EP1458847A1 - Novel nucleic acids, polypeptides, methods of making, and uses thereof - Google Patents

Abstract

HUMAN LGR9 GPCR polypeptides and related nucleic acids are provided. Included are natural HUMAN LGR9 GPCR homologs from several species and polypeptides comprising a HUMAN LGR9 GPCR domain having specific activity. The polypeptides may be produced recombinantly from transformed host cells with the subject nucleic acids. Also provided are 10 isolated hybridization probes and oligonucleotide primers capable of specifically hybridizing with the disclosed genes, specific binding agents and methods of making and using the subject compositions, including high throughput screens.

Description

NOVEL NUCLEIC ACIDS, POLYPEPTIDES, METHODS OF MAKING, AND

USES THEREOF

This application claims priority to U.S. Provisional Patent Application No. 60/299,385 filed June 19, 2001. All publications and patent applications cited in this specification are hereby incorporated by reference as if each individual publication or patent application were specifically and individually indicated to be incorporated by reference.

FIELD OF THE INVENTION

The field of this invention is nucleic acids and polypeptides which are G- protein-coupled receptor (GPCR) nucleic acids and polypeptides, and in particular, HUMAN LGR9 GPCR nucleic acids and polypeptides, as well as methods of making said polypeptides and methods of using said nucleic acids and polypeptides.

BACKGROUND OF THE INVENTION

G-protein coupled receptors (GPCRs) are a class of integral membrane proteins which contain seven hydrophobic transmembrane domains that span the cell membrane and form a cluster of anti-parallel alpha helices. These seven transmembrane domains provide many of the structural and functional features of the GPCR. The cluster of alpha helices forms a pocket into which a low-molecular-weight ligan can bind. In instances when the pocket must accommodate a larger ligand (e.g. a peptide or protein), either the extracellular N-terminal region of the GPCR or one or more of the three extracellular loops participate in binding the ligand. In some cases (e.g. metabotropic glutamate receptors, Ca⁺² sensing receptors and glycoprotein hormone receptors) a large extracellular amino-terminus of the receptor binds a ligand, and then this complex presumably binds to the extracellular loops to activate the receptor. In yet another mode of activation, some receptors (the protease activated receptors, e.g. PAR1 , PAR2, PAR3 and PAR4) are activated by cleavage of their extracellular amino-terminus. In this case the new amino- terminus generated by cleavage serves as a tethered ligand that binds to and activates the receptor. It is the binding of a ligand that activates the GPCR by triggering conformational changes in intracellular regions of the GPCR. Once activated, a GPCR interacts with an intracellular heterotrimeric G-protein causing it to release GDP and bind GTP as well as dissociating the a subunit from the bg subunit heterodimer. The activated a-GTP complex and free bg moieties mediate additional intracellular signaling, often including the activation of effector enzymes (e.g. adenylyl cyclase [Sunahara RK, et al., Aπnu Rev Pharmacol Toxicol. 1996,36:461 - 80]; phospholipase-Cb (Morris AJ; Scarlata S, Biochem Pharmacol 1997 Aug 15;54(4):429-35); and PI3-kinase (Zhong Li, Huiping Jiang, Wei Xie, Zuchuan Zhang, Alan V. Smrcka, and Dianqing Wu, Science 2000 287: 1046-1049; Guy Servant, Orion D. Weiner, Paul Herzmark, Tamas Balla, John W. Sedat, and Henry R. Bourne, Science 2000 287: 1037-1040)) that result in the production of intracellular second messengers, for example, cyclic AMP (cAMP), inositol (1 ,4,5) triphosphate, or phosphatidylinositol (3,4,5) triphosphate (Baldwin, J. M. (1994) Curr. Opin. Cell Biol. 6:180- 190). Free bg also has other effects, for instance the activation of K⁺ channels and inhibition of Ca⁺² channels (Clapham DE and Neer EJ, Annu Rev Pharmacol Toxicol 1997;37:167-203).

As stated supra, the N-terminus of GPCRs is located extracellularly. Its length can vary and it may or may not be glycosylated. The C-terminus is located intracellularly and is often phosphorylated upon activation. Alternating extracellular and intracellular loops connect the seven transmembrane domains (See Baldwin JM; Schertler GF; Unger VM, J Mol Biol 1997 Sep 12;272(1 ): 144-64 for a general review of GPCR structure).

GPCRs respond to many different types of ligands including, but not limited to, lipid analogs, amino acids and their derivatives, polypeptides, hormones and chemokines. In addition, GPCRs are able to respond to specialized types of stimuli such as light, taste, and odor. For example, GPCRs function in physiological processes including vision (the rhodopsins), smell (the olfactory receptors), neurotransmission (serotonin, metabotropic glutamate, GABA-B, muscariπic acetylcholine, dopamine, and adrenergic receptors), and hormonal responses (luteinizing hormone and thyroid-stimulating hormone receptors).

In accordance with the present invention, Applicants disclose herewith a novel, newly discovered GPCR that exhibits sequence homology to the previously described LGR7 (GenBank acc.#AAG17167). Applicants demonstrate that disruption of HUMAN LGR9 leads to cryptorchidism in mice. Cryptorchidism, or impaired testicular descent, is a common congenital abnormality which may affect fertility and result in further health complications, one example of which is testicular cancer. The gubemaculum is one of two ligaments involved in the decent of the gonads. Previously it has been shown that mice mutant for lnsl-3 exhibit cryptorchidism (See Nef, S and Parada, LF, Nature Genetics 1999 Jul 22; 22:295 - 299). lnsl-3 has been shown to induce gubemaculum development, (see Zimmermann, S; Steding, G; Emmen, JM; Brinkmann, AO; Nayernia, K, Mol Endo 1999; 13(5): 681 - 691 ). Relaxin is a molecule that has been shown to be involved in the softening of the pubic ligaments of guinea pig, as well as having other physiological implications for reproductive organs (and Zhao, L; Roche, PJ; Gunnersen, JM; Hammond, VE; Treger, GW; Wintour, EM; Beck, F, Endocrinology 1999; 140(1) 445 - 453). Applicants have demonstrated that relaxin and human lnsl-3 activate human LGR9. The discovery of a new molecule, termed HUMAN LGR9 GPCR, and the nucleic acids encoding it provide new compositions which are useful in the diagnosis, prevention and treatment of cryptorchidism, improper gonad development, atrophy and atrophy-related conditions, as well as muscular, fertility, pregnancy or other disorders and in the development of assays to screen for molecules that modulate HUMAN LGR9 GPCR activity.

SUMMARY OF THE INVENTION

The subject invention provides for isolated HUMAN LGR9 GPCR polypeptides and polypeptides comprising a fragment or derivative thereof.

The subject invention also provides for isolated HUMAN LGR9 GPCR polypeptides, comprising the amino acid sequence as set forth in Figure 1A- 1 FA-1 F.

The subject invention further provides for the isolated HUMAN LGR9 GPCR polypeptides encoded by the nucleic acid molecule as set forth in Figure 1A- 1 FA-1 F .

Another embodiment of the invention is a vector which comprises nucleic acid molecule as set forth in Figure 1A-1 F and SEQ ID NO. 1 , the coding region thereof, a nucleotide sequence that hybridizes thereto, the complement thereof, or a nucleotide sequence which, as a result of the degeneracy of the genetic code, differs from the aforementioned.

A further embodiment is a vector wherein the nucleic acid molecule is operatively linked to an expression control sequence capable of directing its expression in a host cell.

In yet another embodiment the vector is a plasmid.

An additional embodiment of the invention is a fusion protein. Such fusion may comprise an extracellular region of the HUMAN LGR9 GPCR protein and may be fused to an immunoglobulin, an immunoglobulin constant region or a fragment thereof. Such extracellular regions may comprise the amino terminus of HUMAN LGR9 both with and without the predicted signal sequence, the amino acids located between the second and third transmembrane domains, the amino acids located between the fourth and fifth transmembrane domains, the amino acids located between the sixth and the seventh transmembrane domains, or any combination thereof. The predicted signal sequence comprises amino acid residues 1 - 36 of Figure 4. The extracellular amino terminus comprises amino acid residues 1 - 418 of Figure 4 including the signal sequence or amino acid residues 36 - 418 of Figure 4 without the signal sequence; the extracellular region between the second and third transmembrane domains comprises amino acid residues 471 - 498 of Figure 4 , the extracellular region between the fourth and fifth transmembrane domains comprises amino acid residues 560 - 591 of Figure 4 , and the extracellular region between the sixth and seventh transmembrane domains comprises amino acid residues 659 - The invention also contemplates an isolated HUMAN LGR9 GPCR polypeptide comprising amino acid sequence of an allelic variant of an amino acid sequence shown in Figure 4, where in said allelic variant in encoded by a nucleic acid molecule that hybridizes under stringent condition to the opposite strand of a nucleic acid molecule shown in Figure 1 , and an amino acid sequence of an ortholog of an amino acid sequence shown in Figure 4, wherein said ortholog is encoded by a nucleic acid molecule that hybridizes under stringent condition to the opposite strand of a nucleic acid molecule shown in Figure 1 , and a fragment of an amino acid sequence shown in Fig 4 wherein said fragment comprises at least 10 contiguous amino acids.

The invention further contemplates an isolated nucleic acid molecule having a sequence that hybridizes under stringent conditions to the complement of the nucleotide sequence of Figure 1 and which encodes HUMAN LGR9 GPCR, wherein said stringent conditions are 30% formamide in 5 x SSPE (0.18 M NaCl, 0.01 M NaPO₄, pH 7.7, 0.001 M EDTA) buffer at a temperature of 42°C and wherein said nucleotide sequence remains bound when subject to washing at 42°C with 0.2 x SSPE; or a nucleotide sequence which, as a result of the degeneracy of the genetic code, differs from this nucleic acid and which encodes HUMAN LGR9 GPCR.

Another embodiment of the invention is a host-vector system for the expression of HUMAN LGR9 GPCR which comprises a vector in a host cell wherein the host cell is a bacterial, yeast, insect, amphibian or mammalian cell.

The invention further contemplates a method of producing HUMAN LGR9 GPCR which comprises growing cells of a host-vector system under conditions permitting expression of the HUMAN LGR9 GPCR, and recovering the HUMAN LGR9 GPCR so produced.

Still another embodiment of the invention provides for an antibody which specifically binds the HUMAN LGR9 GPCR polypeptide. The antibody may be a polyclonal antibody or a monoclonal antibody, including a wholly human monoclonal antibody.

The invention provides for a composition comprising HUMAN LGR9 GPCR polypeptide and a carrier as well as a composition comprising an antibody and a carrier wherein the compositions are for use in a method of treatment of the human or animal body, or in a method of diagnosis.

The invention also contemplates a method of treating cryptorchidism comprising activating a HUMAN LGR9 expressed in a cell, such as for example a gubemaculum cell. Such cell may be activated by lnsl-3 or relaxin.

In another embodiment, hypertrophy is induced in muscle cells by transfecting the muscles cells with HUMAN LGR9. The invention embodies the induction of hypertrophy through transfection of muscle cells with HUMAN LGR9, or activation of the HUMAN LGR9 in a cell naturally expressing such receptor, as a treatment for conditions associated with a decrease in muscle mass, or atrophy. The invention also embodies utilization of the phenotypic hypertrophy as a marker of activation of HUMAN LGR9.

An additional embodiment of the invention provides for a method of screening for ligands of HUMAN LGR9 comprising: (a) contacting cells expressing LGR9 with the molecule to be screened, and (b) observing the cells to detect a hypertrophic phenotype. In addition, the invention provides for a method of screening for ligands of LGR9 comprising: (a) contacting cells expressing LGR9 with the molecule to be screened, and (b) utilizing a reporter molecule as an indicator of LGR9 activation. In either of these embodiments, the cell expressing LGR9 may be a transfected cell, or a cell which naturally expresses LGR9.

Another embodiment of the invention provides a method of identifying a HUMAN LGR9 GPCR binding target comprising (a) contacting HUMAN LGR9 GPCR polypeptide with a test sample suspected of containing a HUMAN LGR9 GPCR binding target; (b) contacting HUMAN LGR9 GPCR polypeptide with a control sample that does not contain a HUMAN LGR9 GPCR binding target, and (c ) comparing the amount of binding in (a) to the amount of binding in (b) wherein a greater amount of binding in (a) is indicative of the presence of a HUMAN LGR9 GPCR binding target in the test sample.

Another embodiment of the invention provides a method of identifying modulators of HUMAN LGR9 GPCR function using a ligand displacement assay. In such an assay potential modulators are identified by incubating a test sample with the HUMAN LGR9 GPCR protein and a known labeled binding partner. The amount of the known labeled binding partner which binds to the HUMAN LGR9 GPCR protein in the mixture is determined and compared to the amount which binds in a parallel reaction lacking the test sample. A reduction in the amount of known labeled binding partner in the presence of the test sample compared to the parallel reaction indicates the presence of a HUMAN LGR9 GPCR modulator in the test sample. Modulators in this assay can be either agonists or antagonists. Another embodiment of the invention provides a method of identifying modulators of HUMAN LGR9 GPCR function using a biological readout in HUMAN LGR9 GPCR expressing cells or cell fragments. Agonists are identified by incubating cells or cell fragments engineered to express the HUMAN LGR9 GPCR protein with test samples and measuring a biological response in these cells and in parallel cells or cell fragments not expressing the HUMAN LGR9 GPCR protein. An increased biological response in the cells or cell fragments expressing the HUMAN LGR9 GPCR protein compared to the parallel cells or cell fragments indicates the presence of an agonist in the test sample. Likewise, antagonists are identified by incubating cells or cell fragments engineered to express the HUMAN LGR9 GPCR protein with test samples in the presence of a known HUMAN LGR9 GPCR agonist. The amount of biological response is measured and compared to a parallel reaction lacking the test sample. A reduction of the biological response in the presence of the test sample compared to the parallel reaction indicates the presence of an antagonist.

Known binding partners and agonists may include lnsl-3 and relaxin.

The invention also provides for a method of inducing hypertrophy in muscle cells by transfecting the muscle cells with HUMAN LGR9 or activating a naturally occurring HUMAN LGR9 expressed in a cell. Such method may be used as a treatment for conditions associated with a decrease in muscle mass, or atrophy.

Additionally the invention contemplates a method of detecting activation of HUMAN LGR9 by observing the phenotypic hypertrophy following transfection of a cell with HUMAN LGR9. Further the invention comprises a method of screening for ligands for HUMAN LGR9 comprising contacting cells expressing HUMAN LGR9 with a molecule to be screened, and observing the cell to detect a hypertrophic phenotype.

The subject invention provides for unique polypeptides called HUMAN LGR9 GPCR encoded by nucleic acids as set forth in Figure 1A-1 F and SEQ ID NO.1 which were initially identified as a partial sequence by screening virtual proteins derived from the NCBI human genomic sequence database with sequences obtained from known and predicted family members. The full-length sequence set forth in Figure 1A-1 F was derived by testing predicted mRNAs by RT-PCR and extension using 5' RACE (Frohman MA, Dush MK, Martin GR, Proc Natl Acad Sci USA, 1988 Dec; 85(23): 8998- 9002) .

The invention comprises nucleic acids which are complementary to the HUMAN LGR9 GPCR sequences as set forth in Figure 1A-1 F.

The invention also comprises the use of HUMAN LGR9 GPCR sequences to identify and obtain a full length HUMAN LGR9 GPCR cDNA.

The invention further comprises the use of oligomers from the HUMAN LGR9 GPCR sequence in a HUMAN LGR9 GPCR kit which can be used to identify a disorder or disease with altered HUMAN LGR9 GPCR expression and provide a method for monitoring progress of a patient during drug therapy.

In addition, the invention comprises the use of HUMAN LGR9 GPCR-specific antibodies in assays to identify a disorder or disease with altered HUMAN LGR9 GPCR expression and provides a method to monitor the progress of a patient during drug therapy.

Another embodiment of the invention is a competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising a) obtaining cells expressing on their cell surface HUMAN LGR9 GPCR, b) contacting the cells with a first agent known to bind to HUMAN LGR9 GPCR, c) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR, d) contacting (b) with a second agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown, e) detecting the amount of binding of the first agent in (d) to HUMAN LGR9 GPCR, and f) comparing the amount of binding of the first agent detected in (c) with the amount of binding of the first agent detected in (e) wherein a decrease in the amount of binding of the first agent is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

Another embodiment of the invention is a competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising a) preparing a sample comprising HUMAN LGR9 GPCR, b) contacting the sample with a first agent known to bind to HUMAN LGR9 GPCR. c) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR, d) contacting (b) with a second agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown, e) detecting the amount of binding of the first agent in (d) to HUMAN LGR9 GPCR, and f) comparing the amount of binding of the first agent detected in (c) with the amount of binding of the first agent detected in (e) wherein a decrease in the amount of binding of the first agent is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR. Another embodiment of the invention is a competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising a) obtaining cells expressing on their cell surface HUMAN LGR9 GPCR, b) contacting a test sample of the cells of (a) with a first agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown, c) contacting the test sample of the cells of (b) with a second agent known to bind to HUMAN LGR9 GPCR, d) contacting a control sample of the cells of (a) with the second agent known to bind to HUMAN LGR9 GPCR, e) detecting the amount of binding of the second agent in (c) to HUMAN LGR9 GPCR, f) detecting the amount of binding of the second agent in (d) to HUMAN LGR9 GPCR, and g) comparing the amount of binding of the second agent detected in (e) with the amount of binding of the second agent detected in (f) wherein a lesser amount of binding of the second agent in (e) is indicative of the first agent's ability to specifically bind to HUMAN LGR9 GPCR.

Another embodiment of the invention is a competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising a) preparing a sample comprising HUMAN LGR9 GPCR, b) contacting a test sample of the sample of (a) with a first agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown, c) contacting the test sample of (b) with a second agent known to bind to HUMAN LGR9 GPCR, d) contacting a control sample of the sample of (a) with the second agent known to bind to HUMAN LGR9 GPCR, e) detecting the amount of binding of the second agent in (c) to HUMAN LGR9 GPCR, f) detecting the amount of binding of the second agent in (d) to HUMAN LGR9 GPCR, and g) comparing the amount of binding of the second agent detected in (e) with the amount of binding of the second agent detected in (f) wherein a lesser amount of binding of the second agent in (e) is indicative of the first agent's ability to specifically bind to HUMAN LGR9 GPCR.

Another embodiment of the invention is a competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising a) obtaining cells expressing on their cell surface HUMAN LGR9 GPCR, b) contacting a test sample of the cells of (a) with a first agent known to bind to HUMAN LGR9 GPCR and with a second agent whose ability to bind to HUMAN LGR9 GPCR is unknown, c) contacting a control sample of the cells of (a) with the first agent known to bind to HUMAN LGR9 GPCR, d) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR, e) detecting the amount of binding of the first agent in (c) to HUMAN LGR9 GPCR, and f) comparing the amount of binding of the first agent detected in (d) with the amount of binding of the first agent detected in (e) wherein a decrease in the amount of binding of the first agent in (d) is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

Another embodiment of the invention is a competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising a) preparing a sample comprising HUMAN LGR9 GPCR, b) contacting a test sample of the sample of (a) with a first agent known to bind to HUMAN LGR9 GPCR and with a second agent whose ability to bind to HUMAN LGR9 GPCR is unknown, c) contacting a control sample of the sample of (a) with the first agent known to bind to HUMAN LGR9 GPCR, d) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR, e) detecting the amount of binding of the first agent in (c) to HUMAN LGR9 GPCR, and f) comparing the amount of binding of the first agent detected in (d) with the amount of binding of the first agent detected in (e) wherein a decrease in the amount of binding of the first agent in (d) is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

In particular embodiments of the invention the detection of specific binding of the agent to HUMAN LGR9 GPCR is accomplished by any one of the methods selected from the group consisting of radioactive detection, fluorescence detection, chromogenic detection, mass spectroscopy, and plasmon resonance.

In another particular embodiment of the invention the detection of specific binding of the agent to HUMAN LGR9 GPCR is accomplished by detecting a biological response wherein the biological response is selected from the group consisting measuring Ca²⁺ ion flux, cAMP, IP₃, PIP₃ and transcription of reporter genes. Suitable reporter genes include endogenous genes as well as exogenous genes that are introduced into a cell by any of the standard methods familiar to the skilled artisan, such as transfection, electroporation, lipofection and viral infection.

In a further embodiment of the invention the cell expressing HUMAN LGR9 GPCR is a mammalian cell and in a particular embodiment the mammalian cell is a COS-7 cell, a 293 human embryonic kidney cell, a NIH 3T3 cell, or Chinese hamster ovary (CHO) cell.

The proteins of the present inventions are GPCRs that participate in signaling pathways mediated by the cells that express these proteins. Experimental data indicates expression in the gubemaculum and muscle tissue. As used herein, a "signaling pathway" refers to the modulation (e.g., stimulation or inhibition) of a cellular function/activity upon the Binding of a ligand to the GPCR protein. Examples of such functions include mobilization of intracellular molecules that participate in a signal transduction pathway, e.g., phosphatidylinositol 4,5-bisphosphate (PIP₃), inositol 1 ,4,5-triphosphate (IP₃) and adenylate cyclase; polarization of the plasma membrane; production or secretion of molecules; alteration in the structure of a cellular component; cell proliferation, e.g., synthesis of DNA; cell migration; cell differentiation; and cell survival.

The response mediated by the receptor protein depends on the type of cell it is expressed on. Some information regarding the types of cells that express other members of the subfamily of GPCRs of the present invention is already known in the art (see US Patent Application No 20020053091 which is hereby incorporated by reference in its totality). For example, in some cells, binding of a ligand to the receptor protein may stimulate an activity such as release of compounds, gating of a channel, cellular adhesion, migration, differentiation, etc., through phosphatidylinositol or cyclic AMP metabolism and turnover while in other cells, the binding of the ligand will produce a different result. Regardless of the cellular activity/response modulated by the particular GPCR of the present invention, a skilled artisan will clearly know that the receptor protein is a GPCR and interacts with G proteins to produce one or more secondary signals, in a variety of intracellular signal transduction pathways, e.g., through phosphatidylinositol or cyclic AMP metabolism and turnover, in a cell thus participating in a biological process in the cells or tissues that express the GPCR.

As used herein, "phosphatidylinositol turnover and metabolism" refers to the molecules involved in the turnover and metabolism of phosphatidylinositol 4,5-bisphosphate (PIP₂) as well as to the activities of these molecules. PIP₂ is a phospholipid found in the cytosolic leaflet of the plasma membrane. Binding of ligand to the receptor activates, in some cells, the plasma-membrane enzyme phospholipase C that in turn can hydrolyze PIP_εto produce 1 ,2-diacylglycerol (DAG) and inositol 1 ,4,5- triphosphate (IP₃). Once formed IP₃ can diffuse to the endoplasmic reticulum surface where it can bind an IP.sub.3 receptor, e.g., a calcium channel protein containing an IP.sub.3 binding site. IP.sub.3 binding can induce opening of the channel, allowing calcium ions to be released into the cytoplasm. IP.sub.3 can also be phosphorylated by a specific kinase to form inositol 1 ,3,4,5-tetraphosphate (IP₄), a molecule that can cause calcium entry into the cytoplasm from the extracellular medium. IP.sub.3 and IP.sub.4 can subsequently be hydrolyzed very rapidly to the inactive products inositol 1 ,4-biphosphate (IP₂) and inositol 1 ,3,4-thphosphate, respectively. These inactive products can be recycled by the cell to synthesize PIP₂. The other second messenger produced by the hydrolysis of PIP₂, namely 1 ,2-diacylglycerol (DAG), remains in the cell membrane where it can serve to activate the enzyme protein kinase C. Protein kinase C is usually found soluble in the cytoplasm of the cell, but upon an increase in the intracellular calcium concentration, this enzyme can move to the plasma membrane where it can be activated by DAG. The activation of protein kinase C in different cells results in various cellular responses such as the phosphorylation of glycogen synthase, or the phosphorylation of various transcription factors, e.g., NF-kB. The language "phosphatidylinositol activity", as used herein, refers to an activity of IP₃, PIP₂ or one of its metabolites. Another signaling pathway in which the receptor may participate is the cAMP turnover pathway. As used herein, "cyclic AMP turnover and metabolism" refers to the molecules involved in the turnover and metabolism of cyclic AMP (cAMP) as well as to the activities of these molecules. Cyclic AMP is a second messenger produced in response to ligand-induced stimulation of certain G protein coupled receptors. In the cAMP signaling pathway, binding of a ligand to a GPCR can lead to the activation of the enzyme adenyl cyclase, which catalyzes the synthesis of cAMP. The newly synthesized cAMP can in turn activate a cAMP-dependent protein kinase. This activated kinase can phosphorylate a voltage-gated potassium channel protein, or an associated protein, and lead to the inability of the potassium channel to open during an action potential. The inability of the potassium channel to open results in a decrease in the outward flow of potassium, which normally repolarizes the membrane of a neuron, leading to prolonged membrane depolarization.

By targeting an agent to modulate a GPCR, the signaling activity and biological process mediated by the receptor can be agonized or antagonized in specific cells and tissues. Such agonism and antagonism serves as a basis for modulating a biological activity in a therapeutic context (mammalian therapy) or toxic context (anti-cell therapy, e.g. anticancer agent).

The present invention also embodies a method for producing human Insl3 in animal cell culture comprising transfecting cells with nucleic acids encoding Insl3 such that Insl3 is produced, and isolating said Insl3 from said culture. The cell culture may comprise COS cells. BRIEF DESCRIPTION OF THE FIGURES

Figure 1A-1 F. The nucleic acid sequences (sense and antisense) and deduced amino acid sequence of HUMAN LGR9 GPCR. Three potential start codons are underlined. The first two give rise to a precursor protein with a signal sequence that is predicted to be most likely to be cleaved after the Thr residue encoded by nts 176-178, e.g. between Ala Leu Thr and Gin Gly (http://www.cbs. dtu.dk/services/SignalP-2.0/, Henrik Nielsen, Jacob Engelbrecht, Søren Brunak and Gunnar von Heijne, (1997) Protein Engineering, 10, 1 -6).

Figure 2A-2B. A sequence comparison of LGR7 and HUMAN LGR9 GPCR. The high degree of homology indicates that HUMAN LGR9 GPCR is also a putative GPCR family member.

Figure 3. Expression pattern of HUMAN LGR9 GPCR using TaqMan analysis. The LGR9 gene is expressed testis, skeletal muscle, fetal brain and uterus.

Figure 4. The amino acid sequence of HUMAN LGR9 indicating the predicted signal sequence and extracellular portions.

Figure 5: HEK293 were transfected with pCDNA3.1 (HEK293) or pCDNA3.1-LGR9 (LGR9/HEK293) in 10 cm plates using Fugene (Roche). 24 hours later cells were trypsinized and seeded into poly-d-lysine coated, 96-well culture plates (100 ml/well). After an additional 24 hours, cells were treated with 10 microliters of conditioned medium from untransfected COS7 cells (Mock), 10 microliters of conditioned medium from Insl3-transfected COS7 cells (Insl3) or 10 nM porcine relaxin obtained from A.F. Parlow at the National Hormone and Pituitary Program, Harbor-UCLA Medical Center (Relaxin). Levels of cAMP was measured by competitive ELISA using the cAMP-Screen kit (Tropix) according to the manufacturers recommendation.

DEFINITIONS

An "oligonucleotide" or "oligomer" is a stretch of nucleotide residues which has a sufficient number of bases to be used in a polymerase chain reaction (PCR). These short sequences are based on (or designed from) genomic or cDNA sequences and are used to amplify, confirm, or reveal the presence of an identical, similar or complementary DNA or RNA in a particular cell or tissue or test sample. Oligonucleotides or oligomers comprise portions of a DNA sequence having at least about 10 nucleotides and as many as about 50 nucleotides, preferably about 15 to 30 nucleotides. They are chemically synthesized and may be used as probes.

"Probes" are nucleic acid sequences of variable length, preferably between at least about 10 and as many as about 6,000 nucleotides, depending on use. They are used in the detection of identical, similar, or complementary nucleic acid sequences in a particular cell or tissue or test sample. Longer length probes are usually obtained from a natural or recombinant source, are highly specific and much slower to hybridize than oligomers. They may be single- or double-stranded and carefully designed to have specificity in PCR, hybridization membrane-based, or ELISA-like technologies. "Reporter" molecules are chemical moieties used for labeling a nucleic or amino acid sequence. They include, but are not limited to, radionuclides, enzymes, fluorescent, chemi-luminescent, or chromogenic agents. Reporter molecules associate with, establish the presence of, and may allow quantification of a particular nucleic or amino acid sequence.

"Reporter genes" include endogenous genes as well as exogenous genes that are introduced into a cell by any of the standard methods familiar to the skilled artisan, such as transfection, electroporation, lipofection, and viral infection.

A "portion", "region", or "fragment" of a nucleic acid comprises all or any part of the nucleic acid sequence having fewer nucleotides than about 6 kb, preferably fewer than about 1 kb. Such portions or fragments may be used as probes may be labeled with reporter molecules using nick translation, Klenow fill-in reaction, PCR or other methods well known in the art. After pretesting to optimize reaction conditions and to eliminate false positives, nucleic acid probes may be used in Southern, northern or in situ hybridizations to determine whether DNA or RNA encoding the protein is present in a biological sample, cell type, tissue, organ or organism. The portions or fragments may also be used to construct fusion molecules. These fusion molecules may be made by fusing a nucleic acid encoding a first polypeptide with a nucleic acid encoding a second polypeptide such that the final fused nucleic acid encodes a soluble polypeptide.

"Recombinant nucleotide variants" are nucleic acids which encode a protein. They may be synthesized by making use of the "redundancy" in the genetic code. Various codon substitutions, such as the silent changes which produce specific restriction sites or codon usage-specific mutations, may be introduced to optimize cloning into a plasmid or viral vector or expression in a particular prokaryotic or eukaryotic host system, respectively.

"Control elements" or "regulatory sequences" or "expression control sequences" are those nontranslated regions of the gene or DNA such as enhancers, promoters, introns and 3' untranslated regions which interact with cellular proteins to carry out replication, transcription, and translation. They may occur as boundary sequences or even split the gene. They function at the molecular level and along with regulatory genes are very important in development, growth, differentiation and aging processes.

"Chimeric" or "fusion" molecules are nucleic acids or polypeptides which are created by fusing or combining one or more of nucleic acid sequences of this invention (or their parts) with additional nucleic acid sequence(s). Such fused or combined sequences may be introduced into an appropriate vector and expressed to give rise to a chimeric polypeptide which may be expected to be different from the native molecule in one or more of the following characteristics: cellular location, distribution, ligand-binding affinities, interchain affinities, degradation/turnover rate, signaling, etc.

"Active" is that state in which a polypeptide is capable of being useful or of carrying out some role or function. In the subject application, it specifically refers to those forms, fragments, or domains of a polypeptide sequence which display the biologic and/or immunogenic activity characteristic of the naturally occurring HUMAN LGR9 GPCR. "Naturally occurring HUMAN LGR9 GPCR" refers to a polypeptide produced by cells which have not been genetically engineered or which have been genetically engineered to produce the same sequence as that which is naturally produced. Specifically contemplated by the invention are various polypeptides which arise from post-translational modifications. Such modifications of the polypeptide include, but are not limited to, acetylation, carboxylation, glycosylation, phosphorylation, lipidation and acylation.

"Derivative" refers to those polypeptides which have been chemically modified by such techniques as ubiquitination, labeling (see above), pegylation (derivatization with polyethylene glycol), and chemical insertion or substitution of amino acids such as ornithine which do not normally occur in human proteins.

"Recombinant polypeptide variant" refers to any polypeptide which differs from naturally occurring HUMAN LGR9 GPCR by amino acid insertions, deletions and/or substitutions, created using recombinant DNA techniques. Guidance in determining which amino acid residues may be replaced, added or deleted without abolishing characteristics of interest may be found by comparing the sequence of HUMAN LGR9 GPCR with that of related polypeptides and minimizing the number of amino acid sequence changes made in highly conserved regions.

Amino acid "substitutions" are defined as one-for-one amino acid replacements. They are conservative in nature when the substituted amino acid has similar structural and/or chemical properties. Examples of conservative replacements are substitution of a leucine with an isoleucine or valine, an aspartate with a glutamate, or a threoπine with a serine. Non-conservative substitutions involve replacement with an amino acid that has significantly different structural and/or chemical properties than the amino acid residue it is replacing.

Amino acid "insertions" or "deletions" are changes to or within an amino acid sequence. They typically fall in the range of about 1 to 5 amino acids. The variation allowed in a particular amino acid sequence may be experimentally determined by producing the peptide synthetically or by systematically making insertions, deletions, or substitutions of nucleotides in the HUMAN LGR9 GPCR sequence using recombinant DNA techniques.

A "signal or leader sequence" or "signal peptide" is a short amino acid sequence which or can be used, when desired, to direct the polypeptide through a membrane of a cell. Such a sequence may be naturally present on the polypeptides of the present invention or provided from heterologous sources by recombinant DNA techniques.

An "oligopeptide" is a short stretch of amino acid residues and may be expressed from an oligonucleotide. It may be functionally equivalent to and either the same length as or considerably shorter than a "fragment", "portion ", or "segment" of a polypeptide. Such sequences comprise a stretch of amino acid residues of at least about 5 amino acids and often about 17 or more amino acids, typically at least about 9 to 13 amino acids, and of sufficient length to display biologic and/or immunogenic activity.

An "inhibitor" is a substance which retards or prevents a chemical or physiological reaction or response. Common inhibitors include but are not limited to antisense molecules, antibodies, antagonists and their derivatives.

An "agonist" is a substance that causes activation of a receptor as measured by any of a number or biological or biochemical readouts.

An "antagonist" is a substance which prevents activation or retards the activation of a receptor by an agonist.

A "standard" is a quantitative or qualitative measurement for comparison. Preferably, it is based on a statistically appropriate number of samples and is created to use as a basis of comparison when performing diagnostic assays, running clinical trials, or following patient treatment profiles. The samples of a particular standard may be normal or similarly abnormal.

"Animal" as used herein may be defined to include human, domestic (cats, dogs, etc.), agricultural (cows, horses, sheep, goats, chicken, fish, etc.) or test species (amphibian, frogs, mice, rats, rabbits, simians, etc.).

"Disorders or diseases" in which altered HUMAN LGR9 GPCR activity have been implicated specifically include, but are not limited to, reproductive diseases, diseases related to cellular metabolism, growth, development, blood and bone homeostasis.

Since the list of technical and scientific terms cannot be all encompassing, any undefined terms shall be construed to have the same meaning as is commonly understood by one of skill in the art to which this invention belongs. Furthermore, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. For example, reference to a "restriction enzyme" or a "high fidelity enzyme" may include mixtures of such enzymes and any other enzymes fitting the stated criteria, or reference to the method includes reference to one or more methods for obtaining cDNA sequences which will be known to those skilled in the art or will become known to them upon reading this specification.

Before the present sequences, variants, formulations and methods for making and using the invention are described, it is to be understood that the invention is not to be limited only to the particular sequences, variants, formulations or methods described. The sequences, variants, formulations and methodologies may vary, and the terminology used herein is for the purpose of describing particular embodiments. The terminology and definitions are not intended to be limiting since the scope of protection will ultimately depend upon the claims.

DETAILED DESCRIPTION OF THE INVENTION

The subject Application provides for the identification of a novel member of the GPCR family of receptors called HUMAN LGR9 GPCR. The present invention provides for HUMAN LGR9 GPCR nucleic acid and their deduced amino acid sequences. These sequences were identified by their similarity to published or known open reading frames. Since GPCRs are associated with basic cellular processes such as cell proliferation, differentiation and cell signaling, these sequences are useful in the characterization of and delineation of normal and abnormal processes. The HUMAN LGR9 GPCR nucleic acid sequences that are the subject of the present invention are useful in a variety of diagnostic assays used to evaluate the role of specific HUMAN LGR9 GPCRs in normal, diseased, or therapeutically treated cells or tissues.

The present invention provides nucleic acid sequences that encode protein molecules that have been identified as being members of the GPCR family of proteins (protein sequences are provided in FIG. 4 and nucleic acid sequences are provided in FIG. 1). The peptide sequences provided in FIG. 4, as well as the obvious variants described herein, particularly allelic variants as identified herein and using the information in FIG. 1 , will be referred herein as the GPCR peptides of the present invention, GPCR peptides, or peptides/proteins of the present invention.

The present invention provides isolated peptide and protein molecules that consist of, consist essentially of, or comprise the amino acid sequences of the GPCR peptides disclosed in FIG. 4, (encoded by the nucleic acid molecule shown in FIG. 1), as well as all obvious variants of these peptides that are within the art to make and use. Some of these variants are described in detail below.

As used herein, a peptide is said to be "isolated" or "purified" when it is substantially free of cellular material or free of chemical precursors or other chemicals. The peptides of the present invention can be purified to homogeneity or other degrees of purity. The level of purification will be based on the intended use. The critical feature is that the preparation allows for the desired function of the peptide, even if in the presence of considerable amounts of other components.

In some uses, "substantially free of cellular material" includes preparations of the peptide having less than about 30% (by dry weight) other proteins (i.e., contaminating protein), less than about 20% other proteins, less than about 10% other proteins, or less than about 5% other proteins. When the peptide is recombinantly produced, it can also be substantially free of culture medium, i.e., culture medium represents less than about 20% of the volume of the protein preparation.

The language "substantially free of chemical precursors or other chemicals" includes preparations of the peptide in which it is separated from chemical precursors or other chemicals that are involved in its synthesis. In one embodiment, the language "substantially free of chemical precursors or other chemicals" includes preparations of the GPCR peptide having less than about 30% (by dry weight) chemical precursors or other chemicals, less than about 20% chemical precursors or other chemicals, less than about 10% chemical precursors or other chemicals, or less than about 5% chemical precursors or other chemicals.

The isolated GPCR peptide can be purified from cells that naturally express it, purified from cells that have been altered to express it (recombinant), or synthesized using known protein synthesis methods. For example, a nucleic acid molecule encoding the GPCR peptide is cloned into an expression vector, the expression vector introduced into a host cell and the protein expressed in the host cell. The protein can then be isolated from the cells by an appropriate purification scheme using standard protein purification techniques. Many of these techniques are described in detail below.

Accordingly, the present invention provides proteins that consist of the amino acid sequences provided in FIG. 4 The amino acid sequence of such a protein is provided in FIG. 1. A protein consists of an amino acid sequence when the amino acid sequence is the final amino acid sequence of the protein.

The present invention further provides proteins that consist essentially of the amino acid sequences provided in FIG. 4. A protein consists essentially of an amino acid sequence when such an amino acid sequence is present with only a few additional amino acid residues, for example from about 1 to about 100 or so additional residues, typically from 1 to about 20 additional residues in the final protein.

The present invention further provides proteins that comprise the amino acid sequences provided in FIG. 4. A protein comprises an amino acid sequence when the amino acid sequence is at least part of the final amino acid sequence of the protein. In such a fashion, the protein can be only the peptide or have additional amino acid molecules, such as amino acid residues (contiguous encoded sequence) that are naturally associated with it or heterologous amino acid residues/peptide sequences. Such a protein can have a few additional amino acid residues or can comprise several hundred or more additional amino acids. The preferred classes of proteins that are comprised of the GPCR peptides of the present invention are the naturally occurring mature proteins. A brief description of how various types of these proteins can be made/isolated is provided below.

Due to the degeneracy of the genetic code, many HUMAN LGR9 GPCR- encoding nucleic acid sequences may be produced. Some of these nucleic acid sequences will bear only minimal homology to the endogenous sequence of any known and naturally occurring HUMAN LGR9 GPCR. However, Applicant specifically contemplates as his invention each and every possible variation of nucleic acid sequence that could be made by selecting combinations based on possible codon choices. These combinations are made in accordance with the standard triplet genetic code as applied to the nucleic acid sequence of naturally occurring HUMAN LGR9 GPCR, and all such variations are to be considered as being specifically disclosed.

Purified HUMAN LGR9 GPCR nucleic acid sequences have numerous applications in techniques known to those skilled in the art of molecular biology. These techniques include their use as hybridization probes, for chromosome and gene mapping, in PCR technologies, in the production of sense or antisense nucleic acids, in screening for new therapeutic molecules, and in screening for molecules capable of modulating HUMAN LGR9 GPCR activity. These examples are not intended to be limiting. For example, antisense nucleic acid find usefulness in clinical settings wherein a receptor antagonist is called for but unavailable.

The nucleic acid sequences disclosed herein may be used in molecular biology techniques that are currently under development or that have not yet been developed, provided that the new techniques rely on known properties of nucleic acid sequences, including but not limited to, such properties as the triplet genetic code and specific base pair interactions.

HUMAN LGR9 GPCR nucleic acid sequences and their derivatives, variants or fragments thereof are preferably capable of identifying the nucleic acid sequence of the naturally occurring HUMAN LGR9 GPCR. However, it may be desirable or advantageous to produce HUMAN LGR9 GPCR-encoding nucleic acid sequences comprising a substantially different codon usage. By way of non-limiting example, codons can be selected to increase the level of expression of the HUMAN LGR9 GPCR peptide in a particular expression host in accordance with the frequency with which particular codons are utilized by the host chosen. Another example in which a substantial alteration of the nucleic acid sequence encoding the HUMAN LGR9 GPCR without altering the encoded amino acid sequence includes the production of RNA transcripts having more desirable properties, such as a longer half-life, than transcripts produced from the naturally occurring sequence.

Nucleic acid sequences encoding a HUMAN LGR9 GPCR may be joined to a variety of other nucleic acid sequences by means of well established recombinant DNA techniques (see, for example, Sambrook J. et al., (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.; or Ausubel F. M. et al., (1989) Current Protocols in Molecular Biology, John Wiley & Sons, NY, NY). Useful sequences for joining to the HUMAN LGR9 GPCR include, but are not limited to, DNA vectors such as plasmids, cosmids, lambda phage derivatives, phagemids, and BAC vectors. DNA vectors of interest include, but are not limited to, vectors for replication, expression, probe generation, sequencing, and genetic transfer. Vectors of interest may contain an origin of replication functional in at least one organism, convenient restriction enzyme sites, and selectable markers for one or more host cell systems. They may also contain DNA sequences that may be useful in molecular biology techniques which require homologous recombination events. Functional GPCRs may be expressed as fusion proteins (e.g. Wise, A., Carr, I. C, and Milligan, G. (1997) Biochem. J. 325, 17-21) or may even be split and expressed as partial proteins which then re-associate to generate a functional receptor (Ridge KD; Lee SS; Yao LL, Proc Natl Acad. Sci U S A 1995 Apr 1 1 ;92(8):3204-8). Standard PCR such as described in U.S. Pat. Nos. 4,683,195; 4,800,195; and 4,965,188, provides additional uses for oligonucleotides based upon the HUMAN LGR9 GPCR nucleic acid sequence. Such oligonucleotides are generally artificially synthesized, but they may be of recombinant origin or, in some applications, a mixture of both. Oligonucleotides generally are used in pairs and comprise two nucleic acid sequences, one with a sense orientation (5' to 3") and one with an antisense (3' to 5¹). They are generally used under optimized conditions for the purpose of identifying a specific gene or for diagnostic use. In addition, the same two oligonucleotide pairs, a pair of "nested" oligonucleotides, or a pool of degenerate oligonucleotides may be used under less stringent or optimized conditions for identification and/or quantitation of closely related DNA or RNA sequences.

Other useful PCR-based techniques include (1 ) Inverse PCR, which is the first method to report successful acquisition of unknown sequences starting with primers based on a known region (Triglia, T. et al (1988) Nucleic Acids Res 16:8186); (2) Capture PCR (Lagerstrom M. et al (1991) PCR Methods Applic 1 :111-19) which is a method for PCR amplification of DNA fragments adjacent to a known sequence in human and YAC DNA; (3) targeted gene walking (Parker J. D. et al (1991 ; Nucleic Acids Res 19:3055-60) which is a method for targeted gene walking which permits retrieval of unknown sequence; and (4) Capillary Electrophoresis which is a new method for analyzing either the size or the nucleic acid sequence of PCR products.

The GPCR peptides of the present invention can be attached to heterologous sequences to form chimeric or fusion proteins. Such chimeric and fusion proteins comprise a GPCR peptide operatively linked to a heterologous protein having an amino acid sequence not substantially homologous to the GPCR peptide. "Operatively linked" indicates that the GPCR peptide and the heterologous protein are fused in-frame. The heterologous protein can be fused to the N-terminus or C-terminus of the GPCR peptide.

In some uses, the fusion protein does not affect the activity of the GPCR peptide per se. For example, the fusion protein can include, but is not limited to, enzymatic fusion proteins, for example beta-galactosidase fusions, yeast two-hybrid GAL fusions, poly-His fusions, MYC-tagged, Hl- tagged and Ig fusions. Such fusion proteins, particularly poly-His fusions, can facilitate the purification of recombinant GPCR peptide. In certain host cells (e.g., mammalian host cells), expression and/or secretion of a protein can be increased by using a heterologous signal sequence.

A chimeric or fusion protein can be produced by standard recombinant DNA techniques. For example, DNA fragments coding for the different protein sequences are ligated together in-frame in accordance with conventional techniques. In another embodiment, the fusion gene can be synthesized by conventional techniques including automated DNA synthesizers. Alternatively, PCR amplification of gene fragments can be carried out using anchor primers which give rise to complementary overhangs between two consecutive gene fragments which can subsequently be annealed and re-amplified to generate a chimeric gene sequence (see Ausubel et al., Current Protocols in Molecular Biology, 1992). Moreover, many expression vectors are commercially available that already encode a fusion moiety (e.g., a GST protein). A GPCR peptide- encoding nucleic acid can be cloned into such an expression vector such that the fusion moiety is linked in-frame to the GPCR peptide.

As mentioned above, the present invention also provides and enables obvious variants of the amino acid sequence of the proteins of the present invention, such as naturally occurring mature forms of the peptide, allelic/sequence variants of the peptides, non-naturally occurring recombinantly derived variants of the peptides, and orthologs and paralogs of the peptides. Such variants can readily be generated using art-known techniques in the fields of recombinant nucleic acid technology and protein biochemistry. It is understood, however, that variants exclude any amino acid sequences disclosed prior to the invention.

Such variants can readily be identified/made using molecular techniques and the sequence information disclosed herein. Further, such variants can readily be distinguished from other peptides based on sequence and/or structural homology to the GPCR peptides of the present invention. The degree of homology/identity present will be based primarily on whether the peptide is a functional variant or non-functional variant, the amount of divergence present in the paralog family and the evolutionary distance between the orthologs.

To determine the percent identity of two amino acid sequences or two nucleic acid sequences, the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non- homologous sequences can be disregarded for comparison purposes). In a preferred embodiment, the length of a reference sequence aligned for comparison purposes is at least 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the length of the reference sequence. The amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared. When a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity" is equivalent to amino acid or nucleic acid "homology"). The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.

The comparison of sequences and determination of percent identity and similarity between two sequences can be accomplished using a mathematical algorithm. (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part 1 , Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991 ). In a preferred embodiment, the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. Mol. Biol. (48):444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6. In yet another preferred embodiment, the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (Devereux, J., et al., Nucleic Acids Res. 12(1 ):387 (1984)) (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6. In another embodiment, the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of E. Meyers and W. Miller (CABIOS, 4:11 -17 (1989)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

The nucleic acid and protein sequences of the present invention can further be used as a "query sequence" to perform a search against sequence databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of Altschul, et al. (J. Mol. Biol.

215:403-10 (1990)). BLAST nucleotide searches can be performed with the NBLAST program, score=100, wordlength=12 to obtain nucleotide sequences homologous to the nucleic acid molecules of the invention. BLAST protein searches can be performed with the XBLAST program, score=50, wordlength=3 to obtain amino acid sequences homologous to the proteins of the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilized as described in Altschul et al. (Nucleic Acids Res. 25(17):3389-3402 (1997)). When utilizing BLAST and gapped BLAST programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used.

Full-length pre-processed forms, as well as mature processed forms, of proteins that comprise one of the peptides of the present invention can readily be identified as having complete sequence identity to one of the GPCR peptides of the present invention as well as being encoded by the same genetic locus as the GPCR peptide provided herein.

Allelic variants of a GPCR peptide can readily be identified as being a human protein having a high degree (significant) of sequence homology/identity to at least a portion of the GPCR peptide as well as being encoded by the same genetic locus as the GPCR peptide provided herein. As used herein, two proteins (or a region of the proteins) have significant homology when the amino acid sequences are typically at least about 70-80%, 80-90%, and more typically at least about 90-95% or more homologous. A significantly homologous amino acid sequence, according to the present invention, will be encoded by a nucleic acid sequence that will hybridize to a GPCR peptide encoding nucleic acid molecule under stringent conditions as more fully described below.

Paralogs of a GPCR peptide can readily be identified as having some degree of significant sequence homology/identity to at least a portion of the GPCR peptide, as being encoded by a gene from humans, and as having similar activity or function. Two proteins will typically be considered paralogs when the amino acid sequences are typically at least about 60% or greater, and more typically at least about 70% or greater homology through a given region or domain. Such paralogs will be encoded by a nucleic acid sequence that will hybridize to a GPCR peptide encoding nucleic acid molecule under moderate to stringent conditions as more fully described below.

Orthologs of a GPCR peptide can readily be identified as having some degree of significant sequence homology/identity to at least a portion of the GPCR peptide as well as being encoded by a gene from another organism. Preferred orthologs will be isolated from mammals, preferably primates, for the development of human therapeutic targets and agents. Such orthologs will be encoded by a nucleic acid sequence that will hybridize to a GPCR peptide encoding nucleic acid molecule under moderate to stringent conditions, as more fully described below, depending on the degree of relatedness of the two organisms yielding the proteins.

Non-naturally occurring variants of the GPCR peptides of the present invention can readily be generated using recombinant techniques. Such variants include, but are not limited to deletions, additions and substitutions in the amino acid sequence of the GPCR peptide. For example, one class of substitutions are conserved amino acid substitution. Such substitutions are those that substitute a given amino acid in a GPCR peptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu, and lie; interchange of the hydroxyl residues Ser and Thr; exchange of the acidic residues Asp and Glu; substitution between the amide residues Asn and Gin; exchange of the basic residues Lys and Arg; and replacements among the aromatic residues Phe and Tyr. Guidance concerning which amino acid changes are likely to be phenotypically silent are found in Bowie et al., Science 247:1306-1310 (1990).

Variant GPCR peptides can be fully functional or can lack function in one or more activities, e.g. ability to bind ligand, ability to bind G-protein, ability to mediate signaling, etc. Fully functional variants typically contain only conservative variation or variation in non-critical residues or in non- critical regions. Functional variants can also contain substitution of similar amino acids that result in no change or an insignificant change in function. Alternatively, such substitutions may positively or negatively affect function to some degree.

Non-functional variants typically contain one or more non-conservative amino acid substitutions, deletions, insertions, inversions, or truncation or a substitution, insertion, inversion, or deletion in a critical residue or critical region.

Amino acids that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham et al., Science 244:1081 -1085 (1989)), particularly using the results provided in FIG. X. The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as ligand/effector molecule binding or in assays such as an in vitro proliferative activity. Sites that are critical for ligand-receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al., J. Mol. Biol. 224:899-904 (1992); de Vos et al. Science 255:306-312 (1992)).

The present invention further provides fragments of the GPCR peptides, in addition to proteins and peptides that comprise and consist of such fragments. The fragments to which the invention pertains, however, are not to be construed as encompassing fragments that may be disclosed publicly prior to the present invention.

As used herein, a fragment comprises at least 4, 8, 10, 12, 14, 16, or more contiguous amino acid residues from a GPCR peptide. Such fragments can be chosen based on the ability to retain one or more of the biological activities of the GPCR peptide or could be chosen for the ability to perform a function, e.g. ability to bind ligand or effector molecule or act as an immunogen. Particularly important fragments are biologically active fragments, peptides which are, for example, about 8 or more amino acids in length. Such fragments will typically comprise a domain or motif of the GPCR peptide, e.g., active site, a G-protein binding site, a transmembrane domain or a ligand-binding domain. Further, possible fragments include, but are not limited to, domain or motif containing fragments, soluble peptide fragments, and fragments containing immunogenic structures. Predicted domains and functional sites are readily identifiable by computer programs well-known and readily available to those of skill in the art (e.g., PROSITE analysis).

Polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids. Further, many amino acids, including the terminal amino acids, may be modified by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques well known in the art. Common modifications that occur naturally in GPCR peptides are described in basic texts, detailed monographs, and the research literature, and they are well known to those of skill in the art.

Known modifications include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent crosslinks, formation of cystine, formation of pyroglutamate, formylation, gamma carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.

Such modifications are well-known to those of skill in the art and have been described in great detail in the scientific literature. Several particularly common modifications, glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation, for instance, are described in most basic texts, such as Proteins-Structure and Molecular Properties, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993). Many detailed reviews are available on this subject, such as by Wold, F., Posttranslational Covalent Modification of Proteins, B. C. Johnson, Ed., Academic Press, New York 1 -12 (1983); Seifter et al. (Meth. Enzymol. 182: 626-646 (1990)) and Raftan et al. (Ann. N. Y. Acad. Sci. 663:48-62 (1 992)).

Accordingly, the GPCR peptides of the present invention also encompass derivatives or analogs in which a substituted amino acid residue is not one encoded by the genetic code, in which a substituent group is included, in which the mature GPCR peptide is fused with another compound, such as a compound to increase the half-life of the GPCR peptide (for example, polyethylene glycol), or in which the additional amino acids are fused to the mature GPCR peptide, such as a leader or secretory sequence or a sequence for purification of the mature GPCR peptide or a pro-protein sequence. The invention provides efficient methods of identifying agents, compounds or lead compounds for agents active at the level of HUMAN LGR9 GPCR modulatable cellular function. Generally, these screening methods involve assaying for compounds which either activate on their own or modulate HUMAN LGR9 GPCR interaction with a natural or synthetic HUMAN LGR9 GPCR binding target. A wide variety of assays for binding agents are provided including, but not limited to, protein-protein binding assays, immunoassays, and cell based assays. Preferred methods are amenable to automated, cost-effective high throughput screening of chemical libraries for lead compounds. An automated, cost effective high throughput screen may be performed in a number of ways. Such separation may be accomplished using centrifugation or filtration. In a preferred embodiment the binding can be detected by one of several "homogeneous" methods that do not rely of physical separation. Such methods might include scintillation proximity assay (SPA) (Hart HE, Greenwald EB, Mol Immunol. 1979 Apr;16 (4):265-7), fluorescence resonance energy transfer (FRET) (e.g. EP 103,558, US 4,587,223 ) or fluorescence polarization.

A high throughput screen may also be established by detecting the activation (test compound vs. no test compound) or inhibition (test compound vs. no test compound, either in the presence of an agonist or a HUMAN LGR9 GPCR receptor activated by mutation or over expression) of a biological response in HUMAN LGR9 GPCR transfected cells. Such cells could include mammalian cell lines (e.g. COS-7, HEK293, CHO 3T3), insect cells (e.g. Schneider, sf9, hi5), frog melanophore cells, Sacc aromyces cerevisiae, or other suitable cells. Biological readouts might include calcium flux measured by changes in fluorescence of a calcium sensing fluorophore (e.g. FURA2 or a chameleon [Miyawaki A, Llopis J, Heim R, McCaffery JM, Adams JA, Ikura M, Tsien RY, Nature. 1997 Aug 28;388(6645):882-7]) on a FLIPR (Fluorescence Imaging Plate Reader) or by light emission of a protein which emits light in a calcium-dependent manner (e.g. aequorin, see infra for a description of this assay).

Other biological readouts include direct measurement of second messengers. For instance, increases in cAMP levels or decreases in forskolin stimulated cAMP levels can be measured using standard cAMP RIA, standard competition ELISA or SPA. Increases in the second messengers IP3 (PLC activation) and PIP3 (PI3K activation) can also serve as a measure of receptor activation using similar systems. Additional biological readouts include transcriptional activation readouts by either direct measurement of mRNA levels or through the use of enzymatic reporter genes (for example, luciferase, beta-galactosidase or beta- lactamase). Other biological readouts include cell proliferation and changes in pigment distribution (see, for example, McClintock TS, Graminski GF, Potenza MN, Jayawickreme CK, Roby-Shemkovitz A and Lerner MR (1993) , Anal Biochem 209: 298-305).

In vitro binding assays employ a mixture of components including a HUMAN LGR9 GPCR polypeptide, which may be part of a fusion product with another peptide or polypeptide, e.g., a tag for detection or anchoring, and a sample suspected of containing a natural HUMAN LGR9 GPCR binding target. A variety of other reagents such as salts, buffers, neutral proteins, e.g., albumin, detergents, protease inhibitors, nuclease inhibitors, and antimicrobial agents, may also be included. The mixture components can be added in any order that provides for the requisite bindings and incubations may be performed at any temperature which facilitates optimal binding. The mixture is incubated under conditions whereby the HUMAN LGR9 GPCR specifically binds the suspected cellular binding target contained in the sample with a reference binding affinity. Incubation periods are chosen for optimal binding but are also minimized to facilitate rapid, high-throughput screening.

After incubation, the binding between the HUMAN LGR9 GPCR and the suspected binding target is detected by any convenient way. For cell-free binding type assays, a separation step is often used to separate bound from unbound components. Separation may be effected by, for example, precipitation or immobilization, followed by washing by, e.g., membrane filtration or gel chromatography. For cell-free binding assays, one of the components usually comprises or is coupled to a label. The label may provide for direct detection such as, for example, radioactivity, luminescence, optical or electron density, or indirect detection such as an epitope tag or an enzyme. A variety of methods may be used to detect the label depending on the nature of the label and other assay components, e.g., through optical or electron density, radiative emissions, nonradiative energy transfers, or indirectly detected with antibody conjugates. A difference in the binding affinity of the HUMAN LGR9 GPCR polypeptide to the suspected binding target as compared with the binding of the HUMAN LGR9 GPCR polypeptide in the absence of the suspected binding target indicates that the test sample contains a suitable binding target for the HUMAN LGR9 GPCR polypeptide. A difference, as used herein, is statistically significant and preferably represents at least a 50%, more preferably at least a 90% difference.

Alternatively, assays for binding targets for HUMAN LGR9 GPCR can be performed using Biacore technology. Examples of how to use this technology can be found in US Patent No. 5,641 ,640 or are provided by the manufacturer of the instrument, Pharmacia, Piscataway, NJ.

The proteins of the present invention can be used in substantial and specific assays related to the functional information provided in the Figures and Back Ground Section; to raise antibodies or to elicit another immune response; as a reagent (including the labeled reagent) in assays designed to quantitatively determine levels of the protein (or its binding partner or receptor) in biological fluids; and as markers for tissues in which the corresponding protein is preferentially expressed (either constitutively or at a particular stage of tissue differentiation or development or in a disease state). Where the protein binds or potentially binds to another protein (such as, for example, in a receptor-ligand interaction), the protein can be used to identify the binding partner so as to develop a system to identify inhibitors of the binding interaction. Any or all of these research utilities are capable of being developed into reagent grade or kit format for commercialization as commercial products.

Methods for performing the uses listed above are well known to those skilled in the art. References disclosing such methods include "Molecular Cloning: A Laboratory Manual", 2d ed., Cold Spring Harbor Laboratory Press, Sambrook, J., E. F. Fritsch and T. Maniatis eds., 1989, and "Methods in Enzymology: Guide to Molecular Cloning Techniques", Academic Press, Berger, S. L. and A. R. Kimmel eds., 1987.

The potential uses of the peptides of the present invention are based primarily on the source of the protein as well as the class/action of the protein. For example, GPCRs isolated from humans and their human/mammalian orthologs serve as targets for identifying agents for use in mammalian therapeutic applications, e.g. a human drug, particularly in modulating a biological or pathological response in a cell or tissue that expresses the GPCR. The structural and functional information provided in the Background, Figures, Examples and throughout provide specific and substantial uses for the molecules of the present invention, particularly in combination with the expression information.

The proteins of the present invention are useful for biological assays related to GPCRs. Such assays involve any of the known GPCR functions or activities or properties useful for diagnosis and treatment of GPCR- related conditions that are specific for the subfamily of GPCRs that the one of the present invention belongs to, particularly in cells and tissues that express this receptor.

The proteins of the present invention are also useful in drug screening assays, in cell-based or cell-free systems. Cell-based systems can be native, i.e., cells that normally express the receptor protein, as a biopsy or expanded in cell culture. In an alternate embodiment, cell-based assays involve recombinant host cells expressing the receptor protein.

The polypeptides can be used to identify compounds that modulate receptor activity of the protein in its natural state, or an altered form that causes a specific disease or pathology associated with the receptor. Both the GPCRs of the present invention and appropriate variants and fragments can be used in high-throughput screens to assay candidate compounds for the ability to bind to the receptor. These compounds can be further screened against a functional receptor to determine the effect of the compound on the receptor activity. Further, these compounds can be tested in animal or invertebrate systems to determine activity/effectiveness. Compounds can be identified that activate (agonist) or inactivate (antagonist) the receptor to a desired degree.

Further, the proteins of the present invention can be used to screen a compound for the ability to stimulate or inhibit interaction between the receptor protein and a molecule that normally interacts with the receptor protein, e.g. a ligand or a component of the signal pathway that the receptor protein normally interacts, for example, a G-protein or other interactor involved in cAMP or phosphatidylinositol turnover and/or adenylate cyclase, or phospholipase C activation. Such assays typically include the steps of combining the receptor protein with a candidate compound under conditions that allow the receptor protein, or fragment, to interact with the target molecule, and to detect the formation of a complex between the protein and the target or to detect the biochemical consequence of the interaction with the receptor protein and the target, such as any of the associated effects of signal transduction such as G- protein phosphorylation, cAMP or phosphatidylinositol turnover, and adenylate cyclase or phospholipase C activation.

Candidate compounds include, for example, 1 ) peptides such as soluble peptides, including Ig-tailed fusion peptides and members of random peptide libraries (see, e.g., Lam et al., Nature 354:82-84 (1991); Houghten et al., Nature 354:84-86 (1991 )) and combinatorial chemistry- derived molecular libraries made of D- and/or L-configuration amino acids; 2) phosphopeptides (e.g., members of random and partially degenerate, directed phosphopeptide libraries, see, e.g., Songyang et al., Cell 72:767- 778 (1993)); 3) antibodies (e.g., polyclonal, monoclonal, humanized, anti- idiotypic, chimeric, and single chain antibodies as well as Fab, F(ab').sub.2, Fab expression library fragments, and epitope-binding fragments of antibodies); and 4) small organic and inorganic molecules (e.g., molecules obtained from combinatorial and natural product libraries).

One candidate compound is a soluble fragment of the receptor that competes for ligand binding. Other candidate compounds include mutant receptors or appropriate fragments containing mutations that affect receptor function and thus compete for ligand. Accordingly, a fragment that competes for ligand, for example with a higher affinity, or a fragment that binds ligand but does not allow release, is encompassed by the invention.

The invention further includes other end point assays to identify compounds that modulate (stimulate or inhibit) receptor activity. The assays typically involve an assay of events in the signal transduction pathway that indicate receptor activity. Thus, a cellular process such as proliferation, the expression of genes that are up- or down-regulated in response to the receptor protein dependent signal cascade, can be assayed. In one embodiment, the regulatory region of such genes can be operably linked to a marker that is easily detectable, such as luciferase. Any of the biological or biochemical functions mediated by the receptor can be used as an endpoint assay. These include all of the biochemical or biochemical/biological events described herein, in the references cited herein, incorporated by reference for these endpoint assay targets, and other functions known to those of ordinary skill in the art or that can be readily identified using the information provided in the Figures.

Specifically, a biological function of a cell or tissues that expresses the receptor can be assayed. Binding and/or activating compounds can also be screened by using chimeric receptor proteins in which the amino terminal extracellular domain, or parts thereof, the entire transmembrane domain or subregions, such as any of the seven transmembrane segments or any of the intracellular or extracellular loops and the carboxy terminal intracellular domain, or parts thereof, can be replaced by heterologous domains or subregions. For example, a G-protein-binding region can be used that interacts with a different G-protein then that which is recognized by the native receptor. Accordingly, a different set of signal transduction components is available as an end-point assay for activation. Alternatively, the entire transmembrane portion or subregions (such as transmembrane segments or intracellular or extracellular loops) can be replaced with the entire transmembrane portion or subregions specific to a host cell that is different from the host cell from which the amino terminal extracellular domain and/or the G-protein-binding region are derived. This allows for assays to be performed in other than the specific host cell from which the receptor is derived. Alternatively, the amino terminal extracellular domain (and/or other ligand-binding regions) could be replaced by a domain (and/or other binding region) binding a different ligand, thus, providing an assay for test compounds that interact with the heterologous amino terminal extracellular domain (or region) but still cause signal transduction. Finally, activation can be detected by a reporter gene containing an easily detectable coding region operably linked to a transcriptional regulatory sequence that is part of the native signal transduction pathway.

The proteins of the present invention are also useful in competition binding assays in methods designed to discover compounds that interact with the receptor. Thus, a compound is exposed to a receptor polypeptide under conditions that allow the compound to bind or to otherwise interact with the polypeptide (Hodgson, Bio/technology, 1992, September 10(9);973-80). Soluble receptor polypeptide is also added to the mixture. If the test compound interacts with the soluble receptor polypeptide, it decreases the amount of complex formed or activity from the receptor target. This type of assay is particularly useful in cases in which compounds are sought that interact with specific regions of the receptor. Thus, the soluble polypeptide that competes with the target receptor region is designed to contain peptide sequences corresponding to the region of interest.

To perform cell free drug screening assays, it is sometimes desirable to immobilize either the receptor protein, or fragment, or its target molecule to facilitate separation of complexes from uncomplexed forms of one or both of the proteins, as well as to accommodate automation of the assay.

Techniques for immobilizing proteins on matrices can be used in the drug screening assays. In one embodiment, a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix. For example, glutathione-S-transferase fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the cell lysates (e.g., .sup.35S-labeled) and the candidate compound, and the mixture incubated under conditions conducive to complex formation (e.g., at physiological conditions for salt and pH). Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly, or in the supernatant after the complexes are dissociated. Alternatively, the complexes can be dissociated from the matrix, separated by SDS-PAGE, and the level of receptor-binding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques. For example, either the polypeptide or its target molecule can be immobilized utilizing conjugation of biotin and streptavidin using techniques well known in the art. Alternatively, antibodies reactive with the protein but which do not interfere with binding of the protein to its target molecule can be derivatized to the wells of the plate, and the protein trapped in the wells by antibody conjugation. Preparations of a receptor-binding protein and a candidate compound are incubated in the receptor protein-presenting wells and the amount of complex trapped in the well can be quantitated. Methods for detecting such complexes, in addition to those described above for the GST-immobilized complexes, include immunodetection of complexes using antibodies reactive with the receptor protein target molecule, or which are reactive with receptor protein and compete with the target molecule, as well as enzyme-linked assays which rely on detecting an enzymatic activity associated with the target molecule.

Agents that modulate one of the GPCRs of the present invention can be identified using one or more of the above assays, alone or in combination. It is generally preferable to use a cell-based or cell free system first and then confirm activity in an animal or other model system. Such model systems are well known in the art and can readily be employed in this context.

Modulators of receptor protein activity identified according to these drug screening assays can be used to treat a subject with a disorder mediated by the receptor pathway, by treating cells or tissues that express the GPCR. These methods of treatment include the steps of administering a modulator of the GPCR's activity in a pharmaceutical composition to a subject in need of such treatment, the modulator being identified as described herein.

In yet another aspect of the invention, the GPCR proteins can be used as "bait proteins" in a two-hybrid assay or three-hybrid assay (see, e.g., U.S. Pat. No. 5,283,317; Zervos et al. (1993) Cell 72:223-232; Madura et al. (1993) J. Biol. Chem. 268:12046-12054; Bartel et al. (1993) Biotechniques 14:920-924; Iwabuchi et al. (1993) Oncogene 8:1693-1696; and Brent WO94/10300), to identify other proteins, which bind to or interact with the GPCR and are involved in GPCR activity. Such GPCR- binding proteins are also likely to be involved in the propagation of signals by the GPCR proteins or GPCR targets as, for example, downstream elements of a GPCR-mediated signaling pathway. Alternatively, such GPCR- binding proteins are likely to be GPCR inhibitors.

The two-hybrid system is based on the modular nature of most transcription factors, which consist of separable DNA-binding and activation domains. Briefly, the assay utilizes two different DNA constructs. In one construct, the gene that codes for a GPCR protein is fused to a gene encoding the DNA binding domain of a known transcription factor (e.g., GAL-4). In the other construct, a DNA sequence, from a library of DNA sequences, that encodes an unidentified protein ("prey" or "sample") is fused to a gene that codes for the activation domain of the known transcription factor. If the "bait" and the "prey" proteins are able to interact, in vivo, forming a GPCR-dependent complex, the DNA-binding and activation domains of the transcription factor are brought into close proximity. This proximity allows transcription of a reporter gene (e.g., LacZ) which is operably linked to a transcriptional regulatory site responsive to the transcription factor. Expression of the reporter gene can be detected and cell colonies containing the functional transcription factor can be isolated and used to obtain the cloned gene which encodes the protein which interacts with the GPCR protein.

This invention further pertains to novel agents identified by the above- described screening assays. Accordingly, it is within the scope of this invention to further use an agent identified as described herein in an appropriate animal model. For example, an agent identified as described herein (e.g., a GPCR modulating agent, an antisense GPCR nucleic acid molecule, a GPCR-specific antibody, or a GPCR-binding partner) can be used in an animal or other model to determine the efficacy, toxicity, or side effects of treatment with such an agent. Alternatively, an agent identified as described herein can be used in an animal or other model to determine the mechanism of action of such an agent. Furthermore, this invention pertains to uses of novel agents identified by the above- described screening assays for treatments as described herein.

The GPCR proteins of the present invention are also useful to provide a target for diagnosing a disease or predisposition to disease mediated by the peptide. Accordingly, the invention provides methods for detecting the presence, or levels of, the protein (or encoding mRNA) in a cell, tissue, or organism. The method involves contacting a biological sample with a compound capable of interacting with the receptor protein such that the interaction can be detected. Such an assay can be provided in a single detection format or a multi-detection format such as an antibody chip array. One agent for detecting a protein in a sample is an antibody capable of selectively binding to protein. A biological sample includes tissues, cells and biological fluids isolated from a subject, as well as tissues, cells and fluids present within a subject.

The peptides of the present invention also provide targets for diagnosing active protein activity, disease, or predisposition to disease, in a patient having a variant peptide, particularly activities and conditions that are known for other members of the family of proteins to which the present one belongs. Thus, the peptide can be isolated from a biological sample and assayed for the presence of a genetic mutation that results in aberrant peptide. This includes amino acid substitution, deletion, insertion, rearrangement, (as the result of aberrant splicing events), and inappropriate post-translational modification. Analytic methods include altered electrophoretic mobility, altered tryptic peptide digest, altered receptor activity in cell-based or cell-free assay, alteration in ligand or antibody-binding pattern, altered isoelectric point, direct amino acid sequencing, and any other of the known assay techniques useful for detecting mutations in a protein. Such an assay can be provided in a single detection format or a multi-detection format such as an antibody chip array.

In vitro techniques for detection of peptide include enzyme linked immunosorbent assays (ELISAs), Western blots, immunoprecipitations and immunofluorescence using a detection reagent, such as an antibody or protein binding agent. Alternatively, the peptide can be detected in vivo in a subject by introducing into the subject a labeled aπti-peptide antibody or other types of detection agent. For example, the antibody can be labeled with a radioactive marker whose presence and location in a subject can be detected by standard imaging techniques. Particularly useful are methods that detect the allelic variant of a peptide expressed in a subject and methods which detect fragments of a peptide in a sample.

The peptides are also useful in pharmacogenomic analysis.

Pharmacogenomics deal with clinically significant hereditary variations in the response to drugs due to altered drug disposition and abnormal action in affected persons. See, e.g., Eichelbaum, M. (Clin. Exp. Pharmacol. Physiol. 23(10-1 1):983-985 (1996)), and Under, M. W. (Clin. Chem. 43(2):254-266 (1997)). The clinical outcomes of these variations result in severe toxicity of therapeutic drugs in certain individuals or therapeutic failure of drugs in certain individuals as a result of individual variation in metabolism. Thus, the genotype of the individual can determine the way a therapeutic compound acts on the body or the way the body metabolizes the compound. Further, the activity of drug metabolizing enzymes effects both the intensity and duration of drug action. Thus, the pharmacogenomics of the individual permit the selection of effective compounds and effective dosages of such compounds for prophylactic or therapeutic treatment based on the individual's genotype. The discovery of genetic polymorphisms in some drug metabolizing enzymes has explained why some patients do not obtain the expected drug effects, show an exaggerated drug effect, or experience serious toxicity from standard drug dosages. Polymorphisms can be expressed in the phenotype of the extensive metabolizer and the phenotype of the poor metabolizer. Accordingly, genetic polymorphism may lead to allelic protein variants of the receptor protein in which one or more of the receptor functions in one population is different from those in another population. The peptides thus allow a target to ascertain a genetic predisposition that can affect treatment modality. Thus, in a ligand-based treatment, polymorphism may give rise to amino terminal extracellular domains and/or other ligand- binding regions that are more or less active in ligand binding, and receptor activation. Accordingly, ligand dosage would necessarily be modified to maximize the therapeutic effect within a given population containing a polymorphism. As an alternative to genotyping, specific polymorphic peptides could be identified.

The peptides are also useful for treating a disorder characterized by an absence of, inappropriate, or unwanted expression of the protein. Accordingly, methods for treatment include the use of the GPCR protein or fragments.

The invention also provides antibodies that selectively bind to one of the peptides of the present invention, a protein comprising such a peptide, as well as variants and fragments thereof. As used herein, an antibody selectively binds a target peptide when it binds the target peptide and does not significantly bind to unrelated proteins. An antibody is still considered to selectively bind a peptide even if it also binds to other proteins that are not substantially homologous with the target peptide so long as such proteins share homology with a fragment or domain of the peptide target of the antibody. In this case, it would be understood that antibody binding to the peptide is still selective despite some degree of cross-reactivity.

As used herein, an antibody is defined in terms consistent with that recognized within the art: they are multi-subunit proteins produced by a mammalian organism in response to an antigen challenge. The antibodies of the present invention include polyclonal antibodies and monoclonal antibodies, as well as fragments of such antibodies, including, but not limited to, Fab or F(ab')₂, and Fv fragments.

Many methods are known for generating and/or identifying antibodies to a given target peptide. Several such methods are described by Harlow, Antibodies, Cold Spring Harbor Press, (1989).

In general, to generate antibodies, an isolated peptide is used as an immunogen and is administered to a mammalian organism, such as a rat, rabbit or mouse. The full-length protein, an antigenic peptide fragment or a fusion protein can be used. Particularly important fragments are those covering functional domains and domains of sequence homology or divergence amongst the family, such as those that can readily be identified using protein alignment methods and as presented in the Figures.

Antibodies specific for HUMAN LGR9 GPCR may be produced by inoculation of an appropriate animal with an antigenic fragment of the HUMAN LGR9 GPCR polypeptide. Although an amino acid sequence or oligopeptide or polypeptide used for antibody induction does not require biological activity, it must be immunogenic. HUMAN LGR9 GPCR polypeptides or fragments thereof used to induce specific antibodies may have a polypeptide sequence consisting of at least five amino acids and preferably at least 10 amino acids. Short stretches of amino acid sequence may be fused with those of another protein or polypeptide such as keyhole limpet hemocyanin, and the chimeric polypeptide used for antibody production. Alternatively, the polypeptide may be of sufficient length to contain an entire domain of HUMAN LGR9 GPCR. An antibody is specific for HUMAN LGR9 GPCR if it is produced against an epitope of the polypeptide and binds to at least part of the natural or recombinant protein. Antibody production includes not only the stimulation of an immune response by injection into animals, but also analogous processes such as the production of synthetic antibodies, the screening of recombinant immunoglobulin libraries for specific-binding molecules (Orlandi R. et al (1989) PNAS 86:3833-3837, or Huse W. D. et al (1989) Science 256:1275-1281), or the in vitro stimulation of lymphocyte populations. Current technology (Winter G. and Milstein C. (1991 ) Nature 349:293- 299) provides for a number of highly specific binding reagents based on the principles of antibody formation. These techniques may be adapted to produce molecules which specifically bind HUMAN LGR9 GPCR. Antibodies or other appropriate molecules generated against a specific immunogenic peptide fragment or oligopeptide can be used in Western analysis, enzyme-linked immunosorbent assays (ELISA) or similar tests to establish the presence of or to quantitate amounts of HUMAN LGR9 GPCR active in normal, diseased, or therapeutically treated cells or tissues. Wholly human monoclonal antibodies are also provided for and can be made as described in US Patent No. 5,939,598, issued August 17, 1999 and assigned to Abgenix, Inc.

Antibodies are preferably prepared from regions or discrete fragments of the GPCR proteins. Antibodies can be prepared from any region of the peptide as described herein. However, preferred regions will include those involved in function/activity and/or receptor/binding partner interaction. The sequences herein can be used to identify particularly important regions while sequence alignment can be used to identify conserved and unique sequence fragments. Detection on an antibody of the present invention can be facilitated by coupling (i.e., physically linking) the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta.-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin, and examples of suitable radioactive material include I¹²⁵, I¹³¹ , S³⁵, or H³.

The antibodies can be used to isolate one of the proteins of the present invention by standard techniques, such as affinity chromatography or immunoprecipitation. The antibodies can facilitate the purification of the natural protein from cells and recombinantly produced protein expressed in host cells. In addition, such antibodies are useful to detect the presence of one of the proteins of the present invention in cells or tissues to determine the pattern of expression of the protein among various tissues in an organism and over the course of normal development. Further, such antibodies can be used to detect protein in situ, in vitro, or in a cell lysate or supernatant in order to evaluate the abundance and pattern of expression. Also, such antibodies can be used to assess abnormal tissue distribution or abnormal expression during development or progression of a biological condition. Antibody detection of circulating fragments of the full length protein can be used to identify turnover. Further, the antibodies can be used to assess expression in disease states such as in active stages of the disease or in an individual with a predisposition toward disease related to the protein's function. When a disorder is caused by an inappropriate tissue distribution, developmental expression, level of expression of the protein, or expressed/processed form, the antibody can be prepared against the normal protein. If a disorder is characterized by a specific mutation in the protein, antibodies specific for this mutant protein can be used to assay for the presence of the specific mutant protein.

The antibodies can also be used to assess normal and aberrant subcellular localization of cells in the various tissues in an organism. The diagnostic uses can be applied, not only in genetic testing, but also in monitoring a treatment modality. Accordingly, where treatment is ultimately aimed at correcting expression level or the presence of aberrant sequence and aberrant tissue distribution or developmental expression, antibodies directed against the protein or relevant fragments can be used to monitor therapeutic efficacy.

Additionally, antibodies are useful in pharmacogenomic analysis. Thus, antibodies prepared against polymorphic proteins can be used to identify individuals that require modified treatment modalities. The antibodies are also useful as diagnostic tools as an immunological marker for aberrant protein analyzed by electrophoretic mobility, isoelectric point, tryptic peptide digest, and other physical assays known to those in the art. The antibodies are also useful for tissue typing. Where a specific protein has been correlated with expression in a specific tissue, antibodies that are specific for this protein can be used to identify a tissue type.

The antibodies are also useful for inhibiting protein function, for example, blocking the binding of the GPCR peptide to a binding partner such as a ligand. These uses can also be applied in a therapeutic context in which treatment involves inhibiting the protein's function. An antibody can be used, for example, to block binding, thus modulating (agonizing or antagonizing) the peptides activity. Antibodies can be prepared against specific fragments containing sites required for function or against intact protein that is associated with a cell or cell membrane.

The invention also encompasses kits for using antibodies to detect the presence of a protein in a biological sample. The kit can comprise antibodies such as a labeled or labelable antibody and a compound or agent for detecting protein in a biological sample; means for determining the amount of protein in the sample; means for comparing the amount of protein in the sample with a standard; and instructions for use. Such a kit can be supplied to detect a single protein or epitope or can be configured to detect one of a multitude of epitopes, such as in an antibody detection array. Arrays are described in detail below for nucleic acid arrays and similar methods have been developed for antibody arrays.

The present invention further provides isolated nucleic acid molecules that encode a GPCR peptide or protein of the present invention (cDNA, transcript and genomic sequence). Such nucleic acid molecules will consist of, consist essentially of, or comprise a nucleotide sequence that encodes one of the GPCR peptides of the present invention, an allelic variant thereof, or an ortholog or paralog thereof.

As used herein, an "isolated" nucleic acid molecule is one that is separated from other nucleic acid present in the natural source of the nucleic acid. Preferably, an "isolated" nucleic acid is free of sequences which naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived. However, there can be some flanking nucleotide sequences, for example up to about 5 KB, 4 KB, 3 KB, 2 KB, or 1 KB or less, particularly contiguous peptide encoding sequences and peptide encoding sequences within the same gene but separated by introns in the genomic sequence. The important point is that the nucleic acid is isolated from remote and unimportant flanking sequences such that it can be subjected to the specific manipulations described herein such as recombinant expression, preparation of probes and primers, and other uses specific to the nucleic acid sequences.

Moreover, an "isolated" nucleic acid molecule, such as a transcript/cDNA molecule, can be substantially free of other cellular material, or culture medium when produced by recombinant techniques, or chemical precursors or other chemicals when chemically synthesized. However, the nucleic acid molecule can be fused to other coding or regulatory sequences and still be considered isolated.

For example, recombinant DNA molecules contained in a vector are considered isolated. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the isolated DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.

Accordingly, the present invention provides nucleic acid molecules that consist of the nucleotide sequence shown in FIG. 1 or any nucleic acid molecule that encodes the protein provided in FIG. 4. A nucleic acid molecule consists of a nucleotide sequence when the nucleotide sequence is the complete nucleotide sequence of the nucleic acid molecule.

The present invention further provides nucleic acid molecules that consist essentially of the nucleotide sequence shown in FIG. 1 or any nucleic acid molecule that encodes the protein provided in FIG. 4. A nucleic acid molecule consists essentially of a nucleotide sequence when such a nucleotide sequence is present with only a few additional nucleic acid residues in the final nucleic acid molecule.

The present invention further provides nucleic acid molecules that comprise the nucleotide sequences shown in FIG. 1 , or any nucleic acid molecule that encodes the protein provided in FIG. 4. A nucleic acid molecule comprises a nucleotide sequence when the nucleotide sequence is at least part of the final nucleotide sequence of the nucleic acid molecule. In such a fashion, the nucleic acid molecule can be only the nucleotide sequence or have additional nucleic acid residues, such as nucleic acid residues that are naturally associated with it or heterologous nucleotide sequences. Such a nucleic acid molecule can have a few additional nucleotides or can comprises several hundred or more additional nucleotides. A brief description of how various types of these nucleic acid molecules can be readily made/isolated is provided below.

The nucleic acid molecules in the Figures may contain genomic intronic sequences, 5" and 3¹ non-coding sequences, gene regulatory regions and non-coding intergenic sequences. In general such sequence features can readily be identified using computational tools known in the art. As discussed below, some of the non-coding regions, particularly gene regulatory elements such as promoters, are useful for a variety of purposes, e.g. control of heterologous gene expression, target for identifying gene activity modulating compounds, and are particularly claimed as fragments of the genomic sequence provided herein.

The isolated nucleic acid molecules can encode the mature protein plus additional amino or carboxyl-terminal amino acids, or amino acids interior to the mature peptide (when the mature form has more than one peptide chain, for instance). Such sequences may play a role in processing of a protein from precursor to a mature form, facilitate protein trafficking, prolong or shorten protein half-life or facilitate manipulation of a protein for assay or production, among other things. As generally is the case in situ, the additional amino acids may be processed away from the mature protein by cellular enzymes.

As mentioned above, the isolated nucleic acid molecules include, but are not limited to, the sequence encoding the GPCR peptide alone, the sequence encoding the mature peptide and additional coding sequences, such as a leader or secretory sequence (e.g., a pre-pro or pro-protein sequence), the sequence encoding the mature peptide, with or without the additional coding sequences, plus additional non-coding sequences, for example introns and non-coding 5' and 3' sequences such as transcribed but non-translated sequences that play a role in transcription, mRNA processing (including splicing and polyadenylation signals), ribosome binding and stability of mRNA. In addition, the nucleic acid molecule may be fused to a marker sequence encoding, for example, a peptide that facilitates purification.

Isolated nucleic acid molecules can be in the form of RNA, such as mRNA, or in the form DNA, including cDNA and genomic DNA obtained by cloning or produced by chemical synthetic techniques or by a combination thereof. The nucleic acid, especially DNA, can be double-stranded or single- stranded. Single-stranded nucleic acid can be the coding strand (sense strand) or the non-coding strand (anti-sense strand).

The invention further provides nucleic acid molecules that encode fragments of the peptides of the present invention as well as nucleic acid molecules that encode obvious variants of the GPCR proteins of the present invention that are described above. Such nucleic acid molecules may be naturally occurring, such as allelic variants (same locus), paralogs (different locus), and orthologs (different organism), or may be constructed by recombinant DNA methods or by chemical synthesis. Such non-naturally occurring variants may be made by mutagenesis techniques, including those applied to nucleic acid molecules, cells, or organisms. Accordingly, as discussed above, the variants can contain nucleotide substitutions, deletions, inversions and insertions. Variation can occur in either or both the coding and non-coding regions. The variations can produce both conservative and non-conservative amino acid substitutions. The present invention further provides non-coding fragments of the nucleic acid molecules. Preferred non-coding fragments include, but are not limited to, promoter sequences, enhancer sequences, gene modulating sequences and gene termination sequences. Such fragments are useful in controlling heterologous gene expression and in developing screens to identify gene-modulating agents.

A fragment comprises a contiguous nucleotide sequence greater than 12 or more nucleotides. Further, a fragment could at least 30, 40, 50, 100, 250 or 500 nucleotides in length. The length of the fragment will be based on its intended use. For example, the fragment can encode epitope bearing regions of the peptide, or can be useful as DNA probes and primers. Such fragments can be isolated using the known nucleotide sequence to synthesize an oligonucleotide probe. A labeled probe can then be used to screen a cDNA library, genomic DNA library, or mRNA to isolate nucleic acid corresponding to the coding region. Further, primers can be used in PCR reactions to clone specific regions of gene.

A probe/primer typically comprises substantially a purified oligonucleotide or oligonucleotide pair. The oligonucleotide typically comprises a region of nucleotide sequence that hybridizes under stringent conditions to at least about 12, 20, 25, 40, 50 or more consecutive nucleotides.

Orthologs, homologs, and allelic variants can be identified using methods well known in the art. As described, these variants comprise a nucleotide sequence encoding a peptide that is typically 60-70%, 70-80%, 80-90%, and more typically at least about 90-95% or more homologous to the nucleotide sequences shown in the Figures or a fragment of these sequences. Such nucleic acid molecules can readily be identified as being able to hybridize under moderate to stringent conditions, to the nucleotide sequence shown or a fragment of these sequences. Allelic variants can readily be determined by genetic locus of the encoding gene.

As used herein, the term "hybridizes under stringent conditions" is intended to describe conditions for hybridization and washing under which nucleotide sequences encoding a peptide at least 60-70% homologous to each other typically remain hybridized to each other. The conditions can be such that sequences at least about 60%, at least about 70%, or at least about 80% or more homologous to each other typically remain hybridized to each other. Such stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N.Y. (1989), 6.3.1 -6.3.6. One example of stringent hybridization conditions are hybridization in 6X sodium chloride/sodium citrate (SSC) at about 45 C, followed by one or more washes in 0.2.times. SSC, 0.1 % SDS at 50-65 C. Examples of moderate to low stringency hybridization conditions are well known in the art.

The nucleic acid molecules of the present invention are useful for probes, primers, chemical intermediates, and in biological assays. The nucleic acid molecules are useful as a hybridization probe for messenger RNA, transcript/cDNA and genomic DNA to isolate full-length cDNA and genomic clones encoding the peptides described in the figures and to isolate cDNA and genomic clones that correspond to variants (alleles, orthologs, etc.) producing the same or related peptides shown in the figures.

Another aspect of the subject invention is to provide for HUMAN LGR9 GPCR hybridization probes which are capable of hybridizing with naturally occurring nucleic acid sequences encoding HUMAN LGR9 GPCR. The stringency of the hybridization conditions will determine whether the probe identifies only the native nucleic acid sequence of that specific HUMAN LGR9 GPCR or sequences of closely related molecules. Demonstrating specific hybridization generally requires stringent conditions, for example, hybridizing in a buffer comprising 30% formamide in 5 x SSPE (0.18 M NaCl, 0.01 M NaPO₄, pH 7.7, 0.001 M EDTA) buffer at a temperature of 42°C and remaining bound when subject to washing at 42°C with 0.2 x SSPE; preferably hybridizing in a buffer comprising 50% formamide in 5 x SSPE buffer at a temperature of 42°C and remaining bound when subject to washing at 42°C with 0.2 x SSPE buffer at 42°C. HUMAN LGR9 GPCR homologs can also be distinguished from one another using alignment algorithms, such as BLASTX (Altschul, et al., (1990) Basic Local Alignment Search Tool, J. Mol. Biol. 215:403-410). If degenerate HUMAN LGR9 GPCR nucleic acid sequences of the subject invention are used for the detection of related HUMAN LGR9 GPCR encoding sequences, they should preferably contain at least 50% of the nucleotides of the sequences presented herein. Hybridization probes of the subject invention may be derived from the nucleic acid sequence of HUMAN LGR9 GPCR, or from surrounding or included genomic sequences comprising untranslated regions such as promoters, enhancers and introns. Such hybridization probes may be labeled with appropriate reporter molecules. Means for producing specific hybridization probes for HUMAN LGR9 GPCR include oligonucleotide labeling, nick translation, end-labeling or PCR amplification using a labeled oligonucleotide. Alternatively, the cDNA sequence may be cloned into an appropriate vector for the production of an mRNA probe. Such vectors are known to those skilled in the art and are commercially available. They may be used to synthesize RNA probes in vitro by the addition of an appropriate RNA polymerase such as T7, T3 or SP6 and appropriately labeled nucleotides. Several companies, including Pharmacia Biotech, Piscataway, NJ; Promega, Madison, Wl.; and US Biochemical Corp., Cleveland, OH; supply commercial kits and protocols for these procedures.

It is also possible to produce a DNA sequence, or a portion or fragment thereof, entirely by synthetic chemistry using laboratory equipment familiar to the skilled artisans. The source of information for producing the synthetic sequence may be derived from the known homologous sequence from closely related organisms. After synthesis, the nucleic acid sequence can be used alone or joined with another known sequence and inserted into one of the many available DNA vectors and their respective host cells using techniques well known in the art. Moreover, synthetic chemistry may be used to introduce specific mutations into the nucleic acid sequence. Alternatively, a portion of sequence in which a mutation is desired can be synthesized and recombined with a portion of an existing genomic or recombinant sequence.

The HUMAN LGR9 GPCR nucleic acid sequences can be used individually, in panels or arrays, or in diagnostic tests or assays to detect disorders or disease processes that are associated with abnormal levels of HUMAN LGR9 GPCR expression. By way of non-limiting example, the nucleic acid sequence can be added to a sample to be tested (e.g. a body fluid such as blood, plasma, synovial fluid, or CSF or a cell or tissue, including homogenates of cells or tissues), obtained from a patient, under hybridizing conditions. After an incubation period, the sample is washed with a compatible fluid which may or may not contain a reporter molecule which will bind the specific nucleic acid. After the compatible fluid is rinsed off, the reporter molecule is quantitated and compared with a standard for that fluid, cell or tissue. If HUMAN LGR9 GPCR expression is significantly different from the standard, the assay indicates the presence of a disorder or disease. The form of such methods may include Northern analysis, dot blot or other membrane based technologies, dip stick, pin or chip technologies, PCR, ELISAs or other multiple sample format technologies.

A same or similar assay format is applicable in evaluating the efficacy of a particular therapeutic treatment regime. For example, it may be used in evaluating efficacy in animal studies, in human clinical trials, or in monitoring the treatment of an individual patient. In this application, standard expression must be established for use as a basis of comparison with the test samples. Samples from the experimental animals or patients that are affected by the disorder or disease are combined with the nucleic acid sequence to evaluate the difference from the standard or normal expression profile. Next, a therapeutic agent is administered to the experimental animal or patient and a treatment profile is obtained. The assay is evaluated to determine whether or not the profile progresses toward or returns to the standard pattern. Successive treatment profiles may be used to show the efficacy of treatment over a period of time.

The nucleic acid sequence for HUMAN LGR9 GPCR can also be used to generate probes for genomic mapping of the native sequence to a particular chromosome or to a specific region of a chromosome using techniques well known to the skilled artisan. These techniques include, but are not limited to, in situ hybridization to chromosomal spreads (Verma et al (1988) Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, NY, NY), flow-sorted chromosomal preparations, or artificial chromosome constructions such as yeast artificial chromosomes (YACs), bacterial artificial chromosomes (BACs), bacterial P1 constructions or single chromosome cDNA libraries.

In situ hybridization of chromosomal preparations and physical mapping techniques such as linkage analysis using established chromosomal markers are invaluable in extending genetic maps. Examples of genetic maps can be found in the 1994 Genome Issue of Science (265:1981 ). Genetic mapping provides invaluable information to investigators searching for disease-associated genes using gene discovery techniques. Once a disease or syndrome has been generally localized by genetic linkage to a particular genomic region, any sequences mapping to that area represent genes that may be suitable for further investigation. In addition, the nucleic acid sequences of the subject invention may also be used to detect differences in the chromosomal location of nucleic acid sequences due to, for example, translocation or inversion between normal and carrier or affected individuals.

The partial nucleic acid sequence encoding a particular HUMAN LGR9 GPCR may be used to produce an amino acid sequence using well known methods of recombinant DNA technology. The amino acid or polypeptide or polypeptide comprising a fragment thereof may be expressed in a variety of host cells, either prokaryotic or eukaryotic. Host cells may be from the same species from which the nucleic acid sequence was derived or from a different species.

Cells transformed with a HUMAN LGR9 GPCR nucleic acid sequence may be cultured under conditions suitable for the expression and recovery of a polypeptide from cell culture. The receptor may be isolated in a detergent solubilized form and reassembled into membranes or it may be isolated as membrane fragments or vesicles following physical disruption of transfected cells. Other recombinant constructions may join HUMAN LGR9 GPCR nucleic acid to a nucleic acid sequence encoding a polypeptide domain which will facilitate protein purification, for example, the Fc region of an antibody or a tag sequence such as a HIS tag.

The probe can correspond to any sequence along the entire length of the nucleic acid molecules provided in the Figures. Accordingly, it could be derived from 5" noncoding regions, the coding region, and 3¹ noncoding regions. However, as discussed, fragments are not to be construed as encompassing fragments disclosed prior to the present invention.

The nucleic acid molecules are also useful as primers for PCR to amplify any given region of a nucleic acid molecule and are useful to synthesize antisense molecules of desired length and sequence.

The nucleic acid molecules are also useful for constructing recombinant vectors. Such vectors include expression vectors that express a portion of, or all of, the peptide sequences. Vectors also include insertion vectors, used to integrate into another nucleic acid molecule sequence, such as into the cellular genome, to alter in situ expression of a gene and/or gene product. For example, an endogenous coding sequence can be replaced via homologous recombination with all or part of the coding region containing one or more specifically introduced mutations.

The nucleic acid molecules are also useful for expressing antigenic portions of the proteins. The nucleic acid molecules are also useful as probes for determining the chromosomal positions of the nucleic acid molecules by means of in situ hybridization methods. The nucleic acid molecules are also useful in making vectors containing the gene regulatory regions of the nucleic acid molecules of the present invention.

The nucleic acid molecules are also useful for designing ribozymes corresponding to all, or a part, of the mRNA produced from the nucleic acid molecules described herein.

The nucleic acid molecules are also useful for making vectors that express part, or all, of the peptides.

The nucleic acid molecules are also useful for constructing host cells expressing a part, or all, of the nucleic acid molecules and peptides.

The nucleic acid molecules are also useful for constructing transgenic animals expressing all, or a part, of the nucleic acid molecules and peptides.

The nucleic acid molecules are also useful as hybridization probes for determining the presence, level, form and distribution of nucleic acid expression. Accordingly, the probes can be used to detect the presence of, or to determine levels of, a specific nucleic acid molecule in cells, tissues, and in organisms. The nucleic acid whose level is determined can be DNA or RNA. Accordingly, probes corresponding to the peptides described herein can be used to assess expression and/or gene copy number in a given cell, tissue, or organism. These uses are relevant for diagnosis of disorders involving an increase or decrease in GPCR protein expression relative to normal results.

In vitro techniques for detection of mRNA include Northern hybridizations and in situ hybridizations. In vitro techniques for detecting DNA includes Southern hybridizations and in situ hybridization.

Probes can be used as a part of a diagnostic test kit for identifying cells or tissues that express a GPCR protein, such as by measuring a level of a receptor-encoding nucleic acid in a sample of cells from a subject e.g., mRNA or genomic DNA, or determining if a receptor gene has been mutated.

Nucleic acid expression assays are useful for drug screening to identify compounds that modulate GPCR nucleic acid expression.

The invention thus provides a method for identifying a compound that can be used to treat a disorder associated with nucleic acid expression of the GPCR gene, particularly biological and pathological processes that are mediated by the GPCR in cells and tissues that express it.. The method typically includes assaying the ability of the compound to modulate the expression of the GPCR nucleic acid and thus identifying a compound that can be used to treat a disorder characterized by undesired GPCR nucleic acid expression. The assays can be performed in cell-based and cell-free systems. Cell-based assays include cells naturally expressing the GPCR nucleic acid or recombinant cells genetically engineered to express specific nucleic acid sequences. The assay for GPCR nucleic acid expression can involve direct assay of nucleic acid levels, such as mRNA levels, or on collateral compounds involved in the signal pathway. Further, the expression of genes that are up- or down-regulated in response to the GPCR protein signal pathway can also be assayed. In this embodiment the regulatory regions of these genes can be operably linked to a reporter gene such as luciferase.

Thus, modulators of GPCR gene expression can be identified in a method wherein a cell is contacted with a candidate compound and the expression of mRNA determined. The level of expression of GPCR mRNA in the presence of the candidate compound is compared to the level of expression of GPCR mRNA in the absence of the candidate compound. The candidate compound can then be identified as a modulator of nucleic acid expression based on this comparison and be used, for example to treat a disorder characterized by aberrant nucleic acid expression. When expression of mRNA is statistically significantly greater in the presence of the candidate compound than in its absence, the candidate compound is identified as a stimulator of nucleic acid expression. When nucleic acid expression is statistically significantly less in the presence of the - candidate compound than in its absence, the candidate compound is identified as an inhibitor of nucleic acid expression.

The invention further provides methods of treatment, with the nucleic acid as a target, using a compound identified through drug screening as a gene modulator to modulate GPCR nucleic acid expression, particularly to modulate activities within a cell or tissue that expresses the proteins. Modulation includes both up-regulation (i.e. activation or agonization) or down-regulation (suppression or antagonization) or nucleic acid expression. Alternatively, a modulator for GPCR nucleic acid expression can be a small molecule or drug identified using the screening assays described herein as long as the drug or small molecule inhibits the GPCR nucleic acid expression in the cells and tissues that express the protein.

The nucleic acid molecules are also useful for monitoring the effectiveness of modulating compounds on the expression or activity of the GPCR gene in clinical trials or in a treatment regimen. Thus, the gene expression pattern can serve as a barometer for the continuing effectiveness of treatment with the compound, particularly with compounds to which a patient can develop resistance. The gene expression pattern can also serve as a marker indicative of a physiological response of the affected cells to the compound. Accordingly, such monitoring would allow either increased administration of the compound or the administration of alternative compounds to which the patient has not become resistant. Similarly, if the level of nucleic acid expression falls below a desirable level, administration of the compound could be commensurately decreased.

The nucleic acid molecules are also useful in diagnostic assays for qualitative changes in GPCR nucleic acid, and particularly in qualitative changes that lead to pathology. The nucleic acid molecules can be used to detect mutations in GPCR genes and gene expression products such as mRNA. The nucleic acid molecules can be used as hybridization probes to detect naturally-occurring genetic mutations in the GPCR gene and thereby to determine whether a subject with the mutation is at risk for a disorder caused by the mutation. Mutations include deletion, addition, or substitution of one or more nucleotides in the gene, chromosomal rearrangement, such as inversion or transposition, modification of genomic DNA, such as aberrant methylation patterns or changes in gene copy number, such as amplification. Detection of a mutated form of the GPCR gene associated with a dysfunction provides a diagnostic tool for an active disease or susceptibility to disease when the disease results from over expression, under expression, or altered expression of a GPCR protein.

Individuals carrying mutations in the GPCR gene can be detected at the nucleic acid level by a variety of techniques. Genomic DNA can be analyzed directly or can be amplified by using PCR prior to analysis. RNA or cDNA can be used in the same way. In some uses, detection of the mutation involves the use of a probe/primer in a polymerase chain reaction (PCR) (see, e.g. U.S. Pat. Nos. 4,683,195 and 4,683,202), such as anchor PCR or RACE PCR, or, alternatively, in a ligation chain reaction (LCR) (see, e.g., Landegran et al., Science 241 :1077-1080 (1988); and Nakazawa et al., PNAS 91 :360-364 (1994)), the latter of which can be particularly useful for detecting point mutations in the gene (see Abravaya et al., Nucleic Acids Res. 23:675-682 (1995)). This method can include the steps of collecting a sample of cells from a patient, isolating nucleic acid (e.g., genomic, mRNA or both) from the cells of the sample, contacting the nucleic acid sample with one or more primers which specifically hybridize to a gene under conditions such that hybridization and amplification of the gene (if present) occurs, and detecting the presence or absence of an amplification product, or detecting the size of the amplification product and comparing the length to a control sample. Deletions and insertions can be detected by a change in size of the amplified product compared to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to normal RNA or antisense DNA sequences. Alternatively, mutations in a GPCR gene can be directly identified, for example, by alterations in restriction enzyme digestion patterns determined by gel electrophoresis. Further, sequence-specific ribozymes (U.S. Pat. No. 5,498,531 ) can be used to score for the presence of specific mutations by development or loss of a ribozyme cleavage site. Perfectly matched sequences can be distinguished from mismatched sequences by nuclease cleavage digestion assays or by differences in melting temperature.

Sequence changes at specific locations can also be assessed by nuclease protection assays such as RNase and S1 protection or the chemical cleavage method. Furthermore, sequence differences between a mutant GPCR gene and a wild-type gene can be determined by direct DNA sequencing. A variety of automated sequencing procedures can be utilized when performing the diagnostic assays (Naeve, C. W., (1995) Biotechniques 19:448), including sequencing by mass spectrometry (see, e.g., PCT International Publication No. WO 94/16101 ; Cohen et al., Adv. Chromatogr. 36:127-162 (1996); and Griffin et al., Appl. Biochem. Biotechnol. 38:147-159 (1993)).

Other methods for detecting mutations in the gene include methods in which protection from cleavage agents is used to detect mismatched bases in RNA/RNA or RNA/DNA duplexes (Myers et al., Science 230:1242 (1985)); Cotton et al., PNAS 85:4397 (1988); Saleeba et al., Meth.

Enzymol. 217:286-295 (1992)), electrophoretic mobility of mutant and wild type nucleic acid is compared (Orita et al., PNAS 86:2766 (1989); Cotton et al., Mutat. Res. 285:125-144 (1993); and Hayashi et al., Genet. Anal. Tech. Appl. 9:73-79 (1992)), and movement of mutant or wild-type fragments in polyacrylamide gels containing a gradient of denaturant is assayed using denaturing gradient gel electrophoresis (Myers et al., Nature 313:495 (1985)). Examples of other techniques for detecting point mutations include selective oligonucleotide hybridization, selective amplification, and selective primer extension.

The nucleic acid molecules are also useful for testing an individual for a genotype that while not necessarily causing the disease, nevertheless affects the treatment modality. Thus, the nucleic acid molecules can be used to study the relationship between an individual's genotype and the individual's response to a compound used for treatment (pharmacogenomic relationship). Accordingly, the nucleic acid molecules described herein can be used to assess the mutation content of the GPCR gene in an individual in order to select an appropriate compound or dosage regimen for treatment.

Thus nucleic acid molecules displaying genetic variations that affect treatment provide a diagnostic target that can be used to tailor treatment in an individual. Accordingly, the production of recombinant cells and animals containing these polymorphisms allow effective clinical design of treatment compounds and dosage regimens.

The nucleic acid molecules are thus useful as antisense constructs to control GPCR gene expression in cells, tissues, and organisms. A DNA antisense nucleic acid molecule is designed to be complementary to a region of the gene involved in transcription, preventing transcription and hence production of GPCR protein. An antisense RNA or DNA nucleic acid molecule would hybridize to the mRNA and thus block translation of mRNA into GPCR protein. Alternatively, a class of antisense molecules can be used to inactivate mRNA in order to decrease expression of GPCR nucleic acid. Accordingly, these molecules can treat a disorder characterized by abnormal or undesired GPCR nucleic acid expression. This technique involves cleavage by means of ribozymes containing nucleotide sequences complementary to one or more regions in the mRNA that attenuate the ability of the mRNA to be translated. Possible regions include coding regions and particularly coding regions corresponding to the catalytic and other functional activities of the GPCR protein, such as ligand binding.

The nucleic acid molecules also provide vectors for gene therapy in patients containing cells that are aberrant in GPCR gene expression. Thus, recombinant cells, which include the patient's cells that have been engineered ex vivo and returned to the patient, are introduced into an individual where the cells produce the desired GPCR protein to treat the individual.

The invention also encompasses kits for detecting the presence of a GPCR nucleic acid in a biological sample. For example, the kit can comprise reagents such as a labeled or labelable nucleic acid or agent capable of detecting GPCR nucleic acid in a biological sample; means for determining the amount of GPCR nucleic acid in the sample; and means for comparing the amount of GPCR nucleic acid in the sample with a standard. The compound or agent can be packaged in a suitable container. The kit can further comprise instructions for using the kit to detect GPCR protein mRNA or DNA. The present invention further provides nucleic acid detection kits, such as arrays or microarrays of nucleic acid molecules that are based on the sequence information provided in the figures.

As used herein "Arrays" or "Microarrays" refers to an array of distinct polynucleotides or oligonucleotides synthesized on a substrate, such as paper, nylon or other type of membrane, filter, chip, glass slide, or any other suitable solid support. In one embodiment, the microarray is prepared and used according to the methods described in U.S. Pat. No. 5,837,832, Chee et al., PCT application WO95/1 1995 (Chee et al.),

Lockhart, D. J. et al. (1996; Nat. Biotech. 14: 1675-1680) and Schena, M. et al. (1996; Proc. Natl. Acad. Sci. 93: 10614-10619), all of which are incorporated herein in their entirety by reference. In other embodiments, such arrays are produced by the methods described by Brown et. al., U.S. Pat. No. 5,807,522.

The microarray or detection kit is preferably composed of a large number of unique, single-stranded nucleic acid sequences, usually either synthetic antisense oligonucleotides or fragments of cDNAs, fixed to a solid support. The oligonucleotides are preferably about 6-60 nucleotides in length, more preferably 15-30 nucleotides in length, and most preferably about 20-25 nucleotides in length. For a certain type of microarray or detection kit, it may be preferable to use oligonucleotides that are only 7- 20 nucleotides in length. The microarray or detection kit may contain oligonucleotides that cover the known 5', or 3', sequence, sequential oligonucleotides which cover the full length sequence; or unique oligonucleotides selected from particular areas along the length of the sequence. Polynucleotides used in the microarray or detection kit may be oligonucleotides that are specific to a gene or genes of interest. In order to produce oligonucleotides to a known sequence for a microarray or detection kit, the gene(s) of interest is typically examined using a computer algorithm which starts at the 5' or at the 3' end of the nucleotide sequence. Typical algorithms will then identify oligomers of defined length that are unique to the gene, have a GC content within a range suitable for hybridization, and lack predicted secondary structure that may interfere with hybridization. In certain situations it may be appropriate to use pairs of oligonucleotides on a microarray or detection kit. The "pairs" will be identical, except for one nucleotide that preferably is located in the center of the sequence. The second oligonucleotide in the pair (mismatched by one) serves as a control. The number of oligonucleotide pairs may range from two to one million. The oligomers are synthesized at designated areas on a substrate using a light-directed chemical process. The substrate may be paper, nylon or other type of membrane, filter, chip, glass slide or any other suitable solid support.

In another aspect, an oligonucleotide may be synthesized on the surface of the substrate by using a chemical coupling procedure and an ink jet application apparatus, as described in PCT application WO95/2511 16 (Baldeschweiler et al.) which is incorporated herein in its entirety by reference. In another aspect, a "gridded" array analogous to a dot (or slot) blot may be used to arrange and link cDNA fragments or oligonucleotides to the surface of a substrate using a vacuum system, thermal, UV, mechanical or chemical bonding procedures. An array, such as those described above, may be produced by hand or by using available devices (slot blot or dot blot apparatus), materials (any suitable solid support), and machines (including robotic instruments), and may contain 8, 24, 96, 384, 1536, 6144 or more oligonucleotides, or any other number between two and one million which lends itself to the efficient use of commercially available instrumentation.

In order to conduct sample analysis using a microarray or detection kit, the RNA or DNA from a biological sample is made into hybridization probes. The mRNA is isolated, and cDNA is produced and used as a template to make antisense RNA (aRNA). The aRNA is amplified in the presence of fluorescent nucleotides, and labeled probes are incubated with the microarray or detection kit so that the probe sequences hybridize to complementary oligonucleotides of the microarray or detection kit. Incubation conditions are adjusted so that hybridization occurs with precise complementary matches or with various degrees of less complementarity. After removal of nonhybridized probes, a scanner is used to determine the levels and patterns of fluorescence. The scanned images are examined to determine degree of complementarity and the relative abundance of each oligonucleotide sequence on the microarray or detection kit. The biological samples may be obtained from any bodily fluids (such as blood, urine, saliva, phlegm, gastric juices, etc.), cultured cells, biopsies, or other tissue preparations. A detection system may be used to measure the absence, presence, and amount of hybridization for all of the distinct sequences simultaneously. This data may be used for large scale correlation studies on the sequences, expression patterns, mutations, variants, or polymorphisms among samples.

Using such arrays, the present invention provides methods to identify the expression of the GPCR proteins/peptides of the present invention. In detail, such methods comprise incubating a test sample with one or more nucleic acid molecules and assaying for binding of the nucleic acid molecule with components within the test sample. Such assays will typically involve arrays comprising many genes, at least one of which is a gene of the present invention and or alleles of the GPCR gene of the present invention.

Conditions for incubating a nucleic acid molecule with a test sample vary. Incubation conditions depend on the format employed in the assay, the detection methods employed, and the type and nature of the nucleic acid molecule used in the assay. One skilled in the art will recognize that any one of the commonly available hybridization, amplification or array assay formats can readily be adapted to employ the novel fragments of the Human genome disclosed herein. Examples of such assays can be found in Chard, T, An Introduction to Radioimmunoassay and Related Techniques, Elsevier Science Publishers, Amsterdam, The Netherlands (1986); Bullock, G. R. et al., Techniques in Immunocytochemistry, Academic Press, Orlando, Fla. Vol. 1 (1982), Vol. 2 (1983), Vol. 3 (1985); Tijssen, P., Practice and Theory of Enzyme Immunoassays: Laboratory Techniques in Biochemistry and Molecular Biology, Elsevier Science Publishers, Amsterdam, The Netherlands (1985).

The test samples of the present invention include cells, protein or membrane extracts of cells. The test sample used in the above-described method will vary based on the assay format, nature of the detection method and the tissues, cells or extracts used as the sample to be assayed. Methods for preparing nucleic acid extracts or of cells are well known in the art and can be readily be adapted in order to obtain a sample that is compatible with the system utilized.

In another embodiment of the present invention, kits are provided which contain the necessary reagents to carry out the assays of the present invention. Specifically, the invention provides a compartmentalized kit to receive, in close confinement, one or more containers which comprises: (a) a first container comprising one of the nucleic acid molecules that can bind to a fragment of the Human genome disclosed herein; and (b) one or more other containers comprising one or more of the following: wash reagents, reagents capable of detecting presence of a bound nucleic acid.

In detail, a compartmentalized kit includes any kit in which reagents are contained in separate containers. Such containers include small glass containers, plastic containers, strips of plastic, glass or paper, or arraying material such as silica. Such containers allows one to efficiently transfer reagents from one compartment to another compartment such that the samples and reagents are not cross-contaminated, and the agents or solutions of each container can be added in a quantitative fashion from one compartment to another. Such containers will include a container which will accept the test sample, a container which contains the nucleic acid probe, containers which contain wash reagents (such as phosphate buffered saline, Tris-buffers, etc.), and containers which contain the reagents used to detect the bound probe. One skilled in the art will readily recognize that the previously unidentified GPCR genes of the present invention can be routinely identified using the sequence information disclosed herein can be readily incorporated into one of the established kit formats which are well known in the art, particularly expression arrays.

The invention also provides vectors containing the nucleic acid molecules described herein. The term "vector" refers to a vehicle, preferably a nucleic acid molecule, which can transport the nucleic acid molecules. When the vector is a nucleic acid molecule, the nucleic acid molecules are covalently linked to the vector nucleic acid. With this aspect of the invention, the vector includes a plasmid, single or double stranded phage, a single or double stranded RNA or DNA viral vector, or artificial chromosome, such as a BAC, PAC, YAC, OR MAC.

A vector can be maintained in the host cell as an extrachromosomal element where it replicates and produces additional copies of the nucleic acid molecules. Alternatively, the vector may integrate into the host cell genome and produce additional copies of the nucleic acid molecules when the host cell replicates.

The invention provides vectors for the maintenance (cloning vectors) or vectors for expression (expression vectors) of the nucleic acid molecules. The vectors can function in prokaryotic or eukaryotic cells or in both (shuttle vectors).

Expression vectors contain cis-acting regulatory regions that are operably linked in the vector to the nucleic acid molecules such that transcription of the nucleic acid molecules is allowed in a host cell. The nucleic acid molecules can be introduced into the host cell with a separate nucleic acid molecule capable of affecting transcription. Thus, the second nucleic acid molecule may provide a trans-acting factor interacting with the cis- regulatory control region to allow transcription of the nucleic acid molecules from the vector. Alternatively, a trans-acting factor may be supplied by the host cell. Finally, a trans-acting factor can be produced from the vector itself. It is understood, however, that in some embodiments, transcription and/or translation of the nucleic acid molecules can occur in a cell-free system. The regulatory sequence to which the nucleic acid molecules described herein can be operably linked include promoters for directing mRNA transcription. These include, but are not limited to, the left promoter from bacteriophage lambda., the lac, TRP, and TAC promoters from E. coli, the early and late promoters from SV40, the CMV immediate early promoter, the adenovirus early and late promoters, and retrovirus long- terminal repeats.

In addition to control regions that promote transcription, expression vectors may also include regions that modulate transcription, such as repressor binding sites and enhancers. Examples include the SV40 enhancer, the cytomegalovirus immediate early enhancer, polyoma enhancer, adenovirus enhancers, and retrovirus LTR enhancers.

In addition to containing sites for transcription initiation and control, expression vectors can also contain sequences necessary for transcription termination and, in the transcribed region a ribosome binding site for translation. Other regulatory control elements for expression include initiation and termination codons as well as polyadenylation signals. The person of ordinary skill in the art would be aware of the numerous regulatory sequences that are useful in expression vectors. Such regulatory sequences are described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1989).

A variety of expression vectors can be used to express a nucleic acid molecule. Such vectors include chromosomal, episomal, and virus-derived vectors, for example vectors derived from bacterial plasmids, from bacteriophage, from yeast episomes, from yeast chromosomal elements, including yeast artificial chromosomes, from viruses such as baculoviruses, papovaviruses such as SV40, Vaccinia viruses, adenoviruses, poxviruses, pseudorabies viruses, and retroviruses. Vectors may also be derived from combinations of these sources such as those derived from plasmid and bacteriophage genetic elements, e.g. cosmids and phagemids. Appropriate cloning and expression vectors for prokaryotic and eukaryotic hosts are described in Sambrook et al., Molecular Cloning: A Laboratory Manual. 2nd. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., (1989).

The regulatory sequence may provide constitutive expression in one or more host cells (i.e. tissue specific) or may provide for inducible expression in one or more cell types such as by temperature, nutrient additive, or exogenous factor such as a hormone or other ligand. A variety of vectors providing for constitutive and inducible expression in prokaryotic and eukaryotic hosts are well known to those of ordinary skill in the art.

The nucleic acid molecules can be inserted into the vector nucleic acid by well-known methodology. Generally, the DNA sequence that will ultimately be expressed is joined to an expression vector by cleaving the DNA sequence and the expression vector with one or more restriction enzymes and then ligating the fragments together. Procedures for restriction enzyme digestion and ligation are well known to those of ordinary skill in the art.

The vector containing the appropriate nucleic acid molecule can be introduced into an appropriate host cell for propagation or expression using well-known techniques. Bacterial cells include, but are not limited to, E. coli, Streptomyces, and Salmonella typhimurium. Eukaryotic cells include, but are not limited to, yeast, insect cells such as Drosophila, animal cells such as COS and CHO cells, and plant cells.

As described herein, it may be desirable to express the peptide as a fusion protein. Accordingly, the invention provides fusion vectors that allow for the production of the peptides. Fusion vectors can increase the expression of a recombinant protein, increase the solubility of the recombinant protein, and aid in the purification of the protein by acting for example as a ligand for affinity purification. A proteolytic cleavage site may be introduced at the junction of the fusion moiety so that the desired peptide can ultimately be separated from the fusion moiety. Proteolytic enzymes include, but are not limited to, factor Xa, thrombin, and enterokinase. Typical fusion expression vectors include pGEX (Smith et al., Gene 67:31 -40 (1988)), pMAL (New England Biolabs, Beverly, Mass.) and pRIT5 (Pharmacia, Piscataway, N.J.) which fuse glutathione S- transferase (GST), maltose E binding protein, or protein A, respectively, to the target recombinant protein. Examples of suitable inducible non- fusion E. coli expression vectors include pTrc (Amann et al., Gene 69:301 - 315 (1988)) and pET 1 1 d (Studier et al., Gene Expression Technology: Methods in Enzymology 185:60-89 (1990)).

Recombinant protein expression can be maximized in a host bacteria by providing a genetic background wherein the host cell has an impaired capacity to proteolytically cleave the recombinant protein. (Gottesman, S., Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. (1990)1 19-128). Alternatively, the sequence of the nucleic acid molecule of interest can be altered to provide preferential codon usage for a specific host cell, for example E. coli. (Wada et al., Nucleic Acids Res. 20:21 1 1 -21 18 (1992)).

The nucleic acid molecules can also be expressed by expression vectors that are operative in yeast. Examples of vectors for expression in yeast e.g., S. cerevisiae include pYepSed (Baldari, et al., EMBO J. 6:229-234 (1987)), pMFa (Kurjan et al., Cell 30:933-943(1982)), pJRY88 (Schultz et al., Gene 54:113-123 (1987)), and pYES2 (Invitrogen Corporation, San Diego, Calif.).

The nucleic acid molecules can also be expressed in insect cells using, for example, baculovirus expression vectors. Baculovirus vectors available for expression of proteins in cultured insect cells (e.g., Sf 9 cells) include the pAc series (Smith et al., Mol. Cell Biol. 3:2156-2165 (1983)) and the pVL series (Lucklow et al., Virology 170:31 -39 (1989)).

In certain embodiments of the invention, the nucleic acid molecules described herein are expressed in mammalian cells using mammalian expression vectors. Examples of mammalian expression vectors include pCDM8 (Seed, B. Nature 329:840(1987)) and pMT2PC (Kaufman et al., EMBO J. 6:187-195(1987)).

The expression vectors listed herein are provided by way of example only of the well-known vectors available to those of ordinary skill in the art that would be useful to express the nucleic acid molecules. The person of ordinary skill in the art would be aware of other vectors suitable for maintenance propagation or expression of the nucleic acid molecules described herein. These are found for example in Sambrook, J., Fritsh, E. F., and Maniatis, T. Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 1989.

The invention also encompasses vectors in which the nucleic acid sequences described herein are cloned into the vector in reverse orientation, but operably linked to a regulatory sequence that permits transcription of antisense RNA. Thus, an antisense transcript can be produced to all, or to a portion, of the nucleic acid molecule sequences described herein, including both coding and non-coding regions. Expression of this antisense RNA is subject to each of the parameters described above in relation to expression of the sense RNA (regulatory sequences, constitutive or inducible expression, tissue-specific expression).

The invention also relates to recombinant host cells containing the vectors described herein. Host cells therefore include prokaryotic cells, lower eukaryotic cells such as yeast, other eukaryotic cells such as insect cells, and higher eukaryotic cells such as mammalian cells.

The recombinant host cells are prepared by introducing the vector constructs described herein into the cells by techniques readily available to the person of ordinary skill in the art. These include, but are not limited to, calcium phosphate transfection, DEAE-dextraπ-mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, lipofection, and other techniques such as those found in Sambrook, et al. (Molecular Cloning: A Laboratory Manual. 2nd, ed., Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1989). Host cells can contain more than one vector. Thus, different nucleotide sequences can be introduced on different vectors of the same cell. Similarly, the nucleic acid molecules can be introduced either alone or with other nucleic acid molecules that are not related to the nucleic acid molecules such as those providing trans-acting factors for expression vectors. When more than one vector is introduced into a cell, the vectors can be introduced independently, co-introduced or joined to the nucleic acid molecule vector.

In the case of bacteriophage and viral vectors, these can be introduced into cells as packaged or encapsulated virus by standard procedures for infection and transduction. Viral vectors can be replication-competent or replication-defective. In the case in which viral replication is defective, replication will occur in host cells providing functions that complement the defects.

Vectors generally include selectable markers that enable the selection of the subpopulation of cells that contain the recombinant vector constructs. The marker can be contained in the same vector that contains the nucleic acid molecules described herein or may be on a separate vector. Markers include tetracycline or ampicillin-resistance genes for prokaryotic host cells and dihydrofolate reductase or neomycin resistance for eukaryotic host cells. However, any marker that provides selection for a phenotypic trait will be effective.

While the mature proteins can be produced in bacteria, yeast, mammalian cells, and other cells under the control of the appropriate regulatory sequences, cell-free transcription and translation systems can also be used to produce these proteins using RNA derived from the DNA constructs described herein.

Where secretion of the peptide is desired, which is difficult to achieve with multi-transmembrane domain containing proteins such as GPCRs, appropriate secretion signals are incorporated into the vector. The signal sequence can be endogenous to the peptides or heterologous to these peptides.

Where the peptide is not secreted into the medium, which is typically the case with GPCRs, the protein can be isolated from the host cell by standard disruption procedures, including freeze thaw, sonication, mechanical disruption, use of lysing agents and the like. The peptide can then be recovered and purified by well-known purification methods including ammonium sulfate precipitation, acid extraction, anion or cationic exchange chromatography, phosphocellulose chromatography, hydrophobic-interaction chromatography, affinity chromatography, hydroxylapatite chromatography, lectin chromatography, or high performance liquid chromatography.

It is also understood that depending upon the host cell in recombinant production of the peptides described herein, the peptides can have various glycosylation patterns, depending upon the cell, or maybe non-glycosylated as when produced in bacteria. In addition, the peptides may include an initial modified methionine in some cases as a result of a host-mediated process.

The recombinant host cells expressing the peptides described herein have a variety of uses. First, the cells are useful for producing a GPCR protein or peptide that can be further purified to produce desired amounts of GPCR protein or fragments. Thus, host cells containing expression vectors are useful for peptide production.

Host cells are also useful for conducting cell-based assays involving the GPCR protein or GPCR protein fragments, such as those described above as well as other formats known in the art. Thus, a recombinant host cell expressing a native GPCR protein is useful for assaying compounds that stimulate or inhibit GPCR protein function.

Host cells are also useful for identifying GPCR protein mutants in which these functions are affected. If the mutants naturally occur and give rise to a pathology, host cells containing the mutations are useful to assay compounds that have a desired effect on the mutant GPCR protein (for example, stimulating or inhibiting function) which may not be indicated by their effect on the native GPCR protein.

Genetically engineered host cells can be further used to produce non- human transgenic animals. A transgenic animal is preferably a mammal, for example a rodent, such as a rat or mouse, in which one or more of the cells of the animal include a transgene. A transgene is exogenous DNA which is integrated into the genome of a cell from which a transgenic animal develops and which remains in the genome of the mature animal in one or more cell types or tissues of the transgenic animal. These animals are useful for studying the function of a GPCR protein and identifying and evaluating modulators of GPCR protein activity. Other examples of transgenic animals include non-human primates, sheep, dogs, cows, goats, chickens, and amphibians. A transgenic animal can be produced by introducing nucleic acid into the male pronuclei of a fertilized oocyte, e.g., by microinjection, retroviral infection, and allowing the oocyte to develop in a pseudopregnant female foster animal. Any of the GPCR protein nucleotide sequences can be introduced as a transgene into the genome of a non-human animal, such as a mouse.

Any of the regulatory or other sequences useful in expression vectors can form part of the transgenic sequence. This includes intronic sequences and polyadenylation signals, if not already included. A tissue- specific regulatory sequence(s) can be operably linked to the transgene to direct expression of the GPCR protein to particular cells.

Methods for generating transgenic animals via embryo manipulation and microinjection, particularly animals such as mice, have become conventional in the art and are described, for example, in U.S. Pat. Nos. 4,736,866 and 4,870,009, both by Leder et al., U.S. Pat. No. 4,873,191 by Wagner et al. and in Hogan, B., Manipulating the Mouse Embryo, (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1986). Similar methods are used for production of other transgenic animals. A transgenic founder animal can be identified based upon the presence of the transgene in its genome and/or expression of transgenic mRNA in tissues or cells of the animals. A transgenic founder animal can then be used to breed additional animals carrying the transgene. Moreover, transgenic animals carrying a transgene can further be bred to other transgenic animals carrying other transgenes. A transgenic animal also includes animals in which the entire animal or tissues in the animal have been produced using the homologously recombinant host cells described herein. In another embodiment, transgenic non-human animals can be produced which contain selected systems that allow for regulated expression of the transgene. One example of such a system is the cre/loxP recombinase system of bacteriophage P1. For a description of the cre/loxP recombinase system, see, e.g., Lakso et al. PNAS 89:6232-6236 (1992). Another example of a recombinase system is the FLP recombinase system of S. cerevisiae (O'Gorman et al. Science 251 : 1351 -1355 (1991 ). If a cre/loxP recombinase system is used to regulate expression of the transgene, animals containing transgenes encoding both the Cre recombinase and a selected protein is required. Such animals can be provided through the construction of "double" transgenic animals, e.g., by mating two transgenic animals, one containing a transgene encoding a selected protein and the other containing a transgene encoding a recombinase.

Clones of the non-human transgenic animals described herein can also be produced according to the methods described in Wilmut, I. et al. Nature 385:810-813 (1997) and PCT International Publication Nos. WO 97/07668 and WO 97/07669. In brief, a cell, e.g., a somatic cell, from the transgenic animal can be isolated and induced to exit the growth cycle and enter G.sub.o phase. The quiescent cell can then be fused, e.g., through the use of electrical pulses, to an enucleated oocyte from an animal of the same species from which the quiescent cell is isolated. The reconstructed oocyte is then cultured such that it develops to morula or blastocyst and then transferred to pseudopregnant female foster animal. The offspring born of this female foster animal will be a clone of the animal from which the cell, e.g., the somatic cell, is isolated. Transgenic animals containing recombinant cells that express the peptides described herein are useful to conduct the assays described herein in an in vivo context. Accordingly, the various physiological factors that are present in vivo and that could effect ligand binding, GPCR protein activation, and signal transduction, may not be evident from in vitro cell- free or cell-based assays. Accordingly, it is useful to provide non-human transgenic animals to assay in vivo GPCR protein function, including ligand interaction, the effect of specific mutant GPCR proteins on GPCR protein function and ligand interaction, and the effect of chimeric GPCR proteins. It is also possible to assess the effect of null mutations, that is mutations that substantially or completely eliminate one or more GPCR protein functions.

The nucleic acids, cDNAs, oligonucleotides, polypeptides and antibodies for the HUMAN LGR9 GPCR, which are the subject of this invention, provide a plurality of tools for studying GPCR-mediated activity and function in various cells and tissues and for diagnosing diseases and selecting activators, inhibitors or drugs with the potential to intervene in various disorders, diseases, or conditions in which altered HUMAN LGR9 GPCR expression is implicated. The disorders, diseases, or conditions include, but are not limited to, cryptorchidism. atrophy, asthma, inflammation, allergy, angiogenesis, respiratory distress syndrome, Crohn's disease, edema, high or low blood pressure growth, development, blood and bone homeostasis.

Applicants disclose an invention that finds utility in the treatment of cryptorchidism. Additionally, the invention may be used to treat atrophy, and atrophy-associated conditions, as well as in the induction of hypertrophy. All publications and patents mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the above-described modes for carrying out the invention which are obvious to those skilled in the field of molecular biology or related fields are intended to be within the scope of the following claims.

The examples below are provided to illustrate the subject invention. These examples are provided by way of illustration and are not included for the purpose of limiting the invention.

EXAMPLES

Evample 1 : Identification of HUMAN LGR9 GPCR

An extensive database (> 4000 sequences) of all known GPCR protein sequences was compiled. The database was expanded by several rounds of homology search, BLASTp BLAST 2.0 was obtained from the NCBI ftp site (ftp://ncbi.nlm.nih.gov/blast/executables). This homology search was performed against public protein sequences from GenBank. The positions of putative transmembrane segments was annotated for each family member using a combination of homology (matching transmembrane positions to those of the closest homologue), hydrophobicity and alignment of key conserved residues to general models (e.g. Baldwin JM; Schertler GF; Unger VM, J Mol Biol 1997 Sep 12;272(1 ):144-64). In addition to BLAST search, the CLUSTALW algorithm (CLUSTALW 1 .7, Nucleic Acids Research, 22(22):4673-4680), which was downloaded from www.csc.fi/molbio/progs/clustalw/clustalw.html), was also used in some cases to align sequences for annotation of transmembrane regions.

New GPCR homologues were identified from human genomic DNA sequence as follows: Both finished and unfinished high throughput human genomic DNA sequence was downloaded weekly from the NCBI database which can be accessed via the internet at the following URL: ftp://ncbi.nlm.nih.gov/genbank/genomes/H_sapiens. The DNA sequences were converted into predicted proteins using the GenScan program (GenScan, Burge, C. & Karlin, S., 1997, Prediction of complete gene structures in human genomic DNA. J. Mol. Biol. 268, 78-94; Burge, C. B. and Karlin, S.,1998, Finding the genes in genomic DNA. Curr. Opin. Struct. Biol. 8, 346-354, licensed from Stanford University) set for human/vertebrate/Drosophila bias. All proteins greater than 20 amino acids in length that were predicted using either optimal or suboptimal exons (see annotation of GenScan for a description of optimal and suboptimal exon prediction) (cutoff = 0.1 ) were included Each of the predicted proteins were compared using BLASTp to the GPCR database created as described supra using only those regions of each sequence in the GPCR database that extend from the first through the seventh transmembrane domain inclusive (Tms 1 -7). Each predicted protein which showed homology to any member of the database (cutoff = e < 10-4, e = expected value as defined by the BLAST program) was examined. A partial version of HUMAN LGR9 GPCR was initially identified as a predicted protein from a BAC clone (RP11 -15909, GenBank ace. AL136106, gi: 6982015) having homology to known GPCRs in the region extending from the first to the fifth transmembrane segments. Additional regions of the BAC sequence with potential homology to known GPCRs were identified. These were used to design PCR primers which were used to amplify additional HUMAN LGR9 coding sequences from human skeletal muscle cDNA, this having been identified as a location of HUMAN LGR9 expression (see example 3 below). The amino terminus of HUMAN LGR9 was identified by 5' RACE (ref) from human skeletal muscle Marathon-Ready cDNA (Clontech) using the following primers:

1. LGR9-5'RACE-1 : GCATTGTGGATACTGTTTTAGAAAGCACTCCTGTGTTAAGG

2. LGR9-5ΗACE-2: TCGCCCATCCACTAGTGTCACCACAGTTCTC 3. LGR9-5'RACE-3: GTTCCCACAGTCATCCTTGCCATCACAGTG

Example 2: Comparison of LGR7 (GenBank acc.#AAG17167)_an_| HUMAN LGR9 GPCR amino acid sequences.

A comparison of the LGR7 (GenBank acc.#AAG17167)and HUMAN LGR9 GPCR amino acid sequences was performed using the ClustalW algorithm imbedded in MacVector 6.5.1 (Oxford Molecular Group, pic). The results of this comparison are shown in Figure 2A-2B. The high degree of homology indicates that HUMAN LGR9 GPCR identified supra is likely to be a GPCR Example 3: Expression pattern of HUMAN LGR9 GPCR

Expression levels of HUMAN LGR9 GPCR mRNAs in human tissues were ascertained by TaqMan analysis. The abundance of mRNA was determined using the quantitative RT-PCR "TaqMan" procedure (Lie, Y. S. and

Petropoulos, C. J., "Advances in quantitative PCR technology: 5' nuclease assays", Curr Opin Biotechnol 9 (1998): 43-48.) with a PE ABI PRISM 7700 Sequence Detection System instrument (PE Biosystems, Foster City, CA).

This method employs two oligonucleotides spaced relatively close to each other to PCR amplify a portion of the message from cDNA and a third "probe" oligonucleotide co-labeled with a fluorophore and quencher at each end. When the level of the PCR product builds up to a sufficient level, a significant fraction of the fluorophore is released by a "nick-translation" exonucleolytic activity of the polymerase. The released fluorophore becomes highly fluorescent by being dissociated from the quenching moiety. The abundance of a specific mRNA is determined by reading fluorescence during the course of the PCR reaction: samples containing more abundant messages taking fewer PCR cycles to release probe fluorescence, while samples containing the same message in lower abundance will require more cycles.

For TaqMan analysis of HUMAN LGR9 GPCR the following oligonucleotides were employed: LGR9-F1 ACCGAGGGCAGTATCAGAAGTATG

LGR9-R1 AGGAACCCCATGAGGCGG

LGR9-Tqn1 CTTGCTGTGGATGGAGAGCGTGCA The TaqMan PCR reactions were run on a Perkin Elmer ABI PRISM 7700 Sequence Detection System instrument. MicroAmp (Perkin Elmer) optical 96-well plates and optical caps were used. Each reaction had a final volume of 25 vl and the following concentrations of components: 1 X TaqMan buffer A, 4 mM MgCI₂, 200 μM of each of dATP, dCTP, dGTP, and 400 μM dUTP, 300 nM of each of forward (LGR9-F1 ) and reverse (LGR9- R1 ) primers, 200 nM of TaqMan probe, 5% DMSO, 10% glycerol, 0.025 U/μl AmpliTaq Gold, and 1 U/μl AmpErase UNG. The PCR cycling conditions were as follows: 2 min. at 50°C, 10 min. at 95°C, followed by 40 two-step cycles of 15 sec at 95°C and 1 min. at 60°C. The TaqMan probehad a 6- FAM 5'-Fluorescent label and TAMRA 3'-label that acts as a quencher.

The results of this analysis are set forth in Figure 3. Expression was seen in the following human tissues: testis, skeletal muscle, fetal brain and uterus. Specific expression in these tissues suggests that this receptor may be involved in a physiological process or disease state that involves one of them. Activation or inhibition of human LGR9 receptor function may be beneficial to a disease state of one of these tissues. Because of its high expression in muscle tissue, activation of HUMAN LGR9 is specifically expected to inhibit skeletal muscle atrophy.

Example 4: The effect of activation of LGR9 in muscle cells.

The role of the LGR9 pathway in C2C12 myoblasts and differentiated myotubes was examined by genetic manipulation, using vectors capable of expressing a gene of interest as well as the green fluorescent protein (GFP) reporter gene. This strategy enabled isolation of rare clones of transfected cells expressing desired levels of the gene of interest, using standard fluorescence activated cell sorter (FACS) technology. Expression of the transgenes was confirmed by standard immuno- blotting. HA-epitope tagged constitutively active LGR9 (the mutation strategy for creating a constitutively active form of LGR9 was suggested by Kudo et al., (1996) J. of Biolo Chem., 271 , 22470-22478; and Kjelsberg et al., (1992) J. Bio Chem., 2678, 1430-1433) and wild-type LGR9 were subcloned into a bi-cistronic vector consisting of the MCK promoter (Jaynes, et al. (1988) Mol. Cell. Biol. 8:62 and an IRES-EGFP cassette (Clontech). The clone containing the constitutively active LGR9 mutant is called pcDNA+LGR9-HA (A637K, E633G). The clone containing the wild type LGR9 is called pcDNA+LGR9-HA. Both clones were deposited with the American Type Culture Collection (ATCC •) on June 19, 2001. Subconfluent C2C12 myoblasts were transfected by calcium phosphate- mediated co-transfection (Specialty Media, Inc.). Transfection was performed as described previously (Glass, et al. (1996) Cell 85:513). Flow cytometry and cell sorting were carried out on a Cytomation MoFlo (Fort Collins, CO) high speed cell sorter. Laser excitation was 130 mw at 488 nm. Fluorescence emission was collected through a 530/540 nm band pass filter for GFP. For sorting, cells were collected at a sort rate of 25,000 cells/second. The collected myoblasts were then grown to confluence, and differentiated by standard techniques into "myotubes", which are multi-nucleated muscle cells, similar to actual muscle fibers.

Expression of GFP alone did not alter the C2C12 differentiation process. Hypertrophy was scored by determining the average diameter of one hundred transfected myotubes; vector-driven expression of a constitutively active form of LGR9 caused a hypertrophic phenotype in comparison to wild-type LGR9 (wtLGR9) or myotubes expressing EGFP alone. The effect was even more pronounced than that observed previously by the Applicants, in which a dominant negative form of Raf was expressed by C2C12 cells. Thus, genetic manipulation of the LGR9 pathways revealed that activation of LGR9 would be sufficient to cause hypertrophy in skeletal muscle, and may be therefore used to block skeletal muscle atrophy.

EXAMPLE 5: Stimulation of cyclic AMP response element (CRE) transcription by cloned LGR9 and activated mutants.

A CRE-luciferase reporter assay was performed to detect activation of the cAMP pathway by LGR9 and activating mutants of LGR9 using Dual Luciferase Reporter Assay Kit (Promega) as follows: A mixture of 25 ng of receptor (or vector control) plasmid, 25ng CRE-luciferase plasmid and 1 ng pRL-TK (a renilla luciferase control for transfection efficiency) was transfected into HEK293 cells in 96 well plates in triplicate using Fugene 6 (Roche Applied Science).

The LGR9 expression plasmid gave an 11 fold increase in CRE-luciferase expression compared to empty expression vector, whereas LGR9(A637K) gave a 32 fold increase and LGR9 (A637K, E633G) gave a 35 fold increase. Thus, the constitutively active LGR9 mutants showed ligand independent activation of cAMP production as compared to the wild type receptor. Because unstimulated LGR9 gives a basal level stimulation of cAMP levels and mutations in the third loop, homologous to known activating mutations in related receptors, increased this stimulation, we conclude that ligand stimulation of LGR9 will also result in a stimulation of cAMP. EXAMPLE fi: Expression of a LacZ reporter gene knocked into the mouse LGR9 gene.

Methods

Genetic manipulation. A portion of the LGR9 gene, encoding amino acids 452 to 572, was replaced in mice with the E. coli lacZ gene using the technique described in WO 0236789142 This manipulation results in the expression of a hybrid protein, encoding LGR9 through its first transmembrane domain fused to beta-galactosidase, in the same tissues as the endogenous LGR9 gene. LGR9 function was maintained by the second, wild-type, allele in heterozygous animals. LGR9 function was lost in mice homozygous for the modified allele.

Animals. Thirty-seven adult male and female mice (ages 10-20 weeks), comprising wild-type, heterozygous, and homozygous genotypes were used. The mice were F1 offspring of chimera males and C57BL/6 females, and F2 offspring of F1 heterozygous parents. They were housed in 12 hours of light per day at 69-74 and 40-60% humidity, and were fed ad libitum. One litter of 8 F2 pups, born from F1 heterozygous parents, were taken for study on the day of birth (PND 1).

Tissue Preparation. Adult mice were deeply anesthetized with a mixture of 120 mg/kg ketamine and 24 mg/kg xylazine, i.m. Pups were sedated by hypothermia. The mice then were exsanguinated and tissues were fixed by transcardial perfusion with ice-cold saline followed by 2 or 4 % paraformaldehyde in 0.1 M phosphate buffer. The following adult tissues were collected and post-fixed two hours, then transferred to sucrose cryoprotectant: brain, pituitary gland, spinal cord, kidney, striated (leg) muscle, thyroid gland and reproductive tract. Adult brains were sectioned in the coronal plane at 40 μm thickness. Other tissues were sectioned at 15 μm thickness. The reproductive tract was left intact in 6 adult animals and in all pups to examine lacZ expression in situ.

I anZ Expression. The expression of lacZ was examined by reaction with the beta-galactosidase (b-gal) substrate X-gal to produce a blue reaction product, or by immunohistochemistry with an antiserum raised against b- gal.

Tissue sections or whole tissues were stained with X-gal using a published protocol (Cepko C, Ryder E, Fekete DM, Bruhn S (1999) Detection of beta- galactosidase and alkaline phosphatase activities in tissues. In: Cells: A Laboratory Manual (Spector DL, Goldman RD, Leinwand LA, eds), pp 99.1 - 99.12. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.). The tissues were incubated in the X-gal reaction buffer at 37°C for 24 hours. Following X-gal staining, tissue sections were counterstained with eosin or neutral red. Whole tissues were immersed in 4% paraformaldehyde for 24 hours, in 50/50 glycerol/buffered saline for 24 hours, and then in 75% glycerol containing sodium azide for storage.

Standard protocols were followed for fluorescence immunohistochemical staining, using antisera raised against b-gal in goat (Biogenesis, Inc.) or rabbit (Molecular Probes, Inc.). Immunofluorescence staining was amplified using tyramide signal amplification reagents (NEN Life Science Products, Inc.). Results

Gubemaculum. Very strong X-gal staining was observed in the gubemaculum of both PND1 and adult mice of both sexes. In adult male homozygous mutants (with undescended testes, see below), and in adult female heterozygous or homozygous mutants, the staining was observed in the bulb of the gubemaculum, which is located in the most caudal wall of the inguinal cavity, as well as in the cord of the gubemaculum, which extended from the bulb to the epididymus (male) or ovarian duct (female).

Biain. Weaker LacZ expression was observed in neurons in various locations throughout the brain using both the X-gal reaction and the immunofluorescence methods. Regions with labeled neurons included the following: granule cell layer of the accessory olfactory bulb, cerebral cortex (layer V and VI), ventral pallidum, substantia innominata, hypothalamus (periventricular nucleus, paraventricular nucleus, arcuate nucleus, lateral area), thalamus, habenula, zona incerta, amygdala, hippocampus, pretectum, medial geniculate nucleus, superior colliculus, nucleus of the lateral lemniscus, parabrachial nucleus, vestibular nucleus, and area postrema. No difference in staining between males or females was observed. Expression was qualitatively the same in heterozygous and homozygous mutants, although X-gal staining intensity was stronger in the brains of homozygous mice.

Pituitary Gland. Weak LacZ expression was detected in sparsely scattered cells located in the anterior pituitary gland of female mice. No expression was detected in heterozygous or homozygous mutant male mice. Both the X-gal reaction and the immunofluorescence methods were used to study lacZ expression.

Spinal Cord. Weak X-gal staining revealed lacZ expression in a small number of cells located in the dorsal horn of the spinal cord.

Testis. LacZ-positive cells were detected by X-gal reaction near the lumen of the seminiferous tubules in heterozygous mutant males. The testes of homozygous mutant males were much smaller than normal and contained abnormally developed tubules, most likely a result of failure to descend from the peritoneal to the inguinal cavity. The tubules did not display staining.

Uterus. Diffuse X-gal staining was present in cells of the endometrium located along the stoma/epithelial border. Lacz expression also was observed grossly in the uterus of pups on postnatal day 1.

Thyroid Gland. Weak LacZ expression was not detected in the thyroid gland. The thyroid gland was evaluated by immunofluorescence, as it exhibited a strong endogenous b-gal activity when processed for X-gal staining (i.e. wild-type mice displayed X-gal staining).

Other tissues. LacZ expression was not detected by X-gal staining in kidney or striated leg muscle. The ovary exhibited endogenous b-gal activity, and displayed non-specific binding of the b-gal antisera, so LGR9 expression could not be evaluated in this organ.

The overall tissue distribution of LGR9 in mice is consistent with its function in testicular decent. EXAMPLE 7; Homozygous disruption of the LGR9 signaling domain leads to cryptorchidism in mice.

The genetically modified animals described above were bred to homozygosity. These mice fail to express the signaling domain (the 2^nd through 7^th transmembrane segments, the intracellular loops and the intracellular C-terminus) of LGR9 while retaining the entire extracellular N- terminus fused through the first transmembrane segment to beta- galactosidase. The extracellular N-terminus has been shown contain the ligand binding domain of other members of this family. Thus, these animals are likely to retain the ligand binding properties of LGR9, but be devoid of its signaling properties.

A total of 13 age-matched mice from 2 different litters were sacrificed at three moths of age (3 males homozygous for the modification, 3 heterozygous males, 3 wild type males, 1 homozygous female, 2 heterozygous females and 1 wild type female) and analyzed for gross abnormalities.

LGR9-/- mice were found to be normal except that every male examined exhibited bilateral cryptochidism (lack of testicular decent). The LGR9-/- male gube aculum did not contract but formed a long thin elongated structure similar to the normal female gubemaculum. In contrast, the heterozygote males as well as the wild type males contain a gubemaculum cord that is contracted and contains a thickened gubemaculum bulb. The testes of the LGR9-/- are located in the abdomen near the kidneys whereas those in the heterozygous and wild type male mice are fully descended. The testes of the male LGR9-/- mice were small in comparison to the wild type or heterozygote males and they displayed complete arrest of spermatocyte maturation. Seminiferous tubules are almost empty. Sertoli cells are degenerate or absent. The interstitium is thin and interstitial cells of Leydig are reduced in number. All of these testicular abnormalities are believed to be the result of increased temperature due to their lack of decent. In all animals, liver, spleen, kidney, pancreas, muscle and female reproductive organs were essentially normal.

The cryptorchidism phenotype of mice homozygously disrupted in LGR9 signaling appears to be the same as that seen in mice deleted in a large region that contains LGR9 as well as at least one other gene (Overbeek PA, Gorlov IP, Sutherland RW, Houston JB, Harrison WR, Boettger-Tong HL, Bishop CE, Agoulnik Al. A transgenic insertion causing cryptorchidism in mice. Genesis. 2001 May;30(1):26-35.).

EXAMPLE B: Stimulation of cyclic AMP in LGR9 transfected cells with purified relaxin and COS-expressed INSL3.

The cloned HUMAN LGR9 was shown to be stimulated by both porcine relaxin (obtained from A.F. Parlow at the National Hormone and Pituitary Program, Harbor-UCLA Medical Center) and human INSL3 produced in COS cells (fig 5). For expression of human INSL3 in COS cells, human Insl3 cDNA was isolated by PCR and cloned into the expression vector pcDNA3.1. Conditioned media were made by transfecting Cos-7 cells with pcDNA3.1 (mock), or human INSL3 expression plasmids. Conditioned media were harvested 36 hours post-traπsfection, separated from cell debris by low-speed centrifugation, aliquoted and stored at -80 C. It is surprising that the human INSL3 produced in fibroblast (COS7) cells is biologically active, because other members of this family, e.g. insulin, need to be expressed in specialized cell types, e.g. pancreatic islet cells, in order for proper post-translational processing to occur.

Deposit of Biological Material

The following clones were deposited with the ATCC^®, 10801 University Boulevard, Manassas, VA 201 10-2209, on June 19, 2001 :

pcDNA+LGR9-HA ATCC^® accession number pcDNA+LGR9-HA (AB37K, E633G) ATCC^® accession number

Claims

WHAT IS CLAIMED IS:

1. An isolated HUMAN LGR9 GPCR polypeptide comprising amino acid sequence selected from the group comprising: (a) an amino acid sequence as shown in Figure 4; (b) an amino acid sequence of an allelic variant of an amino acid sequence shown in Figure 4, where in said allelic variant in encoded by a nucleic acid molecule that hybridizes under stringent condition to the opposite strand of a nucleic acid molecule shown in Figure 1 ; (c) an amino acid sequence of an ortholog of an amino acid sequence shown in Figure 4, wherein said ortholog is encoded by a nucleic acid molecule that hybridizes under stringent condition to the opposite strand of a nucleic acid molecule shown in Figure 1 ; and (d) a fragment of an amino acid sequence shown in Fig 4 wherein said fragment comprises at least 10 contiguous amino acids.

2. An isolated nucleic acid molecule having a sequence selected from the group consisting of:

(a) the nucleotide sequence comprising the coding region of the HUMAN LGR9 GPCR as set forth in Figure 1 ; or (b) a nucleotide sequence that hybridizes under stringent conditions to the complement of the nucleotide sequence of (a) and which encodes HUMAN LGR9 GPCR, wherein said stringent conditions are 30% formamide in 5 x SSPE (0.18 M NaCl, 0.01 M NaPO₄, pH 7.7, 0.001 M EDTA) buffer at a temperature of 42°C and wherein said nucleotide sequence remains bound when subject to washing at 42°C with 0.2 x SSPE; or

(c) a nucleotide sequence which, as a result of the degeneracy of the genetic code, differs from the nucleic acid of (a) or (b) and which encodes HUMAN LGR9 GPCR.

I ll

3. A vector which comprises a nucleic acid of claim 2.

4. A vector according to claim 3, wherein the nucleic acid molecule is operatively linked to an expression control sequence capable of directing its expression in a host cell.

5. A vector according to claim 3 which is a plasmid.

6. A host-vector system for the production of HUMAN LGR9 GPCR which comprises a vector of claim 2, in a host cell.

7. A host-vector system according to claim 6, wherein the host cell is a bacterial, yeast, insect, amphibian or mammalian cell.

8. A soluble protein which comprises at least one extracellular region of the LGR9 GPCR protein.

9. The soluble protein of claim 8 fused to an immunoglobulin, an immunoglobulin constant region or a fragment thereof.

10. The soluble protein of claim 8 wherein such extracellular regions comprise an extracellular domain of the amino terminus of LGR9, an extracellular domain located between the second and third transmembrane domains, an extracellular domain located between the fourth and fifth transmembrane domains, an extracellular domain located between the fifth and sixth transmembrane domains, or any combination thereof.

11. The soluble protein of claim 10 wherein such extracellular region of the amino terminus comprises amino acid residues 1 - 418 of Figure 4.

12. The soluble protein of claim 10 wherein such extracellular region of the amino terminus comprises amino acid residues 36 - 418 of Figure 4.

13. The soluble protein of claim 10 wherein such an extracellular region between the second and third transmembrane domains comprises amino acid residues 471 - 498 of Figure 4.

14. The soluble protein of claim 10 wherein such an extracellular region between the fourth and fifth transmembrane domains comprises amino acid residues 560 - 591 of Figure 4 .

15. The soluble protein of claim 10 wherein such an extracellular region between the sixth and seventh transmembrane domains comprises amino acid residues 659 - 675 of Figure 4.

16. A method of producing HUMAN LGR9 GPCR which comprises introducing a nucleotide sequence encoding an amino acid sequence of claim 1 into a host cell, culturing under conditions permitting expression of the HUMAN LGR9 GPCR, and recovering the HUMAN LGR9 GPCR so produced.

17. A polypeptide produced by the method of claim 16.

18. An antibody which specifically binds the HUMAN LGR9 GPCR of claim 1 or 8.

19. An antibody according to claim 18, which is a monoclonal antibody.

20. An antibody according to claim 19, which is a wholly human monoclonal antibody.

21. A composition comprising HUMAN LGR9 GPCR according to claim 1 or 8 and a carrier.

22. A composition comprising an antibody according to claim 18, and a carrier.

23. HUMAN LGR9 GPCR according to claim 1 or 8 for use in a method of treatment of the human or animal body, or in a method of diagnosis.

24. A method of inducing hypertrophy in muscle cells by transfecting the muscle cells with an active LGR9 or activating a naturally occurring LGR9 expressed in a cell.

25. The method of claim 24 used as a treatment for conditions associated with a decrease in muscle mass, or atrophy.

26. A method of treating cryptorchidism comprising activating an LGR9 expressed in a cell.

27. The method of claim 26 wherein such cell is a gubemaculum cell.

28. The method of claim 26 wherein such cell is activated by lnsl-3 or relaxin.

29. A method of detecting activation of LGR9 by observing the phenotypic hypertrophy following transfection of a cell with LGR9.

30. A method of screening for ligands for LGR9 comprising contacting cells expressing LGR9 with a molecule to be screened, and observing the cell to detect a hypertrophic phenotype.

31. A method of screening for ligands for LGR9 comprising contacting cells expressing LGR9 with a molecule to be screened, and measuring cAMP production.

32. A method of screening for ligands for LGR9 comprising contacting cells expressing LGR9 with a molecule to be screened, and measuring the response from a reporter gene assay.

33. A method of screening for ligands for LGR9 comprising contacting cells expressing LGR9 with a molecule to be screened, and measuring a biological response.

34. A method for detecting the presence of any of the peptides of claim 1 or 8 in a sample, said method comprising contacting said sample with a detection agent that specifically allows detection of the presence of the peptide in the sample and then detecting the presence of the peptide.

35. A method for detecting the presence of the nucleic acid molecule of claim 2 in a sample, said method comprising contacting said sample with an oligonucleotide that hybridizes to said nucleic acid molecule under stringent conditions and determining whether the oligonucleotide binds to said nucleic acids molecule in the sample.

36. A method for identifying a modulator of a peptide of claim 1 or 8 in a sample, said method comprising contacting said peptide with an agent and determining if said agent has modulated the function or activity of said peptide.

37. A binding assay for identifying an agent which specifically binds to a HUMAN LGR9 GPCR comprising contacting cells expressing on their cell surface a HUMAN LGR9 GPCR with the agent under conditions suitable for binding, and detecting specific binding of the agent to the HUMAN LGR9 GPCR.

38. A competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising: a) obtaining cells expressing on their cell surface HUMAN LGR9 GPCR; b) contacting a sample of the cells in (a) with a first agent known to bind to HUMAN LGR9 GPCR; c) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR; d) contacting a second sample of the cells in (a) with a mixture of the first agent in (b) and a second agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown; e) detecting the amount of binding of the first agent in (d) to HUMAN LGR9 GPCR; f) comparing the amount of binding of the first agent detected in (c) with the amount of binding of the first agent detected in (e) wherein a decrease in the amount of binding of the first agent is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

39. A competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising: a) obtaining cells expressing on their cell surface HUMAN LGR9 GPCR; b) contacting a sample of the cells in (a) with a first agent known to bind to HUMAN LGR9 GPCR; c) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR; d) contacting a second sample of the cells in (a) with a second agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown; e) contacting the second sample in (d) with the first agent in (b); f) detecting the amount of binding of the first agent in (e) to HUMAN LGR9 GPCR; f) comparing the amount of binding of the first agent detected in (c) with the amount of binding of the first agent detected in (f) wherein a decrease in the amount of binding of the first agent is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

40. A competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising: a) preparing samples comprising HUMAN LGR9 GPCR; b) contacting a sample in (a) with a first agent known to bind to HUMAN LGR9 GPCR; c) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR; d) contacting a second sample in (a) with a mixture of the first agent in (b) and a second agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown; e) detecting the amount of binding of the first agent in (d) to HUMAN LGR9 GPCR; f) comparing the amount of binding of the first agent detected in (c) with the amount of binding of the first agent detected in (e) wherein a decrease in the amount of binding of the first agent is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

41. A competitive binding assay useful for identifying an agent which specifically binds to HUMAN LGR9 GPCR comprising: a) preparing samples comprising HUMAN LGR9 GPCR; b) contacting a sample in (a) with a first agent known to bind to HUMAN LGR9 GPCR; c) detecting the amount of binding of the first agent in (b) to HUMAN LGR9 GPCR; d) contacting a second sample in (a) with a second agent whose ability to specifically bind to HUMAN LGR9 GPCR is unknown; e) contacting the second sample in (d) with the first agent in (b); f) detecting the amount of binding of the first agent in (e) to HUMAN LGR9 GPCR; f) comparing the amount of binding of the first agent detected in

(c) with the amount of binding of the first agent detected in (f) wherein a decrease in the amount of binding of the first agent is indicative of the second agent's ability to specifically bind to HUMAN LGR9 GPCR.

42. The assay of claim 38, 39, 40, or 41 wherein said first agent is lnsl-3 or relaxin.

43. The assay of claims 37, 38, 39, 40 or 41 wherein the detection of the binding of the agent to HUMAN LGR9 GPCR is accomplished by any one of the methods selected from the group consisting of radioactive detection, fluorescence detection, chromogenic detection, mass spectroscopy, and plasmon resonance.

44. The assay of claim 37, 38, 39, 40 or 41 wherein the detection of specific binding of the agent to HUMAN LGR9 GPCR is accomplished by detecting a biological response.

45. The assay of claim 37, 38, 39, 40 or 41 wherein the cell expressing HUMAN LGR9 GPCR is a mammalian cell.

46. A method for producing human Insl3 in animal cell culture comprising transfecting cells with nucleic acids encoding Insl3 such that Insl3 is produced, and isolating said lnsl-3 from said culture.

47. The method of claim 46 wherein said cells are COS cells.