EP1356087A2

EP1356087A2 - Genetic determinant for chronic inflammatory disease

Info

Publication number: EP1356087A2
Application number: EP01914028A
Authority: EP
Inventors: Jack Gastro-Enterology Unit SATSANGI; Kenneth National Heart & Lung Institute WELSH; Neil Department of Surgery HALDAR; Roger Gastro Intestinal Unit CHAPMAN
Original assignee: Oxford University Innovation Ltd
Current assignee: Oxford University Innovation Ltd
Priority date: 2000-03-22
Filing date: 2001-03-22
Publication date: 2003-10-29
Also published as: WO2001071030A3; WO2001071030A2; AU2001239416A1; GB0006960D0

Abstract

There is disclosed a method for determining susceptibility of a human subject to a chronic inflammatory disease which method comprises screening for the presence or absence in the genome of the human subject of one or more polymorphic variants of the MMP-3 gene. Also disclosed is a method for determining susceptibility of a human subject to a chronic inflammatory disease which method comprises screening for the presence or absence in the genome of the human subject of one or more polymorphic variants of the MMP-3 gene and determining the genotype of the subject at one or more further polymorphic loci associated with the said chronic inflammatory disease.

Description

GENETIC DETERMINANT FOR CHRONIC INFLAMMATORY DISEASE

Primary sclerosing cholangitis (PSC) is a chronic cholestatic disease characterised by inflammation and fibrosis of the intra- and extra-hepatic biliary tree¹. The natural history of the disease is variable, but progression to end-stage liver disease is common: the median time interval from diagnosis to death (from liver failure or cholangiocarcinoma) or transplantation is 12 years². PSC is a leading indication for liver transplantation in North America³.

The cause of PSC is unknown. The close association with inflammatory bowel disease, particularly extensive ulcerative colitis, has provoked search for common immunological, environmental or genetic factors, but PSC may occur with no evidence of intestinal inflammation, or in association with other conditions, notably thyroiditis, retro-peritoneal fibrosis, arthritis, mediastinal fibrosis and scleroderma³. PSC is more common in men, with a mean age of presentation of 35- 40 years.

By analogy with other chronic liver diseases⁴, inflammatory bowel diseases⁵ and immuno-mediated diseases⁶, host susceptibility is likely to be important in disease pathogenesis. The contribution of the major histocompatibility complex (in man the HLA system at ,6p21) has been most extensively investigated in PSC. The HLA Class II region has received most attention⁷. The strongest association reported is with the HLA DRB1*0301 DQB1*02 haplotype. Negative association with the DRB1*04 DQB1*0302 haplotype is documented: the haplotype may influence disease severity and the presence of extra-intestinal manifestations (Gow, unpublished data) . Controversy continues as to whether these documented associations reflect the role of the Class II molecules, o the extensive linkage disequilibrium within the Class II region. Moreover, it remains unclear as to whether these associations are related to primary sclerosing cholangitis, or concomitant ulcerative colitis⁸.

In contrast, the role of non-HLA genetically- encoded determinants of disease has received relatively little attention. Genome-wide scanning is impracticable in PSC at present, but there are a number of attractive candidate genes. The metalloproteinases, and naturally-occurring tissue inhibition of metalloproteinases (TIMPs) regulate extra-cellular matrix degradation, fibrosis and immune activity in the liver and gastro-intestinal system⁹'¹⁰. Stromelysin (matrix metalloproteinase 3, MMP-3) is widely involved: it degrades type II, IV, IX collagen, laminins, fibronectin, gelatins, and elastin, and may activate other metalloproteinase enzymes such as collagenase, and gelatinase B. Expression of stromelysin is regulated at the level of transcription: binding sites for stimuli which induce transcription have been demonstrated in the promoter region of the gene ^u.

Recent strong evidence has suggested that a common polymorphism at base -1171 (relative to the site of initiation of transcription) both alters transcription factor binding and regulates gene expression ¹²' ¹³ . In transfection experiments, Ye and colleagues compared the relative effects on gene expression of the allelic variants - one containing a sequence of five adenosines (-1171 5A) , one containing six (-1171 6A) . The construct with the 6A allele at the polymorphic site was associated with less gene expression than the 5A allele. The present inventors investigated the contribution of this polymorphism to the pathogenesis of sclerosing cholangitis in a staged study using two independent cohorts of patients with PSC, a control group with ulcerative colitis, and two groups of healthy subjects. The results provided strong evidence that inherited variation in the stromelysin gene may influence not only susceptibility to PSC, but also the development of portal hypertension. These findings may have important implications and clinical application in other forms of chronic liver disease, and also in extra-hepatic chronic inflammatory diseases.

In accordance with a first aspect of the invention there is provided a method for determining susceptibility of a human subject to a chronic inflammatory disease which method comprises screening for the presence or absence in the genome of the human subject of one or more polymorphic variants of the MMP-3 gene.

The method of the invention preferably comprises screening the genome of the subject for one or more polymorphic variants of the MMP-3 gene which have previously been demonstrated to show statistically significant association with susceptibility to a chronic inflammatory disease, for example in a population-based genetic association study. Most preferably, the polymorphic variant will be one which affects the function of the MMP-3 gene (GenBank accession No. J04732) . Polymorphisms affecting MMP-3 function might include variants occurring in a regulatory region of the gene, for example the promoter region, which affect the level of gene expression or variants which result in amino acid substitutions which affect the function of the stromelysin protein encoded by the MMP-3 gene.

In a preferred embodiment the method of the invention comprises determining the genotype of the individual at position -1171 in the promoter region of the MMP-3 gene, wherein individuals having at least one 5A allele at this position are scored as being susceptible to the said chronic inflammatory disease. It is also within the scope of the invention to perform screens for the presence or absence in the genome of the human individual of one or more polymorphic variants of the MMP-3 gene, for example the -1171 5A allele, in conjunction with screens (in the same individual) for other polymorphisms associated with chronic inflammatory disease, for example as part of a panel of screens.

The further polymorphisms associated with chronic inflammatory disease may be single nucleotide polymorphisms or might be other types of polymorphic variation such as, for example, variable number tandem repeats. Moreover, the further polymorphisms need not necessarily occur in the MMP-3 gene but could be any polymorphic variation associated with chronic inflammatory disease. The contribution of HLA Class II genotype to PSC has already been noted, the strongest association so far reported being with the HLA DRB*0301 DQB*02 haplotype. Thus, the invention provides for genetic screens which combine genotyping at a polymorphic locus within MMP-3, preferably at position -1171, and genotyping in the HLA Class II region.

The further polymorphisms will preferably be ones for which a statistically significant association with chronic inflammatory disease has been demonstrated, for example in a population-based association study. However, it will be appreciated that the panel might also include screens for polymorphic variants which are either in linkage disequilibrium with or in close physical proximity to a marker shown to be associated with chronic inflammatory disease but which have not themselves been shown to be associated with disease susceptibility in a population-based study.

As would be readily apparent to persons skilled in the art of human genetics, "linkage disequilibrium" occurs between a marker polymorphism (e.g. a DNA polymorphism which is ^λsilent' ) and a functional polymorphism (i.e. genetic variation which affects phenotype or which contributes to a genetically determined trait) if the marker is situated in close proximity to the functional polymorphism. Due to the close physical proximity, many generations may be required for alleles of the marker polymorphism and the functional polymorphism to be separated by recombination. As a result they will be present together on the same haplotype at higher frequency than expected, even in very distantly related people. As used herein the term "close physical proximity" means that the two markers/alleles in question are close enough for linkage disequilibrium to be likely to arise.

Polymorphisms elsewhere within the MMP-3 gene, and in other genes within the metalloproteinase gene complex on chromosome 11 ¹⁸ are possible candidates for inclusion into the panel of screens. In addition, any genetic variant which interacts epistatically with MMP-3 is a possible candidate for inclusion into the panel of screens. It is suspected that epistatic interaction between the MMP-3 polymorphism and other candidate loci might be important in PSC, epistatic interaction with genes within the major histocompatibility complex being particularly pertinent. Other metalloproteinases, tissue inhibitors and other regulators of immune function and fibrosis all have relevant polymorphisms which may interact with MMP-3.

The above-described methods of the invention provide simple and straightforward genetic screens which may be used to identify ^Λat risk' individuals who may be more susceptible to chronic inflammatory disease by virtue of their genetic make-up. The ability to identify at risk' individuals using a genetic screen may allow early intervention with strategies aimed at delaying the onset or reducing the severity of disease.

The screening methods of the invention may advantageously be used to screen for predisposition to chronic liver diseases, especially chronic liver diseases which are classified as either cholestatic disease or fibrosing liver disease. Most preferably the methods of the invention will be used to screen for susceptibility to primary sclerosing cholangitis.

As will be illustrated in the accompanying Example, the polymorphism at position -1171 in the promoter region of the MMP-3 gene has been shown by the present inventors to be associated with the chronic liver disease primary sclerosing cholangitis (PSC) . These results may be applicable to other forms of chronic liver diseases, specifically primary biliary cirrhosis. In vi tro data have previously demonstrated the functional effect of allelic variation at the MMP-3 locus ¹². It is therefore to be expected that the 5A allelic variant may also predispose to other chronic liver diseases, especially those with similar pathological features to PSC, and also to chronic inflammatory diseases of other organs, such as the joints, lungs and gut.

In a further aspect the invention provides a method for identifying the or any genetic basis for chronic inflammatory disease in a human patient which method comprises screening for the presence or absence in the genome of the. patient of one or more polymorphic variants of the MMP-3 gene.

Again the method of the invention will preferably involve screening for the presence or absence of a functional polymorphism of MMP-3, most preferably one which has been shown to be associated with chronic inflammatory disease in a population-based association study. In a preferred embodiment the method will comprise determining the genotype of the patient at the -1171 position of the promoter region of the MMP-3 gene .

These methods of the invention may preferably be used to determine the or any genetic basis for chronic liver diseases, in particular primary sclerosing cholangitis and diseases with similar pathological features.

Knowledge of the genetic basis of chronic inflammatory disease in a particular patient may allow for a more rigorous classification of disease and assessment of risk of progression. It may further assist the clinician in selecting the most appropriate course of treatment for that patient.

In a still further aspect the invention provides a method for determining whether a patient previously diagnosed with primary sclerosing cholangitis is likely to develop complicating portal hypertension which method comprises screening for the presence or absence in the genome of the patient of one or more polymorphic variants of the MMP-3 gene.

In its most preferred embodiment, this method will also involve determining the genotype of the patient at the -1171 position of the promoter region of the MMP-3 gene. Patients who are homozygous for the 5A allelic variant will be scored as more likely to develop portal hypertension complicating their existing diagnosis of PSC than patients who are either heterozygous or homozygous for the 6A allele.

As will be shown in the accompanying Example, studies in two independent patient cohorts identified an association between the 5A5A genotype and portal hypertension. This finding, illustrating how the MMP- 3 promoter polymorphism may be a factor in disease progression, may have relevance to disease pathophysiology and also immediate clinical application. The identification of the 5A5A genotype as a marker for severe disease would assist in counselling, follow-up strategies and in allocation of pharmacological/endoscopic treatments for the prophylaxis of variceal bleeding.

In summary, the present inventors have identified a functional polymorphism in the MMP-3 gene as a marker both for pre-disposition to chronic liver disease, especially primary sclerosing cholangitis, and for disease progression. Thus the invention provides genetic screens to assist in the identification of ^Λat risk' individuals genetically susceptible to chronic liver disease and screens which may be used to establish the genetic basis of chronic liver disease, for example to identify subsets of patients likely to develop more severe disease. The association between a functional polymorphism in MMP-3 and disease also identifies the stromelysin protein as a potential target for therapeutic intervention in chronic liver disease, and indeed in other chronic inflammatory conditions.

In accordance with the present invention, the process of "determining the genotype" of an individual at a specific position of a given gene may advantageously comprise screening for the presence or absence in the genome of the subject of multiple allelic variants or may comprise screening for the presence or absence of one individual allele, it generally being possible to draw conclusions about the genotype of an individual at a biallelic polymorphic locus just by screening for one or other of the specific alleles. By way of example, the process of determining the genotype of a subject at the -1171 position of the MMP-3 promoter region might involve screening for the 5A allele alone, the 6A allele alone or, most preferably, screening for both alleles. The step of determining the genotype of an individual at a given polymorphic locus, also referred to herein as ^genotyping' , can be carried out using any suitable methodology known in the art and it is to be understood that the invention is in no way limited by the precise technique used to perform such genotyping.

Known techniques for the scoring of single nucleotide polymorphisms (see review by Schafer, A. J. and Hawkins, J. R. in Nature Biotechnology, Vol 16, pp33-39 (1998) include mass spectrometry, particularly matrix-assisted laser desorption/ionization time-of- flight mass spectrometry (MALDI-TOF-MS, see Roskey, M. T. et.al., 1996, PNAS USA, 93: 4724-4729), single nucleotide primer extension (Shumaker, J. M. et.al.,

1996, Hum. Mutat., 7: 346-354; Pastinen, T. et.al.,

1997, Genome Res., 7: 606-614) and DNA chips or microarrays (Underhill, P. A. et.al., 1996, PNAS USA, 93: 196-200; Gilles, P. N. et . al . Nat. Biotech., 1999, 17: 365-370). The use of DNA chips or microarrays could enable simultaneous genotyping at many different polymorphic loci in a single individual or the simultaneous genotyping of a single polymorphic locus in multiple individuals. In addition to the above, SNPs are commonly scored using PCR-based techniques, such as PCR-SSP using allele-specific primers (described by Bunce, 1995, ref 19) . This method generally involves performing DNA amplification reactions using genomic DNA as the template and two different primer pairs, the first primer pair comprising an allele-specific primer which under appropriate conditions is capable of hybridising selectively to the wild type allele and a consensus primer which binds to a complementary sequence elsewhere within the gene in question, the second primer pair comprising an allele-specific primer which under appropriate conditions is capable of hybridising selectively to the variant allele and the same consensus primer.

Genotyping of the -1171 polymorphism of MMP-3 is preferably carried out by PCR-SSP on genomic DNA using the following primers : -

5A allele: TCCTTTGATGGGGGGAAAAAAC

6A allele: TCCTTTGATGGGGGGAAAAAA

Consensus primer: GAGCTGCCACAGCTTCTAC

Procedures for performing PCR-SSP using these primers are given in the accompanying Example .

As would be readily apparent to those skilled in the art, genotyping is generally carried out on genomic DNA prepared from a suitable tissue sample obtained from the subject under test. Most commonly, genomic DNA is prepared from a sample of whole blood, according to standard procedures which are well known in the art. In a final aspect, the invention provides a kit for use in determining the genotype of a human subject at position -1171 in the promoter region of the MMP-3 gene in the context of one of the specific genetic screens described herein, the kit comprising at least an oligonucleotide comprising 10 or more consecutive nucleotides from the promoter region of the human MMP- 3 gene, including the polymorphic nucleotide at position -1171.

The oligonucleotide molecules for inclusion into the kit are preferably from 10 to 50 nucleotides in length, even more preferably from 15-30 nucleotides in length. Skilled artisans will appreciate that the precise length of the oligonucleotide and positioning of the polymorphic nucleotide may vary depending upon the nature of the technique to be used to perform genotyping at the -1171 position. For example, PCR- SSP generally requires allele-specific primers in which the polymorphic nucleotide is positioned at the extreme 3 ' end, whereas techniques based on hybridisation might require allele-specific oligonucleotide probes having the polymorphic nucleotide positioned towards the middle of the probe. In a preferred embodiment the kit is suitable for use in performing genotyping at the -1171 position of MMP- 3 by PCR-SSP and contains the 5A allele, 6A allele and consensus primers listed above. Oligonucleotides for inclusion into the kit may be synthesised using chemical synthesis techniques well known in the art. The oligonucleotides may be DNA, RNA or a synthetic nucleic acid and may be chemically or biochemically modified or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those skilled in the art. Possible modifications include, for example, the addition of isotopic or non-isotopic labels, substitution of one or more of the naturally occurring nucleotide bases with an analog, internucleotide modifications such as uncharged linkages (e.g. methyl phosphonates, phosphoamidates, carbamates, etc.) or charged linkages (e.g. phosphorothioates, phosphorodithioates, etc.). Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence to form a stable hybrid. Such molecules are known in the art and include, for example, so-called peptide nucleic acids (PNAs) in which peptide linkages substitute for phosphate linkages in the backbone of the molecule.

The oligonucleotide molecules for inclusion into the kit are preferably single stranded and may correspond to the sense strand or the antisense strand of the relevant gene and to either allelic variant.

The invention will be further understood with reference to the following experimental Example: Study design and statistics

In stage 1, 59 PSC patients (PSC-King' s) , 80 UC patients (UC) and 72 healthy subjects (HS) were studied. The PSC patients in stage 1 were under the care of the Liver Unit, King's College Hospital, London. Clinical data as shown in Table 1. UC patients were under the care of the Oxford Gastroenterology Unit, Oxford (Table 2) .

In stage 2, 52 patients with PSC (PSC-Oxford) and 99 healthy subjects (HS) were studied. The PSC patients were under the care of the Oxford Gastroenterology Unit.

Healthy subjects studied were prospective kidney transplant donors, attending the Oxford Transplant Centre. All were white European Caucasoids.

Ethical approval was obtained from local committees and data were stored in coded anonymised databases.

Allelic frequencies, allelic carriage rates (i.e. the proportion of individuals carrying one or more copies of a given allele) and genotype and homozygosity frequencies for the 5A and 6A alleles were calculated and compared in disease cohorts and healthy subjects (HS) . Inter-group comparisons were calculated in a 2 x 2 contingency table using Fisher's exact test. Odds -ratio and 95% confidence intervals were calculated.

Intra-group comparisons of the relationship between genotype and clinical characteristics of disease were carried out using the Knowledge Seeker ™ analysis package (Angoss Software International Limited,

Toronto, Canada) , which incorporates a Bonferroni correction for multiple comparisons. Table la Patients with primary sclerosing cholangitis

PSC - Oxford PSC - Kings

Number 52 59

Male 36 (69%) 43 (72.8%)

Age at diagnosis 42 39

(median)

Extent of PSC 26 EH/IH N/a 26 IH

Concomitant IBD 43 (82.6%) 49 (83.1%)

Portal hypertension 7 (13.5%) 20 (33.9%)

Transplantation 3 (5.7%) 16 (27.1%)

In all patients the diagnosis of PSC was made on the basis of clinical, endoscopic and histological findings.

Extent of PSC was assessed from findings at endoscopic retrograde cholangiopancreatography (ERCP) as either intra-hepatic (IH) , or extra-hepatic and intra- hepatic (EH/IH) .

The presence/absence of portal hypertension was assessed from clinical features, Doppler ultra-sound findings, and the presence/absence of oesophago- gastric varices.

Table lb

Patients with ulcerative colitis: clinical data

Number 84

Male 33(39.2%)

Age at diagnosis (median) 38

Extent of disease 20 extensive (23.9%

64 distal (76.1%) Colorectal cancer 0

All subjects studied were white Caucasoids. Extent was described as extensive if the colitis extended proximal tosplenic flexure, at most recent colonoscopic/radiological investigation. All had normal liver function tests documented at clinic visits .

Materials and Methods

DNA Extraction

Genomic DNA was extracted from peripheral venous blood using a modified 'salting out' technique ¹⁴, and stored at -20°C.

Genotyping

Genotyping was carried out using sequence-specific primers ¹⁵. Each reaction contained an allele specific primer, the 3' nucleotide of which determined allele specificity, and the consensus primer.

Predicted amplicon size for the 5A and 6A alleles were respectively 146 and 147 base pairs. Primers were designed using the published gene sequence (Genebank accession number: J04732)

5A allele: TCCTTTGATGGGGGGAAAAAAC

6A allele: TCCTTTGATGGGGGGAAAAAA

Consensus primer: GAGCTGCCACAGCTTCTAC

In addition, amplification control primers giving rise to a 796 base pair fragment of the third intron of HLA DRB were added to each reaction.

HLA DRB1 F 5' TGCCAAGTGGAGCACCCAA-3 '

HLA DRB1 R 5* GCATCTTGCTCTGTGCAGAT-3 '

Amplification conditions

Reaction mixtures of 13μl were used, consisting of 67mM Tris base pH8.8, 16.6mM ammonium sulphate, 2mM magnesium chloride, 0.01% (v/v) Tween 20, 200mM each of dATP, dTTP, dGTP, and dCTP, forward and reverse primers at 6.8μM each, control primers at 0.68μM, between 0.1 and O.Olμg DNA and 0.1875 units of Taq polymerase (Advanced Biotechnology, London, UK) .

Reaction mixtures were dispensed under lOμl of mineral oil in 96-well PCR plates.

DNA samples were amplified in GeneAmp PCR system 9600 (Perkin-El er Corporation) or in MJ Research PTC-200 thermal cyclers with cycling parameters as follows: one minute at 96°C followed by five cycles of 96°C for 25 seconds, 70°C for 45 seconds, and 72°C for 45 seconds, followed by 21 cycles of 96°C for 25 seconds, 65°C for 50 seconds, and 72°C for 45 seconds, followed by four cycles of 96°C for 25 seconds, 55°C for 60 seconds, and 72°C for 120 seconds. PCR plates were sealed and dipped in mineral oil to improve plate to block contact.

Gel electrophoresis and product detection

Following PCR, 5 μl of loading buffer consisting of

0.25% Orange G, 30% v/v glycerol, and 0.5x TBE buffer (89 mM Tris base, 89 mM boric acid, 2 mM EDTA, pH 8.0) was added to each reaction mix. PCR products (amplicons) were then electrophoresed in 1.0% agarose gels containing 0.5 μg/ml ethidium bromide for 20-25 minutes at 15 V/cm in 0.5x TBE buffer, visualized with UV illumination and photographed with a Polaroid land camera.

All samples were assayed in duplicate on two separate occasions, and the gels were analysed by two independent observers. Complete concordance between observers was apparent. To further validate the assay system, 10 randomly chosen samples were sequenced using ABI377 automated sequencer, after amplification of a 199bp of the promoter sequence incorporating the polymorphic site. Sequencing confirmed genotype ascribed by PCR-SSP in all cases.

Table 2

Stromelysin -1171 genotype (a) , allele frequencies (b) , allelic carriage and homozygosity rates (c) in first data-set

2(a) Genotype (%)

5A5A 5A6A 6A6A

Primary sclerosing cholangitis

PSC-Kings 18 37 4¹'²

(n=59) (30.5%) (62.7%) (6.8%)

Ulcerative colitis

UC 14 50 20² (n=80) (16.6%) (59.5%) (23.8%)

Healthy subjects

HS-1 18 37 17¹

(n=72) (25%) (51.3%) (23.6%)

^l p=0.0092 OR 0.235 CI 0.07-0.744

² p=0.006 OR 0.21 CI 0.07-0.60 (b) Allelic frequencies (%) in first data-set

5A 6A

Primary sclerosing cholangitis

PSC-Kings 73¹ 45

(n=118) (46.4%) (53.6%)

Ulcerative colitis

UC 78¹ 90

(n=160) (50%) (50%)

Healthy subjects

HS 73 71

(n=144) (50.6%) (49.4%)

p=0.0116 OR 1.87 CI 1.15-3.03

2 (c) Allelic carriage rates and ho ozygosity rates in first data-set

5A 6A 5A 6A carriage carriage homozygous homozygous

Primary sclerosing cholangitis

PSC-Kings 55¹'³ 41 18 42,4

(n=59) (93.2%) (69.5%) (30.5%) (6.8%)

Ulcerative colitis

UC 64³ 70 14 20⁴

(n=84) (76.2%) (83.3%) (16.6%) (23.8%)

Healthy subjects

HS 55¹ 54 18 ₁₇2

(n=72) (76.4%) (75%) (25%) (23.0%)

¹ p=0.0092 OR 4.25 CI 1.34-13.4

² p=0.0092 OR 0.235 CI 0.07-0.75

³ p=0.0112 OR 4.29 CI 1.38-13.3

p=0.0112 OR 0.24 CI 0.07-0.72 Table 3

Stromelysin -1171 genotype, allele frequencies (b)' carriage rates and homozygosity in second data-set

3 (a) Genotype (%)

5A5A 5A6A 6A6A

Primary sclerosing cholangitis

PSC-Oxford 21 26

(n=52) (40.4%) (50%) (9.6%)

Healthy subjects

HS 24 48 27¹

(n=99) (24.2%) (48.5%) (27.3%)

p=0.012 OR 0.284 CI 0.102-0.79

3(b) Allelic frequency (%) in second data-set

5A 6A

Primary sclerosing cholangitis 68¹ 36 (104 alleles) (65.4%) (34.6^

Healthy subjects 96¹ 102 ^'* (191 alleles) (48.5%) (57.5^

p=0.012 OR 0.284 CI 0.1020-0.788 3 (c) Stromelysin -1171 allele carriage and homozygosity in Oxford data-set

5A 6A 5A 6A carriage carriage homozygous homozygous

PSC-Oxford 47¹ 31 21 5 (n=52 patients) (90.4%) (59.6%) (40.3%) (9.6%) Healthy subjects 72¹ 75 24 27 (n=99 patients) (72.7%) (75.7%) (24.2%) (51.9%)

p=0.0120 OR 3.52 CI 1.27-5.80

Table 4

(a) Stromelysin -1171 genotype (a) , allelic frequencies (b) , allelic carriage and homozygosity in combined data-sets

5A5A 5A6A 6A6A

(n=lll patients) (35.1%) (56.7%) (8.1%)

UC 14² 50 20³

(n=84 patients) (16.6%) (59.5%) (23*.8%)

Healthy subjects 42 85 441

(n=171 subjects) (24.6%) (49.7%) (25.7%)

1 „p_=0.0002 OR 2.54 CI 0.118-0.546

2 p__=0.006 OR 2.7 CI 1.35-5.42

p=0.03 OR 0.37 CI 0.16-0.86 4 (b) Stromelysin -1171 allelic frequencies in combined data-set

Allelic frequencies

(%)

5A 6A Primary sclerosing cholangitis 141¹'² 81 (n=222 alleles) (63.5%) (36.5%) Ulcerative colitis 78² 90 (160 alleles) (46.4%) (53.6%) Healthy subjects 169¹ 173 (342 alleles) (49.4%) (50.6%)

¹ p=0.001 OR 1.78 95% CI 1.26-2.51

p=0.001 OR 2.00 95% CI 1.34-3.02

4 (c) Stromelysin -1171 allelic carriage rates and homozygosity rates in combined data-sets

5A 6A 5A 6A carriage carriage homozygous homozygous

Primary sclerosing cholangitis

PSC 102¹'³ 72⁴ 39⁵ 9²'⁶

(n=lll) (91.9%) (64.9%) (35.1%) (8.1%)

Ulcerative colitis

UC 64³ 70⁴ 14⁵ 20⁶

(n=80) (76.2%) (83.3%) (16.6%) (23.8%)

Healthy subjects

HS 127¹ 129 42 44² (n=171) (74.2%) (75.4%) (24.6%) (25.7%)

¹ p=0.0002 OR 3.92 CI 1.13-8.42

² p=0.0002 OR 2.54 CI 0.118-0.546

³ p=0.028 OR 2.83 CI 1.18-7.4

⁴ p=0.01 OR 0.35 CI 0.16-0.78

⁵ p=0.009 OR 2.55 CI 1.27-5.12

⁶ p=0.002 OR 0.26 CI 0.1132-0.61 Table 5 Genotypes of patients with documented portal hypertension complicating primary sclerosing cholangitis

5A5A 5A6A 6A6A

'PSC-Kings' cohort 10 10 0

(n=20 patients) (50%) (50%) (0%)

^ΛPSC-0xford' cohort 5 2 0

(n=7 patients) (71.4%) (28.6%) (0%)

PSC combined data 15 12 0

(55.5%) (44.4%) (0%)

The 5A5A genotype was significantly associated with the development of portal hypertension, p=0.0192, OR 3.12, 95% CI 1.27-7.65.

Results

Genotype, allelic frequencies, allelic carriage rates and homozygosity rates for the cohorts studied in stage 1 and 2 are presented in tables 2 and 3, and combined data are shown in table 4. Allelic frequencies in the healthy subjects were similar to those previously reported in UK controls.

Stage 1 (Table 2)

Carriage of the 5A allele was significantly increased in patients with primary sclerosing cholangitis, compared with healthy subjects (93.2% v 76.4%, p = 0.0092, OR 4.25), and with ulcerative colitis (p = 0.0112, OR 4.29, CI 1.38 - 13.3) 6A homozygosity was reduced in PSC (0.235) compared with HS (p = 0.0092, OR 0.235) and with UC (p = 0.0112, OR 0.24).

Differences between ulcerative colitis patients and healthy subjects did not attain statistical significance.

Stage 2 (Table 3)

5A allele carriage (90.4% v 72.7%, p = 0.0120, OR

3.52, CI 1.27-5.8); allelic frequency (65.4% v 48.5%, p = 0.0053, OR 2.00) were increased in PSC. Again, the proportion of PSC patients homozygous for the 6A allele was reduced (9.6% v 27.2%, p = 0.012, OR 0.284, CI 0.102-0.78) .

^•.-In the combined data-sets, 5A allelic frequency (63.5 % v 49.4%, p = 0.001, OR 1.78, CI 1.26-2.51), carriage rate (91.9% v 74.2%, p = 0.0002; OR 3.92, 1.82-1.42) were increased, and 6A homozygosity reduced in PSC (p = 0.0002, OR 2.54, CI 0.118 - 0.846), all comparisons with healthy subjects. Similarly, 5A allelic frequency, carriage rate and homozygosity rates were increased in PSC, compared with UC (Table 4 (a) - (c) ) . Again, no differences between UC and HS were significant.

Genotype-phenotype relationship

Allelic carriage, frequency and homozygosity rates were compared with clinical patterns of primary sclerosing cholangitis (age of onset, extent, complications) . Significant association between 5A homozygosity and presence of portal hypertension was noted in the King's data-set (p = 0.035, OR 3.875, CI 1.20-12.5), and in the overall data-set (15 of 39 5A homozygotes had patients documented portal hypertension, compared with 12 of 72 non-5A5A p = 0.0192, OR 3.125, CI 1.27-7.645). (In the Oxford data-set, 5 of 21 5A5A homozygotes had documented portal hypertension, compared with 2 non 5A5A, a comparison which just fails to achieve significance as a result of small numbers, p = 0.095). No other significant genotype-phenotype correlation achieved significance in any of the data-sets.

Discussion

Although considerable evidence now exists that dysregulation of the matrix metalloproteinase enzymes is important in the pathogenesis of chronic liver disease ^lδ, the contribution of inherited variation in these enzymes, (or in the naturally occurring inhibitors MMP-1, MMP-2, MMP-3) has not previously been assessed. The present study provides compelling data that the promoter region polymorphism in the stromelysin gene is associated with susceptibility to primary sclerosing cholangitis, and may influence progression of disease. Moreover, the results may be pertinent not only to primary sclerosing cholangitis but also to other causes of cirrhosis and, indeed, many chronic inflammatory diseases. The difficulties inherent in genetic association studies have been subject to recent re-appraisal ¹⁷: the present investigation has been designed with these potential limitations in mind. The -1171 polymorphism is of proven functional importance in regulating stromelysin transcription, and as such represents a candidate polymorphism of unquestionable biological relevance to fibrosing liver disease. The two-stage design has allowed for the relevance of the association to be examined in two independent cohorts of (ethnically homogeneous) patients. Clinical data were carefully examined to define disease phenotype.

Given the characteristic histopathological features of sclerosing cholangitis, it appears biologically plausible that the 5A allelic variant - associated with increased tissue injury as compared to the 6A variant - predisposes to disease. The case is further strengthened by considering rare disease associations of sclerosing cholangitis (in particular, retro-peritoneal fibrosis, mediastinal, systemic sclerosis) . In the present study, the combined data-set show 5A allelic frequency, carriage rate and homozygosity were significantly increased in primary sclerosing cholangitis compared with the control groups. Moreover, 6A homozygosity was strikingly reduced in patients with liver disease.

The analysis of relationship between genotype and disease behaviour in primary sclerosing cholangitis implicates the polymorphism in disease progression. In both Oxford and King's patients, similar patterns were seen: the 5A5A genotype being associated with portal hypertension; although the p value in the Oxford data-set failed to reach a conventional level of significance, five of seven patients with portal hypertension were 5A homozygous. Overall, the association was significant. In the present study, the 5A allelic frequencies, carriage rate and homozygosity rate was increased in primary sclerosing cholangitis, compared with ulcerative colitis patients. The allelic frequencies in ulcerative colitis did not differ from those in healthy subjects. In addition, the genotype-phenotype analysis within the cohorts of patients with primary sclerosing cholangitis revealed no differences in genotype or allelic frequencies between patients with primary sclerosing cholangitis alone, and those with concomitant ulcerative colitis. This analysis is somewhat weakened by the relatively small numbers of patients with "isolated" primary sclerosing cholangitis, and by the very real possibility that these patients may yet develop clinical evidence of inflammatory bowel disease.

However, the hypothesis most consistent with the present data is that the stromelysin polymorphism is an important determinant of susceptibility or primary sclerosing cholangitis, but not of ulcerative colitis (this hypothesis would also be consistent with the data from genome-wide scanning in inflammatory bowel disease, which have failed to implicate the long arm of chromosome 11, the location of stromelysin and other metalloproteinase genes) .

In conclusion, the present data provide intriguing evidence that inherited variation in metalloproteinase genotype may pre-dispose to the development and progression of primary sclerosing cholangitis. The finding may have important implications, extending beyond this relatively uncommon disease. References

1. Chapman RW. Aetiology and natural history of primary sclerosing cholangitis: a decade of progress? Gut 1991;32:1433-5.

2. Bass N. Sclerosing cholangitis and recurrent pyogenic cholangitis in gastrointestinal and liver disease. In: Feldman M, Scharschmidt BF, Sleisenger MF, editors. 6th ed. Philadelphia: .B. Saunders; 1998. p. 1006-25.

3. Raj V, Lichtenstein DR. Hepatobiliary manifestations of inflammatory bowel disease. Gastroenterol Clin North Am 1999;28 (2) : 491-513.

4. Manns MP, Kruger M. Immunogenetics of chronic liver disease. Gastroenterology 1994;106:1676-97.

5. Satsangi J, Parkes M, Louis E, Hashimoto L, Kato N, Welsh K, et al. Two stage genome-wide search in inflammatory bowel disease provides evidence for susceptibility loci on chromosomes 3, 7 and 12. Nat Genet 1996; 14 (2) : 199-202.

6. Becker KG, Simon RM, Bailey-Wilson JE, Freidlin B, Biddison WE, McFarland HF, et al . Clustering of non-major histocompatibility complex susceptibility candidate loci in human autoimmune diseases. Proc Natl Acad Sci U S 1998;95(17) :9979-84.

7. Spurkland A, Saarinen S, boberg KM, Mitchell S, Broo e U, Catalleria L, et al. HLA Class II haplotypes in primary sclerosing cholangitis in patients from five European populations. Tissue Antigens 1999;53:459-69. 8. Satsangi J, Welsh KI, Bunce M, Julier C, Farrant JM, Bell JI, et al . Contribution of genes of the major histocompatibility complex to susceptibility and disease phenotype in inflammatory bowel disease. Lancet 1996;347(9010) :1212-7.

9. Pender SL, Tickle SP, Docherty AJ, Howie D, Wathen NC, MacDonald TT. A major role for matrix metalloproteinases in T cell injury in the gut. J Immunol 1997;158 (4) : 1582-90.

10. Thomson RK, Arthur MJP. Mechanisms of liver cell damage and repair. Eur. J. Gastro & Hepatol 1999;11:949-55.

11. Quinones S, Saus J, Otani Y, Harris ED, Jr., Kurkinen M. Transcriptional regulation of human stromelysin. J Biol Chem 1989;264 (14) : 8339-44.

12. Ye S, Eriksson P, Hamsten A, Kurkinen M, Humphries SE, Henney AM. Progression of coronary atherosclerosis is associated with a common genetic variant of the human stromelysin-1 promoter which results in reduced gene expression. J Biol Chem 1996;271 (22) : 13055-60.

13. Ye S, Watts GF, Mandalia S, Humphries SE, Henney AM. Preliminary report: genetic variation in the human stromelysin promoter is associated with progression of coronary atherosclerosis. Br Heart J 1995;73(3) :209-15.

14. Miller S, Dykes D, Polesky H. A salting-out procedure for extracting DNA from human nucleated cells. Nucl Acid Research 1988; 16: 1215.

15. Bunce M, Taylor CJ, Welsh KI . Rapid HLA-DQB typing by eight PCR amplifications with sequence-specific primers (PCR-SSP) . Human Immunology 1993;37:201-6.

16. Benyon CR, Iredale JR, Goddard S, Winwood PJ, Arthur MJP. Expression of tissue inhibitor of metalloproteinase 1 and 2 is increased in fibrotic human liver. Gastroenterology 1996;110:821-6.

17. Freely associating [editorial]. Nat Genet 1999;22(1)

18. Spurr NK, Gough AC, Gosden J, Rout D, Porteous

DJ, van Heyningen V, et al. Restriction fragment length polymorphism analysis and assignment of the metalloproteinases stromelysin and collagenase to the long arm of chromosome 11. Geno ics 1988;2 (2) : 119-27.

19. Bunce M, O'Neill C, Barnardo M, et al.,

Phototyping: Comprehensive DNA typing for HLA-A, B, C, DRBl, DRB3, DRB4, DRB5 and DQBl by PCR with 144 primer mixes utlizing sequence-specific primers (PCR-SSP). Tissue Antigens 1995;50:23-31.

Claims

Claims :

1. A method for determining susceptibility of a human subject to a chronic inflammatory disease which method comprises screening for the presence or absence in the genome of the human subject of one or more polymorphic variants of the MMP-3 gene.

2. A method as claimed in claim 1 which comprises determining the genotype of the human subject at position -1171 in the promoter region of the MMP-3 gene, wherein subjects having at least one 5A allele at this position are scored as being susceptible to the said chronic inflammatory disease.

3. A method for determining susceptibility of a human subject to a chronic inflammatory disease which method comprises screening for the presence or absence in the genome of the human subject of one or more polymorphic variants of the MMP-3 gene and determining the genotype of the subject at one or more further polymorphic loci associated with the said chronic inflammatory disease.

4. A method as claimed in any one of claims 1 to 3 wherein the chronic inflammatory disease is a chronic liver disease.

5. A method as claimed in claim 4 wherein the chronic liver disease is a chronic cholestatic disease.

6. A method as claimed in claim 4 wherein the chronic liver disease is a fibrosing liver disease.

7. A method as claimed in claim 4 wherein the chronic liver disease is primary sclerosing cholangitis .

8. A method for identifying the or any genetic basis for a chronic inflammatory disease in a human patient which method comprises screening for the presence or absence in the genome of the patient of one or more polymorphic variants of the MMP-3 gene.

9. A method as claimed in claim 8 which comprises determining the genotype of the said patient at position -1171 in the promoter region of the MMP-3 gene.

10. A method as claimed in claim 8 or claim 9 wherein the chronic inflammatory disease is a chronic liver disease.

11. A method as claimed in claim 10 wherein the chronic liver disease is a cholestatic disease.

12. A method as claimed in claim 10 wherein the chronic liver disease is a fibrosing liver disease.

13. A method as claimed in claim 10 wherein the chronic liver disease is primary sclerosing cholangitis .

14. A method for determining whether a human patient previously diagnosed with primary sclerosing cholangitis is likely to develop complicating portal hypertension which method comprises screening for the presence or absence in the genome of the individual of one or more polymorphic variants of the MMP-3 gene.

15. A method as claimed in claim 14 which comprises determining the genotype of the human subject at position -1171 in the promoter region of the MMP-3 gene, wherein individuals who are homozygous for the 5A allele at this position are scored as being likely to develop complicating portal hypertension.

16. A method as claimed in any one of claims 2, 9 or 15 wherein genotyping at the -1171 position of the promoter region of the MMP-3 gene is carried out by PCR-SSP using the following combination of primers:

5A allele: 5 ' -TCCTTTGATGGGGGGAAAAAAC

6A allele: 5 ' -TCCTTTGATGGGGGGAAAAAA

Consensus primer: 5 ' -GAGCTGCCACAGCTTCTAC

17. A kit for use in performing the method of any one of claims 2, 9 or 15, the kit comprising at least one oligonucleotide comprising 10 or more consecutive nucleotides from the promoter region of the human MMP-3 gene, including the polymorphic nucleotide at position -1171.

18. A kit as claimed in claim 17 which is suitable for use in performing genotyping at position -1171 in the promoter region of the MMP-3 gene by PCR- SSP, the kit comprising oligonucleotide primers having the following sequences:

5A allele: 5 ' -TCCTTTGATGGGGGGAAAAAAC

6A allele: 5 ' -TCCTTTGATGGGGGGAAAAAA

Consensus primer: 5 ' -GAGCTGCCACAGCTTCTAC

: 283956: CDM: JLG: LONDOCS