EP1412372A2 - Endogenous and non-endogenous versions of human g protein-coupled receptors - Google Patents
Endogenous and non-endogenous versions of human g protein-coupled receptorsInfo
- Publication number
- EP1412372A2 EP1412372A2 EP02717500A EP02717500A EP1412372A2 EP 1412372 A2 EP1412372 A2 EP 1412372A2 EP 02717500 A EP02717500 A EP 02717500A EP 02717500 A EP02717500 A EP 02717500A EP 1412372 A2 EP1412372 A2 EP 1412372A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- endogenous
- receptor
- protein
- seq
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
Definitions
- This document is related to the following applications: U.S. Provisional Number 60/250,881, filed December 1, 2000; U.S. Provisional Number 60/253,428, filed November 27, 2000; U.S. Provisional Number 60/234,317, filed September 20, 2000; U.S. Provisional Number 60/245,853, filed November 3, 2000; U.S. Provisional Number 60/234,045, filed September 20, 2000; U.S. Provisional Number 60/200,568, filed April 28, 2000; U.S. Provisional Number 60/198,518, filed April 19, 2000; U.S. Provisional Number 60/189,353, filed March 14, 2000; U.S. Provisional Number 60/166,084, filed November 17, 1999; and U.S. Provisional Number 60/106,451, filed October 30, 1998, the disclosures of each of which are incorporated herein by reference in their entirety.
- the present invention relates to transmembrane receptors, in some embodiments to G protein-coupled receptors and, in some preferred embodiments, to endogenous GPCRs that are altered to estabhsh or enhance constitutive activity of the receptor.
- the constitutively activated GPCRs will be used for the direct identification of candidate compounds as receptor agonists or inverse agonists having applicability as therapeutic agents.
- GPCR G protein-coupled receptor
- GPCRs represent an important area for the development of pharmaceutical products: from approximately 20 of the 100 known GPCRs, approximately 60% of all prescription pharmaceuticals have been developed. For example, in 1999, of the top 100 brand name prescription drugs, the following drugs interact with GPCRs (diseases and/or disorders treated are indicated in parentheses):
- Claritin® (allergies) Prozac® (depression) Vasotec® (hypertension) Paxil® (depression) Zoloft® (depression) Zyprexa ® (psychotic disorder)
- GPCRs share a common structural motif, having seven sequences of between 22 to 24 hydrophobic amino acids that form seven alpha helices, each of which spans the membrane (each span is identified by number, i.e., transmembrane- 1 (TM-1), transmebrane-2 (TM-2), etc.).
- the transmembrane helices are joined by strands of amino acids between transmembrane-2 and transmembrane-3, transmembrane-4 and transmembrane-5, and transmembrane-6 and transmembrane-7 on the exterior, or "extracellular" side, of the cell membrane (these are referred to as "extracellular" regions 1, 2 and 3 (EC-1, EC-2 and EC-3), respectively).
- transmembrane helices are also joined by strands of amino acids between transmembrane- 1 and transmembrane-2, transmembrane-3 and transmembrane-4, and transmembrane-5 and transmembrane-6 on the interior, or "intracellular” side, of the cell membrane (these are referred to as "intracellular” regions 1, 2 and 3 (IC-1, IC-2 and IC-3), respectively).
- the "carboxy" (“C”) terminus of the receptor lies in the intracellular space within the cell, and the "amino" (“N”) terminus of the receptor lies in the extracellular space outside of the cell.
- GPCRs are "promiscuous" with respect to G proteins, i.e., that a GPCR can interact with more than one G protein. See, Kenakin, T., 43 Life Sciences 1095 (1988). Although other G proteins exist, currently, G q , G s , Gj, G z and G 0 are G proteins that have been identified.
- GPCRs exist in the cell membrane in equilibrium between two different conformations: an "inactive" state and an “active” state.
- a receptor in an inactive state is unable to link to the intracellular signaling transduction pathway to initiate signal transduction leading to a biological response.
- Changing the receptor conformation to the active state allows linkage to the transduction pathway (via the G- protein) and produces a biological response.
- a receptor may be stabilized in an active state by a ligand or a compound such as a drug.
- Recent discoveries, including but not exclusively limited to modifications to the amino acid sequence of the receptor provide means other than ligands or drugs to promote and stabilize the receptor in the active state conformation. These means effectively stabilize the receptor in an active state by simulating the effect of a ligand binding to the receptor. Stabihzation by such ligand-independent means is termed "constitutive receptor activation.”
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:2, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:63, and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:62 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:4, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:65, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:64 and host cells comprising the same.
- Some embodiments of the present invention relate to G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:6, non-endogenous, constitutively activated versions of the same, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:5 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.DD.NO.:8, non-endogenous, constitutively activated versions of the same encoded by an amino acid of
- SEQ.ID.NO.:67 SEQ.ID.NO.:69
- SEQ.ID.NO.:71 SEQ.ID.NO.:73
- host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:66, SEQ.ID.NO.:68, SEQ.ID.NO.:70, and SEQ.ID.NO.:72, and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:10, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:75 and SEQ.ID.NO.:77, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:74 and SEQ.ID.NO.:76, and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:12, non-endogenous, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:79 and SEQ.ID.NO.:81, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:78 and SEQ.ID.NO.:80, and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:14, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:83, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:82 and host cells comprising the same. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:16, constitutively activated versions of the same encoded by an amino acid of SEQ.ID.NO.:85, and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:84 and host cells comprising the same.
- Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:18, constitutively activated versions of the same encoded by an amino acid of SEQ. ID .NO.: 87, and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:86 and host cells comprising the same. Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:84 and host cells comprising the same. Some embodiments of the present invention relate to a G protein-coupled receptor encoded by an amino acid sequence of SEQ.ID.NO.:98, non-endogenous, constitutively activated versions of the same and host cells comprising the same.
- Some embodiments of the present invention relate to a plasmid comprising a vector and the cDNA of SEQ.ID.NO.:97 and host cells comprising the same.
- Figure 1 is a graphic representation of the results of a second messenger cell-based cyclic AMP assay providing comparative results for constitutive signaling of endogenous, constitutively active FPRL-2 ("FPRL-2 wt"), non-endogenous, constitutively activated version of FPRL : 2 (“FPRL-2 (L240K)”) fused with a Gs/Gi Fusion Protein Construct and a control (“Gs/Gi”).
- FPRL-2 wt endogenous, constitutively active FPRL-2
- FPRL-2 (L240K) non-endogenous, constitutively activated version of FPRL : 2
- Gs/Gi Gs/Gi
- Figure 2 provides graphic results of comparative analysis of endogenous STRL33 against non-endogenous, constitutively activated STRL33 ("STRL33(L230K)”) utilizing an 8XCRE-Luc Reporter assay in 293T cells as compared with the control (“CMV").
- Figure 3 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR(A623I) ("signal enhancer") with an endogenous target receptor, in this case GPR45 (“GPR45 wt”), versus a control (“CMN”), utilizing a cell-based adenylyl cyclase assay in 293 cells.
- This assay involved the addition of TSH, the endogenous ligand for TSHR.
- Figure 4 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR(A623I) ("signal enhancer") and an endogenous target receptor, in this case mGluR7 ("mGluR7 wt"), versus non-endogenous, constitutively activated versions of the target receptor mGluR7 ("W590S,” “R659H” “T771C” and “I790K”) co-transfected with non-endogenous TSHR(A623I), utilizing a cell-based adenylyl cyclase assay in 293 cells.
- This assay involved the addition of TSH, the endogenous ligand for TSHR.
- Figure 5 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR(A623I) ("signal enhancer") and an endogenous target receptor, in this case mGluR7 ("mGluR7 wt"), versus non-endogenous, constitutively activated versions of the target receptor mGluR7 ("W590S,” “R659H” “T771C” and “I790K”) co-transfected with non-endogenous TSHR(A623I), utilizing a cell-based adenylyl cyclase assay in RGT cells.
- This assay involved the addition of TSH, the endogenous ligand for TSHR.
- Figure 6 provides an illustration of second messenger IP production of non- endogenous mGluR7, "T771C", co-transfected with non-endogenous versions of Gq protein, "Gq(del)” and “Gq(del)/Gi” compared with “Gq(del)” and “Gq(del)/Gi” in the presence and absence of glutamate.
- FIG 7 is a comparative analysis of endogenous, non-constitutively active GPR37 ("wt”) and non-endogenous, constitutively activated versions of GPR37 ("C543Y” and “L352R”) in an SRE Reporter assay, where the control is expression vector ("CMV").
- wt endogenous, non-constitutively active GPR37
- C543Y non-endogenous, constitutively activated versions of GPR37
- L352R control is expression vector
- Figure 8 is comparative analysis of a co-transfection of Gs/Gi Fusion Construct and an endogenous target receptor, in this case GPR37 ("GPR37 wt”), versus non-endogenous, constitutively activated versions of the target receptor GPR37 ("C543Y” and "L352R”) co- transfected with Gs/Gi Fusion Construct utilizing a whole cell second messenger cAMP assay.
- GPR37 wt endogenous target receptor
- Figure 9 is a representation of a Northern Analysis of GPR37 expressed in forskolin treated rat Schwann cells. Cell differentiation was maintained at 20uM of forskolin.
- Figure 10 is a representation of a Northern Analysis of GPR37 expressed in crushed rat sciatic nerve. GPR37 was highly up-regulated seven (7) days post crush.
- Figure 11 is a comparative analysis of endogenous, non-constitutively active
- HF1948 Cwt HF1948 Cwt
- I281F non-endogenous, constitutively activated version of HF1948
- pCMV expression vector
- Figure 12 is comparative analysis of a co-transfection of non-endogenous TSHR- A623I ("signal enhancer") and an endogenous target receptor, in this case HF1948 (“HF1948 wt”), versus non-endogenous, constitutively activated versions of the target receptor HF1948 ("I281F” and "E135N') co-transfected with non-endogenous TSHR- A623I, utilizing a whole cell adenylyl cyclase assay.
- This assay involved the addition of TSH, the endogenous ligand for TSHR.
- Figure 13 a reproduction of a photograph of the results for the Northern Blot of GPR66 using multiple pancreatic cell lines.
- Figure 14 provides graphic results of comparative analysis of endogenous GPR35 against non-endogenous, constitutively activated GPR35 ("GPR35(A216K)") utilizing an E2F-Luc Reporter assay in 293A cells.
- Figure 15 is a reproduction of a photograph of the results for the Northern Blot of GPR35 using multiple tissue (human) cDNA.
- Figures 16 provides graphic results of comparative analysis of a co-transfection of non-endogenous TSHR-A623I (“TSHR-A623I”) (with and without TSH) and endogenous ETBR-LP2 ("WT”), versus non-endogenous, constitutively activated ETBR-LP2
- TSHR-A623I non-endogenous TSHR-A623I
- WT endogenous ETBR-LP2
- N358K co-transfected with mutated TSHR-A623I (with and without TSH) utilizing an adenylyl cyclase assay.
- FIG 17 provides a graphic result comparative analysis of endogenous ETBR-LP2 ("WT”) and non-endogenous, constitutively activated ETBR-LP2 ("N358K”) utilizing an AP 1 reporter assay system.
- WT endogenous ETBR-LP2
- N358K non-endogenous, constitutively activated ETBR-LP2
- Figure 18 is a representation of a Northern Analysis of ETBR-LP2 expressed in forskolin treated rat Schwann cells. Cell differentiation was maintained at 20uM of forskolin.
- Figure 19 is a representation of a Northern Analysis of ETBR-LP2 expressed in crushed rat sciatic nerve. ETBR-LP2 was highly up-regulated seven (7) days post crush.
- Figures 20A and 20B provides an alignment report between the putative amino acid sequence of the human ETBR-LP2 ("hETBRLP2p") and the reported amino acid sequence of human GPR37 (“hGPR37p”).
- hETBRLP2p the putative amino acid sequence of the human ETBR-LP2
- hGPR37p the reported amino acid sequence of human GPR37
- AGONISTS shall mean materials (e.g., ligands, candidate compounds) that activate the intracellular response when they bind to the receptor, or enhance GTP binding to membranes.
- AGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.
- ANTAGONIST shall mean materials (e.g., ligands, candidate compounds) that competitively bind to the receptor at the same site as the agonists but which do not activate the intracellular response initiated by the active form of the receptor, and can thereby inhibit the intracellular responses by agonists.
- ANTAGONISTS do not diminish the baseline intracellular response in the absence of an agonist.
- ANTAGONISTS are those materials not previously known to activate the intracellular response when they bind to the receptor or to enhance GTP binding to membranes.
- CANDDDATE COMPOUND shall mean a molecule (for example, and not limitation, a chemical compound) that is amenable to a screening technique.
- the phrase "candidate compound” does not include compounds which were publicly known to be compounds selected from the group consisting of inverse agonist, agonist or antagonist to a receptor, as previously determined by an indirect identification process ("indirectly identified compound”); more preferably, not including an indirectly identified compound which has previously been determined to have therapeutic efficacy in at least one mammal; and, most preferably, not including an indirectly identified compound which has previously been determined to have therapeutic utility in humans.
- COMPOSITION means a material comprising at least one component; a "pharmaceutical composition” is an example of a composition.
- COMPOUND EFFICACY shall mean a measurement of the ability of a compound to inhibit or stimulate receptor functionality; i.e. the ability to activate/inhibit a signal transduction pathway, as opposed to receptor binding affinity. Exemplary means of detecting compound efficacy are disclosed in the Example section of this patent document.
- CODON shall mean a grouping of three nucleotides (or equivalents to nucleotides) which generally comprise a nucleoside (adenosine (A), guanosine (G), cytidine (C), uridine (U) and thymidine (T)) coupled to a phosphate group and which, when translated, encodes an amino acid.
- A adenosine
- G guanosine
- C cytidine
- U uridine
- T thymidine
- CONSTITUTIVELY ACTIVATED RECEPTOR shall mean a receptor subjected to constitutive receptor activation.
- a constitutively activated receptor can be endogenous or non-endogenous.
- CONSTITUTIVE RECEPTOR ACTIVATION shall mean stabilization of a receptor in the active state by means other than binding of the receptor with its ligand or a chemical equivalent thereof.
- CONTACT or CONTACTING shall mean bringing at least two moieties together, whether in an in vitro system or an in vivo system.
- DIRECTLY IDENTIFYING or DIRECTLY IDENTIFIED in relationship to the phrase "candidate compound”, shall mean the screening of a candidate compound against a constitutively activated receptor, preferably a constitutively activated orphan receptor, and most preferably against a constitutively activated G protein-coupled cell surface orphan receptor, and assessing the compound efficacy of such compound.
- This phrase is, under no circumstances, to be interpreted or understood to be encompassed by or to encompass the phrase "indirectly identifying" or "indirectly identified.”
- ENDOGENOUS shall mean a material that a mammal naturally produces.
- ENDOGENOUS in reference to, for example and not limitation, the term "receptor,” shall mean that which is naturally produced by a mammal (for example, and not limitation, a human) or a virus.
- the term NON-ENDOGENOUS in this context shall mean that which is not naturally produced by a mammal (for example, and not limitation, a human) or a virus.
- a receptor which is not constitutively active in its endogenous form, but when manipulated becomes constitutively active is most preferably referred to herein as a "non-endogenous, constitutively activated receptor.” Both terms can be utilized to describe both "in vivo" and “in vitro" systems.
- the endogenous or non-endogenous receptor may be in reference to an in vitro screening system.
- screening of a candidate compound by means of an in vivo system is viable.
- G PROTEIN COUPLED RECEPTOR FUSION PROTEIN and GPCR FUSION PROTEIN in the context of the invention disclosed herein, each mean a non- endogenous protein comprising an endogenous, constitutively activate GPCR or a non- endogenous, constitutively activated GPCR fused to at least one G protein, most preferably
- G protein preferably being of the same type as the G protein that naturally couples with endogenous orphan GPCR.
- endogenous orphan GPCR For example, and not limitation, in an endogenous state, if the
- G protein "G s" is the predominate G protein that couples with the GPCR, a GPCR Fusion Protein based upon the specific GPCR would be a non-endogenous protein comprising the
- HOST CELL shall mean a cell capable of having a Plasmid and/or Vector incorporated therein, i the case of a prokaryotic Host Cell, a Plasmid is typically replicated as a autonomous molecule as the Host Cell rephcates (generally, the Plasmid is thereafter isolated for introduction into a eukaryotic Host Cell); in the case of a eukaryotic Host Cell, a Plasmid is integrated into the cellular DNA of the Host Cell such that when the eukaryotic Host Cell replicates, the Plasmid replicates.
- the Host Cell is eukaryotic, more preferably, mammalian, and most preferably selected from the group consisting of 293, 293T and COS-7 cells.
- INDIRECTLY IDENTIFYING or INDERECTLY IDENTIFIED means the traditional approach to the drug discovery process involving identification of an endogenous ligand specific for an endogenous receptor, screening of candidate compounds against the receptor for determination of those which interfere and/or compete with the ligand-receptor interaction, and assessing the efficacy of the compound for affecting at least one second messenger pathway associated with the activated receptor.
- INHIBIT or INHIBITING in relationship to the term "response” shall mean that a response is decreased or prevented in the presence of a compound as opposed to in the absence of the compound.
- INVERSE AGONISTS shall mean materials (e.g., ligand, candidate compound) which bind to either the endogenous form of the receptor or to the constitutively activated form of the receptor, and which inhibit the baseline intracellular response initiated by the active form of the receptor below the normal base level of activity which is observed in the absence of agonists, or decrease GTP binding to membranes.
- the baseline intracellular response is inhibited in the presence of the inverse agonist by at least 30%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99% as compared with the baseline response in the absence of the inverse agonist.
- KNOWN RECEPTOR shall mean an endogenous receptor for which the endogenous ligand specific for that receptor has been identified.
- LIGAND shall mean a molecule specific for a naturally occurring receptor.
- MUTANT or MUTATION in reference to an endogenous receptor's nucleic acid and/or amino acid sequence shall mean a specified change or changes to such endogenous sequences such that a mutated form of an endogenous, non-constitutively activated receptor evidences constitutive activation of the receptor.
- a subsequent mutated form of a human receptor is considered to be equivalent to a first mutation of the human receptor if (a) the level of constitutive activation of the subsequent mutated form of a human receptor is substantially the same as that evidenced by the first mutation of the receptor; and (b) the percent sequence (amino acid and/or nucleic acid) homology between the subsequent mutated form of the receptor and the first mutation of the receptor is at least 80%, at least 85%, at least 90%, at least 92%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, and most preferably at least 99%.
- the percent sequence homology should be at least 98%.
- NON-ORPHAN RECEPTOR shall mean an endogenous naturally occurring molecule specific for an identified ligand wherein the binding of a ligand to a receptor activates an intracellular signaling pathway.
- ORPHAN RECEPTOR shall mean an endogenous receptor for which the ligand specific for that receptor has not been identified or is not known.
- PHARMACEUTICAL COMPOSITION shall mean a composition comprising at least one active ingredient, whereby the composition is amenable to investigation for a specified, efficacious outcome in a mammal (for example, and not limitation, a human).
- a mammal for example, and not limitation, a human.
- PLASMID shall mean the combination of a Vector and cDNA.
- a Plasmid is introduced into a Host Cell for the piuposes of repUcation and/or expression of the cDNA as a protein.
- SECOND MESSENGER shall mean an intracellular response produced as a result of receptor activation.
- a second messenger can include, for example, inositol triphosphate (IP 3 ), diacycglycerol (DAG), cyclic AMP (cAMP), and cyclic GMP (cGMP).
- Second messenger response can be measured for a determination of receptor activation.
- second messenger response can be measured for the direct identification of candidate compounds, including for example, inverse agonists, agonists, and antagonists.
- SIGNAL TO NOISE RATIO shall mean the signal generated in response to activation, amplification, or stimulation wherein the signal is above the background noise or the basal level in response to non-activation, non-amplification, or non-stimulation.
- SPACER shall mean a translated number of amino acids that are located after the last codon or last amino acid of a gene, for example a GPCR of interest, but before the start codon or beginning regions of the G protein of interest, wherein the translated number amino acids are placed in-frame with the beginnings regions of the G protein of interest.
- the number of translated amino acids can be tailored according to the needs of the skilled artisan and is generally from about one amino acid, preferably two amino acids, more preferably three amino acids, more preferably four amino acids, more preferably five amino acids, more preferably six amino acids, more preferably seven amino acids, more preferably eight amino acids, more preferably nine amino acids, more preferably ten amino acids, more preferably eleven amino acids, and even more preferably twelve amino acids.
- STIMULATE or STIMULATING in relationship to the term "response” shall mean that a response is increased in the presence of a compound as opposed to in the absence of the compound.
- SUBSTANTIALLY shall refer to a result which is within 40% of a control result, preferably within 35%, more preferably within 30%, more preferably within 25%, more preferably within 20%, more preferably within 15%, more preferably within 10%, more preferably within 5%, more preferably within 2%, and most preferably within 1% of a control result.
- a test receptor may exhibit substantially similar results to a control receptor if the transduced signal, measured using a method taught herein or similar method known to the art-skilled, if within 40% of the signal produced by a control signal.
- VECTOR in reference to cDNA shall mean a circular DNA capable of incorporating at least one cDNA and capable of incorporation into a Host Cell.
- any search for therapeutic compounds should start by screening compounds against the ligand-independent active state.
- Receptor homology is useful in terms of gaining an appreciation of a role of the receptors within the human body. As the patent document progresses, techniques for mutating these receptors to establish non-endogenous, constitutively activated versions of these receptors will be discussed.
- C. Receptor Screening Screening candidate compounds against a non-endogenous, constitutively activated version of the GPCRs disclosed herein allows for the direct identification of candidate compounds which act at the cell surface receptor, without requiring use of the receptor's endogenous ligand.
- routine, and often commercially available techniques one can determine areas within the body where the endogenous version of human GPCRs disclosed herein is expressed and/or over-expressed. The expression location of a receptor in a specific tissue provides a scientist with the ability to assign a physiological functional role of the receptor.
- inverse agonists and agonists to the non- endogenous, constitutively activated GPCR can be identified by the methodologies of this invention.
- Such inverse agonists and agonists are ideal candidates as lead compounds in drug discovery programs for treating diseases related to this receptor. Because of the ability to directly identify inverse agonists to the GPCR, thereby allowing for the development of pharmaceutical compositions, a search for diseases and disorders associated with the GPCR is relevant.
- the expression location of a receptor in a specific tissue provides a scientist with the ability to assign a physiological function to the receptor.
- tissue scans can be conducted across a broad range of healthy and diseased tissues. Such tissue scans provide a potential first step in associating a specific receptor with a disease and/or disorder. Furthermore, expression of a receptor in diseased organs can assist one in determining the magnitude of clinical relevance of the receptor. Skilled artisans, armed with the present specification, are credited with the ability to infer the function of a GPCR once the receptor is localized to a certain tissue or region.
- the DNA sequence of the GPCR can be used to make a probe/primer.
- the DNA sequence is used to make a probe for (a) dot-blot analysis against tissue-mRNA, and/or (b) RT-PCR identification of the expression of the receptor in tissue samples.
- the presence of a receptor in a tissue source, or a diseased tissue, or the presence of the receptor at elevated concentrations in diseased tissue compared to a normal tissue can be used to correlate location to function and indicate the receptor's physiological role/function and create a treatment regimen, including but not limited to, a disease associated with that function/role.
- Receptors can also be locahzed to regions of organs by this technique.
- the putative physiological function of the receptor can be deduced.
- proteins located/expressed in areas of the thalamus are associated with sensorimotor processing and arousal (.see, Goodman & Oilman's, The Pharmacological Basis of Therapeutics, 9 th Edition, page 465 (1996)).
- Proteins expressed in the hippocampus or in Schwann cells are associated with learning and memory, and myelination of peripheral nerves, respectively (see, Kandel, E. et al., Essentials of Neural Science and Behavior pages 657, 680 and 28, respectively (1995)).
- the probes and/or primers may be used to detgect and or diagnose diseases and/or disorders, including but not limited to, those diseases and disorders identified in Example 6, infra.
- Methods of generating such primers and/or probes are well known to those of skill in the art as well as methods of using primers and or probes to detect diseases and or disorders.
- G protein receptor When a G protein receptor becomes constitutively active, it binds to a G protein (e.g., G q , G s , Gj, G z , Go) and stimulates the binding of GTP to the G protein.
- the G protein then acts as a GTPase and hydrolyzes the GTP to GDP, whereby the receptor, under normal conditions, becomes deactivated.
- constitutively activated receptors continue to
- a non-hydrolyzable analog of GTP [ 35 S]GTP ⁇ S, can be used to monitor enhanced binding to membranes which express constitutively activated receptors.
- candidate compounds are identified using the "generic" G protein-coupled receptor assay (i.e., an assay to select compounds that are agonists or inverse agonists), further screening to confirm that the compounds have interacted at the receptor site is preferred.
- a compound identified by the "generic” assay may not bind to the receptor, but may instead merely "uncouple" the G protein from the intracellular domain.
- G s stimulates the enzyme adenylyl cyclase.
- Gj (and G z and Go), on the other hand, inhibits adenylyl cyclase.
- Adenylyl cyclase catalyzes the conversion of ATP to cAMP; thus, constitutively activated GPCRs that couple the G s protein are associated with increased cellular levels of cAMP.
- constitutively activated GPCRs that couple G; (or G z , Go) protein are associated with decreased cellular levels of cAMP. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3 rd Ed.) Nichols, J.G. et al eds.
- assays that detect cAMP can be utihzed to determine if a candidate compound is, e.g., an inverse agonist to the receptor (t ' .e., such a compound would decrease the levels of cAMP).
- a candidate compound e.g., an inverse agonist to the receptor (t ' .e., such a compound would decrease the levels of cAMP).
- a variety of approaches known in the art for measuring cAMP can be utilized; a most preferred approach relies upon the use of anti-cAMP antibodies in an ELISA-based format.
- Another type of assay that can be utihzed is a whole cell second messenger reporter system assay. Promoters on genes drive the expression of the proteins that a particular gene encodes.
- Cyclic AMP drives gene expression by promoting the binding of a cAMP- responsive DNA binding protein or transcription factor (CREB) that then binds to the promoter at specific sites (cAMP response elements) and drives the expression of the gene.
- Reporter systems can be constructed which have a promoter containing multiple cAMP
- response elements before the reporter gene e.g., ⁇ -galactosidase or luciferase.
- constitutively activated G s -linked receptor causes the accumulation of cAMP that then activates the gene and leads to the expression of the reporter protein.
- the reporter protein such as ⁇ -galactosidase or luciferase can then be detected using standard biochemical
- G q and G 0 are associated with activation of the enzyme phospholipase C, which in turn hydrolyzes the phospholipid PIP 2 , releasing two intracellular messengers: diacycloglycerol (DAG) and inositol 1,4,5-triphoisphate (D? 3 ).
- DAG diacycloglycerol
- D? 3 inositol 1,4,5-triphoisphate
- Increased accumulation of IP 3 is associated with activation of G q - and Go-associated receptors. See, generally, "Indirect Mechanisms of Synaptic Transmission," Chpt. 8, From Neuron To Brain (3 rd Ed.) Nichols, J.G. et al eds. Sinauer Associates, Inc. (1992).
- Assays that detect IP 3 accumulation can be utihzed to determine if a candidate compound is, e.g., an inverse agonist to a G q - or Go-associated receptor (i.e., such a compound would decrease the levels of IP 3 ).
- G q - associated receptors can also be examined using an API reporter assay wherein G q - dependent phosphohpase C causes activation of genes containing API elements; thus, activated G q -associated receptors will evidence an increase in the expression of such genes, whereby inverse agonists thereto will evidence a decrease in such expression, and agonists will evidence an increase in such expression.
- Commercially available assays for such detection are available.
- GPCR Fusion Protein The use of an endogenous, constitutively activated GPCR or a non-endogenous, constitutively activated GPCR, for use in screening of candidate compounds for the direct identification of inverse agonists, agonists provide an interesting screening challenge in that, by definition, the receptor is active even in the absence of an endogenous ligand bound thereto.
- an approach be utilized that can enhance such differentiation.
- a preferred approach is the use of a GPCR Fusion Protein.
- a non-endogenous GPCR has been constitutively activated using the assay techniques set forth above (as well as others), it is possible to determine the predominant G protein that couples with the endogenous GPCR. Coupling of the G protein to the GPCR provides a signaling pathway that can be assessed.
- screening take place using a mammalian expression system, such a system will be expected to have endogenous G protein therein.
- the non-endogenous, constitutively activated GPCR will continuously signal.
- this signal be enhanced such that in the presence of, e.g., an inverse agonist to the receptor, it is more likely that it will be able to more readily differentiate, particularly in the context of screening, between the receptor when it is contacted with the inverse agonist.
- the GPCR Fusion Protein is intended to enhance the efficacy of G protein coupling with the non-endogenous GPCR.
- the GPCR Fusion Protein is preferred for screening with either an endogenous, constitutively active GPCR or a non-endogenous, constitutively activated GPCR because such an approach increases the signal that is utilized in such screening techniques. This is important in facilitating a significant "signal to noise" ratio; such a significant ratio is preferred for the screening of candidate compounds as disclosed herein.
- GPCR Fusion Protein construct useful for expression of a GPCR Fusion Protein is within the purview of those having ordinary skill in the art.
- Commercially available expression vectors and systems offer a variety of approaches that can fit the particular needs of an investigator.
- Important criteria on the construction of such a GPCR Fusion Protein construct include but are not limited to, that the endogenous GPCR sequence and the G protein sequence both be in-frame (preferably, the sequence for the endogenous GPCR is upstream of the G protein sequence), and that the "stop" codon of the GPCR be deleted or replaced such that upon expression of the GPCR, the G protein can also be expressed.
- Other embodiments include constructs wherein the endogenous GPCR sequence and the G protein sequence are not in-frame and or the "stop" codon is not deleted or replaced.
- the GPCR can be linked directly to the G protein, or there can be spacer residues between the two (preferably, no more than about 12, although this number can be readily ascertained by one of ordinary skill in the art). Based upon convenience it is preferred to use a spacer.
- the G protein that couples to the non-endogenous GPCR will have been identified prior to the creation of the GPCR Fusion Protein construct. Because there are only a few G proteins that have been identified, it is preferred that a construct comprising the sequence of the G protein (i.e., a universal G protein construct (see Examples)) be available for insertion of an endogenous GPCR sequence therein; this provides for further efficiency in the context of large-scale screening of a variety of different endogenous GPCRs having different sequences.
- constitutively activated GPCRs that couple to Gi, G z and G 0 are expected to inhibit the formation of cAMP making assays based upon these types of GPCRs challenging (i.e., the cAMP signal decreases upon activation thus making the direct identification of, e.g., inverse agonists (which would further decrease this signal), challenging.
- the cAMP signal decreases upon activation thus making the direct identification of, e.g., inverse agonists (which would further decrease this signal), challenging.
- inverse agonists which would further decrease this signal
- an endogenous Gi coupled receptor can be fused to a G s protein -such a fusion construct, upon expression, "drives” or “forces” the endogenous GPCR to couple with, e.g., G s rather than the "natural" G; protein, such that a cyclase-based assay can be established.
- Gj, G z and G 0 coupled receptors in some embodiments it is preferred that when a GPCR Fusion Protein is used and the assay is based upon detection of adenylyl cyclase activity, that the fusion construct be established with G s (or an equivalent G protein that stimulates the formation of the enzyme adenylyl cyclase).
- G Protein Fusion construct that utilizes a G q Protein fused with a G s , Gj, G z or G 0 Protein.
- a preferred fusion construct can be accomplished with a G Protein wherein the first six (6) amino acids of the G-protein ⁇ -
- G ⁇ q subunit
- a fusion construct can have a G q (6 amino acid deletion) fused with a G; Protein, resulting in a "G q /Gi Fusion Construct".
- This fusion construct will forces the endogenous Gj coupled receptor to couple to its non-endogenous G protein, G q , such that the second messenger, for example, inositol triphosphate or diacylgycerol, can be measured in lieu of cAMP production.
- a Gi coupled receptor is known to inhibit adenylyl cyclase, and, therefore, decreases the level of cAMP production, which can make assessment of cAMP levels challenging.
- An effective technique in measuring the decrease in production of cAMP as an indication of constitutive activation of a receptor that predominantly couples Gi upon activation can be accomplished by co-transfecting a signal enhancer, e.g., a non-endogenous, constitutively activated receptor that predominantly couples with G s upon activation (e.g., TSHR-A623I, disclosed below), with the G; linked GPCR.
- a signal enhancer e.g., a non-endogenous, constitutively activated receptor that predominantly couples with G s upon activation (e.g., TSHR-A623I, disclosed below
- constitutive activation of a G s coupled receptor can be determined based upon an increase in production of cAMP.
- cAMP By then co-transfecting the signal enhancer with a constitutively activated version of the target receptor, cAMP would be expected to further decrease (relative to base line) due to the increased functional activity of the Gi target (i.e., which decreases cAMP).
- Candidate compounds selected for further development can be formulated into pharmaceutical compositions using techniques well known to those in the art. Suitable pharmaceutically-acceptable carriers are available to those in the art; for example, see
- non-endogenous versions of the GPCRs disclosed herein may be for the direct identification of candidate compounds as inverse agonists or agonists (preferably for use as pharmaceutical agents), other uses of these versions of GPCRs exist.
- in vitro and in vivo systems incorporating GPCRs can be utilized to further elucidate and understand the roles these receptors play in the human condition, both normal and diseased, as well as understanding the role of constitutive activation as it applies to understanding the signaling cascade.
- the endogenous receptors be "orphan receptors", i.e., the endogenous ligand for the receptor has not been identified.
- the modified, non-endogenous GPCRs can be used to understand the role of endogenous receptors in the human body before the endogenous ligand therefore is identified.
- Such receptors can also be used to further elucidate known receptors and the pathways through which they transduce a signal.
- Other uses of the disclosed receptors will become apparent to those in the art based upon, inter alia, a review of this patent document.
- the mutational approach disclosed herein does not rely upon this approach but is instead based upon an algorithmic approach and a positional distance from a conserved proline residue located within the TM6 region of human GPCRs. Once this approach is secured, those in the art are credited with the ability to make minor modifications thereto to achieve substantially the same results (i.e., constitutive activation) disclosed herein. Such modified approaches are considered within the purview of this disclosure.
- Table B lists the receptors disclosed throughout this patent applications, the open reading frame, the nucleic acid and the amino acid sequences for the endogenous GPCR (Table B).
- FPRL-2 was cloned and sequenced in 1992. Bao, L. et al., 13(2) Genomics 437-40 (1992). FPRL-2 has been reported to be located on chromosome 19 having a sequence similarity to N-formy peptide receptor like-1 (FPRL-1) both of which share significant similarity with the N-formyl peptide receptor (FPR).
- the endogenous ligand for FPR is formyl peptide, however, the two homologues of FPR, FPRL-1 and FPRL-2, do not bind to the same ligand but are likely chemotactic receptors. 13(2) Genomics 437-40 (1992). Chemotactic receptors are reported to be involved in inflammation.
- FPRL-2 is a GPCR having an open reading frame of 1062 bp encoding a 353 amino acid protein. PCR was performed using genomic cDNA as template and rTth polymerase
- the 5' PCR contained an EcoRI
- the PCR fragment was digested with EcoRI and Apal and cloned into an EcoRI-
- PCR was performed using genomic cDNA as template and rTth polymerase
- the cycle condition was 30 cycles of 94°C for 1 min, 62°C for 1 min 20 sec and 72°C for 2 min.
- the 5' PCR contained an EcoRI
- PCR fragment was digested with EcoRI and BamHI and cloned into an EcoRI-BamHI site of CMN expression vector.
- Nucleic acid SEQ.ID.NO.:3
- amino acid SEQ.ID.NO.:4
- PCR was performed using genomic cDNA as template and rTth polymerase
- the cycle condition was as follows with o cylces 2 through four repeated 35 times: 96°C for 2 min, 96°C for 30 sec, 55 C for 20
- the 5' PCR contained a Hindlll site
- the cycle condition was 30 cycles of 94°C for 1 min, 60 C for 2min and 72°C
- Glutamate is an excitatory neurotransmitter which is abundantly found in the mammalian brain. See, Dingledine, R. et al., 130(4S Suppl) J Nutr. 1039S (2000).
- glutamate receptor There are two classes of glutamate receptor, the ionotropic (ligand-gated ion channels) and the metabotropic (GPCRs).
- Metabotropic glutamate receptors are a heterogenous family of GPCRs that are linked to several second messenger pathways to regulate neuronal excitability and synaptic transmission. (See, Phillips, T. et al., 57(1) Brain Res Mol Brain Res 132 (1998)).
- Metabotropic glutamate receptor type 7 has been reported to be expressed in the brain, with highest levels of expression found in the hippocampus, cerebral cortex and cerebellum. See, Makoff, A. et al, 40(1) Brain Res Mol Brain Res 165 (1996). Based on the areas of the brain in which the receptor is locahzed, the putative functional role of the receptor can be deduced. For example, and while not wishing to be bound by any particular theory, mGluR7 is thought to play a role in depression, anxiety, obesity, Alzheimer's Disease, pain and stroke. mGluR7 cDNA was generously supphed by Elizabeth Hoffman, Ph.D.
- the vector utilized for mGluR7 was pRcCMV (the coding region for mGluRJ was subcloned into pCMV vector at an EcoRI-Clal site). See, SEQ.ID.NO.:7 for nucleic acid sequence and SEQ.ID.NO.:8 for the deduced amino acid sequence of mGluR7. e. GPR37 (Seq. Id. Nos. 9 & 10)
- the present invention also relates to the human GPR37.
- GPR37 was cloned and sequenced in 1997. Marazziti, D. et al., 45 (1) Genomics 68-11 (1997).
- GPR37 is an orphan GPCR having an open reading frame of 1839 bp encoding a 613 amino acid protein.
- GPR37 has been reported to share homology with the endothelin type B-like receptor and expressed in the human brain tissues, particularly in corpus callosum, medulla, putamen, and caudate nucleus.
- PCR was performed using brain cDNA as template and rTth polymerase (Perkin
- the cycle condition was 30 cycles of 94°C for 1 min,
- the 5' PCR contained a Hindlll site with the
- HF1948 cDNA was generously supplied by Elizabeth Hoffman, Ph.D.
- the vector utilized for HF1948 was pRcCMV (the coding region for HF1948 was subcloned into pCMN vector at an HindlH-BamHI site). See, SEQ.ID.NO.:ll for nucleic acid sequence and SEQ.ID.NO.:12 for the deduced amino acid sequence of HF1948. g. GPR66 (Seq. Id. Nos. 13 & 14)
- the cDNA for human GPR66 (GenBank Accession Numbers AF044600 and AF044601) was generated and cloned into pCMV expression vector as follows: PCR was performed using genomic DNA as template and TaqPlus Precision polymerase (Stratagene) for first round PCR or pfu polymerase (Stratagene) for second round PCR with the buffer
- the cycle condition was 30 cycles of: 94°C for 1 min; 65 °C for
- the 5' fragment PCR primers were: 5'-ACCATGGCTTGCAATGGCAGTGCGGCCAGGGGGCACT-3' (external sense) (SEQ.ID.NO.:29) and 5'-CGACCAGGACAAACAGCATCTTGGTCACTTGTCTCCGGC-3'(intemal antisense) (SEQ.ID.NO.:30).
- the 3' fragment PCR primers were:
- the 5' and 3' fragments were ligated together by using the first round PCR as template and the kinased external sense primer and external antisense primer to perform second round PCR.
- the 1.2 kb PCR fragment was digested with EcoRI and cloned into the blunt-EcoRI site of pCMV expression vector.
- Nucleic acid (SEQ.ID.NO.:13) and amino acid (SEQ.lD.NO.:14) sequences for human GPR66 were thereafter determined and verified.
- GPR35 (Seq. Id. Nos. l5 & 16)
- GPR35 is a 309 amino acid sequence whereby the endogenous ligand for GPR35 is unknown (O'Dowd B. et al., 47(2) Genomics 310 (1998)). GPR35 was determined to interact with a specific transcription factor, known as E2F, which is necessary for initiating DNA replication and, ultimately, cell proliferation.
- E2F a specific transcription factor
- E2F couples to a tumor suppressor gene, known as retino-blastoma ("Rb").
- Rb retino-blastoma
- E2F is liberated from the Rb gene and then enters the nucleus of the cell. Inside the nucleus, E2F binds to genes, such as DNA polymerase, to initiate DNA replication, which results in proliferation of the cell.
- PCR was performed using genomic DNA as template and rTth polymerase (Perkin
- the cycle condition was 30 cycles of 94°C for 1 min, 62°C for lrnin and 72 °C for 1 min and 20 sec.
- the 5' PCR primer was kinased with the following sequence:
- ETBR-LP2 was cloned and sequenced in 1998. Valdenaire O. et al., 424(3) EEES Eett. 193 (1998); see Figure 1 of Valdenaire for deduced nucleic and amino acid sequences. ⁇ TBR-LP2 has an open reading frame of 1839 bp encoding a 613 amino acid protein. ETBR-LP2 has been reported to share homology with the endothelin type B receptor (ETBR-LP). Further, ETBR-LP2 evidences about a 47% amino acid sequence homology with human GPR37.
- ETBR-LP2 endothelin type B receptor
- ETBR-LP2 has been reported to be expressed in the human central nervous system (e.g., cerebral cortex, internal capsule fibers and Bergmann gha (424 EEES Lett at 196). PCR was performed using brain cDNA as template and rTth polymerase (Perkin
- the cycle condition was 30 cycles of 94°C for 1 min, 65°C for lrnin and 72 °C for 1.5 min.
- the 5' PCR contained an EcoRI site with the sequence: 5'-CTGGAATTCTCCTGCTCATCCAGCCATGCGG -3' (SEQ.ID.NO.:35) and the 3 ' primer contained a BamHI site with the sequence:
- the resulting 1.5 kb PCR fragment was digested with EcoRI and BamHI and cloned into EcoRI-BamHJ site of pCMV expression vector.
- Nucleic acid (SEQ.ID.NO.:17) and amino acid (SEQ.ID.NO.:18) sequences for human ETBR-LP2 were thereafter determined and verified.
- GPR26 (Seq. Id. Nos.97 & 98) EST clone HIBB055, a 3' 400bp PCR fragment used to screen the Human Genomic lambda Dash ⁇ Library (Stratagene catalog special order). The screening conditions were
- filters were hybridize overnight at 55°C in a formamide based hybridization solution.
- the washing conditions were 2X SSC/1%SDS twice at 65° and .2X SSC/.1%SDS
- the 250bp probe was generated by PCR with Taqplus Precision PCR system (Stratagene #600210) with manufacturer supplied buffer system. The cycling parameters were as follows: 30 cycles with 95°C for 45sec, 55°C for 40sec, 72°C for lrnin and final extension for 10 min.
- the primers utilized were as follows: 5'-CGAGAAGGTGCTCAAGGTGGC-3' (SEQ.ID.NO.: 99) and 5'-GAGAAGAGCTCCACTAGCCTGGTGATCACA-3' (SEQ. E>.NO.:100).
- the Human Fetal Brain cDNA library was probed with the same 250bp PCR fragment under the same conditions as the genomic library except the hybridization temp
- the human GPR26 full length clone was then generated by PCR using PfuTurbo DNA Polymerase ( Stratagene #600250) with the following parameters:
- the template used was Human Fetal Brain cDNA (Clonetech# 7402-1) and the primers were as follows: 5'-GAATTCATGAACTCGTGGGACGCGGGCCTGGCGGGC-3' (SEQ.ID.NO.:101) and
- the fragment generated had a 5' EcoRI linker and a 3' Xhol linker.
- the PCR product was digested using the given linker enzymes and subcloned into the expression vector ⁇ cDNA3.1(+) (fr ⁇ vitrogen#V790-20) at the EcoRl/Xhol sites using the Rapid
- the two mutagenesis primers were utihzed, a lysine mutagenesis oligonucleotide and a selection marker oligonucleotide, which had the following sequences: 5'- GCCACCCGCAAGGCTAAACGCATGGTCTGG -3' (SEQ.ID.NO.:60 sense) and 5'- CTCCTTCGGTCCTCCTATCGTTGTCAGAAGT -3' (SEQ.ID.NO.:61; antisense), respectively.
- SEQ.ID.NO.:33 and SEQ.ID.NO.:61 were used to generate the 5' 700 bp fragment, while SEQ.ID.NO.:34 and SEQ.ID.NO. :60 were used to generate the 3' 350 bp fragment.
- PCR was performed using endogenous GPR35 cDNA as template and pfu polymerase (Stratagene) with the buffer system provided by the manufacturer supplemented with 10% DMSO, 0.25 ⁇ M of each primer, and 0.5 mM of each 4 nucleotides.
- the cycle condition was 25 cycles of 94°C for 30 sec, 65°C for lrnin and 72 °C for 2 min and 20 sec.
- the 5' and 3 ' PCR fragment from first round PCR were then used as cotemplate to perform second round PCR using oligo 1 and 2 as primers and pfu polymerase as described above except the annealing temperature was 55 °C, and the extention time was 2 min.
- the resulting PCR fragment was then digested and subcloned into pCMV as described for the endogenous cDNA.
- mammalian cells Although a variety of cells are available to the art-skilled for the expression of proteins, it is preferred that mammalian cells be utilized. The primary reason for this is predicated upon practicalities, t.e., utilization of, e.g., yeast cells for the expression of a
- tube A was prepared by mixing 4 ⁇ g DNA (e.g., pCMV vector; pCMV vector with receptor cDNA, etc.) in 0.5 ml serum free DMEM (Gibco BRL); tube B was prepared by mixing
- hpofectamine (Gibco BRL) in 0.5ml serum free DMEM. Tubes A and B were admixed by inversion (several times), followed by incubation at room temperature for 30- 45min. The admixture is referred to as the "transfection mixture”. Plated 293 cells were washed with 1XPBS, followed by addition of 5 ml serum free DMEM. One ml of the
- transfection mixture were added to the cells, followed by incubation for 4hrs at 37°C/5% CO 2 .
- the transfection mixture was removed by aspiration, followed by the addition of 10ml of DMEM/10% Fetal Bovine Serum. Cells were incubated at 37°C/5% CO 2 . After 48hr incubation, cells were harvested and utihzed for analysis.
- Stable 293 Cell Lines Approximately 12xl0 6 293 cells will be plated on a 15cm tissue culture plate, and grown in DME High Glucose Medium containing 10% fetal bovine serum and one percent sodium pyruvate, L-glutamine, and antibiotics.
- the cells will be transfected using 12 ⁇ g of DNA.
- the 12 ⁇ g of DNA is combined with 60 ⁇ l of hpofectamine and 2mL of DME High Glucose Medium without serum.
- the medium will be aspirated from the plates and the cells washed once with medium without serum.
- the DNA, Hpofectamine, and medium mixture will be added to the plate along with lOmL of medium without serum.
- the medium will be aspirated and 25ml of medium containing serum will be added.
- Twenty-four hours following transfection the medium will be aspirated again, and fresh medium with serum will be added.
- the medium will be aspirated and medium with serum will be added containing geneticin (G418 drug) at a final concentration of 500 ⁇ g/mL.
- the transfected cells will then undergo selection for positively transfected cells containing the G418 resistant gene.
- the medium will be replaced every four to five days as selection occurs.
- cells will be grown to create stable pools, or split for stable clonal selection.
- RGT cells were derived from an adenovirus transformed Syrian hamster cell line (AN 12-664) into which a glutamate-aspartate transporter was stably transfected.
- a G protein-coupled receptor When a G protein-coupled receptor is in its active state, either as a result of ligand binding or constitutive activation, the receptor couples to a G protein and stimulates the release of GDP and subsequent binding of GTP to the G protein.
- the alpha subunit of the G protein-receptor complex acts as a GTPase and slowly hydrolyzes the GTP to GDP, at which point the receptor normally is deactivated. Constitutively activated receptors continue to exchange GDP for GTP.
- the non-hydrolyzable GTP analog, [ 35 S]GTP ⁇ S can
- the assay can,
- the assay is generic and has application to drug discovery at all G protein-coupled receptors.
- the [ 35 S]GTP ⁇ S assay is incubated in 20 mM HEPES and between 1 and about
- a Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) designed for cell-based assays can be modified for use with crude plasma membranes.
- the Flash Plate wells can contain a scintillant coating which also contains a specific antibody recognizing cAMP.
- the cAMP generated in the wells can be quantitated by a direct competition for binding of radioactive cAMP tracer to the cAMP antibody. The following serves as a brief protocol for the measurement of changes in cAMP levels in whole cells that express the receptors.
- Transfected cells were harvested approximately twenty four hours after transient transfection. Media was carefully aspirated and discarded. Ten ml of PBS was gently added to each dish of cells followed by careful aspiration. One ml of Sigma cell dissociation buffer and 3ml of PBS was added to each plate. Cells were pipetted off the plate and the cell suspension collected into a 50ml conical centrifuge tube. Cells were centrifuged at room temperature at 1,100 rpm for 5 min. The cell pellet was carefully re- suspended into an appropriate volume of PBS (about 3ml/plate). The cells were then counted using a hemocytometer and additional PBS was added to give the appropriate number of cells (to a final volume of about 50 ⁇ l/well).
- cAMP standards and Detection Buffer comprising 1 ⁇ Ci of tracer [ 1 5 I cAMP (50 ⁇ l] to 11 ml Detection Buffer) was prepared and maintained in accordance with the manufacturer's instructions.
- Assay Buffer was prepared fresh for screening and contained 50 ⁇ l of Stimulation Buffer, 3 ⁇ l of test compound (12 ⁇ M final assay concentration) and 50 ⁇ l cells, Assay Buffer was be stored on ice until utilized. The assay was initiated by addition of 50 ⁇ l of cAMP standards to appropriate wells followed by addition of 50 ⁇ l of PBSA to wells H-ll and H12. Fifty ⁇ l of Stimulation Buffer was added to all wells.
- DMSO (or selected candidate compounds) was added to appropriate wells using a pin tool capable of dispensing 3 ⁇ l of compound solution, with a final assay concentration of 12 ⁇ M test compound and lOO ⁇ l total assay volume.
- the cells were then added to the wells and incubated for 60 min at room temperature.
- One hundred ⁇ l of Detection Mix containing tracer cAMP was then added to the wells. Plates were incubated for an additional 2 hours followed by counting in a Wallac MicroBetaTM scintillation counter. Values of cAMP/well were then extrapolated from a standard cAMP curve which were contained within each assay plate.
- the transfection mixture (from Example 3A) containing FPRL-2 and Gs/Gi
- Fusion Protein Construct was removed by aspiration, followed by the addition of 10ml of
- DMEM/10% Fetal Bovine Serum were then incubated at 37°C/5% CO 2 . After 48hr incubation, cells were harvested and utilized for analysis. Cell-based cAMP detection assay was then performed according to the protocol in Example 4(2) above.
- a decrease in cAMP production signifies that the disclosed non- endogenous version of FPRL-2 is constitutively active.
- a candidate compound which impacts the FPRL-2 receptor by increasing the cAMP signal is an inverse agonist, while a FPRL-2 agonist will decrease the cAMP signal. See, Figure 1.
- Figure 1 evidence about a 4 fold increase in activity of FPRL-2 when compared to the Gs/Gi.
- the non-endogenous FPRL-2 (“FPRL-2(L240K)")) evidence about a 3 fold increase in receptor activity when compared to the control, Gs/Gi. Therefore, this data suggests that both the endogenous and non-endogenous versions of FPRL-2 are constitutively active.
- TSHR is a G s coupled GPCR that causes the accumulation of cAMP upon activation.
- TSHR will be constitutively activated by mutating amino acid residue 623 (i.e., changing an alanine residue to an isoleucine residue).
- a Gj coupled receptor is expected to inhibit adenylyl cyclase, and, therefore, decrease the level of cAMP production, which can make assessment of cAMP levels challenging.
- An effective technique for measuring the decrease in production of cAMP as an indication of constitutive activation of a Gj coupled receptor can be accomphshed by co-transfecting, most preferably, non-endogenous, constitutively activated TSHR (TSHR-A623I) (or an endogenous, constitutively active G s coupled receptor) as a "signal enhancer" with a Gi linked target GPCR to estabhsh a baseline level of cAMP.
- TSHR-A623I non-endogenous, constitutively activated TSHR
- G TSHR-A623I an endogenous, constitutively active G s coupled receptor
- this non-endogenous version of the target GPCR is then co-transfected with the signal enhancer, and it is this material that can be used for screening.
- This approach will be utilized to effectively generate a signal when a cAMP assay is used; this approach is preferably used in the direct identification of candidate compounds against G; coupled receptors. It is noted that for a Gj coupled GPCR, when this approach is used, an inverse agonist of the target GPCR will increase the cAMP signal and an agonist will decrease the cAMP signal.
- Example 3A Cells were transfected according to Example 3A above. The transfected cells were then transfected cells will be harvested approximately twenty four hours after transient transfection. Cell-based cAMP detection assay was then performed according to the protocol in Example 4(2) above.
- the directly identified candidate compound is preferably screened against the signal enhancer in the absence of the target receptor.
- Figure 3 is a comparative analysis of endogenous GPR45 ("GPR45 wt") versus a control ("CMV”) in 293 cells.
- Endogenous target receptor GPR45 was co-transfected with a signal enhancer, TSHR(A623I).
- TSHR(A623I) a signal enhancer for TSH receptor
- co-transfection of TSHR(A623I) with endogenous GPR45 evidence about a 96% decrease in production of cAMP when compared with the control (CMV).
- CMV control
- Table E summarizes the cAMP production of the vector containing the signal enhancer receptor (Le., TSHR(A623I)) with the target receptor (mGluR7) in the absence of its endogenous ligand (i.e., TSH); the cAMP production of the co-transfection of the signal enhancer with the target receptor in the presence of TSH percent (%) decrease, in cAMP production, between the endogenous version of mGluR7 and the non-endogenous versions of mGluR7, co-transfected with TSHR(A623I) in the presence of TSH.
- TSH endogenous ligand
- a candidate compound which impacts the mGluR7 receptor by increasing the cAMP signal is an inverse agonist, while a mGluR7 agonist will decrease the cAMP signal.
- "W590S,” “R659H,” “T771C” and “I790K” are preferred non-endogenous versions of mGluR7, most preferably is "W590S” when used in a TSHR constitutively activated co-transfection approach using a cAMP assay in both 293 and RGT cells.
- Figure 16 evidences about a 36% decrease in cAMP production of cells co-transfected with TSHR-A623I (“TSHR-A623I”) (in the presence of TSH) and non-endogenous, constitutively activated ETBR-LP2 ("N358K”) (65.96 pmole cAMP/well) compared to TSHR-A623I with endogenous ETBR-LP2 ("WT”) (102.59 pmol cAMP/well).
- TSHR-A623I TSHR-A623I
- N358K non-endogenous, constitutively activated ETBR-LP2
- WT endogenous ETBR-LP2
- this approach is used for screening an inverse agonist, which would increase the signal, whereas an agonist should decrease the signal.
- the small molecule is preferably screened against the construct in the absence of ETBR-LP2.
- CRE-LUC Reporter Assay (G s -associated receptors) 293 and 293T cells were plated-out on 96 well plates at a density of 2 x 10 4 cells per well and were transfected using Lipofectamine Reagent (BRL) the following day according to manufacturer instructions. A DNA/lipid mixture was prepared for each 6-
- vector SRIF- ⁇ -gal was obtained by cloning the rat somatostatin promoter (-
- cAMP response element were obtained by PCR from an adenovirus template AdpCF126CCRE8 (see, 1 Human Gene Therapy 1883 (1996)) and cloned into the SRIF-
- 8xCRE-Luc reporter plasmid was generated by replacing the beta-galactosidase gene in
- the D ⁇ A/lipid mixture was diluted with 400 ⁇ l of DMEM and lOO ⁇ l of the
- transfected cells were changed with 200 ⁇ l/well of DMEM with 10% FCS. Eight
- Luciferase activity was measured the next day using the LucLiteTM
- Figure 2 evidences about a 50% decrease in activity of STRL33 when compared to the control (CMV) at 12.5ng of STRL33 receptor.
- CMV control
- Figure 2 evidences about a 50% decrease in activity of STRL33 when compared to the control (CMV) at 12.5ng of STRL33 receptor.
- the non-endogenous STRL33 (“STRL33(L230K)")) evidence about a 30% decrease in receptor activity when comparing at 12.5ng of protein, and about a 40% decrease in activity at 25 ng of protein.
- This data suggests that non-endogenous version of STRL33 receptor is constitutively active and may couple to the G protein, Gi. b. API reporter assay (G q -associated receptors)
- a method to detect G q stimulation depends on the known property of G q - dependent phospholipase C to cause the activation of genes containing API elements in their promoter.
- a PathdetectTM AP-1 cis-Reporting System (Stratagene, Catalogue #
- Figure 17 represents a 61.1% increase in activity of the non-endogenous, constitutively active version of human ETBR-LP2 (" ⁇ 358K”)
- G q stimulation depends on the known property of G q - dependent phospholipase C to cause the activation of genes containing serum response factors in their promoter.
- a PathdetectTM SRF-Luc-Reporting System (Stratagene) can be utilized to assay for G q coupled activity in, e.g., COS7 cells. Cells are transfected with the plasmid components of the system and the indicated expression plasmid encoding endogenous or non-endogenous GPCR using a Mammalian TransfectionTM Kit (Stratagene, Catalogue #200285) according to the manufacturer's instructions.
- 410 ng SRF-Luc, 80 ng pCMN-receptor expression plasmid and 20 ng CMN-SEAP secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
- a calcium phosphate precipitate as per the manufacturer's instructions.
- Half of the precipitate is equally distributed between 3 wells in a 96-well plate, kept on the cells in a serum free media for 24 hours. The last 5
- a SRE-Luc Reporter (a component of Mercury Luciferase System 3, Clontech Catalogue # K2053-1) was utilized in 293 cells. Cells were transfected with the plasmid components of this system and the indicated expression plasmid encoding endogenous or non-endogenous receptor using Lipofectamine Reagent (Gibco/BRL, Catalogue #18324- 012) according to the manufacturer's instructions.
- CMN secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
- CMN-SEAP secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples
- the final volume was 25 ⁇ l brought up with Optimem (Vendor). This is referred to as the "template mix.”
- the template mix was combined with the lipfectamine in a polystrene tube and was incubated for 30 minutes. During the incubation, the cells were washed
- Cells were transfected with the plasmid components of this system and the indicated expression plasmid encoding endogenous or non-endogenous receptor using Lipofectamine Reagent (Gibco/BRL, Catalogue #18324-012) according to the manufacturer's instructions. Briefly, 400 ng ⁇ E2F-Luc, 80 ng CMV (comprising the GPR35 receptor) and 20 ng CMV-SEAP (secreted alkaline phosphatase expression plasmid; alkaline phosphatase activity is measured in the media of transfected cells to control for variations in transfection efficiency between samples) were combined in a cationic lipid-DNA precipitate as per the manufacturer's instructions.
- Lipofectamine Reagent Gibco/BRL, Catalogue #18324-012
- Figure 14 represents about a 100% increase in activity of the non-endogenous, constitutively active version of human GPR35 (A216K) (607.13 relative light units) compared with that of the endogenous GPR35 (24.97 relative light units).
- GPR35(A216K) interacts with the transcription factor E2F to drive the expression of the luciferase protein.
- E2F transcription factor
- GPR35 may play a role in cancer cell proliferation.
- a preferred candidate compound which impacts the GPR35 receptor would be an inverse agonist.
- the transfection media was removed and replaced with lml/well of regular growth media.
- the cells are labeled with H-myo-inositol. Briefly, the media was removed and the cells are washed with 0.5 ml PBS. Then 0.5 ml inositol-free/serum free media (GIBCO BRL) were added/well with 0.25 ⁇ Ci of 3 H-myo-inositol/ well and the cells incubated for
- fresh/ice cold stop solution (IM KOH; 18 mM Na-borate; 3.8 mM EDTA) is added to each well.
- the solution was kept on ice for 5-10 min (or until cells are lysed) and then neutralized by 200 ⁇ l of fresh/ice cold neutralization solution (7.5 % HCL).
- the lysate was then transfened into 1.5 ml Eppendorf tubes and 1 ml of chloroform/methanol (1:2) was added/tube.
- the solution was vortexed for 15 sec and the upper phase was applied to a Biorad AG1-X8TM anion exchange resin (100-200 mesh). First, the resin was washed with water at 1:1.25 W/V and 0.9 ml of upper phase was loaded onto the column.
- the column was then washed with 10 ml of 5 mM myo-inositol and 10 ml of 5 mM Na-borate/60mM Na-formate.
- the inositol tris phosphates were eluted into scintillation vials containing 10 ml of scintillation cocktail with 2 ml of 0.1 M formic acid/ 1 M ammonium formate.
- the columns were regenerated by washing with 10 ml of 0.1 M formic acid/3M ammonium formate and rinsed twice with dd H 2 O and stored at 4°C in water.
- GPCR G, Fusion Construct
- the design of the constitutively activated GPCR-G protein fusion construct can be
- both the 5' and 3' ends of the rat G protein G s (long form; Itoh, H. et al., 83 PNAS 3776 (1986)) is engineered to include a Hindm (5'-AAGCTT-3') sequence thereon. Following confirmation of the corcect sequence (including the flanking Hindlll sequences), the entire sequence is shuttled into pcDNA3.1(-) ( rvitrogen, cat. no. N795-20) by subcloning using the HindHI restriction site of that vector. The correct orientation for the G s sequence will be determined after subcloning into pcD ⁇ A3.1(-).
- the pcDNA3.1(-) vector contains a variety of well-known restriction sites upstream of the HindHI site, thus beneficially providing the ability to insert, upstream of the G s protein, the coding sequence of an endogenous, constitutively active GPCR.
- This same approach can be utilized to create other "universal" G protein vectors, and, of course, other commercially available or proprietary vectors known to the artisan can be utilized.
- the important criteria is that the sequence for the GPCR be upstream and in-frame with that of the G protein.
- Spacers in the restriction sites between the G protein and the GPCR are optional.
- the sense and anti-sense primers included the restriction sites for Xbal and EcoRN, respectively, such that spacers (attributed to the restriction sites) exist between the G protein and the GPCR.
- PCR will then be utilized to secure the respective receptor sequences for fusion within the G s universal vector disclosed above, using the following protocol for each: lOOng cD ⁇ A for GPCR will be added to separate tubes containing 2 ⁇ l of each primer (sense and anti-sense), 3 ⁇ l of lOmM dNTPs, lO ⁇ l of lOXTaqPlusTM Precision buffer, l ⁇ l of
- PCR products will be run on a 1% agarose gel and then purified.
- the purified products will be digested with Xbal and EcoRV and the desired inserts purified and ligated into the G s universal vector at the respective restriction sites.
- the positive clones will be isolated following transformation and determined by restriction enzyme digestion; expression using 293 cells will be accomphshed following the protocol set forth infra.
- Each positive clone for GPCR- G s Fusion Protein will be sequenced to verify correctness.
- G q (6 amino acid deletion)/Gi Fusion Construct
- the design of a G q (del)/Gi fusion construct was accomplished as follows: the N- terminal six (6) amino acids (amino acids 2 through 7), having the sequence of TLESIM
- TaqPlus ® Precision DNA polymerase (Stratagene) was utilized for the amplification by the following cycles, with steps 2 through 4 repeated 35 times: 95°C for 2 min; 95°C for 20 sec; 56°C for 20 sec; 72°C for 2 min; and 72°C for 7 min.
- the PCR product will be cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the
- the PCR product was cloned into a pCRII-TOPO vector (Invitrogen) and sequenced using the ABI
- 2L of neonate rat pups (Sprague Dawley) (at Post-pardum day 2-Post-pardum day 3 stage) were placed on ice to euthanize. Pups were then removed and decapitated to drain the blood. The neonates were placed, belly-down, on a dissection board and rinsed with 70% ethanol to sterilize. Using a scalpel, the skin was removed in the thigh area until the sciatic nerve was exposed (or until a thin white "string” extended from the spinal cord to the knee was visible). The nerves were placed in DMEM medium and then aspirated, followed by bringing the volume to 2.4 ml with DMEM media and adding 300uL 10X Collagenase (0.3%, Sigma Cat. #C-9891) and 300uL 10X Trypsin (0.25%, GIBCO Cat. #25095-019) for
- Nerves were then incubated at 37°C for 15 min, centrifuged for 5 min at 1,000 rpm followed by removing the media (repeated twice).
- 1 mL DMEM-HEPES and lmL DMEM/10% FBS were added and then transfered to a 50mL conical tube.
- the contents of the tube were sheared with the following gauge needles (NWR): once with 18G, twice with 21G and twice with 23 G.
- the contents were placed on a Falcon cell strainer and spun at a very low speed (about 1200 rpm).
- the total volume was brought to lOmL with DMEM/10% FBS and plated on a Poly-L-lysine treated 10cm plate (Sigma, Cat.
- Antibody selection was accomplished according to the following: the Poly-L-Lysine treated plates were first washed with IX PBS (three times), trypsinized with lmL of 0.5% trypsin-EDTA, for about 1 min and then neutralized with 9mL of DMEM-HEPES buffer and 10% FBS. Cells were centrifuged at 1200rpm for 5 min, resuspended in 3mL of
- DMEM-HEPES to wash out the trypsin and spun for 5 min at 1200rpm. Cells were then resuspended in 600uL of DMEM-HEPES, leaving some media after the spin in order to have single cells.
- Thyl.l antibody (Monoclonal Antibody, Sigma, Cat. #P-1274) was added at a 1 : 1000 dilution.
- the cells were then incubated for 20 min at 37°C, slightly agitating the tube every two minutes.
- 20uL of Guinea Pig complement (GIBCO, Cat. #19195-015) was thawed before using it, followed by adding the complement to the cells with the antibody to a final volume of lmL.
- the cells were incubated for about 20 rnin-30 min at 37°C water bath and lOmL of DMEM-HEPES was added and spun down for 5 min at 1200rpm. Cells were resuspended in 5mLs of DMEM/10% FBS and added to poly-L-lysine treated plates that contains pituitary extract and forskolin. The cells were left to recover for 24-48 hours and the immune selection procedure was repeated twice.
- Dawley rats were exposed at the sciatic notch.
- Nerve crush was produced by tightly compressing the sciatic nerve at the sciatic notch with flattened forceps twice, each time for 10 sec; this technique causes the axons to degenerate, but allows axonal regeneration.
- the animals were euthanized by CO 2 inhalation, the distal nerve stumps were removed, and the most proximal 2-3 mm was trimmed off. For crushed nerves, the entire distal nerve was harvested. The nerves were immediately frozen in liquid nitrogen and stored at -80°C. Unlesioned sciatic nerves were obtained from animals of varying ages, from P0 (post crush) to P13.
- RT-PCR can be applied to confirm the expression and to determine the tissue distribution of several novel human GPCRs. Oligonucleotides utihzed will be GPCR- specific and the human multiple tissue cDNA panels (MTC, Clontech) as templates. Taq
- DNA polymerase (Stratagene) will be utilized for the amplification in a 40 ⁇ l reaction according to the manufacturer's instructions. Twenty ⁇ l of the reaction will be loaded on a
- RNAzol B reagent TelTest Inc., Cat.
- RNA was transferred to a nylon membrane (Sachleicher Schull) by capillary action using 10X SSC.
- a 32 P-labelled GPR37 DNA probe was synthesized using a DNA fragment conesponding precisely to the 3' end of GPR37 and a High Prime labeling kit (Roche Molecular Biochemical) according to the manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat.
- Figure 9 evidences that GPR37 is expressed in Schwann cells, such that myelination can be maintained at 20uM Forskolin.
- Figure 10 evidences that GPR37 is up-regulated in crushed rat sciatic nerves, specifically seven (7) days after crushing the nerves. Such data is consistent with the data presented in Figure 9, i.e., GPR37 may play a role in the regeneration of nerves by stimulating the process of myelination in Schwann cells.
- GPR37 is expressed in the human central nervous system, specifically in the brain tissues. It has been further determined that GPR37 is expressed in Schwann cells.
- Schwann cells act to regenerate the nerves by forming myelin sheaths around the axons, which provides "insulation" in the form of myelin sheaths. This process, known as myelination, is important in that action potentials travel at a faster rate, thereby conserving metabolic energy.
- Schwann cells and their precursors play an important role in influencing the survival and differentiation of other cells that make up a pheripheral nerve.
- GPR37 has been determined to be expressed in crushed rat sciatic nerves. Such data supports the evidence that GPR37 may play a role in regenerating nerve cells.
- the putative functional role of the receptor can be deduced.
- hyper-myelination e.g., tumorgenesis
- an inverse agonist against GPR37 is prefened, while an agonist is prefened where hypo-myelination occurs (e.g., a degenerative disease such as diabetes).
- hypo-myelination e.g., a degenerative disease such as diabetes.
- RNA from several pancreatic cell lines e.g., HIT, ARIP, Tu6, RIN ⁇ TC,
- Hybridization was performed using ExpressHyb Solution (Clontech, Cat.#8015-2) supplemented with lOOug/ml salmon sperm DNA as follows. The membrane containing the separated RNA samples were first incubated with ExpressHyb solution at
- the 32 P-labeled GPR66 DNA probe was denatured by boiling for 2 min, placed on ice for 5 min and then transfened into the ExpressHyb solution bathing the membrane. After an overnight incubation at 65 °C, the membrane was removed from the
- RNA from several cancer cell lines were isolated using TRIzol reagent (Gibco BRL, Cat #15596-018) according to manufacturer's instructions. After electrophoreseis in a 1% agarose/formaldehyde gel, the RNA was transferred to a nylon membrane using standard protocols. A 32 P-labelled GPR35 probe was synthesized using a DNA fragment corresponding precisely to the entire coding sequence and a Prime It II Random Primer Labeling Kit (Stratagene, Cat. #300385) according to manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat.#8015-2) supplemented with lOOug/ml salmon sperm DNA as follows. The membrane containing the separated RNA samples were
- DNA probe was denatured by boiling for 2 min, placed on ice for 5 min and then transfereed into the ExpressHyb solution bathing the membrane. After an overnight incubation at 65 °C, the membrane was removed from the hybridization and washed four
- RNA blots evidences that GPR35 is abundantly expressed in colorectal cancer cell line SW480. Such data suggests that GPR35 may play a role in colorectal carcinogenesis.
- Identification of candidate compounds, by the method discussed below, is most preferably an inverse agonist.
- An inverse agonist for GPR35 is intended to reduce DNA replication in an effort to inhibit cell proliferation of cancerous cells.
- GPR35 is expressed in large and small intestine. Numerous cancer cell lines were examined where GPR35 was determined to be expressed in the colorectal cancer cell line (e.g., HELA, MOLT-4 and SW480). This data suggests that GPR35 may play a role in colorectal carcinogenesis.
- Colorectal cancer is a malignancy that arises from either the colon or the rectum. Cancers of the large intestine are the second most common form of cancer found in both males and females. d. ETBR-LP2
- RNA from Example 6 was harvested utilizing RNAzol B reagent (TelTest Inc., Cat. #CS-104), according to manufacturer's instructions. After electrophoresis in an 1% agarose/formaldehyde gel, the RNA was transfened to a nylon membrane (Sachleicher SchuU) by capillary action using 10X SSC. A 32 P-labelled ETBR-LP2 DNA probe was synthesized using a DNA fragment conesponding precisely to the 3' end of ETBR-LP2 and a High Prime labeling kit (Roche Molecular Biochemical) according to the manufacturer's instructions. Hybridization was performed using ExpressHyb Solution (Clontech, Cat.
- the membrane containing the separated RNA samples was first incubated with ExpressHyb solution at 65°C overnight.
- the 32 P-labelled ETBR-LP2 DNA probe was denatured by boiling for 2 minutes, placed on ice for 5 minutes and then transfened into the ExpressHyb solution bathing the membrane. After an overnight incubation at 65°C, the membrane was removed from the hybridization solution and washed four times for 15 minutes each in 2XSSC/1% SDS at 65°C, followed by two washes for 15 minutes each in 0.2XSSC/0.1% SDS at 55°C. Excess moisture was removed from the blot by gentle shaking, after which the blot was wrapped in plastic wrap and exposed to film overnight at -80°C.
- Figure 18 evidences that ETBR-LP2 is expressed in Schwann cells, such that myelination can be maintained at 20uM Forskolin.
- Figure 19 evidences that ETBR-LP2 is up- regulated in crushed rat sciatic nerves, specifically seven (7) days after crushing the nerves. Such data is consistent with the data presented in Figure 18, i.e., ETBR-LP2 may play a role in the regeneration of nerves by stimulating the process of myelination in Schwann cells. Based upon these data, ETBR-LP2 is expressed in Schwann cells.
- axons or nerves
- Schwann cells act to regenerate the nerves by forming myelin sheaths around the axons, which provides "insulation" in the form of myelin sheaths. This process, known as myelination, is important in that action potentials travel at a faster rate, thereby conserving metabolic energy.
- Schwann cells and their precursors play an important role in influencing the survival and differentiation of other cells that make up a pheripheral nerve.
- ETBR-LP2 has been determined to be expressed in crushed rat sciatic nerves. Such data supports the evidence that ETBR-LP2 may play a role in regenerating nerve cells.
- the putative functional role of the receptor can be deduced.
- an inverse agonist against ETBR-LP2 is preferred, while an agonist is prefened where hypo-myelination occurs (e.g., a degenerative disease such as diabetes).
- Diseases and disorders related to receptors located in these tissues or regions include, but are not limited to, cardiac disorders and diseases (e.g. thrombosis, myocardial infarction; atherosclerosis; cardiomyopathies); kidney disease/disorders (e.g., renal failure; renal tubular acidosis; renal glycosuria; nephrogenic diabetes insipidus; cystinuria; polycystic kidney disease); eosinophilia; leukocytosis; leukopenia; ovarian cancer; sexual dysfunction; polycystic ovarian syndrome; pancreatitis and pancreatic cancer; irritable bowel syndrome; colon cancer; Crohn's disease; ulcerative colitis; diverticulitis; Chronic Obstructive Pulmonary Disease (COPD); Cystic Fibrosis; pneumonia; pulmonary hypertension; tuberculosis and lung cancer; Parkinson's disease; movement disorders and ataxias; learning and memory disorders; eating disorders (e.g., anorexia
- a GPCR Fusion Protein as disclosed above, is also utihzed with a non- endogenous, constitutively activated GPCR.
- infra-assay variation appears to be substantially stabilized, whereby an effective signal-to-noise ratio is obtained.
- a GPCR Fusion Protein it is prefened that for direct identification, a GPCR Fusion Protein be used and that when utilized, the following assay protocols be utihzed.
- Membrane Preparation Membranes comprising the constitutively active orphan GPCR Fusion Protein of interest and for use in the direct identification of candidate compounds as inverse agonists or agonists are preferably prepared as follows: a. Materials "Membrane Scrape Buffer” is comprised of 20mM HEPES and lOmM EDTA, pH 7.4; “Membrane Wash Buffer” is comprised of 20 mM HEPES and 0.1 mM EDTA, pH 7.4; “Binding Buffer” is comprised of 20mM HEPES, 100 mM NaCl, and 10 mM MgCl 2 , pH 7.4 b. Procedure All materials will be kept on ice throughout the procedure.
- the media will be aspirated from a confluent monolayer of cells, followed by rinse with 10ml cold PBS, followed by aspiration. Thereafter, 5ml of Membrane Scrape Buffer will be added to scrape cells; this will be followed by transfer of cellular extract into 50ml centrifuge tubes
- protein concentration of the membranes will be determined, for example, using the Bradford Protein Assay (protein can be diluted to about 1.5mg/ml, aliquoted and frozen (-80°C) for later use; when frozen, protocol for use will be as follows: on the day of the assay, frozen Membrane Protein is thawed at room temperature, followed by vortex and then homogenized with a Polytron at about 12 x 1,000 rpm for about 5-10 seconds; it was noted that for multiple preparations, the homogenizer is thoroughly cleaned between homogenization of different preparations).
- Materials Bmding Buffer as discussed above
- Bradford Dye Reagent Bradford Protein
- Duplicate tubes will be prepared, one including the membrane, and one as a control "blank". Each contains 800 ⁇ l Binding Buffer. Thereafter, lO ⁇ l of Bradford
- Reagent will be added to each tube, followed by vortexing. After five minutes, the tubes will be re-vortexed and the material therein will be transfened to cuvettes. The cuvettes will then be read using a CECIL 3041 spectrophotometer, at wavelength 595.
- GDP Buffer consisted of 37.5 ml Binding Buffer and 2mg GDP (Sigma, cat. no. G- 7127), followed by a series of dilutions in Binding Buffer to obtain 0.2 ⁇ M GDP (final concentration of GDP in each well was 0.1 ⁇ M GDP); each well comprising a candidate compound, has a final volume of 200 ⁇ l consisting of lOO ⁇ l GDP Buffer (final concentration, 0.1 ⁇ M GDP), 50 ⁇ l Membrane Protein in Binding Buffer, and 50 ⁇ l
- Binding Buffer will be added to each well, followed by incubation on a shaker for 60 minutes at room temperature (again, in this example, plates were covered with foil).
- Another assay approach to directly identify candidate compound will be accomplished utihzing a cyclase-based assay.
- this assay approach can be utilized as an independent approach to provide confirmation of the results from the [ 35 S]GTP ⁇ S approach as set forth above.
- a modified Flash PlateTM Adenylyl Cyclase kit (New England Nuclear; Cat. No. SMP004A) will be preferably utihzed for direct identification of candidate compounds as inverse agonists and agonists to GPCRs in accordance with the following protocol.
- Transfected cells will be harvested approximately three days after transfection.
- Membranes will be prepared by homogenization of suspended cells in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl 2 . Homogenization will be performed on ice using a Brinkman PolytronTM for approximately 10 seconds. The resulting homogenate will be centrifuged at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be resuspended in buffer containing 20mM HEPES, pH 7.4 and 0.1 mM EDTA, homogemzed for 10 seconds, followed by centrifugation at 49,000 X g for 15 minutes at 4°C. The resulting pellet will then be stored at -80°C until utilized.
- the membrane pellet On the day of direct identification screening, the membrane pellet will slowly be thawed at room temperature, resuspended in buffer containing 20mM HEPES, pH 7.4 and lOmM MgCl 2 , to yield a final protein concentration of 0.60mg/ml (the resuspended membranes will be placed on ice until use).
- cAMP standards and Detection Buffer comprising 2 ⁇ Ci of tracer [ 125 I cAMP (100 ⁇ l] to 11 ml Detection Buffer) will be prepared and maintained in accordance with the manufacturer's instructions.
- Assay Buffer will be prepared fresh for screening and contain 20mM HEPES, pH 7.4, lOmM MgCl 2 , 20mM phosphocreatine (Sigma), 0.1 units/ml creatine phosphokinase (Sigma), 50 ⁇ M GTP (Sigma), and 0.2 mM ATP (Sigma); Assay Buffer will be stored on ice until utilized.
- Candidate compounds identified as per above if frozen, thawed at room temperature will be added, preferably, to 96- well plate wells (3 ⁇ l/well; 12 ⁇ M final assay concentration), together with 40 ⁇ l Membrane Protein (30 ⁇ g/well) and 50 ⁇ l of Assay Buffer. This admixture will be incubated for 30 minutes at room temperature, with gentle shaking.
- a method for identifying candidate agonists or inverse agonists for a GPCR can be preformed by introducing tests cells of a pigment cell line capable of dispersing or aggregating their pigment in response to a specific stimulus and expressing an exogenous clone coding for the GCPR.
- a stimulant e.g., light
- the tests cells are then contacted with chemical compounds, and it is determined whether the pigment disposition in the cells changed from the initial state of pigment disposition. Dispersion of pigments cells due to the candidate compound coupling to the GPCR will appear dark on a petri dish, while aggregation of pigments cells will appear tight. Materials and methods will be followed according to the disclosure of U.S. Patent
- the vector utilized be pCMV.
- This vector was deposited with the American Type Culture Collection (ATCC) on October 13, 1998 (10801 University Boulevard., Manassas, NA 20110-2209 USA) under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure. The D ⁇ A was tested by the ATCC and determined to be viable. The ATCC has assigned the following deposit number to pCMN: ATCC #203351.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US27191301P | 2001-02-26 | 2001-02-26 | |
| PCT/US2002/005625 WO2002068600A2 (en) | 2001-02-26 | 2002-02-26 | Endogenous and non-endogenous versions of human g protein-coupled receptors |
| US271913P | 2009-07-28 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1412372A2 true EP1412372A2 (en) | 2004-04-28 |
| EP1412372A4 EP1412372A4 (en) | 2005-08-24 |
Family
ID=23037612
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP02717500A Withdrawn EP1412372A4 (en) | 2001-02-26 | 2002-02-26 | Endogenous and non-endogenous versions of human g protein-coupled receptors |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1412372A4 (en) |
| JP (1) | JP2004526441A (en) |
| CN (1) | CN1516706A (en) |
| CA (1) | CA2439383A1 (en) |
| WO (1) | WO2002068600A2 (en) |
Families Citing this family (21)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7115375B2 (en) | 2000-11-14 | 2006-10-03 | Bristol-Myers Squibb | Methods of diagnosing renal tumors by determining the expression level of RNA encoding the HGPRBMY18 polypeptide |
| AU2003246726A1 (en) * | 2002-07-31 | 2004-02-23 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with human g-protein coupled receptor 45 (gpr45) |
| WO2004013637A1 (en) * | 2002-08-01 | 2004-02-12 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with g-protein coupled receptor 37 (gpr37) |
| DE10254601A1 (en) * | 2002-11-22 | 2004-06-03 | Ganymed Pharmaceuticals Ag | Gene products differentially expressed in tumors and their use |
| CN100514066C (en) * | 2003-03-17 | 2009-07-15 | 艾尼纳制药公司 | Modulators of the G protein-coupled formyl peptide receptor-like 2 and their therapeutic use against cell death-related disorders |
| AU2004220864B2 (en) * | 2003-03-17 | 2011-05-26 | Arena Pharmaceuticals Inc. | Modulators of G Protein-Coupled Formyl peptide receptor-like 2 and their therapeutic use against cell death-related disorders |
| JP4533655B2 (en) * | 2003-04-23 | 2010-09-01 | 武田薬品工業株式会社 | New screening method |
| US7517661B2 (en) | 2003-04-23 | 2009-04-14 | Takeda Pharmaceutical Company Limited | Methods of screening for ligands for FPRL2 |
| WO2005059546A2 (en) * | 2003-12-12 | 2005-06-30 | Bayer Healthcare Ag | Diagnostics and therapeutics for diseases associated with g protein-coupled receptor 35 (gpr35) |
| DE102004024617A1 (en) * | 2004-05-18 | 2005-12-29 | Ganymed Pharmaceuticals Ag | Differentially expressed in tumors gene products and their use |
| WO2006005588A1 (en) * | 2004-07-12 | 2006-01-19 | Geneprot, Inc. | Polypeptide species useful for the treatment of neurological disorders |
| WO2006025551A1 (en) * | 2004-08-30 | 2006-03-09 | Takeda Pharmaceutical Company Limited | Screening method |
| EP1790664A1 (en) | 2005-11-24 | 2007-05-30 | Ganymed Pharmaceuticals AG | Monoclonal antibodies against claudin-18 for treatment of cancer |
| US8785135B2 (en) * | 2007-03-22 | 2014-07-22 | Heptares Therapeutics Limited | Mutant G-protein coupled receptors and methods for selecting them |
| GB0724051D0 (en) | 2007-12-08 | 2008-01-16 | Medical Res Council | Mutant proteins and methods for producing them |
| GB0724860D0 (en) | 2007-12-20 | 2008-01-30 | Heptares Therapeutics Ltd | Screening |
| GB0802474D0 (en) | 2008-02-11 | 2008-03-19 | Heptares Therapeutics Ltd | Mutant proteins and methods for selecting them |
| GB0910725D0 (en) | 2009-06-22 | 2009-08-05 | Heptares Therapeutics Ltd | Mutant proteins and methods for producing them |
| WO2013167153A1 (en) | 2012-05-09 | 2013-11-14 | Ganymed Pharmaceuticals Ag | Antibodies useful in cancer diagnosis |
| CN105073776B (en) | 2012-11-13 | 2019-04-12 | 拜恩科技股份公司 | Agents for the treatment of cancer diseases expressing claudin |
| GB201601690D0 (en) | 2016-01-29 | 2016-03-16 | Heptares Therapeutics Ltd | G proteins |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE69731960T2 (en) * | 1996-09-24 | 2005-12-15 | Cadus Pharmaceutical Corp. | METHOD AND COMPOSITIONS FOR IDENTIFYING RECEPTOR EFFECTORS |
| US6555339B1 (en) * | 1997-04-14 | 2003-04-29 | Arena Pharmaceuticals, Inc. | Non-endogenous, constitutively activated human protein-coupled receptors |
-
2002
- 2002-02-26 WO PCT/US2002/005625 patent/WO2002068600A2/en not_active Ceased
- 2002-02-26 JP JP2002568696A patent/JP2004526441A/en not_active Withdrawn
- 2002-02-26 CN CNA028087879A patent/CN1516706A/en active Pending
- 2002-02-26 CA CA002439383A patent/CA2439383A1/en not_active Abandoned
- 2002-02-26 EP EP02717500A patent/EP1412372A4/en not_active Withdrawn
Also Published As
| Publication number | Publication date |
|---|---|
| EP1412372A4 (en) | 2005-08-24 |
| WO2002068600A2 (en) | 2002-09-06 |
| CN1516706A (en) | 2004-07-28 |
| WO2002068600A3 (en) | 2004-02-26 |
| JP2004526441A (en) | 2004-09-02 |
| CA2439383A1 (en) | 2002-09-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2005244540B2 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
| WO2002068600A2 (en) | Endogenous and non-endogenous versions of human g protein-coupled receptors | |
| WO2000022131A2 (en) | Non-endogenous, constitutively activated human g protein-coupled receptors | |
| JP2010166925A (en) | Endogenous and non-endogenous version of human g protein-coupled receptor | |
| US20060240523A1 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
| US20130309766A1 (en) | Endogenous and Non-Endogenous Versions of Human G Protein-Coupled Receptors | |
| US20130165633A1 (en) | Endogenous and Non-Endogenous Versions of Human G Protein-Coupled Receptors | |
| AU2002219890A1 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
| US7119190B2 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
| AU2002248497A1 (en) | Endogenous and non-endogenous versions of human G protein-coupled receptors | |
| US8440391B2 (en) | Constitutively activated human G protein coupled receptors | |
| US20100317046A1 (en) | Non-Endogenous, Constitutively Activated Versions of Human G Protein Coupled Receptor: FSHR | |
| AU2007216751A1 (en) | Endogenous and non-endogenous versions of the human G protein-coupled receptor hRUP30 | |
| US20150153327A1 (en) | Endogenous and Non-Endogenous Versions of Human G Protein-Coupled Receptors | |
| CA2732120A1 (en) | Endogenous and non-endogenous versions of human g protein-coupled receptors | |
| US20070072248A1 (en) | Constitutively activated human G protein coupled receptors | |
| EP2264068A1 (en) | Non-endogenous, constitutively activated human G protein-coupled receptors | |
| HK1091214A (en) | Non-endogenous, constitutively activated human g protein-coupled receptors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030924 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 07K 14/72 B Ipc: 7C 12Q 1/68 B Ipc: 7C 12N 15/63 B Ipc: 7C 12N 15/09 B Ipc: 7C 07K 14/705 B Ipc: 7C 07H 21/04 A |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20050704 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20050901 |