EP1373564A2 - Diagnostic de maladies declarees ou de la predisposition a certaines maladies - Google Patents
Diagnostic de maladies declarees ou de la predisposition a certaines maladiesInfo
- Publication number
- EP1373564A2 EP1373564A2 EP01980314A EP01980314A EP1373564A2 EP 1373564 A2 EP1373564 A2 EP 1373564A2 EP 01980314 A EP01980314 A EP 01980314A EP 01980314 A EP01980314 A EP 01980314A EP 1373564 A2 EP1373564 A2 EP 1373564A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- seq
- dna
- oligomer
- methylation
- cytosine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4702—Regulators; Modulating activity
- C07K14/4703—Inhibitors; Suppressors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/82—Translation products from oncogenes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/154—Methylation markers
Definitions
- the present invention describes nucleic acids, oligonucleotides, PNA oligomers and a method for the diagnosis of existing diseases or the predisposition to certain diseases.
- CpG islands The methylation of CpG islands is often equated with transcription inactivity. Although there is clear evidence that the CpG islands can be found in the promoters of the genes, not all CpG islands and methylation sites are located in known promoters. With various tissue-specific and “imprinting” genes, the CpG islands are located at considerable distances downstream from the start of transcription, and many genes have multiple promoters. Methylation of CpG dinucleotides has been proven to be the cause of a large number of diseases. In contrast to classic mutations, it is in DNA methylation by a mechanism that describes base substitution without changing the coding function of a gene: this interplay between epigenetic modification and classical mutations play an important role in tumorigenesis.
- focal hypermethylation and generalized genomic demethylation are characteristics of many different types of tumors. It is believed that tumorigenesis and tumor progression, on the one hand, by hypermethylation-induced mutation events and, on the other hand, by switching off genes that control cellular proliferation and / or the induced reactivation of genes via demethylation, which are only used for embryological development, caused.
- the majority of mutation-negative colon cancer cases are due to the hypermethylation of the hMLH1 promoter and the subsequent non-expression of hMLH1, a repair gene for mismatches (Bevilacqua RA, Simpson AJ.Methylation of the hMLH1 promoter but no hMLH1 mutations in sporadic gastric carcinomas with high -level microsatellite instability. Int J Cancer. 2000 Jul 15; 87 (2): 200-3.).
- the loss of expression is correlated with the methylation of CpG islets in the promoter sequence of an RAS effector homolog.
- a variety of diseases associated with methylation are closely related to the tumor suppressor genes p16 or p15 genes.
- a relationship between Mycoso fungoides and the hypermethylation of the p16 (INK4a) gene is assumed (Navas IC, Ortiz-Romero PL, Villue ⁇ das R, Martinez P, Garcia C, Gomez E, Rodriguez JL, Garcia D, Vanac cha F, Igiesias L , Piris MA, Algara P, p16 (INK4a) gene alterations are frequent in iesions of mycosis fungoides. Am J Pathol. 2000 May; 156 (5): 1565-72).
- Cholangiocarcinoma which is associated with primary sclerosing cholangitis, is associated with the inactivation of the p16 tumor suppressor gene, which in turn is caused by the
- Eisenberger CF Yip L, Rashid A, Chow JT, Pitt HA, Sidransky D, Chromosome 9p21 loss and p16 inactivation in primary sclerosing cholangitis-associated cholangiocarcinoma.
- Hypermethylation plays a role (Nakamura M, Sugita K, Inukai T, Goi K, lijima K, Tezuka T,
- CpG methylation also elicits the progression of T cell leukemia, which occurs in
- CDKN2A gene is associated with the progression of adult T-cell leukemia. Cancer Res.
- NEP promoter may help stimulate the development of the neuropeptide
- retinoblastoma gene is thought to have DNA methylation in several exons involved in the disease (Mancini D, Singh S, Ainsworth P, Rodenhiser D, Constitutively methylated
- Methylation pattern suspected with disease progression (Guinn BA, Mills Kl, p53 mutations, methylation and genomic instability in the progression of chronic myeloid leukemia. Leuk lymphoma. 1997 Jul; 26 (3-4): 211-26).
- a connection with methylation has also been demonstrated for acute myeloid leukemia (Melki JR, Vincent PC, Clark SJ. Concurrent DNA hypermethylation of multiple genes in acute myeloid leukemia. Cancer Res. 1999 Aug 1; 59 (15): 3730-40).
- a tumor-specific methylation site was identified in the suppressor gene for the Wilms tumor (Kleymenova EV, Yuan X, LaBate ME, Walker CL, Identification of a tumor-specific methylation site in the Wilms tumor suppressor gene. Oncogene. 1998 Feb 12; 1 ⁇ (6 ): 713-20). In Burkitt's lymphoma, some promoters show complete CpG methylation (Tao Q, Robertson KD, Manns A, Hildesheim A, Ambinder RF, Epstein-Barr virus (EBV) in endemic Burkitt's lymphoma: molecular analysis of primary tumor tissue. Blood. 1998 Feb 15; 91 (4): 1373-81).
- DNA methylation is thought to play a role in thyroid carcinoma (Venkataraman GM, Yatin M, Marcinek R, Ain KB, Restoration of iodide uptake in dedifferentiated thyroid carcinoma: relationship to human Na + / l-symporter gene methylation status. J Clin Endocrinol Metab. 1999 Jul; 84 (7): 2449-57).
- Methylation-regulated expression was detected for the ICF syndrome (Kondo T, Bobek MP, Kuick R, Lamb B, Zhu X, Narayan A, Bourc'his D, Viegas-Pequignot E, Ehrlich M, Hanash SM, Whole-genome methylation scan in ICF syndrome: hypomethylation of non-satellite DNA repeats D4Z4 and NBL2).
- the degree of chromosome fragility is determined by the methylation (de Muniain AL, Cobo AM, Poza JJ, Saenz A, [Diseases due to instability of DNA]. Neurologia. 1995 Dec; 10 Suppl 1: 12-9).
- 5-Methylcytosine is the most common covalently modified base in the DNA of eukaryotic cells. For example, it plays a role in the regulation of transcription, in genetic imprinting and in tumorigenesis. The identification of 5-methylcytosine as a component of genetic information is therefore of considerable interest. However, 5-methylcytosine positions cannot be identified by sequencing since 5-methylcytosine has the same base pairing behavior as cytosine. In addition, in the case of PCR amplification, the epigenetic information which the 5-methylcytosines carry is completely lost.
- Matrix-assisted laser desorption / ionization mass spectrometry is a very powerful development for the analysis of biomolecules (Karas, M. and Hillenkamp, F. (1988), Laser desorption ionization of proteins with molecular masses exeeding 10000 daltons. Anal. Chem. 60: 2299-2301).
- An analyte is embedded in a light-absorbing matrix. The matrix is evaporated by a short pulse of Lase and the analyte molecule is thus transported unfragmented into the gas phase. The ionization of the analyte is achieved by collisions with matrix molecules.
- An applied voltage accelerates the ions into a field-free flight tube. Because of your different masses, ions are accelerated to different extents. Smaller ions reach the detector earlier than larger ones.
- MALDI-TOF spectroscopy is ideal for the analysis of peptides and proteins.
- the analysis of nucleic acids is somewhat more difficult (Gut, I.G. and Beck, S. (1995)), DNA and Matrix Assisted Laser Deso ⁇ tion ionization Mass Spectrometry. Molecular Biology: Current Innovations and Future Trends 1: 147-157.)
- the sensitivity is about 100 times worse than for peptides and decreases disproportionately with increasing fragment size.
- nucleic acids that have a backbone that is often negatively charged the ionization process through the matrix is much more inefficient.
- MALDI-TOF spectroscopy the choice of the matrix plays an eminently important role.
- Genomic DNA is obtained by standard methods from DNA from cell, tissue or other test samples. This standard methodology can be found in references such as Fritsch and Maniatis eds., Molecular Cloning: A Laboratory Manual, 1989.
- the present invention is intended to provide oligonucleotides and / or PNA oligomers for the detection of cytosine methylations and a method which is suitable for diagnosis existing diseases or the predisposition to certain diseases by analyzing a set of genetic and / or epigenetic parameters is particularly suitable.
- the present invention describes a set of at least 10 oligomer probes (oligonucleotides and / or PNA oligomers) which are used to detect the cytosine methylation state in chemically pretreated genomic DNA (Seq. ID 1 to Seq. ID 40712). With these probes it is possible to analyze a set of genetic and / or epigenetic parameters for the diagnosis of existing diseases or for the diagnosis of the predisposition to certain diseases.
- oligomer probes oligonucleotides and / or PNA oligomers
- Genetic parameters in the sense of this invention are mutations and polymorphisms of the claimed nucleic acids (Seq. ID 1 to Seq. ID 40712) and sequences further required for their regulation.
- insertions, deletions, point mutations, inversions and polymorphisms and particularly preferably SNPs (single nucleotide polymorphisms) can be referred to as mutations.
- Polymorphisms can also be insertions, deletions or inversions.
- Epigenetic parameters in the sense of this invention are, in particular, cytosine methylations and further chemical modifications of DNA bases of the claimed nucleic acids (Seq. ID 1 to Seq. ID 40712) and sequences which are also required for their regulation. Further epigenetic parameters are, for example, the acetylation of histones, which, however, cannot be analyzed directly with the method described, but in turn correlates with DNA methylation. From the chemically pretreated DNA, at least 18 base pairs long sections from Seq. ID 1 to Seq. ID 40712 used for diagnosis. Oligomers with a length of at least 9 nucleotides are used as detectors for these sections.
- the oligomers contain at least one CpG dinucleotide.
- the cytosine of the corresponding CpG dinucleotide is approximately in the middle third of the oligomer. It is crucial that in the respective set of oligomers for at least each of the CpG dinucleotides at least one oligonucleotide from Seq. ID 1 to Seq. ID 40712 available is
- the oligomers are produced on a carrier material in a fixed arrangement, with at least one oligomer being coupled to a solid phase.
- At least one oligomer is bound to a solid phase.
- At least ten of the oligomers are used for the detection of the cytosine methylation state and / or of single nucleotide polymorphisms (SNPs) in chemically pretreated genomic DNA.
- SNPs single nucleotide polymorphisms
- the oligomers are preferably used to diagnose adverse drug effects, cancer, CNS malfunctions, damage or illnesses, aggressive symptoms or behavioral disorders, clinical, psychological and social consequences of brain injuries, psychotic disorders and personality disorders, dementia and / or associated syndromes, cardiovascular disease, Malfunction, damage or disease of the gastrointestinal tract, malfunction, damage or disease of the respiratory system, injury, inflammation, infection, immunity and / or convalescence, malfunction, damage or disease of the body as a deviation in the development process, malfunction, damage or disease of the skin Muscles, connective tissue or bones, endocrine and metabolic dysfunction, damage or illness, headache and sexual dysfunction through analysis of methylation patterns.
- At least one of the nucleic acids listed in the appendix is also preferably used for the analysis of a set of genetic and / or epigenetic parameters for the diagnosis of existing diseases or for the diagnosis of the predisposition to certain diseases.
- a genomic DNA sample is chemically treated in such a way that at the 5-position unmethylated cytosine bases are converted into uracil, thymine or another base that is not similar to the cytosine in terms of hybridization behavior. This is understood below as chemical pretreatment.
- the genomic DNA to be analyzed is preferably obtained from the usual sources for DNA, such as. B. cell lines, blood, sputum, stool, urine, brain spinal fluid, paraffin-embedded tissue, such as tissue from the eyes, intestines, kidneys, brain, heart, prostate, lungs, chest or liver, histological slides and all possible combinations hereof.
- sources for DNA such as. B. cell lines, blood, sputum, stool, urine, brain spinal fluid, paraffin-embedded tissue, such as tissue from the eyes, intestines, kidneys, brain, heart, prostate, lungs, chest or liver, histological slides and all possible combinations hereof.
- fragments from the chemically pretreated genomic DNA are amplified using primer oligonucleotides.
- More than 10 different fragments that are 100-2000 base pairs long are preferably amplified.
- the amplification is carried out using the Polymerase chain reaction (PCR) through, preferably using a thermostable DNA polymerase.
- PCR Polymerase chain reaction
- the amplification of several DNA sections is carried out in one reaction vessel.
- the set of primer oligonucleotides comprises at least two oligonucleotides, the sequences of which are each reversely complementary or identical to a section of the base sequences listed in the appendix (Seq. ID 1 to Seq. ID 40712) that is at least 18 base pairs long.
- the primer oligonucleotides are preferably characterized in that they contain no CpG dinucleotide.
- different oligomers are arranged on a flat solid phase in the form of a rectangular or hexagonal grid.
- the amplification takes place by extending primer oligonucleotides which are bound to a solid phase.
- the solid phase surface preferably consists of silicon, glass, polystyrene, aluminum, steel, iron, copper, nickel, silver or gold.
- the amplificates obtained in the second process step are then hybridized to a set of oligonucleotides and / or PNA probes or to an array.
- the set used in the hybridization preferably consists of at least 10 oligomer probes.
- the amplificates serve as probes that hybridize to oligonucleotides previously bound to a solid phase.
- the non-hybridized fragments are then removed.
- Said oligomers comprise at least one base sequence with a length of 9 nucleotides, which contains at least one CpG dinucleotide.
- the cytosine of the corresponding CpG dinucleotide is approximately in the middle third of the oligomer.
- the non-hybridized amplificates are removed.
- the hybridized amplificates are detected.
- markings attached to the amplificates can be identified at any position of the solid phase at which an oligonucleotide sequence is located.
- the labels of the amplified products are fluorescent labels.
- the labels of the amplificates are radionuclides.
- the markings of the amplificates are detachable molecular fragments with a typical mass, which are detected in a mass spectrometer.
- the amplicons, fragments of the amplicons or probes complementary to the amplicons are detected in the mass spectrometer.
- the fragments generated have a single positive or negative net charge for better detectability in the mass spectrometer.
- the detection is carried out and visualized by means of matrix assisted laser desorption / ionization mass spectrometry (MALDI) or by means of electrospray mass spectrometry (ESI).
- MALDI matrix assisted laser desorption / ionization mass spectrometry
- ESI electrospray mass spectrometry
- the use of a method for diagnosis is preferred existing diseases or the predisposition to certain diseases by analyzing a set of genetic and / or epigenetic parameters.
- the present invention also relates to a kit consisting of a reagent containing bisulfite, a set of primer oligonucleotides comprising at least two oligonucleotides, the sequences of which each have at least an 18 base pair section of the base sequences listed in the appendix (Seq. ID 1 to Seq.! D 40712) or are complementary to them for the preparation of the amplificates, oligonucleotides and / or PNA oligomers and instructions for carrying out and evaluating the method described.
- the following example relates to a fragment of the gene hMLH1 associated with the inheritable nonpolyposis colorectal cancer, in which a specific CG position is examined for methylation.
- a genomic sequence is treated using bisulfite (hydrogen sulfite, disulfite) in such a way that all of the cytosines that are not methylated at the 5-position of the base are changed in such a way that a base which is different with regard to the base pairing behavior is formed, while the base in the 5-position methylated cytosines remain unchanged.
- bisulfite in the concentration range between 0.1 M and 6 M is used for the reaction, an addition takes place at the unmethylated cytosine bases.
- a denaturing reagent or solvent and a radical scavenger must be present.
- the treated DNA sample is diluted with water or an aqueous solution. Desulfonation of the DNA (10-30 min, 90-100 ° C.) at alkaline pH is then preferably carried out.
- the DNA sample is amplified in a polymerase chain reaction, preferably with a heat-resistant DNA polymerase.
- cytosines of the gene hMLH1 here from a 1551 bp 5 'flanking region, are examined.
- a specific fragment with a length of 719 bp is amplified with the specific primer oligonucleotides AGCAACACCTCCATGCACTG and TTGATTGGACAGCTTGAATGC.
- This amplificate serves as a sample which is attached to an oligonucleotide previously bound to a solid phase to form a Duplex structure hybridizes, for example GAAGAGCGGACAG, with the cytosine to be detected located at position 588 of the amplificate.
- the detection of the hybridization product is based on Cy3 and Cy5 fluorescence-labeled primer oligonucleotides that were used for the amplification.
- a hybridization reaction of the amplified DNA with the oligonucleotide occurs only if a methylated cytosine was present at this point in the bisulfite-treated DNA.
- the methylation status of the respective cytosine to be examined thus decides on the hybridization product.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Immunology (AREA)
- Toxicology (AREA)
- Biotechnology (AREA)
- Pathology (AREA)
- Oncology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
Jeu de sondes oligomères (oligonucléotides et / ou oligomères PNA) qui servent à détecter l'état de méthylation de la cytosine dans des acides nucléiques. Ces sondes sont particulièrement adaptées pour le diagnostic de maladies déclarées par analyse d'un groupe de paramètres génétiques et / ou épigénétiques.
Applications Claiming Priority (3)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
DE10043826 | 2000-09-01 | ||
DE10043826 | 2000-09-01 | ||
PCT/EP2001/010073 WO2002018631A2 (fr) | 2000-09-01 | 2001-09-01 | Diagnostic de maladies declarees ou de la predisposition a certaines maladies |
Publications (1)
Publication Number | Publication Date |
---|---|
EP1373564A2 true EP1373564A2 (fr) | 2004-01-02 |
Family
ID=7655132
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
EP01980314A Withdrawn EP1373564A2 (fr) | 2000-09-01 | 2001-09-01 | Diagnostic de maladies declarees ou de la predisposition a certaines maladies |
Country Status (5)
Country | Link |
---|---|
US (1) | US20050064401A1 (fr) |
EP (1) | EP1373564A2 (fr) |
JP (1) | JP2005512499A (fr) |
AU (1) | AU2002212187A1 (fr) |
WO (1) | WO2002018631A2 (fr) |
Families Citing this family (40)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6727230B1 (en) * | 1994-03-25 | 2004-04-27 | Coley Pharmaceutical Group, Inc. | Immune stimulation by phosphorothioate oligonucleotide analogs |
US20030026782A1 (en) * | 1995-02-07 | 2003-02-06 | Arthur M. Krieg | Immunomodulatory oligonucleotides |
US6207646B1 (en) * | 1994-07-15 | 2001-03-27 | University Of Iowa Research Foundation | Immunostimulatory nucleic acid molecules |
EP0855184A1 (fr) * | 1997-01-23 | 1998-07-29 | Grayson B. Dr. Lipford | Composition pharmaceutique comprenant un polynucléotide et un antigène notamment pour la vaccination |
US6406705B1 (en) * | 1997-03-10 | 2002-06-18 | University Of Iowa Research Foundation | Use of nucleic acids containing unmethylated CpG dinucleotide as an adjuvant |
US20030022854A1 (en) | 1998-06-25 | 2003-01-30 | Dow Steven W. | Vaccines using nucleic acid-lipid complexes |
US6693086B1 (en) * | 1998-06-25 | 2004-02-17 | National Jewish Medical And Research Center | Systemic immune activation method using nucleic acid-lipid complexes |
US7585847B2 (en) * | 2000-02-03 | 2009-09-08 | Coley Pharmaceutical Group, Inc. | Immunostimulatory nucleic acids for the treatment of asthma and allergy |
US20040131628A1 (en) * | 2000-03-08 | 2004-07-08 | Bratzler Robert L. | Nucleic acids for the treatment of disorders associated with microorganisms |
KR100917101B1 (ko) * | 2000-08-04 | 2009-09-15 | 도요 보세키 가부시키가이샤 | 플렉시블 금속적층체 및 그 제조방법 |
US20040053880A1 (en) * | 2002-07-03 | 2004-03-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7576066B2 (en) * | 2002-07-03 | 2009-08-18 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7605138B2 (en) * | 2002-07-03 | 2009-10-20 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7569553B2 (en) * | 2002-07-03 | 2009-08-04 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
US7807803B2 (en) * | 2002-07-03 | 2010-10-05 | Coley Pharmaceutical Group, Inc. | Nucleic acid compositions for stimulating immune responses |
AU2003257587A1 (en) * | 2002-08-23 | 2004-03-11 | Japan As Represented By President Of National Cancer Center | Method of evaluating degree of canceration of human-origin specimen |
ZA200503511B (en) * | 2002-10-29 | 2006-10-25 | Coley Pharmaceutical Group Ltd | Use of CPG oligonucleotides in the treatment of hepatitis C virus infection |
EP1578954A4 (fr) * | 2002-12-11 | 2010-08-11 | Coley Pharm Group Inc | Acides nucleiques 5'cpg et leurs methodes d'utilisation |
US8158768B2 (en) | 2002-12-23 | 2012-04-17 | Dynavax Technologies Corporation | Immunostimulatory sequence oligonucleotides and methods of using the same |
KR101178816B1 (ko) * | 2002-12-23 | 2012-09-07 | 다이나박스 테크놀로지 코퍼레이션 | 면역자극성 서열 올리고뉴클레오타이드 및 이의 이용방법 |
CA2521050A1 (fr) * | 2003-04-02 | 2004-10-14 | Coley Pharmaceutical Group, Ltd. | Formulations de type huile-dans-l'eau a base d'acides nucleiques immunostimulateurs, et procedes d'utilisation associes |
US20050013812A1 (en) * | 2003-07-14 | 2005-01-20 | Dow Steven W. | Vaccines using pattern recognition receptor-ligand:lipid complexes |
KR100558851B1 (ko) * | 2004-01-08 | 2006-03-10 | 학교법인연세대학교 | 면역조절능력이 증가된 CpG 올리고데옥시뉴클레오티드변형체 |
AU2007237444B2 (en) * | 2006-04-17 | 2013-05-23 | Epigenomics Ag | Methods and nucleic acids for the detection of colorectal cell proliferative disorders |
US8084734B2 (en) * | 2006-05-26 | 2011-12-27 | The George Washington University | Laser desorption ionization and peptide sequencing on laser induced silicon microcolumn arrays |
AU2008334901A1 (en) * | 2007-12-11 | 2009-06-18 | Epigenomics Ag | Methods and nucleic acids for analyses of lung carcinoma |
WO2009105549A2 (fr) * | 2008-02-19 | 2009-08-27 | Oncomethylome Sciences Sa | Détection et pronostic de cancer du poumon |
US20110195412A1 (en) * | 2008-09-05 | 2011-08-11 | James Timmons | Predictive Biomarkers for Response to Exercise |
US8110796B2 (en) | 2009-01-17 | 2012-02-07 | The George Washington University | Nanophotonic production, modulation and switching of ions by silicon microcolumn arrays |
WO2010089538A2 (fr) * | 2009-02-03 | 2010-08-12 | Oncomethylome Sciences Sa | Procédés de détection d'un cancer colorectal |
US9490113B2 (en) * | 2009-04-07 | 2016-11-08 | The George Washington University | Tailored nanopost arrays (NAPA) for laser desorption ionization in mass spectrometry |
JP6013910B2 (ja) * | 2009-06-26 | 2016-10-25 | エピゲノミクス アーゲー | 膀胱細胞増殖性障害の分析のための方法及び核酸 |
WO2012154979A2 (fr) * | 2011-05-12 | 2012-11-15 | The Johns Hopkins University | Procédé de détection d'un cancer par l'intermédiaire d'une perte généralisée de stabilité de domaines épigénétiques, et compositions associées |
GB201121924D0 (en) * | 2011-12-20 | 2012-02-01 | Fahy Gurteen Labs Ltd | Detection of breast cancer |
US10011878B2 (en) * | 2014-12-12 | 2018-07-03 | Exact Sciences Development Company | Compositions and methods for performing methylation detection assays |
US10465249B2 (en) * | 2014-12-12 | 2019-11-05 | Exact Sciences Development Company, Llc | Method of characterizing ZDHHC1 DNA |
DE102015009187B3 (de) * | 2015-07-16 | 2016-10-13 | Dimo Dietrich | Verfahren zur Bestimmung einer Mutation in genomischer DNA, Verwendung des Verfahrens und Kit zur Durchführung des Verfahrens |
EP3336197B1 (fr) | 2016-12-16 | 2022-04-06 | Eurofins Genomics Europe Sequencing GmbH | Marqueurs épigénétiques et procédés associés et moyens de détection et de gestion du cancer des ovaires |
CN112195243A (zh) * | 2020-09-22 | 2021-01-08 | 北京华大吉比爱生物技术有限公司 | 一种检测多基因甲基化的试剂盒及其应用 |
WO2023122508A2 (fr) * | 2021-12-23 | 2023-06-29 | Mammoth Biosciences, Inc. | Améliorations de dosage basé sur une nucléase programmable |
Family Cites Families (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP0730663B1 (fr) * | 1993-10-26 | 2003-09-24 | Affymetrix, Inc. | Reseaux de sondes d'acide nucleique sur des microplaquettes biologiques |
DE19754482A1 (de) * | 1997-11-27 | 1999-07-01 | Epigenomics Gmbh | Verfahren zur Herstellung komplexer DNA-Methylierungs-Fingerabdrücke |
-
2001
- 2001-09-01 US US10/363,483 patent/US20050064401A1/en not_active Abandoned
- 2001-09-01 JP JP2002522536A patent/JP2005512499A/ja active Pending
- 2001-09-01 AU AU2002212187A patent/AU2002212187A1/en not_active Abandoned
- 2001-09-01 EP EP01980314A patent/EP1373564A2/fr not_active Withdrawn
- 2001-09-01 WO PCT/EP2001/010073 patent/WO2002018631A2/fr not_active Application Discontinuation
Non-Patent Citations (1)
Title |
---|
See references of WO0218631A2 * |
Also Published As
Publication number | Publication date |
---|---|
JP2005512499A (ja) | 2005-05-12 |
AU2002212187A1 (en) | 2002-03-13 |
WO2002018631A3 (fr) | 2003-10-16 |
US20050064401A1 (en) | 2005-03-24 |
WO2002018631A2 (fr) | 2002-03-07 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
EP1373564A2 (fr) | Diagnostic de maladies declarees ou de la predisposition a certaines maladies | |
EP1423528B1 (fr) | Procede de determination du degre de methylation de cytosines determinees d'adn genomique dans le contexte sequentiel 5'-cpg-3' | |
DE60126593T2 (de) | Diagnose von mit apoptose assoziierten erkrankungen mittels ermittlung des methylierungszustandes von apoptose-assozierten genen | |
DE10151055B4 (de) | Verfahren zum Nachweis von Cytosin-Methylierung in CpG Inseln | |
WO2001077384A2 (fr) | Detection de polymorphismes du nucleotide simple et de methylation de cytosine | |
WO2002000928A2 (fr) | Diagnostic de maladies associees au systeme immunitaire | |
DE10132212B4 (de) | Verfahren zum Nachweis von Cytosin-Methylierung durch vergleichende Analyse der Einzelstränge von Amplifikaten | |
DE10161625A1 (de) | Verfahren und Nukleinsäuren für die Analyse einer Lungenzell-Zellteilungsstörung | |
DE10128508A1 (de) | Verfahren und Nukleinsäuren für die Differenzierung von Prostata-Tumoren | |
DE10061338A1 (de) | Diagnose von mit Angiogenese assoziierten Krankheiten | |
EP1332228A2 (fr) | Diagnostic de maladies associees au gene cdk4 en determinant le degre de methylation du gene cdk4 | |
DE10037769A1 (de) | Diagnose von mit CD24 assoziierten Krankheiten | |
DE10054972A1 (de) | Diagnose von mit humos assoziierten Krankheiten | |
EP1534864A2 (fr) | Procede de detection de sequences d'acides nucleiques au moyen de molecules sonde comportant une liaison cassable | |
DE20121965U1 (de) | Nukleinsäuren für die Diagnose von mit DNA Addukten assoziierten Krankheiten | |
DE20121966U1 (de) | Nukleinsäuren für die Diagnose von mit dem Immunsystem assoziierten Krankheiten | |
DE20121967U1 (de) | Nukleinsäuren für die Diagnose von Verhaltensstörungen, neurologischen Erkrankungen und Krebs | |
DE20121963U1 (de) | Nukleinsäuren für die Diagnose von mit Entwicklungsgenen assoziierten Krankheiten | |
DE20121979U1 (de) | Nukleinsäuren für die Diagnose von mit der Zellsignalisierung assoziierten Krankheiten | |
DE20121964U1 (de) | Nukleinsäuren für die Diagnose von mit dem Metabolismus assoziierten Krankheiten | |
DE20121961U1 (de) | Nukleinsäuren für die Diagnose von mit der Signaltransduktion assoziierten Krankheiten | |
DE20121974U1 (de) | Nukleinsäuren für die Diagnose von mit DNA Replikation assoziierten Krankheiten | |
DE20121969U1 (de) | Nukleinsäuren für die Diagnose von mit DNA Reparatur assoziierten Krankheiten | |
DE20121977U1 (de) | Nukleinsäuren für die Diagnose von mit Tumor-Suppressorgenen und Onkogenen assoziierten Krankheiten | |
DE20121968U1 (de) | Nukleinsäuren für die Diagnose von mit Apoptose assoziierten Krankheiten |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
17P | Request for examination filed |
Effective date: 20030401 |
|
AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: EPIGENOMICS AG |
|
17Q | First examination report despatched |
Effective date: 20070724 |
|
STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
18D | Application deemed to be withdrawn |
Effective date: 20071204 |