EP1412512A2 - Detection of ras mutations - Google Patents
Detection of ras mutationsInfo
- Publication number
- EP1412512A2 EP1412512A2 EP01977871A EP01977871A EP1412512A2 EP 1412512 A2 EP1412512 A2 EP 1412512A2 EP 01977871 A EP01977871 A EP 01977871A EP 01977871 A EP01977871 A EP 01977871A EP 1412512 A2 EP1412512 A2 EP 1412512A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- linked
- terminal nucleotide
- fluorescence
- nucleotides
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6827—Hybridisation assays for detection of mutation or polymorphism
- C12Q1/683—Hybridisation assays for detection of mutation or polymorphism involving restriction enzymes, e.g. restriction fragment length polymorphism [RFLP]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Definitions
- the present invention relates to primers, probes and methods for determining the presence of mutations. More specifically it relates to primers, probes and molecular beacons for determining the presence of ras mutations using Restriction Mediated Selection Polymerase Chain Reaction (REMS-PCR) and nested PCR methods.
- REMS-PCR Restriction Mediated Selection Polymerase Chain Reaction
- the ras family of oncogenes encode for membrane proteins possessing GTPase activity. These proteins are involved in cellular signal transduction. Specific point mutations, usually within the ras codons 12, 13, or 61, can result in the activation of these protooncogenes and result in subsequent neoplasia (Bos, J. L., 1989, Can. Res. 49:4682-4689).
- the frequency with which ras mutations occur varies among different tumor types. The highest frequency is found in tumors from the exocrine pancreas, where more than 80% of tumors harbor a mutated K-ras gene (Bos et al . , 1989, Can. Res. 49:4682-4689) . H-ras mutations occur more frequently than N-ras and K-ras mutations in urinary tract tumors. The frequency of H-ras oncogene mutation has been estimated at 5% to 17% (Saito, S. et al . , 1996, Int. J. Urol . 4:178-185).
- H-ras oncogene mutations have been detected in the urine of patients with bladder tumors (Haliassos, A. et al . , 1992, Int. J. Oncol. 1:731-734); potentially representing a non- invasive means for detecting neoplasia.
- H-ras mutations have been reported in other cancers including thyroid and kidney carcinomas (Bos, J. L., 1988, Mutat . Res. 195:255-71), and human primary breast carcinomas (Theillet, C. et al . , 1986, Cancer Res. 46:4776-4781).
- N-ras Mutations of the N-ras gene are most commonly found in myeloid and lymphoid cancers. Bos (1988, Mutat. Res. 195:255-71) reported that about one-third of leukemia patients have a mutated ras gene, mostly N-ras, in both early stage pre-leukemia and acute myeloid leukemia. N-ras . mutations have also been reported in human lymphoid malignancies (Neri, A. et al . , 1998, Proc . Natl . Acad. Sci . , USA, 85:9268-9272). More rarely, N-ras mutations have been detected in other carcinomas including melanoma, and carcinomas of the liver and thyroid.
- stage II the 7-year survival rate of patients having a ras muation was 58%; whereas, the 7-year survival rate of patients with wild type ras was 86% (Ahnen, D. J. et al., 1998, Can. Res. 58:1149-1158).
- K-ras and p53 gene mutations as well as P16 promoter hypermethylations can be used to screen for lymph node metastasis in colorectal cancer patients, that molecular-based methods increase the sensitivity of tumor cell detection, and are a good predictor of recurrence in patients with resectable liver metastasis .
- the present invention provides methods for amplifying and determining one or more mutations in one or more nucleic acids .
- the present invention provides nucleic acid primers and probes for amplifying and determining ras mutations.
- the invention provides REMS-PCR methods for determining ras mutations.
- the invention provides REMS-PCR methods for determining ras mutations in the presence of excess wild type nucleic acid.
- the invention provides primers, probes and nested PCR methods using one or more restriction endonucleases for amplifying and determining ras mutations.
- the invention provides primers, probes and nested PCR methods using one or more restriction endonucleases for amplifying and determining ras mutations in the presence of excess wild type nucleic acid.
- the invention provides primers, probes and nested PCR methods using one or more restriction endonucleases for amplifying and determining ras mutations in samples having a low copy number of the target nucleic acid.
- the invention is practiced using means such as containment devices for reducing contamination and methods that are capable of being automated.
- the invention provides homogenous methods for determining one or more target mutant sequences in one or more DNA nucleic acid sequences using probes, fluors and fluorescence quenchers. More specifically, a method is provided for amplifying and determining one or more target mutant sequences in a DNA sample, the method comprising the steps of:
- thermostable polymerases at least one thermostable restriction endonuclease that is capable of directly cleaving a wild type sequence or wild type sequences of said one or more target mutant sequences or cleaving a primer induced cleavage site, or both, vi) one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising said one or more target mutant sequences and capable of producing detectable fluorescence when hybridized thereto;
- the invention provides one or more oligonucleotides comprising a sequence selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO:
- Any of the oligonucleotides may comprise one or more fluorescence moieties and one or more fluorescence quenching moieties.
- SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO -.16, SEQ ID NO: 17, NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67 may comprise one or more fluorescence moieties and one or more fluorescence quenching moieties.
- the invention also relates to a method for amplifying DNA comprising a mutant ras sequence in a sample comprising the steps of :
- (A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, S
- the invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
- (A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO: , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ
- thermostable polymerases at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H-,or N-ras sequence or cleaving a primer induced cleavage site, or both;
- step (D) detecting the DNA comprising a mutant ras sequence separated by electrophoresis in step (C)
- the invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of
- thermostable polymerases at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both;
- sequence of the one or more immobilized oligonucleotides or one or more oligonucleotides capable of being immobilized in any composition, method or kit of the invention may be selected from SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
- the invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
- (A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO- 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
- thermostable polymerases at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K-, H-,or N-ras sequence or cleaving a primer induced cleavage site, or both and,
- one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence and capable of producing detectable fluorescence when hybridized thereto;
- the invention also relates to a method for amplifying DNA comprising a mutant ras sequence in a sample comprising the steps of :
- (A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO : 5 , SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, S
- (C) combining the admixture with one or more primer pairs selected from.
- SEQ ID NO: 25 SEQ ID NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29 , SEQ ID NO: 30 SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42 SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50 SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54 SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58 SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
- the invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
- (A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO.-18, SEQ ID NO.-19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, S
- step (C) combining the admixture produced after step (B) is performed with one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:
- SEQ ID NO: 14 SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 7, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID
- step (G) detecting the DNA comprising a mutant ras sequence separated by electrophoresis in step (F) .
- the invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
- (A) forming an admixture comprising (i) the. sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
- SEQ ID NO: 18 SEQ ID NO: 19 SEQ ID NO.-20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO : 26 , SEQ ID NO: 27 SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO : 30 , SEQ ID NO: 31 SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO : 38 , SEQ ID NO: 39 SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO : 54 , SEQ ID
- step (C) combining the admixture produced after step (B) is performed with one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:
- SEQ ID NO : 14 SEQ ID NO 15, SEQ ID NO 16 SEQ ID NO: 17, SEQ ID NO: 13, SEQ ID NO 19, SEQ ID NO 20 SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO 23, SEQ ID NO 24 SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO 27, SEQ ID NO 28 SEQ ID NO: 29, SEQ ID NO : 30 , SEQ ID NO 31, SEQ ID NO 32 SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO 35, SEQ ID NO 36 SEQ ID NO: 37, SEQ ID NO : 38 , SEQ ID NO 39, SEQ ID NO 40 SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO 43, SEQ ID NO 44 SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO 47, SEQ ID NO 48 SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO 51, SEQ ID NO 52 SEQ ID NO: 53, SEQ ID NO : 54 , SEQ ID
- the invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of:
- (A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, S
- one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence and capable of producing detectable fluorescence when hybridized thereto;
- step (C) combining the admixture produced in step (B) with one or more primer pairs selected from SEQ ID NO : 5 , SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO :
- SEQ ID NO: 10 SEQ ID NO: 12, SEQ ID NO: 13 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID
- kits comprising in one or more containers :
- oligonucleotides comprising a sequence selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO : 14 , SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:
- oligonucleotide or oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties.
- kits may comprise further in one or more containers :
- restriction endonucleases comprising (ii) one or more restriction endonucleases, said restriction endonuclease or restriction endonucleases being capable of directly cleaving wild type
- thermostable polymerases one or more thermostable polymerases .
- the one or more fluorescence moieties may be linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and the one or more fluorescence quenching moieties may be linked to one or more nucleotides adjacent to the 5' terminal nucleotide or the one or more fluorescence quenching moieties may be linked to the 5' terminal nucleotide or both, and one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or the one or more fluorescence moieties may be linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both, and the one or more fluorescence quenching moieties may be linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and
- the fluorescence moieties may be selected from carboxyfluorescein, carboxy- ' , 5' -dichloro- 2 ' , 7 ' -dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety may be (4- (4 ' dimethylaminophenylazo) benzoic acid) or 4 (dimethylamine) azobenzene sulfonic acid.
- FIG. 1 shows a nested PCR/RFLP analysis for K-12 ras mutations in cell lines.
- K562 cell line DNA before, lane 1, and after, lane 2, restriction enzyme digestion.
- Calul cell line DNA before, lane 3, and after, lane 4, restriction enzyme digestion.
- FIG. 2 shows a nested PCR/RFLP analysis for K-12 ras in patient samples; before (lanes 2, 4, and 6) and after (lanes 3, 5, and 7) Bstnl restriction enzyme digestion.
- REMS-PCR (Roberts N. J. et al . , 1999, BioTechniques 27: (3)418-422; Ward, R. et al . , 1998, Am. J. Pathol 153 (2) :373-379; WO 96/32500; Fuery, C. J. et al . , 2000, Clin. Chem. 46 (5) 620-624) , employed in various embodiments of the present invention, utilizes a thermostable restriction enzyme and appropriately designed primers; during PCR thermocycling, wild type sequences and/or primer induced sites are cleaved and mutant sequences are enriched.
- the invention enables detection of a mutation in the presence of a large excess of wild type DNA (1000-fold and greater) .
- the invention can be practiced as a tool for analysis following either REMS-PCR or multiple rounds of nested PCR based on digestion with other restriction enzymes including, but not limited to, Bsl I, Msc I, Mse I, Msp I, Bfa I, and Hae III which are useful for determining K-ras mutations at codon 12 (abbreviated K-12, analogous abbreviations are used for the other ras codons) , K-13, K-61, H-12, H-13, N-12, N-
- Examples 5-7 provide specific sequences of primers and probes that were used for determining such mutations in REMS-PCR methods, methods involving nested PCR followed by restriction endonuclease digestion, and REMS-PCR methods employing molecular beacons.
- a nested PCR method was particularly advantageous for determining ras mutations in samples having low levels of target DNA approaching a single copy in the amplification reaction admixture.
- This method involved using a primer design such that wild type K-ras sequences were cleaved in an overnight restriction enzyme digestion after nested PCR amplification.
- Puig et al . 2000, Int. J. Cancer. 85:73-77 describe nested PCR methods for determining K-ras mutations .
- Molecular beacons described in U.S. Patents 5,118,801; 5,312,728 and 5,925,517, are particularly useful in REMS-PCR for automating product detection and for quantifying product.
- Molecular beacons are oligonucleotide probes that can report the presence of specific nucleic acids using homogeneous methods . They are useful in situations where it is either not possible or desirable to isolate the probe-target hybrids from an excess of the hybridization probes, such as in real-time monitoring of polymerase chain reactions in sealed tubes or in detection of RNAs within living cells.
- Molecular beacons are hairpin- shaped molecules with an internally quenched fluorophore whose fluorescence is restored when they bind to a target nucleic acid. They are designed in such a way that the loop portion of the molecule is a probe sequence complementary to a target nucleic acid molecule.
- the stem is formed by the annealing of complementary arm sequences on the ends of the probe sequence.
- a fluorescent moiety is attached to the end of one arm and a quenching moiety is attached to the end of the other arm. The stem keeps these two moieties in close proximity to each other, causing the fluorescence of the fluorophore to be quenched by energy transfer.
- the quencher moiety is a non-fluorescent compound and emits the energy that it receives from the fluorophore as heat, the probe is unable to fluoresce .
- the probe encounters a target molecule, it forms a hybrid that is longer and more stable than the stem and its rigidity and length preclude the simultaneous existence of the stem hybrid.
- the molecular beacon undergoes a spontaneous conformational reorganization that forces the stem apart, and causes the fluorophore and the quencher to move away from each other, leading to the restoration of fluorescence which can be detected.
- molecular beacons can be made in many different colors utilizing a broad range of fluorophores (Tyagi, S. et al., 1998, Nature Biotechnology, 16, 49-53).
- DABCYL a non- fluorescent compound, can serve as a universal quencher for any fluorophore in molecular beacons.
- paraffin blocks comprising tumor or lymph node tissue were sectioned: 10 microns thick for primary tumor samples, and 50 microns thick for lymph node samples.
- excess paraffin was removed from the microtome before the first section was cut. All excess paraffin was removed by brush, and the blade area was wiped with xylene and allowed to air dry prior to use. A fresh blade was used between patient sample paraffin blocks. After cutting, sections were carefully transferred into separate 1.5 mL conical screw-cap tubes by means of a wooden applicator stick. A new stick was used for each paraffin block. In control experiments it was shown that this method successfully eliminated carryover between K-12 ras-positive and K-12 ras-negative samples as determined by REMS-PCR.
- the tubes were centrifuged at 14,000 rpm for 2 min to pellet the paraffin, and 80 microliters of lysis buffer (10 mM Tris-HCl, pH 8.0, and 0.5% Tween 20 and 10 microliters of PreTaq (Life Technologies, Inc., Gaithersburg, MD.) were added and the tube was incubated at 100°C in a heat block for 5 min. Ten microliters of 250 mM sodium hydroxide was added and the tubes were incubated in a heat block at 105°C for 10 min. While hot, the tubes were centrifuged at 14,000 rpm for 2 min. The liquid under the paraffin layer was carefully removed, transferred to a new tube, and stored frozen prior to use.
- lysis buffer 10 mM Tris-HCl, pH 8.0, and 0.5% Tween 20 and 10 microliters of PreTaq (Life Technologies, Inc., Gaithersburg, MD.) were added and the tube was incubated at 100°C in a heat block for 5 min.
- Calu 1 is a cell line derived from a lung adenocarcinoma which is heterozygous at K-ras codon 12 having both a wild type (GGT) and a mutant (TGT) sequence (5).
- K562 is a cell line derived from a human leukemia, which is wild type at codon 12 of K-ras (Roberts, N. J.et al . , 1999, BioTechniques 27 : (3) 418-422) .
- Genomic DNA was extracted from cell lines using a protocol involving incubation of cells in a lysis buffer at high temperature.
- Oligonucleotides Having Mutant Sequences oligonucleotides prepared according to the method of Rochlitz et al . (1988, DNA 7 (7) .-515-519) were used as target nucleic acids (identified as "oligo” in Table 2) . They comprised the base sequence of N-ras codon 13 having a cytosine to thymine (C to T) mutation.
- oligonucleotide "adjacent" When reference is made to a nucleotide "adjacent" to a terminal nucleotide in an oligonucleotide comprising a particular sequence of interest, the term “adjacent” means any nucleotide between the terminal nucleotide and the first nucleotide commencing the sequence of interest. For example, consider an oligonucleotide having the following hypothetical 5' to 3' directed sequence:
- the underlined sequence CATCTATAGAGA represents the particular sequence of interest, the 5' terminal nucleotide (in bold font) is A and the 3 ' terminal nucleotide (in bold font) is G.
- a nucleotide adjacent to the 5' terminal nucleotide is any nucleotide between A and C, where C is the first nucleotide commencing the sequence of interest in the 5' to 3 ' direction. That is, it is any nucleotide in the sequence GTCGTTAGTGT.
- a nucleotide adjacent to the 3 ' terminal nucleotide is any nucleotide in the sequence CTCGGGCCTGACT .
- An oligonucleotide comprising a sequence of interest can be obtained or prepared from a natural source or prepared by way of any suitable chemical synthetic method.
- An oligonucleotide can consist of only the sequence of interest, or the sequence of interest itself may be only part of a larger sequence of nucleotides comprising the ' oligonucleotide.
- An oligonucleotide may have linked to it by way of one or more nucleotides, any molecule or molecules in addition to a nucleotide, such as a linker molecule for covalent bonding to another molecule or substrate; a label, such as a fluor, dye, radioisotope or enzyme; a molecule that interacts with another molecule which may or may not also be linked to the oligonucleotide, such as a fluorescence quencher; a ligand for binding to a specific receptor, such as biotin, avidin or strepavidin, and so forth .
- wild type sequence refers to a conserved sequence of nucleotides within a gene in a biological species, preferably a human gene, that is, a sequence that is observed in a majority of representative members of the species.
- the term “primer” refers to an oligonucleotide, whether naturally occurring or synthetically produced, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand (that is, template) is induced. Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases, which can result in the induction of restriction endonuclease recognition/cleavage sites in specific target sequences.
- primer induced recognition/cleavage site any number of primers capable of inducing a cleavage site in one or more target sequences can be used in a reaction admixture and the statement "a primer induced cleavage site" is meant to include a single primer induced site or multiple primers inducing different cleavage sites in one or more target sequence.
- primer pair refers to two primers, one being capable of acting as a point of initiation of synthesis of a primer extension product on one strand of a duplex DNA target or on one strand derived from a duplex DNA target, and the other primer being capable of acting as a point of initiation of synthesis of a primer extension product on the other strand of a duplex DNA target or on the other strand derived from the duplex DNA target.
- Each PCR admixture contained three pairs of primers .
- the diagnostic primers induce a BstN I restriction site in the wild type ras, but not in a ras mutation at codon 12.
- ras wild type DNA is selectively cleaved during PCR thermocycling, and mutant sequences of ras at codon 12 are enriched.
- the PCR control primers were used to confirm that PCR amplifiable DNA was extracted, and the enzyme control primers confirmed that the restriction enzyme was functioning during thermocycling.
- Reaction admixtures contained 12 units/100 ⁇ L of recombinant Taq polymerase (developed at Ortho-Clinical Diagnostics) , and a 5-fold molar excess (0.842 ⁇ L) of Taq inhibiting antibody TP4-9.2 (developed at Ortho-Clinical Diagnostics according to protocols described in U.S. Patents 5,338,671 and 5,587,287) over the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl , pH 8.3), 0.3 ⁇ M of diagnostic primers (see below), 5BKIT (SEQ ID NO: 1), (Roberts, N. J.et al . ,
- PCR control primer pairs 5BK5 (SEQ ID NO: 3) and 3K6 (SEQ ID NO:4), 0.05 ⁇ M of enzyme control primer pairs, 5BK28 (SEQ ID NO:5) and 3K29 (SEQ ID NO:6), 0.2 mM total dinucleoside triphosphates (dNTPs) , 0.6 units/ ⁇ L of BstN I (New England BioLabs, Beverly MA) , 1 mM dithiothreitol (DTT) , 4 mM magnesium chloride, sample (typically 3 ⁇ L) and deionized water up to a final volume of 100 ⁇ L.
- dNTPs total dinucleoside triphosphates
- DTT dithiothreitol
- magnesium chloride sample (typically 3 ⁇ L) and deionized water up to a final volume of 100 ⁇ L.
- At least one of the primers used in Example 1 was biotinylated. Biotinylated primers, after extension by polymerase, are captured using avidin reagents to generate signal.
- the letter "B" appearing in the name of an oligonucleotide identifies it as being biotinylated. If the oligonucleotide is not biotinylated, the letter "B" does not appear in the name identifying it.
- a primer having sequence SEQ ID NO: 5 if biotinylated, it was named 5BK28, if it is not biotinylated, it was named 5K28.
- Biotinylated and n ⁇ n- biotinylated primers provide substantially the same results as determined using gel-based detection.
- the following primers were biotinylated at the 5' end: 5BKIT (SEQ ID NO: 1) , 5BK5 (SEQ ID NO: 3), 5BK28 (SEQ ID NO: 5), 5BKITSC (SEQ ID NO: 12), 5BN2 (SEQ ID NO: 28), 5BN4 (SEQ ID NO: 29), 3BN13 (SEQ ID NO: 55), 5BK15 (SEQ ID NO: 60), and 5BK37 (SEQ ID NO: 61) .
- the nucleotide sequences of the primers are as follows :
- the reaction admixture was amplified and detected using an Ortho-Clinical Diagnostics, Inc. pouch containment system for nucleic acid amplification and detection as described by Findlay et al . (1993, Clin. Chem. 39 (9) : 1927-1933) and U.S. Patent 5,229,297.
- Sample approximately 0.8ug DNA
- PCR reagents to a total volume of 85ul as described above, was loaded into a blister of the pouch and the pouch was sealed.
- the PCR blister was heated for 1 min at 94°C, followed by 30 PCR cycles (a melt temperature of 94°C for 10 sec, followed by an annealing temperature of 58°C for 75 seconds) .
- Capture oligo K-CapD8 (SEQ ID NO:7), hybridized to biotinylated REMS-PCR diagnostic product, capture oligo, Cap-2E (SEQ ID NO:8), hybridized to biotinylated enzyme contol PCR product, and capture oligo, K-Cap6 (SEQ ID NO: 9), hybridized to biotinylated PCR control product.
- the nucleotide sequences follow:
- the horseradish peroxidase (HRP) channel and wash channel of the pouch were at 55°C.
- the detection channel was at 40°C.
- Hybridized product was detected using a solution of HRP-streptavidin and HRP-dye substrate.
- Each pouch contained 3 detection blisters, each with 200 ⁇ L of reagent solution (streptavidin-HRP, 200 ⁇ L/blister; wash 200 ⁇ L/blister; and dye/gel 200 ⁇ L/blister) .
- the order in which the blisters were used was as follows: HRP-streptavidin, wash, and finally dye/gel blister.
- the capture oligo beads were ordered in the pouch (in the direction of reagent flow) as follows: no beads, K-Cap2E, no beads, K-capD8, no beads, K- Cap6M, and no beads.
- K-12 ras mutation may be due to differences in the ability of each method to detect a mutation in a large excess of wild type DNA. Also, increased sensitivity is possible because product can be detected using enzyme-mediated calorimetric, florescence, or chemiluminescense signal formation methods.
- the REMS-PCR based method is sensitive, utilizes internal PCR and enzyme controls, and is rapid.
- the method was carried out in a pouch containment device, which allowed automation.
- the method reduced the possibility of contamination, and permitted increased detection sensitivity, as product was detected using enzyme-catalyzed dye formation, in contrast with detection of product in a gel subsequent to electrophoresis (Findlay, J. B. et al . , 1993, Clin. Chem. 39 (9) : 1927-1933) .
- the method, subsequent to DNA extraction, took less than 90 minutes to complete.
- Round 1 PCR admixtures contained 4 units/50 ⁇ L of recombinant Taq polymerase, a 5-fold molar excess of Taq inhibiting antibody TP1-12.2, Cetus II buffer (50 mM KC1 in 10 mM Tris-HCl , pH8.3), 1.2 ⁇ M each of primers 5KID (SEQ ID NO:10 and 3KiE (SEQ ID N0:11), 0.2 mM total dinucleoside triphosphates (dNTPs) , 0.04 mM magnesium chloride, sample
- Round 2 PCR admixtures contained 10 units/100 ⁇ L of recombinant Taq polymerase, a 5-fold molar excess of Taq inhibiting antibody TP12.2, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl, pH 8.3), 0.2 ⁇ M each of primers 5BKITSC (SEQ ID NO .-12) and 3KiU (SEQ ID NO: 13) (see below), 0.2 mM total dNTPs, 0.04 mM magnesium chloride, 2 ⁇ L sample, and deionized water up to a final volume of 100 ⁇ L.
- Restriction enzyme digestion was performed by combining 40 units of BstN I, (New England BioLabs, Beverley MA), and 15 uL of the amplification product from Round 2 in a icrofuge tube. Tubes were incubated overnight at 60°C.
- Samples were analyzed by electrophoresis on 4% w/v NUSieve agarose gel (FMC Bioproducts, Rockland, ME) and imaged by means of a Stratagene Eagle Eye II video system (La Jolla, CA) .
- Figure 1 shows the results obtained with K562 cell line DNA, which is wild type for K-ras, before (lane 1) and after (lane 2) restriction enzyme digestion.
- Calul DNA heterozygous for a K-ras mutation at codon 12 is shown before (lane 3) and after (lane 4) restriction enzyme digestion.
- a gel band at 152bp remaining after BstN I digestion is diagnostic for a K-ras mutation at codon 12, whereas gel bands of 128bp and 24bp are formed as a result of Bstnl digestion of the K-ras wild type product.
- Figure 2 shows results obtained for both K-12 ras positive and negative lymph nodes, as assayed by the nested PCR protocol followed by Restriction Fragment Length Polymorphism (RFLP) gel analysis.
- Fig. 2 results for three different lymph node samples before (lanes 2, 4, and 6) and after BstN I restriction enzyme digesion (lanes 3,5 and 7) are shown.
- the 152bp product remaining after restriction enzyme digestion (lane 5) is diagnostic for a K- ras mutation at codon 12, and the absence of a 152bp product after digestion is diagnostic for wild type K-ras at codon 12 (lanes 3 and 7) .
- the lymph node samples in lanes 2 and 3, and in lanes 6 and 7 are negative for a K-12 ras mutation and the lymph node sample in lanes 4 and 5 are positive for this mutation.
- the starting material for the synthesis of molecular beacons is an oligonucleotide that contains a sulfhydryl group at its 5' -end and a primary amino group at its 3 '-end.
- DABCYL is coupled to the primary amino group utilizing an amine- reactive derivative of DABCYL.
- the oligonucleotides that are coupled to DABCYL are then purified.
- the protective trityl moiety is then removed from the 5 ' -sulfhydryl group and a fluorophore is introduced in its place using an iodoacecamide derivative.
- Recently a control pore column that can introduce DABCYL moiety at the 3 ' end of an oligonucleotide has become available which makes it possible to synthesize a molecular beacon completely on a DNA synthesizer.
- the probe sequences are as follows :
- BD2 SEQ ID NO: 14
- BPIG SEQ ID NO: 15
- BEl SEQ ID NO: 16
- BE2 SEQ ID NO: 17
- Thermocycling and fluorescence detection were carried out using an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, Foster City, CA.). Thermocycling parameters were: A first incubation at 50°C for 1 min, a second incubation at 94°C for 1 min, followed by 40 cycles of alternate heating at 94°C for 10 sec and heating at 58°C for 75 sec. After the last cycle, the reagent admixture was incubated at 50°C for 2 min. The single reporter mode was used for detecting fluorescence. Results are summarized in Table 1 below. t
- C t which is reported in Table 1, is the calculated cycle number at which point the fluorescence signal exceeds the baseline threshold value established during approximately the first 15 PCR cycles (see ABI PRISM 7700, "Sequence Detection System", User's Manual, 1998, pp D4-D5, Perkin-Elmer Corp, Foster City, CA) .
- the C t value is related, therefore, to the presence and amount of target in the sample.
- the wells containing BD2 had C t values of 40 and 38.2 indicating that the samples were negative for a K-12 ras mutation.
- the wells containing the enzyme controls BEl or BE2 had C t values of 40.00.
- This example illustrates the use of molecular beacons comprising different fluorophores for multiplexed REMS-PCR based determination of K-12 ras mutations.
- Each REMS-PCR reaction admixture was as described in example 1, except that primer 5BKITSC (SEQ ID NO: 12) was substituted for primer 5BKIT (SEQ IS NO:l) and 0. l ⁇ M enzyme control primers and 0. l ⁇ M PCR control primers were used.
- Each microtiter well also contained 0. l ⁇ M of molecular beacons BP1-TET (SEQ ID NO: 19) and BE6-JOE (SEQ ID NO: 21) and 0.20 ⁇ M of molecular beacon BD-FAM(SEQ ID NO: 20) .
- Molecular beacon, BP1-TET comprised the fluor tetrachlorofluorescein (TET) at its 5 'end.
- Molecular beacon BD3-FAM comprised the fluor carboxyfluorescein (FAM) at its 5 'end.
- Molecular beacon BE6-JOE comprised the fluor carboxy- 4 ' , 5 ' -dichloro-2 ' , 7 ' dimethoxyfluorescein (JOE) at its 5' end.
- the quencher DABCYL was attached at the 3' end.
- Molecular beacons comprising FAM or TET were purchased from Synthetic Genetics, San Diego, CA, and the JOE-labeled beacon was purchased from Tri-Link BioTechnologies, Inc., San Diego, CA.
- the target directed DNA sequences are as follows :
- PCR control beacon BP1-TET, Ct values for duplicate determinations, at a 1:100 weight ratio of mutant to wild type DNA were 31.902 and 31.176, indicating the presence of amplifiable DNA.
- diagnostic beacon BD3- FAM, at a 1:100 ratio of mutant to wild type DNA, Ct values of 35.058 and 36.225 were obtained, indicating the presence of K-12 ras mutation.
- Ct values for the enzyme control beacon, BE6-JOE were 40.000 and 40.000, confirming that the BstN I restriction enzyme was active.
- Round 1 PCR reaction admixtures contained MgCl2, dNTP, and Taq polymerase, and anti-Taq antibody TP1.12.2 in the concentrations described in Example 1, as well as 0.2 ⁇ M of the indicated Round I primer in Table 2, 0.8 ⁇ g DNA, Cetus Buffer II (50mM KCl and lOmM Tris-HCl, pH8.3) and water to a final volume of 50 ⁇ L.
- the appropriate wild type and mutant cell line or synthetic DNA were included for each assay as shown in Table 2.
- Thermocycling was performed on a Gene-Amp 9600 (Perkin- Elmer, Norwalk, CT) with the following parameters for Round 1: 1 cycle of 94°C for 3mins, followed by 12 cycles of alternate incubations at 94C for 10 sec, and 55°C for 30sec.
- 1 cycle of 94°C for 3mins followed by 12 cycles of alternate incubations at 94C for 10 sec, and 55°C for 30sec.
- 20 cycles of PCR amplification were used instead of 12 cycles.
- Round 2 PCR reaction admixtures contained 10 units/100 ⁇ L of recombinant Taq polymerase (developed at Ortho- Clinical Diagnostics), and a 5-fold molar excess (0.842 ⁇ L) of Taq inhibiting antibody TP1-12.2 over the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl , pH 7.5), 0.2 mM total dinucleoside triphosphates (dNTPs), 3 mM magnesium chloride, 0.2uM of the indicated Round 2 primers in Table 2, DNA sample from Round 1 (typically 3 ⁇ L) and deionized water up to a final volume of 100 ⁇ L .
- Thermocycling was performed on a Gene-Amp 9600 (Perkin- Elmer, Norwalk, CT) with the following parameters for Round 2: 1 cycle of 94°C for 3mins, followed by 32 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30sec.
- 1 cycle of 94°C for 3mins followed by 32 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30sec.
- 38 cycles of PCR a plifcation were used instead of 32 cycles.
- Restriction enzyme digestions were prepared by mixing 15 uL of PCR product from Round 2, 2 uL of restriction enzyme buffer (10X stock) , the indicated units of each restriction enzyme in Table 2 and water to a final volume of between 17 and 20 uL. Restriction enzyme digestion buffers were purchased from New England BioLabs (Beverly, MA) . For BstN I, Mse I, Hae III digestions, NEB2 buffer was used, and for Bsl 1 digestions, NEB3 buffer was used. Digestion with all other restriction enzymes shown in Table 2 used NEB4 buffer, except for Mae I, which used SuRE/Cut Buffer purchased from Roche Molecular Biochemicals, Indianapolis, IN) . Overnight digestion at the temperature indicated in Table 2 was used.
- the primers having the target directed sequences identified below were used in REMS-PCR and/or nested PCR methods for determining mutations in K-12, K-13, K-61, H-12, H-13, N-12, N-13, N-61 and mutations in H-ras intron D.
- K- 61 specify the nucleotide bases screened for mutation in the 5 ' to 3' direction (codon 12 of K-ras, nucleotide bases 2 and 3) .
- the absence of parentheses for K-12, K-13, N-12, N- 13, and H-12 ras mutations indicates that the assay was capable of detecting a mutation at any of the first two nucleotide bases in the codon.
- column 1 where the same assay number appears in multiple rows, a multiplexed assay for the specified target mutations was performed using the indicated primers in those rows. Where a single assay number appears in a single row only the specified target mutation was determined using the indicated primers in that row.
- ras mutations were detected in cell lines or in oligonucleotides comprising ras mutation sequences.
- the size of digested and undigested products for each specific mutation are described in Table 2.
- each PCR admixture contained three sets of primers.
- the diagnostic primers induce a Bsl I restriction site in the wild type ras, but not in the indicated ras mutation at N-ras codon 12, N-ras codon 13, or H-ras codon 12.
- ras wild type DNA is selectively cleaved during PCR thermocycling, and mutant sequences of above indicated ras mutations are enriched.
- the PCR control primers were used to confirm that PCR amplifiable DNA was extracted, and the enzyme control primers confirmed that the restriction enzyme was functioning during thermocycling.
- Reaction admixtures contained 12 units/100 ⁇ L of recombinant Taq polymerase (developed at Ortho-Clinical Diagnostics) , and a 2 -fold molar excess (0.842 ⁇ L) of Taq inhibiting antibody TP4-9.2 the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl, pH7.5), 0.2 ⁇ M of the indicated diagnostic primers pairs (see below), 0.05 ⁇ M of PCR control primer pairs 0.
- SEQ ID NO: 3 5BK5
- SEQ ID NO: 4 3K6
- SEQ ID NO: 63 5N12
- SEQ ID NO: 55 3BN13
- the following primer pairs were used: For the detection of H-ras mutation at codon 12: SEQ ID NO: 51
- Thermocycling was performed on a Gene-Amp 9600 (Perkin- Elmer, Norwalk, CT) with the following parameters for Round 1: 1 cycle of 94°C for 3mins, followed by 32 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30sec.
- 1 cycle of 94°C for 3mins followed by 32 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30sec.
- 38 cycles of PCR amplification were used instead of 32 cycles.
- ras mutations were detected in cell lines or in oligonucleotides comprising ras mutation sequences .
- the following probes were used for determining mutations in H-12, N-12 and N-13.
- the probe for H-12 can also be used for detecting H-13 mutations.
- the target specific probes were prepared in the form of molecular beacons comprising the fluor FAM at the 5 ' terminus and the quencher DABCYL at the 3' terminus. Primers from example 5 were used in REMS-PCR.
- Reaction admixtures contained 12 units/100 ⁇ L of recombinant Taq polymerase (developed at Ortho-Clinical Diagnostics), and a 4-fold molar excess (0.842 ⁇ L) of Taq inhibiting antibody TP4-9.2 the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl , pH7.50.2 mM total dinucleoside triphosphates (dNTPs), 0.3 units/ ⁇ L of Bsl I (New England BioLabs, Beverly MA) , 1 mM dithiothreitol (DTT) , 4 mM magnesium chloride, sample composed of the indicated dilution of mutant and wild type DNA (typically 3 ⁇ L) and deionized water up to a final volume of 100 ⁇ L.
- HT50 buffer 100 mM sodium chloride
- dNTPs total dinucleoside triphosphates
- Bsl I New England BioLabs, Beverly MA
- DTT
- PCR control primers 5BK5 SEQ ID NO: SEQ ID NO: 3
- 3K6 SEQ ID NO: 4
- the PCR control molecular beacon was BPIG (SEQ ID NO: 15)
- the enzyme control molecular beacon was BEl (SEQ ID NO: 16)
- the diagnostic molecular beacon was BND12 (SEQ ID NO:
- PCR control primers 5BK5 SEQ ID NO : SEQ ID NO : 3
- 3K6 SEQ ID NO: 4
- PCR control primers 5N12A SEQ ID NO: 54
- 3N13A SEQ ID NO: 49
- diagnostic primers 5H12B SEQ ID NO: 66
- the PCR control molecular beacon was BP1 (SEQ ID NO 59)
- the enzyme control molecular beacon was BEl (SEQ ID NO 16)
- the diagnostic molecular beacon was BHD12 (SEQ ID NO: 57) All molecular beacons were added at 0.2uM each and were labeled with a FAM dye.
- PCR thermal cycling on the ABI Prism 7700 Sequence Detector were as described in example 3 except that a total of 45 thermal cycles were used.
- PCR control primers 5BK5 SEQ ID NO: 3
- 3K6 SEQ ID NO: 4
- 3N13 SEQ ID NO: 55
- diagnostic primers 5N4 SEQ ID NO: 29
- 3N5S SEQ ID NO: 44
- the PCR control molecular beacon was BPI (SEQ ID NO: 59), the enzyme control molecular beacon was BEL (SEQ ID NO: 58) and the diagnostic molecular beacon was BND12 (SEQ ID NO: 56) All molecular beacons were added at 0.2uM each and were labeled with a FAM dye. PCR thermal cycling parameters on the ABI Prism 7700 Sequence Detector were as described in example 3 except that 45 thermal cyles were used .
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Hospice & Palliative Care (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Paints Or Removers (AREA)
- Road Repair (AREA)
Abstract
Mutations in K-ras, N-ras, and H-ras were determined using target specific primers and probes in REMS-PCR methods, nested PCR methods employing a restriction endonuclease, and REMS-PCR methods using molecular beacons.
Description
DETECTION OF RAS MUTATIONS
Field of the Invention
The present invention relates to primers, probes and methods for determining the presence of mutations. More specifically it relates to primers, probes and molecular beacons for determining the presence of ras mutations using Restriction Mediated Selection Polymerase Chain Reaction (REMS-PCR) and nested PCR methods.
Background of the Invention
The ras family of oncogenes (K-ras, H-ras, and -ras) encode for membrane proteins possessing GTPase activity. These proteins are involved in cellular signal transduction. Specific point mutations, usually within the ras codons 12, 13, or 61, can result in the activation of these protooncogenes and result in subsequent neoplasia (Bos, J. L., 1989, Can. Res. 49:4682-4689).
The frequency with which ras mutations occur varies among different tumor types. The highest frequency is found in tumors from the exocrine pancreas, where more than 80% of tumors harbor a mutated K-ras gene (Bos et al . , 1989, Can. Res. 49:4682-4689) . H-ras mutations occur more frequently than N-ras and K-ras mutations in urinary tract tumors. The frequency of H-ras oncogene mutation has been estimated at 5% to 17% (Saito, S. et al . , 1996, Int. J. Urol . 4:178-185).
H-ras oncogene mutations have been detected in the urine of patients with bladder tumors (Haliassos, A. et al . , 1992, Int. J. Oncol. 1:731-734); potentially representing a non- invasive means for detecting neoplasia. H-ras mutations have been reported in other cancers including thyroid and kidney carcinomas (Bos, J. L., 1988, Mutat . Res. 195:255-71), and human primary breast carcinomas (Theillet, C. et al . , 1986, Cancer Res. 46:4776-4781).
Mutations of the N-ras gene are most commonly found in myeloid and lymphoid cancers. Bos (1988, Mutat. Res. 195:255-71) reported that about one-third of leukemia patients have a mutated ras gene, mostly N-ras, in both early stage pre-leukemia and acute myeloid leukemia. N-ras . mutations have also been reported in human lymphoid malignancies (Neri, A. et al . , 1998, Proc . Natl . Acad. Sci . , USA, 85:9268-9272). More rarely, N-ras mutations have been detected in other carcinomas including melanoma, and carcinomas of the liver and thyroid.
Approximately 40-50% of colon cancers exhibit a mutation in the c-K-ras gene, with 86% of these mutations occurring at codons 12 and 13 (Bos, J. L. et al . , 1987, Nature 327: (6120)293-7, Vogelstein B. et al . , 1988, N. Engl . J. Med. 319:525-532). .Ras mutations result in increased cell proliferation due to decreased intrinsic GTP- ase activity of the ras protein.
Lymph node metastasis is an important predictor of prognosis in colorectal carcinoma (Calaluce R et al . , 1998, J. Surg. Oncol. 67:194-202). Turnbull et al . (1967, Ann. Surg. 166:420-7) extended the original classification of adenocarcinoma of the colon (Dukes, C. E. 1932, J. Pathol . Bacteriol . 35:323-332) into four clinicopathologic stages: Stage A-Tumor confined to the colon and its coats; Stage B- Tumor extension into pericolic fat; Stage C-Tumor metastasis to regional mesenteric lymph nodes, but no evidence of distant spread; Stage D-Tumor metastasis to liver, lung, bone. Although adjuvant therapies are of considerable benefit in Dukes C (stage III) colon cancer, no statistical benefit of adjuvant treatment has been demonstrated in Dukes B patients (Moertel C. G. et al . , 1990, N. Engl . J. Med. 322:352-8) . Thus, Dukes B patients generally do not receive adjuvant therapy after surgery. Approximately 20-30% of these patients will develop metastatic disease.
In a large multicenter study of 2721 patients including a total of 1173 Dukes' B, multivariate analysis suggested that the presence of a ras mutation increased risk of recurrence and death in all Dukes' stages (Andreyev, H. J. N. et al., 1998, Natl . Cancer Inst . 90 (9) : 675-684) . Risk of recurrence and death increased with higher Dukes' stage. A study from the Southwest Oncology Group, concluded that mutation of the Ki-ras gene occurred in 41% of colon cancers and was associated with poor prognosis in stage II, but not stage III. In stage II, the 7-year survival rate of patients having a ras muation was 58%; whereas, the 7-year survival
rate of patients with wild type ras was 86% (Ahnen, D. J. et al., 1998, Can. Res. 58:1149-1158).
Recently workers have examined the utility of determining mutations in K-ras as a means for sensitive detection of lymph node metastases in colorectal cancer. Hayashi et al . (1994, Cancer Res. 54:3853-3856) used a mutant allele-specific amplification (MASA) method to examine the lymph nodes of 22 colorectal cancer patients who were positive for either a K-ras or p53 mutation in the primary tumor. Seven of 14 cases in which genetic alterations were detected in lymph nodes had negative lymph nodes as determined by histology. In a subsequent study
(Haysahi, N. et al . , 1995, Lancet 345: 1257-1259), 120 colorectal cancer patients who had negative lymph nodes by histology were screened. Of 37 patients with genetically positive lymph nodes, 27 had a tumor recurrence within 5 years of surgery; whereas, none of the 34 patients with nodes that were negative by the molecular assay had a recurrence. Nakamori et al . (1997, Dis. Colon Rectum: 40
(Suppl 10) :S29-36) have reported that either K-ras or p53 mutations were detected in 9 lymph nodes from a total of 17 patients who had these mutations in the primary tumor. Two of the nine patients with mutation-positive lymph nodes presented with recurrences to the liver, and all eight patients with mutation-negative lymph nodes remained disease-free. It has been reported (Monserrat S. et al . , 1999, Clin. Cancer. Res. 5:2450-2454) that K-ras and p53 gene mutations as well as P16 promoter hypermethylations can
be used to screen for lymph node metastasis in colorectal cancer patients, that molecular-based methods increase the sensitivity of tumor cell detection, and are a good predictor of recurrence in patients with resectable liver metastasis .
As pointed out by Andreyev et al . (1998, Natl . Cancer Inst . 90 (9) : 675-684), more than 75 research groups have published data on the significance of a K-ras gene mutation in colorectal cancer. Some workers have suggested that the presence of a K-ras mutation conveys prognostic signi icance, and other workers have reached the opposite conclusion. The discrepancy, in part, can be explained by the variable sensitivity of methods used for detecting ras mutations and the difficulty in determining mutations in the presence of excess wild type sequences. Furthermore, contamination during sample preparation and PCR amplification can be a serious problem.
Thus, a need exists for determining ras mutations, and other nucleic acid mutations particularly in the presence of high levels of wild type nucleic acid, using methods that are rapid, sensitive, specific and are capable of being automated. It is desirable to have available methods that reduce contamination.
Summary of the Invention
In accordance with the above-mentioned needs the present invention provides methods for amplifying and determining one or more mutations in one or more nucleic acids .
The present invention provides nucleic acid primers and probes for amplifying and determining ras mutations.
The invention provides REMS-PCR methods for determining ras mutations.
The invention provides REMS-PCR methods for determining ras mutations in the presence of excess wild type nucleic acid.
The invention provides primers, probes and nested PCR methods using one or more restriction endonucleases for amplifying and determining ras mutations.
The invention provides primers, probes and nested PCR methods using one or more restriction endonucleases for amplifying and determining ras mutations in the presence of excess wild type nucleic acid.
The invention provides primers, probes and nested PCR methods using one or more restriction endonucleases for
amplifying and determining ras mutations in samples having a low copy number of the target nucleic acid.
In one embodiment the invention is practiced using means such as containment devices for reducing contamination and methods that are capable of being automated.
In one aspect, the invention provides homogenous methods for determining one or more target mutant sequences in one or more DNA nucleic acid sequences using probes, fluors and fluorescence quenchers. More specifically, a method is provided for amplifying and determining one or more target mutant sequences in a DNA sample, the method comprising the steps of:
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs specific for said one or more target mutant sequences,
(iii) at least four different nucleoside triphosphates ,
(iv) one or more thermostable polymerases, (v) at least one thermostable restriction endonuclease that is capable of directly cleaving a wild type sequence or wild type sequences of said one or more target mutant sequences or cleaving a primer induced cleavage site, or both, vi) one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more
oligonucleotides being capable of hybridizing to DNA comprising said one or more target mutant sequences and capable of producing detectable fluorescence when hybridized thereto;
(B) subjecting the admixture to one or more cycles of heating and cooling, thereby amplifying DNA comprising said one or more target mutant sequences; and
(C) detecting the fluorescence.
In another aspect, the invention provides one or more oligonucleotides comprising a sequence selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID
NO 23, SEQ ID NO 24 SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID
NO 27, SEQ ID NO 28 SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID
NO 31, SEQ ID NO 32 SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID
NO 35, SEQ ID NO 36 SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID
NO 39, SEQ ID NO 40 SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID
NO 43, SEQ ID NO 44 SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID
NO 47, SEQ ID NO 48 SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID
NO 51, SEQ ID NO 52 SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID
NO 55, SEQ ID NO 56 SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID
NO 59, SEQ ID NO 60 SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID
NO 63, SEQ ID NO 64 SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67. Any of the oligonucleotides may comprise one or more fluorescence moieties and one or more fluorescence quenching moieties. In particular, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID
NO -.16, SEQ ID NO: 17, NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67 may comprise one or more fluorescence moieties and one or more fluorescence quenching moieties.
The invention also relates to a method for amplifying DNA comprising a mutant ras sequence in a sample comprising the steps of :
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(B) subjecting the admixture to one or more cycles of heating and cooling thereby amplifying DNA comprising a mutant ras sequence .
The invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO: , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID
NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H-,or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(B) subjecting the admixture to one or more cycles of heating and cooling, thereby amplifying DNA comprising a mutant ras sequence;
(C) separating the DNA by electrophoresis; and
(D) detecting the DNA comprising a mutant ras sequence separated by electrophoresis in step (C)
The invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of
(A) forming an admixture comprising
(i) the sample,
(ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO : 13 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID
NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO: 1, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO : 52 , SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO : 64 , SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(B) subjecting the admixture to one or more cycles of heating and cooling, thereby amplifying DNA comprising a mutant ras sequence;
(C) combining the admixture comprising amplified DNA with one or more immobilized oligonucleotides or one or more oligonucleotides capable of being immobilized, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence thereby capturing DNA comprising a mutant ras sequence; and
(D) detecting the captured DNA comprising a mutant ras sequence .
The sequence of the one or more immobilized oligonucleotides or one or more oligonucleotides capable of
being immobilized in any composition, method or kit of the invention may be selected from SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO: 9.
The invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO- 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO 18, SEQ ID NO 19 SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID
NO 22, SEQ ID NO 23 SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID
NO 26, SEQ ID NO 27 SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID
NO 30, SEQ ID NO 31 SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID
NO 34, SEQ ID NO 35 SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID
NO 38, SEQ ID NO 39 SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID
NO 42, SEQ ID NO 43 SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID
NO 46, SEQ ID NO 47 SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID
NO 50, SEQ ID NO 51 SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID
NO 54, SEQ ID NO 55 SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID
NO 58, SEQ ID NO 59 SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
NO 62, SEQ ID NO 63 SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID
NO 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is
capable of directly cleaving wild type K-, H-,or N-ras sequence or cleaving a primer induced cleavage site, or both and,
(iv) one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence and capable of producing detectable fluorescence when hybridized thereto;
(B) subjecting the admixture to one or more cycles of heating and cooling, thereby amplifying DNA comprising a mutant ras sequence;
(C) detecting the fluorescence.
The invention also relates to a method for amplifying DNA comprising a mutant ras sequence in a sample comprising the steps of :
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO : 5 , SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID
NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates and one or more thermostable polymerases;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture with one or more primer pairs selected from. SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO : 14 , SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID
NO: 25, SEQ ID NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO : 29 , SEQ ID NO: 30 SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38 SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42 SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50 SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54 SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58 SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62 SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66 or SEQ ID NO: 67, provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling thereby amplifying DNA comprising a mutant ras sequence;
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both.
The invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO.-18, SEQ ID NO.-19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates and one or more thermostable polymerases; (B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture produced after step (B) is performed with one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID
NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 7, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67, provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling thereby amplifying DNA comprising a mutant ras sequence;
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site;
(F) separating the DNA by electrophoresis; and
(G) detecting the DNA comprising a mutant ras sequence separated by electrophoresis in step (F) .
The invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of :
(A) forming an admixture comprising (i) the. sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO: 18, SEQ ID NO: 19 SEQ ID NO.-20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO : 26 , SEQ ID NO: 27 SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO : 30 , SEQ ID NO: 31 SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO : 38 , SEQ ID NO: 39 SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO : 54 , SEQ ID NO: 55 SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates and one or more thermostable polymerases;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture produced after step (B) is performed with one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID
NO : 14 , SEQ ID NO 15, SEQ ID NO 16 SEQ ID NO: 17, SEQ ID NO: 13, SEQ ID NO 19, SEQ ID NO 20 SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO 23, SEQ ID NO 24 SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO 27, SEQ ID NO 28 SEQ ID NO: 29, SEQ ID NO : 30 , SEQ ID NO 31, SEQ ID NO 32 SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO 35, SEQ ID NO 36 SEQ ID NO: 37, SEQ ID NO : 38 , SEQ ID NO 39, SEQ ID NO 40 SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO 43, SEQ ID NO 44 SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO 47, SEQ ID NO 48 SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO 51, SEQ ID NO 52 SEQ ID NO: 53, SEQ ID NO : 54 , SEQ ID NO 55, SEQ ID NO 56 SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO 59, SEQ ID NO 60 SEQ ID NO: 61, SEQ ID NO : 62 , SEQ ID NO 63, SEQ ID NO 64 SEQ ID NO: 65, SEQ ID
NO: 66, or SEQ ID NO: 67, provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling thereby amplifying DNA comprising a mutant ras sequence;
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H-,or N-ras sequence or cleaving a primer induced cleavage site, or both;
(F) combining the admixture comprising amplified DNA with one or more immobilized oligonucleotides or oligonucleotides capable of being immobilized, said oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence thereby capturing DNA comprising a mutant ras sequence; and
(G) detecting the captured DNA comprising a mutant ras sequence .
The invention also relates to a method for determining one or more ras mutations in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO : 13 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID
NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates and one or more thermostable polymerases, and
(iv) one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence and capable of producing detectable fluorescence when hybridized thereto;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture produced in step (B) with one or more primer pairs selected from SEQ ID NO : 5 , SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID
NO: 10, SEQ ID NO: 12, SEQ ID NO : 13 , SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID
NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67, provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling thereby amplifying DNA comprising a mutant ras sequence;
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(F) detecting the fluorescence.
In yet another aspect, the invention relates to kits comprising in one or more containers :
(i) one or more oligonucleotides comprising a sequence selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO : 14 , SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID
NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, or SEQ ID NO: 55;
(ii) one or more oligonucleotides selected from SEQ ID NO.-19, SEQ ID NO.-20, SEQ ID NO.-21, SEQ ID NO.-56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67, the oligonucleotide or oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties.
The kits may comprise further in one or more containers :
(i) one or more nucleoside triphosphates ;
(ii) one or more restriction endonucleases, said restriction endonuclease or restriction endonucleases being capable of directly cleaving wild type
K- , H- , or N-ras sequence or a primer induced cleavage site, or both; and
(iii) one or more thermostable polymerases .
In all instances described above, the one or more fluorescence moieties may be linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and the one or more fluorescence quenching moieties may be linked to one or more nucleotides adjacent to the 5' terminal nucleotide or the one or more fluorescence quenching moieties may be linked to
the 5' terminal nucleotide or both, and one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or the one or more fluorescence moieties may be linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both, and the one or more fluorescence quenching moieties may be linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5 ' terminus. For example, the fluorescence moieties may be selected from carboxyfluorescein, carboxy- ' , 5' -dichloro- 2 ' , 7 ' -dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety may be (4- (4 ' dimethylaminophenylazo) benzoic acid) or 4 (dimethylamine) azobenzene sulfonic acid.
Brief Description of the Drawings
FIG. 1 shows a nested PCR/RFLP analysis for K-12 ras mutations in cell lines. K562 cell line DNA: before, lane 1, and after, lane 2, restriction enzyme digestion. Calul cell line DNA: before, lane 3, and after, lane 4, restriction enzyme digestion.
FIG. 2 shows a nested PCR/RFLP analysis for K-12 ras in patient samples; before (lanes 2, 4, and 6) and after (lanes 3, 5, and 7) Bstnl restriction enzyme digestion.
Detailed Description
REMS-PCR (Roberts N. J. et al . , 1999, BioTechniques 27: (3)418-422; Ward, R. et al . , 1998, Am. J. Pathol 153 (2) :373-379; WO 96/32500; Fuery, C. J. et al . , 2000, Clin. Chem. 46 (5) 620-624) , employed in various embodiments of the present invention, utilizes a thermostable restriction enzyme and appropriately designed primers; during PCR thermocycling, wild type sequences and/or primer induced sites are cleaved and mutant sequences are enriched.
In addition to simplifying and reducing the time required for detecting mutations, the invention enables detection of a mutation in the presence of a large excess of wild type DNA (1000-fold and greater) .
The invention is described below in detail in examples 1-4, using the restriction enzyme BstN I, which is particularly useful for determining K-ras mutations at codon
12. The invention can be practiced as a tool for analysis following either REMS-PCR or multiple rounds of nested PCR based on digestion with other restriction enzymes including, but not limited to, Bsl I, Msc I, Mse I, Msp I, Bfa I, and Hae III which are useful for determining K-ras mutations at codon 12 (abbreviated K-12, analogous abbreviations are used for the other ras codons) , K-13, K-61, H-12, H-13, N-12, N-
13, N-61 and mutations at H-ras intron D. Examples 5-7 provide specific sequences of primers and probes that were
used for determining such mutations in REMS-PCR methods, methods involving nested PCR followed by restriction endonuclease digestion, and REMS-PCR methods employing molecular beacons.
It was found that a nested PCR method was particularly advantageous for determining ras mutations in samples having low levels of target DNA approaching a single copy in the amplification reaction admixture. This method involved using a primer design such that wild type K-ras sequences were cleaved in an overnight restriction enzyme digestion after nested PCR amplification. Puig et al . 2000, Int. J. Cancer. 85:73-77 describe nested PCR methods for determining K-ras mutations .
Primary tumor samples from individuals were examined for the presence of K-12 ras mutation using molecular beacons. Molecular beacons, described in U.S. Patents 5,118,801; 5,312,728 and 5,925,517, are particularly useful in REMS-PCR for automating product detection and for quantifying product. Molecular beacons are oligonucleotide probes that can report the presence of specific nucleic acids using homogeneous methods . They are useful in situations where it is either not possible or desirable to isolate the probe-target hybrids from an excess of the hybridization probes, such as in real-time monitoring of polymerase chain reactions in sealed tubes or in detection of RNAs within living cells. Molecular beacons are hairpin- shaped molecules with an internally quenched fluorophore
whose fluorescence is restored when they bind to a target nucleic acid. They are designed in such a way that the loop portion of the molecule is a probe sequence complementary to a target nucleic acid molecule. The stem is formed by the annealing of complementary arm sequences on the ends of the probe sequence. A fluorescent moiety is attached to the end of one arm and a quenching moiety is attached to the end of the other arm. The stem keeps these two moieties in close proximity to each other, causing the fluorescence of the fluorophore to be quenched by energy transfer. Since the quencher moiety is a non-fluorescent compound and emits the energy that it receives from the fluorophore as heat, the probe is unable to fluoresce . When the probe encounters a target molecule, it forms a hybrid that is longer and more stable than the stem and its rigidity and length preclude the simultaneous existence of the stem hybrid. Thus, the molecular beacon undergoes a spontaneous conformational reorganization that forces the stem apart, and causes the fluorophore and the quencher to move away from each other, leading to the restoration of fluorescence which can be detected. In order to detect multiple targets in the same solution, molecular beacons can be made in many different colors utilizing a broad range of fluorophores (Tyagi, S. et al., 1998, Nature Biotechnology, 16, 49-53). DABCYL, a non- fluorescent compound, can serve as a universal quencher for any fluorophore in molecular beacons.
Sectioning and DNA Extraction
Except where noted, all reagents used in protocols described in this disclosure were purchased from Sigma- Aldrich (St. Louis, Mo.), and all oligonucleotides were synthesized at Ortho-Clinical Diagnostics.
Using a microtome, paraffin blocks comprising tumor or lymph node tissue were sectioned: 10 microns thick for primary tumor samples, and 50 microns thick for lymph node samples. To avoid DNA contamination between samples, excess paraffin was removed from the microtome before the first section was cut. All excess paraffin was removed by brush, and the blade area was wiped with xylene and allowed to air dry prior to use. A fresh blade was used between patient sample paraffin blocks. After cutting, sections were carefully transferred into separate 1.5 mL conical screw-cap tubes by means of a wooden applicator stick. A new stick was used for each paraffin block. In control experiments it was shown that this method successfully eliminated carryover between K-12 ras-positive and K-12 ras-negative samples as determined by REMS-PCR.
To extract DNA, the tubes were centrifuged at 14,000 rpm for 2 min to pellet the paraffin, and 80 microliters of lysis buffer (10 mM Tris-HCl, pH 8.0, and 0.5% Tween 20 and 10 microliters of PreTaq (Life Technologies, Inc., Gaithersburg, MD.) were added and the tube was incubated at 100°C in a heat block for 5 min. Ten microliters of 250 mM sodium hydroxide was added and the tubes were incubated in a heat block at 105°C for 10 min. While hot, the tubes were
centrifuged at 14,000 rpm for 2 min. The liquid under the paraffin layer was carefully removed, transferred to a new tube, and stored frozen prior to use.
Cell -Lines
All human cell lines were purchased from the American Type Culture Collection, Manassas, VA. Calu 1 (ATCC HTB54) is a cell line derived from a lung adenocarcinoma which is heterozygous at K-ras codon 12 having both a wild type (GGT) and a mutant (TGT) sequence (5). K562 (ATCC CCL243) is a cell line derived from a human leukemia, which is wild type at codon 12 of K-ras (Roberts, N. J.et al . , 1999, BioTechniques 27 : (3) 418-422) . Other human cell lines known to have ras mutations used include Molt-4 (ATCC CRL-1582) having an N-ras mutation at codon 12 (Bos, J. L., 1988, Hematol. Pathol . 2:55-63), HCT-116 (ATCC CCL-247) having a K-ras mutation at codon 13 (Aoki, T. , S. et al.,1994, Hum. Mutat..-3 (4) .-342-6) , HL-60 (ATCC CCL-240) having an N-ras at codon 61 (Bos, J. L. et al . , 1984, Nucleic Acids Res. 12 (23) .-9155-63) and T24 (ATTCC HTB-4) having an H-ras mutation at codon 12 (Capon, D. J. et al . , 1983, Nature 302: 33-37) and intron D (Cohen, J. N. and A. D. Levinson, 1988, . Nature 334 (6178) : 119-124) . Genomic DNA was extracted from cell lines using a protocol involving incubation of cells in a lysis buffer at high temperature.
Oligonucleotides Having Mutant Sequences
In some experiments oligonucleotides prepared according to the method of Rochlitz et al . (1988, DNA 7 (7) .-515-519) were used as target nucleic acids (identified as "oligo" in Table 2) . They comprised the base sequence of N-ras codon 13 having a cytosine to thymine (C to T) mutation.
Defini tions
When reference is made to a nucleotide "adjacent" to a terminal nucleotide in an oligonucleotide comprising a particular sequence of interest, the term "adjacent" means any nucleotide between the terminal nucleotide and the first nucleotide commencing the sequence of interest. For example, consider an oligonucleotide having the following hypothetical 5' to 3' directed sequence:
AGTCGTTAGTGTCATCTATAGAGACTCGGGCCTGACTAG
The underlined sequence CATCTATAGAGA represents the particular sequence of interest, the 5' terminal nucleotide (in bold font) is A and the 3 ' terminal nucleotide (in bold font) is G. A nucleotide adjacent to the 5' terminal nucleotide is any nucleotide between A and C, where C is the first nucleotide commencing the sequence of interest in the 5' to 3 ' direction. That is, it is any nucleotide in the sequence GTCGTTAGTGT. Analogously, a nucleotide adjacent to the 3 ' terminal nucleotide is any nucleotide in the sequence CTCGGGCCTGACT .
When reference is made to the "3 ' terminus" it means the nucleotides comprising those adjacent to the 3' terminal nucleotide, as defined above, and the 3' terminal nucleotide. An analogous definition applies to the "5' terminus" .
An oligonucleotide comprising a sequence of interest can be obtained or prepared from a natural source or prepared by way of any suitable chemical synthetic method. An oligonucleotide can consist of only the sequence of interest, or the sequence of interest itself may be only part of a larger sequence of nucleotides comprising the 'oligonucleotide. An oligonucleotide may have linked to it by way of one or more nucleotides, any molecule or molecules in addition to a nucleotide, such as a linker molecule for covalent bonding to another molecule or substrate; a label, such as a fluor, dye, radioisotope or enzyme; a molecule that interacts with another molecule which may or may not also be linked to the oligonucleotide, such as a fluorescence quencher; a ligand for binding to a specific receptor, such as biotin, avidin or strepavidin, and so forth .
As used herein the term "wild type sequence" refers to a conserved sequence of nucleotides within a gene in a biological species, preferably a human gene, that is, a sequence that is observed in a majority of representative members of the species.
The term "primer" refers to an oligonucleotide, whether naturally occurring or synthetically produced, that is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product complementary to a nucleic acid strand (that is, template) is induced. Primers may be perfectly matched to the target sequence or they may contain internal mismatched bases, which can result in the induction of restriction endonuclease recognition/cleavage sites in specific target sequences. For the purpose of the present invention, this shall be referred to as a primer induced recognition/cleavage site. Any number of primers capable of inducing a cleavage site in one or more target sequences can be used in a reaction admixture and the statement "a primer induced cleavage site" is meant to include a single primer induced site or multiple primers inducing different cleavage sites in one or more target sequence.
The term "primer pair" refers to two primers, one being capable of acting as a point of initiation of synthesis of a primer extension product on one strand of a duplex DNA target or on one strand derived from a duplex DNA target, and the other primer being capable of acting as a point of initiation of synthesis of a primer extension product on the other strand of a duplex DNA target or on the other strand derived from the duplex DNA target.
Example 1
Detection of Ras Mutations in Primary Tumor Samples Using REMS-PCR
Mutations in codon 12 of the K-ras gene were detected using REMS-PCR according to the methods of Roberts, N. J. et al . , 1999, BioTechniques 27 : (3) 418-422 ; Ward, R. et al . ,
1998, Am. J. Pathol. 153 (2) : 373-379; and WO 96/32500. Each PCR admixture contained three pairs of primers . The diagnostic primers induce a BstN I restriction site in the wild type ras, but not in a ras mutation at codon 12. Thus, ras wild type DNA is selectively cleaved during PCR thermocycling, and mutant sequences of ras at codon 12 are enriched. The PCR control primers were used to confirm that PCR amplifiable DNA was extracted, and the enzyme control primers confirmed that the restriction enzyme was functioning during thermocycling. Reaction admixtures contained 12 units/100 μL of recombinant Taq polymerase (developed at Ortho-Clinical Diagnostics) , and a 5-fold molar excess (0.842 μL) of Taq inhibiting antibody TP4-9.2 (developed at Ortho-Clinical Diagnostics according to protocols described in U.S. Patents 5,338,671 and 5,587,287) over the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl , pH 8.3), 0.3 μM of diagnostic primers (see below), 5BKIT (SEQ ID NO: 1), (Roberts, N. J.et al . ,
1999, BioTechniques 27 : (3) 418-422 ; Ward, R. et al . , 1998, Am. J. Pathol. 153 (2) : 373-379) and 3K2 (SEQ ID NO:2) (Ward, R. et al., 1998, Am. J. Pathol. 153 (2) : 373-379) , 0.05 μM of
PCR control primer pairs, 5BK5 (SEQ ID NO: 3) and 3K6 (SEQ ID NO:4), 0.05 μM of enzyme control primer pairs, 5BK28 (SEQ ID NO:5) and 3K29 (SEQ ID NO:6), 0.2 mM total dinucleoside triphosphates (dNTPs) , 0.6 units/μL of BstN I (New England BioLabs, Beverly MA) , 1 mM dithiothreitol (DTT) , 4 mM magnesium chloride, sample (typically 3 μL) and deionized water up to a final volume of 100 μL. At least one of the primers used in Example 1 was biotinylated. Biotinylated primers, after extension by polymerase, are captured using avidin reagents to generate signal. In all the examples, the letter "B" appearing in the name of an oligonucleotide identifies it as being biotinylated. If the oligonucleotide is not biotinylated, the letter "B" does not appear in the name identifying it. For example, a primer having sequence SEQ ID NO: 5, if biotinylated, it was named 5BK28, if it is not biotinylated, it was named 5K28. Biotinylated and nσn- biotinylated primers provide substantially the same results as determined using gel-based detection. The following primers were biotinylated at the 5' end: 5BKIT (SEQ ID NO: 1) , 5BK5 (SEQ ID NO: 3), 5BK28 (SEQ ID NO: 5), 5BKITSC (SEQ ID NO: 12), 5BN2 (SEQ ID NO: 28), 5BN4 (SEQ ID NO: 29), 3BN13 (SEQ ID NO: 55), 5BK15 (SEQ ID NO: 60), and 5BK37 (SEQ ID NO: 61) . The nucleotide sequences of the primers are as follows :
SEQ ID NO: 1
TATAAACTTG TGGTAGTTGG ACCT
SEQ ID NO: 2
CGTCCACAAA ATGATTCTGA
SEQ ID NO : 3
TCAGCAAAGA CAAGACAGGTA
SEQ ID NO: 4
AGCAATGCCC TCTCAAGA
SEQ ID NO: 5
AGTAAAAGGT GCACTGTAAT AATC
SEQ ID NO: 6
GTGTCGAGAA TATCCAAGAG CCA
The solutions comprising Taq polymerase and anti-Taq antibody were combined and incubated for 10-15 minutes prior to the addition of the other PCR components. BstN I restriction enzyme was added to the reaction admixture just prior to the addition of sample, the last component added.
In the case of primary tumor samples, the reaction admixture was amplified and detected using an Ortho-Clinical Diagnostics, Inc. pouch containment system for nucleic acid amplification and detection as described by Findlay et al . (1993, Clin. Chem. 39 (9) : 1927-1933) and U.S. Patent 5,229,297. Sample (approximately 0.8ug DNA), combined with PCR reagents to a total volume of 85ul as described above, was loaded into a blister of the pouch and the pouch was sealed. The PCR blister was heated for 1 min at 94°C,
followed by 30 PCR cycles (a melt temperature of 94°C for 10 sec, followed by an annealing temperature of 58°C for 75 seconds) . After a post-amplification incubation for 5 min at 103°C, product was detected in a "detection" blister of the pouch, wherein product hybridized with complementary oligonucleotide (capture oligo) attached to beads. The method of oligo attachment to polystyrene beads has been described by Findlay et al . (1993, Clin. Chem. 39(9): 1927- 1933) and in US5,380,489 and involves the use of polymeric particles (1.2um average diameter) of poly (styrene-co-mono- 2 (p-vinylbenzylthio) ethyl succinate (95:5 weight ratio) prepaz'ed by known emulsion polymerization techniques. To these particles were attached molecules of the indicated capture oligo K-CapD-8 (SEQ ID NO:7), Cap-2E (SEQ ID NO:8),- or K-Cap6 (SEQ ID NO: 9) . Attachment was though an aminediol linking group with two tetraethylene glycol spacer groups prepared and attached to the oligonucleotide according to the teaching of U.S. 4,962,029. The oligonucleotide molecules were attached to the particles to form a nucleic acid reagent as described in US 5,380,489, example 3.
Capture oligo, K-CapD8 (SEQ ID NO:7), hybridized to biotinylated REMS-PCR diagnostic product, capture oligo, Cap-2E (SEQ ID NO:8), hybridized to biotinylated enzyme contol PCR product, and capture oligo, K-Cap6 (SEQ ID NO: 9), hybridized to biotinylated PCR control product. The nucleotide sequences follow:
SEQ ID NO: 7
TATCGTCAAG GCACTCTTGC CTACGCCA
SEQ ID NO: 8
GACTGTGTTT CTCCCTTCTC AGGATTCC
SEQ ID NO: 9
GACATAACAG TTATGATTTT GCAGAAAACA GATC
The horseradish peroxidase (HRP) channel and wash channel of the pouch were at 55°C. The detection channel was at 40°C. Hybridized product was detected using a solution of HRP-streptavidin and HRP-dye substrate. Each pouch contained 3 detection blisters, each with 200 μL of reagent solution (streptavidin-HRP, 200 μL/blister; wash 200 μL/blister; and dye/gel 200 μL/blister) . The order in which the blisters were used was as follows: HRP-streptavidin, wash, and finally dye/gel blister. The capture oligo beads were ordered in the pouch (in the direction of reagent flow) as follows: no beads, K-Cap2E, no beads, K-capD8, no beads, K- Cap6M, and no beads.
Using the REMS-PCR based method in a pouch format as described, approximately 51% of the primary tumor samples from 106 Dukes' B colon cancer patients were found to possess a K-ras mutation at codon 12. Forty-five of the samples (49%) were negative for K-ras mutation at codon 12. In comparison, in a multi-center study (Andreyev, H. J. N. et al, 1998, Natl . Cancer Inst . 90 (9):675-684) it was
reported that 43.8% of colon cancer primary tumors, as determined by single-stranded conformation polymorphism (SSCP) techniques, exhibited a K-12 ras mutation, 33.1% by direct sequencing, and 32.7% by allele-specific primer PCR. The greater incidence of K-12 ras mutation observed using the methods of the present invention may be due to differences in the ability of each method to detect a mutation in a large excess of wild type DNA. Also, increased sensitivity is possible because product can be detected using enzyme-mediated calorimetric, florescence, or chemiluminescense signal formation methods.
The REMS-PCR based method is sensitive, utilizes internal PCR and enzyme controls, and is rapid. The method was carried out in a pouch containment device, which allowed automation. The method reduced the possibility of contamination, and permitted increased detection sensitivity, as product was detected using enzyme-catalyzed dye formation, in contrast with detection of product in a gel subsequent to electrophoresis (Findlay, J. B. et al . , 1993, Clin. Chem. 39 (9) : 1927-1933) . The method, subsequent to DNA extraction, took less than 90 minutes to complete.
Example 2
Detection of K12-ras Mutations in Lymph Node Samples Using Nested PCR
Lymph nodes from a total of 38 Dukes' B colorectal cancer patients, identified as having a K-12 ras mutation in the primary tumor, were analyzed for the presence of K-12 ras mutations . Because of the small amount of lymph node tissue, and therefore nucleic acids, in the paraffin blocks and the limited stability of the BstN I restriction enzyme during thermocycling, which permitted only about 34 amplification cycles, the REMS-PCR method described based on BstN I above for primary tumor samples was less sensitive than desired for amplification and detection of low copy number samples. Therefore, a more sensitive nested PCR method involving two separate rounds of amplification, followed by restriction endonuclease digestion was used.
Extended PCR thermocycling in this method (12 cycles in round 1 and 40 cycles in round 2) allowed greater sensitivity for low copy number samples. For the present experiments, a Stratagene Eagle Eye II Still Video System
(Stratagene, La Jolla, CA.) was used. This instrument uses sensitive CCD optics and video and software enhancement to improve resolution of gel bands .
Round 1 PCR admixtures contained 4 units/50 μL of recombinant Taq polymerase, a 5-fold molar excess of Taq inhibiting antibody TP1-12.2, Cetus II buffer (50 mM KC1 in 10 mM Tris-HCl , pH8.3), 1.2 μM each of primers 5KID (SEQ ID NO:10 and 3KiE (SEQ ID N0:11), 0.2 mM total dinucleoside triphosphates (dNTPs) , 0.04 mM magnesium chloride, sample
(typically 5 μL) and deionized water up to a final volume of 50 μL. Taq poymerase and anti-Taq antibody were combined and
incubated for 10-15 minutes prior to the addition of the other PCR components. Thermocycling was performed in a Gene- Amp 9600 (Perkin-Elmer, Norwalk, CT) with the following parameters for Round 1 : An initial incubation at 94°C for 3 min, followed by 12 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30 sec. The primer sequences are as follows :
SEQ ID NO: 10
GGCCTGCTGA AAATGACTGA ATA
SEQ ID NO : 11
CTCATGAAAA TGGTCAGAGA AAC
Round 2 PCR admixtures contained 10 units/100 μL of recombinant Taq polymerase, a 5-fold molar excess of Taq inhibiting antibody TP12.2, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl, pH 8.3), 0.2 μM each of primers 5BKITSC (SEQ ID NO .-12) and 3KiU (SEQ ID NO: 13) (see below), 0.2 mM total dNTPs, 0.04 mM magnesium chloride, 2 μL sample, and deionized water up to a final volume of 100 μL. Round 2 thermocycling parameters performed on a Gene-Amp 9600 were: An initial incubation at 94°C for 3 min, followed by 40 cycles of alternate incubations at 94°C for 10 sec and 60°C for 30 sec. The primer sequences are as follows:
SEQ ID NO: 12
GAATATAAAC TTGTGGTAGT TGGACCT
SEQ ID NO: 13
ATCAAAGAAT GGTCCTGCACC
Restriction enzyme digestion was performed by combining 40 units of BstN I, (New England BioLabs, Beverley MA), and 15 uL of the amplification product from Round 2 in a icrofuge tube. Tubes were incubated overnight at 60°C.
Samples were analyzed by electrophoresis on 4% w/v NUSieve agarose gel (FMC Bioproducts, Rockland, ME) and imaged by means of a Stratagene Eagle Eye II video system (La Jolla, CA) .
Figure 1 shows the results obtained with K562 cell line DNA, which is wild type for K-ras, before (lane 1) and after (lane 2) restriction enzyme digestion. Calul DNA, heterozygous for a K-ras mutation at codon 12 is shown before (lane 3) and after (lane 4) restriction enzyme digestion. Thus, a gel band at 152bp remaining after BstN I digestion is diagnostic for a K-ras mutation at codon 12, whereas gel bands of 128bp and 24bp are formed as a result of Bstnl digestion of the K-ras wild type product.
Figure 2 shows results obtained for both K-12 ras positive and negative lymph nodes, as assayed by the nested PCR protocol followed by Restriction Fragment Length Polymorphism (RFLP) gel analysis. In Fig. 2, results for three different lymph node samples before (lanes 2, 4, and
6) and after BstN I restriction enzyme digesion (lanes 3,5 and 7) are shown. The 152bp product remaining after restriction enzyme digestion (lane 5) is diagnostic for a K- ras mutation at codon 12, and the absence of a 152bp product after digestion is diagnostic for wild type K-ras at codon 12 (lanes 3 and 7) . The lymph node samples in lanes 2 and 3, and in lanes 6 and 7 are negative for a K-12 ras mutation and the lymph node sample in lanes 4 and 5 are positive for this mutation.
Of the 38 samples, 14 (37%) were positive for a K-12 ras mutation in one or more lymph nodes, whereas 24 samples (63%) were negative for a ras mutation. For the 14 lymph node samples exhibiting a K-12 ras mutation, a total of 142 nodes were evaluated (an average of 10 nodes per patient) . Similarly, for the 24 samples that were negative for a K-12 ras mutation in one or more lymph nodes, a total of 97 nodes were evaluated (an average of 4 nodes per patient) .
In the REMS-PCR and nested PCR based methods one or more of the following "negative" controls were used: (a) a tonsil sample prepared from a paraffin block as described in Example 1, (b) genomic DNA from cell line K562 (K-ras wild type) , and (c) a reagent control in which no DNA template was added. Genomic DNA from the cell line Calu-1 was used as a "positive" control. Genomic DNA was prepared as described previously in the present application.
Example 3
Detection of K-12 Ras Mutations Using Molecular Beacons in REMS-PCR
Samples, reaction mixtures, and primers were as described in example 1 except that 0.2μM of the diagnostic primers were used. To each of three microtiter wells was added lμL of a 20μM stock of the molecular beacons. Molecular beacon synthesis was performed at Synthetic Genetics, San Diego Ca. Each molecular beacon was labeled with the dye carboxyfluorescein, FAM, on the 5' end and the fluorescence quencher DABCYL (4-(4'~ dimechylaminophenylazo) benzoic acid) on the 3 'end. Typically the starting material for the synthesis of molecular beacons is an oligonucleotide that contains a sulfhydryl group at its 5' -end and a primary amino group at its 3 '-end. DABCYL is coupled to the primary amino group utilizing an amine- reactive derivative of DABCYL. The oligonucleotides that are coupled to DABCYL are then purified. The protective trityl moiety is then removed from the 5 ' -sulfhydryl group and a fluorophore is introduced in its place using an iodoacecamide derivative. Recently a control pore column that can introduce DABCYL moiety at the 3 ' end of an oligonucleotide has become available which makes it possible to synthesize a molecular beacon completely on a DNA synthesizer.
The probe sequences are as follows :
SEQ ID NO: 14
GCGAGCTATC GTCAAGGCAC TCTTGCCTAC GCCAGCTCGC
SEQ ID NO: 15
CCGAGCGACA TAACAGTTAT GATTTTGCAG AAAACAGAGC TCGG
SEQ ID NO: 16
GCGAGCAAGC CTTCGCCTGT CCTCATGTAT TGGTGCTCGC
SEQ ID NO: 17
GCGAGCGACT GTGTTTCTCC CTTCTCAGGA TTCCGCTCGC
For each analysis three separate microtiter wells were used. BD2 (SEQ ID NO: 14) was added to a first well as a mutant K-12 ras diagnostic probe; increased fluorescence signal indicating a K-ras mutation at codon 12. A second well contained BPIG (SEQ ID NO: 15) as a PCR control; increased fluorescence indicates sufficient amplifiable DNA. A third well contained either BEl (SEQ ID NO: 16) or BE2 (SEQ ID NO: 17) as an enzyme control. Increased fluorescence of the enzyme control would indicate that the restriction enzyme may have been inactivated during PCR thermocycling, and would represent a failed assay.
Thermocycling and fluorescence detection were carried out using an ABI Prism 7700 Sequence Detector (PE Applied Biosystems, Foster City, CA.). Thermocycling parameters were: A first incubation at 50°C for 1 min, a second incubation at 94°C for 1 min, followed by 40 cycles of alternate heating at 94°C for 10 sec and heating at 58°C for
75 sec. After the last cycle, the reagent admixture was incubated at 50°C for 2 min. The single reporter mode was used for detecting fluorescence. Results are summarized in Table 1 below. t
For a valid determination, the diagnostic and PCR control must develop an increase in fluorescence signal above a threshold level; whereas, fluorescence of the enzyme control must remain below this threshold level. Ct, which is reported in Table 1, is the calculated cycle number at which point the fluorescence signal exceeds the baseline threshold value established during approximately the first 15 PCR cycles (see ABI PRISM 7700, "Sequence Detection System", User's Manual, 1998, pp D4-D5, Perkin-Elmer Corp, Foster City, CA) . The smaller the Ct value, the earlier amplified product is detected. The Ct value is related, therefore, to the presence and amount of target in the sample.
Table 1 Molecular Beacon-Based Detection of K-12 ras Mutations
Replicate determinations for samples containing a 1:10 ratio, by weight, of K-12 ras mutant to wild type DNA (1:10 (C:K)) are shown in Table 1. Duplicate wells with BPIG, the PCR amplification control, had Ct values of 25.76 and 25.32, indicating that the samples contained PCR amplifiable DNA. Duplicate determinations with BD2 resulted in Ct values of 30.01 and 28.01, indicating that the samples are positive for a K-12 ras mutation. Ct values with enzyme controls BEl and BE2 were considerably higher at 40.00 and 37.31, respectively, indicating that the restriction enzyme was active during thermocycling.
With wild type K562 cell line DNA alone (K562 in Table 1) , duplicates with the BPIG PCR control had Ct values of 28.28 and 27.70, indicating the presence of amplifiable DNA.
The wells containing BD2 had Ct values of 40 and 38.2 indicating that the samples were negative for a K-12 ras mutation. The wells containing the enzyme controls BEl or BE2 had Ct values of 40.00.
Example 4
Detection of K-12 ras Mu tations Using Molecular Beacons in Mul tiplexed REMS-PCR Methods
This example illustrates the use of molecular beacons comprising different fluorophores for multiplexed REMS-PCR based determination of K-12 ras mutations.
Each REMS-PCR reaction admixture was as described in example 1, except that primer 5BKITSC (SEQ ID NO: 12) was substituted for primer 5BKIT (SEQ IS NO:l) and 0. lμM enzyme control primers and 0. lμM PCR control primers were used. Each microtiter well also contained 0. lμM of molecular beacons BP1-TET (SEQ ID NO: 19) and BE6-JOE (SEQ ID NO: 21) and 0.20μM of molecular beacon BD-FAM(SEQ ID NO: 20) . Molecular beacon, BP1-TET, comprised the fluor tetrachlorofluorescein (TET) at its 5 'end. Molecular beacon BD3-FAM comprised the fluor carboxyfluorescein (FAM) at its 5 'end. Molecular beacon BE6-JOE comprised the fluor carboxy- 4 ' , 5 ' -dichloro-2 ' , 7 ' dimethoxyfluorescein (JOE) at its 5' end. The quencher DABCYL was attached at the 3' end.
Molecular beacons comprising FAM or TET were purchased from Synthetic Genetics, San Diego, CA, and the JOE-labeled beacon was purchased from Tri-Link BioTechnologies, Inc., San Diego, CA. The target directed DNA sequences are as follows :
SEQ ID NO: 18
GGATATTCTC GACACAGCAG GTT
SEQ ID NO: 19
GCGAGCGACA TAACAGTTAT GATTTTGCAG AAAACAGATC GCTCGC
SEQ ID NO: 20
GCGAGCCTAT CGTCAAGGCA CTCTTGCCTA CGCCAGCTCG C
SEQ ID NO: 21
GCGAGCAGGA ATCCTGAGAA GGGAGAAACA CAGTCGCTCG C
Thermocycling conditions on the ABI Prism 7700 Sequence Detector were as described in example 3.
For the PCR control beacon, BP1-TET, Ct values for duplicate determinations, at a 1:100 weight ratio of mutant to wild type DNA were 31.902 and 31.176, indicating the presence of amplifiable DNA. For the diagnostic beacon, BD3- FAM, at a 1:100 ratio of mutant to wild type DNA, Ct values of 35.058 and 36.225 were obtained, indicating the presence of K-12 ras mutation. Ct values for the enzyme control
beacon, BE6-JOE, were 40.000 and 40.000, confirming that the BstN I restriction enzyme was active.
These results show that K-12 ras mutations can be determined using molecular beacons in multiplexed REMS-PCR- based methods .
Example 5
Mul tiplexed method for common K- , H- , and N-ras mutations
For multiplexed detection of ras mutations, a nested PCR protocol involving two rounds of PCR was used. Round 1 PCR reaction admixtures contained MgCl2, dNTP, and Taq polymerase, and anti-Taq antibody TP1.12.2 in the concentrations described in Example 1, as well as 0.2μM of the indicated Round I primer in Table 2, 0.8 μg DNA, Cetus Buffer II (50mM KCl and lOmM Tris-HCl, pH8.3) and water to a final volume of 50 μL. The appropriate wild type and mutant cell line or synthetic DNA were included for each assay as shown in Table 2.
Thermocycling was performed on a Gene-Amp 9600 (Perkin- Elmer, Norwalk, CT) with the following parameters for Round 1: 1 cycle of 94°C for 3mins, followed by 12 cycles of alternate incubations at 94C for 10 sec, and 55°C for 30sec. For the assay of mutations in H-ras intron D, 20 cycles of PCR amplification were used instead of 12 cycles.
Round 2 PCR reaction admixtures contained 10 units/100 μL of recombinant Taq polymerase (developed at Ortho- Clinical Diagnostics), and a 5-fold molar excess (0.842 μL) of Taq inhibiting antibody TP1-12.2 over the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl , pH 7.5), 0.2 mM total dinucleoside triphosphates (dNTPs), 3 mM magnesium chloride, 0.2uM of the indicated Round 2 primers in Table 2, DNA sample from Round 1 (typically 3 μL) and deionized water up to a final volume of 100 μL .
Thermocycling was performed on a Gene-Amp 9600 (Perkin- Elmer, Norwalk, CT) with the following parameters for Round 2: 1 cycle of 94°C for 3mins, followed by 32 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30sec. For the assay of mutations in H-ras intron D, 38 cycles of PCR a plifcation were used instead of 32 cycles.
Restriction enzyme digestions were prepared by mixing 15 uL of PCR product from Round 2, 2 uL of restriction enzyme buffer (10X stock) , the indicated units of each restriction enzyme in Table 2 and water to a final volume of between 17 and 20 uL. Restriction enzyme digestion buffers were purchased from New England BioLabs (Beverly, MA) . For BstN I, Mse I, Hae III digestions, NEB2 buffer was used, and for Bsl 1 digestions, NEB3 buffer was used. Digestion with all other restriction enzymes shown in Table 2 used NEB4 buffer, except for Mae I, which used SuRE/Cut Buffer purchased from Roche Molecular Biochemicals, Indianapolis,
IN) . Overnight digestion at the temperature indicated in Table 2 was used.
After restriction enzyme digestion, samples were analyzed by electrophoresis on 4% w/v NUSieve agarose gel (FMC Bioproducts, Rockland, ME) and imaged by means of a Stratagene Eagle Eye II video system (La Jolla, CA) . As provided in Table 2, a mutation in the particular ras gene is indicated by the presence of a gel band similar to that of undigested product . Wild type DNA is cleaved by the restriction enzyme to two smaller size gel bands of expected molecular weights as provided in Table 2.
The primers having the target directed sequences identified below were used in REMS-PCR and/or nested PCR methods for determining mutations in K-12, K-13, K-61, H-12, H-13, N-12, N-13, N-61 and mutations in H-ras intron D.
SEQ ID NO: 22
GTAGTAATTG ATGGAGAAAC CTGT
SEQ ID NO: 23
TGGACATACT GGATACAGCT GGACT
SEQ ID NO: 24
CGGCCCCTCG CGCTTTA
SEQ ID NO: 25
AGCTGTGTCG GCCCAGGACT GCA
SEQ ID NO: 26
ATGTGACCCA GCGGCCCCTC G
SEQ ID NO: 27
CTATAATGGT GAATATCTTC AAATG
SEQ ID NO: 28
AGTACAAACT GGTGGTGCCT GGAG
SEQ ID NO: 29
ACTGGTGGTG GTTCCAGCAG GT
SEQ ID NO: 30
ATATAAACTT GTGGTAGTTC CAGCTGGT
SEQ ID NO: 31
GGTTCTGGAT TAGCTGGATT G
SEQ ID NO: 32
GGATATTCTC GACACAGCAG GC
SEQ ID NO: 33
GGGAGACGTG CCTGTTGGAC
SEQ ID NO: 34
TTGATGGCAA ACACACACAG GA
SEQ ID NO: 35
ACAAGTGGTT ATAGATGGTG AAAC
SEQ ID NO: 36
TGATGGCAAA TACACAGAGG A
SEQ ID NO: 37
GGACATACTG GATACAGCTG GC
SEQ ID NO: 38
TTGGACATCC TGGATACCGC TGG
SEQ ID NO: 39
CCCTGAGGAG CGATGACGGA A
SEQ ID NO: 40
AGTGGGGTCG TATTCGTCC
SEQ ID NO: 41
TCACCTCTAT AGTGGGGTCG TA
SEQ ID NO: 42
GTTCTTGCTG GTGTGAAATG AC
SEQ ID NO: 43
AGGTCCTTGC TGGTGTGAAA TGACTG
SEQ ID NO: 44
GTGGTTCTGG ATTAGCTGGA TTGTCAG
SEQ ID NO: 45
GTTGGACATA CTGGATACAG CTGGC
SEQ ID:N0 46
GGCAAATACA CAGAGGAAGC CTTCG
SEQ ID NO: 47
GTTGGACATA CTGGATACAG CTGGACT
Specific primer sets used in nested PCR and their ras targets are identified in Table 2 below. The restriction enzyme, added subsequent to round 2 amplification, cleaves the wild type gene.
Table 2
* Numbers in parentheses in columns 3 and 4 indicate the SEQ ID NO of the identified primer.
The numerals in parentheses in column 2, for example K- 61 specify the nucleotide bases screened for mutation in the 5 ' to 3' direction (codon 12 of K-ras, nucleotide bases 2 and 3) . The absence of parentheses for K-12, K-13, N-12, N- 13, and H-12 ras mutations indicates that the assay was capable of detecting a mutation at any of the first two nucleotide bases in the codon. In column 1, where the same assay number appears in multiple rows, a multiplexed assay for the specified target mutations was performed using the indicated primers in those rows. Where a single assay number appears in a single row only the specified target mutation was determined using the indicated primers in that row. Where the source of the target sequence in Table 2 is indicated as "none", a cell line comprising the specified ras mutation was not available. In these cases, the size of the round 2 digestion products were determined based on restriction endonuclease digestion of the wild type DNA from cell-line K562.
Using the above-identified primers and methods, ras mutations were detected in cell lines or in oligonucleotides comprising ras mutation sequences. The size of digested and
undigested products for each specific mutation are described in Table 2.
Example 6
REMS-PCR for N-12, N-13 , and H-12 ras mutations
For the detection of N-ras mutations at codons 12 and 13 and H-ras mutations at codon 12, each PCR admixture contained three sets of primers. The diagnostic primers induce a Bsl I restriction site in the wild type ras, but not in the indicated ras mutation at N-ras codon 12, N-ras codon 13, or H-ras codon 12. Thus, ras wild type DNA is selectively cleaved during PCR thermocycling, and mutant sequences of above indicated ras mutations are enriched. The PCR control primers were used to confirm that PCR amplifiable DNA was extracted, and the enzyme control primers confirmed that the restriction enzyme was functioning during thermocycling. Reaction admixtures contained 12 units/100 μL of recombinant Taq polymerase (developed at Ortho-Clinical Diagnostics) , and a 2 -fold molar excess (0.842 μL) of Taq inhibiting antibody TP4-9.2 the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl, pH7.5), 0.2 μM of the indicated diagnostic primers pairs (see below), 0.05 μM of PCR control primer pairs 0. lμM of enzyme control primer pairs (see below), 0.2 mM total dinucleoside triphosphates (dNTPs), 0.6 units/μL of Bsl I (New England BioLabs, Beverly MA) , 1 mM dithiothreitol
(DTT) , 4 mM magnesium chloride, sample (typically 3 μL) and deionized water up to a final volume of 100 μL.
SEQ ID NO: 3 (5BK5) and SEQ ID NO: 4 (3K6) were used as a PCR control primer pair, and SEQ ID NO: 63 (5N12) and SEQ ID NO: 55 (3BN13) were used as the enzyme control primer pair. The following primer pairs were used: For the detection of H-ras mutation at codon 12: SEQ ID NO: 51
(5H12A) and SEQ ID NO : SEQ ID NO: 52 (3HB1) ; for the detection of H-ras mutation at codon 13: SEQ ID NO: 53
(5H13) and SEQ ID NO: 52 (3HB1) ; for the detection of N-ras mutation at codon 12: SEQ ID NO: 28 (5BN2) and SEQ ID NO: 31
(3N5) ; and for the detection of N-ras at codon 13: SEQ ID NO: 29 (5N4) and SEQ ID NO.-SEQ ID NO: 31 (3N5) .
Thermocycling was performed on a Gene-Amp 9600 (Perkin- Elmer, Norwalk, CT) with the following parameters for Round 1: 1 cycle of 94°C for 3mins, followed by 32 cycles of alternate incubations at 94°C for 10 sec, and 60°C for 30sec. For the assay of mutations in H-ras intron D, 38 cycles of PCR amplification were used instead of 32 cycles.
The following primers were used in REMS-PCR with Bsl I as restriction enzyme for determining mutations at N-ras codons 12 and 13 and mutations at H-ras codon 12.
SEQ ID NO: 48
AATATAAGCT GGTGGTGCCG GGCG
SEQ ID NO: 49
ATAAGCTGGT GGTGCCCGCC GT
SEQ ID NO: 50
TGAATATAAA CTTGTGGTAC CTGGAGCT
SEQ ID NO: 51
AATATAAGCT GGTGGTGCCG GGCGC
SEQ ID NO: 52
AATGGTTCTG GATCAGCTGG ATG
SEQ ID NO: 53
ATAAGCTGGT GGTGGTGCCC GCCG
SEQ ID NO: 54
TATAGATGGT GAAACCTGTT TGTTGG
SEQ ID NO: 55
CTATTATTGA TGGCAACCAC ACAG
Using the above-identified primers and methods, ras mutations were detected in cell lines or in oligonucleotides comprising ras mutation sequences .
Example 7
Detection of H-12, N-12 and N-13 ras mutations based on a molecular beacon assay
The following probes were used for determining mutations in H-12, N-12 and N-13. The probe for H-12 can
also be used for detecting H-13 mutations. The target specific probes were prepared in the form of molecular beacons comprising the fluor FAM at the 5 ' terminus and the quencher DABCYL at the 3' terminus. Primers from example 5 were used in REMS-PCR.
SEQ ID NO: 56
GCGAGCGTGG TGTTGGGAAA AGCGCAGCTC GC
SEQ ID NO: 57
GCGAGCCGTC GGTGTGGGCA GAGTGCGCTG CTCGC
SEQ ID NO: 58
GCGAGCGAAA CCTCAGCCAA GACCAGACAG GCTCGC
SEQ ID NO: 59
GCGAGCGACA TAACAGTTAT GATTTTGCAG AAAACAGATC GCTCGC
SEQ ID NO : 60
ATATAAACTT GTGGTACCTG GAGCT
SEQ ID NO: 61
TATAGATGGT GAAACCTGTT TG
SEQ ID NO: 62
CTTGCTATTA TTGATGGCAA CCACACAGA
SEQ ID NO: 63
TATAGATGGT GAAACCTGTT TG
SEQ ID NO: 64
ATAAGCTGGT GGTGCCGGGC G
SEQ ID NO: 65
ATGGTTCTGG ATCAGCTGG
SEQ ID NO: 66
AATATAAGCT GGTGGTGCCG GGCG
SEQ ID NO: 67
AATGGTTCTG GATCAGCTGG ATGGTC
Reaction admixtures contained 12 units/100 μL of recombinant Taq polymerase (developed at Ortho-Clinical Diagnostics), and a 4-fold molar excess (0.842 μL) of Taq inhibiting antibody TP4-9.2 the polymerase, HT50 buffer (100 mM sodium chloride, and 50 mM Tris-HCl , pH7.50.2 mM total dinucleoside triphosphates (dNTPs), 0.3 units/μL of Bsl I (New England BioLabs, Beverly MA) , 1 mM dithiothreitol (DTT) , 4 mM magnesium chloride, sample composed of the indicated dilution of mutant and wild type DNA (typically 3 μL) and deionized water up to a final volume of 100 μL.
The following primers and molecular beacons were added to individual reaction admixtures for the detection of N-12 ras mutations based on REMS-PCR and molecular beacons. PCR control primers 5BK5 (SEQ ID NO : SEQ ID NO: 3) and 3K6 (SEQ
ID NO: 4) were added at O.lμM, 0.2μM enzyme control primers 5N12A (SEQ ID NO: 54) and 3N13A (SEQ ID NO: 49), and 0.3μM diagnostic primers 5BN2 (SEQ ID NO: 28) and 3N5S (SEQ ID NO: 4.4) . The PCR control molecular beacon was BPIG (SEQ ID NO: 15) , the enzyme control molecular beacon was BEl (SEQ ID NO: 16) and the diagnostic molecular beacon was BND12 (SEQ ID
NO: 56) All molecular beacons were added at 0.2uM each and were labeled with a FAM dye. PCR thermal cycling parameters on the ABI Prism 7700 Sequence Detector were as described in example 3 except that 45 PCR cycles were used.
The following primers and molecular beacons were added to individual reaction admixtures for the detection of H-12 ras mutations based on REMS-PCR and molecular beacons. PCR control primers 5BK5 (SEQ ID NO : SEQ ID NO : 3) and 3K6 (SEQ ID NO: 4) were added at 0.0.05μM, O.lμM enzyme control primers 5N12A (SEQ ID NO: 54) and 3N13A (SEQ ID NO: 49), and 0.2μM diagnostic primers 5H12B (SEQ ID NO: 66) and 3HB2
(SEQ ID NO 67) . The PCR control molecular beacon was BP1 (SEQ ID NO 59) , the enzyme control molecular beacon was BEl (SEQ ID NO 16) and the diagnostic molecular beacon was BHD12 (SEQ ID NO: 57) All molecular beacons were added at 0.2uM each and were labeled with a FAM dye. PCR thermal cycling on the ABI Prism 7700 Sequence Detector were as described in example 3 except that a total of 45 thermal cycles were used.
The following primers and molecular beacons were added to individual reaction admixtures for the detection of N ras
mutations at codon 13 based on REMS-PCR and molecular beacons. PCR control primers 5BK5 (SEQ ID NO: 3) and 3K6 (SEQ ID NO: 4) were added at O.lμM, O.lμM enzyme control primers 5N12A (SEQ ID NO: 54) and 3N13 (SEQ ID NO: 55), and 0.3μM diagnostic primers 5N4 (SEQ ID NO: 29) and 3N5S (SEQ ID NO: 44) . The PCR control molecular beacon was BPI (SEQ ID NO: 59), the enzyme control molecular beacon was BEL (SEQ ID NO: 58) and the diagnostic molecular beacon was BND12 (SEQ ID NO: 56) All molecular beacons were added at 0.2uM each and were labeled with a FAM dye. PCR thermal cycling parameters on the ABI Prism 7700 Sequence Detector were as described in example 3 except that 45 thermal cyles were used .
Results of these studies are shown below in Table 3. All PCR controls exhibited a Ct value between 28.31 and 34.43 indicating that samples contained PCR amplifiable DNA. All diagnostic samples for H-ras mutations at codon 12 and N-ras mutations at codons 12 and 13 exhibited Ct values values below 40 except for the most dilute 1:1000 mutant to wild type sample for N-ras mutation at codon 12, indicating that mutant sequences were detectable. Enzyme control samples exhibited a Ct of >40 or >45, except for a control sample in which restriction enzyme was deleted. This sample had a Ct value of 29.1 indicating that the enzyme control functioned in the absence of restriction enzyme. These results indicate that the ras mutations can be detected at dilutions of 1:100 mutant to wild type or greater based on the above-identified primers, probes and methods.
Table 3
Homogeneous PCR Detection of H-ras Mutations at Codon 12 and N-ras Mutations at Codons 12 and 13
The invention has been described in detail with respect to particular preferred embodiments. It will be understood that variations and modifications can be effected without departing from the scope and spirit of the invention. The entire contents of all patents, patent applications, and non-patent disclosures and their citations are expressly incorporated herein by reference.
SEQUENCE LISTING
<110> Belly, Robert T. Todd, Alison V. Fuery, Caroline J.
<120> DIRECTION OF RAS MUTATIONS
<130> CDS-225
<140> 60/237,416 <141> 2000-10-02
<160> 67
<170> Patentln version 3.1
<210> 1
<211> 24
<212> DNA
<213> Synthetic Construct
<400> 1 tataaacttg tggtagttgg acct 24
<210> 2
<211> 20
<212> DNA
<213> Synthetic Construct
<400> 2 cgtccacaaa atgattctga 20
<210> 3
<211> 21
<212> DNA
<213> Synthetic Construct
<400> 3 tcagcaaaga caagacaggt 21
<210> 4 <211> 18 <212> DNA
<213> Synthetic Construct
<400> 4 agcaatgccc tctcaaga 18
<210> 5
<211> 24
<212> DNA
<213> Synthetic Construct
<400 5 agtaaaaggt gcactgtaat aatc 24
<210> 6
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 6 gtgtcgagaa tatccaagag cca 23
<210> 7
<211> 28
- 61
<212 > DNA
<213 > Synthetic Construct
<400> 7 tatcgtcaag gcactcttgc ctacgcca 28
<210> 8
<211> 28
<212> DNA
<213 Synthetic Construct
<400> 8 gactgcgttt ctcccttctc aggattcc 28
<210> 9
<211> 34
<212> DNA
<213> Synthetic Construct
<400> 9 gacataacag ttatgatttt gcagaaaaca gate 34
<210> 10
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 10 ggcctgctga aaatgactga ata 23
<210> 11
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 11 ctcatgaaaa tggtcagaga aac 23
<210> 12
<211> 27
<212> DNA
<213> Synthetic Construct
<400> 12 gaatataaac ttgtggtagt tggacct 27
<210> 13
<211> 21
<212> DNA
<213> Synthetic Construct
<400> 13 atcaaagaat ggtcctgcac c 21
<210> 14
<21.1> 40 212> DNA
<213> Synthetic Construct
<400> 14 gcgagctatc gtcaaggcac tcttgcctac gccagctcgc 40
<210> 15
<211> 44
<212> DNA
<213> Synthetic Construct
<400> 15 ccgagcgaca taacagttat gattttgcag aaaacagagc tcgg 44
<210> 16
<211> 40
<212> DNA
<213> Synthetic Construct
<400> 16 gcgagcaagc cttcgcctgt cctcatgtat tggtgctcgc 40
<210> 17
<211> 40
<212> DNA
<213> Synthetic Construct
<400> 17 gcgagcgact gtgtttctcc cttctcagga ttccgctcgc 40
<210> 18
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 18
ggatattctc gacacagcag gtt 23
<210> 19
<211> 46
<212> DNA
<213> Synthetic Construct
<400> 19 gcgagcgaca taacagttat gattttgcag aaaacagatc gctcgc 46
<210> 20
<211> 41
<212> DNA
<213> Synthetic Construct
<400> 20 gcgagcctat cgtcaaggca ctcttgccta cgccagctcg c 41
<210> 21
<211> 41
<212> DNA
<213> Synthetic Construct
<400> 21 gcgagcagga atcctgagaa gggagaaaca cagtcgctcg c 41
<210> 22
<21.l> 24
<212> DNA
<213> Synthetic Construct
<400> 22 gtagtaattg atggagaaac ctgt 24
<210> 23
<211> 25
<212> DNA
<213> Synthetic Construct
<400> 23 tggacatact ggatacagct ggact 25
<210> 24 <211> 17 <212> DNA
<213> Synthetic Construct
<400> 24 cggcccctcg cgcttta 17
<210> 25
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 25 agctgtgtcg gcccaggact gca 23
<210> 26
<211> 21
<212> DNA
<213> Synthetic Construct
<400> 26 atgtgaccca gcggcccctc g 21
<210> 27
<211> 25
<212 > DNA
<213> Synthetic Construct
<400> 27 ctataatggt gaatatcttc aaatg 25
<210> 28
<211> 24
<212> DNA
<213> Synthetic Construct
<400> 28 agcacaaact ggtggtgcct ggag 24
<210> 29
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 29 actggtggtg gttccagcag gt 22
<210> 30
<211> 28
<212> DNA
<213> Synthetic Construct
<400> 30 atataaactt gtggtagttc cagctggt 28
<210> 31
<211> 21
<212> DNA
<213> Synthetic Construct
<400> 31 ggttctggat tagctggatt g 21
<210> 32
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 32 ggatattctc gacacagcag gc 22
<210> 33
<211> 20
<212> DNA
<213> Synthetic Construct
<400> 33 gggagacgtg cctgttggac 20
<210> 34
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 34 ttgatggcaa acacacacag ga 22
<210> 35
<211> 24
<212> DNA
<213> Synthetic Construct
<400> 35 acaagtggtt atagatggtg aaac 24
- Ii
<210> 36
<211> 21
<212> DNA
<213> Synthetic Construct
<400> 36 tgatggcaaa tacacagagg a 21
<210> 37
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 37 ggacatactg gatacagctg gc 22
<210> 38
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 38
ttggacatcc tggataccgc tgg 23
<210> 39
<211> 21
<212> DNA
<213> Synthetic Construct
<400> 39 ccctgaggag cgatgacgga a 21
<210> 40
<211> 19
<212> DNA
<213> Synthetic Construct
<400> 40 agtggggtcg tattcgtcc 19
<210> 41
<211> 22
<212> DNA
<213> Synthetic Construct
10 -
<400> 41 tcacctctat agtggggtcg ta 22
<210> 42
<.211-* 22
<212> DNA
<213> Synthetic Construct
<400> 42 gttcctgctg gtgtgaaatg ac 22
<210. 43
<211> 26
<212> DNA
<213> Synthetic Construct
<400> 43 aggtccttgc tggtgtgaaa tgactg 26
<210> 44 <211> 27 <212> DNA
$ 1 -
<213> Synthetic Construct
<400> 44 gtggttctgg attagctgga ttgtcag 27
<210> 45
<211> 25
<212> DNA
<213> Synthetic Construct
<400 45 gttggacata ctggatacag ctggc 25
<210> 46
<211> 25
<212> DNA
<213> Synthetic Construct
<400> 46 ggcaaataca cagaggaagc cttcg 25
<210> 47
<211> 27
<212 > DNA
<213 > Synthetic Construct
<400> 47 gttggacata ctggatacag ctggact 27
<210> 48
<211> 24
<212> DNA
<213> Synthetic Construct
<400> 48 aatataagct ggtggtgccg ggcg 24
<210> 49
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 49 ataagctggt ggtgcccgcc gt 22
<210> 50
<211> 28
<212> DNA
<213> Synthetic Construct
<400> 50 tgaatataaa cttgtggtac ctggagct 28
<210> 51
<211> 25
<212> DNA
<213> Synthetic Construct
<400> 51 aatataagct ggtggtgccg ggcgc 25
<210> 52
<211> 23
<212> DNA
<213> Synthetic Construct
<400> 52 aatggttctg gatcagctgg atg 23
<210> 53
<211> 24
<212> DNA
<213> Synthetic Construct
<400> 53 ataagctggt ggtggtgccc gccg 24
<210> 54
<211> 26
<212> DNA
<213> Synthetic Construct
<400> 54 tatagatggt gaaacctgtt tgttgg 26
<210> 55
<211> 24
<212.> DNA
<213> Synthetic Construct
<400> 55 ctattattga tggcaaccac acag 24
55 -
<210> 56
<211> 32
<212> DNA
<213> Synthetic Construct
<400 56 gcgagcgtgg tgttgggaaa agcgcagctc gc 32
<210> 57
<211> 35
<212> DNA
<213> Synthetic Construct
<400> 57 gcgagccgtc ggtgtgggca gagtgcgctg ctcgc 35
<210> 58
<211> 36
<212> DNA
<213> Synthetic Construct
<400> 58
gcgagcgaaa cctcagccaa gaccagacag gctcgc 36
<210> 59
<211> 46
<212> DNA
<213> Synthetic Construct
<400> 59 gcgagcgaca taacagttat gattttgcag aaaacagatc gctcgc 46
<210> 60 <211> 25
<212> DNA
<213 > Synthetic Construct
<400> 60 atataaactt gtggtacctg gagct 25
<210> 61
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 61 tatagatggt gaaacctgtt tg 22
<210> 62
<211> 29
<212> DNA
<213> Synthetic Construct
<400> 62 cttgctatta ttgatggcaa ccacacaga 29
<210> 63
<211> 22
<212> DNA
<213> Synthetic Construct
<400> 63 tatagatggt gaaacctgtt tg 22
<210> 64 <211> 21 <212> DNA
<213 > Synthetic Construct
<400> 64 ataagctggt ggtgccgggc 21
<210> 65
<211> 19
<212> DNA
<213> Synthetic Construct
<400> 65 atggttctgg atcagctgg 19
<210> 66
<211> 24
<212> DNA
<213> Synthetic Construct
<400> 66 aatataagct ggtggtgccg ggcg 24
<210> 67
<211> 26
<212 > DNA
<213> Synthetic Construct
<400> 67 aatggttctg gatcagctgg atggtc 26
Claims
We claim :
1. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO -.25, SEQ ID
NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID
NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID
NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID
NO:38, SEQ ID NO:39, SEQ ID N0:40, SEQ ID N0:41, SEQ ID
NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID
NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID
NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID
NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID
NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID
NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID
NO: 66, or SEQ ID NO: 67.
2. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO: 7, SEQ ID NO: 8, or SEQ ID NO : 9.
3. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 10, SEQ ID NO: 12, or SEQ ID NO: 13.
4. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, or SEQ ID NO: 17.
5. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21.
6. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID
NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID
NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID
NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID
NO: 45, SEQ ID NO: 46, or SEQ ID NO: 47.
7. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, or SEQ ID NO: 55.
8. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67.
9. The oligonucleotides of claim 4 further comprising one or more fluorescence moieties and one or more fluorescence quenching moieties .
10. The oligonucleotides of claim 9 wherein
(i) one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) one or more fluorescence moieties are linked co one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both, and one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus.
11. The oligonucleotides of claim 10 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4' , 5' - dichloro-2' ,7' -dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching
moiety is (4- ( ' dimethylaminophenylazo) benzoic acid) or 4 (dimethylamine) azobenzene sulfonic acid.
12. One or more oligonucleotides comprising a sequence selected from SEQ ID NO: 19, SEQ ID NO: 20, or SEQ ID NO: 21, said one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties .
13. The oligonucleotides of claim 12 wherein
(i) one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both and one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus.
14. The oligonucleotides of claim 13 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4' , 5' - dichloro-2 ' , 7 ' -dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety is (4- (4 'dimethylaminophenylazo) benzoic acid) or'
4 (dimethylamine) azobenzene sulfonic acid.
15. The oligonucleotides of claim 8 further comprising one or more fluorescence moieties and one or more fluorescence quenching moieties .
16. The oligonucleotides of claim 15
(i) one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or- linked to the 3 ' terminal nucleotide or both and one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5' terminal nucleotide or both and one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the
3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus.
17. The oligonucleotides of claim 16 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4' , 5' - dichloro-2 ' , 7 ' -dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety is (4- (4 ' dimethylaminophenylazo) benzoic acid) or 4 (dimethylamine) azobenzene sulfonic acid.
18. A method for amplifying DNA comprising a mutant ras sequence in a sample comprising the steps of: (B) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO :5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO: 43, SEQ ID NO:44h, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO : 54 , SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID
NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H-,or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(B) subjecting the admixture to one or more cycles of heating and cooling.
19. A method for determining one or more ras mutations in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID
NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) separating the DNA by electrophoresis; and
(D) detecting the DNA comprising -a mutant ras sequence separated by electrophoresis in step (C) .
20. A method for determining one or more .ras mutations in a DNA sample comprising the steps of :
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO:17> SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID' NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID
NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO : 64 , SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(ii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H-,or N-ras sequence or cleaving a primer .induced cleavage site, or both; and
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture comprising amplified DNA with one or more immobilized oligonucleotides or one or more oligonucleotides capable of being immobilized, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence thereby capturing DNA comprising a mutant ras sequence; and
(D) detecting the captured DNA comprising a mutant ras sequence .
21. The method of claim 20 wherein the sequence of one or more immobilized oligonucleotides or one or more oligonucleotides capable of being immobilized is selected from SEQ ID NO : 7 , SEQ ID NO : 8 , or SEQ ID NO : 9.
22. A method for determining one or more ras mutations in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ. ID NO:17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO.-38, SEQ ID NO.-39, SEQ ID NO.-40, SEQ ID NO.-41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO : 64 , SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, one or more thermostable polymerases, and at least one thermostable restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both, and
(iv) one or more oligonucleotides comprising one or more fluorescence moieties and one or more
fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence and capable of producing detectable fluorescence when hybridized thereto;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) detecting the fluorescence.
2.3. The method of claim 22 wherein
(i) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or the one or more fluorescence quenching moieties are linked to the 5 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5' terminal nucleotide or both, and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5 ' terminus .
24. The method of claim 23 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4 ', 5' -dichloro-2 ', 7' - dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety is (4- (4 ' dimethylaminophenylazo) benzoic acid) or
4 (dimethylamine) azobenzene sulfonic acid.
25. A method for amplifying DNA comprising a mutant ras sequence in a sample comprising the steps of:
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO : 6 , SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID N0:16, SEQ ID NO:17, SEQ ID' NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 2, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO:46, SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates and one or more thermostable polymerases;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture with one or more primer pairs selected from SEQ ID NO : 5 , SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ
ID NO: 17, SEQ ID NO 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO : 21 , SEQ ID NO: 22 SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO : 25 , SEQ ID NO: 26 SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO : 29 , SEQ ID NO: 30 SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34 SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO : 37 , SEQ ID NO: 38 SEQ ID NO:39, SEQ ID NO.-40, SEQ ID NO : 41 , SEQ ID NO: 42 SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46 SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO : 9 , SEQ ID NO: 50 SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54 SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58 SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62 SEQ ID NO: 63, SEQ ID NO : 64 , SEQ ID NO: 65, SEQ ID NO: 66 or SEQ ID NO: 67, provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling; and
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both.
26. A method for determining one or more ras mutations in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample, (ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO : 12 , SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO : 64 , SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates and one or more thermostable polymerases;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture with one or more primer pairs selected from SEQ ID NO : 5 , SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ
ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO -.35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO : 62 , SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67, provided at least one of the orimers is different .from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling; and
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H- , or N-ras sequence or cleaving a primer induced cleavage site, or both;
(F) separating the DNA by electrophoresis; and
(G) detecting the DNA comprising a mutant ras sequence separated by electrophoresis in step (F) .
27. A method for determining one or more ras mutations in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample,
(ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO : 7 , SEQ ID NO : 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID
NO: :18, SEQ ID NO: :19, SEQ ID NO 20, SEQ ID NO: :21, SEQ ID
NO: :22, SEQ ID NO: :23, SEQ ID NO 24, SEQ ID NO: :25, SEQ ID
NO: :26, SEQ ID NO: :27, SEQ ID NO 28, SEQ ID NO: :29, SEQ ID
NO: :30, SEQ ID NO: :31, SEQ ID NO 32, SEQ ID NO: :33, SEQ ID
NO: :34, SEQ ID NO: :35, SEQ ID NO 36, SEQ ID NO: :37, SEQ ID
NO: :38, SEQ ID NO: :39, SEQ ID NO 40, SEQ ID NO: :41, SEQ ID
NO: :42, SEQ ID NO: :43, SEQ ID NO 44, SEQ ID NO: :45, SEQ ID
NO: :46, SEQ ID NO: :47, SEQ ID NO 48, SEQ ID NO: :49, SEQ ID
NO: :50, SEQ ID NO: :51, SEQ ID NO 52, SEQ ID NO: :53, SEQ ID
NO: :54, SEQ ID NO: :55, SEQ ID NO 56, SEQ ID NO: :57, SEQ ID
NO: :58, SEQ ID NO: :59, SEQ ID NO 60, SEQ ID NO: :61, SEQ ID
NO: :62, SEQ ID NO: :63, SEQ ID NO 64, SEQ ID NO: :65, SEQ ID
NO: 66, or SEQ ID NO: 67,
(iii) at least four different nucleoside riphosphates and one or more thermostable polymerases;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture with one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID
NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO : 62 , SEQ ID NO : 63 , SEQ ID NO : 64 , SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67, provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling; and
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K- , H-,or N-ras sequence or cleaving a primer induced cleavage site, or both;
(F) combining the admixture comprising amplified DNA with one or more immobilized oligonucleotides or oligonucleotides capable of being immobilized, said oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence thereby capturing DNA comprising a mutant ras sequence; and
(G) detecting the captured DNA comprising a mutant ras sequence .
28. A method for determining one or more ras mutations in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample,
(ii) one or more primer pairs selected from SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO .- 8 , SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, SEQ ID SEQ ID NO: 35, SEQ ID NO: 36, SEQ ID NO: 37, SEQ ID SEQ ID NO: 39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID SEQ ID NO: 43, SEQ ID NO: 44, SEQ ID NO: 45, SEQ ID SEQ ID NO: 47, SEQ ID NO: 48, SEQ ID NO: 49, SEQ ID SEQ ID NO: 51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID SEQ ID NO: 55, SEQ ID NO: 56, SEQ ID NO: 57, SEQ ID SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID or SEQ ID NO: 67,
(iii) at least four different nucleoside triphosphates, and one or more thermostable polymerases;
(iv) one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising a mutant ras sequence and capable of producing detectable fluorescence when hybridized thereto;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) combining the admixture produced in step (B) with one or more primer pairs selected from SEQ ID NO: 5, SEQ
ID NO 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10 SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19 SEQ ID NO: 20 SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23 SEQ ID NO: 24 SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27 SEQ ID NO: 28 SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31 SEQ ID NO: 32 SEQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35 SEQ ID NO: 36 SEQ ID NO: 37, SEQ ID NO: 38, SEQ ID NO: 39 SEQ ID NO: 40 SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43 SEQ ID NO: 44 SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47 SEQ ID NO: 48 SEQ ID NO: 49, SEQ ID NO: 50, SEQ ID NO: 51 SEQ ID NO: 52 SEQ ID NO: 53, SEQ ID NO: 54, SEQ ID NO: 55 SEQ ID NO: 56 SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59 SEQ ID NO: 60 SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63 SEQ ID NO: 64 SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67 provided at least one of the primers is different from the primers in step (A) ;
(D) subjecting the admixture to one or more cycles of heating and cooling;
(E) combining the admixture with at least one restriction endonuclease that is capable of directly cleaving wild type K-, H- , or N-ras sequence or cleaving a primer induced cleavage site, or both; and
(F) detecting the fluorescence.
29 The method of claim 28 wherein
(i) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or the one or more fluorescence quenching moieties are linked to the 5 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 5' - terminal nucleotide or linked to the 5' terminal nucleotide '■• or both arid the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide ""' or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus.
30. The method of claim 28 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4 ' , 5 ' -dichloro-2 ' , 7 ' - dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety is (4- (4 ' dimethylaminophenylazo) benzoic acid) or
4 (dimethylamine) azobenzene sulfonic acid.
31. A kit comprising in one or more containers:
(i) one or more oligonucleotides comprising a sequence selected from SEQ ID NO : 5 , SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO : 8 , SEQ ID NO : 9 , SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, SEQ ID NO: 25, SEQ ID NO: 26, SEQ ID NO: 27, SEQ ID NO: 23, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SΞQ ID NO: 33, SEQ ID NO: 34, SEQ ID NO: 35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO: 40, SEQ ID NO: 41, SEQ ID NO: 42, SEQ ID NO: 43, SEQ ID NO:44, SEQ ID NO: 45, SEQ ID NO: 46, SEQ ID NO: 47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, SEQ ID NO:51, SEQ ID NO: 52, SEQ ID NO: 53, SEQ ID NO : 54 , Or SEQ ID NO: 55;
■(ii) one or more oligonucleotides selected from SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:56, SEQ ID NO: 57, SEQ ID NO: 58, SEQ ID NO: 59, SEQ ID NO: 60, SEQ ID NO: 61, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, or SEQ ID NO: 67, the oligonucleotide or oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties.
32. The kit of claim 31 wherein
(i) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or the one or more fluorescence quenching moieties are linked to the 5 ' terminal nucleotide
or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5 ' terminal nucleotide . or both and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the . 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus. . •
33. The kit of claim 32 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4 ', 5 ' -dichloro-2 ', 7' - dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety is (4- (4 ' dimethylaminophenylazo) benzoic acid) or 4 (dimethylamine) azobenzene sulfonic acid.
34. The kit of claim 33 further comprising in one or more containers
(i) one or more nucleoside triphosphates; (ii) one or more restriction endonucleases capable of directly cleaving wild type K- , H-, or N-ras sequence or a primer induced cleavage site, or both; and
(iii) one or more thermostable polymerases.
35. A method for amplifying and determining one or more target mutant sequences in a DNA sample comprising the steps of:
(A) forming an admixture comprising (i) the sample,
(ii) one or more primer pairs specific for one or more of the mutant target sequences,
(iii) at least four different nucleoside triphosphates ,
(iv) one or more thermostable polymerases ,
(v) at least one thermostable restriction endonuclease that is capable of directly •" . cleaving wild type DNA sequence of the mutant target or ■' mutant targets or cleaving a primer induced cleavage site, or both,
(vi) one or more oligonucleotides comprising one or more fluorescence moieties and one or more fluorescence quenching moieties, said one or more oligonucleotides being capable of hybridizing to DNA comprising the target mutant sequence or target mutant sequences and capable of producing detectable fluorescence when hybridized thereto;
(B) subjecting the admixture to one or more cycles of heating and cooling;
(C) detecting the fluorescence.
36. The method of claim 35 wherein
(i) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or the one or more fluorescence quenching moieties are linked to the 5 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus, or
(ii) the one or more fluorescence moieties are linked to one or more nucleotides adjacent to the 5' terminal nucleotide or linked to the 5' terminal nucleotide or both and the one or more fluorescence quenching moieties are linked to one or more nucleotides adjacent to the 3' terminal nucleotide or linked to the 3 ' terminal nucleotide or both, and wherein one or more nucleotides comprising the 3 ' terminus are complementary to one or more nucleotides comprising the 5' terminus.
37. The method of claim 36 wherein the fluorescence moiety is carboxyfluorescein, carboxy-4 ', 5' -dichloro-2 ', 1 ' - dimethoxyfluorescein, tetrachlorofluorescein, dimethoxyfluorescein, or carboxyrhodamine and the quenching moiety is (4- (4 ' dimethylaminophenylazo) benzoic acid) or 4 (dimethylamine) azobenzene sulfonic acid.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US23741600P | 2000-10-02 | 2000-10-02 | |
| US237416P | 2000-10-02 | ||
| PCT/US2001/042422 WO2002029005A2 (en) | 2000-10-02 | 2001-10-02 | Detection of ras mutations |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1412512A2 true EP1412512A2 (en) | 2004-04-28 |
| EP1412512A4 EP1412512A4 (en) | 2004-04-28 |
Family
ID=22893623
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01977871A Ceased EP1412512A4 (en) | 2000-10-02 | 2001-10-02 | Detection of ras mutations |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1412512A4 (en) |
| JP (1) | JP2004518412A (en) |
| AU (1) | AU2001296955A1 (en) |
| CA (1) | CA2424584A1 (en) |
| WO (1) | WO2002029005A2 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101381779B (en) * | 2008-10-21 | 2011-06-08 | 广州益善生物技术有限公司 | Detection probe of kRas gene mutation, liquid phase chip and detection method thereof |
| CA2741592A1 (en) * | 2008-12-19 | 2010-06-24 | Abbott Laboratories | Diagnostic test for mutations in codons 12-13 of human k-ras |
| US10266828B2 (en) | 2013-12-16 | 2019-04-23 | Syddansk Universitet | RAS exon 2 skipping for cancer treatment |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AUPN245295A0 (en) * | 1995-04-13 | 1995-05-11 | Johnson & Johnson Research Pty. Limited | Assay for genetic abnormalities |
| GB9715034D0 (en) * | 1997-07-18 | 1997-09-24 | Zeneca Ltd | Assay |
| EP2267127A1 (en) * | 1998-04-28 | 2010-12-29 | Ortho-Clinical Diagnostics, Inc. | Improved methods for extracting nucleic acids from tissue samples and paraffin-embedded tissues |
| AUPQ495700A0 (en) * | 2000-01-05 | 2000-02-03 | Johnson & Johnson Research Pty. Limited | Method for concurrent amplification and real time detection of polymorphic nucleic acid sequences |
-
2001
- 2001-10-02 AU AU2001296955A patent/AU2001296955A1/en not_active Abandoned
- 2001-10-02 WO PCT/US2001/042422 patent/WO2002029005A2/en not_active Ceased
- 2001-10-02 EP EP01977871A patent/EP1412512A4/en not_active Ceased
- 2001-10-02 JP JP2002532576A patent/JP2004518412A/en active Pending
- 2001-10-02 CA CA 2424584 patent/CA2424584A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| WO2002029005A3 (en) | 2004-02-26 |
| WO2002029005A2 (en) | 2002-04-11 |
| CA2424584A1 (en) | 2002-04-11 |
| JP2004518412A (en) | 2004-06-24 |
| EP1412512A4 (en) | 2004-04-28 |
| AU2001296955A1 (en) | 2002-04-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8679788B2 (en) | Methods for the detection of nucleic acid differences | |
| WO2008009740A1 (en) | Method for the detection of egfr mutations in blood samples | |
| JPH11504517A (en) | Nucleic acid detection and amplification by chemical bonding of oligonucleotides | |
| US6664064B1 (en) | Method for melting curve analysis of repetitive PCR products | |
| JPH10508746A (en) | Method for detecting ras oncogene, especially K-ras oncogene | |
| CN109952381A (en) | Method for Multiple detection methylate DNA | |
| KR20140010093A (en) | Kit and method for sequencing a target dna in a mixed population | |
| US20100086918A1 (en) | Methods for High Sensitivity Detection of Genetic Polymorphisms | |
| US10023904B2 (en) | Method for detection of KRAS mutations | |
| WO1999004037A1 (en) | Detection of k-ras mutations in cancer | |
| EP1544309A1 (en) | Assay for detecting methylation status by methylation specific primer extension (MSPE) | |
| US20080003609A1 (en) | Method of detecting bladder urothelial carcinoma | |
| KR101857227B1 (en) | Method for analysing cancer gene using multiple amplification nested signal amplification and kit for analysing cancer gene | |
| US20040106109A1 (en) | Detection of ras mutations | |
| JP2025118633A (en) | Highly specific target nucleic acid amplification method and composition for amplifying target nucleic acid using the same | |
| EP1207210B1 (en) | Method for melting curve analysis of repetitive PCR products | |
| CN113930501A (en) | Digital PCR detection method for human EGFR gene mutation and application | |
| CN113897429A (en) | Digital PCR detection method and application of human NRAS gene mutation | |
| EP1412512A2 (en) | Detection of ras mutations | |
| EP4317455A1 (en) | Target nucleic acid amplification method using guide probe and clamping probe and composition for amplifying target nucleic acid comprising same | |
| JP4315812B2 (en) | Molecular diagnosis and prognosis of carcinoma | |
| CN113897430A (en) | Digital PCR detection method and application of human IDH1/IDH2 gene mutation | |
| AU2007216745A1 (en) | Detection of ras mutations | |
| CN113913514B (en) | Digital PCR detection method and application of human CTNNB1 gene mutation | |
| TW202338101A (en) | Primers and probe for detecting presence of bladder cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030410 |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20040305 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| 17Q | First examination report despatched |
Effective date: 20040624 |
|
| 17Q | First examination report despatched |
Effective date: 20040624 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED |
|
| 18R | Application refused |
Effective date: 20100605 |