EP1470222A2 - Transgenic animal comprising intracellular immunoglobins for xenotransplantation - Google Patents
Transgenic animal comprising intracellular immunoglobins for xenotransplantationInfo
- Publication number
- EP1470222A2 EP1470222A2 EP03731802A EP03731802A EP1470222A2 EP 1470222 A2 EP1470222 A2 EP 1470222A2 EP 03731802 A EP03731802 A EP 03731802A EP 03731802 A EP03731802 A EP 03731802A EP 1470222 A2 EP1470222 A2 EP 1470222A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- protein
- immunoglobulin
- galactose
- antibody
- transgenic organism
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/40—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against enzymes
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/08—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from viruses
- C07K16/10—RNA viruses
- C07K16/112—Retroviridae (F), e.g. leukemia viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/8509—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells for producing genetically modified animals, e.g. transgenic
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/15—Humanized animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/20—Animal model comprising regulated expression system
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/02—Animal zootechnically ameliorated
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/02—Animal zootechnically ameliorated
- A01K2267/025—Animal producing cells or organs for transplantation
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/80—Immunoglobulins specific features remaining in the (producing) cell, i.e. intracellular antibodies or intrabodies
Definitions
- the present invention relates to methods of producing transgenic animals.
- it relates to the use of polynucleotide constructs to enable intracellular expression of polypeptides whose effect is to enable the use of said animals in xenotransplantation whilst providing improved safety and tolerance.
- a particularly preferred candidate as a xenotransplantation donor is the pig (Sus scrofa), which, as well as being easy to breed and handle, has organs of similar size to that of humans. The pig also has a lower risk of infectious disease in comparison to primates.
- the graft recipient's complement is primarily activated via the classical complement pathways, in which Cl binds to antibody.
- the Cl s subunit acquires esterase activity and cleaves C4 to generate activated C4b, surface bound forms of which act as a binding site for C2.
- the resultant C4b2a complex has "C3-convertase” activity and splits C3 to produce C3a, which has anaphylatoxin activity which contributes to complement-mediated damage, and C3b, which is membrane bound and can cause immune adherence of the antigen-antibody-C3b complex, so facilitating subsequent phagocytosis.
- C3b binds C5 which is then cleaved by C5 convertase, a trimolecular complex of C4b2a3b, to give C5a, a potent anaphylatoxin, and C5b, which binds C6, then C7 to form a complex which preferentially inserts into lipid bilayers. Finally C8 and C9 are recruited to generate the membrane attack complex (MAC).
- MAC membrane attack complex
- the complement cascade is subject to regulation by a number of complement control proteins.
- complement control proteins For example, decay accelerating factor (DAF) and CRl inhibit the binding of C2 to C4b and promote the dissociation of C2a from C4b with CRl and Membrane co- factor protein (MCP) promoting the catabolism of C4b by Factor I. Further regulation is provided by membrane proteins which protect against lysis by the MAC.
- CD59 binds to C8 in C5b-8 complexes, inhibiting the insertion and unfolding of C9, with homologous restriction factor, HRF, known to have a similar function.
- WO 91/05855 describes the preparation of transgenic mice bearing a transgene encoding human membrane cofactor protein (MCP) (CD46) or human decay accelerating factor (DAF).
- MCP membrane cofactor protein
- DAF human decay accelerating factor
- Yannoutsos et al., First Int'l Conqr. Xenotr., Abstracts, p7 (1991) describes the development of transgenic mice expressing human DAF and MCP.
- Transgenic mice and pigs which contain a human DAF gene have been produced using a partial genomic DNA fragment (Gary et al., Trans. Proc. 25:400-401, 1993: Cozzi et al., Trans. Proc. 27:319-320, 1995).
- Foder et al. (Proc. Nat. Acad. Sci. USA, 91: 11153-57 (1994)) sought to produce transgenic mice and swine producing the complement inhibitor CD59 by expressing CD59 under the control of the promoter of the MHC Class I gene H2K.sup.b, which encodes an antigen which is a predominant endothelial cell surface antigen.
- PCT/US93/08889 (WO 9105855; describes the expression of complement inhibitors in the red blood cells of transgenic animals, which then transfer the proteins to the vascular endothelium of their organs and tissues.
- this method requires routine reperfusion with the transgenic animal's blood in order to maintain high expression.
- Gal ⁇ l,4GlcNAc3- ⁇ -D galactosyltransferase or " ⁇ -1 ,3 galactosyltransferase"; EC 2.4.1.51
- N-lac N-acetyllactosamine
- US 6,166,288 proposes the production of transgenic animals such as pigs (or mice) which express an enzyme such as ⁇ -1, 2 fucosyltransferase to mask or reduce the level of xenoreactive antigens, such as Gal epitope, by competing with ⁇ -1, 3 galactosyl transferase for its N-lac substrate in order to reduce the expression of the xenoantigenic galactose ⁇ -1 ,3 -galactose.
- an enzyme such as ⁇ -1, 2 fucosyltransferase to mask or reduce the level of xenoreactive antigens, such as Gal epitope
- US 6,096,725 discloses the use of oligosaccharides containing a galactose ⁇ -1, 3- galactose motif to competitively bind anti-galactose ⁇ - 1,3 -galactose antibodies in order to reduce the binding of such antibodies to the xenograft and help reduce or slow rejection.
- the DNA of most investigated species comprise integrated endogenous retroviruses. Although many of such endogenous retroviruses are not believed to be harmful to their natural host species, they may nevertheless be harmful to other species. Therefore concerns remain regarding the possibility of cross-species infection. The presence of such retroviruses in the cells of donor organisms have led to concern over the safety of their use in xenotransplantation, given that some retroviruses are widely believed to have crossed the species barrier.
- Porcine endogenous retroviruses are present in the genome of all pigs and are believed to be harmless to pigs.
- new PERN particles are produced and released from the cells, the R ⁇ A within the particle being enclosed by an envelope protein in part derived from the membrane of the cell.
- porcine retroviruses At least two classes of porcine retroviruses (PERN-A and PERN-B) are able to infect human cells in vitro (3-6). Although long term infection after transplantation has not been found (7-9), PERNs are able to infect mouse cells in vivo (10,11). Hence there is a possibility that PERNs might lead to a malignant, immunosuppressive (12) or other diseases in the recipient of a porcine transplant and that they might spread beyond the recipient into the human population, all potential risks, that presently do not allow xenotransplantation (as described, for example, in reference 13).
- the present invention is based on the finding that intracellular expression of antibodies or antibody fragments by the introduction of a gene encoding such an antibody can improve the safety and tolerance of xenotransplants.
- a non-human transgenic animal comprising a polynucleotide construct which includes a nucleotide sequence encoding an intracellular immunoglobulin.
- the present invention is based on the surprising finding that expression of galactose ⁇ -1, 3 -galactose epitopes on the cell surface of an animal may be reduced or eliminated by the introduction of a gene encoding an antibody which binds specifically to an enzyme required for the production of the epitope.
- said immunoglobulin is able to bind specifically to an enzyme which catalyses the production of galactose ⁇ -1,3 -galactose.
- An immunoglobulin "binds specifically" to a protein, e.g. enzyme, polypeptide or peptide molecule if such binding is not competitively inhibited by the presence of a non-related molecule.
- the invention provides a method of producing a non-human transgenic organism, said method comprising inserting into the genome of said organism a polynucleotide construct which includes a nucleotide sequence encoding an intracellular immunoglobulin.
- said intracellular immunoglobulin is able to bind specifically to an enzyme which catalyses the production of galactose ⁇ - 1,3 -galactose.
- an immunoglobulin such as an antibody with specificity for an enzyme which catalyses the production of galactose ⁇ -1, 3 -galactose
- the synthesis of galactose ⁇ -l,3-galactose and its expression on the surface of cells of transgenic organisms may be reduced or prevented.
- Cells, tissues and organs of such organisms will therefore be less imrnunogenic and such animals may thus be of use as a source of tissues and/or organs for xenotransplantation.
- the invention extends to a method for preparing organs, tissues or cells for xenotransplantation comprising: providing a transgenic organism according to the first aspect of the invention or produced according to the method of the second aspect of the invention, and isolating said organ, tissue or cell from said transgenic organism.
- the enzyme to which the intracellular antibody binds is ⁇ -1,3 galactosyl transferase.
- the reduction or elimination of galactose ⁇ -1,3 -galactose epitopes from cells or tissues of transgenic animals reduces the immunogenicity of the cells or tissues and thus may be useful in reducing or preventing graft rejection when such cells or tissues are transplanted into a recipient organism.
- retrovirus such as a porcine endogenous retrovirus (PERN)
- PERN porcine endogenous retrovirus
- the retrovirus particles e.g. PERN particles
- the retrovirus particles released from such cells also express the oligosaccharide on the envelope protein of the particle.
- galactose ⁇ -l,3-galactose By eliminating the expression of galactose ⁇ -l,3-galactose from the surface of cells of an organism, the expression of galactose ⁇ -1,3 -galactose on the surface of retroviral particles such as PERNs may also be eliminated, reducing or eliminating recognition of the retroviral particles by host anti-galactose ⁇ -l,3-galactose antibodies (31). The same is true for pigs transgenic for human CD46, CD55 or CD59. This lack of recipient anti-galactose ⁇ -l,3-galactose response to the retrovirus may promote retroviral infection of the host through escaping the complement-mediated virolysis (32).
- the present inventors have found that this problem may be obviated by introduction of a gene encoding an intracellular immunoglobulin able to bind specifically to a retrovirus protein into the genome of a host organism.
- introduction of a gene encoding an intracellular immunoglobulin able to bind specifically to a retrovirus protein into the genome of a host organism.
- the release of retroviruses such as PERNs from the cells and tissues of the organism may be reduced or prevented completely.
- the present invention provides a method of disrupting release of a retroviral particle from a cell of a host organism, comprising inserting into the genome of the organism a polynucleotide construct encoding an intracellular immunoglobulin which binds specifically to a retrovirus protein.
- a retrovirus protein is any protein or part thereof, which, upon binding by an immunoglobulin, is inhibited from forming, packaging or releasing a retrovirus particle from a host cell.
- Retroviruses consist of the gag, pol and env genes flanked by LTRs (long terminal repeats).
- the gag gene encodes the structural virion proteins.
- the pol gene encodes reverse transcriptase (RT), which ensures synthesis of DNA complementary to viral RNA, and in addition the pol gene encodes protease and integrase which are required for proviral integration.
- the env gene encodes two envelope proteins denoted transmembrane protein (TM), and surface unit (SU). These two proteins mediate the interactions with host cell membranes and make exit from host cells and entry into cells possible by interaction with receptors at the cell membrane.
- C-type PERVs differ significantly in the env gene encoding the envelope proteins, the genes for the polymerase (pol) and the group specific antigens (gag) show high homology between all potentially xenotropic classes of PERVs (6).
- the immunoglobulin binds specifically to a retrovirus protein selected from Gag or Pol.
- a retrovirus protein selected from Gag or Pol.
- anti-sera raised against Gag or Pol will react to both xenotropic/polytropic classes of PERVs (PERV-A and PERV-B) as well as the ecotropic PERV-C class.
- the invention also provides a non-human transgenic animal comprising a polynucleotide construct which includes a nucleotide sequence encoding an intracellular immunoglobulin able to bind specifically to a retrovirus protein.
- the retrovirus protein to which the intracellular immunoglobulin or antibody is capable of specifically binding is a retroviral GAG protein or an ENV protein.
- the immunoglobulins are immunoglobulins which selectively bind the plO, i 2, pi 5 or p30 nucleocapsid portion, or p27, of the GAG polyprotein.
- the intracellular immunoglobulin is a single domain antibody (VHH), preferably a single domain antibody derived from Lama glama.
- VHH single domain antibody
- said intracellular immunoglobulin has an amino acid sequence as set out in Figure 2.
- the intracellular immunoglobulin is a single domain antibody (VHH) against i 5, the matrix domain protein of the PERV Gag polyprotein.
- said non-human transgenic animal further comprises a nucleotide sequence encoding an intracellular immunoglobulin able to bind specifically to an enzyme which catalyses the production of galactose ⁇ -1, 3 -galactose.
- Also provided is a method of producing a non-human transgenic organism comprising inserting into the genome of said organism a polynucleotide construct which includes a nucleotide sequence encoding an intracellular immunoglobulin able to bind specifically to a retrovirus protein.
- the method further comprises inserting into the genome of said organism a polynucleotide construct which includes a nucleotide sequence encoding an intracellular immunoglobulin able to bind specifically to an enzyme which catalyses the production of galactose ⁇ -1, 3 -galactose.
- Transgenic organisms comprising both nucleotide sequences are also encompassed by the invention.
- the retroviral particle is porcine endogenous retroviral particle (PERV).
- PERV porcine endogenous retroviral particle
- the invention thus further provides a method of producing a transgenic pig with reduced expression of PERV particles, said method comprising inserting into the genome of said organism a polynucleotide construct which includes a nucleotide sequence encoding an intracellular immunoglobulin able to bind specifically to a PERV protein.
- Transgenic pigs produced using a method according to the invention are also provided.
- the invention further extends to polynucleotide constructs suitable for use in the methods of the invention and immunoglobulins encoded by such polynucleotide constructs.
- said polynucleotide constructs are selected from polynucleotides encoding Gag positive binders having the amino acid sequences as set out in Figure 2.
- the polynucleotide construct encodes the amino acid sequence which encodes any of the single domain antibodies A5, El 1 or D2.
- Polynucleotide constructs may further comprise a nucleic acid sequence encoding at least one complement inhibiting protein, such as CD59, DAF and MCP. Expression of the construct within a host cell may thus result in production of one or more complement inhibitors to reduce the activation of complement which may be induced by xenoantigens other than galactose ⁇ -1, 3 -galactose or indeed by any residual galactose ⁇ -1,3 -galactose.
- complement inhibiting protein such as CD59, DAF and MCP.
- an isolated polypeptide having the amino acid sequence of any of the gag positive binders set out in Figure 2, or variant, derivatives or fragments thereof.
- the isolated polypeptide encodes any of the single domain antibodies A5, El 1 or D2.
- gag positive binders can also be used in a method of diagnosing the presence of PERVs. Accordingly, in another aspect of the invention there is provided a method of detecting the presence of a PERV in a sample, said method comprising taking said sample and incubating in the presence of a gag positive binder in accordance with the invention. Suitably said gag positive binder is linked to a detectable moiety to enable binding to be detected. Methods for determining immunoglobulin binding to a sample are well known to those skilled in the art and include western blotting, immunofluoresence and so forth.
- Lama glama antiserum recognizes Gag and contains several VHHs with different affinities for viral Gag.
- A. PERVs detection in PK15 cells cryosections by immunoelectron microscopy using llama ⁇ Gag antiserum. Arrows indicate viral particles.
- A4, A5, El l, Cl, BIO and H2 are antibodies against matrix protein pi 5 while D2 and G12 bind to capsid protein p27. All VHHs recognize whole Gag.
- Figure ID shows that the epitope of the gag protein pi 5 (l 3 amino acids in size) that is recognised by the A5 antibody maps between amino acid 47 and 113 and involves the sequence PPPWN.
- FIG. 2 Amino acid sequences of Gag positive binders and constructs used to intracellularly express single domain antibody A5.
- A Alignment of 8 different llama antibodies against the PERV-B Gag protein . The VHH structural elements (CDRs and FRs), hinge region and CH2 exon are indicated.
- B The vectors used for transfection experiments in PK15 cells. Left: Tet-on regulatory plasmid pUHrT 62-1-puro. Right: response plasmid 2x p(A)BiDi-A5-Myc containing A5 VHH in frame with the Myc - tag cloned on one side of the bidirectional Tre responsive promoter (Clontech) and the neomycin resistance gene.
- FIG. 3 hnmunofluorescent staining showing doxycycline induced production of A5 VHH and its influence on Gag expression.
- PK15 cells were stably transfected with the tet-on regulatory plasmid, so called tet-on line (panel A) and two clones 17 (panel B) and 13 (panel C) of tet-on line, which were additionally stably transfected with the response plasmid containing A5 VHH.
- the cells were either not treated (Al, Bl, Cl) or treated for 48 hours with doxycycline (A2, B2, C2).
- A3, B3, C3 same fields as A2, B2 and C2 of dox induced cells showing Gag expression in green and A5 VHH expression in red.
- FIG. 4 Viral production (PERVA/B) by PK15 cells is blocked upon expression of A5 VHH.
- A Relative RT activity in the cell free supernatant. Light blue bars represent RT activity in non-treated samples; dark blue bars represent RT activity in supernatants from dox treated cells. The decrease in RT activity is proportional to the number of A5 VHH expressing cells.
- B Western blot showing gag expression in cell lysates upon dox induction in the different clones. Within each clone ⁇ tubulin is stained as a loading control.
- C RT-PCR of serially diluted viral cDNA preparations. 2, 0.4 and 0.08 refer to ⁇ l of template used in reaction. The gel was stained with Ethidium Bromide. Both PERV-A and PERV-B are blocked (>25fold decrease) by the expression of A5VHH.
- Figure 5 shows two clones El 1-1 and El 1-15 made by transfecting the El l single chain antibody into PK15 Tet-on (PERV producing cell line). Induction of expression of the antibody (red stain) results in a loss of virus production (green speckles), although the gag protein is still visible in the cells (diffuse green staining). El l recognises epitopes on the PERV A and B gag protein pi 5 different from those recognised by antibody A5.
- Figure 6 shows two clones D2-1 and D2-2 made by transfecting the D2 single chain antibody into PK15 Tet-on (PERV producing cell line). Induction of expression of the antibody (red stain) results in a loss of virus production (green speckles), although the gag protein is still visible in the cells (diffuse green staining). D2 recognises the p30 gag protein of PERV A and B.
- Immunoglobulins in the context of the present invention, refer to any moieties which are capable of binding specifically to an enzyme which catalyses the production of galactose ⁇ -l,3-galactose or which are capable of binding specifically to a retrovirus protein, preferably a PERV protein.
- the immunoglobulin superfamily includes members of the immunoglobulin superfamily, a family of polypeptides which comprise the immunoglobulin fold characteristic of antibody molecules, which contains two ⁇ sheets and, usually, a conserved disulphide bond.
- the present invention is applicable to all immunoglobulin superfamily molecules which are capable of binding specifically to an enzyme which catalyses the production of galactose ⁇ -l,3-galactose or which are capable of binding specifically to a refrovirus protein.
- the present invention relates to antibodies.
- Antibodies refers to complete antibodies or antibody fragments capable of binding to a an enzyme which catalyses the production of galactose ⁇ -1, 3- galactose, and include Fv, ScFv, Fab' and F(ab') 2 , monoclonal and polyclonal antibodies, engineered antibodies including chimeric, CDR-grafted (complementarity determining region-grafted) and humanised antibodies, diabodies, and artificially selected antibodies produced using phage display or alternative techniques.
- the antibody is a single chain antibody, such as a heavy chain only antibody or a camelid single domain VHH antibody.
- the invention may employ CDR-grafted antibodies, which are preferably CDR-grafted light chain and heavy chain variable domains only.
- the heavy chain variable domain and the light chain variable domain are linked by way of a spacer group, optionally comprising a signal sequence facilitating the processing of the antibody in the host cell and or a DNA coding for a peptide facilitating the purification of the antibody and/or a cleavage site and/or a peptide spacer and/or an effector molecule.
- Such antibodies are known as scFvs.
- Diabodies are multimers of polypeptides, each polypeptide comprising first and second domains comprising a binding region of an immunoglobulin light chain and a binding region of an immunoglobulin heavy chain respectively, the two domains being linked (e.g. by a peptide linker) but unable to associate with each other to form an antigen binding site.
- Antigen binding sites are formed by the association of the first domain of one polypeptide with the second domain of another polypeptide within the multimer. (W094/1 3804).
- diabodies or ScFv dimers rather than whole antibodies as diabodies and scFv dimers can be constructed without an Fc region, using only variable domains, potentially reducing the effects of anti-idiotypic reaction.
- the term "antibody” should be understood to refer to any specific binding member or substance having a binding domain with the required specificity.
- the antibodies for use in the invention may be altered antibodies comprising an effector protein such as a toxin or a label.
- labels which allow the imaging of the distribution of the antibody in vivo.
- Such labels may be radioactive labels or radioopaque labels, such as metal particles, which are readily visualisable within the body of an organism, e.g. a transgenic organism or a patient into whom a tissue or organ has been transplanted.
- they may be fluorescent labels or other labels which are visualisable on tissue samples removed from patients.
- Effector groups may be added prior to the selection of the antibodies or afterwards. Effector groups e.g. toxins may be used which denature an enzyme such as ⁇ -1,3 galactosyl transferase involved in the catalysis of the production of galactose ⁇ -1,3-galactose.
- the immunoglobulins are intracellular immunoglobulins, preferably intracellular antibodies.
- Intracellular immunoglobulins/antibodies are immunoglobulins/antibodies which will bind to targets selectively within a cell.
- the biosynthesis of immunoglobulin occurs into the endoplasmic reticulum for secretion as antibody.
- antibodies may be expressed in the cell cytoplasm.
- intracellular antibodies or intrabodies have been demonstrated to function in antigen recognition in the cells of higher organisms (reviewed in Cattaneo, A. & Biocca, S. (1997) Intracellular Antibodies: Development and Applications Austin and Springer- Nerlag). This interaction can influence the function of cellular proteins which have been successfully inhibited in the cytoplasm, the nucleus or in the secretory pathway.
- the immunoglobulins are camelid heavy chain only single chain antibodies.
- Camelids (camels and llamas) contain, in addition to normal heavy and light chain antibodies (2 light chains and 2 heavy chains in one antibody), single chain antibodies (containing only heavy chains). The latter are coded for by a distinct set of N H segments referred to as V HH genes.
- Natural V HH containing antibodies are missing the entire C H I domain of the constant region of the heavy chain.
- the exon coding for the C H I domain is present in the genome but is spliced out due to the loss of a functional splice acceptor sequence at the 5 'side of the C H I exon.
- the VDJ region is spliced onto the C H 2 exon.
- an antibody is produced that acts as a single chain antibody (i.e. an antibody of two heavy chains without a light chain interaction). Binding of an antigen is different from that seen with a conventional antibody, but high affinity is achieved the same way, i.e. through hypermutation of the variable region and selection of the cells expressing such high affinity antibodies. The same process of hypermutation seen in camelids may be replicated in transgenic animals.
- Such single chain antibodies to a specific antigen may be obtained by screening an artificially constructed synthetic library of single chain antibodies or a library made from antibodies derived from immunised llamas or camels.
- single chain antibodies to a specific antigen may be obtained by screening a library made from antibodies derived from immunised transgenic animals such as those described in co-pending GB patent application GBO 110029.6.
- Camelid single chain antibodies which may be produced by said transgenic animals and which may be used in the present invention may be encoded by a camelid heavy chain immunoglobin locus comprising (i) a first locus including a V HH region, a D region and a J region capable of recombining to form a VDJ coding sequence encoding a variable heavy chain polypeptide including a complete antigen binding site; and (ii) a second locus including at least one exon encoding a constant heavy chain polypeptide.
- the V HH region of the first locus preferably comprises at least one V HH exon.
- the V HH exon may be a naturally occurring V HH coding sequence such as found in camelids or a derivative of a naturally occurring V HH coding sequence that includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleic acids from or to the sequence of a naturally occurring V HH coding sequence, provided the resultant nucleotide sequence is able to form a VDJ exon encoding a functional variable heavy chain polypeptide.
- V H H exons may be obtained from a variety of sources readily apparent to one skilled in the art including camelid genomic DNA, cDNA, PAC, BAG or YAC libraries.
- the V HH exons may be chemically synthesised using established techniques and the available nucleic acid sequence information.
- the D region and J region of the first locus comprises at least one D exon and J exon respectively.
- the D exon and J exon may correspond to naturally occurring sequences.
- the exon included in the second locus is one or more exons selected from the group of exons encoding a constant heavy chain ("C H exons") comprising: C ⁇ , C ⁇ , C ⁇ -,- , C ⁇ and C ⁇ 1-2 .
- C H exons constant heavy chain
- D exon, J exon, and C H exon in particular the species of origin, will depend at least partly on the intended use of the construct.
- single chain antibodies are encoded from C ⁇ exons only.
- the other exons may be engineered to allow use in single chain antibodies by deletion of the C R I exon.
- the choice of the exons may depend upon the intended use of antibodies produced therefrom.
- the D exon, J exon and C H exon may originate from the same species as the transgenic animal in which the transgene is to be incorporated, such as a pig.
- the D exon, J exon and C H exon may originate from the same species into which a transplant is to be introduced.
- nucleic acids comprising an insert coding for a heavy chain variable domain and/or for a light chain variable domain of antibodies are employed.
- nucleic acids comprise coding single stranded nucleic acids, double stranded nucleic acids consisting of said coding nucleic acids and of complementary nucleic acids thereto, or these complementary (single stranded) nucleic acids themselves.
- nucleic acids encoding a heavy chain variable domain and/or a light chain variable domain of antibodies can be enzymatically or chemically synthesised nucleic acids having the authentic sequence coding for a naturally-occurring heavy chain variable domain and/or for the light chain variable domain, or a mutant thereof.
- a mutant of the authentic sequence is a nucleic acid encoding a heavy chain variable domain and/or a light chain variable domain of the above-mentioned antibodies in
- mutant nucleic acid is also intended to be a silent mutant wherein one or more nucleotides are replaced by other nucleotides with the new codons coding for the same amino acid(s).
- mutant sequence is also a degenerated sequence. Degenerated sequences are degenerated within the meaning of the genetic code in that an unlimited number of nucleotides are replaced by other nucleotides without resulting in a change of the amino acid sequence originally encoded.
- Such degenerated sequences may be useful due to their different restriction sites and/or frequency of particular codons which are preferred by the specific host, particularly yeast, bacterial or mammalian cells, to obtain an optimal expression of the heavy chain variable domain and/or a light chain variable domain.
- mutant is intended to include a DNA mutant obtained by in vitro or in vivo mutagenesis of DNA according to methods known in the art.
- chimeric antibodies may be constructed in order to decrease the immunogenicity thereof in diagnostic or therapeutic applications.
- immunogenicity within, for example, a transgenic organism such as a pig may be minimised, by altering the antibodies by CDR grafting in a technique analogous to humanising antibodies [see European Patent Application 0,239,400 (Winter)] and, optionally, framework modification [see international patent application WO 90/07861 (Protein Design Labs)] .
- the invention therefore may also employ recombinant nucleic acids comprising an insert coding for a heavy chain variable domain of an antibody fused to a porcine constant domain.
- the invention concerns recombinant DNAs comprising an insert coding for a light chain variable domain of an antibody fused to a porcine constant domain K or ⁇ .
- the invention may employ recombinant nucleic acids comprising an insert coding for a heavy chain variable domain of an antibody fused to a human constant domain.
- the invention concerns recombinant DNAs comprising an insert coding for a ligh chain variable domain of an antibody fused to a human constant domain K or ⁇ .
- single chain antibodies may also be engineered by deletion of C H I exons of a human antibody.
- Antibodies may moreover be generated by mutagenesis of antibody genes to produce 5 artificial repertoires of antibodies. This technique allows the preparation of antibody libraries. As discussed further below; antibody libraries are also available commercially. Hence, the present invention advantageously employs artificial repertoires of immunoglobulins, preferably artificial ScFv repertoires, as an immunoglobulin source.
- Immunoglobulins which are able to bind specifically to an enzyme which catalyses the production of galactose ⁇ -l,3-galactose and thus may be used in the methods of the invention may be identified using any technique known to the skilled person. Such immunoglobulins may be conveniently isolated from libraries comprising artificial repertoires of immunoglobulin polypeptides.
- a "repertoire” refers to a set of molecules generated by random, semi-random or directed variation of one or more template molecules, at the nucleic acid level, in order to provide a multiplicity of binding specificities. Methods for generating repertoires are well characterised in the art.
- Any library selection system may be used in conjunction with the invention. Selection protocols for isolating desired members of large libraries are known in the art, as typified by phage display techniques. Such systems, in which diverse peptide sequences are displayed on the surface of filamentous bacteriophage, have proven useful for creating libraries of antibody fragments (and the nucleotide sequences that encode them) for the in vitro selection and amplification of specific antibody fragments that bind a target antigen. The nucleotide sequences encoding the V H and V L regions are linked to gene fragments which encode leader signals that direct them to the periplasmic space of E.
- phage-based display systems An advantage of phage-based display systems is that, because they are biological systems, selected library members can be amplified simply by growing the phage containing the selected library member in bacterial cells. Furthermore, since the nucleotide sequence that encodes the polypeptide library member is contained on a phage or phagemid vector, sequencing, expression and subsequent genetic manipulation is relatively straightforward.
- phage display approaches are also known, for example as described in W096/06213, W092/01047 (Medical Research Council et al.) and W097/08320 (Morphosys), which are incorporated herein by reference.
- Alternative library selection technologies include bacteriophage lambda expression systems, which may be screened directly as bacteriophage plaques or as colonies of lysogens, both as previously described (Huse et al. (1989) Science, 246: 1275; Caton and Koprowski (1990) Proc Natl Acad Sci. USA., 87; Mullinax et al. (1990) Proc. Nat. Acad Sci. USA., 87: 8095; Persson et al (1991) Proc. Nat. Acad Sci. US.A., 88: 2432) and are of use in the invention.
- a significant improvement of the bead-based methods involves tagging each bead with a 15 unique identifier tag, such as an oligonucleotide, so as to facilitate identification of the amino acid sequence of each library member.
- a 15 unique identifier tag such as an oligonucleotide
- Another chemical synthesis method involves the synthesis of arrays of peptides (or 20 peptidomimetics) on a surface in a manner that places each distinct library member (e.g., unique peptide sequence) at a discrete, predefined location in the array.
- the identity of each library member is determined by its spatial location in the array.
- the locations in the array where binding interactions between a predetermined molecule (e.g., a receptor) and reactive library members occur is determined, thereby identifying the sequences of the reactive library members on the basis of spatial location.
- RNA molecules are selected by alternate rounds of selection against a target ligand and PCR amplification (Tuerk and Gold (1990) Science, 249: 505; Ellington and Szostak (1990) Nature, 346: 818).
- in vitro translation can be used to synthesise polypeptides as a method for generating large libraries.
- RNA nucleic acid
- an enzyme involved in the catalysis of the production of galactose ⁇ -1,3 -galactose such as ⁇ -1,3 galactosyl transferase.
- RNA thus obtained represents a natural library of immunoglobulins.
- RNA is isolated from the B cells of an immunised animal, for example from the spleen of an immunised mouse or the circulating B cells of a llama, and PCR primers used to amplify V H and N cD ⁇ A selectively from the R ⁇ A pool.
- the N H and N L sequences thus obtained are joined to make scFv antibodies.
- PCR primer sequences may be based on published N H and N sequences.
- immunoglobulins may be tested to identify ability to function intracellularly.
- the assay comprises a system in which a first part of a signal-generating agent is associated with the putative intracellular antibody and a second part of the signal-generating molecule is associated with an infracellular target molecule.
- a signal is generated by the interaction of the antibody with the target molecule enabling the stable interaction of the two parts of the signal generating molecule.
- “Stable interaction” may be defined as an interaction which permits functional co-operation of the first and second parts in order to give rise to a detectable result, according to the signalling methods selected for use.
- the signal may be any detectable event such as a luminescent, fluorescent or other signal which involves the modulation of the intensity or frequency of emission or absorption of radiation; for example, a FRET signal or the induction of a luciferase gene.
- a detectable event such as a luminescent, fluorescent or other signal which involves the modulation of the intensity or frequency of emission or absorption of radiation; for example, a FRET signal or the induction of a luciferase gene.
- the assay may further comprise a functional assay for the immunoglobulin.
- the immunoglobulins may be tested in an assay to determine any modulating activity on the production of galactose ⁇ -1,3 galactose epitope.
- the cells of the fransgenic organism are advantageously transfected with a polynucleotide construct which encodes the immunoglobulin.
- Polynucleotide constructs encoding an immunoglobulin capable of specifically binding to a retrovirus protein form aspects of the present invention.
- polynucleotide constructs encoding an immunoglobulin capable of specifically binding to an enzyme which catalyses the production of galactose ⁇ -l,3-galactose and vectors comprising such constructs form aspects of the present invention.
- Polynucleotide constructs of the invention may comprise DNA or RNA. They may be single-stranded or double-stranded. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present invention, it is to be understood that the polynucleotides described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of polynucleotides of the invention.
- variant in relation to the nucleotide sequence of the present invention include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleotides from or to the sequence providing the resultant nucleotide sequence encodes an immunoglobulin which specifically binds an enzyme which catalyses the production of galactose ⁇ -1 ,3-galactose or which encodes an intracellular immunoglobulin able to bind specifically to an endogenous retroviral particle.
- the polynucleotide of the invention is double-stranded, both strands of the duplex, either individually or in combination, are encompassed by the present invention.
- polynucleotide is single-stranded, it is to be understood that the complementary sequence of that polynucleotide is also included within the scope of the present invention.
- Polynucleotides of the invention may be used to produce a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.
- a primer e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.
- Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides of the invention as used herein.
- Preferred fragments are less than 500, 200, 100, 50 or 20 nucleotides in
- Polynucleotides such as DNA polynucleotides according to the invention may be 20 produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.
- primers will be produced by synthetic means, involving a step wise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.
- Longer polynucleotides will generally be produced using recombinant means, for example using PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e.g. of about 15 to 30 nucleotides) flanking a region of the sequence which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from an animal or human cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA.
- the primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.
- Polynucleotides of the invention can be incorporated into a recombinant replicable vector.
- a vector may be any suitable vector, but vectors capable of inserting large amounts of nucleic acid, sufficient to encode an entire immunoglobulin heavy chain locus, are preferred.
- vectors include artificial chromosomes, such as YACs.
- the vector may be used to replicate the nucleic acid in a compatible host cell.
- the construct may be recovered from the host cell.
- Suitable host cells include bacteria such as E. coli, yeast, mammalian cell lines and other eukaryotic cell lines, for example insect Sf9 cells.
- the construct of the present invention may also be incorporated into a vector capable of inserting the construct into a recipient genome and thus achieving transformation.
- a polynucleotide construct of the invention in a vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
- operably linked means that the components described are in a relationship permitting them to function in their intended manner.
- a regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under conditions compatible with the control sequences.
- control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators.
- Vectors of the invention may be transformed or transfected into a suitable host cell as described below to provide for expression of an immunoglobulin of the invention. This process may comprise culturing a host cell transformed with an expression vector as described above under conditions to provide for expression by the vector of a coding sequence encoding the immunoglobulin, and optionally recovering the expressed immunoglobulin.
- the vectors may be for example, plasmid or virus vectors provided with an origin of replication, optionally a promoter for the expression of the said polynucleotide and optionally a regulator of the promoter.
- the vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid or a neomycin resistance gene for a mammalian vector. Vectors may be used, for example, to transfect or transform a host cell.
- Control sequences operably linked to sequences encoding the protein of the invention include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host cell for which the expression vector is designed to be used in.
- promoter is well-known in the art and encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.
- the promoter is typically selected from promoters which are functional in mammalian cells, although prokaryotic promoters and promoters functional in other eukaryotic cells may be used.
- the promoter is typically derived from promoter sequences of viral or eukaryotic genes. For example, it may be a promoter derived from the genome of a cell in which expression is to occur. With respect to eukaryotic promoters, they may be promoters that function in a ubiquitous manner (such as promoters of ⁇ -actin, ⁇ -actin, tubulin) or, alternatively, a tissue-specific manner (such as promoters of the genes for pyruvate kinase).
- promoters may also be promoters that respond to specific stimuli, for example promoters that bind steroid hormone receptors.
- Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR) promoter, the Rous sarcoma virus (RSV) LTR promoter or the human cytomegalovirus (CMV) IE (Immediate Early) promoter.
- MMLV LTR Moloney murine leukaemia virus long terminal repeat
- RSV Rous sarcoma virus
- CMV human cytomegalovirus
- the promoters may also be inducible so that the levels of expression of the heterologous gene can be regulated during the lifetime of the cell. Inducible means that the levels of expression obtained using the promoter can be regulated. Examples of inducible systems which may be used include the Tet-Off gene expression system (Gossen, M.
- the production of immunoglobulin able to bind specifically to an enzyme which catalyses the production of galactose ⁇ -1,3 - galactose is maintained throughout the lifetime of the cell in order to inhibit completely the production of galactose ⁇ -l,3-galactose.
- immunoglobulins able to bind specifically to an endogenous retroviral particle are produced, it is desired to maintain immunoglobulin production throughout the lifetime of the cell in order to prevent release of PERV particles.
- any of these promoters may be modified by the addition of further regulatory sequences, for example enhancer sequences.
- Tissue-specific enhancers capable of regulating expression in antibody-producing cells are preferred.
- the heavy-chain enhancer required for the successful activation of the antibody gene locus in vivo (Serwe, M., and Sablitzky, F., EMBO J. 12, p2321-2321, 1993) may be included.
- Locus control regions (LCRs), particularly the immunoglobulin LCR may also be used.
- Chimeric promoters may also be used comprising sequence elements from two or more different promoters.
- vectors of the present invention preferably contain other elements useful for optimal functioning of the vector in the mammal into which the vector is inserted. These elements are well known to those of ordinary skill in the art, and are described, for example in Sambrook et al., Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory Press, 1989.
- Vectors used for transforming mammalian embryos are constructed using methods well known in the art, including, without limitation, the standard techniques of restriction endonuclease digestion, ligation, plasmid and DNA and RNA purification, DNA sequencing, and the like as described, for example in Sambrook, Fritsch, and Maniatis, eds., Molecular Cloning: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. F. [1989]). If desired, analysis to confirm correct sequences in the constructed vectors is performed in a known fashion.
- the presence of a desired construct may be measured in a cell directly, for example, by conventional Southern blotting, dot blotting, PCR or in situ hybridisation, using an appropriately labelled probe which may be based on a sequence present in the gene. Those skilled in the art will readily envisage how these methods may be modified, if desired.
- Vectors and polynucleotides of the invention may be introduced into host cells for the purpose of replicating the vectors/polynucleotides and/or expressing the immunoglobulins of the invention encoded by the polynucleotides of the invention.
- the immunoglobulins of the invention may be produced using prokaryotic cells as host cells, it is preferred to use eukaryotic cells, for example yeast, insect or mammalian cells, in particular mammalian cells.
- Vectors/polynucleotides of the invention may introduced into suitable host cells using a variety of techniques known in the art, such as transfection, transformation and electroporation. Where vectors/polynucleotides of the invention are to be administered to animals, several techniques are known in the art, for example infection with recombinant viral vectors such as retroviruses, herpes simplex viruses and adenoviruses, direct injection of nucleic acids and biolistic transformation. These are discussed further below.
- the constructs of the present invention may be introduced into an animal to produce a fransgenic animal.
- the invention thus provides a transgenic animal including a construct of the invention.
- transgenic animal the transgene is contained in essentially all of the animal's cells, including germ cells, such that it can be transmitted to the animal's offspring.
- a "chimeric animal” the transgene is contained in at least some cells of the animal, but germ line transmission is not necessarily possible.
- the transgene may be limited to particular somatic tissues.
- "transgenic animals” in which germ line transmission of the transgene is possible, is preferred.
- the production of a chimeric animal in which the transgene is produced in a particular tissue or organ may be of use in, for example, the provision of that tissue or organ for xenotransplantation.
- references to “transgenic animals” in the present application should be understood to include reference to chimeric animals, unless the context demands otherwise.
- Embryo micromanipulation technologies now permit inteoduction of heterologous DNA into, for example, fertilised mammalian ova.
- totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal.
- developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo.
- the appropriate DNAs are coinjected into the pronucleus of embryos, preferably at the single cell stage, by standard methods.
- Injected eggs are then transferred, either directly or after culturing, into the oviducts of pseudopregnant recipients and the embryos allowed to develop into mature transgenic animals.
- Those techniques as well known see reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian fertilised ova, including Hogan et al, Manipulating the Mouse Embryo, (Cold Spring Harbor Press 1986); Krimpenfort et al, Bio/Technology 9:844 (1991); Palmiter et al, Cell, 41: 343 (198S); Kraemer et al, Genetic manipulation of the Mammalian Embryo, (Cold Spring Harbor Laboratory Press 198S); Hammer et al, Nature, 315: 680 (198S); Wagner et al, U.S. Pat. No. 5,175,385; Krimpenfort et al, U.S. Pat. No. 5,175,384, the respective contents of which are incorporated herein by reference).
- Transgenic animals may also be produced by nuclear transfer technology as described in Schnieke, A.E. et al, 1997, Science, 278: 2130 and Cibelli, J.B. et al, 1998, Science, 280: 1256.
- fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a polypeptide of interest under the confrol of regulatory sequences.
- Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.
- nucleotide constructs comprising a sequence encoding a DNA binding molecule are microinjected using, for example, the technique described in U.S. Pat. No. 4,873,191, into oocytes which are obtained from ovaries freshly removed from the mammal.
- the oocytes are aspirated from the follicles and allowed to settle before fertilisation with thawed frozen sperm capacitated with heparin and prefractionated by Percoll gradient to isolate the motile fraction.
- the fertilised oocytes are centrifuged, for example, for eight minutes at 15,000g to visualise the pronuclei for injection and then cultured from the zygote to morula or blastocyst stage in oviduct tissue-conditioned medium.
- This medium is prepared by using luminal tissues scraped from oviducts and diluted in culture medium.
- the zygotes must be placed in the culture medium within two hours following microinjection.
- Oestrous is then synchronized in the intended recipient mammals, by administering coprostanol. Oestrous is produced within two days and the embryos are transferred to the recipient 5-7 days after oestrous. Successful transfer can be evaluated in the offspring by Southern blot.
- the desired constructs can be introduced into embryonic stem cells (ES cells) and the cells cultured to ensure modification by the transgene.
- the modified cells are then injected into the blastula embryonic stage and the blastulas replaced into pseudopregnant hosts.
- the resulting offspring are chimeric with respect to the ES and host cells, and nonchimeric strains which exclusively comprise the ES progeny can be obtained using conventional cross-breeding. This technique is described, for example, in W091/10741. Further details of methods of constructing transgenic animals, for example pigs, can be found in US 6,166,288.
- Analysis of animals which may contain fransgenic sequences may be performed by either PCR, Northern or Southern blot analysis using a probe that is complementary to at least a portion of the transgene following standard methods.
- Western blot analysis using a ligand specific for the antibody encoded by the transgene may be employed as an alternative or additional method for screening.
- the tissues or cells believed to express the transgene at the highest levels are tested, although any tissues or cell types may be used for this analysis.
- Progeny of the fransgenic mammals may be obtained by mating the transgenic mammal with a suitable partner, or by in vitro fertilisation of eggs and/or sperm obtained from the transgenic mammal. Where in vitro fertilisation is used, the fertilised embryo maybe implanted into a surrogate host or incubated in vitro, or both. Where mating is used to produce transgenic progeny, the transgenic mammal may be backcrossed to a parental line. Using either method, the progeny may be evaluated for the presence of the transgene using methods described above, or other appropriate methods.
- the methods of the present invention may be used to provide fransgenic animals, on the cell membranes of which expression of the xenoantigen galactose ⁇ -1,3 galactose is reduced or eliminated.
- Cells, organs or tissues from such organisms may therefore be used in xenotransplantation to humans with the risk of hyperacute rejection of the transplant much reduced.
- the immunoglobulins inhibiting the production of the xenoantigen are expressed from polynucleotides integrated into the genome of the transplanted tissue, the immunoglobulins may be expressed throughout the lifetime of the tissue, providing constant protection from rejection by the recipient without the need for administration of such immunoglobulins to the recipient of the transplant.
- the methods of the invention may be used to inhibit the release of endogenous retroviral particles from cells of animals such as pigs by providing fransgenic animals that do not release PERVs due to the presence of blocking antibodies and thus reduce the risk of infection of a recipient.
- Immunoglobulins which specifically bind to PERV retroviral proteins may be used in the detection or diagnosis of PERVs.
- Antigen preparation and immunisation PERV-B gag cDNA (AJ13381) was amplified from PK15 cell RNA using the forward primer: Gag fw/Asp (5'ATAGGTACCATGGGACAGACAGTGACTACC 3') and reverse primer: Gag rv/Hind (5'ATAAGCTTGTCCGAACCCCGTCTCCTA 3').
- the 1.6 kb gag cDNA was cloned into the pET30-a expression vector (Novagen Inc. Winconsin, USA) and over-expressed upon IPTG induction in E. coli B121 DE3 (pLysS).
- p30 was cloned into pTRCB and parts of pi 5 were cloned into pGEX3x.
- Purified 60 kD Gag protein was used for immunisation of a New Zealand rabbit that yielded in a polyclonal rabbit antiserum against the PERVs Gag.
- the same protein was used for the immunisation of a young adult male Lama glama.
- the immunisation schedule was as previously described by van der Linden et al. (33)
- PK15 cells were fixed in 4% Paraformaldehyde and prepared for ultracryotom as previously described (34).
- Ultrathin cryosections (75nm) were immunolabeled with llama polyclonal antiserum against Gag (1:250) followed by the goat anti-llama Ig G antibody (1 :250)(Bethyl Laboratories, Inc. Texas, USA) and rabbit anti-goat antibody conjugated with 15 nm colloidal gold particles (1:20) (Aurion, Wageningen, NL) as described by Geuze et al. (35)
- VHHs ( ⁇ 500b ⁇ ) were separated by gel electrophoresis from the VHs of conventional antibodies containing the CHI exon ( ⁇ 800bp) and gel purified.
- the isolated DNA was Sfil Notl digested and cloned into Sfil /Notl of the phagemid vector pHENl (31).
- Transformation into TGI elecfrocompetent cells yielded in a llama single chain antibody library with estimated size of 10 6 recombinants. Two rounds of selection were performed using panning on antigen adsorbed onto plastic (immunotubes coated with 30 ⁇ g/ml and lO ⁇ g ml of purified Gag protein).
- the interaction buffer was 20mM Hepes, pH 7.4, 150 mM NaCl, 2mM EDTA and 0.005% Tween 20. Dilutions of different periplasmic fractions in the above buffer were firstly injected over the anti-myc surface and adjusted so as to give the same response and thus ensure that the same amount of anti-Gag VHH was present. The adjusted dilutions of periplasmic fractions were then passed at the same time over the control and Gag surfaces and the response at equilibrium was recorded. The amount of non-specific binding was small (less than 5% of the specific) and was subtracted from the specific response.
- Regeneration of the surfaces was accomplished with a 5il pulse of 0.005% SDS, which resulted in complete dissociation of bound protein and did not affect the binding capacity of the surface for subsequent interactions. Affinity or kinetic constants could not be obtained because of the inability to measure the exact concentration of VHH in the periplasmic fractions and therefore results are presented as relative Gag binding at equilibrium.
- the PK15 cells were grown in Dulbecco's modified Eagle medium/ Ham's F10 (Gibco-BRL, NL) containing 10% foetal calf serum and in later stages supplemented with the appropriate selection markers.
- the tet-on regulatory plasmid (pUHrT 62-1, generous gift from Dr. Bujard) containing rtTA2 s sequence was modified by introduction of the puromycin resistance gene as an eukaryotic selection marker.
- the resulting plasmid, pUHrT 62-1-puro was Seal linearised and transfected into PK15 cells using SuperFect Transfection Reagent (Qiagen, California, USA) according to the manufacturer instructions.
- Clones were selected on puromycin l ⁇ g/ml (Sigma, Zwijndrecht, NL), and screened in a transient transfection assay with the pBI-EGFP- Luc reporter plasmid (Clontech, California, USA). Each clone was tested for luciferase and EGFP expression (16) with and without doxycycline induction (500ng/ml). The clone that gave highest level of luciferase activity and EGFP expression in "on"state and no background in "off state was used for the transfection experiments with the antibody coding genes.
- clones were selected and grown in 800 ⁇ g/ml G418 (Gibco,UK). Tet on line and clones 13 and 17 were cultured to 40% confluency in 6- ell plates with 3ml of medium. Dox was added to half of the wells, all the wells were washed once after 8 hrs of induction to remove residual virus and the medium replaced for another 48 hrs of incubation. The cells were collected and used for Western blot, immunofluorescent staining and immunoelectron microscopy. The supernatant was collected for RTassays or RT-PCR.
- RT assay C-type Mn 2+ -dependent RT activity assay was performed on the cell-free supernatants from each clone in the un-induced and induced state using Cavidi HSkit (Cavidi Tech Ab, Uppsala, Sweden) according to the manufacturer instructions.
- RT-PCR Culture supernatant was harvested, filtered through 0.45- ⁇ m-pore-size filter and virions were pelleted by ulfracentrifugation for 2 hrs at 150000xg/ 30000rpm.
- Viral RNA was isolated using a commercially available kit (including a DNase step, Qiagen, California, USA).
- cDNA was synthesized using oligo dT and super RT (HT Biotechnology, Cambridge, UK).
- a previously described env specific set of primers for the PCR of PERV-A (pi 206/ pi 205) (32), PERV-B (pi 170/ pi 171) (1) and PERV-C (pi 172/ pi 173) (1) were used.
- PERV-A pi 206/ pi 205)
- PERV-B pi 170/ pi 171)
- PERV-C pi 172/ pi 173
- pol specific set of primers (for A, B and C type: pol fw 5'ATACTCCCCTGCTACCGGTT 3' and pol rv 5'CAAGAGGTTATAAGGGTTCGG 3') was used with the following cycle parameters: 92° C for 4 min, 36 cycles of 92° C for lmin, 53° C for lmin, 72° C for 1 min, followed by 10 min at 72° C.
- VHH variable heavy chain fragments
- PERV-B gag cDNA was amplified from porcine PK15 cell RNA, expressed in bacteria and the resulting protein was used for immunisation of a New Zealand rabbit that yielded in a polyclonal antiserum against the PERVs Gag. The same protein was used for the immunisation of a young adult male Lama glama. The specificity of both the rabbit and llama polyclonal antisera was tested on Western blots, immunocytochemistry and immunoelectron microscopy. Both sera recognise the precursor 60KD Gag polyprotein, intermediate forms and further processed matured forms of the viral structural proteins (major capsid (p27), matrix (pi 5), inner coat and nucleocapsid protein). Immunoelectron microscopy on PK15 cells cryosections, showed specific labelling of the virus particles (Figure 1A).
- cDNA was synthesized from RNA isolated from peripheral lymphocytes of the immunised llama and cloned to yield an immune llama single chain antibody phagemid library of 10° clones. Purified Gag protein was used to screen the library. Two rounds of selection were performed using panning on antigen adsorbed onto plastic. The clones positive in an ELISA assay using anti-myc antibody (9E10)(Covane, California, USA) for detection of VHHs, were analysed at the DNA level by Hinfl fingerprinting.
- Figure ID shows A5 VHH epitope mapping.
- the table shows a plus when the A5 antibody detects the full length or mutant protein and a minus when it does not recognise the protein because at least one of the epitopes has been lost.
- This Figure shows that the epitope of the gag protein pl5 (133 amino acids in size) that is recognised by the A5 antibody maps between amino acid 47 and 113 and involves the sequence PPPWV.
- PK15 cells containing the tet-on regulatory construct were stably transfected with the A5 single domain expression vector ( Figure 2B).
- Clones were kept on a double selection using puromycin and G418. After doxycycline (dox) induction, they were screened for expression of the A5 antibody by immunofluorescence using an anti-myc antibody. The expression of antibody differed from clone to clone, ranging from a few percent of cells expressing in some clones, up to a maximum of 90-95% of the cells expressing the A5 VHH (clone 13).
- Gag antigen could be detected by rabbit polyclonal antiserum in all of the non-induced cells ( Figure 3, Al, Bl, Cl). It is also detectable in those cells that were induced but did not express single chain antibody ( Figure 3, A2-3, B2-3, C2-3). Gag is detected at the plasma membrane in a punctate pattern. However, when the A5 VHH is expressed, the level of Gag protein drops below detection and the punctate staining pattern at the plasma membrane is lost ( Figure 3, B2-3, C2-3).
- Figure 5 shows loss of virus production in PK15 cells containing the tet-on regulatory construct stably transfected with an El 1 single domain expression vector. Two clones, El 1-1 and E- 11-15 are shown. Induction of expression of the antibody (red stain) results in a loss of virus production (green speckles), although the gag protein is still visible in the cells (diffuse green staining).
- Figure 6 shows loss of virus production in PK15 cells containing the tet-on regulatory construct stably transfected with D2 single domain expression vector.
- D2 recognises the p30 gag protein of PERV A and B.
- Patience, C Takeuchi, Y & Weiss, R.A. Infection of human cells by an endogenous retrovirus of pigs. Nature Med. 3, 282-286 (1997).
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Virology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Physics & Mathematics (AREA)
- Veterinary Medicine (AREA)
- Plant Pathology (AREA)
- Toxicology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0201611.1A GB0201611D0 (en) | 2002-01-24 | 2002-01-24 | Transgenic animal |
| GB0201611 | 2002-01-24 | ||
| PCT/IB2003/000653 WO2003062415A2 (en) | 2002-01-24 | 2003-01-24 | Transgenic animal comprising intracellular immunoglobins for xenotransplantation |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1470222A2 true EP1470222A2 (en) | 2004-10-27 |
Family
ID=9929668
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP03731802A Withdrawn EP1470222A2 (en) | 2002-01-24 | 2003-01-24 | Transgenic animal comprising intracellular immunoglobins for xenotransplantation |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1470222A2 (en) |
| AU (1) | AU2003237975A1 (en) |
| CA (1) | CA2474030A1 (en) |
| GB (1) | GB0201611D0 (en) |
| WO (1) | WO2003062415A2 (en) |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2846667B1 (en) * | 2002-11-06 | 2004-12-31 | Pasteur Institut | VARIABLE FRAGMENTS OF SINGLE-CHAIN CAMELIDE ANTIBODIES DIRECTED AGAINST BETA-AMYLOID PEPTIDE 1-42 AND THEIR APPLICATIONS FOR DIAGNOSIS AND TREATMENT OF NEUROAGREGATIVE DISEASES |
| GB0522460D0 (en) * | 2005-11-03 | 2005-12-14 | Prendergast Patrick T | Composition and method for the treatment of avian influenza |
| HUE052232T2 (en) | 2013-05-06 | 2021-04-28 | Scholar Rock Inc | Preparations and methods for modulating growth factor |
| US9879087B2 (en) | 2014-11-12 | 2018-01-30 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| US20170306046A1 (en) | 2014-11-12 | 2017-10-26 | Siamab Therapeutics, Inc. | Glycan-interacting compounds and methods of use |
| CN108463248B (en) | 2015-11-12 | 2022-10-21 | 西雅图基因公司 | Glycan interactive compounds and methods of use |
| EP3541847A4 (en) | 2016-11-17 | 2020-07-08 | Seattle Genetics, Inc. | GLYCAN INTERACTING COMPOUNDS AND METHOD FOR USE |
| EP3589319A4 (en) | 2017-03-03 | 2021-07-14 | Seagen Inc. | COMPOUNDS INTERACTING WITH GLYCAN AND METHODS OF USE |
-
2002
- 2002-01-24 GB GBGB0201611.1A patent/GB0201611D0/en not_active Ceased
-
2003
- 2003-01-24 WO PCT/IB2003/000653 patent/WO2003062415A2/en not_active Ceased
- 2003-01-24 EP EP03731802A patent/EP1470222A2/en not_active Withdrawn
- 2003-01-24 CA CA002474030A patent/CA2474030A1/en not_active Abandoned
- 2003-01-24 AU AU2003237975A patent/AU2003237975A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of WO03062415A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2474030A1 (en) | 2003-07-31 |
| GB0201611D0 (en) | 2002-03-13 |
| AU2003237975A1 (en) | 2003-09-02 |
| WO2003062415A3 (en) | 2004-06-03 |
| WO2003062415A2 (en) | 2003-07-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6641379B2 (en) | Transgenic mouse | |
| AU2002245335B2 (en) | Production of a monoclonal antibody by a transgenic avian | |
| US8084024B2 (en) | Method for producing antibodies | |
| AU682206B2 (en) | Intracellular immunization | |
| EP1106061A1 (en) | Method for modifying chromosomes | |
| JPH11514225A (en) | ARF-p19, a novel regulator of the mammalian cell cycle | |
| AU2002245335A1 (en) | Production of a monoclonal antibody by a transgenic avian | |
| KR101764426B1 (en) | Identification of antigen- or ligand-specific binding proteins | |
| US20240207318A1 (en) | Chimeric costimulatory receptors, chemokine receptors, and the use of same in cellular immunotherapies | |
| KR20220033468A (en) | Cells, tissues, organs and/or animals having one or more modified genes for enhanced xenograft survival and/or resistance | |
| US20030037347A1 (en) | Expression of xenogenous (human) immunoglobulins in cloned, transgenic ungulates | |
| KR20210137499A (en) | Genome-Editing Birds | |
| WO2003062415A2 (en) | Transgenic animal comprising intracellular immunoglobins for xenotransplantation | |
| KR20050000558A (en) | Transgenic Ungulates Capable of Human Antibody Production | |
| WO2021042050A1 (en) | Rna-regulated fusion proteins and methods of their use | |
| HRP20050237A2 (en) | Method of expressing gene in transgenic birds using retrovirus vector and transgenic birds thus obtained | |
| US20060150261A1 (en) | Intracellular antibodies for a retrovirus protein | |
| US20260021181A1 (en) | Chimeric costimulatory receptors, chemokine receptors, and the use of same in cellular immunotherapies | |
| JPWO2005065450A1 (en) | Transgenic birds and their production | |
| US6946266B2 (en) | Gene transfer in chicken bursal stem cells | |
| de Wit et al. | Intracellularly Expressed Single-Domain | |
| JP2001231403A (en) | Non-human animals carrying modified foreign chromosomes or fragments thereof | |
| HK40082059A (en) | Cells, tissues, organs, and/or animals having one or more modified genes for enhanced xenograft survival and/or tolerance | |
| EP4308140A1 (en) | Rna-regulated fusion proteins and methods of their use | |
| WO2010023928A1 (en) | Transgenic bird and method for production thereof, and method for production of protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20040819 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IT LI LU MC NL PT SE SI SK TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: ERASMUS UNIVERSITY MEDICAL CENTER ROTTERDAM |
|
| 17Q | First examination report despatched |
Effective date: 20070727 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20070801 |