EP1390380A2 - Methods and primers for evaluating hiv-1 mutations - Google Patents

Methods and primers for evaluating hiv-1 mutations

Info

Publication number
EP1390380A2
EP1390380A2 EP02721252A EP02721252A EP1390380A2 EP 1390380 A2 EP1390380 A2 EP 1390380A2 EP 02721252 A EP02721252 A EP 02721252A EP 02721252 A EP02721252 A EP 02721252A EP 1390380 A2 EP1390380 A2 EP 1390380A2
Authority
EP
European Patent Office
Prior art keywords
seq
primers
sequence
primer
reverse
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
EP02721252A
Other languages
German (de)
French (fr)
Other versions
EP1390380B1 (en
EP1390380A4 (en
Inventor
Robert M. Lloyd, Jr.
Arejas Uzgiris
Joe Tzong-Jyh Huong
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Siemens Healthcare Diagnostics Inc
Original Assignee
Visible Genetics Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Visible Genetics Inc filed Critical Visible Genetics Inc
Publication of EP1390380A2 publication Critical patent/EP1390380A2/en
Publication of EP1390380A4 publication Critical patent/EP1390380A4/en
Application granted granted Critical
Publication of EP1390380B1 publication Critical patent/EP1390380B1/en
Anticipated expiration legal-status Critical
Expired - Lifetime legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701Specific hybridization probes
    • C12Q1/702Specific hybridization probes for retroviruses
    • C12Q1/703Viruses associated with AIDS

Definitions

  • the present application relates to methods and primers for evaluating mutations in human immunodeficiency virus (HIN-1).
  • ADDS Human immunodeficiency vims is the primary causative agent of Acquired Immune Deficiency Syndrome (ADDS), or ATDS-related complex (ARC).
  • ADDS is an infectious disease characterized by generalized immune suppression, multiple opportunistic infections, and neurological disease.
  • HIN is regarded to be the primary causative agent of AIDS, multiple co-infecting clinical viral and bacterial pathogens are responsible for the cluster of clinical syndromes seen in AIDS patients.
  • the clinical course of HIV infection is remarkable for its great variability.
  • the clinical effects include increased susceptibility to opportunistic infections and rare cancers, such as Kaposi's sarcoma, neurological dysfunctions, leading to AIDS related dementias, and generalized immune dysfunctions.
  • the HIV-1 vims is a member of the lenti virus group of the retrovimses. Like all other retrovimses, it has an R ⁇ A genome which is replicated via the viral reverse transcriptase, into a D ⁇ A provirus which becomes integrated into the host cell genome.
  • d gs are presently available to treat HIV. They fall into three different classes - nucleoside reverse transcriptase inliibitors, or ⁇ RTI's such as zidovudine, didanosine, zalcitabine, lamivudine, stavudine, abacavir, tenofovir, foscarnet; non- nucleoside reverse transcriptase inliibitors or ⁇ RTI's such as nevirapine, delavirdine, efavirenz; and protease inliibitors or Pi's such as saquinavir, indinavir, ritonavir, nelfmavir, amprenavir, and lopinavir with ritonavir. Although some of these dmgs may have similar modes of actions, resistance to one does not necessarily confer resistance to another.
  • ⁇ RTI's such as zidovudine, didanosine, zalcitabine, lam
  • Combination therapy has significantly decreased HIV associated morbidity and mortality.
  • a large number of patients are not able to achieve or maintain complete viral suppression even with combination therapy.
  • Drug resistance is the consequence of this incomplete viral suppression.
  • the very high mutagenicity rate of HIV vims due to the error-prone nature of the viral reverse transcriptase) and the genetic variability of the vims have led to many HIV variants with decreased dmg susceptibility.
  • HIN-1 replication depends on a virally encoded enzyme, reverse transcriptase (RT) that copies the single-stranded viral R ⁇ A genome into a double-stranded D ⁇ A/R ⁇ A hybrid.
  • RT reverse transcriptase
  • the HIN-1 RT enzyme lacks a 3' exonuclease activity which normally helps the "proof-reading" function of a polymerase enzyme to repair errors.
  • HIN-1 has a 9200-base genome and, on average, RT makes at least one error during every transcription of 10,000 bases copied. Therefore, each progeny vims produced may be slightly different from its predecessor. The inaccuracy of RT results in an estimated in vivo forward mutation rate of 3 x 10 "5 per base incorporated. Mansky LM. Virology. 1996; 222:391-400.
  • the mutagenicity of the vims represents a significant barrier to treatment of the disease. Moreover, the mutagenicity of the vims makes testing for genetic changes in the vims very difficult. Testing for changes in D ⁇ A sequence can proceed via complete sequencing of a target nucleic acid molecule, although many persons in the art believe that such testing is too expensive to ever be routine.
  • HIN-1 replication occurs rapidly, large numbers of vims variants, including those that display diminished sensitivity to antiretroviral dmgs, are generated. Mutations that confer resistance to antiretroviral dmgs can be present in HIV-1 infected persons before antiretroviral therapy is initiated due to transmission from an individual having had prior therapy or due to spontaneously arising mutations. Once dmg therapy is initiated, the pre-existing population of drug-resistant viruses can rapidly predominate because of a selective advantage.
  • dmgs such as lamivudine or nevirapine (and other ⁇ RTIs)
  • a single nucleotide change in the HIV-1 RT gene can confer 100- to 1, 000-fold reductions in dmg susceptibility (Schinazi RF, et al Int Antiviral News. 1997;5:129-42).
  • In vivo antiretroviral activity of these dmgs, when used alone, is largely lost within 4 weeks of starting therapy due to the rapid outgrowth of drug-resistant variants, Richman DD, et al. Nevirapine resistance mutations of human immunodeficiency virus type 1 selected during therapy. J Virol. 1994; 68:1660-6.
  • antiretroviral dmgs Some mutations selected by antiretroviral dmgs directly affect viral enzymes and cause resistance via decreased dmg binding, whereas others have indirect effects., Condra JH, et al. J Virol. 1996; 70:8270-6, and Harrigan PR, et al. J Virol. 1996; 70:5930-4. Treatment with different antiretroviral dmgs may select for HIV-l variants that harbor the same, or related, mutations. Treatments may even select for the outgrowth of HIV-1 variants that are resistant to dmgs to which the patient has not yet been exposed (cross-resistance).
  • Mutations can be detected by a technique called “single stranded conformational polymorphism” (SSCP) described by Orita et al., Genomics 5: 874-879 (1989), or by a modification thereof referred to as dideoxy- fingerprinting ("ddF") described by Sarkar et al, Genomics 13: 441-443 (1992).
  • SSCP and ddF both evaluate the pattern of bands created when DNA fragments are electrophoretically separated on a non-denaturing electrophoresis gel. This pattern depends on a combination of the size of the fragments and the three-dimensional conformation of the undenatured fragments. Thus, the pattern can not be used for sequencing, because the theoretical spacing of the fragment bands is not equal.
  • Other methods include the use of resistance test vectors to culture host cells with vims derived from a patient.
  • the vector may include an indicator gene, such that when a test amount of an anti-HIV dmg is added to the cell culture, in an attempt to measure the resistance of the cloned vims to the dmg in the cell culture system. (Parkin et al, LTSPN 5,837,464).
  • genotyping the most direct information about the genetic composition of the vims in a patient is to directly determine the sequence of the vims (genotyping).
  • genotyping has been demonstrated in controlled retrospective and prospective intervention based studies such as the Genotypic Antiretroviral Resistance Testing (GART)(Baxter JD, et al. A randomized study of antiretroviral management based on plasma genotypic antiretroviral resistance testing in patients failing therapy. AIDS; 2000;14;F83-F93 and VIRADAPT studies, Durant J, et al. Drug-resistance genotyping in HIN-1 therapy: the VIRADAPT randomised controlled trial, Lancet.
  • GART Genotypic Antiretroviral Resistance Testing
  • HIV-1 vims has been categorized into two genetic groups, based on phylogenetic reconstmction using the viral DNA sequences.
  • Group O outlier
  • Group M major type
  • subtypes also referred to as clades
  • HIV-1 Group M Subtype Predominant geographical location
  • Each subtype differs from the others in amino acid composition by at least 20% in the viral envelope region, and at least 15% in the viral gag region. Within each subtype, the differences in env can be up to 10%, while the differences in gag can be up to 8%.
  • the viral reverse transcriptase and protease genes are found on the viral pol transcript. It is estimated that there is only a 75% similarity in amino acids between subtypes for HIV-1 pol. The variability at the nucleic acid sequence level is even greater.
  • Retrovimses have propensity to recombine with related retrovimses. If one cell is infected with multiple vimses, recombination events may occur, leading to recombinant subtypes that may then infect other individuals. In addition to the various subtypes known, circulating recombinant subtypes have been observed, such as A/E (Central Africa), A/G (West and Central Africa), A/B (Kalingrad), A/G/H/K (Cyprus/Greece) as well as D/F, and B/D recombinants.
  • A/E Central Africa
  • A/G West and Central Africa
  • A/B Kalingrad
  • A/G/H/K Cyprus/Greece
  • a first aspect of the present invention is a combination of primers, including at least one species of forward primer and at least one species of reverse primer.
  • the forward primer(s) can be represented by the degenerate sequence:
  • RARRARGGGCTGYTGGARATGTS (Seq ID No. 9) optionally with an additional G at either or both ends, where the non-standard letters (those others than A, C, G and T) reflect choices of bases in accordance with conventional nomenclature as outlined below.
  • the non-standard letters (those others than A, C, G and T) reflect choices of bases in accordance with conventional nomenclature as outlined below.
  • Seq. ID Nos. 11, 15 and 16 show primers where one G is added.
  • the reverse primer(s) can be represented by the degenerate sequence: AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No.: 10) or GTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No.
  • the degenerate sequence also represents 3456 possible sequences, differing only in the initial A.
  • the selected primers, one or more from each group, can be used as reverse transcription, amplification and sequencing primers.
  • the primers are suitably packaged in a genotyping kit.
  • a genotyping kit may include reagents in addition to the primers, such as an RNase inhibitor, a reverse transcriptase, a polymerase, and/or dNTP and ddNTP feedstocks.
  • the primers are suitably employed in the method of the invention, hi accordance with this method, a sample suspected of containing a non-B Group M HIV-1 vims or a Group O HIN-1 vims is treated to recover viral R ⁇ A.
  • the recovered viral R ⁇ A is reverse transcribed to D ⁇ A, which is sequenced using the primers of the invention.
  • the resulting sequence information is used to establish the genotype of the tested vims, i.e., to determine to which subtype the vims in the sample belongs.
  • the method of the invention may be practiced in parallel with genotyping procedures that are designed to evaluate B- subtype vims. Alternatively, the method of the invention is practiced on samples that have previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype vims.
  • allele means a specific version of a nucleotide sequence at a polymorphic genetic locus.
  • polymorphic site means a given nucleotide location in a genetic locus which is variable within a population.
  • gene or “genetic locus” as used herein means a specific nucleotide sequence within a given genome.
  • location or "position” of a nucleotide in a genetic locus means the number assigned to the nucleotide in the gene, generally taken from the cD ⁇ A sequence of the genomic sequence of a gene.
  • the nucleotides adenosine, cytosine, guanine and thymine are represented by their one-letter codes A, C, G, and T respectively.
  • the symbol R refers to either G or A
  • the symbol Y refers to either T/U or C
  • the symbol M refers to either A or C
  • the symbol K refers to either G or T U
  • the symbol S refers to G or C
  • the symbol W refers to either A or T/U
  • the symbol B refers to "not A”
  • the symbol D refers to "not C”
  • the symbol H refers to "not G”
  • the symbol V refers to "not T/U”
  • the symbol N refers to any nucleotide.
  • a degenerate primer refers to any or all of the combinations of base choices and to either DNA or the corresponding RNA sequence (i.e., with T replaced by U).
  • a degenerate primer may represent a single species, or a mixture of two species which fall within the choices, or a mixture of three choices which fall with the choices, and so on up to a mixture containing all the possible combinations.
  • oligonucleotide primer defines a molecule comprised of more than three deoxyribonucleotides or ribonucleotides. Its exact length will depend on many factors relating to the ultimate function and use of the oligonucleotide primer, including temperature, source of the primer and use of the method.
  • the oligonucleotide primer is capable of acting as an initiation point for synthesis when placed under conditions which induce synthesis of a primer extension product complementary to a nucleic acid strand.
  • the conditions can include the presence of nucleotides and an inducing agent such as a DNA polymerase at a suitable temperature and pH.
  • the primer is a SS oligodeoxyribonucleotide of sufficient length to prime the synthesis of an extension product from a specific sequence in the presence of an inducing agent.
  • the oligonucleotide primers are at least 18 nucleotides long. Sensitivity and specificity of the oligonucleotide primers are determined by the primer length and uniqueness of sequence within a given sample of template nucleic acid. Primers which are too short, for example, may show non-specific binding. to a wide variety of sequences.
  • a first aspect of the present invention is a primer combination comprising, in a single solution, at least one forward HIV-1 primer selected from among primers comprising a sequence as represented by the degenerate sequence of Seq ID Nos. 9, for example Seq. ID. Nos. 11, 15 or 16, and preferably from among primers with exactly these sequences, at least one reverse HIV-1 primer selected from among primers comprising a sequence as represented by the degenerate sequences of Seq. ID Nos. 10 or 12, for example Seq. ID. Nos. 13 or 14, and preferably from among primers with exactly these sequences. Wliere the primers are to be used as sequencing primers, the forward primers or the reverse primers are labeled with a detectable label.
  • the primer combination may include other reagents appropriate for reverse transcription, amplification or sequencing, and may, of course, include HIV-1 genetic material for analysis.
  • Specific forward primers for use in the primer combinations of the invention are: GGAAAAAGGGCTGTTGGAAATGYG (Seq. TD No. 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ID No. 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ID No. 3) including without limitation the following non-degenerate primer sequences: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ID No. 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ID No. 1 S) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ID No. 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. JO No. 11) GAAAAAGGGCTGTTGGAAATGTG (Seq. ID No. 15) GAAAAAGGGCTGTTGGAAATGCG (Seq. ID No. 16).
  • AGYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 8) including without limitation the following non-degenerate primer sequences: GTCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No.: 13)
  • the primer combinations described above can be used in a method in accordance with the invention for a sample suspected of containing a non-B Group M HIN-1 vims or a Group O HIN-1 vims to assess the subtype and genotype of the vims.
  • the method comprises the steps of treating the sample to recover viral RNA; reverse transcribing the recovered viral RNA; sequencing the reverse transcription product; and using the results of the sequencing step to establish the genotype of the tested vims.
  • either or both of the reverse transcription step and the sequencing step are performed using a primer combination as described above.
  • the method of the invention can include the step of performing a parallel genotyping procedure that is designed to evaluate B-subtype vims.
  • the method can be utilized with a sample that has previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype vims.
  • This alternative method provides the advantage of not performing needless testing on a sample that proves to be the presently more common B-subtype.
  • GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 7) were used to salvage non-B subtypes in samples that could not be genotyped using other primers.
  • the TRUGENE HJN-1 genotyping kit (Visible Genetics Inc., Toronto, Canada) was used to determine the genotype of certain non-B subtypes of HIV-1 vims.
  • R ⁇ A was extracted from patient plasma samples according to the package instructions in a TRUPREP Extraction Kit forviral R ⁇ A. 17ul of R ⁇ A is added to the amplification master mix.
  • the master mix contains (per reaction) 0.2ul of SEQ ID No. 1 (30 pmole/ul), 0.4ul of SEQ ID No.
  • the second master mix contains lOul of RT-PCR buffer, 5ul of Rnase inhibitor, 1 ul of reverse transcriptase enzyme (Superscript, Invitrogen Corporation), and 17.5 ul of DNA polymerase.
  • Viral load numbers are provided as copies of viral RNA per milliliter of patient plasma. "Origin” refers to the residence of the patient at the time the plasma was collected.
  • Oligonucleotide primers in accordance with the present invention were tested to determine what percentage of non-B subtypes could be genotyped using samples that could not be genotyped using the TRUGENE HIN-1 genotyping kit. 74% of those samples were successfully genotyped. Similarly, greater than 95% of all samples known to be non-B samples were successftilly genotyped using the oligonucleotide primers of the present invention. Panels of non-B subtype vimses were generated, using pLAI as a positive control.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • AIDS & HIV (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Primer sequences and a method of using such sequences for the genotyping of HIV-1-containing samples, particularly those which have failed genotyping analysis are provided using primer sequences designed for analysis of Group B subtype of the Group M type virus. For example, a combination of primers, including at least one species of forward primer and at least one species of reverse primer where the forward primer(s) can be represented by the degenerate sequence: RARRARGGGCTGYTGGARATGTS (Seq. ID No. 9) and the reverse primer(s) can be represented by the degenerate sequence: BCHTYACYTTRATCCCSGVRTARATYTGACT (Seq. ID No.: 10) or BCHTYACYTTRATCCCSGVRTARATYTGAC (Seq. ID No. 12) are suitably employed. The selected primers, one or more from each group, can be used as reverse transcription, amplification and sequencing primers and are suitably packaged in a genotyping kit. Such a kit may include reagents in addition to the primers, such as an RNase inhibitor, a reverse transcriptase, a polymerase, and/or dNTP and ddNTP feedstocks.

Description

METHODS AND PRIMERS FOR EVALUATING HIV-1 MUTATIONS
DESCRIPTION
Background of the Invention
The present application relates to methods and primers for evaluating mutations in human immunodeficiency virus (HIN-1).
Human immunodeficiency vims is the primary causative agent of Acquired Immune Deficiency Syndrome (ADDS), or ATDS-related complex (ARC). ADDS is an infectious disease characterized by generalized immune suppression, multiple opportunistic infections, and neurological disease. Although HIN is regarded to be the primary causative agent of AIDS, multiple co-infecting clinical viral and bacterial pathogens are responsible for the cluster of clinical syndromes seen in AIDS patients.
The clinical course of HIV infection is remarkable for its great variability. The clinical effects include increased susceptibility to opportunistic infections and rare cancers, such as Kaposi's sarcoma, neurological dysfunctions, leading to AIDS related dementias, and generalized immune dysfunctions.
The HIV-1 vims is a member of the lenti virus group of the retrovimses. Like all other retrovimses, it has an RΝA genome which is replicated via the viral reverse transcriptase, into a DΝA provirus which becomes integrated into the host cell genome.
Various d gs are presently available to treat HIV. They fall into three different classes - nucleoside reverse transcriptase inliibitors, or ΝRTI's such as zidovudine, didanosine, zalcitabine, lamivudine, stavudine, abacavir, tenofovir, foscarnet; non- nucleoside reverse transcriptase inliibitors or ΝΝRTI's such as nevirapine, delavirdine, efavirenz; and protease inliibitors or Pi's such as saquinavir, indinavir, ritonavir, nelfmavir, amprenavir, and lopinavir with ritonavir. Although some of these dmgs may have similar modes of actions, resistance to one does not necessarily confer resistance to another.
Each of the presently available anti-retroviral compounds used to treat AIDS suffers from some disadvantages, including transient CD4 cell count effects, incomplete inhibition of viral replication, toxicity at prescribing doses, and emergence of resistant forms of the vims. As a result, combination therapies are being used to treat patients. Several in vitro studies have suggested that the combination of two or more anti-HTV compounds will more effectively inhibit HIV replication than each dmg alone. Over the last several years, the standard of patient care has evolved such that HIV patients are routinely treated with triple drug combination therapy.
Combination therapy has significantly decreased HIV associated morbidity and mortality. However, a large number of patients are not able to achieve or maintain complete viral suppression even with combination therapy. Drug resistance is the consequence of this incomplete viral suppression. The very high mutagenicity rate of HIV vims (due to the error-prone nature of the viral reverse transcriptase) and the genetic variability of the vims have led to many HIV variants with decreased dmg susceptibility.
HIN-1 replication depends on a virally encoded enzyme, reverse transcriptase (RT) that copies the single-stranded viral RΝA genome into a double-stranded DΝA/RΝA hybrid. The HIN-1 RT enzyme lacks a 3' exonuclease activity which normally helps the "proof-reading" function of a polymerase enzyme to repair errors. HIN-1 has a 9200-base genome and, on average, RT makes at least one error during every transcription of 10,000 bases copied. Therefore, each progeny vims produced may be slightly different from its predecessor. The inaccuracy of RT results in an estimated in vivo forward mutation rate of 3 x 10"5 per base incorporated. Mansky LM. Virology. 1996; 222:391-400.
Many mutations introduced into the HIV-1 genome will compromise the infectivity of the vims; while some are compatible with vims infectivity. The frequency with which genetic variants of HIV- 1 are detected in patients is a function of each variant's replicative vigor (fitness) and the nature of the selective pressures that may be acting on the population within the infected patient, Volberding PA, et al., Antiretroviral therapy for HIN infection: promises and problems. JAMA. 1998;279:1343-4. Selective pressures existing in HIN-1 infected persons include anti-HIN-1 immune responses, the availability of host cells that are susceptible to vims infection in different tissues, and the use of antiretroviral dmg treatments.
The mutagenicity of the vims represents a significant barrier to treatment of the disease. Moreover, the mutagenicity of the vims makes testing for genetic changes in the vims very difficult. Testing for changes in DΝA sequence can proceed via complete sequencing of a target nucleic acid molecule, although many persons in the art believe that such testing is too expensive to ever be routine.
Attention has been increasingly focused on failure to achieve or maintain viral suppression. Several factors may contribute to dmg failure, including poor patient adherence to treatment regimen, dmg potency, pharmacokinetic issues (related to antiretroviral dmg absorption, metabolism, excretion, and dmg-dmg interactions) and dmg resistance Vella S, et al.Aids. 1998; 12:S147-8.b. Although multiple combinations of antiretroviral dmgs may suppress HIV-1 below the level of HJN-1 RΝA detection, this does not mean that the vims is not replicating in "sanctuary" compartments. A therapy regimen may decrease HIN-1 RΝA to below detectable levels, but within months the HIN- 1 viral load may increase again. If HIV-1 is replicating, resistance to therapy can develop.
Because HIN-1 replication occurs rapidly, large numbers of vims variants, including those that display diminished sensitivity to antiretroviral dmgs, are generated. Mutations that confer resistance to antiretroviral dmgs can be present in HIV-1 infected persons before antiretroviral therapy is initiated due to transmission from an individual having had prior therapy or due to spontaneously arising mutations. Once dmg therapy is initiated, the pre-existing population of drug-resistant viruses can rapidly predominate because of a selective advantage. For dmgs such as lamivudine or nevirapine (and other ΝΝRTIs), a single nucleotide change in the HIV-1 RT gene can confer 100- to 1, 000-fold reductions in dmg susceptibility (Schinazi RF, et al Int Antiviral News. 1997;5:129-42). In vivo antiretroviral activity of these dmgs, when used alone, is largely lost within 4 weeks of starting therapy due to the rapid outgrowth of drug-resistant variants, Richman DD, et al. Nevirapine resistance mutations of human immunodeficiency virus type 1 selected during therapy. J Virol. 1994; 68:1660-6. Some mutations selected by antiretroviral dmgs directly affect viral enzymes and cause resistance via decreased dmg binding, whereas others have indirect effects., Condra JH, et al. J Virol. 1996; 70:8270-6, and Harrigan PR, et al. J Virol. 1996; 70:5930-4. Treatment with different antiretroviral dmgs may select for HIV-l variants that harbor the same, or related, mutations. Treatments may even select for the outgrowth of HIV-1 variants that are resistant to dmgs to which the patient has not yet been exposed (cross-resistance).
Mutations can be detected by a technique called "single stranded conformational polymorphism" (SSCP) described by Orita et al., Genomics 5: 874-879 (1989), or by a modification thereof referred to as dideoxy- fingerprinting ("ddF") described by Sarkar et al, Genomics 13: 441-443 (1992). SSCP and ddF both evaluate the pattern of bands created when DNA fragments are electrophoretically separated on a non-denaturing electrophoresis gel. This pattern depends on a combination of the size of the fragments and the three-dimensional conformation of the undenatured fragments. Thus, the pattern can not be used for sequencing, because the theoretical spacing of the fragment bands is not equal.
Others have attempted to determine the genetic status of the vims by probe-based analyses, in which the presence or absence of a specific viral mutation is determined by whether or not an inquiry probe hybridizes to the viral nucleic acid under specific hybridization conditions. For example, Stuyver et al. (PCT International Publication No. WO 99/67428) describe the use of nucleic acid probe panels in a reverse hybridization assay, and Gingeras et al. describe the use of probes to detect pairs of mutations (PCT International Publication No. WO 92/16180). Such assays may suffer from several deficiencies, including being unable to detect new viral mutants, and may not be sensitive enough to cope with the complexity of many mutations within a region.
Other methods include the use of resistance test vectors to culture host cells with vims derived from a patient. The vector may include an indicator gene, such that when a test amount of an anti-HIV dmg is added to the cell culture, in an attempt to measure the resistance of the cloned vims to the dmg in the cell culture system. (Parkin et al, LTSPN 5,837,464).
By far, the most direct information about the genetic composition of the vims in a patient is to directly determine the sequence of the vims (genotyping). The positive clinical benefit of genotyping has been demonstrated in controlled retrospective and prospective intervention based studies such as the Genotypic Antiretroviral Resistance Testing (GART)(Baxter JD, et al. A randomized study of antiretroviral management based on plasma genotypic antiretroviral resistance testing in patients failing therapy. AIDS; 2000;14;F83-F93 and VIRADAPT studies, Durant J, et al. Drug-resistance genotyping in HIN-1 therapy: the VIRADAPT randomised controlled trial, Lancet. 1999; 353:2195-9 and Lancet 1999 Sep 25;354(9184):1128. The greater reduction in viral load when the identification of mutations associated with resistance to specific antiretroviral drags is used as an adjunct to standard of care in treated patients has demonstrated the clinical benefit of the adjunctive use of genotyping to guide therapeutic decisions.
One of the difficulties of genotyping is the inherent variability and heterogeneity of the vims. Vimses have been found to be serologically different on the basis of reactivity of the host immune system to the vims, and on the basis of ELISAs, antibody dependent cellular cytotoxicity assays (ADCC's), and CD4 inactivation procedures. The extensive serologic heterogeneity of the vims is also mirrored in the genetic sequences of the vims. As a result, the HIV-1 vims has been categorized into two genetic groups, based on phylogenetic reconstmction using the viral DNA sequences. Group O (outlier) represents a minority of the HIV-1, and is thought to originate in West Africa, perhaps in Cameroon. The vast majority of HIV-1 sequences that are associated with clinical AIDS are of the Group M (major) type. Within the M group, there are various subtypes (also referred to as clades), having different geographic distributions, as shown below..
HIV-1 Group M Subtype Predominant geographical location
A (including Al and A2) Central Africa
B Europe, North and South America, Australia, and Asia
C East and South Africa, India
D Central Africa
E Southeast Asia (Thailand)
F (including FI and F2) South America (Brazil) and Eastern Europe (Romania)
G Central Africa,Russia, and Portugal
H Central Africa and Taiwan
I Cyprus
J Central Africa and Europe
K
N
O
Each subtype differs from the others in amino acid composition by at least 20% in the viral envelope region, and at least 15% in the viral gag region. Within each subtype, the differences in env can be up to 10%, while the differences in gag can be up to 8%. The viral reverse transcriptase and protease genes, the sites known to be associated with dmg resistance, are found on the viral pol transcript. It is estimated that there is only a 75% similarity in amino acids between subtypes for HIV-1 pol. The variability at the nucleic acid sequence level is even greater.
Retrovimses have propensity to recombine with related retrovimses. If one cell is infected with multiple vimses, recombination events may occur, leading to recombinant subtypes that may then infect other individuals. In addition to the various subtypes known, circulating recombinant subtypes have been observed, such as A/E (Central Africa), A/G (West and Central Africa), A/B (Kalingrad), A/G/H/K (Cyprus/Greece) as well as D/F, and B/D recombinants.
To date, the majority of clinical research in North America and Western Europe has been directed to the Group M subtype B, due to its relative prevalence over the other Group M subtypes. However, as the AIDS epidemic has spread, non-B subtypes are appearing with increasing frequency in North America and Europe. In some instances, for example, an initial infected person with a non-B infection may serve as the infection focal point for a local group, such that in some North American centers (which remain predominantly B subtype), there can be entire localized population groups infected with non-B subtypes. For example, Group O and Subtype G of Group M have recently been found in ADDS patients arriving in the United States from Africa.
Summary of the Invention
The present invention provides primer sequences, and a method of using such sequences for the genotyping of HIN-1 -containing samples, particularly those which have failed genotyping analysis using primer sequences designed for analysis of Group B subtype of the Group M type vims. Thus, a first aspect of the present invention is a combination of primers, including at least one species of forward primer and at least one species of reverse primer. The forward primer(s) can be represented by the degenerate sequence:
RARRARGGGCTGYTGGARATGTS (Seq ID No. 9) optionally with an additional G at either or both ends, where the non-standard letters (those others than A, C, G and T) reflect choices of bases in accordance with conventional nomenclature as outlined below. There are a total of 128 possible sequences represented by this sequence. Variations of these sequences may also be employed. For example, Seq. ID Nos. 11, 15 and 16 show primers where one G is added. Similarly, the reverse primer(s) can be represented by the degenerate sequence: AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No.: 10) or GTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No. 12) In the former case, there are a total of 3456 possible primer species within this definition, hi the latter case, the degenerate sequence also represents 3456 possible sequences, differing only in the initial A. The selected primers, one or more from each group, can be used as reverse transcription, amplification and sequencing primers.
The primers are suitably packaged in a genotyping kit. Such a kit may include reagents in addition to the primers, such as an RNase inhibitor, a reverse transcriptase, a polymerase, and/or dNTP and ddNTP feedstocks.
The primers are suitably employed in the method of the invention, hi accordance with this method, a sample suspected of containing a non-B Group M HIV-1 vims or a Group O HIN-1 vims is treated to recover viral RΝA. The recovered viral RΝA is reverse transcribed to DΝA, which is sequenced using the primers of the invention. The resulting sequence information is used to establish the genotype of the tested vims, i.e., to determine to which subtype the vims in the sample belongs. The method of the invention may be practiced in parallel with genotyping procedures that are designed to evaluate B- subtype vims. Alternatively, the method of the invention is practiced on samples that have previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype vims.
Detailed Description of the Invention
While the terminology used in this application is standard within the art, the following definitions of certain terms are provided to assure clarity.
The term "allele" as used herein means a specific version of a nucleotide sequence at a polymorphic genetic locus.
The term "polymorphic site" as used herein means a given nucleotide location in a genetic locus which is variable within a population.
The term "gene" or "genetic locus" as used herein means a specific nucleotide sequence within a given genome.
The term "location" or "position" of a nucleotide in a genetic locus means the number assigned to the nucleotide in the gene, generally taken from the cDΝA sequence of the genomic sequence of a gene.
The nucleotides adenosine, cytosine, guanine and thymine are represented by their one-letter codes A, C, G, and T respectively. In representations of degenerate primers, the symbol R refers to either G or A, the symbol Y refers to either T/U or C, the symbol M refers to either A or C, the symbol K refers to either G or T U, the symbol S refers to G or C, the symbol W refers to either A or T/U, the symbol B refers to "not A", the symbol D refers to "not C", the symbol H refers to "not G", the symbol V refers to "not T/U" and the symbol N refers to any nucleotide. In the specification and claims of this application, a degenerate primer refers to any or all of the combinations of base choices and to either DNA or the corresponding RNA sequence (i.e., with T replaced by U). Thus, a degenerate primer may represent a single species, or a mixture of two species which fall within the choices, or a mixture of three choices which fall with the choices, and so on up to a mixture containing all the possible combinations.
The term "oligonucleotide primer" as used herein defines a molecule comprised of more than three deoxyribonucleotides or ribonucleotides. Its exact length will depend on many factors relating to the ultimate function and use of the oligonucleotide primer, including temperature, source of the primer and use of the method. The oligonucleotide primer is capable of acting as an initiation point for synthesis when placed under conditions which induce synthesis of a primer extension product complementary to a nucleic acid strand. The conditions can include the presence of nucleotides and an inducing agent such as a DNA polymerase at a suitable temperature and pH. In the preferred embodiment, the primer is a SS oligodeoxyribonucleotide of sufficient length to prime the synthesis of an extension product from a specific sequence in the presence of an inducing agent. In the preferred embodiment, the oligonucleotide primers are at least 18 nucleotides long. Sensitivity and specificity of the oligonucleotide primers are determined by the primer length and uniqueness of sequence within a given sample of template nucleic acid. Primers which are too short, for example, may show non-specific binding. to a wide variety of sequences.
A first aspect of the present invention is a primer combination comprising, in a single solution, at least one forward HIV-1 primer selected from among primers comprising a sequence as represented by the degenerate sequence of Seq ID Nos. 9, for example Seq. ID. Nos. 11, 15 or 16, and preferably from among primers with exactly these sequences, at least one reverse HIV-1 primer selected from among primers comprising a sequence as represented by the degenerate sequences of Seq. ID Nos. 10 or 12, for example Seq. ID. Nos. 13 or 14, and preferably from among primers with exactly these sequences. Wliere the primers are to be used as sequencing primers, the forward primers or the reverse primers are labeled with a detectable label. For most common sequencing instmments, a fluorescent label is desirable, although other labels types including colored, chromogenic, fluorogenic (including chemiluminescent) and radiolabels could also be employed. The primer combination may include other reagents appropriate for reverse transcription, amplification or sequencing, and may, of course, include HIV-1 genetic material for analysis.
Specific forward primers for use in the primer combinations of the invention are: GGAAAAAGGGCTGTTGGAAATGYG (Seq. TD No. 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ID No. 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ID No. 3) including without limitation the following non-degenerate primer sequences: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ID No. 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ID No. 1 S) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ID No. 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. JO No. 11) GAAAAAGGGCTGTTGGAAATGTG (Seq. ID No. 15) GAAAAAGGGCTGTTGGAAATGCG (Seq. ID No. 16).
Specific reverse primers for use in the primer combinations of the invention are: AGTCAGATTTACCCAGGGATTAAAGTAAGGV (Seq. JD No. 4)
AGTCAGATTTACCCAGGGATTAAGGTAAGGV (Seq. ID No. 5)
AGTCAGATTTACCCAGGGATCAAAGTAAGGV (Seq. JD No. 6)
GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. TD No. 7)
AGYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 8) including without limitation the following non-degenerate primer sequences: GTCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No.: 13)
GCCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No.: 14)
The primer combinations described above can be used in a method in accordance with the invention for a sample suspected of containing a non-B Group M HIN-1 vims or a Group O HIN-1 vims to assess the subtype and genotype of the vims. The method comprises the steps of treating the sample to recover viral RNA; reverse transcribing the recovered viral RNA; sequencing the reverse transcription product; and using the results of the sequencing step to establish the genotype of the tested vims. In this method, either or both of the reverse transcription step and the sequencing step are performed using a primer combination as described above. The method of the invention can include the step of performing a parallel genotyping procedure that is designed to evaluate B-subtype vims. Altematively, the method can be utilized with a sample that has previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype vims. This alternative method provides the advantage of not performing needless testing on a sample that proves to be the presently more common B-subtype.
EXAMPLE 1
Degenerate mixtures of forward primers of the sequence GGAAAAAGGGCTGTTGGAAATGYG (Seq. ID No. 1) and reverse primers of the sequence
GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 7) were used to salvage non-B subtypes in samples that could not be genotyped using other primers. The TRUGENE HJN-1 genotyping kit (Visible Genetics Inc., Toronto, Canada) was used to determine the genotype of certain non-B subtypes of HIV-1 vims. RΝA was extracted from patient plasma samples according to the package instructions in a TRUPREP Extraction Kit forviral RΝA. 17ul of RΝA is added to the amplification master mix. The master mix contains (per reaction) 0.2ul of SEQ ID No. 1 (30 pmole/ul), 0.4ul of SEQ ID No. 7 (30 pmole/ul), 6.4 ul of water, 1.75 ul of dNTP, 1.165ul of DTT, and 0.58ul of Rnase inhibitor. The reactions are thermocycled using a Perkin-Elmer 9700 thermocycler using the following temperature/time cycle program:
After incubating the amplification master mix and the RNA together for five minutes at 50 C, 14ul of a second master mix is added and the RT-PCR cycle program is continued. The second master mix contains lOul of RT-PCR buffer, 5ul of Rnase inhibitor, 1 ul of reverse transcriptase enzyme (Superscript, Invitrogen Corporation), and 17.5 ul of DNA polymerase. After the PCR cycle program was completed, samples were sequenced according to the protocol in the TRUGENE HTV-1 package insert (Visible Genetics Inc.).
The following samples were successfully amplified and sequenced. Viral load numbers are provided as copies of viral RNA per milliliter of patient plasma. "Origin" refers to the residence of the patient at the time the plasma was collected.
Sample JD Subtype ORIGIN TYPE Viral Load
1 1-001 B USA co-culture unknown
2 1-002 A/G USA co-culture unknown
3 1-003 F USA co-culture 7.5 x 107
4 1-004 B USA co-culture LInknown
5 1-005 Group O USA co-culture Unknown
6 1-006 E USA co-culture 6.4 x lO6
7 1-007 E USA co-culture 2.6 x 109
8 1-008 B USA co-culture Unknown
9 1-009 E USA co-culture 4.4 x lO5
10 1-010 E USA co-culture unknown
11 1-011 E USA co-culture 1.1 x lO7
12 1-012 C USA co-culture 6.9 x lO6
13 1-013 B USA co-culture Unknown
14 1-014 F USA co-culture Unknown
15 1-015 F/B USA co-culture 2.1 x 10ό
16 1-016 B USA co-culture Unknown
17 1-017 C USA co-culture 5.6 x lO5
IS 1747 A NTH Repos. co-culture 2.5 x 104
19 2386 D NTH Repos. co-culture 4 x l04
20 Wl-1 A Europe patient plasma 2.1 x 104
21 Wl-2 A Europe patient plasma 1.4 x lO5
22 Wl-3 C Europe patient plasma 2.1 x 104 Wl-4 D Europe patient plasma 6.2 x lO4
Wl-5 C Europe patient plasma 9.4 x lO4
Wl-6 A Europe patient plasma 8.5 x lO4
Wl-7 D Europe patient plasma 5.6 x lO5
Wl-8 F Europe patient plasma 5.7 x lO3
Wl-9 C Europe patient plasma Unknown
Wl-10 G Europe patient plasma Unknown
Wl-11 F Europe patient plasma 1.6 x lO5
Wl-12 G Europe patient plasma 5.6 x lO5
Wl-13 G Europe patient plasma 2.3 x lO3
W2-1 A Europe patient plasma 2.2 x 104
W2-2 A Europe patient plasma 1.4 x lO5
W2-3 C Europe patient plasma 2.1 x 104
13866 B Israel patient plasma 1.4 x lO4
15089 B Israel patient plasma 1.0 x lO3
15214 A Israel patient plasma 2.0 x lO3
15422 C Israel patient plasma 1.1 x lO6
16100 C Israel patient plasma 7.2 x lO5
16242 C Israel patient plasma 7.2 x lO5
16360 C Israel patient plasma 2.6 x lO5
16361 C Israel patient plasma 2.2 x lO5
NA A/G Russia patient plasma 2.0 x lO5
NA C Africa patient plasma 6.3 x 103
NA B Israel patient plasma 7.6 x 104
NA C Ethiopia patient plasma 9.2 x lO4
NA C Ethiopia patient plasma 4.1 x 105
NA C Ethiopia patient plasma 2.5 x 104
NA unknown Argentina patient plasma 7.3 x 103
NA unknown Argentina patient plasma 3.6 xlO4
NA C Ethiopia patient plasma 7.3 x 104
NA unknown Argentina patient plasma 4.8 x lO5
NA C Ethiopia patient plasma 1.2 x lO5 55 NA C Ethiopia patient plasma 2.7 x lO3
56 NA C Ethiopia patient plasma 1.9 x lO5
57 NA C Ethiopia patient plasma 5.3 x 104
58 NA C Ethiopia patient plasma 1.6 x lO4
59 NA C Ethiopia patient plasma 1.1 x 105
60 NA C Ethiopia patient plasma 9.3 x 104
61 NA C Ethiopia patient plasma 3.8 x lO4
62 NA C Ethiopia patient plasma 1.0 x lO3
63 NA C Ethiopia patient plasma 2.8 x 104
64 NA C Ethiopia patient plasma 1.4 x lO4
65 NA C Ethiopia patient plasma 7.5 10 5
66 NA B Israel patient plasma 5.5 x lO5
67 NA Uulnknown Israel patient plasma 3.2 x 104
68 NA C Ethiopia patient plasma unknown
69 NA B Europe patient plasma unknown
70 NA K Ivory Coast patient plasma unknown
EXAMPLE 2
Oligonucleotide primers in accordance with the present invention were tested to determine what percentage of non-B subtypes could be genotyped using samples that could not be genotyped using the TRUGENE HIN-1 genotyping kit. 74% of those samples were successfully genotyped. Similarly, greater than 95% of all samples known to be non-B samples were successftilly genotyped using the oligonucleotide primers of the present invention. Panels of non-B subtype vimses were generated, using pLAI as a positive control. After a viral load for each sample was obtained (Roche Amplicor or Organon Teknika ΝASBA), samples were diluted, using a serial dilution procedure, down to 25 copies per reverse transcriptase reaction, hi each case, successful base calling and mutation detection was achieved.
EXAMPLE 3
Using the primers of the present invention, successful amplification and sequencing of HIN-1 vimses from both Group M (various subtypes and recombinants) and Group O was achieved.
HIN-1 Type or Subtype Number non-B's tested Mean % SucessfuUy Amplified
A (Group M) n = > 7 > 95%
B (Group M) n = >200 > 95%
C (Group M) n = >29 > 95%
D (Group M) n = > 3 > 95%
E (Group M) n = > 5 > 95%
F (Group M) n = > 25 > 95%
G (Group M) n = 3 > 95%
K (Group M) n=l 100%
Group O n = 2 100%
Group M Recombinants n=6 100%

Claims

CLALMS
1. A primer combination comprising, in a single solution, at least one foiward HJN-1 primer selected from among primers comprising a sequence represented by the degenerate sequence
RARRARGGGCTGYTGGARATGTS (Seq JJD No. 9) and at least one reverse HJN-1 primer selected from among primers comprising a sequence represented by the degenerate sequence
AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ED No.: 10) or
GTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ED No. 12).
2. The primer combination of claim 1, wherein at least one foiward primer comprises a sequence selected from the group consisting of: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ED No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. JJD No. : 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. JJD No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. JJD No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ED No.: 1) GRARRARGGGCTGTTGGAAATGTGG (Seq. ED No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ED No.: 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ED No. : 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ED No.: 16).
3. The primer combination of claim 1, wherein at least one reverse primer comprises a sequence selected from the group consisting of: AGTCAGATTTACCCAGGGATTAAAGTAAGGV (Seq. JJD No. 4) AGTCAGATTTACCCAGGGATTAAGGTAAGGV (Seq. ED No. 5) AGTCAGATTTACCCAGGGATCAAAGTAAGGV (Seq. JJD No. 6) GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ID No. 7) AGYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No. 8) GTCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No. : 13) GCCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No.: 14).
4. The primer combination of claim 3, wherein at least one forward primer comprises a sequence selected from the group consisting of: GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ED No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. JJD No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. JJD No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. JJD No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ED No.: 1) GRARJIARGGGCTGTTGGAAATGTGG (Seq. ED No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ED No. : 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ED No.: 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ED No. : 16)
5. The primer combination of claim 4, wherein the foiward and reverse primers are members of a set of degenerate foiward and reverse primers, and the primer combination includes at least two species of degenerate foiward and at least two species of degenerate reverse primers.
6. The primer combination of claim 5, wherein the foiward and reverse primers comprise sequences as set forth in Seq. ED Nos. 1 and 7, respectively.
7. The primer combination of claim 5, wherein the foiward primers are members of the set of degenerate primers comprising the sequence: GGAAAAAGGGCTGTTGGAAATGYG (Seq. ED No.: 1).
8. The primer combination of claim 1, wherein the forward primers have sequences as set forth in Seq. ED Nos. 15 and 16.
9. The primer combination of claim 7, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No. 7).
10. The primer combination of claim 9, wherein the reverse primers have the sequence as set forth in Seq. ED Nos. 13 and 14.
11. The primer combination of claim 5, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No. 7).
12. The primer combination of claim 11, wherein the reverse primers have the sequence as set forth in Seq. ED Nos. 13 and 14.
13. The primer combination of any of claims 1-12, wherein the forward primers or the reverse primers are labeled with a detectable label.
14. The primer combination of claim 13, wherein the detectable label is a fluorescent label.
15. A genotyping kit comprising at least one foiward HIN-1 primer selected from among primers comprising a sequence represented by the degenerate sequence
RARRARGGGCTGYTGGARATGTS (Seq ED No. 9) and at least one reverse HIV-1 primer selected fi-om among primers comprising a sequence represented by the degenerate sequence
AGTCARATYTAYBCWGGGATYAARGTRADGV (Seq. JJD No.: 10) or
GTCARATYTAYBCWGGGATYAARGTRADGV (Seq. ID No. 12).
16. The kit of claim 15, wherein at least one foiward primer is selected from the group consisting of:
GGAAAAAGGGCTGTTGGAAATGTGG (Seq. JJD No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ED No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. JJD No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. ED No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ED No.: 1)
GRARRARGGGCTGTTGGAAATGTGG (Seq. ED No.: 2)
GRARRARGGGCTGTTGGAAATGTG (Seq. ED No.: 3)
GAAAAAGGGCTGTTGGAAATGTG (Seq. ED No. : 15)
GAAAAAGGGCTGTTGGAAATGCG. (Seq. ED No.: 16).
17. The kit of claim 15, wherein at least one reverse primer is selected from the group consisting of:
AGTCAGATTTACCCAGGGATTAAAGTAAGGV (Seq. ED No.4)
AGTCAGATTTACCCAGGGATTAAGGTAAGGV (Seq. ED No.5)
AGTCAGATTTACCCAGGGATCAAAGTAAGGV (Seq. ED No.6)
GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No.7)
AGYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No.8)
GTCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No.: 13)
GCCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No.: 14).
18. The kit of claim 17, wherein at least one foiward primer is selected from the group consisting of:
GGAAAAAGGGCTGTTGGAAATGTGG (Seq. ED No.: 17) GGAAAAAGGGCTGTTGGAAATGTG (Seq. ED No.: 18) GGAAAAAGGGCTGTTGGAAATGTCG (Seq. ED No.: 19) GGAAAAAGGGCTGTTGGAAATGTC (Seq. ED No.: 11) GGAAAAAGGGCTGTTGGAAATGYG (Seq. ED No.: 1) GRARJIARGGGCTGTTGGAAATGTGG (Seq. JD No.: 2) GRARRARGGGCTGTTGGAAATGTG (Seq. ED No.: 3) GAAAAAGGGCTGTTGGAAATGTG (Seq. ED No.: 15) GAAAAAGGGCTGTTGGAAATGCG. (Seq. ED No.: 16).
19. The kit of claim 15, wherein the forward and reverse primers are members of a set of degenerate fonvard and reverse primers, and the primer combination includes at least two species of degenerate forward and at least two species of degenerate reverse primers.
20. The kit of claim 19, wherein the foiward primers are members of the set of degenerate primers comprising the sequence: GGAAAAAGGGCTGTTGGAAATGYG (Seq. ID No.: 1).
21. The kit of claim 20, wherein the forward primers have the sequence as set forth in Seq. JJD Nos. 15 and 16.
22. The kit of claim 20, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No. 7).
23. The kit of claim 22, wherein the fonvard primers have the sequence as set forth in Seq. JJD Nos. 15 and 16.
24. The kit of claim 23, wherein the reverse primers have the sequence as set forth in Seq. ED Nos. 13 and 14.
25. The kit of claim 19, wherein the reverse primers are members of the set of degenerate primers comprising the sequence: GYCAGATTTACCCAGGGATTAAAGTAAGGC (Seq. ED No. 7).
26. The kit of claim 25, wherein the reverse primers have the sequence as set forth in Seq. ED Nos. 13 and 14.
27. The kit of any of claims 15-26, wherein the foiward primers or the reverse primers are labeled with a detectable label.
28. The kit of claim 27, wherein the detectable label is a fluorescent label.
29. The kit of any of claims 15-26, wherein the kit further comprises one or more reagents selected from the group consisting of an RNase inhibitor, a reverse transcriptase, a polymerase, and dNTP and ddNTP feedstocks.
30. The kit of claim 29, wherein the forward primers or the reverse primers are labeled with a detectable label.
31. The kit of claim 30, wherein the detectable label is a fluorescent label.
32. A method for evaluating a sample suspected of containing a non-B Group M HIN-1 vims or a Group O HIN-1 vims to assess the type of the vims, comprising the steps of: treating the sample to recover viral RΝA; reverse transcribing the recovered viral RΝA; sequencing the reverse transcription product; and using the results of the sequencing step to establish the genotype of the tested vims, wherein at least one of the reverse transcription step and the sequencing step is performed using a primer combination in accordance with any of claims 1-12.
33. The method of claim 32, further comprising the step of performing a parallel genotyping procedures that is designed to evaluate B-subtype vims.
34. The method of claim 32, wherein the sample is one that has previously been the subject of a failed genotyping attempt using genotyping procedures that are designed to evaluate B-subtype vims.
EP02721252A 2001-03-05 2002-03-05 Methods and primers for evaluating hiv-1 mutations Expired - Lifetime EP1390380B1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US27368301P 2001-03-05 2001-03-05
US273683P 2001-03-05
PCT/US2002/006632 WO2002070731A2 (en) 2001-03-05 2002-03-05 Methods and primers for evaluating hiv-1 mutations

Publications (3)

Publication Number Publication Date
EP1390380A2 true EP1390380A2 (en) 2004-02-25
EP1390380A4 EP1390380A4 (en) 2005-07-06
EP1390380B1 EP1390380B1 (en) 2009-09-30

Family

ID=23044977

Family Applications (1)

Application Number Title Priority Date Filing Date
EP02721252A Expired - Lifetime EP1390380B1 (en) 2001-03-05 2002-03-05 Methods and primers for evaluating hiv-1 mutations

Country Status (6)

Country Link
US (1) US7847087B2 (en)
EP (1) EP1390380B1 (en)
JP (1) JP2004537278A (en)
AU (1) AU2002252192A1 (en)
DE (1) DE60233871D1 (en)
WO (1) WO2002070731A2 (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US9040244B2 (en) 2011-07-05 2015-05-26 The United States Of America As Represented By The Secretary Of The Department Of Health And Human Services, Centers For Disease Control And Prevention HIV-1 genotyping assay for global surveillance of HIV-1 drug resistance
US10144976B2 (en) 2014-05-22 2018-12-04 Case Western Reserve University HIV-1 genotyping and coreceptor tropism assay

Family Cites Families (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1715064B1 (en) * 1989-06-02 2009-02-25 Institut Pasteur Nucleotide sequences derived from the genomes of the retroviruses HIV-1, HIV-2 and SIV, and their application to the amplification of pol sequences in these viral genomes and to the in vitro diagnosis of infections resulting from these viruses
US5149691A (en) 1991-03-12 1992-09-22 Creative Biomolecules, Inc. Issue repair and regeneration through the use of platelet derived growth factor (pdgf) in combination with dexamethasone
US5599662A (en) 1995-02-17 1997-02-04 Hoffmann-La Roche Inc. Oliconucleotide primers and probes for the detection of HIV-1
US5837464A (en) 1996-01-29 1998-11-17 Virologic, Inc. Compositions and methods for determining anti-viral drug susceptibility and resistance and anti-viral drug screening
DE19644248A1 (en) 1996-10-24 1998-04-30 Boehringer Mannheim Gmbh Primers and probes for the detection of HIV
US5962665A (en) * 1997-06-16 1999-10-05 Abbott Laboratories Nucleic acid primers and probes for detecting HIV-1 and HIV-2
EP1090147A2 (en) 1998-06-24 2001-04-11 Innogenetics N.V. Method for detection of drug-selected mutations in the hiv protease gene
CA2406830C (en) 2000-04-20 2012-10-02 Virco Bvba Method for mutation detection in hiv using pol sequencing
US6800463B1 (en) 2000-04-20 2004-10-05 Virco Bvba Method for mutation detection in HIV-1 using pol sequencing

Also Published As

Publication number Publication date
DE60233871D1 (en) 2009-11-12
WO2002070731A3 (en) 2003-12-11
JP2004537278A (en) 2004-12-16
US20050084854A1 (en) 2005-04-21
EP1390380B1 (en) 2009-09-30
AU2002252192A1 (en) 2002-09-19
US7847087B2 (en) 2010-12-07
WO2002070731A2 (en) 2002-09-12
EP1390380A4 (en) 2005-07-06

Similar Documents

Publication Publication Date Title
EP1026263B1 (en) Oligonucleotide primers for reverse transcription for efficient detection of HIV-1 and HIV-2 and methods of use thereof
Kozal et al. Extensive polymorphisms observed in HIV–1 clade B protease gene using high–density oligonucleotide arrays
Pasquier et al. HIV-1 subtyping using phylogenetic analysis of pol gene sequences
USRE37918E1 (en) Nucleic acid derivatives
Shafer et al. Sequence and drug susceptibility of subtype C reverse transcriptase from human immunodeficiency virus type 1 seroconverters in Zimbabwe
EP0817866A1 (en) Method for detection of drug-induced mutations in the reverse transcriptase gene
Bessong et al. Resistance mutational analysis of HIV type 1 subtype C among rural South African drug-naive patients prior to large-scale availability of antiretrovirals
US8575324B2 (en) Methods and reagents for molecular detection of HIV-1 groups M, N and O
CA2406830C (en) Method for mutation detection in hiv using pol sequencing
WO2008062385A2 (en) Antiretroviral drug resistance testing
EP1390380B1 (en) Methods and primers for evaluating hiv-1 mutations
US7235387B2 (en) Method for mutation detection in HIV-1 using pol sequencing
EP1284296A1 (en) Method for the detection of minority genomes in virus quasispecies using dna microchips
Oliveira et al. Enfuvirtide (T-20) resistance-related mutations in HIV type 1 subtypes B, C, and F isolates from Brazilian patients failing HAART
Belda et al. Sequence Note: A Dual Subtype B/E HIV Type 1 Infection with a Novel V3 Loop Crown Motif among Infections Acquired in Thailand and Imported into England
Tirado et al. Evolution of SIV envelope in morphine-dependent rhesus macaques with rapid disease progression
JP3351773B2 (en) HIV-1 subtype determination method
WO2014037712A2 (en) Hiv-1 detection
Yabar et al. Polymorphism, recombination, and mutations in HIV type 1 gag-infecting Peruvian male sex workers
Koch et al. Comparison of two commercial assays for the detection of insertion mutations of HIV-1 reverse transcriptase
Kanizsai et al. Monitoring of drug resistance in therapy-naive HIV infected patients and detection of African HIV subtypes in Hungary
USRE39282E1 (en) Nucleic acid derivatives
Varathan Molecular characterisation of HIV-1 recombinants and non-subtype C viruses in South Africa
Gichana HIV-1 molecular diversity and drug resistance mutations amongst immuno-competent, therapy naïve infants/children and adults in Yaounde, Cameroon
Sukhanova et al. Polymorphism of the genome region coding for protease and reverse transcriptase in HIV type 1 subtype a variants prevailing in CIS countries

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030902

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BAYER HEALTHCARE, LLC

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12Q 1/70 A

A4 Supplementary search report drawn up and despatched

Effective date: 20050524

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: BAYER HEALTHCARE LLC

17Q First examination report despatched

Effective date: 20060509

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SIEMENS HEALTHCARE DIAGNOSTICS INC.

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

GRAS Grant fee paid

Free format text: ORIGINAL CODE: EPIDOSNIGR3

GRAA (expected) grant

Free format text: ORIGINAL CODE: 0009210

AK Designated contracting states

Kind code of ref document: B1

Designated state(s): DE ES FR GB IT

REG Reference to a national code

Ref country code: GB

Ref legal event code: FG4D

REF Corresponds to:

Ref document number: 60233871

Country of ref document: DE

Date of ref document: 20091112

Kind code of ref document: P

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: ES

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20100110

PLBE No opposition filed within time limit

Free format text: ORIGINAL CODE: 0009261

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: NO OPPOSITION FILED WITHIN TIME LIMIT

26N No opposition filed

Effective date: 20100701

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: IT

Free format text: LAPSE BECAUSE OF FAILURE TO SUBMIT A TRANSLATION OF THE DESCRIPTION OR TO PAY THE FEE WITHIN THE PRESCRIBED TIME-LIMIT

Effective date: 20090930

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: DE

Free format text: LAPSE BECAUSE OF NON-PAYMENT OF DUE FEES

Effective date: 20111001

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 15

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 16

REG Reference to a national code

Ref country code: FR

Ref legal event code: PLFP

Year of fee payment: 17

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: FR

Payment date: 20210315

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: DE

Payment date: 20210519

Year of fee payment: 20

PGFP Annual fee paid to national office [announced via postgrant information from national office to epo]

Ref country code: GB

Payment date: 20210406

Year of fee payment: 20

REG Reference to a national code

Ref country code: DE

Ref legal event code: R071

Ref document number: 60233871

Country of ref document: DE

REG Reference to a national code

Ref country code: GB

Ref legal event code: PE20

Expiry date: 20220304

PG25 Lapsed in a contracting state [announced via postgrant information from national office to epo]

Ref country code: GB

Free format text: LAPSE BECAUSE OF EXPIRATION OF PROTECTION

Effective date: 20220304