sugar transport system to the glucose facilitator
(GLF) aus Zymomonas mobilis handelt.(GLF) from Zymomonas mobilis.
17. Mikroorganismus nach Anspruch 16, dadurch gekennzeichnet, dass der Organismus die Sequenz Nr. 1 codierend für GLF aufweist. 17. Microorganism according to claim 16, characterized in that the organism has sequence number 1 coding for GLF.
18. Mikroorganismus nach einem der Ansprüche 14 bis 17, dadurch gekennzeichnet, dass er Glukose, Fructose oder Gemische hiervon zu D-Mannitol umsetzt.18. Microorganism according to one of claims 14 to 17, characterized in that it converts glucose, fructose or mixtures thereof into D-mannitol.
19. Mikroorganismus nach einem der vorhergehenden Ansprüche 14 bis 18, dadurch gekennzeichnet, dass er eine für MDH codierende Sequenz aus19. Microorganism according to one of the preceding claims 14 to 18, characterized in that it comprises a sequence coding for MDH
Mikroorganismen der Familie der Lactobacteriaceae, insbesondere Leuconostoc pseudomesenteroides enthält.Contains microorganisms of the Lactobacteriaceae family, in particular Leuconostoc pseudomesenteroides.
20. Mikroorganismus nach einem der vorhergehenden Ansprüche 14 bis 19, dadurch gekennzeichnet, dass er eine für FDH codierende Sequenz aus Mycobacterium vaccae enthält.20. Microorganism according to one of the preceding claims 14 to 19, characterized in that it contains a sequence coding for FDH from Mycobacterium vaccae.
21. Mikroorganismus nach einem der vorhergehenden Ansprüche 14 bis 20, dadurch gekennzeichnet, dass er aus der Gattung Bacillus, Lactobacillus, Leuconostoc, den Enterobakteriaceae oder methylotrophen Hefen und Pilzen sowie aus allen auch in der Lebensmittelindustrie verwendeten Mik- roorganismen stammt.21. Microorganism according to one of the preceding claims 14 to 20, characterized in that it comes from the genus Bacillus, Lactobacillus, Leuconostoc, Enterobacteriaceae or methylotrophic yeasts and fungi and from all microorganisms also used in the food industry.
22. Verwendung eines Mikroorganismus nach einem der Ansprüche 14 bis 21 zur Herstellung von D-Mannitol.22. Use of a microorganism according to one of claims 14 to 21 for the production of D-mannitol.
23. Nukleotidsequenz gemäß Sequenz Nr. 1 codierend für GLF zur Verwendung in einem Mikroorganismus nach einem der Ansprüche 14 bis 21.23. Nucleotide sequence according to sequence no. 1 coding for GLF for use in a microorganism according to one of claims 14 to 21.
24. Nukleotidsequenz gemäß Sequenz Nr. 2 codierend für MDH zur Verwendung in einem Mikroorganismus nach einem der Ansprüche 14 bis 21.24. Nucleotide sequence according to sequence no. 2 coding for MDH for use in a microorganism according to one of claims 14 to 21.
25. Nukleotidsequenz gemäß Sequenz Nr. 3 codierend für FDH zur Verwendung in einem Mikroorganismus nach einem der Ansprüche 14 bis 21.25. Nucleotide sequence according to sequence no. 3 coding for FDH for use in a microorganism according to one of claims 14 to 21.
26. Genstruktur enthaltend mindestens eine oder mehrere Nukleotidsequenzen gemäß den Ansprüchen 23 bis 25.26. Gene structure containing at least one or more nucleotide sequences according to claims 23 to 25.
27. Vektor enthaltend mindestens eine oder mehrere Nukleotidsequenzen gemäß Ansprüchen 23 bis 25 oder eine oder mehrere Genstrukturen gemäß Anspruch 26. 27. Vector containing at least one or more nucleotide sequences according to claims 23 to 25 or one or more gene structures according to claim 26.
28. Verwendung einer Nukleotidsequenz gemäß einem der Ansprüche 23 bis 25 zur Transformierung eines Mikroorganismus nach einem der Ansprüche 14 bis 21.28. Use of a nucleotide sequence according to one of claims 23 to 25 for transforming a microorganism according to one of claims 14 to 21.
29. Mikroorganismus nach einem der Ansprüche 14 bis 21 enthaltend mindes- tens eine Genstruktur gemäß Anspruch 26.29. A microorganism according to any one of claims 14 to 21 containing at least one gene structure according to claim 26.
30. Mikroorganismus nach einem der Ansprüche 14 bis 21 enthaltend mindestens einen Vektor gemäß Anspruch 27. 30. Microorganism according to one of claims 14 to 21 containing at least one vector according to claim 27.
EP03757939A 2002-10-09 2003-10-09 Method and microorganism for the production of d-mannitol Withdrawn EP1549744A1 (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
DE10247147 2002-10-09
DE10247147A DE10247147A1 (en) 2002-10-09 2002-10-09 Production of D-mannitol, useful e.g. as sweetener and plasma extender, by culturing organisms that express mannitol-2-dehydrogenase and where substrate is introduced by a non-phosphorylating pathway
PCT/EP2003/011191 WO2004033676A1 (en) 2002-10-09 2003-10-09 Method and microorganism for the production of d-mannitol

Publications (1)

Publication Number Publication Date
EP1549744A1 true EP1549744A1 (en) 2005-07-06

Family

ID=32038413

Family Applications (1)

Application Number Title Priority Date Filing Date
EP03757939A Withdrawn