EP1366069A2 - Histone acetyltransferase inhibitors and their use as insecticides - Google Patents

Histone acetyltransferase inhibitors and their use as insecticides

Info

Publication number
EP1366069A2
EP1366069A2 EP01949388A EP01949388A EP1366069A2 EP 1366069 A2 EP1366069 A2 EP 1366069A2 EP 01949388 A EP01949388 A EP 01949388A EP 01949388 A EP01949388 A EP 01949388A EP 1366069 A2 EP1366069 A2 EP 1366069A2
Authority
EP
European Patent Office
Prior art keywords
dna
protein
insect
seq
rot
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01949388A
Other languages
German (de)
French (fr)
Inventor
Michael J. Pankratz
Ingo Zinke
Peter Luemmen
Jürgen BENTING
Nikolas Gunkel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Karlsruher Institut fuer Technologie KIT
Original Assignee
Forschungszentrum Karlsruhe GmbH
Bayer CropScience AG
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Forschungszentrum Karlsruhe GmbH, Bayer CropScience AG filed Critical Forschungszentrum Karlsruhe GmbH
Priority to EP01949388A priority Critical patent/EP1366069A2/en
Publication of EP1366069A2 publication Critical patent/EP1366069A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/1025Acyltransferases (2.3)
    • C12N9/1029Acyltransferases (2.3) transferring groups other than amino-acyl groups (2.3.1)
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/026Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a baculovirus

Definitions

  • Histone acetyltransferase inhibitors and their use as insecticides
  • the invention relates to new DNA sequences encoding a protein which shows the biological activity of an insect histone acetyltransferase.
  • This invention also relates to a process for the identification of new insecticidal substances and the use of substances as insecticides or acaricides that had been identified by employing said process.
  • insecticides Due to the enormous damages that are still caused by insects on crops, wood, textiles as well as due to the transmission of diseases on or across human beings, animals and crops by various insects, the application of insecticides is still unavoidable. Insecticides are still an important part of integrated disease control and are heavily involved in order to guarantee/build up a stable or increased yield on harvests all over the world.
  • Histone acetyltransferases are known form many organisms like it is the case for the human HATs as MOZ, MORF, and TIP60 as well as Drosophila's MOF-HAT (Howe et al., Critical Review in Eukaryotic Gene Expression, 9, 231-243 (1999)) .
  • These members of the so called MYST-family (according to a conserved amino acid domain) of known and putative acetyltransferases primarily acetylate nucleosomal histone H4 and are proposed to regulate gene transcription in connection with other transcriptional factors.
  • Drosophila's MOF-protein which is belonging to that MYST- related family of histone acetyltransferases is involved in dosage compensation, a process that results in a two-fold increase in transcription from the single X- chromosome in male flies and is accompanied by histone H4 hyperacetylation at the aminoacid Lys 16.
  • a single site mutation leads to a deficiency in X- associated acetylation of H4 at Lys 16 which in its consequence ends in a male- specific lethality (Gu et al., Dev. Genet, 22, 56-64 (1998); Hilfiker et al., EMBO J., 16, 2054-2060 (1997)).
  • H4 acetylation by MYST-family of acetyltranferases had been identified as being important for transcriptional regulation and - beside that - HATs may also be important for other chromatin- related functions in addition to transcriptional activation (Turner et al, Cell, 69, 375- 384 (1992); Howe et al., Critical Review in Eukaryotic Gene Expression, 9, 231-243 (1999)).
  • histone- acetyltransferases Beside these MYST-belonging histone-acetyltransferases, other histone- acetyltransferases are known which more preferably acetylate histone H3, like the GCN5-HAT does (Smith et al., Nucleic Acids Res., 26, 2948-2954 (1998)). It has been shown that a related GCN5-HAT from the yeast Saccharomyces cerevisiae acetylates primarily the Lys 14 of Histone H3. Recent studies in yeast could clearly demonstrate that a promoter-specific acetylation of histone H3 is important for transcriptional activation in yeast.
  • TAFn250 subunit of the general transcription factor TFIID and its homologues in Drosophila melanogaster this is TAFn230, and in Saccharomyces cerevisiae this is TAF M 130 have also been shown to acetylate histones H3 and H4, in vitro (Mizzen et al, Cell, 87, 1261-1270).
  • HAT and its counter player HD histone deacetylases
  • HAT histone deacetylases
  • HD repress
  • In situ hybridisation indicates that the rot gene is expressed specifically in the central nervous system in late embryos. Rot mutant larvae show specific defects in food uptake and display drastically reduced growth. The rot phenotype becomes apparent within two to three hours of larval development, a penetration which is indicative of the central role of the rot gene in feeding control, in which ROT may act through transcription control of neuraly expressed genes regulating food uptake.
  • This invention provides an isolated DNA molecule comprising a DNA sequence encoding a protein which shows the biological activity of an insect histone acetyltransferase, said DNA sequence being selected from the group consisting of: (a) DNA sequences, coding for a protein with an amino acid sequence as listed under SEQ ID NO 3;
  • DNA sequences showing a modified sequence and wherein such modification(s) is (are) based on the degeneration of the genetic code in comparison to the DNA sequences as being defined under (a), (b), or (c);
  • the encoded histone acetyltransferase according to the invention may be preferably, highly preferable, or solely expressed in the central nervous system in late insect embryos.
  • derivative of DNA sequences means by definition in the content of the whole disclosure modifications which either are not affecting the amino acid composition of the encoded protein as it can be the case by an obtained modification of the third (so called “wobble base") of the triplet codon encoding an amino acid each, or effecting the amino acid composition of the encoded protein but the entire protein itself is showing the biochemical and/or enzymatic characteristics of an insect histone acetyltransferase.
  • DNA molecules hybridising with DNA molecules comprising DNA sequences of (a) or (b), can be obtained from genomic or cDNA-libraries being prepared from various insects.
  • the identification and isolation of such DNA molecules from insects or other organisms can be performed by employing the DNA molecules according to the invention or parts or reverse complements thereof by using standard molecular biology protocols as described for example in Sambrook et al. (1989) (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)).
  • DNA or RNA molecules can be used that show the identical sequence as listed under SEQ ID NO 1 or SEQ ID NO 2, or exhibit at least significant homologies to the sequence as listed under SEQ ID NO 1 or SEQ ID NO 2.
  • the corresponding DNA or RNA molecules serving as hybridisation probe(s) can either be of natural source or can be synthetic DNA-fragments that had been synthesised by using standard DNA-synthesis protocols.
  • a DNA sequence which is significantly homologous to the coding sequence of SEQ ID NO 1 or the sequence complementary to that coding sequence will generally have at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the coding sequence of SEQ ID NO 1 or the complement of that sequence over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO 1. Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define DNA sequences of the invention with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred. Thus, for example a DNA sequence which has at least 90% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a DNA sequence which has at least 95% sequence identity over 40 nucleotides.
  • the invention relates to DNA molecules or parts or derivatives thereof which are able to hybridise specifically to a DNA molecule according to the invention or part or derivatives thereof. Respective parts or derivatives can result from insertion, deletion, addition, substitution and/or inversion.
  • the minimum length requirement of the hybridising DNA molecule is of 15 nucleotides.
  • specifically hybridise means that under conventional hybridisation conditions, preferably under stringent conditions, no significant cross hybridisation can be observed to DNA sequences encoding other proteins. Conditions for a specific hybridisation may be, for example, 0.03 M sodium chloride and 0.03 M sodium citrate at about 60°C.
  • Such DNA molecules show an entire length of at least 20, preferably a length of at least 50, and most preferably a length of at least 100 nucleotides. Such molecules can be employed as PCR-primers or as hybridisation probes.
  • the coding sequence of SEQ ID NO 1 may be modified by nucleotide substitutions, for example from 1 , 2, or 3 to 10, 25, 50, 100 or 300 substitutions.
  • Fragments of the DNA sequence as given under (b), (c), or (d) of the invention may be used as a primer, e.g. a PCR primer (Polymerase Chain Reaction primer), a primer for an alternative amplification reaction, a probe e.g. labeled with a revealing label by conventional means using radioactive or non-radioactive labels, or the DNA sequences may be cloned into appropriate vectors.
  • Such primers, probes or other fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of the coding sequence of SEQ ID NO 1.
  • Fragments of a DNA molecule comprising a DNA sequence as given under (b), (c), or (d) and primers according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. The DNA molecules are typically provided in isolated and/or purified form. In general, primers will be produced by synthetic means.
  • DNA molecules which do not have 100% sequence identity to the sequence of SEQ ID NO 1 but fall within the scope of the invention can be obtained by a number of ways.
  • Allelic variants of SEQ ID NO 1 may be obtained for example by probing genomic libraries made from Drosphila melanogaster cells, using probes as described above.
  • homologues of SEQ ID NO 1 may be obtained for example from other Drosophila species, or other insects and such homologues and fragments thereof in general will be substantially homogenous to the coding sequence of SEQ ID NO 1 or its complement.
  • sequences may be obtained by probing cDNA (complementary DNA) or genomic libraries from other Drosophila or further insects with the probes as described above.
  • Degenerate probes can be prepared by means known in the art to take into account the possibility of degenerate variation between the DNA sequences of SEQ ID NO 1 and the sequences being probed for under conditions of medium to high stringency (for example 0.03 M sodium chloride and 0.03 M sodium citrate at from about 50°C to about 60°C).
  • medium to high stringency for example 0.03 M sodium chloride and 0.03 M sodium citrate at from about 50°C to about 60°C.
  • allelic variants and species homologues may also be obtained using degenerate PCR (Polymerase Chain Reaction) which will use primers designed to target sequences within the variants and homologues encoding likely conserved amino acid sequences.
  • Likely conserved sequences can be predicted from aligning the amino acid sequences of the invention (SEQ' ID NO 3) with that of other similar ROT-sequences.
  • the primers will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.
  • DNA molecules may be obtained by site directed mutagenesis of SEQ ID NO 1 sequences or allelic variants thereof. This may be useful where, for example, silent codon changes are preferred to sequences to optimise codon preferences for a particular host cell in which the DNA sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the proteins encoded by the DNA sequence.
  • present invention provides DNA vectors, comprising the above described DNA molecules of the invention, wherein the DNA molecules of the invention are connected to regulatory elements in order to guarantee a proper transcription/translation in the appropriate cellular environment.
  • the basic DNA vector which lacks any of the DNA sequences of (a), (b), (c), (d), or (e) and which is used for the insertion of any DNA molecule of present invention can be selected out of the group of phages, plasmids, phasmids, bacmids, eukaryotic viruses or the like.
  • the DNA vector may be used to replicate the DNA sequences in a compatible host cell.
  • the invention provides a method of making proteins of the invention by introducing any DNA sequence of the invention into a replicable basic DNA vector, introducing the resulting DNA vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector.
  • the DNA vector may be recovered from the host cell.
  • the DNA vector of choice is based on a baculovirus expression vector which is preferably based for example on Autographa californica nuclear polyhedrosis virus like pBacPAK9, insect cells like Sf9 (Spodoptera frugiperda 9), Sf21 or BTI-TN-5B1-4 are employed for transfection and replication.
  • promoters like but not limited to the polyhedrin promoter may be used.
  • any DNA sequence of the invention in a DNA vector is operably linked to at least one control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the DNA vector is an expression vector.
  • the DNA vectors may be transformed/transfected into a suitable host cell according standard protocols of state of the art to provide for expression of a protein of the invention.
  • the invention provides a process for preparing a protein according to the invention which comprises cultivating a host cell transformed or transfected with an expression vector encoding the protein, and recovering the expressed protein.
  • the DNA vector may be for example, a plasmid, a virus or a phage vector provided with an origin of replication, optionally a promoter for the expression of the said DNA sequence and optionally a regulator of the promoter.
  • the DNA vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid.
  • DNA vectors may be used in vitro for example for the production of RNA or used to transform/transfect a host cell, for example E. coli or Spodoptera frugiperda insect cells.
  • the invention provides host cells, comprising the DNA sequences and/or DNA vectors of present invention.
  • the host cell can be a prokaryotic or eukaryotic cell transformed or transfected with one or more DNA vectors for the replication and/or expression of DNA sequences of the invention.
  • the cells will be chosen to be compatible with said vector and may for example be bacterial, yeast, insect, or mammalian.
  • insect cells that can be infected by a baculovirus are preferably employed.
  • Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed.
  • yeast promoters include Saccharomyces cerevisiae GAL4 and adh (alcohol dehydrogenase) promoters, Schizosaccaromyces pombe nmtl and adh promoter.
  • Viral promoters such as the SV40 large T antigen or adenovirus or baculovirus promoters, like the polyhedrin promoter, may also be used. All these promoters are readily available in the art.
  • Any DNA molecule according to the invention may also be inserted in a DNA vector in an antisense orientation in order to provide for the production of antisense RNA.
  • Antisense RNA or other antisense DNA may also be produced by synthetic means.
  • Such antisense poynucleotides may be used in a method of controlling the levels of ROT or it variants or species homologues.
  • Such antisense molecules may be present in single cells or whole organisms in transient expressions systems or in transgenic organisms, like but not limited to transgenic Drosophila melanogaster. Promoters and other expression signals may be selected to be compatible with the host cell for which the expression vector is designed.
  • a suitable promoter for use inducible is the lacZ gene promoter, which is induced in the presence of IPTG.
  • the present invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself.
  • this invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself, wherein said proteins belong to the classes of transcription regulating factors.
  • this invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself, wherein said proteins belong to the class of histone acetyltransferases.
  • this invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself, wherein said proteins belong to the class of histone acetyltransferases and being member of the MYST-family of histone acetyltransferases.
  • the invention provides a protein, which can be a recombinant gene product based on the DNA sequence according to SEQ ID NO 1 or parts or derivatives thereof, like for example expressed directly from the cDNA according to SEQ ID NO 2, obtained from transformed/transfected prokaryotic or eukaryotic host cells, and which can be used for the biochemical or structural characterisation of potential inhibitors thereof.
  • a protein of the invention comprises the amino acid sequence set out in SEQ ID NO 3 or a substantially homologous sequence, or a fragment of either of these sequences.
  • a fragment may have a size of at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 99.9% of the amino acids of the full size protein according to of the SEQ ID NO 3.
  • Other preferred fragments include those which include an epitope. Suitable fragments will be at least 5, e.g. at least 10, at least 12, at least 15 or at least 20 amino acids in size.
  • Epitope fragments may typically be up to 50, 60, 70, 80, 10, 150 or 200 amino acids in size.
  • Protein fragments of the protein of SEQ ID NO 3, and allelic and species variants thereof may contain one or more (e.g. 1 , 2, 3 or 5 to 10, 20 or 30) substitutions, deletions or insertions, including conservative substitutions.
  • Epitopes may be determined by techniques such as peptide scanning techniques already known in the art. These fragments will be useful for obtaining antibodies to proteins of the invention.
  • the proteins have insect histone acetyltransferase activity.
  • the naturally occurring amino acid sequence shown in SEQ ID NO 3 is preferred.
  • a protein of the invention may comprise:
  • allelic variant for example, will be a variant which will occur naturally in a strain of Drosophila melanogaster and which will function in a substantially similar manner to the protein of SEQ ID NO 3.
  • a species homologue of the protein will be the equivalent protein which occurs naturally in an insect other than Drosophila melanogaster and which can function as a histone acetyltransferase showing same or similar biochemical characteristics.
  • Allelic variants and species homologues can be obtained by following the procedures described herein for the production of the proteins of SEQ ID NO 3. It will be also possible to use a probe as defined above to probe libraries made from insect cells in order to obtain clones encoding the allelic or species variants. The clones can be multiplied by conventional techniques to generate a protein of the invention which can then be produced by recombinant or synthetic techniques known per se.
  • a protein of the invention preferably has at least 70% sequence identity to the protein of SEQ ID NO 3, more preferably at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% sequence identity thereto over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, at least 100 contiguous amino acids or over the full length of SEQ ID NO 3.
  • amino acid substitutions may be made, for example from 1 , 2, or 3 to 10, 20 or 30 substitutions.
  • the modified protein retains activity as an insect histone acetyltransferase as defined herein.
  • Conservative substitutions may be made, for example according to the following Table 1. Amino acids in the same block in the second column and preferably in the same line on the third column may be substituted for each other.
  • Proteins of the invention may be in a crude extract or in a substantially isolated form. It will be understood that the protein may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated.
  • a protein of the invention may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 50%, e.g., more than 80%, 90%, 95% or 99% of the protein in the preparation is a protein of the invention.
  • Proteins of the invention may be chemically modified, e.g. post-translationally modified. For example, they may be glycosylated or comprise modified amino acid residues. They may also be modified by the addition of certain residues like polyhistidine residues, polyarginine residues, polyasparte residues, polycysteine residues or polyphenylalanine residues, or glutathion-S-transferase, or protein A, or maltose binding protein, or galactose binding protein to assist their purification, or by addition of signal sequences to promote their secretion from a cell. Such modified proteins fall within the scope of the term "protein" of the invention.
  • the invention relates to an assay being employed for the detection of molecules that show an interaction and most preferably an inhibiting effect on the biochemical activity of any protein based on any DNA sequence of the present invention when compared with the non-treated control of said protein.
  • any assay can be employed that allows a measurement of the inhibiting effect of any molecule added to histone acetyltransferase activity on a suitable substrate under suitable buffer and reaction conditions. Most preferably, such assay is carried out in a single well of a plastics microtitre plate, so that high throughput screening for histone acetyltransferase activity inhibitors may be carried out. In practice, the assay is carried out preferably by adding histone acetyltransferase protein, most preferably in a purified form, to labeled acetyl-CoA as a donor molecule and histones as a natural receptor molecule. Any test substance, which can be a potential inhibitor, is added thereafter.
  • the assay can be followed in the absence of the test substance.
  • the test substance may be tested with any other known enzyme to exclude the possibility that the test substance is a general inhibitor of enzyme activity. This would lead to a molecule which does act on a histone acetyltransferase, and preferably on the ROT protein in a highly specific manner.
  • the assay can contain a suitable substrate
  • the reaction mixture can contain a suitable buffer, suitable cofactors and suitable divalent cations as a cofactor.
  • a suitable buffer includes any suitable biological buffer that can provide buffering capability at a pH conductive to the reaction requirements of the enzyme.
  • an assay for identifying an inhibitor of an acetyl transferase may comprise the following steps:
  • a substance which inhibits or affects the activity of a histone acetyltransferase like ROT may do so by binding the enzyme.
  • Such enzyme inhibition may be reversible or irreversible.
  • An irreversible inhibitor dissociates very slowly from its target enzyme because it becomes very tightly bound to the enzyme, either covalently or non-covalently.
  • Reversible inhibition in contrast with irreversible inhibition, is characterised by a rapid dissociation of the enzyme-inhibitor complex.
  • the test substance may be a competitive inhibitor.
  • the enzyme can bind substrate (forming an enzyme-substrate complex) or inhibitor (enzyme-inhibitor complex) but not both. Many competitive inhibitors resemble the substrate and bind the active site of the enzyme. The substrate is therefore prevented from binding to the same active site.
  • a competitive inhibitor diminishes the rate of catalysis by reducing the proportion of enzyme molecules bound to a substrate.
  • the inhibitor may also be a non-competitive inhibitor. In non-competitive inhibition, which is also reversible, the inhibitor and substrate can bind simultaneously to an enzyme molecule. This means that their binding sites do not overlap.
  • a non- competitive inhibitor acts by decreasing the turnover number of an enzyme rather than by decreasing the turnover number of an enzyme rather than by diminishing the proportion of enzyme molecules that are bound to substrate.
  • the inhibitor can also be a mixed inhibitor.
  • Mixed inhibition occurs when an inhibitor both effects the binding of substrate and alters the turnover number of the enzyme.
  • a substance which inhibits the activity of ROT may also do so by binding to the substrate.
  • the substance may itself catalyse a reaction of the substrate, so that the substrate is not available to the enzyme. Alternatively, the inhibitor may simply prevent the substrate binding to the enzyme.
  • Suitable candidate substances for inhibitors of ROT include combinatorial libraries, defined chemical identities, peptide and peptide mimetics, and natural product libraries.
  • the candidate substances may be used in an initial screen of, for example, ten substances per reaction, and the substance of these batches which show inhibition will be tested individually.
  • An inhibitor of an histone acetyltransferase like ROT is one which produces a measurable or sufficient reduction in ROT activity in the assays described above.
  • Preferred substances are those which inhibit the histone actyltransferase activity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% at a concentration of the inhibitor of 1 ⁇ g/ml, 10 ⁇ g/ml, 100 ⁇ g/ml, 500 ⁇ g/ml, 1 mg/ml, 10mg/ml, 100mg/ml.
  • the percentage inhibition represents the percentage decrease in activity in a comparison of assays in the presence and absence of the test substance. Any combination of the above mentioned degrees of percentage inhibition and concentration of inhibitor may be used to define an inhibitor of the invention, with greater inhibition at lower concentrations being preferred.
  • Candidate substances which show activity in assays such as those described above can be tested in in v/Vo-systems, such as animal model, preferred on insects and specifically preferred on insect model systems for the validation of insecticidal molecules.
  • candidate substances show an activity in such in vivo systems on the ROT protein.
  • any suitable assay format may be used for identifying an inhibitor of ROT.
  • a suitable cell extract will typically be used.
  • the invention also relates to chemical compounds that had been identified in the assay system of the present invention compared to a non-treated control of said recombinant gene product.
  • Such chemical compound(s) can be used in appropriate chemical compositions for insect control based on the specific inhibition or sufficient reduction of activity of the native target molecule in an insect.
  • the present invention also relates to methods controlling feeding behaviour of insects by using the chemical compounds identifiable as of being inhibitors of an insect histone acetyltransferase, preferably to methods for insect control by specifically inhibiting a protein encoded by a DNA sequence as defined under (a), (b), (c), (d), or (e) of present invention.
  • the chemical compounds identified according to the invention can be used in agrochemistry, veterinary, pharmaceutical applications, and on non-living materials.
  • the inhibitors (active ingredients) of the present invention are normally applied in the form of compositions together with one or more agriculturally acceptable carriers or diluents, and can be applied to the crop area or plant to be treated, simultaneously or in succession with, further compounds.
  • These compounds can be both fertilizers or micro-nutrient donors or other preparations that influence plant growth. They can also be herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides or mixtures of several of these preparations, if desired together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation.
  • Suitable carriers and diluents correspond to substances ordinarily employed in formulation technology, e.g. natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, binders or fertilizers.
  • the active ingredient may either be applied by spraying, soil application or seed coating.
  • the active ingredients are used in unmodified form or, preferably, together with the adjuvants conventionally employed in the art of formulation, and are therefore formulated in known manner preferably to emulsifiable concentrates, coatable pastes, directly sprayable or dilutable solutions, dilute emulsions, wettable powders, soluble powders, dusts, granulates, and also encapsulations, for example, in polymer substances.
  • the methods of application such as spraying, atomising, dusting, scattering or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances.
  • Advantageous rates of application are normally from 5g to 5 kg of active ingredient per hectare (a.i/ha), preferably from 50g to 2.5 kg a.i./ha, most preferably from 100 to 1 kg a.i./ha.
  • Suitable solvents include but are not limited to aromatic hydrocarbons, preferably the fractions having 8 to 12 carbon atoms, for example xylene mixtures or substituted naphthalenes, phthalates such as dibutyl phthalate or dioctyl phthalate, aliphatic hydrocarbons such as cyclohexane or paraffins, alcohols and glycols and their ethers and esters, such as ethanol, ethylene glycol monemethyl or monoethyl ether, ketones such as cyclohexanone, strongly polar solvents such as N-methyl-2- pyrrolidone, dimethyl sulfoxide or demethyl formamide, as well as epoxidized vegetable oils, such as epoxidized coconut oil or soybean oil, or water.
  • aromatic hydrocarbons preferably the fractions having 8 to 12 carbon atoms, for example xylene mixtures or substituted naphthalenes, phthalates such as dibutyl phthalate or dioc
  • the solid carriers used e.g. for dusts and dispersible powders are normally natural mineral fillers such as calcite, talcum, kaolin, montmorillonite or attapulgite.
  • Suitable granulated adsorptive carriers are porous types, for example pumice, broken brick, sepiolite or bentonite; and suitable non-sorbent carriers are materials such as calcite or sand.
  • a great number of pregranulated materials of inorganic or organic nature can be used, e.g. especially dolomite or pulverised plant residues.
  • suitable surface-active compounds are nonionic, cationic and/or anionic surfactants having good emulsifying, dispersing and wetting properties.
  • surfactants will also be understood as comprising mixtures of surfactants.
  • Suitable anionic surfactants can be both water-soluble soaps and water-soluble synthetic surface- active compounds.
  • the invention also relates to compositions, containing preferably insecticidal or acaricidal ingredients comprising one or more active substances influencing the activity of histone acetyltransferases like ROT, preferably on a specific way.
  • the agrochemical compositions usually contain form about 0.1% to about 99%, preferably about 0.1 % to about 95%, and most preferably from about 3 to about 90% of the active ingredient, from about 1 to about 99.9%, preferably form about 1 to about 99%, and most preferably form. about 5% to about 95% of solid or liquid adjuvant, and from about 0% to about 25%, preferably about 0.1% to about 25%, and most preferably from about 0.1 % to about 20% of a surfactant.
  • the necessary formulation aid which can be, for example, surface active substances like inert materials, tensides, diluents and further additives are known and are descirbed for example in: Watkins, "Handbook of Insecticide Dust Diluents and Carriers", 2 nd Edition, Darland Books, Caldwell N.J.; Olphen, “Introduction to Clay Colloid Chemistry", 2 nd Edition, J. Wiley & Sons, N.Y.; Marsden, “Solvents Guide”, 2 nd Edition, Interscience, N.Y. 1950; ;Cutcheon ' s, "Detergents and Emulsifiers Annual", MC Publ.
  • the identified inhibitors may be used as insecticides for application to insects on animals, especially on mammals, or on non-living materials.
  • standard applications, frequencies and/or formulations known to the skilled artisan may be used.
  • the original rot mutant, 1(2)09373 was identified by screening the Spadling collection of P-element induced lethal lines (Karpen, G., Spadling, A. Genetics 132, 737 (1992)) to isolate larval mutants that are defective in food intake.
  • the phenotype of 1(2)09373 is a failure of the food to be pumped into the esophagus, which was visualised by using dyed food.
  • the dyed food assay has been described by Zinke et al. (Development, 126, 5275 (1999)). Additional rot alleles have been isolated by performing a standard ethyl methane sulfonate (ems) mutagenesis screen for mutants that fail to complement 1(2)09373.
  • Ems mutagenesis was carried out by feeding 20 or 25 mM ems in sugar solution to pr en bw male Drosophila melanogaster (Tubingen stock collection # A234) flies. Mutagenised chromosomes were tested in single pair crosses for complementation to 1(2)09373. 5800 single lines were established, and from these five new alleles of rot were identified. Two of these, rot 60 and rot 104 , showed the same phenotype as the original allele. Rot 2 is a weaker allele since the mutants can grow larger than those of rot 60 and rot 104 mutants. Mutant stocks were kept balanced over CyO with GFP-Kr (Casso D. et al., : Mech Dev 2000 Mar 1;91(1-2):451), which shows GFP expression in the Bolwig organs of larvae. The use of this balancer allows mutant larvae to be unambiguously identified.
  • Example B Isolation and characterisation of rot and the protein encoded
  • the gene mutagenised by the P-element insertion in 1(2)09373 was identified by plasmid rescue, using standard techniques. Comparison of plasmid rescue fragments with sequences from the Drosophila genome sequencing project revealed that the P-element had inserted 5' of the genghis khan (gek) coding region and has caused the deletion of 15755 kb genomic stretch containing the entire gene 5' of the gene.
  • the genomic region was characterised by screening a Drosophila melanogaster genomic library (Lamda Fixll, Stratagene) with a radio labelled PCR fragment corresponding to the 5' half of [Primer GK1+ (forward) [SEQ ID NO 4]: 5'- GAT GGA ATA CGA ATC TTC - 3' (gek Exonl)/ Primer GK3- (reverse) [SEQ ID NO 5]: 5'- GCG CTT ATC GAG CAG TAC - 3 ' (gek Exon4)]. The longest clone .
  • Phenotypic rescue of the rotkehlchen phenotype was performed using a 8943 bp genomic fragment spanning the entire rot locus, cloned in 3 steps into the Drosophila transformation vector pCaSpR-4 (Pirrotta et al., in: "Vectors for P-element transformation in Drosophila”; eds.: Rodriguez and Denhardt, 437-456 (1988), resulting in the Rot transgenic vector pRotl .
  • Cloning of pRotl was done in the following way: A 2839 bp Nsi l(blunt)/Xbal and a 4277 bp Xbal/EcoRI fragment was cloned into pBluescript KS (Stratagene), linearised with Pstl(blunt)/EcoRI. From this intermediate construct a 7147 bp Notl/EcoRI fragment was excised and ligated, together with a 1756 bp EcoR l/Hindlll genomic fragment into a Notl/Hindlll linearised pBluescript KS.
  • a Notl/Kpnl fragment was cloned into a Notl/Kpnl linearised pCaSpR-4 vector.
  • a stock was established, which harbours pRotl on the third chromosome (referred to here as P- rescue).
  • P- rescue pRotl on the third chromosome
  • a stock was constructed with l(2)09373/CyO; P-rescue/P-rescue.
  • the phenotype of progenies from this stock was compared in parallel with those of the original l(2)09373/CyO; +/+ stock. From a collection of 831 eggs each, 596 (original stock) and 599 (P-rescue stock) hatched larvae were obtained.
  • Rot cDNA clones were identified in a Drosophila melanogaster cDNA library constructed by Nick Brown (NH Brown and FC Kafatos: Functional cDNA Libraries from Drosophila Embryos; J.Mol.Biol., 203, p425- 437(1988)) using a radioactively labelled probe corresponding to the 2478 bp Xbal/Sall fragment in exon 4 of the rot gene. A full length clone was identified (pMaxl 0) and characterised by sequencing.
  • PCR products were cloned into the TOPO TA vector (Invitrogen) and sequenced with M13 forward and M13 reverse primers. For the clones that showed a mutation,
  • ROT belongs to the MYST domain containing class of histone acetyl transferases. These include the human MOZ (accession No. U47742), MORF (accession No. NM_012330), and TIP60 (accession No. U74667), yeast SAS2 (accession No. S48299), and SAS3 (accession No. P34218), and Drosophila MOF (accession No. U71219).
  • the MYST domain contains a characteristic C2HC zinc finger and an acetyl CoA binding site.
  • ROT shows highest homology to the human MOZT gene, and both also possess PHD fingers, which are thought to be involved in chromatin interaction (Assland, Gibson and Stuard, TIBS 20, 56 (1995).
  • the rot gene of SEQ ID NO 1 encoding the ROT protein of SEQ ID NO 3 was deposited on June 16, 2000 according to the Budapest treaty at the DSMZ- Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124 Braunschweig, Germany and obtained the catalogue number: DSM 13549.
  • the corresponding cDNA (SEQ ID NO 2) of the rot gene encoding the ROT protein of SEQ ID NO 3 was also deposited on June 19, 2000 according to the Budapest treaty at the DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 Braunschweig, Germany and obtained the catalogue number: DSM 13550.
  • ROT-HAT rof ceft/cften-histone acetyltransferase
  • acetyltransferase was expressed as a 2774 bp BamHI/Hindlll fragment derived from pMax10, containing the PHD domain and MYST domain (acetyltransferase catalytic domain (ROT-HAT cat )) in insect cells using the baculoviral transfer vector pBacPAK9 (Clontech Labs., Palo Alto).
  • the Bam MHinc ⁇ rot fragment was first cloned into a BamHI/Hindlll linearised pQE32 E. coii expression vector (Qiagen).
  • This first cloning step added a start codon and a 6xHis tag upstream and an in-frame stop codon downstream to the ROT reading frame.
  • This intermediate construct was called pMB1.
  • pMB1 a 2952 bp EcoRI/Nhel fragment was excised and cloned into a EcoRI/Xbal linearised pBacPAK9 vector.
  • the resulting construct was called pBacPAK9- ROT-HAT ca t.
  • Insect cells BTI-TN-5B1-4 were seeded at 1.5 x 10 6 ml "1 in Grace's medium and incubated for 4 hours at 27° C. Cells were washed twice with serum-free Grace ' s medium before transfection.
  • the following transfection mix was prepared: 500 ng recombinant transfer vector pBacPAK ⁇ , 5 ⁇ l BacPAK ⁇ viral DNA (Bsu36 I digest, Clontech Labs, Palo Alto), 91 ⁇ l sterile distilled water. 4 ⁇ l Lipofectin were added to the solution and gently mixed for 15 min at RT. The mix was then added to 1.5 ml of serum-free Grace's medium and incubated with the cells for 2 h at 27° C with gentle shaking. Then 3 ml Grace's medium were added and the cells were incubated for 72 h for recombinant baculovirus production.
  • baculoviruses Clonal recombinant baculoviruses was isolated from single plaques following standard protocols and propagated further. After virus titer determination BTI-TN- 5B1-4 cells were infected at a m.o.i (multiplicity of infection) of 10 with recombinant baculovirus. After 36 h incubation the cells were harvested by centrifugation for 10 min at 800 x g and washed with PBS (50 mM phosphate buffer, 0.15 M NaCl, pH 7.4).
  • PBS 50 mM phosphate buffer, 0.15 M NaCl, pH 7.4
  • Cells were lysed by three cycles of freezing and thawing followed by centrifugation for 10 min at 800 x g. The protein concentration of the cell-free lysate was determined (Bradford).
  • Example D Method to identify an inhibitor of ROT Histone acetyltransferase assay
  • Histone acetyltransferases and histone deacetylases participate in the remodeling of chromatin structure thereby regulating its transcriptional activity (Magnaghi- Jaulin, et al.; Cell Development. Biology, 10, 197-203 (1999)).
  • Acetylation neutralises the charge of ⁇ -amino groups of lysine residues in the N-terminal domains of histones.
  • Histone actyltransferases act on either free histones or nucleosomes.
  • HAT protein 100 ⁇ g of HAT protein (crude extracts) were incubated with 10 ⁇ g ⁇ l "1 histones (calf thymus, type IIA, Sigma) and 10 ⁇ M 14 C-acetyl-CoA in 50 mM Tris-HCI, pH 8.0, 1 mM DTT, 0.1 mM EDTA in a total volume of 100 ⁇ l for 30 min at 30° C. Control samples without histone substrate were run in parallel. The reaction was stopped by addition of double-concentrated SDS-sample buffer and proteins were subjected to SDS polyacrylamide gel electrophoresis (15% polyacrylamide gels). Gels were fixed in 20% methanol, 10% acetic acid and subsequently soaked in intensifying liquid scintillant (NEN). After drying, gels were autoradiographed to detect acetylated proteins.
  • NNN intensifying liquid scintillant

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The invention relates to new DNA sequences encoding a protein which shows the biological activity of an insect histone acetyltransferase. This invention also relates to a process for the identification of new insecticidal substances and the use of substances as insecticides or acaricides that had been identified by employing said process.

Description

Description
Histone acetyltransferase inhibitors and their use as insecticides
The invention relates to new DNA sequences encoding a protein which shows the biological activity of an insect histone acetyltransferase. This invention also relates to a process for the identification of new insecticidal substances and the use of substances as insecticides or acaricides that had been identified by employing said process.
Due to the enormous damages that are still caused by insects on crops, wood, textiles as well as due to the transmission of diseases on or across human beings, animals and crops by various insects, the application of insecticides is still unavoidable. Insecticides are still an important part of integrated disease control and are heavily involved in order to guarantee/build up a stable or increased yield on harvests all over the world.
Moreover, the ecological as well as the economical duties on modern insecticides are permanently increasing and there is an ongoing demand to develop new insecticides that are advantageous concerning toxicity, selectivity, needed quantities, residue levels, resistance, and the like when compared to known and/or applied today's insecticides. An important aspect in developing new insecticides is the search for new molecular target sites which are also able to serve as an integrated part of high throughput screening assays for the design of new and/or superior insecticides.
Concerning modern farming, feeding of insect on crop plants or related seeds is the major reason of crop damages caused by insect pests. Apart from direct killing of insect pests by e.g. neuro-active insecticides, crop damage can be reduced or avoided by chemical agents affecting the feeding behaviour of insects. Insecticides controlling feeding behaviour are often more selective against beneficial insects and, consequently, they have a greater chance to be environmentally friendly.
Histone acetyltransferases (HAT) are known form many organisms like it is the case for the human HATs as MOZ, MORF, and TIP60 as well as Drosophila's MOF-HAT (Howe et al., Critical Review in Eukaryotic Gene Expression, 9, 231-243 (1999)) . These members of the so called MYST-family (according to a conserved amino acid domain) of known and putative acetyltransferases primarily acetylate nucleosomal histone H4 and are proposed to regulate gene transcription in connection with other transcriptional factors. Drosophila's MOF-protein which is belonging to that MYST- related family of histone acetyltransferases is involved in dosage compensation, a process that results in a two-fold increase in transcription from the single X- chromosome in male flies and is accompanied by histone H4 hyperacetylation at the aminoacid Lys 16. In this case, a single site mutation leads to a deficiency in X- associated acetylation of H4 at Lys 16 which in its consequence ends in a male- specific lethality (Gu et al., Dev. Genet, 22, 56-64 (1998); Hilfiker et al., EMBO J., 16, 2054-2060 (1997)). In general, H4 acetylation by MYST-family of acetyltranferases had been identified as being important for transcriptional regulation and - beside that - HATs may also be important for other chromatin- related functions in addition to transcriptional activation (Turner et al, Cell, 69, 375- 384 (1992); Howe et al., Critical Review in Eukaryotic Gene Expression, 9, 231-243 (1999)). Beside these MYST-belonging histone-acetyltransferases, other histone- acetyltransferases are known which more preferably acetylate histone H3, like the GCN5-HAT does (Smith et al., Nucleic Acids Res., 26, 2948-2954 (1998)). It has been shown that a related GCN5-HAT from the yeast Saccharomyces cerevisiae acetylates primarily the Lys 14 of Histone H3. Recent studies in yeast could clearly demonstrate that a promoter-specific acetylation of histone H3 is important for transcriptional activation in yeast. The human TAFn250 subunit of the general transcription factor TFIID and its homologues (in Drosophila melanogaster this is TAFn230, and in Saccharomyces cerevisiae this is TAFM130) have also been shown to acetylate histones H3 and H4, in vitro (Mizzen et al, Cell, 87, 1261-1270). In general, it is well accepted within the scientific community that HAT and its counter player HD (histone deacetylases) facilitate (HAT) or repress (HD) transcription by serving as intermediates between gene-specific and general transcription factors (Struhl et al., Genes Dev., 12, 599-606 (1998); Grant et al., In: Methods in Molecular Biology, P.B. Becker, Ed. (Totowa, NJ: Humana Press Inc.), 119, 311-317; Eberharter et al., Methods, 15, 315-321 (1998)).
It would thus be desirable for control of insects to obtain genes expressing proteins that control the feeding behaviour of insects and to develop an assay for identifying inhibitors of such protein activities.
Surprisingly, it has now been found that a Drosophila melanogaster endogenous gene which subsequently is named "Rotkehlchen" (rot) is directly involved in the control of feeding behaviour of this insect. The gene encoded protein (ROT) which was identified as a histone acetyltransferase belongs to the so called "MYST family" of histone acetyltransferases (HAT).
In situ hybridisation indicates that the rot gene is expressed specifically in the central nervous system in late embryos. Rot mutant larvae show specific defects in food uptake and display drastically reduced growth. The rot phenotype becomes apparent within two to three hours of larval development, a penetration which is indicative of the central role of the rot gene in feeding control, in which ROT may act through transcription control of neuraly expressed genes regulating food uptake.
This invention provides an isolated DNA molecule comprising a DNA sequence encoding a protein which shows the biological activity of an insect histone acetyltransferase, said DNA sequence being selected from the group consisting of: (a) DNA sequences, coding for a protein with an amino acid sequence as listed under SEQ ID NO 3;
(b) DNA sequences comprising the region of the DNA sequence as listed under SEQ ID NO 1 or SEQ ID NO 2;
(c) DNA sequences, hybridising with DNA sequences as being defined under (a) or (b);
(d) DNA sequences, showing a modified sequence and wherein such modification(s) is (are) based on the degeneration of the genetic code in comparison to the DNA sequences as being defined under (a), (b), or (c); and
(e) DNA sequences that are fragments, derivatives or allelic variants of DNA sequences as listed under (a), (b), (c), or (d).
The encoded histone acetyltransferase according to the invention may be preferably, highly preferable, or solely expressed in the central nervous system in late insect embryos.
The used term "derivative" of DNA sequences means by definition in the content of the whole disclosure modifications which either are not affecting the amino acid composition of the encoded protein as it can be the case by an obtained modification of the third (so called "wobble base") of the triplet codon encoding an amino acid each, or effecting the amino acid composition of the encoded protein but the entire protein itself is showing the biochemical and/or enzymatic characteristics of an insect histone acetyltransferase.
The used term ..degeneration of the genetic code" means that most amino acids can be specified by more than one codon of a DNA RNA sequence. All of the amino acids except tryptophan and methionine are represented by more than one codon and almost all of the degeneracy is confined to the third codon position. DNA molecules hybridising with DNA molecules comprising DNA sequences of (a) or (b), can be obtained from genomic or cDNA-libraries being prepared from various insects. The identification and isolation of such DNA molecules from insects or other organisms can be performed by employing the DNA molecules according to the invention or parts or reverse complements thereof by using standard molecular biology protocols as described for example in Sambrook et al. (1989) (Sambrook et al., Molecular Cloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989)).
As a hybridisation probe, DNA or RNA molecules can be used that show the identical sequence as listed under SEQ ID NO 1 or SEQ ID NO 2, or exhibit at least significant homologies to the sequence as listed under SEQ ID NO 1 or SEQ ID NO 2. The corresponding DNA or RNA molecules serving as hybridisation probe(s) can either be of natural source or can be synthetic DNA-fragments that had been synthesised by using standard DNA-synthesis protocols.
A DNA sequence which is significantly homologous to the coding sequence of SEQ ID NO 1 or the sequence complementary to that coding sequence will generally have at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to the coding sequence of SEQ ID NO 1 or the complement of that sequence over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, more preferably at least 100 contiguous nucleotides or most preferably over the full length of SEQ ID NO 1. Any combination of the above mentioned degrees of sequence identity and minimum sizes may be used to define DNA sequences of the invention with the more stringent combinations (i.e. higher sequence identity over longer lengths) being preferred. Thus, for example a DNA sequence which has at least 90% sequence identity over 25, preferably over 30 nucleotides forms one aspect of the invention, as does a DNA sequence which has at least 95% sequence identity over 40 nucleotides.
Furthermore, the invention relates to DNA molecules or parts or derivatives thereof which are able to hybridise specifically to a DNA molecule according to the invention or part or derivatives thereof. Respective parts or derivatives can result from insertion, deletion, addition, substitution and/or inversion. The minimum length requirement of the hybridising DNA molecule is of 15 nucleotides. The term "specifically hybridise" means that under conventional hybridisation conditions, preferably under stringent conditions, no significant cross hybridisation can be observed to DNA sequences encoding other proteins. Conditions for a specific hybridisation may be, for example, 0.03 M sodium chloride and 0.03 M sodium citrate at about 60°C. Such DNA molecules show an entire length of at least 20, preferably a length of at least 50, and most preferably a length of at least 100 nucleotides. Such molecules can be employed as PCR-primers or as hybridisation probes. The coding sequence of SEQ ID NO 1 may be modified by nucleotide substitutions, for example from 1 , 2, or 3 to 10, 25, 50, 100 or 300 substitutions. Fragments of the DNA sequence as given under (b), (c), or (d) of the invention may be used as a primer, e.g. a PCR primer (Polymerase Chain Reaction primer), a primer for an alternative amplification reaction, a probe e.g. labeled with a revealing label by conventional means using radioactive or non-radioactive labels, or the DNA sequences may be cloned into appropriate vectors.
Such primers, probes or other fragments will preferably be at least 10, preferably at least 15 or at least 20, for example at least 25, at least 30 or at least 40 nucleotides in length. They will typically be up to 40, 50, 60, 70, 100 or 150 nucleotides in length, for example up to 200, 300, 400, 500, 600, 700 nucleotides in length, or even up to a few nucleotides, such as five or ten nucleotides, short of the coding sequence of SEQ ID NO 1.
Fragments of a DNA molecule comprising a DNA sequence as given under (b), (c), or (d) and primers according to the invention may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques. The DNA molecules are typically provided in isolated and/or purified form. In general, primers will be produced by synthetic means.
DNA molecules which do not have 100% sequence identity to the sequence of SEQ ID NO 1 but fall within the scope of the invention can be obtained by a number of ways. Thus: . Allelic variants of SEQ ID NO 1 may be obtained for example by probing genomic libraries made from Drosphila melanogaster cells, using probes as described above. Additionally, homologues of SEQ ID NO 1 may be obtained for example from other Drosophila species, or other insects and such homologues and fragments thereof in general will be substantially homogenous to the coding sequence of SEQ ID NO 1 or its complement. Such sequences may be obtained by probing cDNA (complementary DNA) or genomic libraries from other Drosophila or further insects with the probes as described above. Degenerate probes can be prepared by means known in the art to take into account the possibility of degenerate variation between the DNA sequences of SEQ ID NO 1 and the sequences being probed for under conditions of medium to high stringency (for example 0.03 M sodium chloride and 0.03 M sodium citrate at from about 50°C to about 60°C).
2. Allelic variants and species homologues may also be obtained using degenerate PCR (Polymerase Chain Reaction) which will use primers designed to target sequences within the variants and homologues encoding likely conserved amino acid sequences. Likely conserved sequences can be predicted from aligning the amino acid sequences of the invention (SEQ' ID NO 3) with that of other similar ROT-sequences. The primers will contain one or more degenerate positions and will be used at stringency conditions lower than those used for cloning sequences with single sequence primers against known sequences.
3. Alternatively, DNA molecules may be obtained by site directed mutagenesis of SEQ ID NO 1 sequences or allelic variants thereof. This may be useful where, for example, silent codon changes are preferred to sequences to optimise codon preferences for a particular host cell in which the DNA sequences are being expressed. Other sequence changes may be desired in order to introduce restriction enzyme recognition sites, or to alter the property or function of the proteins encoded by the DNA sequence.
In a further embodiment, present invention provides DNA vectors, comprising the above described DNA molecules of the invention, wherein the DNA molecules of the invention are connected to regulatory elements in order to guarantee a proper transcription/translation in the appropriate cellular environment. The basic DNA vector which lacks any of the DNA sequences of (a), (b), (c), (d), or (e) and which is used for the insertion of any DNA molecule of present invention can be selected out of the group of phages, plasmids, phasmids, bacmids, eukaryotic viruses or the like. The DNA vector may be used to replicate the DNA sequences in a compatible host cell. Thus, in a further embodiment, the invention provides a method of making proteins of the invention by introducing any DNA sequence of the invention into a replicable basic DNA vector, introducing the resulting DNA vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The DNA vector may be recovered from the host cell. In case that the DNA vector of choice is based on a baculovirus expression vector which is preferably based for example on Autographa californica nuclear polyhedrosis virus like pBacPAK9, insect cells like Sf9 (Spodoptera frugiperda 9), Sf21 or BTI-TN-5B1-4 are employed for transfection and replication. As a promoter for the transcription of the ROT encoding mRNA from any DNA sequence of present invention in such insect cells, promoters like but not limited to the polyhedrin promoter may be used.
Preferably, any DNA sequence of the invention in a DNA vector is operably linked to at least one control sequence which is capable of providing for the expression of the coding sequence by the host cell, i.e. the DNA vector is an expression vector. Such DNA vectors may be transformed/transfected into a suitable host cell according standard protocols of state of the art to provide for expression of a protein of the invention. Thus, in a further aspect the invention provides a process for preparing a protein according to the invention which comprises cultivating a host cell transformed or transfected with an expression vector encoding the protein, and recovering the expressed protein.
The DNA vector may be for example, a plasmid, a virus or a phage vector provided with an origin of replication, optionally a promoter for the expression of the said DNA sequence and optionally a regulator of the promoter. The DNA vectors may contain one or more selectable marker genes, for example an ampicillin resistance gene in the case of a bacterial plasmid. DNA vectors may be used in vitro for example for the production of RNA or used to transform/transfect a host cell, for example E. coli or Spodoptera frugiperda insect cells.
Furthermore, the invention provides host cells, comprising the DNA sequences and/or DNA vectors of present invention. The host cell can be a prokaryotic or eukaryotic cell transformed or transfected with one or more DNA vectors for the replication and/or expression of DNA sequences of the invention. The cells will be chosen to be compatible with said vector and may for example be bacterial, yeast, insect, or mammalian. In case of eukaryotic cells, insect cells that can be infected by a baculovirus are preferably employed.
Promoters and other expression regulation signals may be selected to be compatible with the host cell for which expression is designed. For example, yeast promoters include Saccharomyces cerevisiae GAL4 and adh (alcohol dehydrogenase) promoters, Schizosaccaromyces pombe nmtl and adh promoter. Viral promoters such as the SV40 large T antigen or adenovirus or baculovirus promoters, like the polyhedrin promoter, may also be used. All these promoters are readily available in the art.
Any DNA molecule according to the invention may also be inserted in a DNA vector in an antisense orientation in order to provide for the production of antisense RNA. Antisense RNA or other antisense DNA may also be produced by synthetic means. Such antisense poynucleotides may be used in a method of controlling the levels of ROT or it variants or species homologues. Such antisense molecules may be present in single cells or whole organisms in transient expressions systems or in transgenic organisms, like but not limited to transgenic Drosophila melanogaster. Promoters and other expression signals may be selected to be compatible with the host cell for which the expression vector is designed. A suitable promoter for use inducible is the lacZ gene promoter, which is induced in the presence of IPTG. The present invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself.
More especially, this invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself, wherein said proteins belong to the classes of transcription regulating factors.
Preferably, this invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself, wherein said proteins belong to the class of histone acetyltransferases.
More preferably, this invention relates to proteins controlling feeding behaviour of insects, genes encoding said proteins and the use of said proteins for the identification of insect control agents as well as target site(s) for insect control itself, wherein said proteins belong to the class of histone acetyltransferases and being member of the MYST-family of histone acetyltransferases. Furthermore, the invention provides a protein, which can be a recombinant gene product based on the DNA sequence according to SEQ ID NO 1 or parts or derivatives thereof, like for example expressed directly from the cDNA according to SEQ ID NO 2, obtained from transformed/transfected prokaryotic or eukaryotic host cells, and which can be used for the biochemical or structural characterisation of potential inhibitors thereof.
A protein of the invention, comprises the amino acid sequence set out in SEQ ID NO 3 or a substantially homologous sequence, or a fragment of either of these sequences. A fragment may have a size of at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 99.9% of the amino acids of the full size protein according to of the SEQ ID NO 3. Other preferred fragments include those which include an epitope. Suitable fragments will be at least 5, e.g. at least 10, at least 12, at least 15 or at least 20 amino acids in size. Epitope fragments may typically be up to 50, 60, 70, 80, 10, 150 or 200 amino acids in size. Protein fragments of the protein of SEQ ID NO 3, and allelic and species variants thereof may contain one or more (e.g. 1 , 2, 3 or 5 to 10, 20 or 30) substitutions, deletions or insertions, including conservative substitutions. Epitopes may be determined by techniques such as peptide scanning techniques already known in the art. These fragments will be useful for obtaining antibodies to proteins of the invention.
The proteins have insect histone acetyltransferase activity. The naturally occurring amino acid sequence shown in SEQ ID NO 3 is preferred. In particular, a protein of the invention may comprise:
(a) the amino acid sequence of SEQ ID NO 3;
(b) an allelic variant or species homologue of (a); or
(c) a protein with at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to (a) or (b).
An allelic variant, for example, will be a variant which will occur naturally in a strain of Drosophila melanogaster and which will function in a substantially similar manner to the protein of SEQ ID NO 3. Similarly, a species homologue of the protein will be the equivalent protein which occurs naturally in an insect other than Drosophila melanogaster and which can function as a histone acetyltransferase showing same or similar biochemical characteristics.
Allelic variants and species homologues can be obtained by following the procedures described herein for the production of the proteins of SEQ ID NO 3. It will be also possible to use a probe as defined above to probe libraries made from insect cells in order to obtain clones encoding the allelic or species variants. The clones can be multiplied by conventional techniques to generate a protein of the invention which can then be produced by recombinant or synthetic techniques known per se. A protein of the invention preferably has at least 70% sequence identity to the protein of SEQ ID NO 3, more preferably at least 80%, at least 90%, at least 95%, at least 97%, or at least 99% sequence identity thereto over a region of at least 20, preferably at least 30, for instance at least 40, at least 60, at least 100 contiguous amino acids or over the full length of SEQ ID NO 3.
The sequence of the protein of SEQ ID NO 3 and of allelic variants and species homologues can thus be modified to provide proteins of the invention. Amino acid substitutions may be made, for example from 1 , 2, or 3 to 10, 20 or 30 substitutions. The modified protein retains activity as an insect histone acetyltransferase as defined herein. Conservative substitutions may be made, for example according to the following Table 1. Amino acids in the same block in the second column and preferably in the same line on the third column may be substituted for each other.
TABLE 1
The abreviations as used in TABLE 1 have the follwing meaning:
A = Alanine; C = Cysteine; D = Aspartic acid; E = Glutamic acid; F = Phenylalanine; G = Glycine; H = Histidine; I = Isoleucine; K = Lysine; L = Leucine; M = Mehtionine; N = Asparagine; P = Proline; Q = Glutamine; R = Arginine; S = Serine; T = Threonine; V = Valine; W = Tryptophan; Y = Tyrosine;
Proteins of the invention may be in a crude extract or in a substantially isolated form. It will be understood that the protein may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated. A protein of the invention may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 50%, e.g., more than 80%, 90%, 95% or 99% of the protein in the preparation is a protein of the invention.
Proteins of the invention may be chemically modified, e.g. post-translationally modified. For example, they may be glycosylated or comprise modified amino acid residues. They may also be modified by the addition of certain residues like polyhistidine residues, polyarginine residues, polyasparte residues, polycysteine residues or polyphenylalanine residues, or glutathion-S-transferase, or protein A, or maltose binding protein, or galactose binding protein to assist their purification, or by addition of signal sequences to promote their secretion from a cell. Such modified proteins fall within the scope of the term "protein" of the invention.
Moreover, the invention relates to an assay being employed for the detection of molecules that show an interaction and most preferably an inhibiting effect on the biochemical activity of any protein based on any DNA sequence of the present invention when compared with the non-treated control of said protein.
Any assay can be employed that allows a measurement of the inhibiting effect of any molecule added to histone acetyltransferase activity on a suitable substrate under suitable buffer and reaction conditions. Most preferably, such assay is carried out in a single well of a plastics microtitre plate, so that high throughput screening for histone acetyltransferase activity inhibitors may be carried out. In practice, the assay is carried out preferably by adding histone acetyltransferase protein, most preferably in a purified form, to labeled acetyl-CoA as a donor molecule and histones as a natural receptor molecule. Any test substance, which can be a potential inhibitor, is added thereafter. As a control, the assay can be followed in the absence of the test substance. Additionally, the test substance may be tested with any other known enzyme to exclude the possibility that the test substance is a general inhibitor of enzyme activity. This would lead to a molecule which does act on a histone acetyltransferase, and preferably on the ROT protein in a highly specific manner.
In addition to the compounds as given above, the assay can contain a suitable substrate, the reaction mixture can contain a suitable buffer, suitable cofactors and suitable divalent cations as a cofactor. A suitable buffer includes any suitable biological buffer that can provide buffering capability at a pH conductive to the reaction requirements of the enzyme.
For example such an assay for identifying an inhibitor of an acetyl transferase may comprise the following steps:
(a) incubation of (i) cellular protein or (ii) histone actyltransferase protein (crude extract) with histones and radioactive labelled acetyl-CoA, preferably 3H- actyl-CoA for a defined time period, in general in the range of 10-60 min, preferably 20-40 min and most preferably for 30 min and at certain temperature conditions, in the range of 25-40°C, preferably between 28 an 35°C, and most preferably at 30°C; and
(b) incubation of (i) cellular protein or (ii) histone actyltransferase protein (crude extract) in presence of a potential inhibitor with histones and radioactive labelled acetyl-CoA, preferably 3H-actyl-CoA for a defined time period, in general in the range of 10-60 min, preferably 20-40 min and most preferably for 30 min and at a certain temperature conditions, in the range of 25-40°C, preferably between 28 an 35°C, and most preferably at 30°C; and
(c) incubating a control sample containing (i) the cellular protein or (ii) histone acetyltransferase (crude extract) and radioactive labelled acetyl-CoA as under (a) but without the histone substrate in order to define the non-specific protein acetylation of the assay reaction; and
(d) in case of adding the cellular protein (i) to the reaction, spotting aliquots of the reaction and control mixtures on filters and counting in a liquid scintillation counter; or
(e) in case of adding histone actyltransferase (ii) to the reaction, detection of actetylated proteins after polyacrylamide gelelectrophoresis. A substance which inhibits or affects the activity of a histone acetyltransferase like ROT may do so by binding the enzyme. Such enzyme inhibition may be reversible or irreversible. An irreversible inhibitor dissociates very slowly from its target enzyme because it becomes very tightly bound to the enzyme, either covalently or non-covalently. Reversible inhibition, in contrast with irreversible inhibition, is characterised by a rapid dissociation of the enzyme-inhibitor complex. The test substance may be a competitive inhibitor. In competitive inhibition, the enzyme can bind substrate (forming an enzyme-substrate complex) or inhibitor (enzyme-inhibitor complex) but not both. Many competitive inhibitors resemble the substrate and bind the active site of the enzyme. The substrate is therefore prevented from binding to the same active site. A competitive inhibitor diminishes the rate of catalysis by reducing the proportion of enzyme molecules bound to a substrate. The inhibitor may also be a non-competitive inhibitor. In non-competitive inhibition, which is also reversible, the inhibitor and substrate can bind simultaneously to an enzyme molecule. This means that their binding sites do not overlap. A non- competitive inhibitor acts by decreasing the turnover number of an enzyme rather than by decreasing the turnover number of an enzyme rather than by diminishing the proportion of enzyme molecules that are bound to substrate. The inhibitor can also be a mixed inhibitor. Mixed inhibition occurs when an inhibitor both effects the binding of substrate and alters the turnover number of the enzyme. A substance which inhibits the activity of ROT may also do so by binding to the substrate. The substance may itself catalyse a reaction of the substrate, so that the substrate is not available to the enzyme. Alternatively, the inhibitor may simply prevent the substrate binding to the enzyme.
Suitable candidate substances for inhibitors of ROT include combinatorial libraries, defined chemical identities, peptide and peptide mimetics, and natural product libraries. The candidate substances may be used in an initial screen of, for example, ten substances per reaction, and the substance of these batches which show inhibition will be tested individually. An inhibitor of an histone acetyltransferase like ROT is one which produces a measurable or sufficient reduction in ROT activity in the assays described above. Preferred substances are those which inhibit the histone actyltransferase activity by at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95% or at least 99% at a concentration of the inhibitor of 1 μg/ml, 10μg/ml, 100μg/ml, 500μg/ml, 1 mg/ml, 10mg/ml, 100mg/ml. The percentage inhibition represents the percentage decrease in activity in a comparison of assays in the presence and absence of the test substance. Any combination of the above mentioned degrees of percentage inhibition and concentration of inhibitor may be used to define an inhibitor of the invention, with greater inhibition at lower concentrations being preferred. Candidate substances which show activity in assays such as those described above can be tested in in v/Vo-systems, such as animal model, preferred on insects and specifically preferred on insect model systems for the validation of insecticidal molecules. Preferably, candidate substances show an activity in such in vivo systems on the ROT protein.
Beside the described assay, any suitable assay format may be used for identifying an inhibitor of ROT. In the case of using a construct of the invention, a suitable cell extract will typically be used.
The invention also relates to chemical compounds that had been identified in the assay system of the present invention compared to a non-treated control of said recombinant gene product.
Such chemical compound(s) can be used in appropriate chemical compositions for insect control based on the specific inhibition or sufficient reduction of activity of the native target molecule in an insect. The present invention also relates to methods controlling feeding behaviour of insects by using the chemical compounds identifiable as of being inhibitors of an insect histone acetyltransferase, preferably to methods for insect control by specifically inhibiting a protein encoded by a DNA sequence as defined under (a), (b), (c), (d), or (e) of present invention.
The chemical compounds identified according to the invention can be used in agrochemistry, veterinary, pharmaceutical applications, and on non-living materials. The inhibitors (active ingredients) of the present invention are normally applied in the form of compositions together with one or more agriculturally acceptable carriers or diluents, and can be applied to the crop area or plant to be treated, simultaneously or in succession with, further compounds. These compounds can be both fertilizers or micro-nutrient donors or other preparations that influence plant growth. They can also be herbicides, insecticides, fungicides, bactericides, nematicides, molluscicides or mixtures of several of these preparations, if desired together with further carriers, surfactants or application-promoting adjuvants customarily employed in the art of formulation. Suitable carriers and diluents correspond to substances ordinarily employed in formulation technology, e.g. natural or regenerated mineral substances, solvents, dispersants, wetting agents, tackifiers, binders or fertilizers.
The active ingredient may either be applied by spraying, soil application or seed coating.
The active ingredients are used in unmodified form or, preferably, together with the adjuvants conventionally employed in the art of formulation, and are therefore formulated in known manner preferably to emulsifiable concentrates, coatable pastes, directly sprayable or dilutable solutions, dilute emulsions, wettable powders, soluble powders, dusts, granulates, and also encapsulations, for example, in polymer substances. Like the nature of the compositions, the methods of application, such as spraying, atomising, dusting, scattering or pouring, are chosen in accordance with the intended objectives and the prevailing circumstances. Advantageous rates of application are normally from 5g to 5 kg of active ingredient per hectare (a.i/ha), preferably from 50g to 2.5 kg a.i./ha, most preferably from 100 to 1 kg a.i./ha.
Suitable solvents include but are not limited to aromatic hydrocarbons, preferably the fractions having 8 to 12 carbon atoms, for example xylene mixtures or substituted naphthalenes, phthalates such as dibutyl phthalate or dioctyl phthalate, aliphatic hydrocarbons such as cyclohexane or paraffins, alcohols and glycols and their ethers and esters, such as ethanol, ethylene glycol monemethyl or monoethyl ether, ketones such as cyclohexanone, strongly polar solvents such as N-methyl-2- pyrrolidone, dimethyl sulfoxide or demethyl formamide, as well as epoxidized vegetable oils, such as epoxidized coconut oil or soybean oil, or water. The solid carriers used e.g. for dusts and dispersible powders, are normally natural mineral fillers such as calcite, talcum, kaolin, montmorillonite or attapulgite. In order to improve the physical properties it is also possible to add highly dispersed silicic acid or highly dispersed adsorbent polymers. Suitable granulated adsorptive carriers are porous types, for example pumice, broken brick, sepiolite or bentonite; and suitable non-sorbent carriers are materials such as calcite or sand. In addition, a great number of pregranulated materials of inorganic or organic nature can be used, e.g. especially dolomite or pulverised plant residues. Depending on the nature of the active ingredient to be used in the formulation, suitable surface-active compounds are nonionic, cationic and/or anionic surfactants having good emulsifying, dispersing and wetting properties. The term "surfactants" will also be understood as comprising mixtures of surfactants. Suitable anionic surfactants can be both water-soluble soaps and water-soluble synthetic surface- active compounds.
The invention also relates to compositions, containing preferably insecticidal or acaricidal ingredients comprising one or more active substances influencing the activity of histone acetyltransferases like ROT, preferably on a specific way. The agrochemical compositions usually contain form about 0.1% to about 99%, preferably about 0.1 % to about 95%, and most preferably from about 3 to about 90% of the active ingredient, from about 1 to about 99.9%, preferably form about 1 to about 99%, and most preferably form. about 5% to about 95% of solid or liquid adjuvant, and from about 0% to about 25%, preferably about 0.1% to about 25%, and most preferably from about 0.1 % to about 20% of a surfactant. The respective types of formulation are known and are described for example in: Winnacker-Kϋchler, "Chemische Technologie", Volume 7, C. Hauser Veriag Munich, 4th Edition 1986, van Falkenberg, "Pesticides Formulations", Marcel Dekker N.Y., 2nd Edition, 1972-1973, Martens, "Spray Drying Handbook", 3rd Edition, G. Goodwin Ltd. London.
The necessary formulation aid, which can be, for example, surface active substances like inert materials, tensides, diluents and further additives are known and are descirbed for example in: Watkins, "Handbook of Insecticide Dust Diluents and Carriers", 2nd Edition, Darland Books, Caldwell N.J.; Olphen, "Introduction to Clay Colloid Chemistry", 2nd Edition, J. Wiley & Sons, N.Y.; Marsden, "Solvents Guide", 2nd Edition, Interscience, N.Y. 1950; ;Cutcheon's, "Detergents and Emulsifiers Annual", MC Publ. Corp., Ridgewood N.J.; Sisley and Wood, "Encyclopedia of Surface Active Agents", Chem. Publ. Co. Inc., N.Y., 1964; Schόnfeldt, "Grenzflachenaktive Athylenoxiaddukte", Wiss. Veriagsgesell., Stuttgart, 1967; Winnacker-Kϋchler, "Chemische Technologie, Volume 7, C. Hauser Veriag, Munich, 4th Edition.
Alternatively, the identified inhibitors may be used as insecticides for application to insects on animals, especially on mammals, or on non-living materials. In such cases, standard applications, frequencies and/or formulations known to the skilled artisan may be used.
The following Examples are intended to illustrate the present invention without in any way restricting its scope. Example A: Genetical identification of rot
The original rot mutant, 1(2)09373, was identified by screening the Spadling collection of P-element induced lethal lines (Karpen, G., Spadling, A. Genetics 132, 737 (1992)) to isolate larval mutants that are defective in food intake. The phenotype of 1(2)09373 is a failure of the food to be pumped into the esophagus, which was visualised by using dyed food. The dyed food assay has been described by Zinke et al. (Development, 126, 5275 (1999)). Additional rot alleles have been isolated by performing a standard ethyl methane sulfonate (ems) mutagenesis screen for mutants that fail to complement 1(2)09373. Ems mutagenesis was carried out by feeding 20 or 25 mM ems in sugar solution to pr en bw male Drosophila melanogaster (Tubingen stock collection # A234) flies. Mutagenised chromosomes were tested in single pair crosses for complementation to 1(2)09373. 5800 single lines were established, and from these five new alleles of rot were identified. Two of these, rot60 and rot104, showed the same phenotype as the original allele. Rot2 is a weaker allele since the mutants can grow larger than those of rot60 and rot104 mutants. Mutant stocks were kept balanced over CyO with GFP-Kr (Casso D. et al., : Mech Dev 2000 Mar 1;91(1-2):451), which shows GFP expression in the Bolwig organs of larvae. The use of this balancer allows mutant larvae to be unambiguously identified.
Example B: Isolation and characterisation of rot and the protein encoded
The gene mutagenised by the P-element insertion in 1(2)09373 was identified by plasmid rescue, using standard techniques. Comparison of plasmid rescue fragments with sequences from the Drosophila genome sequencing project revealed that the P-element had inserted 5' of the genghis khan (gek) coding region and has caused the deletion of 15755 kb genomic stretch containing the entire gene 5' of the gek gene. The genomic region was characterised by screening a Drosophila melanogaster genomic library (Lamda Fixll, Stratagene) with a radio labelled PCR fragment corresponding to the 5' half of gek [Primer GK1+ (forward) [SEQ ID NO 4]: 5'- GAT GGA ATA CGA ATC TTC - 3' (gek Exonl)/ Primer GK3- (reverse) [SEQ ID NO 5]: 5'- GCG CTT ATC GAG CAG TAC - 3' (gek Exon4)]. The longest clone . identified (Clone 8) contained part of the gek locus and the entire rot gene (with Exons from positions: 1180-2061 [Exonl], 2565-3436 [Exon2], 3496-3576 [Exon3]. 3637-8381 [Exon4], and 8447-9724 [Exonδ]. The identification of this gene as the rotkehlchen locus was achieved by phenotypic rescue and sequencing of ems induced rot alleles. Phenotypic rescue of the rotkehlchen phenotype was performed using a 8943 bp genomic fragment spanning the entire rot locus, cloned in 3 steps into the Drosophila transformation vector pCaSpR-4 (Pirrotta et al., in: "Vectors for P-element transformation in Drosophila"; eds.: Rodriguez and Denhardt, 437-456 (1988), resulting in the Rot transgenic vector pRotl . Cloning of pRotl was done in the following way: A 2839 bp Nsi l(blunt)/Xbal and a 4277 bp Xbal/EcoRI fragment was cloned into pBluescript KS (Stratagene), linearised with Pstl(blunt)/EcoRI. From this intermediate construct a 7147 bp Notl/EcoRI fragment was excised and ligated, together with a 1756 bp EcoR l/Hindlll genomic fragment into a Notl/Hindlll linearised pBluescript KS. Finally, from this intermediate construct, a Notl/Kpnl fragment was cloned into a Notl/Kpnl linearised pCaSpR-4 vector. A stock was established, which harbours pRotl on the third chromosome (referred to here as P- rescue). Using standard genetical crosses, a stock was constructed with l(2)09373/CyO; P-rescue/P-rescue. The phenotype of progenies from this stock was compared in parallel with those of the original l(2)09373/CyO; +/+ stock. From a collection of 831 eggs each, 596 (original stock) and 599 (P-rescue stock) hatched larvae were obtained. From these, 157 larvae with the distinct red pharynx feeding defect were seen in animals from the original stock, whereas only 21 were obtained from the P-rescue stock. Rot cDNA clones were identified in a Drosophila melanogaster cDNA library constructed by Nick Brown (NH Brown and FC Kafatos: Functional cDNA Libraries from Drosophila Embryos; J.Mol.Biol., 203, p425- 437(1988)) using a radioactively labelled probe corresponding to the 2478 bp Xbal/Sall fragment in exon 4 of the rot gene. A full length clone was identified (pMaxl 0) and characterised by sequencing. Molecular analysis of ems generated rot alleles was carried out from genomic DNA isolated from approximately 100 mutant larvae, which were identified based on their feeding phenotype. Primers were designed to generate fragments of about 800 bp in overlapping manner over the entire genomic region of the rot gene: (Del-1983+(gtgtaacgcggagctgag) [SEQ ID
NO 6]/Del-2782-(ccttgttgtagaccttgatg) [SEQ ID NO 7]; Del-
2441+(gagtgcctattgactacc) [SEQ ID NO 8] or Del-2664+ (ctccgtgcagaggatttg) [SEQ
ID NO 9]/Del-3530-(cttcggagtatcaaagcc) [SEQ ID NO 10];
Del-3389+(gtcttgatacgattccagac) [SEQ ID NO 11]/Del-4184-(ctaggccatcgccagtac)
[SEQ ID NO 12];
Del-4067+(ggatgacgaatacgacgag) [SEQ ID NO 13]/Del-4860-(caggtttcaatgtcccac)
[SEQ ID NO 14];
Del-4703+(cgccacggatgtggaattg) [SEQ ID NO 15]/Del-5481-(gcgatgtcggaaatagcc)
[SEQ ID NO 16];
Del-5109+(acactctactacgacgtag) [SEQ ID NO 17]/Del-5814-(gaagactcctgattcacc)
[SEQ ID NO 18];
Del-5710+(tgagcaaccaaatggagac) [SEQ ID NO 19]/Del-6259-(gtcgacatgctccttttc)
[SEQ ID NO 20];
Del-6153+(ccagctcaaagtcaagcgg) [SEQ ID NO 21]/Del-6793-(gtgcacatccaactccag)
[SEQ ID NO 22];
Del-6536+(gtagcatcgtacaacactg) [SEQ ID NO 23]/Del-7301-(ggatcttgtcccgaatgg)
[SEQ ID NO 24];
Del-7169+(gatcacagcaagacgaaag) [SEQ ID NO 25]/Del-7918-(gaccgatgtcgagttgac)
[SEQ ID NO 26];
Del-7772+(ctggccaatgtccagaac) [SEQ ID NO 27]/Del-8469-(gtgtcggtgagctaactg)
[SEQ ID NO 28];
Del-8238+(ccatgcacatgtccatcc) [SEQ ID NO 29]/Del-9038-(caggctacacagattgcc)
[SEQ ID NO 30];
Del-8944+ (gtaacaatgatcagcggc) [SEQ ID NO 31]/ Del-9685-
(cagcacacatttatgtacagg) [SEQ ID NO 32].
PCR products were cloned into the TOPO TA vector (Invitrogen) and sequenced with M13 forward and M13 reverse primers. For the clones that showed a mutation,
PCR was repeated and clones resequenced. rot 60 showed a c - t transition in position 2563 relative to the entire rot open reading frame, rot104 showed a c → t transition in position 2569. Both mutations cause translation stops within the MYST domain, proceeding the absolutely conserved glycine residue of homologous acetyltransferases
ROT belongs to the MYST domain containing class of histone acetyl transferases. These include the human MOZ (accession No. U47742), MORF (accession No. NM_012330), and TIP60 (accession No. U74667), yeast SAS2 (accession No. S48299), and SAS3 (accession No. P34218), and Drosophila MOF (accession No. U71219). The MYST domain contains a characteristic C2HC zinc finger and an acetyl CoA binding site. ROT shows highest homology to the human MOZT gene, and both also possess PHD fingers, which are thought to be involved in chromatin interaction (Assland, Gibson and Stuard, TIBS 20, 56 (1995). The rot gene of SEQ ID NO 1 encoding the ROT protein of SEQ ID NO 3 was deposited on June 16, 2000 according to the Budapest treaty at the DSMZ- Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1 b, D-38124 Braunschweig, Germany and obtained the catalogue number: DSM 13549. The corresponding cDNA (SEQ ID NO 2) of the rot gene encoding the ROT protein of SEQ ID NO 3 was also deposited on June 19, 2000 according to the Budapest treaty at the DSMZ-Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Mascheroder Weg 1b, D-38124 Braunschweig, Germany and obtained the catalogue number: DSM 13550.
Example C: Expression of ROT
Expression of rof ceft/cften-histone acetyltransferase (ROT-HAT) acetyltransferase was expressed as a 2774 bp BamHI/Hindlll fragment derived from pMax10, containing the PHD domain and MYST domain (acetyltransferase catalytic domain (ROT-HATcat)) in insect cells using the baculoviral transfer vector pBacPAK9 (Clontech Labs., Palo Alto). The Bam MHincβ rot fragment was first cloned into a BamHI/Hindlll linearised pQE32 E. coii expression vector (Qiagen). This first cloning step added a start codon and a 6xHis tag upstream and an in-frame stop codon downstream to the ROT reading frame. This intermediate construct was called pMB1. From this, a 2952 bp EcoRI/Nhel fragment was excised and cloned into a EcoRI/Xbal linearised pBacPAK9 vector. The resulting construct was called pBacPAK9- ROT-HATcat.
1. Preparation of recombinant baculovirus
Insect cells BTI-TN-5B1-4 were seeded at 1.5 x 106 ml"1 in Grace's medium and incubated for 4 hours at 27° C. Cells were washed twice with serum-free Grace's medium before transfection.
The following transfection mix was prepared: 500 ng recombinant transfer vector pBacPAKδ, 5 μl BacPAKδ viral DNA (Bsu36 I digest, Clontech Labs, Palo Alto), 91 μl sterile distilled water. 4 μl Lipofectin were added to the solution and gently mixed for 15 min at RT. The mix was then added to 1.5 ml of serum-free Grace's medium and incubated with the cells for 2 h at 27° C with gentle shaking. Then 3 ml Grace's medium were added and the cells were incubated for 72 h for recombinant baculovirus production.
2. Preparation of ROT-HAT or ROT-HATcat crude fractions
Clonal recombinant baculoviruses was isolated from single plaques following standard protocols and propagated further. After virus titer determination BTI-TN- 5B1-4 cells were infected at a m.o.i (multiplicity of infection) of 10 with recombinant baculovirus. After 36 h incubation the cells were harvested by centrifugation for 10 min at 800 x g and washed with PBS (50 mM phosphate buffer, 0.15 M NaCl, pH 7.4).
Cells were lysed by three cycles of freezing and thawing followed by centrifugation for 10 min at 800 x g. The protein concentration of the cell-free lysate was determined (Bradford).
Example D: Method to identify an inhibitor of ROT Histone acetyltransferase assay Histone acetyltransferases and histone deacetylases participate in the remodeling of chromatin structure thereby regulating its transcriptional activity (Magnaghi- Jaulin, et al.; Cell Development. Biology, 10, 197-203 (1999)). Acetylation neutralises the charge of ε-amino groups of lysine residues in the N-terminal domains of histones. Histone actyltransferases act on either free histones or nucleosomes.
1. Phosphocellulose binding assay
100 μg of cellular protein were incubated with 10 μg μl"1 histones (calf thymus, type IIA, Sigma) and 3.7 kBq 3H-acetyl-CoA in 50 mM Tris-HCI, pH 8.0, 1 mM DTT, 0.1 mM EDTA for 30 min at 30° C. Control samples contained protein and acetyl-CoA without the histone substrate to account for non-specific protein acetylation. 10 μl aliquots of the reaction and control mixtures were spotted on phosphocellulose filters (Whatman P-81) and washed with 50 mM sodium bicarbonate buffer, pH 9.0, to wash out non-reacted acetyl-CoA. After drying the filters were counted in a liquid scintillation counter.
2. Electrophoretic analysis of acetylated histones
100 μg of HAT protein (crude extracts) were incubated with 10 μg μl"1 histones (calf thymus, type IIA, Sigma) and 10 μM 14C-acetyl-CoA in 50 mM Tris-HCI, pH 8.0, 1 mM DTT, 0.1 mM EDTA in a total volume of 100 μl for 30 min at 30° C. Control samples without histone substrate were run in parallel. The reaction was stopped by addition of double-concentrated SDS-sample buffer and proteins were subjected to SDS polyacrylamide gel electrophoresis (15% polyacrylamide gels). Gels were fixed in 20% methanol, 10% acetic acid and subsequently soaked in intensifying liquid scintillant (NEN). After drying, gels were autoradiographed to detect acetylated proteins.

Claims

Claims:
1. An isolated DNA molecule comprising a DNA sequence encoding a protein which shows the biological activity of an insect histone acetyltransferase, said DNA sequence being selected from the group of:
(a) DNA sequences, coding for a protein with an amino acid sequence as listed under SEQ ID NO 3;
(b) DNA sequences comprising the region of the DNA sequence as listed under SEQ ID NO 1 or SEQ ID NO 2;
(c) DNA sequences, hybridising with DNA sequences as being defined under (a) or (b);
(d) DNA sequences, showing a modified sequence and wherein such modification(s) is (are) based on the degeneration of the genetic code in comparison to the DNA sequences as being defined under (a), (b), or (c); and
(e) DNA sequences that are fragments, derivatives or allelic variants of DNA sequences as listed under (a) to (d).
2. An isolated DNA molecule or parts or derivatives thereof which are able to hybridise specifically with DNA molecules as claimed in claim 1 or parts or derivatives thereof, and wherein parts or derivatives can result from insertion, deletion, addition, substitution and/or inversion.
3. A DNA vector comprising one or more DNA molecules as claimed in claims 1 or 2.
4. A DNA vector as claimed in claim 3 wherein the DNA molecule of claims 1 or 2 is connected to regulatory elements in order to guarantee a proper transcription in an appropriate cellular environment.
5. Use of a DNA vector as claimed in claims 3 or 4 in prokaryotic or eukaryotic cells.
6. Use of a DNA vector as claimed in claims 3 or 4 in insect cells.
7. A DNA vector as claimed in claim 4 which is based on a baculovirus expression system.
8. A host cell, harbouring any DNA molecule according to claims 1 or 2 and/or any DNA vector according to claims 3 or 4 or 7.
9. A method for the production and/or isolation of a protein encoded by any DNA sequence according to claims 1 or 2 and which protein is obtained from a host cell according to claim 8.
10. An isolated protein encoded by a DNA sequence according to claims 1 or 2.
11. Use of a protein encoded by a DNA sequence according to claims 1 or 2 for the biochemical or structural characterisation of potential inhibitors of the encoded protein.
12. Use of a protein obtainable according to claim 9 for the biochemical or structural characterisation of potential inhibitors of the encoded protein.
13. An assay for the detection of molecules that show an effect on the biochemical activity of any protein according to claims 9 or 10 when compared with the non-treated control of protein in presence of a suitable substrate and under suitable buffer and assay conditions.
14. A method for screening for histone acetyltranferase inhibitors by using the assay system according to claim 13.
15. A chemical compound being identifiable by the assay according to claim 13, or the method as claimed in claim 14.
16. An insecticidal composition comprising an insecticidally effective amount of a chemical compound according to claim 15.
17. A method for insect control by using a chemical compound according to claim 15, or an insecticidal composition according to claim 16.
18. Use of a chemical compound according to claim 15 in appropriate chemical compositions for insect control based on the specific inhibition or sufficient reduction of activity of the native target protein in an insect.
19. Use of a chemical compound according to claim 15 in appropriate chemical compositions for insect control based in the specific inhibition or sufficient reduction of the activity of the ROT protein.
20. A method for insect control characterised by specifically inhibiting a protein encoded by a DNA sequence according to claim 1 or 2.
21. A method for insect control according to claim 20, wherein the insect to be controlled exists in crop planting areas.
22. A method for insect control according to claim 20, wherein the insect to be controlled exists on animals.
23. A method for insect control according to claim 20, wherein the insect to be controlled exists on non-living materials.
EP01949388A 2000-06-27 2001-06-08 Histone acetyltransferase inhibitors and their use as insecticides Withdrawn EP1366069A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP01949388A EP1366069A2 (en) 2000-06-27 2001-06-08 Histone acetyltransferase inhibitors and their use as insecticides

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP00113527 2000-06-27
EP00113527 2000-06-27
EP01949388A EP1366069A2 (en) 2000-06-27 2001-06-08 Histone acetyltransferase inhibitors and their use as insecticides
PCT/EP2001/006505 WO2002000864A2 (en) 2000-06-27 2001-06-08 Histone acetyltransferase inhibitors and their use as insecticides

Publications (1)

Publication Number Publication Date
EP1366069A2 true EP1366069A2 (en) 2003-12-03

Family

ID=8169072

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01949388A Withdrawn EP1366069A2 (en) 2000-06-27 2001-06-08 Histone acetyltransferase inhibitors and their use as insecticides

Country Status (3)

Country Link
EP (1) EP1366069A2 (en)
AU (1) AU2001270558A1 (en)
WO (1) WO2002000864A2 (en)

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998003652A2 (en) * 1996-07-23 1998-01-29 The Government Of The United States Of America, Represented By The Secretary, Department Of Health And Human Services P300/cbp-associated transcriptional co-factor p/caf and uses thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0200864A3 *

Also Published As

Publication number Publication date
WO2002000864A3 (en) 2003-10-02
AU2001270558A1 (en) 2002-01-08
WO2002000864A2 (en) 2002-01-03

Similar Documents

Publication Publication Date Title
BE1015281A5 (en) Receptors gaba-b.
Meister et al. The antimicrobial host defense of Drosophila
US20040236092A1 (en) Peptidologlycan recognition protein encoding nucleic acids and methods of use thereof
CA2216702A1 (en) Nucleotide and protein sequences of lats genes and methods based thereon
WO1996024605A1 (en) Methods and compositions for altering sexual behavior
US7777000B2 (en) Anti-viral activity of cathelicidin peptides
US6087488A (en) Potassium ion channel genes and proteins
US20030013177A1 (en) Polynucleotides encoding insect glutaminyl cyclase and uses thereof
EP1366069A2 (en) Histone acetyltransferase inhibitors and their use as insecticides
EP1130970B1 (en) Insecticidal agents
WO1997022690A2 (en) SIGNALING INOSITOL POLYPHOSPHATE 5-PHOSPHATASES (SIPs)
US5654397A (en) Interleukin-1 receptor-associated protein kinase and assays
AU702844B2 (en) Interleukin-1 receptor-associated protein kinase and assays
US7195902B2 (en) Phosphatases which activate map kinase pathways
CA2370313A1 (en) Materials and methods useful for the control of insect larvae
US5470735A (en) Insecticidal plectoxins from Plectreurys tristis
US6228641B1 (en) Diagnosis and treatment of PTP04 related disorders
US6630323B1 (en) Naked cuticle genes and their uses
CN114041464B (en) A way to enhance plant resistance to bacteria
JPH104976A (en) TAB1 protein and DNA encoding the same
CA2275434A1 (en) Insect sodium channels from insecticide-susceptible and insecticide-resistant house flies
JP2007000061A (en) Drugs that alter the physiological state of pests associated with c-Jun amino-terminal kinase activity from insects
WO2001018057A2 (en) Serine protease inhibitors (spn43a) from drosophila
US20030049711A1 (en) Polynucleotides encoding insect cysteine protease and uses thereof
CA2437121A1 (en) Juvenile hormone esterase

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17P Request for examination filed

Effective date: 20040402

RIN1 Information on inventor provided before grant (corrected)

Inventor name: GUNKEL, NIKOLAS

Inventor name: BENTING, JUERGEN

Inventor name: LUEMMEN, PETER

Inventor name: ZINKE, INGO

Inventor name: PANKRATZ, MICHAEL, J.

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: FORSCHUNGSZENTRUM KARLSRUHE GMBH

RIN1 Information on inventor provided before grant (corrected)

Inventor name: GUNKEL, NIKOLAS

Inventor name: BENTING, JUERGEN

Inventor name: LUEMMEN, PETER

Inventor name: ZINKE, INGO

Inventor name: PANKRATZ, MICHAEL, J.

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060228