EP1348031A2 - Detection of genetic polymorphisms in genes associated with pharmacogenomics - Google Patents

Detection of genetic polymorphisms in genes associated with pharmacogenomics

Info

Publication number
EP1348031A2
EP1348031A2 EP01272361A EP01272361A EP1348031A2 EP 1348031 A2 EP1348031 A2 EP 1348031A2 EP 01272361 A EP01272361 A EP 01272361A EP 01272361 A EP01272361 A EP 01272361A EP 1348031 A2 EP1348031 A2 EP 1348031A2
Authority
EP
European Patent Office
Prior art keywords
assay
intron
seq
location
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01272361A
Other languages
German (de)
French (fr)
Inventor
Yusuke Nakamura
Akihiro Sekine
Aritoshi Iida
Susumu Saito
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
RIKEN
Original Assignee
RIKEN
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by RIKEN filed Critical RIKEN
Priority to EP06024411A priority Critical patent/EP1816212A2/en
Publication of EP1348031A2 publication Critical patent/EP1348031A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the present invention relates to genetic polymorphism data, compositions and methods for detecting genetic polymorphisms, methods for evaluating drugs using genetic polymorphisms and screening methods for drugs.
  • Human beings come in all shapes and sizes, and over three billion genetic codes are located in somewhat different sites in each human being.
  • Individual DNA sequence variations in the human genome are known to directly cause specific diseases or conditions, to predispose certain individuals to specific diseases or conditions, and to affect responses of individuals to treatments such as drugs. Such variations also modulate the severity or progression of many diseases. Additionally, DNA sequences vary between populations. Therefore, determining DNA sequence variations in the human genome is useful for making accurate diagnoses, for finding suitable therapies, and for understanding the relationship between genome variations and environmental factors in the pathogenesis of diseases, the prevalence of conditions and the efficacy of therapies.
  • SNPs single nucleotide polymorphisms
  • a single nucleotide polymorphism may be classified as a coding SNP (cSNP) when it is in a region encoding a protein, or genome SNP (gSNP) when it is detected anywhere in a genome, without reference to whether it is in a coding region.
  • Coding SNPs include silent SNPs (sSNP), and SNPs that may be in regions associated with coding sequences, such as regulatory regions or elements (e.g., regulatory SNPs, or rSNPs) and introns (e.g., intron SNPs, or iSNPs).
  • SNPs are particularly useful in studying the relationship between DNA sequence variations and human diseases, conditions and drug responses because SNPs are stable in populations, occur frequently, and have lower mutation rates than other genome variations such as repeating sequences.
  • methods for detecting SNPs are more amenable to being automated and used for large-scale studies than methods for detecting other, less common DNA sequence variations.
  • Single nucleotide polymorphisms are useful as polymorphism markers for discovering genes that cause or exacerbate certain diseases. This is directly related in clinical medicine to diagnosing the risk for a disease and determining the proper pharmaceutical treatment. There is currently a worldwide effort going on to develop drugs based on the target genes that cause diseases. Individual patients also react differently when a drug is administered.
  • a drug may have a significant effect, in others a lesser effect and in still others no effect at all. In other words, there is a major difference in patient reactions to the same drug. Patients may also metabolize drugs at different rates. In addition to differences in therapeutic reactions among patients to drugs, there is also the possibility of strong and even fatal side effects due to genetically linked differences in, e.g., drug metabolism, drug transport or drug receptor function. Analysis of genetic polymorphisms such as SNPs allows for the selection of drugs and the development of treatment protocols tailored to each individual patient (so- called "personalized" medical treatments).
  • doctors may, for example, be able to analyze a patient's genetic profile and prescribe the best available drug therapy from the beginning. Not only would this take the guesswork out of finding the right drug, it would reduce the likelihood of adverse reactions, thus increasing safety.
  • the present invention identifies genetic polymorphisms relating to genes associated with drug metabolism.
  • the present invention provides methods for determining variations in sequences and genes associated with drug- metabolizing enzymes.
  • the present invention provides methods for collecting genetic polymorphism data for use in evaluating the effectiveness and safety of a drug based on the data, and screening drugs using the data.
  • the polymorphisms of the present invention are used to evaluate a causal relationship between the genetic make-up of a patient and a response to an administered drug.
  • the present invention relates to genes encoding enzymes associated with drug metabolism (drug metabolizing enzymes, or DMEs).
  • DMEs drug metabolizing enzymes
  • the present invention relates to sequence variations associated with variations in DMEs.
  • variations occur in coding regions of DMEs, such as may alter a function of the DMEs, (e.g., by increasing or decreasing its level of activity, or shifting its activity to an alternative target or function).
  • the variations occur in non-coding regions of the genome, such as may alter expression of a DME (e.g., increasing or decreasing the amount of an enzyme produced in a cell) or processing of an RNA transcript encoding a DME (e.g., by altering splicing).
  • the present invention provides methods for detecting DME-related sequence variations. In some preferred embodiments, the methods of the present invention are used to create a profile of DME-related polymorphisms in a test subject.
  • the present invention provides isolated nucleic acid sequences encoding variant DMEs.
  • the present invention provides a recombinant DNA vector comprising DNA having a nucleotide sequence encoding a variant DME, the nucleotide sequence comprising a sequence including, but not limited to, SEQ ID NOS: 1-3360 and 3361-7669, and substantially similar sequences.
  • the invention provides a host cell transformed with a recombinant DNA vector comprising DNA having a nucleotide sequence encoding a variant DME. The invention is not limited by the nature of the host cell employed.
  • the art is well aware of expression vectors suitable for the expression of nucleotide sequences encoding variant DMEs that can be expressed in a variety of prokaryotic and eukaryotic host cells.
  • the host cell is a eukaryotic cell grown in culture, such as for use in in vitro drug screening (e.g., by monitoring the expression of genes associated with the pathways targeted by a particular test drug).
  • the host cell is in vivo.
  • the present invention provides systems and methods for detection of polymorphisms associated with genes encoding enzymes associated with drug metabolism.
  • the present invention is not limited in the nature of the detection assay used for detection or identification of such polymorphisms.
  • detection assays include, but are not limited to, hybridization methods and array technologies (e.g., technologies available from Aclara BioSciences, Haywood, CA; Affymetrix, Santa Clara, CA; Agilent Technologies, Inc., Palo Alto, CA; Aviva Biosciences Corp., San Diego, CA; Caliper
  • Methods of the present invention find application in improving the drug discovery and approval processes. For example, the costs and risks of drug development may be reduced if only those persons capable of responding to a drug are selected for clinical trials. In addition, previously failed drug candidates may be revived as they are matched with more appropriate patient populations. Decreases in the number of adverse drug reactions, the number of failed drug trials, the time it takes to get a drug approved, the length of time patients are on medication, the number of medications patients must take to find an effective therapy, and an increase in the range of possible drug targets will promote a net decrease in the cost of health care.
  • the present invention provides a method of identifying individuals having a polymo ⁇ hism, comprising providing nucleic acid from a subject; and detecting the presence of at least one polymo ⁇ hism in said nucleic acid, said at least one polymo ⁇ hism including, but not limited to, polymo ⁇ hisms found in SEQ ID Nos:l-3360 and 3361-7669.
  • the method further provides the step of providing a prognosis (e.g., a genotype relative risk or a population attributable risk) to the subject based on the presence or absence of the at least one polymo ⁇ hism.
  • a prognosis e.g., a genotype relative risk or a population attributable risk
  • the detecting step is carried out using a detection assay including, but not limited to, a hybridization assay, a TAQMAN assay, an invasive cleavage assay, use of mass spectroscopy, a microarray, a polymerase chain reaction, a rolling circle extension assay, a sequencing assay, a hybridization assay employing a probe complementary to a polymo ⁇ hism, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
  • a detection assay including, but not limited to, a hybridization assay, a TAQMAN assay, an invasive cleavage assay, use of mass spectroscopy, a microarray, a polymerase chain reaction, a rolling circle extension assay,
  • the present invention also provides a nucleic acid (e.g., a gene, a probe, a primer, etc.) comprising a sequence selected from the group consisting of SEQ ID NO: 1-3360 and 3361-7669 or complements thereof.
  • the nucleic acid molecule comprises a label.
  • the nucleic acid is attached to a solid support (e.g., as part of a microarray).
  • the present invention also provides vectors comprising the nucleic acid and host cell comprising the vector, as well as polypeptide encoded by the nucleic acid. Methods of producing and purifying polypeptides are well known in the art.
  • kits for detecting a polymo ⁇ hism comprising at least one reagent that specifically detects a polymo ⁇ hism in a sequence including, but not limited to, SEQ ED Nos:l-3360 and 3361-7669.
  • the kit further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
  • the at least one reagent comprises a nucleic acid probe.
  • the kits can be configured for a variety of uses including, but not limited to, use as an in vitro diagnostic detection assay, an analyte specific reagent detection assay, and a research-use-only detection assay.
  • the present invention also provides a method for screening subjects for genetic markers associated with drug metabolizing enzyme(s), comprising: a) providing a biological sample comprising a nucleic acid from a subject; b) testing the nucleic acid for a polymo ⁇ hism in a genetic marker associated with a drug metabolizing enzyme, said genetic marker comprising one or more nucleotide polymo ⁇ hisms designated by n, said n selected from a base substitution, an insertion, or a deletion found in a sequence selected from the group consisting of SEQ ID Nos: 1-3360 and 3361-7669.
  • the present invention is not limited by the source of the nucleic acid.
  • the biological sample comprises blood, saliva, amniotic fluid, and tissue.
  • the subject is a human.
  • the nucleic acid comprises DNA and/or RNA.
  • the present invention further provides a composition comprising an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymo ⁇ hism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymo ⁇ hisms designated by n in SEQ ID Nos: 1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
  • the present invention also provides a composition
  • a composition comprising a detection probe for determining the presense or absence a single nucleotide polymo ⁇ hism in a gene encoding a drug metabolizing enzyme, said gene comprising a sequence selected from the group consisting of SEQ ID Nos: 1-3360 and 3361-7669.
  • the present invention further provides a method of determining the effectiveness of or side-effect of a drug or treatment protocol, comprising; a) administering a drug or treatment protocol to one or more subjects; b) obtaining nucleic acid from said one or more subjects; c) using a detection assay to detect the presence of at least one polymo ⁇ hism in said nucleic acid from said one or more of subjects, said at least one polymo ⁇ hism selected from the group consisting of polymo ⁇ hisms found in SEQ ID Nos: 1-3360 and 3361-7669; and d) assigning an effectiveness rating, side-effect rating, or score for said drug or treatment protocol based upon a result of one or more said detection assays (See e.g., Toxicology Testing Handbook: Principles, Applications, and Data Inte ⁇ retation, ed.
  • the present invention also provides a method of prescribing a drug to or treatment protocol for a subject, comprising; providing nucleic acid from said subject; using a detection assay to detect the presence of at least one polymo ⁇ hism in the nucleic acid, said at least one polymo ⁇ hism selected from the group consisting of polymo ⁇ hisms found in SEQ ID Nos: 1-3360 and 3361-7669; and, prescribing said drug or treatment protocol based upon the result of said detection assay.
  • the present invention further provides a method for generating assay data comprising: obtaining a sample from a subject containing nucleic acid; transferring said sample to a laboratory; and receiving data from said laboratory, wherein said data corresponds to the presence of at least one polymo ⁇ hism in said nucleic acid, said at least one polymo ⁇ hism selected from the group consisting of polymo ⁇ hisms found in SEQ ID Nos: 1-3360 and 3361-7669.
  • the present further provides data sets generated by this method.
  • the terms “complementary” or “complementarity” are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence “ 5 -A-G-T-3',” is complementary to the sequence “ 3'-T-C-A-5'.” Complementarity may be “partial,” in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be “complete” or “total” complementarity between the nucleic acids.
  • the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand.
  • Nucleotide analogs used to form non-standard base pairs whether with another nucleotide analog (e.g., an IsoC/TsoG base pair), or with a naturally occurring nucleotide (e.g., as described in U.S. Patent 5,912,340, herein inco ⁇ orated by reference in its entirety) are also considered to be complementary to a base pairing partner within the meaning this definition.
  • another nucleotide analog e.g., an IsoC/TsoG base pair
  • a naturally occurring nucleotide e.g., as described in U.S. Patent 5,912,340, herein inco ⁇ orated by reference in its entirety
  • homologous refers to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence.
  • hybridization is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the T m of the formed hybrid. "Hybridization” methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and anneal through base pairing interaction is a well-recognized phenomenon. The initial observations of the
  • complementarity it is important for some diagnostic applications to determine whether the hybridization represents complete or partial complementarity. For example, where it is desired to detect simply the presence or absence of a foreign DNA sequence, it is only important that the hybridization method ensures hybridization when the relevant sequence is present; conditions can be selected where both partially complementary probes and completely complementary probes will hybridize. Other diagnostic applications, however, may require that the hybridization method distinguish between partial and complete complementarity. It may be of interest to detect genetic polymo ⁇ hisms. For example, human hemoglobin is composed, in part, of four polypeptide chains. Two of these chains are identical chains of 141 amino acids (alpha chains) and two of these chains are identical chains of 146 amino acids (beta chains).
  • the gene encoding the beta chain is known to exhibit polymo ⁇ hism.
  • the normal allele encodes a beta chain having glutamic acid at the sixth position.
  • the mutant allele encodes a beta chain having valine at the sixth position.
  • This difference in amino acids has a profound (most profound when the individual is homozygous for the mutant allele) physiological impact known clinically as sickle cell anemia. It is well known that the genetic basis of the amino acid change involves a single base difference between the normal allele DNA sequence and the mutant allele DNA sequence.
  • nucleic acid sequence refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association.”
  • Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine.
  • duplex stability need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases.
  • Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.
  • T m is used in reference to the "melting temperature.”
  • the melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands.
  • stringency is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With “high stringency” conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of "weak” or “low” stringency are often required when it is desired that nucleic acids that are not completely complementary to one another be hybridized or annealed together.
  • High stringency conditions when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g/1 NaCI, 6.9 g/1 NaH 2 PO4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42 C when a probe of about 500 nucleotides in length is employed.
  • 5X SSPE 43.8 g/1 NaCI, 6.9 g/1 NaH 2 PO4 H 2 O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH
  • SDS 5X Denhardt's reagent
  • 100 ⁇ g/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42 C when a probe of
  • “Medium stringency conditions” when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g/1 NaCI, 6.9 g/1 NaH 2 PO H 2 O and 1.85 g/1
  • Low stringency conditions comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g/1 NaCI, 6.9 g/1 NaH 2 PO 4 H O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1 % SDS, 5X
  • Denhardt's reagent [50X Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1 % SDS at 42 C when a probe of about 500 nucleotides in length is employed.
  • RNA having a non-coding function e.g., a ribosomal or transfer RNA
  • the RNA or polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
  • wild-type refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild- type gene is that which is most frequently observed in a population and is thus arbitrarily designated the "normal” or “wild-type” form of the gene.
  • wild-type refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • a wild- type gene is that which is most frequently observed in a population and is thus arbitrarily designated the “normal” or “wild-type” form of the gene.
  • wild-type refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source.
  • modified refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product.
  • oligonucleotide as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 10-15 nucleotides and more preferably at least about 15 to 30 nucleotides.
  • the exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide.
  • the oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof.
  • an end of an oligonucleotide is referred to as the "5' end” if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end” if its 3" oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring.
  • a nucleic acid sequence even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends.
  • a first region along a nucleic acid strand is said to be upstream of another region if the 3' end of the first region is before the 5' end of the second region when moving along a strand of nucleic acid in a 5' to 3' direction.
  • the former When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3' end of one oligonucleotide points towards the 5' end of the other, the former may be called the "upstream” oligonucleotide and the latter the "downstream” oligonucleotide.
  • the first oligonucleotide when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5' end is upstream of the 5' end of the second oligonucleotide, and the 3' end of the first oligonucleotide is upstream of the 3' end of the second oligonucleotide, the first oligonucleotide may be called the "upstream” oligonucleotide and the second oligonucleotide may be called the "downstream" oligonucleotide.
  • primer refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated.
  • An oligonucleotide “primer” may occur naturally, as in a purified restriction digest or may be produced synthetically.
  • a primer is selected to be "substantially" complementary to a strand of specific sequence of the template.
  • a primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur.
  • a primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand.
  • Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer.
  • label refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect, and that can be attached to a nucleic acid or protein.
  • Labels include but are not limited to dyes; radiolabels such as 32 P; binding moieties such as biotin; haptens such as digoxgenin; luminogenic, phosphorescent or fluorogenic moieties; and fluorescent dyes alone or in combination with moieties that can suppress or shift emission spectra by fluorescence resonance energy transfer (FRET). Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or abso ⁇ tion, magnetism, enzymatic activity, and the like. A label may be a charged moiety (positive or negative charge) or alternatively, may be charge neutral. Labels can include or consist of nucleic acid or protein sequence, so long as the sequence comprising the label is detectable.
  • signal refers to any detectable effect, such as would be caused or provided by a label or an assay reaction.
  • the term "detector” refers to a system or component of a system, e.g., an instrument (e.g. a camera, fluorimeter, charge-coupled device, scintillation counter, etc.) or a reactive medium (X-ray or camera film, pH indicator, etc.), that can convey to a user or to another component of a system (e.g., a computer or controller) the presence of a signal or effect.
  • an instrument e.g. a camera, fluorimeter, charge-coupled device, scintillation counter, etc.
  • a reactive medium X-ray or camera film, pH indicator, etc.
  • a detector can be a photometric or spectrophotometric system, which can detect ultraviolet, visible or infrared light, including fluorescence or chemiluminescence; a radiation detection system; a spectroscopic system such as nuclear magnetic resonance spectroscopy, mass spectrometry or surface enhanced Raman spectrometry; a system such as gel or capillary electrophoresis or gel exclusion chromatography; or other detection systems known in the art, or combinations thereof.
  • sequence variation refers to differences in nucleic acid sequence between two nucleic acids.
  • a wild- type structural gene and a mutant form of this wild-type structural gene may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another.
  • a second mutant form of the structural gene may exist. This second mutant form is said to vary in sequence from both the wild-type gene and the first mutant form of the gene.
  • nucleotide analog refers to modified or non-naturally occurring nucleotides such as 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.
  • polymo ⁇ hism refers to the coexistence of more than one form of a gene or portion thereof.
  • a portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymo ⁇ hic region of a gene".
  • a polymo ⁇ hic region can be a single nucleotide, the identity of which differs in different alleles.
  • a polymo ⁇ hic region can also be several nucleotides long.
  • a “polymo ⁇ hic gene” refers to a gene having at least one polymo ⁇ hic region.
  • the term "polymo ⁇ hic locus” is a locus present in a population that shows variation between members of the population (e.g., the most common allele has a frequency of less than 0.95).
  • a “monomo ⁇ hic locus” is a genetic locus at little or no variations seen between members of the population (generally taken to be a locus at which the most common allele exceeds a frequency of 0.95 in the gene pool of the population).
  • non-human animal of the invention can include mammals such as rodents, non-human primates, sheep, goats, horses, dogs, cows, chickens, amphibians, reptiles, etc.
  • Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens can also provide important tools for understanding and identifying drugs that can affect processes, e.g., embryogenesis and tissue formation.
  • operably linked is intended to mean that the promoter is associated with the nucleic acid in such a manner as to facilitate transcription of the nucleic acid from the promoter.
  • protein protein
  • polypeptide peptide
  • recombinant protein refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein.
  • a "regulatory element”, also termed herein “regulatory sequence” is intended to include elements which are capable of modulating transcription from a basic promoter and include elements such as enhancers and silencers.
  • enhancer also referred to herein as “enhancer element” is intended to include regulatory elements capable of increasing, stimulating, or enhancing transcription from a basic promoter.
  • siRNA also referred to herein as “silencer element” is intended to include regulatory elements capable of decreasing, inhibiting, or repressing transcription from a basic promoter. Regulatory elements are typically present in 5' flanking regions of genes. However, regulatory elements have also been shown to be present in other regions of a gene, in particular in introns. Regulatory elements may also be present downstream of coding regions. Thus, it is possible that DME genes have regulatory elements located in introns, exons, coding regions, and 3' flanking sequences.
  • regulatory elements are also intended to be encompassed by the present invention and polymo ⁇ hisms in such elements can be identified by any of the assays that can be used to identify polymo ⁇ hisms in regulatory elements in 5' flanking regions of genes.
  • the term “regulatory element” further encompasses "tissue specific” regulatory elements, i.e., regulatory elements that affect expression of a DME gene preferentially in specific cells (e.g., cells of a specific tissue). Gene expression occurs preferentially in a specific cell if expression in this cell type is significantly higher than expression in other cell types.
  • regulatory element also encompasses non-tissue specific regulatory elements, i.e., regulatory elements that are active in most cell types.
  • a regulatory element can be a constitutive regulatory element, i.e., a regulatory element that constitutively regulates transcription, as opposed to a regulatory element that is inducible, i.e., a regulatory element which is active primarily in response to a stimulus.
  • a stimulus can be, e.g., a molecule, such as a hormone, cytokine, heavy metal, phorbol ester, cyclic AMP (cAMP), or retinoic acid.
  • transfection means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • transduction is generally used herein when the transfection with a nucleic acid is by viral delivery of the nucleic acid.
  • Transformation refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally-occurring form of the recombinant protein is disrupted.
  • transgene refers to a nucleic acid sequence that has been introduced into a cell.
  • Daughter cells deriving from a cell in which a transgene has been introduced are also said to contain the transgene (unless it has been deleted).
  • a transgene can encode, e.g., a polypeptide, or an antisense transcript, partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout).
  • a transgene can also be present in an episome.
  • a transgene can include one or more transcriptional regulatory sequence and any other nucleic acid, (e.g. intron), that may be necessary for optimal expression of a selected nucleic acid.
  • a "transgenic animal” refers to any animal, preferably a non-human animal, e.g. a mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art.
  • the nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus.
  • transgenic animal also includes those recombinant animals in which gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques.
  • treating is intended to encompass curing as well as ameliorating at least one symptom of the condition or disease.
  • sample in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a biological (e.g., human) specimen. On the other hand, a sample may include a specimen of synthetic origin.
  • Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste.
  • Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamo ⁇ hs, rodents, etc.
  • source of target nucleic acid refers to any sample that contains or is suspected to contain nucleic acids (RNA or DNA).
  • Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
  • polymerization means or “polymerization agent” refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide.
  • Preferred polymerization means comprise DNA and RNA polymerases.
  • ligation means or “ligation agent” refers to any agent capable of facilitating the ligation (i.e., the formation of a phosphodiester bond between a 3'-OH and a 5' P located at the termini of two strands of nucleic acid).
  • Preferred ligation means comprise DNA ligases and RNA ligases.
  • reactant is used herein in its broadest sense.
  • the reactant can comprise, for example, an enzymatic reactant, a chemical reactant or light (e.g., ultraviolet light, particularly short wavelength ultraviolet light is known to break oligonucleotide chains).
  • a chemical reactant or light e.g., ultraviolet light, particularly short wavelength ultraviolet light is known to break oligonucleotide chains.
  • Any agent capable of reacting with an oligonucleotide to either shorten (i.e., cleave) or elongate the oligonucleotide is encompassed within the term "reactant.”
  • nucleic acid sequence refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single or double stranded, and represent the sense or antisense strand.
  • amino acid sequence refers to peptide or protein sequence.
  • PNA peptide nucleic acid
  • PNA peptide nucleic acid
  • the attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide.
  • These small molecules also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63 [1993]).
  • the terms “purified” or “substantially purified” refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated.
  • An "isolated polynucleotide” or “isolated oligonucleotide” is therefore a substantially purified polynucleotide.
  • kit refers to any delivery system for delivering materials. In the context of reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., oligonucleotides, enzymes, etc.
  • kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials.
  • the term "fragmented kit” refers to a delivery systems comprising two or more separate containers that each contain a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain an enzyme for use in an assay, while a second container contains oligonucleotides.
  • fragment kit is intended to encompass kits containing Analyte specific reagents
  • kits include both fragmented and combined kits.
  • the term "information" refers to any collection of facts or data. In reference to information stored or processed using a computer system(s), including but not limited to internets, the term refers to any data stored in any format (e.g., analog, digital, optical, etc.).
  • the term “information related to a subject” refers to facts or data pertaining to a subject (e.g., a human, plant, or animal).
  • the term “genomic information” refers to information pertaining to a genome including, but not limited to, nucleic acid sequences, genes, allele frequencies, RNA expression levels, protein expression, phenotypes correlating to genotypes, etc.
  • Allele frequency information refers to facts or data pertaining allele frequencies, including, but not limited to, allele identities, statistical correlations between the presence of an allele and a characteristic of a subject (e.g., a human subject), the presence or absence of an allele in a individual or population, the percentage likelihood of an allele being present in an individual having one or more particular characteristics, etc.
  • cleavage structure refers to a structure that is formed by the interaction of at least one probe oligonucleotide and a target nucleic acid, forming a structure comprising a duplex, the resulting structure being cleavable by a cleavage agent, including but not limited to an enzyme.
  • the cleavage structure is a substrate for specific cleavage by the cleavage means in contrast to a nucleic acid molecule that is a substrate for non-specific cleavage by agents such as phosphodiesterases that cleave nucleic acid molecules without regard to secondary structure (i.e., no formation of a duplexed structure is required).
  • FIG. 1 shows sample embodiments of TAQMAN probes.
  • Figure 2 represents one embodiment of the TAQMAN PCR method.
  • Figure 3 shows examples of probes labeled with fluorescent dyes.
  • Figure 4 shows a sample embodiment of an invasive cleavage structure, e.g., for an INVADER assay.
  • Figure 5 shows one embodiment of a FRET probe, e.g., for an INVADER assay.
  • Figure 6 shows one embodiment of an INVADER assay.
  • Figure 7 shows a diagram of an INVADER assay probe in which the allele does not match the probe.
  • Figure 8 shows one embodiment of allele identification using a ligation reaction.
  • Figure 9 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 2 (ABCB2) gene.
  • Figure 10 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 4 (ABCB4) gene.
  • Figure 11 shows a drawing of the structure of and SNP position in the microsomal epoxide hydrogenase 1 (EPHX1) gene.
  • Figure 12 shows a drawing of the structure of and SNP position in the cytoplasmic epoxide hydrogenase 2 (EPHX2) gene.
  • Figure 13 shows a drawing of the structure of and SNP position in the guanidinoacetate-N-methyltransferase (GAMT) gene.
  • Figure 14 shows a drawing of the structure of and SNP position in the nicotinamide-N-methyltransferase (NNMT) gene.
  • Figure 15 shows a drawing of the structure of and SNP position in the phenylethanolamine-N-methyltransferase (PNMT) gene.
  • Figure 16 shows a drawing of the structure of and SNP position in the phosphatidylethanolamine-N-methyltransferase (PEMT) gene.
  • PNMT phenylethanolamine-N-methyltransferase
  • Figure 17 shows a drawing of the structure of and SNP position in the glutathione-S-methyltransferase 3 (GSTM3) gene.
  • Figure 18 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 5 (ALDH5) gene.
  • FIG 19 shows a drawing of the structure of and SNP position in the transglutaminase (TGM1) gene.
  • Figure 20 shows a drawing of the structure of and SNP position in the gamma glutamyltransferase (GGT1) gene.
  • Figure 21 shows a drawing of the structure of and SNP position in the NAD(P)H: quinone oxidetransferase (NQ01) gene.
  • Figure 22 shows a drawing of the structure of and SNP position in the p53- induced gene 3 (PIG3) of a quinone oxide transferase homologue.
  • Figure 23 shows a drawing of the structure of and SNP position in the NRH: quinone oxide transferase 2 (NQ02) gene.
  • Figure 24 shows a drawing of the structure of and SNP position in the sulfotransferase 1A1 (SULT1A1/STP1) gene.
  • Figure 25 shows a drawing of the structure of and SNP position in the sulfotransferase 1A2 (SULT1A2/STP2) gene.
  • Figure 26 shows a drawing of the structure of and SNP position in the sulfotransferase-related protein 3 (SULTX3) gene.
  • Figure 27 shows a drawing of the structure of and SNP position in the tyrosyl protein sulfotransferase (TPST1) gene.
  • Figure 28 shows a drawing of the structure of and SNP position in the tyrosyl protein sulfotransferase (TPST2) gene.
  • Figure 29 shows a drawing of the structure of and SNP position in the sulfotransferase 1A3 (SULT1A3/ STM/HAST) gene.
  • Figure 30 shows a drawing of the structure of and SNP position in the cerebroside transferase (CST) gene.
  • Figure 31 shows a drawing of the structure of and SNP position in the sulfotransferase 1C1 (SULT1C1) gene.
  • Figure 32 shows a drawing of the structure of and SNP position in the sulfotransferase 1C2 (SULT1C2) gene.
  • Figure 33 shows a drawing of the structure of and SNP position in the thyroid hormone sulfotransferase (ST1B2) gene.
  • Figure 34 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 2 (CHST2) gene.
  • Figure 35 shows a drawing of the structure of and SNP position in the sulfotransferase 2A1 (SULT2A1) gene.
  • Figure 36 shows a drawing of the structure of and SNP position in the sulfotransferase 2B1 (SULT2B1) gene.
  • Figure 37 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 4 (CHST4) gene.
  • Figure 38 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 5 (CHST5) gene.
  • Figure 39 shows a drawing of the structure of and SNP position in the HNK- sulfotransferase (NHK-1ST) gene.
  • Figure 40 shows a drawing of the structure of and SNP position in the estrogen sulfotransferase (STE) gene.
  • Figure 41 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 1 (ADH1) gene.
  • Figure 42 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 2 (ADH2) gene.
  • Figure 43 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 3 (ADH3) gene.
  • Figure 44 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 6 (ADH6) gene.
  • Figure 45 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 7 (ADH7) gene.
  • Figure 46 shows a drawing of the structure of and SNP position in the short- chained alcohol dehydrogenase family (HEP27) gene.
  • Figure 47 shows a drawing of the structure of and SNP position in the LI intracellular adhesion molecule (LI CAM) gene.
  • Figure 48 shows a drawing of the structure of and SNP position in the arylalkylamine-N-acetyl transferase (A AN AT) gene.
  • Figure 49 shows a drawing of the structure of and SNP position in the N- actyltransferase homologue (ARD1) gene of Saccharomyces cerevisiae.
  • Figure 50 shows a drawing of the structure of and SNP position in the N- actyltransferase 1 (NAT1) gene.
  • Figure 51 shows a drawing of the structure of and SNP position in the N- actyltransferase 2 (NAT2) gene.
  • Figure 52 shows a drawing of the structure of and SNP position in the granzyme A (GZMA) gene.
  • Figure 53 shows a drawing of the structure of and SNP position in the granzyme B (GZMB) gene.
  • Figure 54 shows a drawing of the structure of and SNP position in the esterase D- formylglutathione hydrolase (ESD) gene.
  • Figure 55 shows a drawing of the structure of and SNP position in the dolichyl- diphosphooligosaccharide-protein glycosyltransferase (DDOST) gene.
  • Figure 56 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase (MGST1) gene.
  • Figure 57 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 5 (ADH5) gene.
  • Figure 58 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Ml (GSTM1) gene.
  • Figure 59 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M2 (GSTM2) gene.
  • Figure 60 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M4 (GSTM4) gene.
  • Figure 61 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Zl (GSTZ1) gene.
  • Figure 62 shows a drawing of the structure of and SNP position in the glutathione-S-transferase P (GSTZPi) gene.
  • Figure 63 shows a drawing of the structure of and SNP position in the glutathione-S-transferase ql (GSTT1) gene.
  • Figure 64 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 1L1 (MGST1L1) gene.
  • Figure 65 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 2 (MGST2) gene.
  • Figure 66 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 3 (MGST3) gene.
  • Figure 67 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Al (GSTA1) gene.
  • Figure 68 shows a drawing of the structure of and SNP position in the glutathione-S-transferase A4 (GSTA4) gene.
  • Figure 69 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 1 (NDUFA1) gene.
  • Figure 70 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 2 (NDUFA2) gene.
  • Figure 71 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 3 (NDUFA3) gene.
  • Figure 72 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 5 (NDUFA5) gene.
  • Figure 73 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 6 (NDUFA6) gene.
  • Figure 74 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 7 (NDUFA7) gene.
  • Figure 75 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 8 (NDUFA8) gene.
  • Figure 76 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la/b subcomplex 1 (NDUFAB1) gene.
  • Figure 77 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 9 (NDUFA9) gene.
  • Figure 78 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 1 (NDUFS1) gene.
  • Figure 79 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 3 (NDUFS3) gene.
  • Figure 80 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 4 (NDUFS4) gene.
  • Figure 81 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 5 (NDUFS5) gene.
  • Figure 82 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 6 (NDUFS6) gene.
  • Figure 83 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 8 (NDUFS8) gene.
  • Figure 84 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase lb subcomplex 3 (NDUFB3) gene.
  • Figure 85 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase lb subcomplex 5 (NDUFB5) gene.
  • Figure 86 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase lb subcomplex 7 (NDUFB7) gene.
  • Figure 87 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily A member 1 (ABCA1) gene.
  • Figure 88 shows a drawing of the structure of and SNP position in the catechol-0- methyltransferase (COMT) gene.
  • Figure 89 shows a drawing of the structure of and SNP position in the vitamin-N- transferase (HNMT) gene.
  • Figure 90 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (aromatic compound-induced) polypeptide 1 (CYP1A1) gene.
  • Figure 91 shows a drawing of the structure of and SNP position in the cytochrome
  • P450 subfamily 1 aromatic compound-induced polypeptide 2 (CYP1A2) gene.
  • Figure 92 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (dioxin-induced) polypeptide 1 (CYP1B1) gene.
  • Figure 93 shows a drawing of the structure of and SNP position in the arylacetamide deactylase (A AD AC) gene.
  • Figure 94 shows a drawing of the structure of and SNP position in the neuropathy target esterase (NTE) gene.
  • Figure 95 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C (CFTR/MRP) member 2 (MRP2) gene.
  • Figure 96 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 1 (ABCB1) gene.
  • Figure 97 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 3 (ABCB3) gene.
  • Figure 98 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 7 (ABCB7) gene.
  • Figure 99 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 8 (ABCB8) gene.
  • Figure 100 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 9 (ABCB9) gene.
  • Figure 101 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 10 (ABCB10) gene.
  • Figure 102 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 11 (ABCB11) gene.
  • Figure 103 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IVB polypeptide 1 (CYP4B1) gene.
  • Figure 104 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily XXVIIA polypeptide 1 (CYP27A1) gene.
  • Figure 105 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IVF polypeptide 1 (CYP4F2) gene.
  • Figure 106 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 4F polypeptide 3 (CYP4F3) gene.
  • Figure 107 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 4F polypeptide 8 (CYP4F8) gene.
  • Figure 108 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 (ALDH1) gene.
  • Figure 109 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 2 (ALDH2) gene.
  • Figure 110 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 7 (ALDH7) gene.
  • Figure 111 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 8 (ALDH8) gene.
  • Figure 112 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 9 (ALDH9) gene.
  • Figure 113 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 10 (ALDH10) gene.
  • Figure 114 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C member 7 (ABCC7) gene.
  • Figure 115 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C member 8 (ABCC8) gene.
  • Figure 116 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C member 9 (ABCC9) gene.
  • Figure 117 shows a drawing of the structure of and SNP position in the carboxylesterase 1 (CES1) gene.
  • Figure 118 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily A member 4 (ABCC4) gene.
  • Figure 119 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily A member 7 (ABCC7) gene.
  • Figure 120 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily G member 1 (ABCG1) gene.
  • Figure 121 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily G member 2 (ABCG2) gene.
  • Figure 122 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily G member 4 (ABCG4) gene.
  • Figure 123 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily E member 1 (ABCE1) gene.
  • Figure 124 shows a drawing of the structure of and SNP position in the carbohydrate sulfotransferase 1 (CHST1) gene.
  • Figure 125 shows a drawing of the structure of and SNP position in the carbohydrate sulfotransferase 3 (CHST3) gene.
  • Figure 126 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 1 (NDUFV1) gene.
  • Figure 127 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 2 (NDUFV2) gene.
  • Figure 128 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 3 (NDUFV3) gene.
  • Figure 129 shows a drawing of the structure of and SNP position in the NADH: ubiquinone oxide reductase A 10 (NDUFA10) gene.
  • Figure 130 shows a drawing of the structure of and SNP position in the high- mobility group protein 17-like 1 (HMG17L1) gene.
  • Figure 131 shows a drawing of the structure of and SNP position in the UDP glycoxyl transferase 2 family polypeptide Al (UGT2A1) gene.
  • Figure 132 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 1 (hOATPl) gene.
  • Figure 133 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 2 (hOATP2) gene.
  • Figure 134 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 8 (hOATP ⁇ ) gene.
  • Figure 135 shows a drawing of the structure of and SNP position in the human organic anion transporter 1 (hOATl) gene.
  • Figure 136 shows a drawing of the structure of and SNP position in the human organic anion transporter 2 (hOAT2) gene.
  • Figure 137 shows a drawing of the structure of and SNP position in the human organic anion transporter 3 (hOAT3) gene.
  • Figure 138 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 family member A2 (ALDH1 A2) gene.
  • Figure 139 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 family member A3 (ALDH1A3) gene.
  • Figure 140 shows a drawing of the structure of and SNP position in the formyltetrahydroforate dehydrogenase (FTHFD/ALDH1L1) gene.
  • Figure 141 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IHA (aromatic compound-induced) polypeptide 4 (CYP3A4) gene.
  • CYP3A4 cytochrome P450 subfamily IHA (aromatic compound-induced) polypeptide 4
  • Figure 142 shows graph of the results of typing performed on two different groups of subjects using the INVADER assay method.
  • Figure 143 shows a summary of genetic information.
  • Figure 144A shows a structure of ATP-binding cassette subfamily A member 1 (ABCA1) gene and the SNP location therein.
  • Figure 144B shows a structure of ATP-binding cassette subfamily A member 1
  • Figure 145 shows a structure of ATP-binding cassette subfamily A member 4 (ABCA4) gene and the SNP location therein. Accession No.: NT 019258.1
  • Figure 146 shows a structure of ATP-binding cassette subfamily A member 7 (ABCA7) gene and the SNP location therein.
  • Figure 147 shows a structure of ATP-binding cassette subfamily A member 8 (ABCA8) gene and the SNP location therein.
  • Figure 148 shows a structure of ATP-binding cassette subfamily B member 1 (ABCB1) gene and the SNP location therein.
  • Figure 149 shows a structure of ATP-binding cassette subfamily B member 4
  • ABSB4 gene and the SNP location therein.
  • Figure 150 shows a structure of ATP-binding cassette subfamily B member 7 (ABCB7) gene and the SNP location therein. Accession No.: AL360179.3 and AC002417.1
  • Figure 151 shows a structure of ATP-binding cassette subfamily B member 8 (ABCB8) gene and the SNP location therein.
  • Figure 152 shows a structure of ATP-binding cassette subfamily B member 9 (ABCB9) gene and the SNP location therein.
  • Figure 153 shows a structure of ATP-binding cassette subfamily B member 10 (ABCB10) gene and the SNP location therein.
  • Figure 154 shows a structure of ATP-binding cassette subfamily B member 11
  • Figure 155 shows a structure of ATP-binding cassette subfamily C member 1 (ABCC1) gene and the SNP location therein. Accession No.: AC026452.5 and AC025778.4
  • Figure 156 shows a structure of ATP-binding cassette subfamily C member 2 (ABCC2) gene and the SNP location therein.
  • Figure 157 shows a structure of ATP-binding cassette subfamily C member 3 (ABCC3) gene and the SNP location therein.
  • Figure 158A shows a structure of ATP-binding cassette subfamily C member 4 (ABCC4) gene and the SNP location therein.
  • Figure 158B shows a structure of ATP-binding cassette subfamily C member 4
  • Figure 159 shows a structure of ATP-binding cassette subfamily C member 5 (ABCC5) gene and the SNP location therein. Accession No.: AC068644.5
  • Figure 160 shows a structure of ATP-binding cassette subfamily C member 7 (ABCC7) gene and the SNP location therein.
  • ABCC7 ATP-binding cassette subfamily C member 7
  • Figure 161 shows a structure of ATP-binding cassette subfamily C member 8 (ABCC8) gene and the SNP location therein.
  • Figure 162 shows a structure of ATP-binding cassette subfamily C member 9 (ABCC9) gene and the SNP location therein.
  • Figure 163 shows a structure of ATP-binding cassette subfamily D member 1
  • Figure 164 shows a structure of ATP-binding cassette subfamily D member 3 (ABCD3) gene and the SNP location therein. Accession No.: NT.019284.3
  • Figure 165 shows a structure of ATP-binding cassette subfamily D member 4 (ABCD4) gene and the SNP location therein. Accession No.: AC005519.3
  • Figure 166 shows a structure of ATP-binding cassette subfamily G member 1 (ABCG1) gene and the SNP location therein. Accession No.: AP001746.1
  • Figure 167 shows a structure of ATP-binding cassette subfamily G member 2 (ABCG2) gene and the SNP location therein. Accession No.: NT.022959.2
  • Figure 168 shows a structure of ATP-binding cassette subfamily G member 4
  • Figure 169 shows a structure of ATP-binding cassette subfamily G member 5 (ABCG5) gene and the SNP location therein. Accession No.: AC084265.2 and AC011242.8
  • Figure 170 shows a structure of ATP-binding cassette subfamily G member 8 (ABCG8) gene and the SNP location therein. Accession No.: AC084265.2
  • Figure 171 shows a structure of ATP-binding cassette subfamily E member 1 (ABCE 1 ) gene and the SNP location therein. Accession No.: NT.006296.2
  • Figure 172 shows a structure of ATP-binding cassette subfamily F member 1 (ABCF1) gene and the SNP location therein. Accession No.: NT.007592.3
  • Figure 173 shows a structure of organic anion transporter 1 (OATl) gene and the
  • Figure 174 shows a structure of organic anion transporter 2 (OAT2) gene and the SNP location therein.
  • Figure 175 shows a structure of organic anion transporter 3 (OAT3) gene and the SNP location therein.
  • Figure 176 shows a structure of organic anion transporter polypeptide 1 (OATP1) gene and the SNP location therein. Accession No.: AC022224.22
  • Figure 177 shows a structure of organic anion transporter polypeptide 2 (OATP2) gene and the SNP location therein. Accession No.: NT 024399.2
  • Figure 178 shows a structure of organic anion transporter polypeptide 8 (OATP8) gene and the SNP location therein. Accession No.: NT.024399.2
  • Figure 179 shows a structure of transporter 1 ATP-binding cassette subfamily B (TAP1) gene and the SNP location therein. Accession No.: X66401.1
  • Figure 180 shows a structure of transporter 2 ATP-binding cassette subfamily B (TAP2) gene and the SNP location therein. Accession No.: X66401.1
  • Figure 181 shows a structure of SLC22A4 solute carrier family 22 (organic cation transporter) member 4 (OCTN1) gene and the SNP location therein. Accession No.: AC008599.6
  • Figure 182 shows a structure of SLC22A5 solute carrier family 22 (organic cation transporter) member 5 (OCTN2) gene and the SNP location therein. Accession No.: AC023861.3
  • Figure 183 shows a structure of SLC22A1 solute carrier family 22 (organic cation transporter) member 1 (OCT1) gene and the SNP location therein. Accession No.: AL35625.5
  • Figure 184 shows a structure of SLC22A2 solute carrier family 22 (organic cation transporter) member 2 (OCT2) gene and the SNP location therein. Accession No.: AL162582.18
  • Figure 185 shows a structure of SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family) member 2 (NTCP) gene and the SNP location therein. Accession No.: AL 157789.6
  • Figure 186 shows a structure of SLC15A1 solute carrier family 15 (oligopeptide transporter) member 1 (PEPT1) gene and the SNP location therein. Accession No.: AL353574.8 and AL391670.6
  • Figure 187 shows a structure of microsomal epoxide hydrolase 1 (EPHXl) gene and the SNP location therein.
  • Figure 188 shows a structure of cytoplasmic epoxide hydrolase (EPHX2) gene and the SNP location therein.
  • Figure 189 shows a structure of catechol-O-methyl transferase (COMT) gene and the SNP location therein. Accession No.: AC000080.2
  • Figure 190 shows a structure of guanidinoacetate N-methyl transferase (GAMT) gene and the SNP location therein. Accession No.: NT.000879.1
  • Figure 191 shows a structure of phenyl ethanolamine N-methyl transferase (PNMT) gene and the SNP location therein. Accession No.: AC040933.3
  • Figure 192 shows a structure of histamine N-methyl transferase (HNMT) gene and the SNP location therein.
  • HNMT histamine N-methyl transferase
  • Figure 194 shows a structure of phosphatidylethanolamine N-methyl transferase (PEMT) gene and the SNP location therein. Accession No.: AC020558.3
  • Figure 195 shows a structure of aldehyde dehydrogenase 1 family member Al (ALDH1A1) gene and the SNP location therein.
  • Figure 196 shows a structure of aldehyde dehydrogenase 1 family member A2 (ALDH1A2) gene and the SNP location therein.
  • Figure 197 shows a structure of aldehyde dehydrogenase 1 family member A3 (ALDH1A3) gene and the SNP location therein.
  • Figure 198 shows a structure of aldehyde dehydrogenase 1 family member Bl
  • Figure 199 A shows a structure of formyl tetrahydrofolate dehydrogenase (ALDHILI) gene and the SNP location therein. Accession No.: AC079848.6
  • Figure 199B shows a structure of formyl tetrahydrofolate dehydrogenase (ALDHILI) gene and the SNP location therein, (continuation of Figure 199A)
  • ADHILI formyl tetrahydrofolate dehydrogenase
  • Figure 200 shows a structure of aldehyde dehydrogenase 2 (ALDH2) gene and the SNP location therein.
  • Figure 201 shows a structure of aldehyde dehydrogenase 3 family member Al (ALDH3A1) gene and the SNP location therein.
  • Figure 202 shows a structure of aldehyde dehydrogenase 3 family member A2
  • Figure 203 shows a structure of aldehyde dehydrogenase 3 family member B 1 (ALDH3B1) gene and the SNP location therein. Accession No.: AC004923.2
  • Figure 204 shows a structure of aldehyde dehydrogenase 3 family member B2 (ALDH3B2) gene and the SNP location therein.
  • Figure 205 shows a structure of aldehyde dehydrogenase 5 family member Al (ALDH5A1) gene and the SNP location therein.
  • Figure 206 shows a structure of aldehyde dehydrogenase 6 family member Al (ALDH6A1) gene and the SNP location therein.
  • Figure 207 shows a structure of aldehyde dehydrogenase 8 family member Al
  • Figure 208 shows a structure of aldehyde dehydrogenase 9 family member Al (ALDH9A1) gene and the SNP location therein. Accession No.: AL451074.4
  • Figure 209 shows a structure of alcohol dehydrogenase 1 (ADHl) gene and the SNP location therein.
  • Figure 210 shows a structure of alcohol dehydrogenase 2 (ADH2) gene and the SNP location therein.
  • Figure 211 shows a structure of alcohol dehydrogenase 3 (ADH3) gene and the SNP location therein.
  • Figure 212 shows a structure of alcohol dehydrogenase 4 (ADH4) gene and the SNP location therein.
  • Figure 213 shows a structure of alcohol dehydrogenase 5 (ADH5) gene and the SNP location therein. Accession No.: AC019131.4
  • Figure 214 shows a structure of alcohol dehydrogenase 6 (ADH6) gene and the SNP location therein.
  • Figure 215 shows a structure of alcohol dehydrogenase 7 (ADH7) gene and the SNP location therein.
  • Figure 216 shows a structure of short-chain alcohol dehydrogenase family gene (HEP27) and the SNP location therein.
  • FIG. 218 shows a structure of UDP glycosyltransferase 2 family polypeptide Al (UGT2A1) and the SNP location therein. Accession No.: AC011254.3
  • Figure 219 shows a structure of UDP glycosyltransferase 2 family polypeptide B15 (UGT2B15) and the SNP location therein.
  • Figure 220 shows a structure of UDP glycosyltransferase 8 (UGT8) and the SNP location therein.
  • Figure 221 shows a structure of glutathione S transferase Al (GSTA1) gene and the SNP location therein.
  • Figure 222 shows a structure of glutathione S transferase A4 (GSTA4) gene and the
  • Figure 223 shows a structure of glutathione S transferase Ml (GSTMl) gene and the SNP location therein. Accession No.: AC000032.7
  • Figure 224 shows a structure of glutathione S transferase M2 (GSTM2) gene and the SNP location therein.
  • Figure 225 shows a structure of glutathione S transferase Zl (GSTZl) gene and the SNP location therein.
  • Figure 226 shows a structure of glutathione S transferase Pi (GSTPi) gene and the SNP location therein.
  • Figure 227 shows a structure of glutathione S transferase Tl (GSTTl) gene and the
  • FIG. 228 shows a structure of microsomal glutathione S transferase 1 (MGST1) gene and the SNP location therein. Accession No.: AC007528.5
  • FIG. 229 shows a structure of microsomal glutathione S transferase 1-like 1 (MGST1L1) gene and the SNP location therein. Accession No.: AC007936.2
  • FIG. 230 shows a structure of microsomal glutathione S transferase T2 (MGST2) gene and the SNP location therein. Accession No.: AC019049.4
  • Figure 231 shows a structure of microsomal glutathione S transferase T3 (MGST3) gene and the SNP location therein. Accession No.: AC064827.2
  • Figure 232 shows a structure of sulfotransferase 1 Al (SULT1 A1/STP1) gene and the SNP location therein. Accession No.: U52852.2
  • Figure 233 shows a structure of sulfotransferase 1A2 (SULT1A2/STP2) gene and the SNP location therein. Accession No.: U33886.1, U34804.1 and AC020765.5
  • Figure 234 shows a structure of sulfotransferase 1A3 (SULT1A3/STM/HAST) gene and the SNP location therein
  • Figure 235 shows a structure of sulfotransferase 1C1 (SULT1C1) gene and the SNP location therein.
  • Figure 236 shows a structure of sulfotransferase 1C2 (SULT1C2) gene and the SNP location therein.
  • Figure 237 shows a structure of sulfotransferase 2A1 (SULT2A1) gene and the SNP location therein.
  • Figure 239 shows a structure of sulfotransferase-associated protein 3 (SULTX3) gene and the SNP location therein. Accession No.: Z97055.1
  • Figure 240 shows a structure of tyrosyl protein sulfotransferase 1 (TPST1) gene and the SNP location therein.
  • TPST1 tyrosyl protein sulfotransferase 1
  • Figure 241 shows a structure of tyrosyl protein sulfotransferase 2 (TPST2) gene and the SNP location therein. Accession No.: Z95115.1
  • Figure 242 shows a structure of cerebroside sulfotransferase (CST) gene and the
  • Figure 243 shows a structure of thyroid hormone sulfotransferase (ST1B2) gene and the SNP location therein. Accession No.: AC027059.2
  • Figure 244 shows a structure of carbohydorate sulfotransferase 1 (CHSTl) gene and the SNP location therein.
  • CHSTl carbohydorate sulfotransferase 1
  • Figure 245 shows a structure of carbohydorate sulfotransferase 2 (CHST2) gene and the SNP location therein.
  • CHST2 carbohydorate sulfotransferase 2
  • Figure 246 shows a structure of carbohydorate sulfotransferase 3 (CHST3) gene and the SNP location therein.
  • CHST3 carbohydorate sulfotransferase 3
  • Figure 247 shows a structure of carbohydorate sulfotransferase 4 (CHST4) gene and the SNP location therein.
  • CHST4 carbohydorate sulfotransferase 4
  • Figure 248 shows a structure of carbohydorate sulfotransferase 5 (CHST5) gene and the SNP location therein. Accession No.: AC025287.3
  • Figure 249 shows a structure of HNK-sulfotransferase (HNK- 1ST) gene and the SNP location therein.
  • Figure 250 shows a structure of estrogen sulfotransferase (STE) gene and the SNP location therein.
  • Figure 251 shows a structure of NAD (P)H: quinone oxidoreductase 1 (NQOl) gene and the SNP location therein.
  • Figure 252 shows a structure of NRH: quinone oxidoreductase 2 (NQO2) gene and the SNP location therein.
  • Figure 253 shows a structure of p53-inducible gene 3 (PIG3) in a quinone oxidoreductase homolog and the SNP location therein. Accession No.: AC008073.3
  • Figure 254 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 1 (NDUFA1) gene and the SNP location therein. Accession No.: AC002477.1
  • Figure 255 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 2 (NDUFA2) gene and the SNP location therein. Accession No.: AB054976.1
  • Figure 256 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 3 (NDUFA3) gene and the SNP location therein. Accession No.: AC009968.6
  • Figure 257 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex
  • NDUFA5 NDUFA5
  • Figure 258 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex
  • NDUFA6 NDUFA6 gene and the SNP location therein. Accession No.: AL021878.1
  • Figure 259 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex
  • NDUFA7 NDUFA7
  • Figure 260 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 8 (NDUFA8) gene and the SNP location therein. Accession No.: AL162423.10
  • Figure 261 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex
  • NDUFA10 NDUFA 10
  • Figure 263 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ / ⁇ - subcomplex 1 (NDUFAB1) gene and the SNP location therein. Accession No.: AC008870.6
  • Figure 264 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 3 (NDUFB3) gene and the SNP location therein.
  • Figure 265 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 5 (NDUFB5) gene and the SNP location therein.
  • Figure 266 shows a structure of NADH-dehydrogenase(ubiquinone)l ⁇ -subcomplex 7 (NDUFB7) gene and the SNP location therein.
  • NUFS1 (NDUFS1) gene and the SNP location therein.
  • Figure 268 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 3 (NDUFS3) gene and the SNP location therein. Accession No.: AC067943.4
  • Figure 269 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 4 (NDUFS4) gene and the SNP location therein.
  • Figure 270 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 5 (NDUFS5) gene and the SNP location therein.
  • Figure 271 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 6 (NDUFS6) gene and the SNP location therein.
  • Figure 273 shows a structure of NADH-dehydrogenase(ubiquinone)flavoprotein 1 (NDUFV1) gene and the SNP location therein. Accession No.: NT.009304.2
  • Figure 274 shows a structure of NADH-dehydrogenase(ubiquinone)flavoprotein 2 (NDUFV2) gene and the SNP location therein. Accession No.: NT.011024.2
  • Figure 275 shows a structure of NADH-dehydrogenase(ubiquinone)flavoprotein 3 (NDUFV3) gene and the SNP location therein. Accession No.: AP001748.1
  • Figure 276 shows a structure of gamma-glutamyl transferase 1 (GGTl) gene and the SNP location therein.
  • TGM1 transglutaminase 1
  • Figure 278 shows a structure of cytochrome P450 subfamily 1 (aromatic compound- inducible) polypeptide 1 (CYP1A1) gene and the SNP location therein. Accession No.: X04300.1 and AC020705.4
  • Figure 279 shows a structure of cytochrome P450 subfamily 1 (aromatic compound- inducible) polypeptide 2 (CYP1A2) gene and the SNP location therein. Accession No.: AC020705.4
  • Figure 280 shows a structure of cytochrome P450 subfamily 1 (dioxin-inducible) polypeptide 1 (CYP1B1) gene and the SNP location therein. Accession No.: AC009229.4
  • Figure 281 shows a structure of cytochrome P450 subfamily 3 A (aromatic compound-inducible) polypeptide 4 (CYP3A4) gene and the SNP location therein. Accession No.: AF280107.1
  • Figure 282 shows a structure of cytochrome P450 subfamily 3A (aromatic compound-inducible) polypeptide 5 (CYP3A5) gene and the SNP location therein. Accession No.: AC005020.5
  • Figure 283 shows a structure of cytochrome P450 subfamily 3 A polypeptide 7 (CYP3A7) gene and the SNP location therein. Accession No. : AF280107.1
  • Figure 284 shows a structure of cytochrome P450 polypeptide 43 (CYP3 A43) gene and the SNP location therein.
  • Figure 285 shows a structure of cytochrome P450 subfamily IVB polypeptide 1 (CYP4B 1) gene and the SNP location therein.
  • Figure 286 shows a structure of cytochrome P450 subfamily IVF polypeptide 2 (CYP4F2) gene and the SNP location therein.
  • Figure 288 shows a structure of cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8) gene and the SNP location therein. Accession No.: AC068845.3
  • Figure 289 shows a structure of cytochrome P450 subfamily XXVIIA polypeptide 1 (CYP27A1) gene and the SNP location therein.
  • Figure 290 shows a structure of cytochrome P450 subfamily XXVIIB polypeptide 1 (C YP27B 1 ) gene and the SNP location therein .
  • Figure 291 shows a structure of allylacetamide deacetylase (AADAC) gene and the SNP location therein.
  • AADAC allylacetamide deacetylase
  • Figure 293 shows a structure of carboxyl esterase 2 (CES2) gene and the SNP location therein Accession No.: AC027131.4
  • Figure 294 shows a structure of granzyme A (GZMA) gene and the SNP location therein.
  • CES2 carboxyl esterase 2
  • GZMA granzyme A
  • Figure 295 shows a structure of granzyme B (GZMB) gene and the SNP location therein.
  • GZMB granzyme B
  • Figure 296 shows a structure of esterase D/formylglutathione hydrolase (ESD) gene and the SNP location therein.
  • ESD esterase D/formylglutathione hydrolase
  • Figure 297 A shows a structure of carboxyl ester lipase (bile salt-stimulated lipase)
  • Figure 297B shows a structure of carboxyl ester lipase (bile salt-stimulated lipase) (CEL) gene and the SNP location therein, (continuation of Figure 297 A) Accession No.: AL138750. , AL162417.20 and AF072711.1
  • CEL carboxyl ester lipase
  • Figure 298 shows a structure of interleukin 17 (cytotoxic T lymphocyte-associated serine esterase 8) (IL17) gene and the SNP location therein.
  • IL17 cytotoxic T lymphocyte-associated serine esterase 8
  • Figure 299 shows a structure of ubiquitin carboxyl terminal esterase L3 (ubiquitin thiol esterase) (UCHL3) gene and the SNP location therein.
  • ubiquitin carboxyl terminal esterase L3 ubiquitin thiol esterase
  • Figure 300 shows a structure of dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST) gene and the SNP location therein.
  • DDOST dolichyl-diphosphooligosaccharide-protein glycosyltransferase
  • Figure 301 shows a structure of neuropathy target esterase (NTE) gene and the SNP location therein.
  • NTE neuropathy target esterase
  • Figure 302 shows a structure of LI cell adhesion molecule (LI CAM) gene and the SNP location therein. Accession No. : U52112
  • Figure 303 shows a structure of arylalkylamine N-acetyltransferase (AANAT) gene and the SNP location therein. Accession No.: U40391
  • Figure 304 shows a structure of N-acetyltransferase homolog (ARD1) gene of Saccharomyces cerevisiae and the SNP location therein. Accession No.: U52112
  • Figure 305 shows a structure of N-acetyltransferase (NAT 1) gene and the SNP location therein.
  • NAT 1 N-acetyltransferase
  • FIG. 306 shows a structure of N-acetyltransferase 2 (NAT2) gene and the SNP location therein.
  • Figure 307 shows a structure of ATP-binding cassette subfamily B member 2 (ABCB2) gene and the SNP location therein. Accession No.: X66401
  • Figure 308 shows a structure of ATP-binding cassette subfamily B member 3 (ABCB3) gene and the SNP location therein. Accession No.: X66401
  • Figure 309 shows a structure of glutathione S transferase M3 (GSTM3) gene and the SNP location therein.
  • Figure 310 shows a structure of glutathione S transferase M4 (GSTM4) gene and the SNP location therein.
  • FIG. 312 shows a structure of high-mobility group protein 17-like 1 (HMG17L1) gene and the SNP location therein. Accession No.: Z97055.1 GENERAL DESCRIPTION OF THE INVENTION
  • the present invention provides a method of analysis of drug metabolizing enzymes by analysis of SNPs associated with their encoding genes.
  • the method of the present invention can be used in the selection of drugs based on, e.g., particular characteristics of an individual patient or on characteristics of a target disease.
  • the present invention provides a method for detecting a genetic polymo ⁇ hism associated with a DME, wherein an oligonucleotide probe and/or oligonucleotide primer is created so as to include the genetic polymo ⁇ hism site from genetic polymo ⁇ hism data in a gene for encoding a drug metabolizing enzyme or so as to include the genetic polymo ⁇ hism site in an amplified fragment when the gene encoding the drug metabolizing enzyme has been amplified, and wherein at least one genetic polymo ⁇ hism in a gene for encoding the target drug metabolizing enzyme is detected using the oligonucleotide probe and/or oligonucleotide primer thus obtained.
  • the present invention further provides methods for evaluating a drug, wherein the effectiveness and safety of a drug metabolized by the drug metabolizing enzyme are evaluated based on the results obtained by the detection method.
  • the present invention provides a method for screening a drug, wherein the drug to be used is selected based on the results obtained in the evaluation method. In other embodiments, the present invention provides a method for screening a drug, wherein the genetic polymo ⁇ hism data associated with the gene encoding a DME in a control subject is compared to the genetic polymo ⁇ hism data associated with the same gene in a test subject, and wherein a drug to be used is selected from the results of an analysis of the effectiveness and/or safety of the drugs metabolized by the drug metabolizing enzyme.
  • the invention further features predictive medicines, which are based, at least in part, on determination of the identity of DME polymo ⁇ hic regions that are associated with particular drug responses. For example, information obtained using the diagnostic assays described herein (alone or in conjunction with information on another genetic defect, which contributes to the same disease) is useful for determining if a test subject has an allele of a polymo ⁇ hic region that is associated with a particular drug response.
  • DME genetic profile in an individual (the DME genetic profile), alone or in conjunction with information on other genetic defects contributing to the same disease (the genetic profile of the particular disease) allows customization of therapy for a particular disease to the individual's genetic profile, the goal of "pharmacogenomics.”
  • an individual's DME genetic profile can enable a doctor: 1) to more effectively prescribe a drug that will address the molecular basis of the disease or condition; and 2) to better determine the appropriate dosage of a particular drug.
  • the ability to target populations expected to show the highest clinical benefit, based on the DME genetic profile, allows: 1) the repositioning of marketed drugs with disappointing market results; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup-specific; and 3) an accelerated and less costly development for drug candidates and more optimal drug labeling (e.g. since the use of DMEs as markers is useful for optimizing effective dose).
  • a drug-metabolizing enzyme is at least one of the following: epoxide hydrolase, methyltransferase, N-acetyltransferase, sulfotransferase, quinone oxidereductase, glutathione S-transferase, UDP-glycosyltransferase, aldehyde dehydrogenase, alcohol dehydrogenase, esterase, NDUF, cytochrome P450 (CYP) and ATP-binding cassette.
  • the present invention relates to a method for detecting a genetic polymo ⁇ hism in a test subject using the genetic polymo ⁇ hism data related to a drug metabolizing enzyme.
  • the present invention analyzes the effectiveness, safety and strength of drugs metabolized by a drug metabolizing enzyme.
  • the relationship between a disease and the drug to be evaluated is based on the results of the analysis.
  • the genetic polymo ⁇ hism data for the drug metabolizing enzyme is different for each patient with a given disease. Therefore, the effectiveness and safety of a specific drug depends on drug metabolism in the presence of certain genetic polymo ⁇ hism data and the side effects in the presence of certain genetic polymo ⁇ hism data.
  • a physician can determine whether a certain drug should be used by a certain patient and can tailor drugs for use by a certain patient based on the genetic polymo ⁇ hism data (so-called "made-to-order" treatments).
  • Drug metabolizing enzymes refer to a group of enzymes that catalyze in vivo structural changes in exogenous materials including drugs. When used for clinical pu ⁇ oses, the group of metabolizing enzymes includes some endogenous materials. Because drug-metabolizing enzymes absorb, metabolize and secrete drugs, the polymo ⁇ hism of an enzyme depends on the amount of enzyme expressed (transcription and translation) and the amount of activity. As a result, there are blood serum concentrations of both unchanged materials and metabolites.
  • Drug metabolizing enzymes expressed by the genes that are targeted for genetic polymo ⁇ hism analysis in the present invention include, but are not limited to the following classes of enzymes:
  • Epoxide hydrolases are enzymes that hydrolyze epoxide using a trans- cleavage mechanism to produce 1,2-glycol. Examples include microsomal epoxide hydrolase 1 and cytoplasmic epoxide hydrolase 2.
  • Methyltransferases are enzymes that catalyze transmethylation in amino groups, hydroxyl groups and thiol groups. Examples include the following. Catechol-O-methyltransferase Vitamin-N-methyltransferase Phenylethanolamine-N-methyltransferase Phosphatidylethanolamine-N-methyltransferase
  • N-acetyltransferases are enzymes that catalyze transacetylation in amino groups, sulfonamide groups and hydrazine groups. Examples include the following.
  • Sulfotransferases are enzymes that contribute to sulfate conjugation and catalyzes trans-sulfonylation in phenols, steroids, arylamines and biliary acid. Examples include the following. Sulfotransferase 1A1, 1A2, 1A3, 1C1, 1C2, 2A1, 2B1
  • Estrogen sulfotransferase Cerebroside sulfotransferase
  • HNK-sulfotransferase 1 Carbohydrate sulfotransferase 2, 4, 5 Carbohydrate sulfotransferase 1, 3
  • Quinone oxidereductases are enzymes that catalyze the reduction of quinones such as o-quinone and p-quinone. Examples include the following.
  • NAD(P)H Quinone oxidereductase 1
  • NRH Quinone oxidereductase 2
  • PAG3 p53-induced gene 3 of a quinone oxide transferase homologue
  • Glutathione S-transferases are enzymes that catalyze the conjugation of glutathione. Examples include the following.
  • Microsomal Glutathione S-transferase 1-1 Microsomal Glutathione S-transferase 2, 3
  • UDP-glycosyltransferases are enzymes that catalyze the contribution of glucuronic acid to functional groups such as hydroxyl groups, carboxyl groups, amino groups and thiol groups after their introduction in the 1st drug metabolism route. Examples include the following. UDP-glycosyltransferase 1
  • Aldehyde dehydrogenases are enzyme that converts aldehydes into carboxylic acids. Examples include Aldehyde dehydrogenase 1 through 10.
  • Alcohol dehydrogenases are enzymes that convert alcohols into aldehydes or ketones. Examples include the following. Alcohol dehydrogenase 1 through 7
  • Esterases are enzymes that hydrolyze some esters. Examples include the following.
  • DDOST Dolichyl-diphosphooligosaccharide-protein glycosyltransferase
  • Ubiquinone dehydrogenases are enzymes that support energy metabolism, e.g., as in the mitochondrial respiratory chain. Examples include NADH ubiquinone dehydrogenase la Subunit 1 through 10. NADH-dehydrogenase (ubiquinone) l -subcomplex 1 through 3 and 5 through 10
  • NADH-dehydrogenase loc/ ⁇ -subcomplex 1 NADH-dehydrogenase (ubiquinone) l ⁇ -subcomplex 3, 5, 7 NADH-dehydrogenase (ubiquinone) Fe-S protein 1, 3, 4, 5, 6, 8 NADH-dehydrogenase (ubiquinone) flavoprotein 1 through 3
  • Cytochrome P450s are enzymes that regulate 1st drug metabolism and introduce oxygen atoms to the drug. Examples include Cytochrome P450 (CYP) 1A1, CYP 1A2, CYPIBI, CYP 2A6, CYP 2B6, CYP 2C8, CYP 2C18, CYP 2C9, CYP 2C19, CYP 2E1, CYP 2D6, CYP 2E1, CYP 2F1, CYP 3A3, CYP 3A4, CYP 3A5, CYP 3A7, CYP 3A43, CYP 4A11, CYP 4B1, CYP 4F2, CYP 4F3, CYP 4F8, CYP 1 IBl, CYP 11B2, CYP 17, CYP 19, CYP 21 A2, CYP 21 Al, CYP 27B1 and CYP 27.
  • CYPs Cytochrome P450
  • ATP-binding cassettes absorb the drug and adjust the interstitial concentration with a transporter. Examples include the following. ATP-Binding Cassette Subfamily A Members 1 through 6, 8
  • SLC22A2 solute carrier family 22 organic cation transporter
  • SLC10A2 solute carrier family 10 sodium/bile acid cotransporter family
  • SLC15A1 solute carrier family 15 (oligopeptide transporter) member 1
  • Other enzymes include gamma glutamyl transferase 1, transglutaminase 1 and dihydropyrimidine dihydrogenase.
  • Genetic polymo ⁇ hism data relating to DMEs can be obtained using any general genetic polymo ⁇ hism detection method. Examples include, but are not limited to, PCR or other amplification methods, hybridization methods using an allele-specific oligonucleotide matrix (e.g., TAQMAN PCR method, INVADER assay method), primer extension reaction methods, sequencing methods, MALDI-TOF/MS methods and the DNA chip methods (e.g., microarrays). Examples of detection methods that are applicable to analysis of the DME associated polymo ⁇ hisms of the present invention include but are not limited to those listed below. 1. Direct sequencing Assays
  • variant sequences are detected using a direct sequencing technique.
  • DNA samples are first isolated from a subject using any suitable method.
  • the region of interest is cloned into a suitable vector and amplified by growth in a host cell (e.g., a bacteria).
  • DNA in the region of interest is amplified using PCR.
  • DNA in the region of interest (e.g., the region containing the SNP or mutation of interest) is sequenced using any suitable method, including but not limited to manual sequencing using radioactive marker nucleotides, or automated sequencing. The results of the sequencing are displayed using any suitable method. The sequence is examined and the presence or absence of a given SNP or mutation is determined.
  • variant sequences are detected using a PCR-based assay.
  • the PCR assay comprises the use of oligonucleotide primers that hybridize only to the variant or wild type allele (e.g., to the region of polymo ⁇ hism or mutation). Both sets of primers are used to amplify a sample of DNA. If only the mutant primers result in a PCR product, then the patient has the mutant allele. If only the wild-type primers result in a PCR product, then the patient has the wild type allele.
  • variant sequences are detected using a fragment length polymo ⁇ hism assay.
  • a fragment length polymo ⁇ hism assay a unique DNA banding pattern based on cleaving the DNA at a series of positions is generated using an enzyme (e.g., a restriction enzyme or a CLEAVASE I [Third Wave Technologies, Madison, WI] enzyme).
  • an enzyme e.g., a restriction enzyme or a CLEAVASE I [Third Wave Technologies, Madison, WI] enzyme.
  • DNA fragments from a sample containing a SNP or a mutation will have a different banding pattern than wild type.
  • variant sequences are detected using a restriction fragment length polymo ⁇ hism assay (RFLP).
  • RFLP restriction fragment length polymo ⁇ hism assay
  • the region of interest is first isolated using PCR.
  • the PCR products are then cleaved with restriction enzymes known to give a unique length fragment for a given polymo ⁇ hism.
  • the restriction- enzyme digested PCR products are generally separated by gel electrophoresis and may be visualized by ethidium bromide staining.
  • the length of the fragments is compared to molecular weight markers and fragments generated from wild-type and mutant controls.
  • variant sequences are detected using a CLEAVASE fragment length polymo ⁇ hism assay (CFLP; Third Wave Technologies, Madison, WI; See e.g., U.S. Patent Nos. 5,843,654; 5,843,669; 5,719,208; and 5,888,780; each of which is herein inco ⁇ orated by reference).
  • This assay is based on the observation that when single strands of DNA fold on themselves, they assume higher order structures that are highly individual to the precise sequence of the DNA molecule. These secondary structures involve partially duplexed regions of DNA such that single stranded regions are juxtaposed with double stranded DNA hai ⁇ ins.
  • the CLEAVASE I enzyme is a structure-specific, thermostable nuclease that recognizes and cleaves the junctions between these single-stranded and double-stranded regions.
  • the region of interest is first isolated, for example, using PCR.
  • one or both strands are labeled.
  • DNA strands are separated by heating.
  • the reactions are cooled to allow intrastrand secondary structure to form.
  • the PCR products are then treated with the CLEAVASE I enzyme to generate a series of fragments that are unique to a given SNP or mutation.
  • the CLEAVASE enzyme treated PCR products are separated and detected (e.g., by denaturing gel electrophoresis) and visualized (e.g., by autoradiography, fluorescence imaging or staining).
  • the length of the fragments is compared to molecular weight markers and fragments generated from wild- type and mutant controls. 4.
  • variant sequences are detected a hybridization assay.
  • a hybridization assay the presence of absence of a given SNP or mutation is determined based on the ability of the DNA from the sample to hybridize to a complementary DNA molecule (e.g., a oligonucleotide probe).
  • a complementary DNA molecule e.g., a oligonucleotide probe.
  • hybridization of a probe to the sequence of interest e.g., a probe to the sequence of interest (e.g., a probe to the sequence of interest).
  • SNP or mutation is detected directly by visualizing a bound probe (e.g., a Northern or Southern assay; See e.g., Ausabel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY [1991]).
  • a bound probe e.g., a Northern or Southern assay; See e.g., Ausabel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY [1991].
  • genomic DNA Southern or RNA (Northern) is isolated from a subject.
  • the DNA or RNA is then cleaved with a series of restriction enzymes that cleave infrequently in the genome and not near any of the markers being assayed.
  • the DNA or RNA is then separated (e.g., on an agarose gel) and transferred to a membrane.
  • a labeled (e.g., by inco ⁇ orating a radionucleotide) probe or probes specific for the SNP or mutation being detected is allowed to contact the membrane under a condition or low, medium, or high stringency conditions. Unbound probe is removed and the presence of binding is detected by visualizing the labeled probe.
  • variant sequences are detected using a DNA chip hybridization assay.
  • a DNA chip hybridization assay a series of oligonucleotide probes are affixed to a solid support. The oligonucleotide probes are designed to be unique to a given SNP or mutation.
  • the DNA sample of interest is contacted with the DNA "chip” and hybridization is detected.
  • the DNA chip assay is a GeneChip (Affymetrix, Santa Clara, CA; See e.g., U.S. Patent Nos. 6,045,996; 5,925,525; and 5,858,659; each of which is herein inco ⁇ orated by reference) assay.
  • the GeneChip technology uses miniaturized, high-density arrays of oligonucleotide probes affixed to a "chip.” Probe arrays are manufactured by Affymetrix's light-directed chemical synthesis process, which combines solid-phase chemical synthesis with photolithographic fabrication techniques employed in the semiconductor industry.
  • the process constructs high-density arrays of oligonucleotides, with each probe in a predefined position in the array.
  • Multiple probe arrays are synthesized simultaneously on a large glass wafer.
  • the wafers are then diced, and individual probe arrays are packaged in injection-molded plastic cartridges, which protect them from the environment and serve as chambers for hybridization.
  • the nucleic acid to be analyzed is isolated, amplified by PCR, and labeled with a fluorescent reporter group.
  • the labeled DNA is then incubated with the array using a fluidics station.
  • the array is then inserted into the scanner, where patterns of hybridization are detected.
  • the hybridization data are collected as light emitted from the fluorescent reporter groups already inco ⁇ orated into the target, which is bound to the probe array. Probes that perfectly match the target generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe on the array are known, by complementarity, the identity of the target nucleic acid applied to the probe array can be determined.
  • a DNA microchip containing electronically captured probes (Nanogen, San Diego, CA) is utilized (See e.g., U.S. Patent Nos. 6,017,696;
  • Nanogen's technology enables the active movement and concentration of charged molecules to and from designated test sites on its semiconductor microchip.
  • DNA capture probes unique to a given SNP or mutation are electronically placed at, or "addressed" to, specific sites on the microchip. Since DNA has a strong negative charge, it can be electronically moved to an area of positive charge.
  • a test site or a row of test sites on the microchip is electronically activated with a positive charge.
  • a solution containing the DNA probes is introduced onto the microchip.
  • the negatively charged probes rapidly move to the positively charged sites, where they concentrate and are chemically bound to a site on the microchip.
  • the microchip is then washed and another solution of distinct DNA probes is added until the array of specifically bound DNA probes is complete.
  • a test sample is then analyzed for the presence of target DNA molecules by determining which of the DNA capture probes hybridize, with complementary DNA in the test sample (e.g., a PCR amplified gene of interest).
  • An electronic charge is also used to move and concentrate target molecules to one or more test sites on the microchip. The electronic concentration of sample DNA at each test site promotes rapid hybridization of sample DNA with complementary capture probes O ybridization may occur in minutes).
  • the polarity or charge of the site is reversed to negative, thereby forcing any unbound or nonspecifically bound DNA back into solution away from the capture probes.
  • a laser-based fluorescence scanner is used to detect binding,
  • an array technology based upon the segregation of fluids on a flat surface (chip) by differences in surface tension (ProtoGene, Palo Alto, CA) is utilized (See e.g., U.S. Patent Nos. 6,001,311; 5,985,551; and 5,474,796; each of which is herein inco ⁇ orated by reference).
  • Protogene's technology is based on the fact that fluids can be segregated on a flat surface by differences in surface tension that have been imparted by chemical coatings. Once so segregated, oligonucleotide probes are synthesized directly on the chip by ink-jet printing of reagents.
  • the array with its reaction sites defined by surface tension is mounted on a X/Y translation stage under a set of four piezoelectric nozzles, one for each of the four standard DNA bases.
  • the translation stage moves along each of the rows of the array and the appropriate reagent is delivered to each of the reaction site.
  • the A amidite is delivered only to the sites where amidite A is to be coupled during that synthesis step and so on.
  • Common reagents and washes are delivered by flooding the entire surface and then removing them by spinning.
  • DNA probes unique for the SNP or mutation of interest are affixed to the chip using Protogene's technology.
  • the chip is then contacted with the PCR-amplified genes of interest.
  • unbound DNA is removed and hybridization is detected using any suitable method (e.g., by fluorescence de-quenching of an inco ⁇ orated fluorescent group).
  • a "bead array” is used for the detection of polymo ⁇ hisms (Hlumina, San Diego, CA; See e.g., PCT Publications WO 99/67641 and WO 00/39587, each of which is herein inco ⁇ orated by reference), niumina uses a BEAD ARRAY technology that combines fiber optic bundles and beads that self-assemble into an array. Each fiber optic bundle contains thousands to millions of individual fibers depending on the diameter of the bundle. The beads are coated with an oligonucleotide specific for the detection of a given SNP or mutation. Batches of beads are combined to form a pool specific to the array. To perform an assay, the BEAD ARRAY is contacted with a prepared subject sample (e.g., DNA). Hybridization is detected using any suitable method.
  • a prepared subject sample e.g., DNA
  • hybridization is detected by enzymatic cleavage of specific structures (INVADER assay, Third Wave Technologies; See e.g., U.S. Patent Nos. 5,846,717, 6,090,543; 6,001,567; 5,985,557; and 5,994,069; each of which is herein inco ⁇ orated by reference).
  • the INVADER assay detects specific DNA and RNA sequences by using structure-specific enzymes to cleave a complex formed by the hybridization of overlapping oligonucleotide probes. Elevated temperature and an excess of one of the probes enable multiple probes to be cleaved for each target sequence present without temperature cycling.
  • the secondary probe oligonucleotide can be 5'-end labeled with a fluorescent dye that is quenched by a second dye or other quenching moiety.
  • the de-quenched dye-labeled product may be detected using a standard fluorescence plate reader, or an instrument configured to collect fluorescence data during the course of the reaction (i.e., a "real-time" fluorescence detector, such as an ABI 7700 Sequence Detection System, Applied Biosystems, Foster City, CA).
  • the INVADER assay detects specific mutations and SNPs in unamplified genomic DNA.
  • two oligonucleotides hybridize in tandem to the genomic DNA to form an overlapping structure.
  • a structure-specific nuclease enzyme recognizes this overlapping structure and cleaves the primary probe.
  • cleaved primary probe combines with a fluorescence-labeled secondary probe to create another overlapping structure that is cleaved by the enzyme.
  • the initial and secondary reactions can run concurrently in the same vessel. Cleavage of the secondary probe is detected by using a fluorescence detector, as described above.
  • the signal of the test sample may be compared to known positive and negative controls.
  • hybridization of a bound probe is detected using a TAQMAN assay (PE Biosystems, Foster City, CA; See e.g., U.S. Patent Nos. 5,962,233 and 5,538,848, each of which is herein inco ⁇ orated by reference).
  • the assay is performed during a PCR reaction.
  • the TAQMAN assay exploits the 5'-3' exonuclease activity of DNA polymerases such as AMPLITAQ DNA polymerase.
  • a probe, specific for a given allele or mutation, is included in the PCR reaction.
  • the probe consists of an oligonucleotide with a 5'-reporter dye (e.g., a fluorescent dye) and a 3'-quencher dye.
  • the 5'-3' nucleolytic activity of the AMPLITAQ polymerase cleaves the probe between the reporter and the quencher dye.
  • the separation of the reporter dye from the quencher dye results in an increase of fluorescence.
  • the signal accumulates with each cycle of PCR and -can be monitored with a fluorimeter.
  • polymo ⁇ hisms are detected using the SNP-IT primer extension assay (Orchid Biosciences, Princeton, NJ; See e.g., U.S. Patent Nos. 5,952,174 and 5,919,626, each of which is herein inco ⁇ orated by reference).
  • SNPs are identified by using a specially synthesized DNA primer and a DNA polymerase to selectively extend the DNA chain by one base at the suspected SNP location. DNA in the region of interest is amplified and denatured. Polymerase reactions are then performed using miniaturized systems called microfluidics. Detection is accomplished by adding a label to the nucleotide suspected of being at the SNP or mutation location.
  • I co ⁇ oration of the label into the DNA can be detected by any suitable method (e.g., if the nucleotide contains a biotin label, detection is via a fluorescently labelled antibody specific for biotin). 5.
  • Other Detection Assays Additional detection assays that are produced and utilized using the systems and methods of the present invention include, but are not limited to, enzyme mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770, herein inco ⁇ orated by reference in their entireties); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos.
  • a MassARRAY system (Sequenom, San Diego, CA.) is used to detect variant sequences (See e.g., U.S. Patent Nos. 6,043,031; 5,777,324; and 5,605,798; each of which is herein inco ⁇ orated by reference).
  • DNA is isolated from blood samples using standard procedures.
  • specific DNA regions containing the mutation or SNP of interest about 200 base pairs in length, are amplified by PCR.
  • the amplified fragments are then attached by one strand to a solid surface and the non-immobilized strands are removed by standard denaturation and washing. The remaining immobilized single strand then serves as a template for automated enzymatic reactions that produce genotype specific diagnostic products.
  • Very small quantities of the enzymatic products are then transferred to a SpectroCHIP array for subsequent automated analysis with the SpectroREADER mass spectrometer. Each spot is preloaded with light absorbing crystals that form a matrix with the dispensed diagnostic product.
  • the MassARRAY system uses MALDI-TOF (Matrix Assisted Laser Deso ⁇ tion Ionization - Time of Flight) mass spectrometry. In a process known as deso ⁇ tion, the matrix is hit with a pulse from a laser beam. Energy from the laser beam is transferred to the matrix and it is vaporized resulting in a small amount of the diagnostic product being expelled into a flight tube.
  • MALDI-TOF Microx Assisted Laser Deso ⁇ tion Ionization - Time of Flight
  • the diagnostic product As the diagnostic product is charged when an electrical field pulse is subsequently applied to the tube they are launched down the flight tube towards a detector.
  • the time between application of the electrical field pulse and collision of the diagnostic product with the detector is referred to as the time of flight.
  • This is a very precise measure of the product's molecular weight, as a molecule's mass correlates directly with time of flight with smaller molecules flying faster than larger molecules.
  • the entire assay is completed in less than one thousandth of a second, enabling samples to be analyzed in a total of 3-5 second including repetitive data collection.
  • the SpectroTYPER software then calculates, records, compares and reports the genotypes at the rate of three seconds per sample.
  • the present invention provides an oligonucleotide comprising a DME related sequence, or a complement of a DME-related sequence.
  • an oligonucleotide of the present invention comprises a sequence or a complement of a sequence selected from the group consisting SEQ ID NOs. 1-3360 and 3361-7669, or a substantially similar sequence.
  • an oligonucleotide probe or oligonucleotide primer is created so the 5' terminus, 3' terminus or central base contains the genetic polymo ⁇ hism site.
  • an oligonucleotide is created comprising at least 13 contiguous bases of a sequence selected from SEQ ID NOs 1 through 3360 or the complement thereto, and further comprising the 21 sl nucleotide of the sequence selected from SEQ ID NOs 1 through 3360, or the complement thereto.
  • an oligonucleotide of the present invention flanks or is adjacent to a polymo ⁇ hic site, such that the presence of the polymo ⁇ hism can be detected by modification of the oligonucleotide in a manner dependent on the presence or absence of the polymo ⁇ hism.
  • the present invention provides kits comprising one or more of the components necessary for practicing the present invention.
  • the present invention provides kits for storing or delivering the enzymes of the present invention and/or the reaction components necessary to practice a cleavage assay (e.g., the INVADER assay).
  • the kit may include any and all components necessary or desired for the enzymes or assays including, but not limited to, the reagents themselves, buffers, control reagents (e.g., tissue samples, positive and negative control target oligonucleotides, etc.), solid supports, labels, written and/or pictorial instructions and product information, inhibitors, labeling and/or detection reagents, package environmental controls (e.g., ice, desiccants, etc.), and the like.
  • the kits provide a sub-set of the required components, wherein it is expected that the user will supply the remaining components.
  • the kits comprise two or more separate containers wherein each container houses a subset of the components to be delivered.
  • a first container e.g., box
  • an enzyme e.g., structure specific cleavage enzyme in a suitable storage buffer and container
  • a second box may contain oligonucleotides (e.g., INVADER oligonucleotides, probe oligonucleotides, control target oligonucleotides, etc.).
  • one or more the reaction components may be provided in a predispensed format (i.e., pre- measured for use in a step of the procedure without re-measurement or re-dispensing).
  • selected reaction components are mixed and predispensed together.
  • predispensed reaction components are predispensed and are provided in a reaction vessel (including but not limited to a reaction tube or a well, as in, e.g., a microtiter plate).
  • predispensed reaction components are dried down (e.g., desiccated or lyophilized) in a reaction vessel. Examples of genetic polymo ⁇ hism data (especially the SNP data) that can be used in the method of the present invention are shown in Table 1. Table 1 1/161
  • ABCB11 40 intron 12 + 326 gataaatgacaaggcaatta G/C aacaatcaggaagcacaggt 4032
  • ABCC4 49 intron 4 - 6267 acttccaccattcacagtat T/C gttcttaatggcatgcggat , 4242
  • ABCC4 52 intron 4 - 5295 agttgtctggcttacagtag A/G tgcttactaaatggtagctt 4245
  • ABCC4 66 intron 6 + (380-381) tgtgttagagctgttttcac (AT) gtgtatatatgtgtgttatt 4259
  • ABCC4 66 intron 6 + (380-381) tgtgttagagctgttttcac gtgtatatatgtgtgttatt 4260
  • ABCC4 121 intron 20 + (637-648) ctaagtettaagctgtcttt (A)l 2 -13 eeaaeaatcetacagaaata 4316
  • ABCC4 138 intron 26 + (101-109) taattggatgaaaggattgt (T)8-9 cacccaatagagcatgtttt 4333
  • ABCC4 148 intron 30 - 704 acgtttatcagaaaacctgt A/C tctcttctagttcagctaga 4343
  • ABCC5 10 intron 2 - (18735-18734) atagaagcttaaactcacaa (A) cacgtactctacatagatga 4361
  • ABCC5 10 intron 2 - (18735-18734) atagaagcttaaactcacaa cacgtactctacatagatga 4362
  • ABCC5 14 intron 2 - 15605 aggagacgccacgacactga C/T agctgtacctgacctgaggg 4366

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pathology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Apparatus Associated With Microorganisms And Enzymes (AREA)

Abstract

The present invention relates to genetic polymorphism data, compositions and methods for detecting genetic polymorphisms, methods for evaluating drugs using genetic polymorphisms and screening methods for drugs.

Description

Detection of Genetic Polymorphisms
The present invention claims priority to Japanese Patent Application Ser. Nos. 2000-399,443 filed December 27, 2000, 2001-135,256 field May 2, 2001, and 2001- 256,862 filed August 27, 2001.
FIELD OF THE INVENTION
The present invention relates to genetic polymorphism data, compositions and methods for detecting genetic polymorphisms, methods for evaluating drugs using genetic polymorphisms and screening methods for drugs.
BACKGROUND
Human beings come in all shapes and sizes, and over three billion genetic codes are located in somewhat different sites in each human being. Individual DNA sequence variations in the human genome are known to directly cause specific diseases or conditions, to predispose certain individuals to specific diseases or conditions, and to affect responses of individuals to treatments such as drugs. Such variations also modulate the severity or progression of many diseases. Additionally, DNA sequences vary between populations. Therefore, determining DNA sequence variations in the human genome is useful for making accurate diagnoses, for finding suitable therapies, and for understanding the relationship between genome variations and environmental factors in the pathogenesis of diseases, the prevalence of conditions and the efficacy of therapies.
There are several types of DNA sequence variations in the human genome. These variations include insertions, deletions and copy number differences of repeated sequences. These differences in the genetic code are called genetic polymorphisms. The most common DNA sequence variations in the human genome are single base pair substitutions. These are generally referred to as single nucleotide polymorphisms (SNPs) when the variant allele has a population frequency of at least 1 % . SNPs may be classified by where they appear in the genome. For example, a single nucleotide polymorphism may be classified as a coding SNP (cSNP) when it is in a region encoding a protein, or genome SNP (gSNP) when it is detected anywhere in a genome, without reference to whether it is in a coding region. Coding SNPs include silent SNPs (sSNP), and SNPs that may be in regions associated with coding sequences, such as regulatory regions or elements (e.g., regulatory SNPs, or rSNPs) and introns (e.g., intron SNPs, or iSNPs).
SNPs are particularly useful in studying the relationship between DNA sequence variations and human diseases, conditions and drug responses because SNPs are stable in populations, occur frequently, and have lower mutation rates than other genome variations such as repeating sequences. In addition, methods for detecting SNPs are more amenable to being automated and used for large-scale studies than methods for detecting other, less common DNA sequence variations. Single nucleotide polymorphisms are useful as polymorphism markers for discovering genes that cause or exacerbate certain diseases. This is directly related in clinical medicine to diagnosing the risk for a disease and determining the proper pharmaceutical treatment. There is currently a worldwide effort going on to develop drugs based on the target genes that cause diseases. Individual patients also react differently when a drug is administered. In some patients, a drug may have a significant effect, in others a lesser effect and in still others no effect at all. In other words, there is a major difference in patient reactions to the same drug. Patients may also metabolize drugs at different rates. In addition to differences in therapeutic reactions among patients to drugs, there is also the possibility of strong and even fatal side effects due to genetically linked differences in, e.g., drug metabolism, drug transport or drug receptor function. Analysis of genetic polymorphisms such as SNPs allows for the selection of drugs and the development of treatment protocols tailored to each individual patient (so- called "personalized" medical treatments). Instead of the using trial-and-error methods of matching patients with the right drugs, doctors may, for example, be able to analyze a patient's genetic profile and prescribe the best available drug therapy from the beginning. Not only would this take the guesswork out of finding the right drug, it would reduce the likelihood of adverse reactions, thus increasing safety.
SUMMARY OF THE INVENTION The present invention identifies genetic polymorphisms relating to genes associated with drug metabolism. In some embodiments, the present invention provides methods for determining variations in sequences and genes associated with drug- metabolizing enzymes. In preferred embodiments, the present invention provides methods for collecting genetic polymorphism data for use in evaluating the effectiveness and safety of a drug based on the data, and screening drugs using the data. In some preferred embodiments, the polymorphisms of the present invention are used to evaluate a causal relationship between the genetic make-up of a patient and a response to an administered drug.
The present invention relates to genes encoding enzymes associated with drug metabolism (drug metabolizing enzymes, or DMEs). In particular, the present invention relates to sequence variations associated with variations in DMEs. In some embodiments, variations occur in coding regions of DMEs, such as may alter a function of the DMEs, (e.g., by increasing or decreasing its level of activity, or shifting its activity to an alternative target or function). In other embodiments, the variations occur in non-coding regions of the genome, such as may alter expression of a DME (e.g., increasing or decreasing the amount of an enzyme produced in a cell) or processing of an RNA transcript encoding a DME (e.g., by altering splicing).
In some embodiments, the present invention provides methods for detecting DME-related sequence variations. In some preferred embodiments, the methods of the present invention are used to create a profile of DME-related polymorphisms in a test subject.
In other embodiments, the present invention provides isolated nucleic acid sequences encoding variant DMEs. For example, the present invention provides a recombinant DNA vector comprising DNA having a nucleotide sequence encoding a variant DME, the nucleotide sequence comprising a sequence including, but not limited to, SEQ ID NOS: 1-3360 and 3361-7669, and substantially similar sequences. In a preferred embodiment, the invention provides a host cell transformed with a recombinant DNA vector comprising DNA having a nucleotide sequence encoding a variant DME. The invention is not limited by the nature of the host cell employed. The art is well aware of expression vectors suitable for the expression of nucleotide sequences encoding variant DMEs that can be expressed in a variety of prokaryotic and eukaryotic host cells. In some preferred embodiments, the host cell is a eukaryotic cell grown in culture, such as for use in in vitro drug screening (e.g., by monitoring the expression of genes associated with the pathways targeted by a particular test drug). In other preferred embodiments, the host cell is in vivo.
The present invention provides systems and methods for detection of polymorphisms associated with genes encoding enzymes associated with drug metabolism. The present invention is not limited in the nature of the detection assay used for detection or identification of such polymorphisms. Such detection assays include, but are not limited to, hybridization methods and array technologies (e.g., technologies available from Aclara BioSciences, Haywood, CA; Affymetrix, Santa Clara, CA; Agilent Technologies, Inc., Palo Alto, CA; Aviva Biosciences Corp., San Diego, CA; Caliper
Technologies Corp., Palo Alto, CA; Celera, Rockville, MD; CuraGen Corp., New Haven, CT; Hyseq Inc., Sunnyvale, CA; Illumina, Inc., San Diego, CA; Incyte Genomics, Palo Alto, CA; Motorola BioChip Systems; Nanogen, San Diego, CA; Orchid BioSciences, Inc., Princeton, NJ; Applera Corp., Foster City, CA; Rosetta Inpharmatics, Kirkland, WA; and Sequenom, San Diego, CA); polymerase chain reaction-based methods (e.g., TAQMAN, Applera Corp., GENECODE system, EraGen, Middleton, WI); branched hybridization methods; enzyme mismatch cleavage methods; NASBA; sandwich hybridization methods; methods employing molecular beacons; ligase chain reactions, and the like. Methods of the present invention find application in improving the drug discovery and approval processes. For example, the costs and risks of drug development may be reduced if only those persons capable of responding to a drug are selected for clinical trials. In addition, previously failed drug candidates may be revived as they are matched with more appropriate patient populations. Decreases in the number of adverse drug reactions, the number of failed drug trials, the time it takes to get a drug approved, the length of time patients are on medication, the number of medications patients must take to find an effective therapy, and an increase in the range of possible drug targets will promote a net decrease in the cost of health care.
Thus, in some embodiments, the present invention provides a method of identifying individuals having a polymoφhism, comprising providing nucleic acid from a subject; and detecting the presence of at least one polymoφhism in said nucleic acid, said at least one polymoφhism including, but not limited to, polymoφhisms found in SEQ ID Nos:l-3360 and 3361-7669. In some embodiments, the method further provides the step of providing a prognosis (e.g., a genotype relative risk or a population attributable risk) to the subject based on the presence or absence of the at least one polymoφhism. In some embodiments, the detecting step is carried out using a detection assay including, but not limited to, a hybridization assay, a TAQMAN assay, an invasive cleavage assay, use of mass spectroscopy, a microarray, a polymerase chain reaction, a rolling circle extension assay, a sequencing assay, a hybridization assay employing a probe complementary to a polymoφhism, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
The present invention also provides a nucleic acid (e.g., a gene, a probe, a primer, etc.) comprising a sequence selected from the group consisting of SEQ ID NO: 1-3360 and 3361-7669 or complements thereof. In some embodiments, the nucleic acid molecule comprises a label. In some embodiments, the nucleic acid is attached to a solid support (e.g., as part of a microarray). The present invention also provides vectors comprising the nucleic acid and host cell comprising the vector, as well as polypeptide encoded by the nucleic acid. Methods of producing and purifying polypeptides are well known in the art.
The present invention further provides kits for detecting a polymoφhism, comprising at least one reagent that specifically detects a polymoφhism in a sequence including, but not limited to, SEQ ED Nos:l-3360 and 3361-7669. In some embodiments, the kit further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder. In some embodiments, the at least one reagent comprises a nucleic acid probe. The kits can be configured for a variety of uses including, but not limited to, use as an in vitro diagnostic detection assay, an analyte specific reagent detection assay, and a research-use-only detection assay.
The present invention also provides a method for screening subjects for genetic markers associated with drug metabolizing enzyme(s), comprising: a) providing a biological sample comprising a nucleic acid from a subject; b) testing the nucleic acid for a polymoφhism in a genetic marker associated with a drug metabolizing enzyme, said genetic marker comprising one or more nucleotide polymoφhisms designated by n, said n selected from a base substitution, an insertion, or a deletion found in a sequence selected from the group consisting of SEQ ID Nos: 1-3360 and 3361-7669. The present invention is not limited by the source of the nucleic acid. In some embodiments, the biological sample comprises blood, saliva, amniotic fluid, and tissue. In some embodiments, the subject is a human. In some preferred embodiments, the nucleic acid comprises DNA and/or RNA.
The present invention further provides a composition comprising an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymoφhism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymoφhisms designated by n in SEQ ID Nos: 1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence. The present invention also provides a composition comprising a detection probe for determining the presense or absence a single nucleotide polymoφhism in a gene encoding a drug metabolizing enzyme, said gene comprising a sequence selected from the group consisting of SEQ ID Nos: 1-3360 and 3361-7669.
The present invention further provides a method of determining the effectiveness of or side-effect of a drug or treatment protocol, comprising; a) administering a drug or treatment protocol to one or more subjects; b) obtaining nucleic acid from said one or more subjects; c) using a detection assay to detect the presence of at least one polymoφhism in said nucleic acid from said one or more of subjects, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361-7669; and d) assigning an effectiveness rating, side-effect rating, or score for said drug or treatment protocol based upon a result of one or more said detection assays (See e.g., Toxicology Testing Handbook: Principles, Applications, and Data Inteφretation, ed. Jacobson-Kram and Keller, 2001, herein incoφorated by reference in its entirety). The present invention also provides a method of prescribing a drug to or treatment protocol for a subject, comprising; providing nucleic acid from said subject; using a detection assay to detect the presence of at least one polymoφhism in the nucleic acid, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361-7669; and, prescribing said drug or treatment protocol based upon the result of said detection assay. The present invention further provides a method for generating assay data comprising: obtaining a sample from a subject containing nucleic acid; transferring said sample to a laboratory; and receiving data from said laboratory, wherein said data corresponds to the presence of at least one polymoφhism in said nucleic acid, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361-7669. The present further provides data sets generated by this method.
DEFINITIONS
To facilitate an understanding of the present invention, a number of terms and phrases are defined below:
As used herein, the terms "complementary" or "complementarity" are used in reference to polynucleotides (i.e., a sequence of nucleotides such as an oligonucleotide or a target nucleic acid) related by the base-pairing rules. For example, for the sequence " 5 -A-G-T-3'," is complementary to the sequence " 3'-T-C-A-5'." Complementarity may be "partial," in which only some of the nucleic acids' bases are matched according to the base pairing rules. Or, there may be "complete" or "total" complementarity between the nucleic acids. The degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, as well as detection methods that depend upon binding between nucleic acids. Either term may also be used in reference to individual nucleotides, especially within the context of polynucleotides. For example, a particular nucleotide within an oligonucleotide may be noted for its complementarity, or lack thereof, to a nucleotide within another nucleic acid strand, in contrast or comparison to the complementarity between the rest of the oligonucleotide and the nucleic acid strand. Nucleotide analogs used to form non-standard base pairs, whether with another nucleotide analog (e.g., an IsoC/TsoG base pair), or with a naturally occurring nucleotide (e.g., as described in U.S. Patent 5,912,340, herein incoφorated by reference in its entirety) are also considered to be complementary to a base pairing partner within the meaning this definition.
The term "homology" and "homologous" refers to a degree of identity. There may be partial homology or complete homology. A partially homologous sequence is one that is less than 100% identical to another sequence.
As used herein, the term "hybridization" is used in reference to the pairing of complementary nucleic acids. Hybridization and the strength of hybridization (i.e., the strength of the association between the nucleic acids) is influenced by such factors as the degree of complementary between the nucleic acids, stringency of the conditions involved, and the Tm of the formed hybrid. "Hybridization" methods involve the annealing of one nucleic acid to another, complementary nucleic acid, i.e., a nucleic acid having a complementary nucleotide sequence. The ability of two polymers of nucleic acid containing complementary sequences to find each other and anneal through base pairing interaction is a well-recognized phenomenon. The initial observations of the
"hybridization" process by Marmur and Lane, Proc. Natl. Acad. Sci. USA 46:453 (1960) and Doty et al., Proc. Natl. Acad. Sci. USA 46:461 (1960) have been followed by the refinement of this process into an essential tool of modern biology.
With regard to complementarity, it is important for some diagnostic applications to determine whether the hybridization represents complete or partial complementarity. For example, where it is desired to detect simply the presence or absence of a foreign DNA sequence, it is only important that the hybridization method ensures hybridization when the relevant sequence is present; conditions can be selected where both partially complementary probes and completely complementary probes will hybridize. Other diagnostic applications, however, may require that the hybridization method distinguish between partial and complete complementarity. It may be of interest to detect genetic polymoφhisms. For example, human hemoglobin is composed, in part, of four polypeptide chains. Two of these chains are identical chains of 141 amino acids (alpha chains) and two of these chains are identical chains of 146 amino acids (beta chains). The gene encoding the beta chain is known to exhibit polymoφhism. The normal allele encodes a beta chain having glutamic acid at the sixth position. The mutant allele encodes a beta chain having valine at the sixth position. This difference in amino acids has a profound (most profound when the individual is homozygous for the mutant allele) physiological impact known clinically as sickle cell anemia. It is well known that the genetic basis of the amino acid change involves a single base difference between the normal allele DNA sequence and the mutant allele DNA sequence.
The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association." Certain bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention and include, for example, inosine and 7-deazaguanine.
Complementarity need not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, base composition and sequence of the oligonucleotide, ionic strength and incidence of mismatched base pairs.
As used herein, the term "Tm" is used in reference to the "melting temperature." The melting temperature is the temperature at which a population of double-stranded nucleic acid molecules becomes half dissociated into single strands. Several equations for calculating the Tm of nucleic acids are well known in the art. As indicated by standard references, a simple estimate of the Tm value may be calculated by the equation: Tm = 81.5 + 0.41(% G + C), when a nucleic acid is in aqueous solution at 1 M NaCI (see e.g., Anderson and Young, Quantitative Filter Hybridization, in Nucleic Acid Hybridization (1985). Other references (e.g., Allawi, H.T. & SantaLucia, J., Jr. Thermodynamics and NMR of internal G.T mismatches in DNA. Biochemistry 36, 10581-94 (1997) include more sophisticated computations which take structural and environmental, as well as sequence characteristics into account for the calculation of Tm.
As used herein the term "stringency" is used in reference to the conditions of temperature, ionic strength, and the presence of other compounds, under which nucleic acid hybridizations are conducted. With "high stringency" conditions, nucleic acid base pairing will occur only between nucleic acid fragments that have a high frequency of complementary base sequences. Thus, conditions of "weak" or "low" stringency are often required when it is desired that nucleic acids that are not completely complementary to one another be hybridized or annealed together.
"High stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g/1 NaCI, 6.9 g/1 NaH2PO4 H2O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 0.1X SSPE, 1.0% SDS at 42 C when a probe of about 500 nucleotides in length is employed.
"Medium stringency conditions" when used in reference to nucleic acid hybridization comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g/1 NaCI, 6.9 g/1 NaH2PO H2O and 1.85 g/1
EDTA, pH adjusted to 7.4 with NaOH), 0.5% SDS, 5X Denhardt's reagent and 100 μg/ml denatured salmon sperm DNA followed by washing in a solution comprising 1.0X SSPE, 1.0% SDS at 42 C when a probe of about 500 nucleotides in length is employed. "Low stringency conditions" comprise conditions equivalent to binding or hybridization at 42 C in a solution consisting of 5X SSPE (43.8 g/1 NaCI, 6.9 g/1 NaH2PO4 H O and 1.85 g/1 EDTA, pH adjusted to 7.4 with NaOH), 0.1 % SDS, 5X
Denhardt's reagent [50X Denhardt's contains per 500 ml: 5 g Ficoll (Type 400, Pharamcia), 5 g BSA (Fraction V; Sigma)] and 100 g/ml denatured salmon sperm DNA followed by washing in a solution comprising 5X SSPE, 0.1 % SDS at 42 C when a probe of about 500 nucleotides in length is employed.
The term "gene" refers to a DNA sequence that comprises control and coding sequences necessary for the production of an RNA having a non-coding function (e.g., a ribosomal or transfer RNA), a polypeptide or a precursor. The RNA or polypeptide can be encoded by a full-length coding sequence or by any portion of the coding sequence so long as the desired activity or function is retained.
The term "wild-type" refers to a gene or a gene product that has the characteristics of that gene or gene product when isolated from a naturally occurring source. A wild- type gene is that which is most frequently observed in a population and is thus arbitrarily designated the "normal" or "wild-type" form of the gene. In contrast, the term
"modified,""mutant," or "polymoφhic" refers to a gene or gene product that displays modifications in sequence and or functional properties (i.e., altered characteristics) when compared to the wild-type gene or gene product. It is noted that naturally-occurring mutants can be isolated; these are identified by the fact that they have altered characteristics when compared to the wild-type gene or gene product. The term "oligonucleotide" as used herein is defined as a molecule comprising two or more deoxyribonucleotides or ribonucleotides, preferably at least 5 nucleotides, more preferably at least about 10-15 nucleotides and more preferably at least about 15 to 30 nucleotides. The exact size will depend on many factors, which in turn depend on the ultimate function or use of the oligonucleotide. The oligonucleotide may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription, PCR, or a combination thereof.
Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5' phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbor in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end" if its 3" oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have 5' and 3' ends. A first region along a nucleic acid strand is said to be upstream of another region if the 3' end of the first region is before the 5' end of the second region when moving along a strand of nucleic acid in a 5' to 3' direction.
When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, and the 3' end of one oligonucleotide points towards the 5' end of the other, the former may be called the "upstream" oligonucleotide and the latter the "downstream" oligonucleotide. Similarly, when two overlapping oligonucleotides are hybridized to the same linear complementary nucleic acid sequence, with the first oligonucleotide positioned such that its 5' end is upstream of the 5' end of the second oligonucleotide, and the 3' end of the first oligonucleotide is upstream of the 3' end of the second oligonucleotide, the first oligonucleotide may be called the "upstream" oligonucleotide and the second oligonucleotide may be called the "downstream" oligonucleotide. The term "primer" refers to an oligonucleotide that is capable of acting as a point of initiation of synthesis when placed under conditions in which primer extension is initiated. An oligonucleotide "primer" may occur naturally, as in a purified restriction digest or may be produced synthetically. A primer is selected to be "substantially" complementary to a strand of specific sequence of the template. A primer must be sufficiently complementary to hybridize with a template strand for primer elongation to occur. A primer sequence need not reflect the exact sequence of the template. For example, a non-complementary nucleotide fragment may be attached to the 5' end of the primer, with the remainder of the primer sequence being substantially complementary to the strand. Non-complementary bases or longer sequences can be interspersed into the primer, provided that the primer sequence has sufficient complementarity with the sequence of the template to hybridize and thereby form a template primer complex for synthesis of the extension product of the primer. The term "label" as used herein refers to any atom or molecule that can be used to provide a detectable (preferably quantifiable) effect, and that can be attached to a nucleic acid or protein. Labels include but are not limited to dyes; radiolabels such as 32P; binding moieties such as biotin; haptens such as digoxgenin; luminogenic, phosphorescent or fluorogenic moieties; and fluorescent dyes alone or in combination with moieties that can suppress or shift emission spectra by fluorescence resonance energy transfer (FRET). Labels may provide signals detectable by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absoφtion, magnetism, enzymatic activity, and the like. A label may be a charged moiety (positive or negative charge) or alternatively, may be charge neutral. Labels can include or consist of nucleic acid or protein sequence, so long as the sequence comprising the label is detectable.
The term "signal" as used herein refers to any detectable effect, such as would be caused or provided by a label or an assay reaction.
As used herein, the term "detector" refers to a system or component of a system, e.g., an instrument (e.g. a camera, fluorimeter, charge-coupled device, scintillation counter, etc.) or a reactive medium (X-ray or camera film, pH indicator, etc.), that can convey to a user or to another component of a system (e.g., a computer or controller) the presence of a signal or effect. A detector can be a photometric or spectrophotometric system, which can detect ultraviolet, visible or infrared light, including fluorescence or chemiluminescence; a radiation detection system; a spectroscopic system such as nuclear magnetic resonance spectroscopy, mass spectrometry or surface enhanced Raman spectrometry; a system such as gel or capillary electrophoresis or gel exclusion chromatography; or other detection systems known in the art, or combinations thereof.
The term "sequence variation" as used herein refers to differences in nucleic acid sequence between two nucleic acids. For example, a wild- type structural gene and a mutant form of this wild-type structural gene may vary in sequence by the presence of single base substitutions and/or deletions or insertions of one or more nucleotides. These two forms of the structural gene are said to vary in sequence from one another. A second mutant form of the structural gene may exist. This second mutant form is said to vary in sequence from both the wild-type gene and the first mutant form of the gene.
The term "nucleotide analog" as used herein refers to modified or non-naturally occurring nucleotides such as 7-deaza purines (i.e., 7-deaza-dATP and 7-deaza-dGTP). Nucleotide analogs include base analogs and comprise modified forms of deoxyribonucleotides as well as ribonucleotides.
The term "polymoφhism" refers to the coexistence of more than one form of a gene or portion thereof. A portion of a gene of which there are at least two different forms, i.e., two different nucleotide sequences, is referred to as a "polymoφhic region of a gene". A polymoφhic region can be a single nucleotide, the identity of which differs in different alleles. A polymoφhic region can also be several nucleotides long.
A "polymoφhic gene" refers to a gene having at least one polymoφhic region. The term "polymoφhic locus" is a locus present in a population that shows variation between members of the population (e.g., the most common allele has a frequency of less than 0.95). In contrast, a "monomoφhic locus" is a genetic locus at little or no variations seen between members of the population (generally taken to be a locus at which the most common allele exceeds a frequency of 0.95 in the gene pool of the population). A "non-human animal" of the invention can include mammals such as rodents, non-human primates, sheep, goats, horses, dogs, cows, chickens, amphibians, reptiles, etc. Preferred non-human animals are selected from the rodent family including rat and mouse, most preferably mouse, though transgenic amphibians, such as members of the Xenopus genus, and transgenic chickens can also provide important tools for understanding and identifying drugs that can affect processes, e.g., embryogenesis and tissue formation.
The term "operably linked" is intended to mean that the promoter is associated with the nucleic acid in such a manner as to facilitate transcription of the nucleic acid from the promoter.
The terms "protein", "polypeptide" and "peptide" are used interchangeably herein when referring to a gene product.
The term "recombinant protein" refers to a polypeptide which is produced by recombinant DNA techniques, wherein generally, DNA encoding the polypeptide is inserted into a suitable expression vector which is in turn used to transform a host cell to produce the heterologous protein. A "regulatory element", also termed herein "regulatory sequence" is intended to include elements which are capable of modulating transcription from a basic promoter and include elements such as enhancers and silencers. The term "enhancer", also referred to herein as "enhancer element", is intended to include regulatory elements capable of increasing, stimulating, or enhancing transcription from a basic promoter. The term "silencer", also referred to herein as "silencer element" is intended to include regulatory elements capable of decreasing, inhibiting, or repressing transcription from a basic promoter. Regulatory elements are typically present in 5' flanking regions of genes. However, regulatory elements have also been shown to be present in other regions of a gene, in particular in introns. Regulatory elements may also be present downstream of coding regions. Thus, it is possible that DME genes have regulatory elements located in introns, exons, coding regions, and 3' flanking sequences. Such regulatory elements are also intended to be encompassed by the present invention and polymoφhisms in such elements can be identified by any of the assays that can be used to identify polymoφhisms in regulatory elements in 5' flanking regions of genes. The term "regulatory element" further encompasses "tissue specific" regulatory elements, i.e., regulatory elements that affect expression of a DME gene preferentially in specific cells (e.g., cells of a specific tissue). Gene expression occurs preferentially in a specific cell if expression in this cell type is significantly higher than expression in other cell types. The term "regulatory element" also encompasses non-tissue specific regulatory elements, i.e., regulatory elements that are active in most cell types. Furthermore, a regulatory element can be a constitutive regulatory element, i.e., a regulatory element that constitutively regulates transcription, as opposed to a regulatory element that is inducible, i.e., a regulatory element which is active primarily in response to a stimulus. A stimulus can be, e.g., a molecule, such as a hormone, cytokine, heavy metal, phorbol ester, cyclic AMP (cAMP), or retinoic acid. As used herein, the term "transfection" means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer. The term "transduction" is generally used herein when the transfection with a nucleic acid is by viral delivery of the nucleic acid. "Transformation", as used herein, refers to a process in which a cell's genotype is changed as a result of the cellular uptake of exogenous DNA or RNA, and, for example, the transformed cell expresses a recombinant form of a polypeptide or, in the case of anti-sense expression from the transferred gene, the expression of a naturally-occurring form of the recombinant protein is disrupted.
As used herein, the term "transgene" refers to a nucleic acid sequence that has been introduced into a cell. Daughter cells deriving from a cell in which a transgene has been introduced are also said to contain the transgene (unless it has been deleted). A transgene can encode, e.g., a polypeptide, or an antisense transcript, partly or entirely heterologous, i.e., foreign, to the transgenic animal or cell into which it is introduced, or, is homologous to an endogenous gene of the transgenic animal or cell into which it is introduced, but which is designed to be inserted, or is inserted, into the animal's genome in such a way as to alter the genome of the cell into which it is inserted (e.g., it is inserted at a location which differs from that of the natural gene or its insertion results in a knockout). Alternatively, a transgene can also be present in an episome. A transgene can include one or more transcriptional regulatory sequence and any other nucleic acid, (e.g. intron), that may be necessary for optimal expression of a selected nucleic acid. A "transgenic animal" refers to any animal, preferably a non-human animal, e.g. a mammal, bird or an amphibian, in which one or more of the cells of the animal contain heterologous nucleic acid introduced by way of human intervention, such as by transgenic techniques well known in the art. The nucleic acid is introduced into the cell, directly or indirectly by introduction into a precursor of the cell, by way of deliberate genetic manipulation, such as by microinjection or by infection with a recombinant virus. The term genetic manipulation does not include classical cross-breeding, or in vitro fertilization, but rather is directed to the introduction of a recombinant DNA molecule. This molecule may be integrated within a chromosome, or it may be extrachromosomally replicating DNA. In the typical transgenic animals described herein, the transgene causes cells to express a recombinant form of one of a protein, e.g. either agonistic or antagonistic forms. However, transgenic animals in which the recombinant gene is silent are also contemplated. Moreover, "transgenic animal" also includes those recombinant animals in which gene disruption of one or more genes is caused by human intervention, including both recombination and antisense techniques.
The term "treating" as used herein is intended to encompass curing as well as ameliorating at least one symptom of the condition or disease.
The term "sample" in the present specification and claims is used in its broadest sense. On the one hand it is meant to include a biological (e.g., human) specimen. On the other hand, a sample may include a specimen of synthetic origin.
Biological samples may be animal, including human, fluid, solid (e.g., stool) or tissue, as well as liquid and solid food and feed products and ingredients such as dairy items, vegetables, meat and meat by-products, and waste. Biological samples may be obtained from all of the various families of domestic animals, as well as feral or wild animals, including, but not limited to, such animals as ungulates, bear, fish, lagamoφhs, rodents, etc. The term "source of target nucleic acid" refers to any sample that contains or is suspected to contain nucleic acids (RNA or DNA). Particularly preferred sources of target nucleic acids are biological samples including, but not limited to blood, saliva, cerebral spinal fluid, pleural fluid, milk, lymph, sputum and semen.
The term "polymerization means" or "polymerization agent" refers to any agent capable of facilitating the addition of nucleoside triphosphates to an oligonucleotide. Preferred polymerization means comprise DNA and RNA polymerases. The term "ligation means" or "ligation agent" refers to any agent capable of facilitating the ligation (i.e., the formation of a phosphodiester bond between a 3'-OH and a 5' P located at the termini of two strands of nucleic acid). Preferred ligation means comprise DNA ligases and RNA ligases. The term "reactant" is used herein in its broadest sense. The reactant can comprise, for example, an enzymatic reactant, a chemical reactant or light (e.g., ultraviolet light, particularly short wavelength ultraviolet light is known to break oligonucleotide chains). Any agent capable of reacting with an oligonucleotide to either shorten (i.e., cleave) or elongate the oligonucleotide is encompassed within the term "reactant."
The term "nucleic acid sequence" as used herein refers to an oligonucleotide, nucleotide or polynucleotide, and fragments or portions thereof, and to DNA or RNA of genomic or synthetic origin that may be single or double stranded, and represent the sense or antisense strand. Similarly, "amino acid sequence" as used herein refers to peptide or protein sequence.
The term "peptide nucleic acid" ("PNA") as used herein refers to a molecule comprising bases or base analogs such as would be found in natural nucleic acid, but attached to a peptide backbone rather than the sugar-phosphate backbone typical of nucleic acids. The attachment of the bases to the peptide is such as to allow the bases to base pair with complementary bases of nucleic acid in a manner similar to that of an oligonucleotide. These small molecules, also designated anti gene agents, stop transcript elongation by binding to their complementary strand of nucleic acid (Nielsen, et al. Anticancer Drug Des. 8:53 63 [1993]).
As used herein, the terms "purified" or "substantially purified" refer to molecules, either nucleic or amino acid sequences, that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably 75% free, and most preferably 90% free from other components with which they are naturally associated. An "isolated polynucleotide" or "isolated oligonucleotide" is therefore a substantially purified polynucleotide. As used herein, the term "kit" refers to any delivery system for delivering materials. In the context of reaction assays, such delivery systems include systems that allow for the storage, transport, or delivery of reaction reagents (e.g., oligonucleotides, enzymes, etc. in the appropriate containers) and/or supporting materials (e.g., buffers, written instructions for performing the assay etc.) from one location to another. For example, kits include one or more enclosures (e.g., boxes) containing the relevant reaction reagents and/or supporting materials. As used herein, the term "fragmented kit" refers to a delivery systems comprising two or more separate containers that each contain a subportion of the total kit components. The containers may be delivered to the intended recipient together or separately. For example, a first container may contain an enzyme for use in an assay, while a second container contains oligonucleotides. The term "fragmented kit" is intended to encompass kits containing Analyte specific reagents
(ASR's) regulated under section 520(e) of the Federal Food, Drug, and Cosmetic Act, but are not limited thereto. Indeed, any delivery system comprising two or more separate containers that each contains a subportion of the total kit components are included in the term "fragmented kit." In contrast, a "combined kit" refers to a delivery system containing all of the components of a reaction assay in a single container (e.g., in a single box housing each of the desired components). The term "kit" includes both fragmented and combined kits.
As used herein, the term "information" refers to any collection of facts or data. In reference to information stored or processed using a computer system(s), including but not limited to internets, the term refers to any data stored in any format (e.g., analog, digital, optical, etc.). As used herein, the term "information related to a subject" refers to facts or data pertaining to a subject (e.g., a human, plant, or animal). The term "genomic information" refers to information pertaining to a genome including, but not limited to, nucleic acid sequences, genes, allele frequencies, RNA expression levels, protein expression, phenotypes correlating to genotypes, etc. "Allele frequency information" refers to facts or data pertaining allele frequencies, including, but not limited to, allele identities, statistical correlations between the presence of an allele and a characteristic of a subject (e.g., a human subject), the presence or absence of an allele in a individual or population, the percentage likelihood of an allele being present in an individual having one or more particular characteristics, etc. The term "cleavage structure" as used herein, refers to a structure that is formed by the interaction of at least one probe oligonucleotide and a target nucleic acid, forming a structure comprising a duplex, the resulting structure being cleavable by a cleavage agent, including but not limited to an enzyme. The cleavage structure is a substrate for specific cleavage by the cleavage means in contrast to a nucleic acid molecule that is a substrate for non-specific cleavage by agents such as phosphodiesterases that cleave nucleic acid molecules without regard to secondary structure (i.e., no formation of a duplexed structure is required).
DESCRIPTION OF THE DRAWINGS
Figure 1 shows sample embodiments of TAQMAN probes.
Figure 2 represents one embodiment of the TAQMAN PCR method.
Figure 3 shows examples of probes labeled with fluorescent dyes.
Figure 4 shows a sample embodiment of an invasive cleavage structure, e.g., for an INVADER assay.
Figure 5 shows one embodiment of a FRET probe, e.g., for an INVADER assay.
Figure 6 shows one embodiment of an INVADER assay.
Figure 7 shows a diagram of an INVADER assay probe in which the allele does not match the probe. Figure 8 shows one embodiment of allele identification using a ligation reaction.
Figure 9 shows a drawing of the structure of and SNP position in the ATP-binding cassette subfamily B member 2 (ABCB2) gene.
Figure 10 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 4 (ABCB4) gene. Figure 11 shows a drawing of the structure of and SNP position in the microsomal epoxide hydrogenase 1 (EPHX1) gene.
Figure 12 shows a drawing of the structure of and SNP position in the cytoplasmic epoxide hydrogenase 2 (EPHX2) gene.
Figure 13 shows a drawing of the structure of and SNP position in the guanidinoacetate-N-methyltransferase (GAMT) gene. Figure 14 shows a drawing of the structure of and SNP position in the nicotinamide-N-methyltransferase (NNMT) gene.
Figure 15 shows a drawing of the structure of and SNP position in the phenylethanolamine-N-methyltransferase (PNMT) gene. Figure 16 shows a drawing of the structure of and SNP position in the phosphatidylethanolamine-N-methyltransferase (PEMT) gene.
Figure 17 shows a drawing of the structure of and SNP position in the glutathione-S-methyltransferase 3 (GSTM3) gene.
Figure 18 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 5 (ALDH5) gene.
Figure 19 shows a drawing of the structure of and SNP position in the transglutaminase (TGM1) gene.
Figure 20 shows a drawing of the structure of and SNP position in the gamma glutamyltransferase (GGT1) gene. Figure 21 shows a drawing of the structure of and SNP position in the NAD(P)H: quinone oxidetransferase (NQ01) gene.
Figure 22 shows a drawing of the structure of and SNP position in the p53- induced gene 3 (PIG3) of a quinone oxide transferase homologue.
Figure 23 shows a drawing of the structure of and SNP position in the NRH: quinone oxide transferase 2 (NQ02) gene.
Figure 24 shows a drawing of the structure of and SNP position in the sulfotransferase 1A1 (SULT1A1/STP1) gene.
Figure 25 shows a drawing of the structure of and SNP position in the sulfotransferase 1A2 (SULT1A2/STP2) gene. Figure 26 shows a drawing of the structure of and SNP position in the sulfotransferase-related protein 3 (SULTX3) gene.
Figure 27 shows a drawing of the structure of and SNP position in the tyrosyl protein sulfotransferase (TPST1) gene.
Figure 28 shows a drawing of the structure of and SNP position in the tyrosyl protein sulfotransferase (TPST2) gene. Figure 29 shows a drawing of the structure of and SNP position in the sulfotransferase 1A3 (SULT1A3/ STM/HAST) gene.
Figure 30 shows a drawing of the structure of and SNP position in the cerebroside transferase (CST) gene. Figure 31 shows a drawing of the structure of and SNP position in the sulfotransferase 1C1 (SULT1C1) gene.
Figure 32 shows a drawing of the structure of and SNP position in the sulfotransferase 1C2 (SULT1C2) gene.
Figure 33 shows a drawing of the structure of and SNP position in the thyroid hormone sulfotransferase (ST1B2) gene.
Figure 34 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 2 (CHST2) gene.
Figure 35 shows a drawing of the structure of and SNP position in the sulfotransferase 2A1 (SULT2A1) gene. Figure 36 shows a drawing of the structure of and SNP position in the sulfotransferase 2B1 (SULT2B1) gene.
Figure 37 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 4 (CHST4) gene.
Figure 38 shows a drawing of the structure of and SNP position in the hydrocarbon sulfotransferase 5 (CHST5) gene.
Figure 39 shows a drawing of the structure of and SNP position in the HNK- sulfotransferase (NHK-1ST) gene.
Figure 40 shows a drawing of the structure of and SNP position in the estrogen sulfotransferase (STE) gene. Figure 41 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 1 (ADH1) gene.
Figure 42 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 2 (ADH2) gene.
Figure 43 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 3 (ADH3) gene. Figure 44 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 6 (ADH6) gene.
Figure 45 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 7 (ADH7) gene. Figure 46 shows a drawing of the structure of and SNP position in the short- chained alcohol dehydrogenase family (HEP27) gene.
Figure 47 shows a drawing of the structure of and SNP position in the LI intracellular adhesion molecule (LI CAM) gene.
Figure 48 shows a drawing of the structure of and SNP position in the arylalkylamine-N-acetyl transferase (A AN AT) gene.
Figure 49 shows a drawing of the structure of and SNP position in the N- actyltransferase homologue (ARD1) gene of Saccharomyces cerevisiae.
Figure 50 shows a drawing of the structure of and SNP position in the N- actyltransferase 1 (NAT1) gene. Figure 51 shows a drawing of the structure of and SNP position in the N- actyltransferase 2 (NAT2) gene.
Figure 52 shows a drawing of the structure of and SNP position in the granzyme A (GZMA) gene.
Figure 53 shows a drawing of the structure of and SNP position in the granzyme B (GZMB) gene.
Figure 54 shows a drawing of the structure of and SNP position in the esterase D- formylglutathione hydrolase (ESD) gene.
Figure 55 shows a drawing of the structure of and SNP position in the dolichyl- diphosphooligosaccharide-protein glycosyltransferase (DDOST) gene. Figure 56 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase (MGST1) gene.
Figure 57 shows a drawing of the structure of and SNP position in the alcohol dehydrogenase 5 (ADH5) gene.
Figure 58 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Ml (GSTM1) gene. Figure 59 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M2 (GSTM2) gene.
Figure 60 shows a drawing of the structure of and SNP position in the glutathione-S-transferase M4 (GSTM4) gene. Figure 61 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Zl (GSTZ1) gene.
Figure 62 shows a drawing of the structure of and SNP position in the glutathione-S-transferase P (GSTZPi) gene.
Figure 63 shows a drawing of the structure of and SNP position in the glutathione-S-transferase ql (GSTT1) gene.
Figure 64 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 1L1 (MGST1L1) gene.
Figure 65 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 2 (MGST2) gene. Figure 66 shows a drawing of the structure of and SNP position in the microsomal glutathione-S-transferase 3 (MGST3) gene.
Figure 67 shows a drawing of the structure of and SNP position in the glutathione-S-transferase Al (GSTA1) gene.
Figure 68 shows a drawing of the structure of and SNP position in the glutathione-S-transferase A4 (GSTA4) gene.
Figure 69 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 1 (NDUFA1) gene.
Figure 70 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 2 (NDUFA2) gene. Figure 71 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 3 (NDUFA3) gene.
Figure 72 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 5 (NDUFA5) gene.
Figure 73 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 6 (NDUFA6) gene. Figure 74 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 7 (NDUFA7) gene.
Figure 75 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 8 (NDUFA8) gene. Figure 76 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la/b subcomplex 1 (NDUFAB1) gene.
Figure 77 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase la subcomplex 9 (NDUFA9) gene.
Figure 78 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 1 (NDUFS1) gene.
Figure 79 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 3 (NDUFS3) gene.
Figure 80 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 4 (NDUFS4) gene. Figure 81 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 5 (NDUFS5) gene.
Figure 82 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 6 (NDUFS6) gene.
Figure 83 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase Fe-S protein 8 (NDUFS8) gene.
Figure 84 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase lb subcomplex 3 (NDUFB3) gene.
Figure 85 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase lb subcomplex 5 (NDUFB5) gene. Figure 86 shows a drawing of the structure of and SNP position in the NADH- ubiquinone oxide reductase lb subcomplex 7 (NDUFB7) gene.
Figure 87 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily A member 1 (ABCA1) gene.
Figure 88 shows a drawing of the structure of and SNP position in the catechol-0- methyltransferase (COMT) gene. Figure 89 shows a drawing of the structure of and SNP position in the vitamin-N- transferase (HNMT) gene.
Figure 90 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (aromatic compound-induced) polypeptide 1 (CYP1A1) gene. Figure 91 shows a drawing of the structure of and SNP position in the cytochrome
P450 subfamily 1 (aromatic compound-induced) polypeptide 2 (CYP1A2) gene.
Figure 92 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 1 (dioxin-induced) polypeptide 1 (CYP1B1) gene.
Figure 93 shows a drawing of the structure of and SNP position in the arylacetamide deactylase (A AD AC) gene.
Figure 94 shows a drawing of the structure of and SNP position in the neuropathy target esterase (NTE) gene.
Figure 95 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C (CFTR/MRP) member 2 (MRP2) gene. Figure 96 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 1 (ABCB1) gene.
Figure 97 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 3 (ABCB3) gene.
Figure 98 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 7 (ABCB7) gene.
Figure 99 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 8 (ABCB8) gene.
Figure 100 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 9 (ABCB9) gene. Figure 101 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 10 (ABCB10) gene.
Figure 102 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily B member 11 (ABCB11) gene.
Figure 103 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IVB polypeptide 1 (CYP4B1) gene. Figure 104 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily XXVIIA polypeptide 1 (CYP27A1) gene.
Figure 105 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IVF polypeptide 1 (CYP4F2) gene. Figure 106 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 4F polypeptide 3 (CYP4F3) gene.
Figure 107 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily 4F polypeptide 8 (CYP4F8) gene.
Figure 108 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 (ALDH1) gene.
Figure 109 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 2 (ALDH2) gene.
Figure 110 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 7 (ALDH7) gene. Figure 111 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 8 (ALDH8) gene.
Figure 112 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 9 (ALDH9) gene.
Figure 113 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 10 (ALDH10) gene.
Figure 114 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C member 7 (ABCC7) gene.
Figure 115 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C member 8 (ABCC8) gene. Figure 116 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily C member 9 (ABCC9) gene.
Figure 117 shows a drawing of the structure of and SNP position in the carboxylesterase 1 (CES1) gene.
Figure 118 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily A member 4 (ABCC4) gene. Figure 119 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily A member 7 (ABCC7) gene.
Figure 120 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily G member 1 (ABCG1) gene. Figure 121 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily G member 2 (ABCG2) gene.
Figure 122 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily G member 4 (ABCG4) gene.
Figure 123 shows a drawing of the structure of and SNP position in the ATP- binding cassette subfamily E member 1 (ABCE1) gene.
Figure 124 shows a drawing of the structure of and SNP position in the carbohydrate sulfotransferase 1 (CHST1) gene.
Figure 125 shows a drawing of the structure of and SNP position in the carbohydrate sulfotransferase 3 (CHST3) gene. Figure 126 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 1 (NDUFV1) gene.
Figure 127 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 2 (NDUFV2) gene.
Figure 128 shows a drawing of the structure of and SNP position in the NADH: ubiquinone dehydrogenase flavoprotein 3 (NDUFV3) gene.
Figure 129 shows a drawing of the structure of and SNP position in the NADH: ubiquinone oxide reductase A 10 (NDUFA10) gene.
Figure 130 shows a drawing of the structure of and SNP position in the high- mobility group protein 17-like 1 (HMG17L1) gene. Figure 131 shows a drawing of the structure of and SNP position in the UDP glycoxyl transferase 2 family polypeptide Al (UGT2A1) gene.
Figure 132 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 1 (hOATPl) gene.
Figure 133 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 2 (hOATP2) gene. Figure 134 shows a drawing of the structure of and SNP position in the human organic anion transporter polypeptide 8 (hOATPδ) gene.
Figure 135 shows a drawing of the structure of and SNP position in the human organic anion transporter 1 (hOATl) gene. Figure 136 shows a drawing of the structure of and SNP position in the human organic anion transporter 2 (hOAT2) gene.
Figure 137 shows a drawing of the structure of and SNP position in the human organic anion transporter 3 (hOAT3) gene.
Figure 138 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 family member A2 (ALDH1 A2) gene.
Figure 139 shows a drawing of the structure of and SNP position in the aldehyde dehydrogenase 1 family member A3 (ALDH1A3) gene.
Figure 140 shows a drawing of the structure of and SNP position in the formyltetrahydroforate dehydrogenase (FTHFD/ALDH1L1) gene. Figure 141 shows a drawing of the structure of and SNP position in the cytochrome P450 subfamily IHA (aromatic compound-induced) polypeptide 4 (CYP3A4) gene.
Figure 142 shows graph of the results of typing performed on two different groups of subjects using the INVADER assay method. Figure 143 shows a summary of genetic information.
Figure 144A shows a structure of ATP-binding cassette subfamily A member 1 (ABCA1) gene and the SNP location therein.
Accession No.: AF275948.1 and AL359846.i l Figure 144B shows a structure of ATP-binding cassette subfamily A member 1
(ABCA1) gene and the SNP location therein, (continuation of Figure 9A) Accession No.: AF275948.1 and AL359846.i l
Figure 145 shows a structure of ATP-binding cassette subfamily A member 4 (ABCA4) gene and the SNP location therein. Accession No.: NT 019258.1 Figure 146 shows a structure of ATP-binding cassette subfamily A member 7 (ABCA7) gene and the SNP location therein.
Accession No.: NT.025194.1
Figure 147 shows a structure of ATP-binding cassette subfamily A member 8 (ABCA8) gene and the SNP location therein.
Accession No.: AC005922.1 and AC015844.5
Figure 148 shows a structure of ATP-binding cassette subfamily B member 1 (ABCB1) gene and the SNP location therein.
Accession No.: AC002457.1 and AC005068.1 Figure 149 shows a structure of ATP-binding cassette subfamily B member 4
(ABCB4) gene and the SNP location therein.
Accession No.: AC079591.1, AC079303.3 and AC005045.2
Figure 150 shows a structure of ATP-binding cassette subfamily B member 7 (ABCB7) gene and the SNP location therein. Accession No.: AL360179.3 and AC002417.1
Figure 151 shows a structure of ATP-binding cassette subfamily B member 8 (ABCB8) gene and the SNP location therein.
Accession No.: AC010973.4
Figure 152 shows a structure of ATP-binding cassette subfamily B member 9 (ABCB9) gene and the SNP location therein.
Accession No.: AC026362.9 and AC073857.10
Figure 153 shows a structure of ATP-binding cassette subfamily B member 10 (ABCB10) gene and the SNP location therein.
Accession No.: AL121990.9 Figure 154 shows a structure of ATP-binding cassette subfamily B member 11
(ABCB11) gene and the SNP location therein.
Accession No.: AC008177.3 and AC069137.3
Figure 155 shows a structure of ATP-binding cassette subfamily C member 1 (ABCC1) gene and the SNP location therein. Accession No.: AC026452.5 and AC025778.4 Figure 156 shows a structure of ATP-binding cassette subfamily C member 2 (ABCC2) gene and the SNP location therein.
Accession No.: AL392107.4
Figure 157 shows a structure of ATP-binding cassette subfamily C member 3 (ABCC3) gene and the SNP location therein.
Accession No.: AC004590.1 and AC005921.3
Figure 158A shows a structure of ATP-binding cassette subfamily C member 4 (ABCC4) gene and the SNP location therein.
Accession No.: AL356257.i l, AL157818.12 and AL139381.12 Figure 158B shows a structure of ATP-binding cassette subfamily C member 4
(ABCC4) gene and the SNP location therein, (continuation of Figure 158A)
Accession No.: AL356257.il, AL157818.12, and AL139381.12
Figure 159 shows a structure of ATP-binding cassette subfamily C member 5 (ABCC5) gene and the SNP location therein. Accession No.: AC068644.5
Figure 160 shows a structure of ATP-binding cassette subfamily C member 7 (ABCC7) gene and the SNP location therein.
Accession No.: AC000111.1 and AC000061.1
Figure 161 shows a structure of ATP-binding cassette subfamily C member 8 (ABCC8) gene and the SNP location therein.
Accession No.: AC000406.1
Figure 162 shows a structure of ATP-binding cassette subfamily C member 9 (ABCC9) gene and the SNP location therein.
Accession No.: AC084806.9 andAC008250.23 Figure 163 shows a structure of ATP-binding cassette subfamily D member 1
(ABCD1) gene and the SNP location therein.
Accession No.: U52111.2
Figure 164 shows a structure of ATP-binding cassette subfamily D member 3 (ABCD3) gene and the SNP location therein. Accession No.: NT.019284.3 Figure 165 shows a structure of ATP-binding cassette subfamily D member 4 (ABCD4) gene and the SNP location therein. Accession No.: AC005519.3
Figure 166 shows a structure of ATP-binding cassette subfamily G member 1 (ABCG1) gene and the SNP location therein. Accession No.: AP001746.1
Figure 167 shows a structure of ATP-binding cassette subfamily G member 2 (ABCG2) gene and the SNP location therein. Accession No.: NT.022959.2 Figure 168 shows a structure of ATP-binding cassette subfamily G member 4
(ABCG4) gene and the SNP location therein. Accession No.: AP001315.3
Figure 169 shows a structure of ATP-binding cassette subfamily G member 5 (ABCG5) gene and the SNP location therein. Accession No.: AC084265.2 and AC011242.8
Figure 170 shows a structure of ATP-binding cassette subfamily G member 8 (ABCG8) gene and the SNP location therein. Accession No.: AC084265.2
Figure 171 shows a structure of ATP-binding cassette subfamily E member 1 (ABCE 1 ) gene and the SNP location therein. Accession No.: NT.006296.2
Figure 172 shows a structure of ATP-binding cassette subfamily F member 1 (ABCF1) gene and the SNP location therein. Accession No.: NT.007592.3 Figure 173 shows a structure of organic anion transporter 1 (OATl) gene and the
SNP location therein.
Accession No.: AP001858.3, AJ249369.1, and AP000438.4 Figure 174 shows a structure of organic anion transporter 2 (OAT2) gene and the SNP location therein. Accession No.: AC26532.3 Figure 175 shows a structure of organic anion transporter 3 (OAT3) gene and the SNP location therein.
Accession No.: AP001858.3
Figure 176 shows a structure of organic anion transporter polypeptide 1 (OATP1) gene and the SNP location therein. Accession No.: AC022224.22
Figure 177 shows a structure of organic anion transporter polypeptide 2 (OATP2) gene and the SNP location therein. Accession No.: NT 024399.2 Figure 178 shows a structure of organic anion transporter polypeptide 8 (OATP8) gene and the SNP location therein. Accession No.: NT.024399.2
Figure 179 shows a structure of transporter 1 ATP-binding cassette subfamily B (TAP1) gene and the SNP location therein. Accession No.: X66401.1
Figure 180 shows a structure of transporter 2 ATP-binding cassette subfamily B (TAP2) gene and the SNP location therein. Accession No.: X66401.1
Figure 181 shows a structure of SLC22A4 solute carrier family 22 (organic cation transporter) member 4 (OCTN1) gene and the SNP location therein. Accession No.: AC008599.6
Figure 182 shows a structure of SLC22A5 solute carrier family 22 (organic cation transporter) member 5 (OCTN2) gene and the SNP location therein. Accession No.: AC023861.3 Figure 183 shows a structure of SLC22A1 solute carrier family 22 (organic cation transporter) member 1 (OCT1) gene and the SNP location therein. Accession No.: AL35625.5
Figure 184 shows a structure of SLC22A2 solute carrier family 22 (organic cation transporter) member 2 (OCT2) gene and the SNP location therein. Accession No.: AL162582.18 Figure 185 shows a structure of SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family) member 2 (NTCP) gene and the SNP location therein. Accession No.: AL 157789.6
Figure 186 shows a structure of SLC15A1 solute carrier family 15 (oligopeptide transporter) member 1 (PEPT1) gene and the SNP location therein. Accession No.: AL353574.8 and AL391670.6
Figure 187 shows a structure of microsomal epoxide hydrolase 1 (EPHXl) gene and the SNP location therein.
Accession No.: AC058782.8 Figure 188 shows a structure of cytoplasmic epoxide hydrolase (EPHX2) gene and the SNP location therein.
Accession No.: AC010856.3
Figure 189 shows a structure of catechol-O-methyl transferase (COMT) gene and the SNP location therein. Accession No.: AC000080.2
Figure 190 shows a structure of guanidinoacetate N-methyl transferase (GAMT) gene and the SNP location therein. Accession No.: NT.000879.1
Figure 191 shows a structure of phenyl ethanolamine N-methyl transferase (PNMT) gene and the SNP location therein. Accession No.: AC040933.3
Figure 192 shows a structure of histamine N-methyl transferase (HNMT) gene and the SNP location therein.
Accession No.: AC019304.3 Figure 193 shows a structure of nicotinamide N-methyl transferase (NNMT) gene and the SNP location therein. Accession No.: AC019290.3
Figure 194 shows a structure of phosphatidylethanolamine N-methyl transferase (PEMT) gene and the SNP location therein. Accession No.: AC020558.3 Figure 195 shows a structure of aldehyde dehydrogenase 1 family member Al (ALDH1A1) gene and the SNP location therein.
Accession No.: AC009284.2 and AL162416.3
Figure 196 shows a structure of aldehyde dehydrogenase 1 family member A2 (ALDH1A2) gene and the SNP location therein.
Accession No.: AC025431.7 and AC012653.8
Figure 197 shows a structure of aldehyde dehydrogenase 1 family member A3 (ALDH1A3) gene and the SNP location therein.
Accession No.: AC015712.7 Figure 198 shows a structure of aldehyde dehydrogenase 1 family member Bl
(ALDH1B1) gene and the SNP location therein.
Accession No.: AL135785.9
Figure 199 A shows a structure of formyl tetrahydrofolate dehydrogenase (ALDHILI) gene and the SNP location therein. Accession No.: AC079848.6
Figure 199B shows a structure of formyl tetrahydrofolate dehydrogenase (ALDHILI) gene and the SNP location therein, (continuation of Figure 199A)
Accession No.: AC079848.6
Figure 200 shows a structure of aldehyde dehydrogenase 2 (ALDH2) gene and the SNP location therein.
Accession No.: AC002996.1 and AC003029.2
Figure 201 shows a structure of aldehyde dehydrogenase 3 family member Al (ALDH3A1) gene and the SNP location therein.
Accession No.: AC005722.1 Figure 202 shows a structure of aldehyde dehydrogenase 3 family member A2
(ALDH3A2) gene and the SNP location therein.
Accession No.: AC005722.1
Figure 203 shows a structure of aldehyde dehydrogenase 3 family member B 1 (ALDH3B1) gene and the SNP location therein. Accession No.: AC004923.2 Figure 204 shows a structure of aldehyde dehydrogenase 3 family member B2 (ALDH3B2) gene and the SNP location therein.
Accession No.: AC021987.3
Figure 205 shows a structure of aldehyde dehydrogenase 5 family member Al (ALDH5A1) gene and the SNP location therein.
Accession No.: AL031230.1
Figure 206 shows a structure of aldehyde dehydrogenase 6 family member Al (ALDH6A1) gene and the SNP location therein.
Accession No.: AC005484.2 Figure 207 shows a structure of aldehyde dehydrogenase 8 family member Al
(ALDH8A1) gene and the SNP location therein.
Accession No.: AL445190.9 and AL021939.1
Figure 208 shows a structure of aldehyde dehydrogenase 9 family member Al (ALDH9A1) gene and the SNP location therein. Accession No.: AL451074.4
Figure 209 shows a structure of alcohol dehydrogenase 1 (ADHl) gene and the SNP location therein.
Accession No.: AP002027.1
Figure 210 shows a structure of alcohol dehydrogenase 2 (ADH2) gene and the SNP location therein.
Accession No.: AP002027.1
Figure 211 shows a structure of alcohol dehydrogenase 3 (ADH3) gene and the SNP location therein.
Accession No.: AP002027.1 Figure 212 shows a structure of alcohol dehydrogenase 4 (ADH4) gene and the SNP location therein.
Accession No.: AP002026.1
Figure 213 shows a structure of alcohol dehydrogenase 5 (ADH5) gene and the SNP location therein. Accession No.: AC019131.4 Figure 214 shows a structure of alcohol dehydrogenase 6 (ADH6) gene and the SNP location therein.
Accession No.: AP002026.1
Figure 215 shows a structure of alcohol dehydrogenase 7 (ADH7) gene and the SNP location therein.
Accession No.: AC027065.3
Figure 216 shows a structure of short-chain alcohol dehydrogenase family gene (HEP27) and the SNP location therein.
Accession No.: AL135999.3 Figure 217 shows a structure of UDP glycosyltransferase 1 family polypeptide Al
(UGT1A1) and the SNP location therein.
Accession No.: AC006985.2
Figure 218 shows a structure of UDP glycosyltransferase 2 family polypeptide Al (UGT2A1) and the SNP location therein. Accession No.: AC011254.3
Figure 219 shows a structure of UDP glycosyltransferase 2 family polypeptide B15 (UGT2B15) and the SNP location therein.
Accession No.: AC019173.4
Figure 220 shows a structure of UDP glycosyltransferase 8 (UGT8) and the SNP location therein.
Accession No.: U31353.1
Figure 221 shows a structure of glutathione S transferase Al (GSTA1) gene and the SNP location therein.
Accession No.: AC021133.4 Figure 222 shows a structure of glutathione S transferase A4 (GSTA4) gene and the
SNP location therein.
Accession No.: AC025085.4
Figure 223 shows a structure of glutathione S transferase Ml (GSTMl) gene and the SNP location therein. Accession No.: AC000032.7 Figure 224 shows a structure of glutathione S transferase M2 (GSTM2) gene and the SNP location therein.
Accession No.: AC000031.5
Figure 225 shows a structure of glutathione S transferase Zl (GSTZl) gene and the SNP location therein.
Accession No.: AC007954.7
Figure 226 shows a structure of glutathione S transferase Pi (GSTPi) gene and the SNP location therein.
Accession No.: X08058.1 and M24485.1 Figure 227 shows a structure of glutathione S transferase Tl (GSTTl) gene and the
SNP location therein.
Accession No.: AF240786.1 and AP000351.3
Figure 228 shows a structure of microsomal glutathione S transferase 1 (MGST1) gene and the SNP location therein. Accession No.: AC007528.5
Figure 229 shows a structure of microsomal glutathione S transferase 1-like 1 (MGST1L1) gene and the SNP location therein. Accession No.: AC007936.2
Figure 230 shows a structure of microsomal glutathione S transferase T2 (MGST2) gene and the SNP location therein. Accession No.: AC019049.4
Figure 231 shows a structure of microsomal glutathione S transferase T3 (MGST3) gene and the SNP location therein. Accession No.: AC064827.2 Figure 232 shows a structure of sulfotransferase 1 Al (SULT1 A1/STP1) gene and the SNP location therein. Accession No.: U52852.2
Figure 233 shows a structure of sulfotransferase 1A2 (SULT1A2/STP2) gene and the SNP location therein. Accession No.: U33886.1, U34804.1 and AC020765.5 Figure 234 shows a structure of sulfotransferase 1A3 (SULT1A3/STM/HAST) gene and the SNP location therein
Accession No.: L34160.1 and AC012645.4
Figure 235 shows a structure of sulfotransferase 1C1 (SULT1C1) gene and the SNP location therein.
Accession No.: AC019100.4
Figure 236 shows a structure of sulfotransferase 1C2 (SULT1C2) gene and the SNP location therein.
Accession No.: AF186263.1 Figure 237 shows a structure of sulfotransferase 2A1 (SULT2A1) gene and the SNP location therein.
Accession No.: AC024582.4, AC008745.5, NT 011190.1, and AC024582.4 Figure 238 shows a structure of sulfotransferase 2B1 (SULT2B1) gene and the SNP location therein. Accession No. : AC040922.2 and AC008403.6
Figure 239 shows a structure of sulfotransferase-associated protein 3 (SULTX3) gene and the SNP location therein. Accession No.: Z97055.1
Figure 240 shows a structure of tyrosyl protein sulfotransferase 1 (TPST1) gene and the SNP location therein.
Accession No.: AC026281.5
Figure 241 shows a structure of tyrosyl protein sulfotransferase 2 (TPST2) gene and the SNP location therein. Accession No.: Z95115.1 Figure 242 shows a structure of cerebroside sulfotransferase (CST) gene and the
SNP location therein.
Accession No.: AC005006.2
Figure 243 shows a structure of thyroid hormone sulfotransferase (ST1B2) gene and the SNP location therein. Accession No.: AC027059.2 Figure 244 shows a structure of carbohydorate sulfotransferase 1 (CHSTl) gene and the SNP location therein.
Accession No.: NT 008982.1
Figure 245 shows a structure of carbohydorate sulfotransferase 2 (CHST2) gene and the SNP location therein.
Accession No.: AC055737.10
Figure 246 shows a structure of carbohydorate sulfotransferase 3 (CHST3) gene and the SNP location therein.
Accession No.: AC073370.3 Figure 247 shows a structure of carbohydorate sulfotransferase 4 (CHST4) gene and the SNP location therein.
Accession No.: AC010547.5
Figure 248 shows a structure of carbohydorate sulfotransferase 5 (CHST5) gene and the SNP location therein. Accession No.: AC025287.3
Figure 249 shows a structure of HNK-sulfotransferase (HNK- 1ST) gene and the SNP location therein.
Accession No.: AC012493.4
Figure 250 shows a structure of estrogen sulfotransferase (STE) gene and the SNP location therein.
Accession No.: AC074273.1
Figure 251 shows a structure of NAD (P)H: quinone oxidoreductase 1 (NQOl) gene and the SNP location therein.
Accession No.: M81596.1 Figure 252 shows a structure of NRH: quinone oxidoreductase 2 (NQO2) gene and the SNP location therein.
Accession No.: AB050248.1
Figure 253 shows a structure of p53-inducible gene 3 (PIG3) in a quinone oxidoreductase homolog and the SNP location therein. Accession No.: AC008073.3 Figure 254 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex 1 (NDUFA1) gene and the SNP location therein. Accession No.: AC002477.1
Figure 255 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex 2 (NDUFA2) gene and the SNP location therein. Accession No.: AB054976.1
Figure 256 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex 3 (NDUFA3) gene and the SNP location therein. Accession No.: AC009968.6 Figure 257 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex
5 (NDUFA5) gene and the SNP location therein.
Accession No.: AC073323.5
Figure 258 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex
6 (NDUFA6) gene and the SNP location therein. Accession No.: AL021878.1
Figure 259 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex
7 (NDUFA7) gene and the SNP location therein.
Accession No.: AC010323.6
Figure 260 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex 8 (NDUFA8) gene and the SNP location therein. Accession No.: AL162423.10 Figure 261 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex
9 (NDUFA9) gene and the SNP location therein.
Accession No.: AC005832.1 Figure 262 shows a structure of NADH-dehydrogenase(ubiquinone)lα-subcomplex
10 (NDUFA10) gene and the SNP location therein.
Accession No.: AC013469.8
Figure 263 shows a structure of NADH-dehydrogenase(ubiquinone)lα/β- subcomplex 1 (NDUFAB1) gene and the SNP location therein. Accession No.: AC008870.6 Figure 264 shows a structure of NADH-dehydrogenase(ubiquinone)lβ-subcomplex 3 (NDUFB3) gene and the SNP location therein.
Accession No.: AC007272.3
Figure 265 shows a structure of NADH-dehydrogenase(ubiquinone)lβ-subcomplex 5 (NDUFB5) gene and the SNP location therein.
Accession No.: AC068361.2
Figure 266 shows a structure of NADH-dehydrogenase(ubiquinone)lβ-subcomplex 7 (NDUFB7) gene and the SNP location therein.
Accession No.: AC010527.4 Figure 267 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 1
(NDUFS1) gene and the SNP location therein.
Accession No.: AC007383.4
Figure 268 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 3 (NDUFS3) gene and the SNP location therein. Accession No.: AC067943.4
Figure 269 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 4 (NDUFS4) gene and the SNP location therein.
Accession No.: AC024569.3
Figure 270 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 5 (NDUFS5) gene and the SNP location therein.
Accession No.: AL139015.5
Figure 271 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 6 (NDUFS6) gene and the SNP location therein.
Accession No.: AC026443.2 Figure 272 shows a structure of NADH-dehydrogenase(ubiquinone)Fe-S protein 8
(NDUFS8) gene and the SNP location therein.
Accession No.: AC034259.2
Figure 273 shows a structure of NADH-dehydrogenase(ubiquinone)flavoprotein 1 (NDUFV1) gene and the SNP location therein. Accession No.: NT.009304.2 Figure 274 shows a structure of NADH-dehydrogenase(ubiquinone)flavoprotein 2 (NDUFV2) gene and the SNP location therein. Accession No.: NT.011024.2
Figure 275 shows a structure of NADH-dehydrogenase(ubiquinone)flavoprotein 3 (NDUFV3) gene and the SNP location therein. Accession No.: AP001748.1
Figure 276 shows a structure of gamma-glutamyl transferase 1 (GGTl) gene and the SNP location therein.
Accession No.: D87002.1 Figure 277 shows a structure of transglutaminase 1 (TGM1) gene and the SNP location therein.
Accession No.: M98447.1
Figure 278 shows a structure of cytochrome P450 subfamily 1 (aromatic compound- inducible) polypeptide 1 (CYP1A1) gene and the SNP location therein. Accession No.: X04300.1 and AC020705.4
Figure 279 shows a structure of cytochrome P450 subfamily 1 (aromatic compound- inducible) polypeptide 2 (CYP1A2) gene and the SNP location therein. Accession No.: AC020705.4
Figure 280 shows a structure of cytochrome P450 subfamily 1 (dioxin-inducible) polypeptide 1 (CYP1B1) gene and the SNP location therein. Accession No.: AC009229.4
Figure 281 shows a structure of cytochrome P450 subfamily 3 A (aromatic compound-inducible) polypeptide 4 (CYP3A4) gene and the SNP location therein. Accession No.: AF280107.1 Figure 282 shows a structure of cytochrome P450 subfamily 3A (aromatic compound-inducible) polypeptide 5 (CYP3A5) gene and the SNP location therein. Accession No.: AC005020.5
Figure 283 shows a structure of cytochrome P450 subfamily 3 A polypeptide 7 (CYP3A7) gene and the SNP location therein. Accession No. : AF280107.1 Figure 284 shows a structure of cytochrome P450 polypeptide 43 (CYP3 A43) gene and the SNP location therein.
Accession No.: AC011904.3
Figure 285 shows a structure of cytochrome P450 subfamily IVB polypeptide 1 (CYP4B 1) gene and the SNP location therein.
Accession No.: AL356793.10
Figure 286 shows a structure of cytochrome P450 subfamily IVF polypeptide 2 (CYP4F2) gene and the SNP location therein.
Accession No.: AC005336.1 Figure 287 shows a structure of cytochrome P450 subfamily IVF polypeptide 3
(CYP4F3) gene and the SNP location therein.
Accession No.: AD000685.1
Figure 288 shows a structure of cytochrome P450 subfamily IVF polypeptide 8 (CYP4F8) gene and the SNP location therein. Accession No.: AC068845.3
Figure 289 shows a structure of cytochrome P450 subfamily XXVIIA polypeptide 1 (CYP27A1) gene and the SNP location therein.
Accession No.: AC009974.7
Figure 290 shows a structure of cytochrome P450 subfamily XXVIIB polypeptide 1 (C YP27B 1 ) gene and the SNP location therein .
Accession No.: AC025165.27
Figure 291 shows a structure of allylacetamide deacetylase (AADAC) gene and the SNP location therein.
Accession No.: AC068647.4 Figure 292 shows a structure of carboxyl esterase 1 (CES1) gene and the SNP location therein
Accession No.: AC007602.4
Figure 293 shows a structure of carboxyl esterase 2 (CES2) gene and the SNP location therein Accession No.: AC027131.4 Figure 294 shows a structure of granzyme A (GZMA) gene and the SNP location therein.
Accession No.: AC091977.1
Figure 295 shows a structure of granzyme B (GZMB) gene and the SNP location therein.
Accession No.: AL136018.3
Figure 296 shows a structure of esterase D/formylglutathione hydrolase (ESD) gene and the SNP location therein.
Accession No.: AL136958.9 Figure 297 A shows a structure of carboxyl ester lipase (bile salt-stimulated lipase)
(CEL) gene and the SNP location therein.
Accession No.: AL138750.8, AL162417.20 and AF072711.1
Figure 297B shows a structure of carboxyl ester lipase (bile salt-stimulated lipase) (CEL) gene and the SNP location therein, (continuation of Figure 297 A) Accession No.: AL138750. , AL162417.20 and AF072711.1
Figure 298 shows a structure of interleukin 17 (cytotoxic T lymphocyte-associated serine esterase 8) (IL17) gene and the SNP location therein.
Accession No.: AL355513.il
Figure 299 shows a structure of ubiquitin carboxyl terminal esterase L3 (ubiquitin thiol esterase) (UCHL3) gene and the SNP location therein.
Accession No.: AL137244.28
Figure 300 shows a structure of dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST) gene and the SNP location therein.
Accession No.: D89060 Figure 301 shows a structure of neuropathy target esterase (NTE) gene and the SNP location therein.
Accession No.: AC021153
Figure 302 shows a structure of LI cell adhesion molecule (LI CAM) gene and the SNP location therein. Accession No. : U52112 Figure 303 shows a structure of arylalkylamine N-acetyltransferase (AANAT) gene and the SNP location therein. Accession No.: U40391
Figure 304 shows a structure of N-acetyltransferase homolog (ARD1) gene of Saccharomyces cerevisiae and the SNP location therein. Accession No.: U52112
Figure 305 shows a structure of N-acetyltransferase (NAT 1) gene and the SNP location therein.
Accession No.: X17059 Figure 306 shows a structure of N-acetyltransferase 2 (NAT2) gene and the SNP location therein.
Accession No.: D10870
Figure 307 shows a structure of ATP-binding cassette subfamily B member 2 (ABCB2) gene and the SNP location therein. Accession No.: X66401
Figure 308 shows a structure of ATP-binding cassette subfamily B member 3 (ABCB3) gene and the SNP location therein. Accession No.: X66401
Figure 309 shows a structure of glutathione S transferase M3 (GSTM3) gene and the SNP location therein.
Accession No.: AF043105.1
Figure 310 shows a structure of glutathione S transferase M4 (GSTM4) gene and the SNP location therein.
Accession No.: M96233.1 Figure 311 shows a structure of aldehyde dehydrogenase 7 (ALDH7) gene and the
SNP location therein.
Accession No.: AC004923
Figure 312 shows a structure of high-mobility group protein 17-like 1 (HMG17L1) gene and the SNP location therein. Accession No.: Z97055.1 GENERAL DESCRIPTION OF THE INVENTION
The present invention provides a method of analysis of drug metabolizing enzymes by analysis of SNPs associated with their encoding genes. In some embodiments, the method of the present invention can be used in the selection of drugs based on, e.g., particular characteristics of an individual patient or on characteristics of a target disease.
In some embodiments, the present invention provides a method for detecting a genetic polymoφhism associated with a DME, wherein an oligonucleotide probe and/or oligonucleotide primer is created so as to include the genetic polymoφhism site from genetic polymoφhism data in a gene for encoding a drug metabolizing enzyme or so as to include the genetic polymoφhism site in an amplified fragment when the gene encoding the drug metabolizing enzyme has been amplified, and wherein at least one genetic polymoφhism in a gene for encoding the target drug metabolizing enzyme is detected using the oligonucleotide probe and/or oligonucleotide primer thus obtained. The present invention further provides methods for evaluating a drug, wherein the effectiveness and safety of a drug metabolized by the drug metabolizing enzyme are evaluated based on the results obtained by the detection method.
In some embodiments, the present invention provides a method for screening a drug, wherein the drug to be used is selected based on the results obtained in the evaluation method. In other embodiments, the present invention provides a method for screening a drug, wherein the genetic polymoφhism data associated with the gene encoding a DME in a control subject is compared to the genetic polymoφhism data associated with the same gene in a test subject, and wherein a drug to be used is selected from the results of an analysis of the effectiveness and/or safety of the drugs metabolized by the drug metabolizing enzyme.
The invention further features predictive medicines, which are based, at least in part, on determination of the identity of DME polymoφhic regions that are associated with particular drug responses. For example, information obtained using the diagnostic assays described herein (alone or in conjunction with information on another genetic defect, which contributes to the same disease) is useful for determining if a test subject has an allele of a polymoφhic region that is associated with a particular drug response. Knowledge of the DME profile in an individual (the DME genetic profile), alone or in conjunction with information on other genetic defects contributing to the same disease (the genetic profile of the particular disease) allows customization of therapy for a particular disease to the individual's genetic profile, the goal of "pharmacogenomics." For example, an individual's DME genetic profile can enable a doctor: 1) to more effectively prescribe a drug that will address the molecular basis of the disease or condition; and 2) to better determine the appropriate dosage of a particular drug.
The ability to target populations expected to show the highest clinical benefit, based on the DME genetic profile, allows: 1) the repositioning of marketed drugs with disappointing market results; 2) the rescue of drug candidates whose clinical development has been discontinued as a result of safety or efficacy limitations, which are patient subgroup-specific; and 3) an accelerated and less costly development for drug candidates and more optimal drug labeling (e.g. since the use of DMEs as markers is useful for optimizing effective dose).
DETAILED DESCRIPTION OF THE INVENTION
Examples of genetic polymoφhism data related to a DME, and useful in the detection, evaluation method and screening methods of the present invention are shown in Table 1. In some embodiments, a drug-metabolizing enzyme is at least one of the following: epoxide hydrolase, methyltransferase, N-acetyltransferase, sulfotransferase, quinone oxidereductase, glutathione S-transferase, UDP-glycosyltransferase, aldehyde dehydrogenase, alcohol dehydrogenase, esterase, NDUF, cytochrome P450 (CYP) and ATP-binding cassette.
The present invention relates to a method for detecting a genetic polymoφhism in a test subject using the genetic polymoφhism data related to a drug metabolizing enzyme. The present invention analyzes the effectiveness, safety and strength of drugs metabolized by a drug metabolizing enzyme. The relationship between a disease and the drug to be evaluated is based on the results of the analysis. The genetic polymoφhism data for the drug metabolizing enzyme is different for each patient with a given disease. Therefore, the effectiveness and safety of a specific drug depends on drug metabolism in the presence of certain genetic polymoφhism data and the side effects in the presence of certain genetic polymoφhism data. As a result, a physician can determine whether a certain drug should be used by a certain patient and can tailor drugs for use by a certain patient based on the genetic polymoφhism data (so-called "made-to-order" treatments).
"Drug metabolizing enzymes" refer to a group of enzymes that catalyze in vivo structural changes in exogenous materials including drugs. When used for clinical puφoses, the group of metabolizing enzymes includes some endogenous materials. Because drug-metabolizing enzymes absorb, metabolize and secrete drugs, the polymoφhism of an enzyme depends on the amount of enzyme expressed (transcription and translation) and the amount of activity. As a result, there are blood serum concentrations of both unchanged materials and metabolites.
Drug metabolizing enzymes expressed by the genes that are targeted for genetic polymoφhism analysis in the present invention include, but are not limited to the following classes of enzymes:
Epoxide hydrolases Methyltransferases
N-acetyltransferases
Sulfotransferases
Quinone oxidereductases
Glutathione S-transferases UDP-glycosyltransferases
Aldehyde dehydrogenases
Alcohol dehydrogenases
Esterases
Ubiquinone dehydrogenases : NDUF Cytochrome P450s (CYPs)
ATP-binding cassettes
ATP-binding cassettes / Transporters
Examples and descriptions of these enzymes are provided below. (1) Epoxide hydrolases are enzymes that hydrolyze epoxide using a trans- cleavage mechanism to produce 1,2-glycol. Examples include microsomal epoxide hydrolase 1 and cytoplasmic epoxide hydrolase 2.
(2) Methyltransferases are enzymes that catalyze transmethylation in amino groups, hydroxyl groups and thiol groups. Examples include the following. Catechol-O-methyltransferase Vitamin-N-methyltransferase Phenylethanolamine-N-methyltransferase Phosphatidylethanolamine-N-methyltransferase
Nicotinamide-N-methyltransferase Acetylserotonin-O-methyltransferase Thiopurine S-methyltransferase
(3) N-acetyltransferases are enzymes that catalyze transacetylation in amino groups, sulfonamide groups and hydrazine groups. Examples include the following.
Arylamine-N-acetyltransferase 1, 2
Arylalkylamine-N-acetyltransferase
N-acetyltransferase homologues of saccharomyces cerevisiae LI intracellular adhesion molecules
(4) Sulfotransferases are enzymes that contribute to sulfate conjugation and catalyzes trans-sulfonylation in phenols, steroids, arylamines and biliary acid. Examples include the following. Sulfotransferase 1A1, 1A2, 1A3, 1C1, 1C2, 2A1, 2B1
Thyroid hormone sulfotransferase
Tyrosyl protein sulfotransferase 1, 2
Sulfotransferase-opening protein 3
Estrogen sulfotransferase Cerebroside sulfotransferase
HNK-sulfotransferase 1 Carbohydrate sulfotransferase 2, 4, 5 Carbohydrate sulfotransferase 1, 3
(5) Quinone oxidereductases are enzymes that catalyze the reduction of quinones such as o-quinone and p-quinone. Examples include the following.
NAD(P)H: Quinone oxidereductase 1 NRH: Quinone oxidereductase 2 Quinone oxidereductase homologues p53-induced gene 3 (PIG3) of a quinone oxide transferase homologue
(6) Glutathione S-transferases are enzymes that catalyze the conjugation of glutathione. Examples include the following.
Glutathione S-transferase Mul, Mu2, Mu3, Mu4, Mu5
Glutathione S-transferase Z (zeta) Glutathione S-transferase P (pi)
Glutathione S-transferase 1 Tl (zeta)
Glutathione S-transferase 1 Theta 1, Theta 2
Microsomal Glutathione S-transferase 1
Microsomal Glutathione S-transferase 1-1 Microsomal Glutathione S-transferase 2, 3
Microsomal Glutathione S-transferase Ha Subunit 1 , 2
Microsomal Glutathione S-transferase A3, A4
Glutathione S-transferase Al, A4
Glutathione S-transferase Ml, M2, M3, M4
(7) UDP-glycosyltransferases are enzymes that catalyze the contribution of glucuronic acid to functional groups such as hydroxyl groups, carboxyl groups, amino groups and thiol groups after their introduction in the 1st drug metabolism route. Examples include the following. UDP-glycosyltransferase 1
UDP-glycosyltransferase 1 Family Polypeptide Al UDP-glycosyltransferase 2 Family Polypeptide Al, B7, BIO, B4, Bl l, B15, B17 UDP-glycosyltransferase 8 Dolichyl-diP-oligosaccharide protein glycosyl transferase
(8) Aldehyde dehydrogenases are enzyme that converts aldehydes into carboxylic acids. Examples include Aldehyde dehydrogenase 1 through 10.
Aldehyde dehydrogenase 1 family member Al, A2, A3
Aldehyde dehydrogenase 1 family member B 1
Formyltetrahydroforate dehydrogenase Aldehyde dehydrogenase 2
Aldehyde dehydrogenase 3 family member Al, A2
Aldehyde dehydrogenase 3 family member Bl, B2
Aldehyde dehydrogenase 5 family member Al
Aldehyde dehydrogenase 6 family member A 1 Aldehyde dehydrogenase 8 family member Al
Aldehyde dehydrogenase 9 family member Al
(9) Alcohol dehydrogenases are enzymes that convert alcohols into aldehydes or ketones. Examples include the following. Alcohol dehydrogenase 1 through 7
Hydroxy-CoA-dehydrogenase Short-chain alcohol dehydrogenase family genes
(10) Esterases are enzymes that hydrolyze some esters. Examples include the following.
Arylacetoamide deacetylase Granzyme A Granzyme B Interleukin 17 Ubiquitin carboxyl-terminal esterase LI, 3
Carboxyl esterase 1 Lipase A
Esterase D-formylglutathione hydrolase Carboxylester lipase
Dolichyl-diphosphooligosaccharide-protein glycosyltransferase (DDOST) Neuropathy target esterase
(11) Ubiquinone dehydrogenases (NDUF) are enzymes that support energy metabolism, e.g., as in the mitochondrial respiratory chain. Examples include NADH ubiquinone dehydrogenase la Subunit 1 through 10. NADH-dehydrogenase (ubiquinone) l -subcomplex 1 through 3 and 5 through 10
NADH-dehydrogenase (ubiquinone) loc/β-subcomplex 1 NADH-dehydrogenase (ubiquinone) lβ -subcomplex 3, 5, 7 NADH-dehydrogenase (ubiquinone) Fe-S protein 1, 3, 4, 5, 6, 8 NADH-dehydrogenase (ubiquinone) flavoprotein 1 through 3
(12) Cytochrome P450s (CYPs) are enzymes that regulate 1st drug metabolism and introduce oxygen atoms to the drug. Examples include Cytochrome P450 (CYP) 1A1, CYP 1A2, CYPIBI, CYP 2A6, CYP 2B6, CYP 2C8, CYP 2C18, CYP 2C9, CYP 2C19, CYP 2E1, CYP 2D6, CYP 2E1, CYP 2F1, CYP 3A3, CYP 3A4, CYP 3A5, CYP 3A7, CYP 3A43, CYP 4A11, CYP 4B1, CYP 4F2, CYP 4F3, CYP 4F8, CYP 1 IBl, CYP 11B2, CYP 17, CYP 19, CYP 21 A2, CYP 21 Al, CYP 27B1 and CYP 27.
(13) ATP-binding cassettes absorb the drug and adjust the interstitial concentration with a transporter. Examples include the following. ATP-Binding Cassette Subfamily A Members 1 through 6, 8
ATP-Binding Cassette Subfamily A Members 1, 4, 7, 8 ATP-Binding Cassette Subfamily B Members 1 through 11 ATP-Binding Cassette Subfamily B Members 1, 4, 7, 8, 9, 10, 11 ATP-Binding Cassette Subfamily C Members 1 through 6, 8 through 10 ATP-Binding Cassette Subfamily C Members 1, 2, 3, 4, 5, 7, 8, 9
ATP-Binding Cassette Subfamily D Members 1 through 4 ATP-Binding Cassette Subfamily D Members 1, 3, 4
ATP-Binding Cassette Subfamily E Members 1
ATP-Binding Cassette Subfamily F Members 1 through 3
ATP-Binding Cassette Subfamily F Member 1 ATP-Binding Cassette Subfamily G Members 1
ATP-Binding Cassette Subfamily G Members 1, 2, 4, 8
Organic anion transporters 1 , 2, 3
Organic anion transporter polypeptides 1, 2, 8
Transporter 1 ATP-binding cassette subfamily B Transporter 2 ATP-binding cassette subfamily B
SLC22A4 solute carrier family 22 (organic cation transporter) member 4
SLC22A5 solute carrier family 22 (organic cation transporter) member 5
SLC22A1 solute carrier family 22 (organic cation transporter) member 1
SLC22A2 solute carrier family 22 (organic cation transporter) member 2 SLC10A2 solute carrier family 10 (sodium/bile acid cotransporter family) member 2
SLC15A1 solute carrier family 15 (oligopeptide transporter) member 1
(14) Other enzymes include gamma glutamyl transferase 1, transglutaminase 1 and dihydropyrimidine dihydrogenase.
Genetic polymoφhism data relating to DMEs can be obtained using any general genetic polymoφhism detection method. Examples include, but are not limited to, PCR or other amplification methods, hybridization methods using an allele-specific oligonucleotide matrix (e.g., TAQMAN PCR method, INVADER assay method), primer extension reaction methods, sequencing methods, MALDI-TOF/MS methods and the DNA chip methods (e.g., microarrays). Examples of detection methods that are applicable to analysis of the DME associated polymoφhisms of the present invention include but are not limited to those listed below. 1. Direct sequencing Assays
In some embodiments of the present invention, variant sequences are detected using a direct sequencing technique. In these assays, DNA samples are first isolated from a subject using any suitable method. In some embodiments, the region of interest is cloned into a suitable vector and amplified by growth in a host cell (e.g., a bacteria). In other embodiments, DNA in the region of interest is amplified using PCR.
Following amplification, DNA in the region of interest (e.g., the region containing the SNP or mutation of interest) is sequenced using any suitable method, including but not limited to manual sequencing using radioactive marker nucleotides, or automated sequencing. The results of the sequencing are displayed using any suitable method. The sequence is examined and the presence or absence of a given SNP or mutation is determined.
2. PCR Assay In some embodiments of the present invention, variant sequences are detected using a PCR-based assay. In some embodiments, the PCR assay comprises the use of oligonucleotide primers that hybridize only to the variant or wild type allele (e.g., to the region of polymoφhism or mutation). Both sets of primers are used to amplify a sample of DNA. If only the mutant primers result in a PCR product, then the patient has the mutant allele. If only the wild-type primers result in a PCR product, then the patient has the wild type allele.
3. Fragment Length Polymorphism Assays
In some embodiments of the present invention, variant sequences are detected using a fragment length polymoφhism assay. In a fragment length polymoφhism assay, a unique DNA banding pattern based on cleaving the DNA at a series of positions is generated using an enzyme (e.g., a restriction enzyme or a CLEAVASE I [Third Wave Technologies, Madison, WI] enzyme). DNA fragments from a sample containing a SNP or a mutation will have a different banding pattern than wild type. a. RFLP Assay
In some embodiments of the present invention, variant sequences are detected using a restriction fragment length polymoφhism assay (RFLP). The region of interest is first isolated using PCR. The PCR products are then cleaved with restriction enzymes known to give a unique length fragment for a given polymoφhism. The restriction- enzyme digested PCR products are generally separated by gel electrophoresis and may be visualized by ethidium bromide staining. The length of the fragments is compared to molecular weight markers and fragments generated from wild-type and mutant controls.
b. CFLP Assay
In other embodiments, variant sequences are detected using a CLEAVASE fragment length polymoφhism assay (CFLP; Third Wave Technologies, Madison, WI; See e.g., U.S. Patent Nos. 5,843,654; 5,843,669; 5,719,208; and 5,888,780; each of which is herein incoφorated by reference). This assay is based on the observation that when single strands of DNA fold on themselves, they assume higher order structures that are highly individual to the precise sequence of the DNA molecule. These secondary structures involve partially duplexed regions of DNA such that single stranded regions are juxtaposed with double stranded DNA haiφins. The CLEAVASE I enzyme, is a structure-specific, thermostable nuclease that recognizes and cleaves the junctions between these single-stranded and double-stranded regions.
The region of interest is first isolated, for example, using PCR. In preferred embodiments, one or both strands are labeled. Then, DNA strands are separated by heating. Next, the reactions are cooled to allow intrastrand secondary structure to form. The PCR products are then treated with the CLEAVASE I enzyme to generate a series of fragments that are unique to a given SNP or mutation. The CLEAVASE enzyme treated PCR products are separated and detected (e.g., by denaturing gel electrophoresis) and visualized (e.g., by autoradiography, fluorescence imaging or staining). The length of the fragments is compared to molecular weight markers and fragments generated from wild- type and mutant controls. 4. Hybridization Assays In preferred embodiments of the present invention, variant sequences are detected a hybridization assay. In a hybridization assay, the presence of absence of a given SNP or mutation is determined based on the ability of the DNA from the sample to hybridize to a complementary DNA molecule (e.g., a oligonucleotide probe). A variety of hybridization assays using a variety of technologies for hybridization and detection are available. A description of a selection of assays is provided below.
a. Direct Detection of Hybridization In some embodiments, hybridization of a probe to the sequence of interest (e.g., a
SNP or mutation) is detected directly by visualizing a bound probe (e.g., a Northern or Southern assay; See e.g., Ausabel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY [1991]). In a these assays, genomic DNA (Southern) or RNA (Northern) is isolated from a subject. The DNA or RNA is then cleaved with a series of restriction enzymes that cleave infrequently in the genome and not near any of the markers being assayed. The DNA or RNA is then separated (e.g., on an agarose gel) and transferred to a membrane. A labeled (e.g., by incoφorating a radionucleotide) probe or probes specific for the SNP or mutation being detected is allowed to contact the membrane under a condition or low, medium, or high stringency conditions. Unbound probe is removed and the presence of binding is detected by visualizing the labeled probe.
b. Detection of Hybridization Using "DNA Chip" Assays
In some embodiments of the present invention, variant sequences are detected using a DNA chip hybridization assay. In this assay, a series of oligonucleotide probes are affixed to a solid support. The oligonucleotide probes are designed to be unique to a given SNP or mutation. The DNA sample of interest is contacted with the DNA "chip" and hybridization is detected.
In some embodiments, the DNA chip assay is a GeneChip (Affymetrix, Santa Clara, CA; See e.g., U.S. Patent Nos. 6,045,996; 5,925,525; and 5,858,659; each of which is herein incoφorated by reference) assay. The GeneChip technology uses miniaturized, high-density arrays of oligonucleotide probes affixed to a "chip." Probe arrays are manufactured by Affymetrix's light-directed chemical synthesis process, which combines solid-phase chemical synthesis with photolithographic fabrication techniques employed in the semiconductor industry. Using a series of photolithographic masks to define chip exposure sites, followed by specific chemical synthesis steps, the process constructs high-density arrays of oligonucleotides, with each probe in a predefined position in the array. Multiple probe arrays are synthesized simultaneously on a large glass wafer. The wafers are then diced, and individual probe arrays are packaged in injection-molded plastic cartridges, which protect them from the environment and serve as chambers for hybridization. The nucleic acid to be analyzed is isolated, amplified by PCR, and labeled with a fluorescent reporter group. The labeled DNA is then incubated with the array using a fluidics station. The array is then inserted into the scanner, where patterns of hybridization are detected. The hybridization data are collected as light emitted from the fluorescent reporter groups already incoφorated into the target, which is bound to the probe array. Probes that perfectly match the target generally produce stronger signals than those that have mismatches. Since the sequence and position of each probe on the array are known, by complementarity, the identity of the target nucleic acid applied to the probe array can be determined.
In other embodiments, a DNA microchip containing electronically captured probes (Nanogen, San Diego, CA) is utilized (See e.g., U.S. Patent Nos. 6,017,696;
6,068,818; and 6,051,380; each of which are herein incoφorated by reference). Through the use of microelectronics, Nanogen's technology enables the active movement and concentration of charged molecules to and from designated test sites on its semiconductor microchip. DNA capture probes unique to a given SNP or mutation are electronically placed at, or "addressed" to, specific sites on the microchip. Since DNA has a strong negative charge, it can be electronically moved to an area of positive charge.
First, a test site or a row of test sites on the microchip is electronically activated with a positive charge. Next, a solution containing the DNA probes is introduced onto the microchip. The negatively charged probes rapidly move to the positively charged sites, where they concentrate and are chemically bound to a site on the microchip. The microchip is then washed and another solution of distinct DNA probes is added until the array of specifically bound DNA probes is complete.
A test sample is then analyzed for the presence of target DNA molecules by determining which of the DNA capture probes hybridize, with complementary DNA in the test sample (e.g., a PCR amplified gene of interest). An electronic charge is also used to move and concentrate target molecules to one or more test sites on the microchip. The electronic concentration of sample DNA at each test site promotes rapid hybridization of sample DNA with complementary capture probes O ybridization may occur in minutes). To remove any unbound or nonspecifically bound DNA from each site, the polarity or charge of the site is reversed to negative, thereby forcing any unbound or nonspecifically bound DNA back into solution away from the capture probes. A laser-based fluorescence scanner is used to detect binding,
In still further embodiments, an array technology based upon the segregation of fluids on a flat surface (chip) by differences in surface tension (ProtoGene, Palo Alto, CA) is utilized (See e.g., U.S. Patent Nos. 6,001,311; 5,985,551; and 5,474,796; each of which is herein incoφorated by reference). Protogene's technology is based on the fact that fluids can be segregated on a flat surface by differences in surface tension that have been imparted by chemical coatings. Once so segregated, oligonucleotide probes are synthesized directly on the chip by ink-jet printing of reagents. The array with its reaction sites defined by surface tension is mounted on a X/Y translation stage under a set of four piezoelectric nozzles, one for each of the four standard DNA bases. The translation stage moves along each of the rows of the array and the appropriate reagent is delivered to each of the reaction site. For example, the A amidite is delivered only to the sites where amidite A is to be coupled during that synthesis step and so on. Common reagents and washes are delivered by flooding the entire surface and then removing them by spinning.
DNA probes unique for the SNP or mutation of interest are affixed to the chip using Protogene's technology. The chip is then contacted with the PCR-amplified genes of interest. Following hybridization, unbound DNA is removed and hybridization is detected using any suitable method (e.g., by fluorescence de-quenching of an incoφorated fluorescent group). In yet other embodiments, a "bead array" is used for the detection of polymoφhisms (Hlumina, San Diego, CA; See e.g., PCT Publications WO 99/67641 and WO 00/39587, each of which is herein incoφorated by reference), niumina uses a BEAD ARRAY technology that combines fiber optic bundles and beads that self-assemble into an array. Each fiber optic bundle contains thousands to millions of individual fibers depending on the diameter of the bundle. The beads are coated with an oligonucleotide specific for the detection of a given SNP or mutation. Batches of beads are combined to form a pool specific to the array. To perform an assay, the BEAD ARRAY is contacted with a prepared subject sample (e.g., DNA). Hybridization is detected using any suitable method.
c. Enzymatic Detection of Hybridization
In some embodiments of the present invention, hybridization is detected by enzymatic cleavage of specific structures (INVADER assay, Third Wave Technologies; See e.g., U.S. Patent Nos. 5,846,717, 6,090,543; 6,001,567; 5,985,557; and 5,994,069; each of which is herein incoφorated by reference). The INVADER assay detects specific DNA and RNA sequences by using structure-specific enzymes to cleave a complex formed by the hybridization of overlapping oligonucleotide probes. Elevated temperature and an excess of one of the probes enable multiple probes to be cleaved for each target sequence present without temperature cycling. These cleaved probes then direct cleavage of a second labeled probe. The secondary probe oligonucleotide can be 5'-end labeled with a fluorescent dye that is quenched by a second dye or other quenching moiety. Upon cleavage, the de-quenched dye-labeled product may be detected using a standard fluorescence plate reader, or an instrument configured to collect fluorescence data during the course of the reaction (i.e., a "real-time" fluorescence detector, such as an ABI 7700 Sequence Detection System, Applied Biosystems, Foster City, CA).
The INVADER assay detects specific mutations and SNPs in unamplified genomic DNA. In an embodiment of the INVADER assay used for detecting SNPs in genomic DNA, two oligonucleotides (a primary probe specific either for a SNP/mutation or wild type sequence, and an INVADER oligonucleotide) hybridize in tandem to the genomic DNA to form an overlapping structure. A structure-specific nuclease enzyme recognizes this overlapping structure and cleaves the primary probe. In a secondary reaction, cleaved primary probe combines with a fluorescence-labeled secondary probe to create another overlapping structure that is cleaved by the enzyme. The initial and secondary reactions can run concurrently in the same vessel. Cleavage of the secondary probe is detected by using a fluorescence detector, as described above. The signal of the test sample may be compared to known positive and negative controls.
In some embodiments, hybridization of a bound probe is detected using a TAQMAN assay (PE Biosystems, Foster City, CA; See e.g., U.S. Patent Nos. 5,962,233 and 5,538,848, each of which is herein incoφorated by reference). The assay is performed during a PCR reaction. The TAQMAN assay exploits the 5'-3' exonuclease activity of DNA polymerases such as AMPLITAQ DNA polymerase. A probe, specific for a given allele or mutation, is included in the PCR reaction. The probe consists of an oligonucleotide with a 5'-reporter dye (e.g., a fluorescent dye) and a 3'-quencher dye. During PCR, if the probe is bound to its target, the 5'-3' nucleolytic activity of the AMPLITAQ polymerase cleaves the probe between the reporter and the quencher dye. The separation of the reporter dye from the quencher dye results in an increase of fluorescence. The signal accumulates with each cycle of PCR and -can be monitored with a fluorimeter.
In still further embodiments, polymoφhisms are detected using the SNP-IT primer extension assay (Orchid Biosciences, Princeton, NJ; See e.g., U.S. Patent Nos. 5,952,174 and 5,919,626, each of which is herein incoφorated by reference). In this assay, SNPs are identified by using a specially synthesized DNA primer and a DNA polymerase to selectively extend the DNA chain by one base at the suspected SNP location. DNA in the region of interest is amplified and denatured. Polymerase reactions are then performed using miniaturized systems called microfluidics. Detection is accomplished by adding a label to the nucleotide suspected of being at the SNP or mutation location. I coφoration of the label into the DNA can be detected by any suitable method (e.g., if the nucleotide contains a biotin label, detection is via a fluorescently labelled antibody specific for biotin). 5. Other Detection Assays Additional detection assays that are produced and utilized using the systems and methods of the present invention include, but are not limited to, enzyme mismatch cleavage methods (e.g., Variagenics, U.S. Pat. Nos. 6,110,684, 5,958,692, 5,851,770, herein incoφorated by reference in their entireties); polymerase chain reaction; branched hybridization methods (e.g., Chiron, U.S. Pat. Nos. 5,849,481, 5,710,264, 5,124,246, and 5,624,802, herein incoφorated by reference in their entireties); rolling circle replication (e.g., U.S. Pat. Nos. 6,210,884 and 6,183,960, herein incoφorated by reference in their entireties); NASBA (e.g., U.S. Pat. No. 5,409,818, herein incoφorated by reference in its entirety); molecular beacon technology (e.g., U.S. Pat. No. 6,150,097, herein incoφorated by reference in its entirety); E-sensor technology (Motorola, U.S. Pat. Nos. 6,248,229, 6,221,583, 6,013,170, and 6,063,573, herein incoφorated by reference in their entireties); cycling probe technology (e.g., U.S. Pat. Nos. 5,403,711, 5,011,769, and 5,660,988, herein incoφorated by reference in their entireties); Dade Behring signal amplification methods (e.g., U.S. Pat. Nos. 6,121,001, 6,110,677, 5,914,230, 5,882,867, and 5,792,614, herein incoφorated by reference in their entireties); ligase chain reaction (Barnay Proc. Natl. Acad. Sci USA 88, 189-93 (1991)); and sandwich hybridization methods (e.g., U.S. Pat. No. 5,288,609, herein incoφorated by reference in its entirety).
6. Mass Spectroscopy Assay
In some embodiments, a MassARRAY system (Sequenom, San Diego, CA.) is used to detect variant sequences (See e.g., U.S. Patent Nos. 6,043,031; 5,777,324; and 5,605,798; each of which is herein incoφorated by reference). DNA is isolated from blood samples using standard procedures. Next, specific DNA regions containing the mutation or SNP of interest, about 200 base pairs in length, are amplified by PCR. The amplified fragments are then attached by one strand to a solid surface and the non-immobilized strands are removed by standard denaturation and washing. The remaining immobilized single strand then serves as a template for automated enzymatic reactions that produce genotype specific diagnostic products. Very small quantities of the enzymatic products, typically five to ten nanoliters, are then transferred to a SpectroCHIP array for subsequent automated analysis with the SpectroREADER mass spectrometer. Each spot is preloaded with light absorbing crystals that form a matrix with the dispensed diagnostic product. The MassARRAY system uses MALDI-TOF (Matrix Assisted Laser Desoφtion Ionization - Time of Flight) mass spectrometry. In a process known as desoφtion, the matrix is hit with a pulse from a laser beam. Energy from the laser beam is transferred to the matrix and it is vaporized resulting in a small amount of the diagnostic product being expelled into a flight tube. As the diagnostic product is charged when an electrical field pulse is subsequently applied to the tube they are launched down the flight tube towards a detector. The time between application of the electrical field pulse and collision of the diagnostic product with the detector is referred to as the time of flight. This is a very precise measure of the product's molecular weight, as a molecule's mass correlates directly with time of flight with smaller molecules flying faster than larger molecules. The entire assay is completed in less than one thousandth of a second, enabling samples to be analyzed in a total of 3-5 second including repetitive data collection. The SpectroTYPER software then calculates, records, compares and reports the genotypes at the rate of three seconds per sample.
In some embodiments, the present invention provides an oligonucleotide comprising a DME related sequence, or a complement of a DME-related sequence. In preferred embodiments, an oligonucleotide of the present invention comprises a sequence or a complement of a sequence selected from the group consisting SEQ ID NOs. 1-3360 and 3361-7669, or a substantially similar sequence.
In some embodiments, an oligonucleotide probe or oligonucleotide primer is created so the 5' terminus, 3' terminus or central base contains the genetic polymoφhism site. In some preferred embodiments, an oligonucleotide is created comprising at least 13 contiguous bases of a sequence selected from SEQ ID NOs 1 through 3360 or the complement thereto, and further comprising the 21sl nucleotide of the sequence selected from SEQ ID NOs 1 through 3360, or the complement thereto.
In some embodiments, an oligonucleotide of the present invention flanks or is adjacent to a polymoφhic site, such that the presence of the polymoφhism can be detected by modification of the oligonucleotide in a manner dependent on the presence or absence of the polymoφhism. In some embodiments, the present invention provides kits comprising one or more of the components necessary for practicing the present invention. For example, the present invention provides kits for storing or delivering the enzymes of the present invention and/or the reaction components necessary to practice a cleavage assay (e.g., the INVADER assay). The kit may include any and all components necessary or desired for the enzymes or assays including, but not limited to, the reagents themselves, buffers, control reagents (e.g., tissue samples, positive and negative control target oligonucleotides, etc.), solid supports, labels, written and/or pictorial instructions and product information, inhibitors, labeling and/or detection reagents, package environmental controls (e.g., ice, desiccants, etc.), and the like. In some embodiments, the kits provide a sub-set of the required components, wherein it is expected that the user will supply the remaining components. In some embodiments, the kits comprise two or more separate containers wherein each container houses a subset of the components to be delivered. For example, a first container (e.g., box) may contain an enzyme (e.g., structure specific cleavage enzyme in a suitable storage buffer and container), while a second box may contain oligonucleotides (e.g., INVADER oligonucleotides, probe oligonucleotides, control target oligonucleotides, etc.). In some embodiments one or more the reaction components may be provided in a predispensed format (i.e., pre- measured for use in a step of the procedure without re-measurement or re-dispensing). In some embodiments, selected reaction components are mixed and predispensed together. In preferred embodiments, predispensed reaction components are predispensed and are provided in a reaction vessel (including but not limited to a reaction tube or a well, as in, e.g., a microtiter plate). In particularly preferred embodiments, predispensed reaction components are dried down (e.g., desiccated or lyophilized) in a reaction vessel. Examples of genetic polymoφhism data (especially the SNP data) that can be used in the method of the present invention are shown in Table 1. Table 1 1/161
Table 1 2 /161
Table 1 3/161
Table 1 /161
Table 1 iV161
Table 1 ../161
Table 1 /161
Table 1 S7161
Table 1 9/161
Table 1 /O/161
Table 1 ///161
Table 1 IZ /161
Table 1 /3/161
Table 1 / /161
Table 1 /i"/161
Table 1 /<-/161
Table 1 /77161
Table 1 /S7161
Table 1 /f/161
Table 1 -?ø/161
Table 1 -2//161
Table 1 2Λ /161
Table 1 JC-/161
Table 1 -#/161
Table 1 -jjviei
Table 1 J--/161
Table 1 - /i 61
Table 1 -?<$7l61
Table 1 -2^/161
Table 1 otf/161
Table 1 όV/161
Table 1 32/161
Table 1 -33/161
Table 1 & /161
Table 1 -?i"/161
Table 1 o /161
Table 1 -77161
Table 1 -#/ιeι
Table 1 iy iei
Table 1 <?ø/ιeι
Table 1 47161
Table 1 2/161
Table 1 --7161
Table 1 44/161
Table 1 **" /ι 61
Table 1 /161
Table 1 47/161
Table 1 8 /161
Table 1 tf /161
Table 1 >/161
Table 1 £f /161
Table 1 £2 /161
Table 1 $3 /161
Table 1 /161
Table 1 a- /1Θ1
Table 1 - /161
Table 1 £ /ι 61
Table 1 58/161
Table 1 59/161
Table 1 60/161
Table 1 61/161
Table 1 62/161
Table 1 63/161
to
ON
Table 1 64/161
Table 1 65/161
Table 1 66/161
Table 1 67/161
> o
Table 1 68/161
Table 1 69/161
Table 1 70/161
Table 1 71/161
Table 1 72/161
Table 1 73/161
GENE number position SEQ. SEQ ID NO.
ABCB9 3 intron 1 + 8940 accagctcagcctgcccagc G/A tgcacacggcaccaagctgg 3965
ABCB9 4 intron 1 + 11410 agatccaagggatccagagg T/C tggaatgtgaccctccgtgc 3966
ABCB9 5 intron 1 + 12863 gggaagccagatgcccacaa G/A gctctgtgacttcacttcca 3967
ABCB9 6 intron 1 + 19731 gccaagtgtcaagatcgagc G/A aggggagggcctgacgaggg 3968
ABCB9 7 intron 1 + 29649 cagaatccagatgcccgtaa T/C gttgttaagaagcctgcaca 3969
ABCB9 8 intron 1 + 31793 ggccaggcggggaggggtac C/T ggccagaccggtgggcaaaa 3970
ABCB9 9 intron 1 + 37537 agagtcacagggttggggtg C/A ccccgggaaggtggcatcta 3971
ABCB9 10 intron 1 + 38293 taccagccctgtgctttcag G/A gaccatgtgacctgtcaact 3972
ABCB9 11 intron 1 + 44661 cccgaggtgcctggcttcac A/G gcaggattgccgtcctgcag 3973
ABCB9 12 intron 1 + 49576 aaagtggccccg ggcttgt C/T ccctgaagccctaaagcacc 3974
ABCB9 13 intron 1 + 64669 ccacagacaagccgggtagc C/A cacctcgcagctcaacacac 3975
ABCB9 14 exon 2 + 448 cctggttttgggccctgttc G/A tgtggacgtacatttcactc 3976
ABCB9 15 intron 7 + 3364 ggtaccaggagtcgggtatc A/G gtgggacaggaacgcgtgtc 3977
ABCB9 16 intron 11 + 113 gggccccaggagctctccca G/T actatcagcctcctgggctg 3978
ABCB9 17 exon 12 + 370 cccaggcctgcagcactgaa A/G gacgacctgccatgtcccat 3979
ABCB10 1 5 ' lanking - 424 tcgcgtctgcgcgctccgcc C/T ggtctgccggcgtgagaaag 3980
ABCB10 2 exon 1 + 491 acaaggggcggttgcgcccc G/T cagcggccggactcccggag 3981
ABCB10 3 intron 1 + 37 ccacttccctccgccgggcc T/G ctccttctccacacgcgggg 3982
ABCBIO 4 intron 1 + 217 actcgtttgcagattttaca C/T ttgttttcttgttgacacac 3983
ABCBIO 5 intron 1 + 405 gcgtttatactttttttttt T/Δ aaccaaaaacacattatttg 3984
ABCBIO 6 exon 3 + 185 agggccggggcccaggcttc C/T gtaggcatcagtatgatggt 3985
ON ABCBIO 7 intron 6 + 1269 caaattcacaactgtgcctt C/G cacagaatgggttggaaaac 3986
ABCBIO 8 intron 9 + 632 ccccactccacttgggtgag G/A gcaggtggatggtgatgggt 3987
ABCBIO 9 intron 10 • 2373 tacctcagggcactcagaca G/C cctcaccaatcagaggctca 3988
ABCBIO 10 intron 11 + 108 tcc tttcctgttttttgtt T/G ttttttttttcttggagtgg 3989
ABCBIO 11 intron 11 + 2379 cattggtttttagtgtattc T/A gtgttgtgcatccatcatca 3990
ABCB11 1 5 ' flanking - (2596-2595) tgtggtttagagctttctct (TT) gagacatttttgctaaggtt 3991
ABCB11 1 5 ' flanking - (2596-2595) tgtggtttagagctttctct gagacatttttgctaaggtt 3992
ABCB11 2 5 ' flanking - 1746 agctgaagtgaattaagcac G/A atcaactcagtactcacact 3993
ABCB11 3 5 ' flanking - (326-314) agggggaaagtttaaaggta (T)9-12 gtcttgttatgtttttaagt 3994
ABCB11 4 5 ' flanking - 135 agagggtttcccaagcacac T/C ctgtgtttggggttattgct 3995
ABCB11 5 intron 1 + 511 aaatatagatgcaaaaaaaa A/Δ tgagctgtggatgcatgttt 3996
ABCB11 6 intron 1 + 581 aatttcagtttttaggtcac C/T caagccagtgggagtcacat 3997
ABCB11 7 intron 1 + (1938-1951) aaagacgttttaagggcttt (A) 10-13 gaaagaaaagaaaactgtag 3998
ABCB11 8 intron 1 + 4517 ggtttcccaacatctcatct G/A ataaaaaaaataatttgcca 3999
ABCB11 9 intron 1 + 5651 aaagagaataggttag gga T/C tagtattcctgtgcttaatg 4000
ABCB11 10 intron 1 + (12200-12201) aagagatggtctctagcccc CT/Δ gtttgatttggggcacttac 4001
ABCB11 11 intron 1 + 13023 gtttggctactttgattaaa G/A aagaaagaagagataataat 4002
ABCB11 12 intron 2 + 739 cctgcatctattctgaccta C/T actggggaaaacagtatgtg 4003 tattttgtagttcaaaaagt (CAGATCTTCTTCAGCTAATTTAGAAATGT)
ABCB11 13 intron 2 + (921-922) tgctgtccatttgatattca 4004 tattttgtagttcaaaaagt
ABCB11 13 intron 2 + (921-922) tgctgtccatttgatattca 4005
Table 1 74/161
GENE number position SEQ. SEQ ID NO.
ABCB11 14 intron 3 + 644 agecacacgtttcttattgc G/A tgggaagtttaaaaaatggg 4006
ABCB11 15 intron 3 + 2231 agtgaacctgagattgagct A/G tactgaaatctctagaagag 4007
ABCB11 16 intron 3 + 2406 aaagggtggtctttaaatcc T/C tatgtttttctcatcaggtt 4008
ABCB11 17 exon 4 + 10 tttc catcaggttacaaga T/C gagaagaaaggtgatggcgt 4009
ABCB11 18 intron 4 + 434 acaatttatagtatttctca A/G tgccccacacagtttatcta 4010
ABCB11 19 intron 4 + 518 gtagatgagtagctaaaaac G/T aaagtcagctcctgaaataa 4011
ABCB11 20 exon 5 + 120 ggcacaatgacagatgtttt T/C attgactacgacgttgagtt 4012
ABCB11 21 intron 5 + 320 gggaggtgacccatgaattt T/C acttgagtatcatctccaag 4013
ABCB11 22 intron 5 + 16076 agaagaggtaacagtaagcc T/G cctgatttacagcacacatc 4014
ABCB11 23 intron 6 + 303 atttgcaggtgtgtttgtag G/C gggcagttgagtagcttgaa 4015
ABCB11 24 intron 7 + 1141 aaaggattcagcaggcatga A/G gaaagaaaagctttgcaaga 4016
ABCB11 25 intron 8 + 2463 ccattggctaatagcaatga A/C ctatgacatggtctaactta 4017
ABCB11 26 intron 8 + 2677 tcaatgatgttacagtgaga A/C tctaatattgtattaaaccc 4018
ABCB11 27 intron 8 + 2699 ctaatattgtattaaaccca T/A gccacatgttaaatgaatct 4019
ABCB11 28 exon 9 + 24 gtgtccaagtttacggacta T/C gagctgaaggcctatgccaa 4020
ABCB11 29 intron 9 + 108 caccttggtctgtggcctcc A/G gaggaagtacttgttcaaga 4021
ABCB11 30 intron 10 + 2475 taatcattccaaaccacgga C/A tttatttcattaagaacatg 4022
ABCB11 31 intron 10 + 2478 tcattccaaaccacggactt T/A a ttcattaagaacatgata 4023
ABCB11 32 intron 10 + 2711 tttacagattggaaaagcca C/T tgaagtattgcaggtccaga 4024
ABCB11 33 intron 10 + 3539 agtgactgtaattagtatca C/G ttgtgcacagagaaaaaatg 4025
ABCB11 34 intron 10 + 3623 tgcagaaggttgttctttca T/C gaccttcctgagtttcagaa 4026
ABCB11 35 intron 10 + 3661 gaattcattaataaaaataa A/T cacataatggagcgtgacat 4027
ABCB11 36 intron 10 + 5100 gggccactctttggcttggc A/G atagactgtggccaatgaaa 4028
ABCB11 37 intron 10 + 5292 gctatttggtaggaacatct G/A ggcatgatcaggtagccttc 4029
ABCB11 38 intron 10 + 5912 gagtaatattcagtaaaaaa A/Δ taaagtggtattttaaatca 4030
ABCB11 39 intron 12 + 116 tgtttccagtaatagggaat G/A gaggtgtctttctctgaaag 4031
ABCB11 40 intron 12 + 326 gataaatgacaaggcaatta G/C aacaatcaggaagcacaggt 4032
ABCB11 41 intron 12 + 335 caaggcaattacaaca tca A/G gaagcacaggttcttcccaa 4033
ABCB11 42 intron 12 + 2572 cctcatccttgccaatgttt C/T cttttactggtttttgatgg 4034
ABCB11 43 exon 13 + 23 tctaaatgacctcaacatgg T/C cattaaaccaggggaaatga 4035
ABCB11 44 intron 13 + 70 atggcagtatattgatcaaa C/T agaaaggtgtagcatacatt 4036
ABCB11 45 intron 13 + (1578-1579) ttattggcctctattttttc (C) tgcccattggtcaagtatga 4037
ABCB11 45 intron 13 + (1578-1579) ttattggcctctattttttc tgcccattggtcaagtatga 4038
ABCB11 46 intron 14 + 32 catacattcctgggagaaac C/T aagaggtcatagaaggaaaa 4039
ABCB11 47 intron 14 + 80 cacaattatacacatttctt C/T tcgtatgattcccaagtcat 4040
ABCB11 48 intron 14 + 439 tattgtgtcaaaaacaattc A/G ttgtatatctccattctaag 4041
ABCB11 49 intron 14 + (1262-1263) cagcctttgcattatatttt (T) gctgtgttgtctaacaggag 4042
ABCB11 49 intron 14 + (1262-1263) cagcctttgcattatatttt gctgtgttgtctaacaggag 4043
ABCB11 50 intron 14 + 1283 gctgtgttgtctaacaggag A/C aaagagacaeggatttgctc 4044
ABCB11 51 intron 14 + 1339 tgagatagatatttaggacc G/A tgaccaatttttattttggt 4045
ABCB11 52 intron 14 + 1359 gtgaccaatttttattttgg T/C tgaaaaatcttatttgaagt 4046
ABCB11 53 intron 14 + 1480 tattgattagacaataaccc G/A tctggggaagggatatttct 4047
ABCB11 54 intron 15 + 370 ccttttctaatgtctgcaca G/A cctatttaagaatattccca 4048
Table 1 75/161
Table 1 76/161
GENE number position SEQ. SEQ ID NO.
ABCC1 18 intron 13 + (2061-2062) ctcattacaactattccttc (C) ttggtcaggttggcaaatta 4092
ABCC1 18 intron 13 + (2061-2062) cteattacaactattecttc ttggtcaggttggcaaatta 4093
ABCC1 19 intron 13 + 11776 gccacctggggagggcccaa G/A cgcgtctccagggcctgtca 4094
ABCC1 20 intron 14 + 179 aaagaaagaaaacacatttg A/T cttcttgacagagaactcgc 4095
ABCC1 21 intron 16 + 219 ctagcacagagggttccctg G/T gattgtaagttacagcagcc 4096
ABCC1 22 intron 16 + 310 ggaagttctactttcaggtg C/T ggtgtgatccagggactctg 4097
ABCC1 23 intron 16 + 890 ctctccagagaaaacaatct G/T tagaaggcctgcattgaaaa 4098
ABCC1 24 intron 17 + 1171 aaccccaggctcaaagaagc G/A tgggaaataatgcatactcc 4099
ABCC1 25 intron 17 + 1332 cacctctttagtgtctgtgc A/G actgcacatttgtctcttgg 4100
ABCC1 26 exon 18 + 53 gattcagaatgattctctcc G/A agaaaacatcctttttggat 4101
ABCC1 27 intron 19 + (3373-3379) ccaagctaggcagtctcaca CA/Δ tgtgcactcacgtggccggg 4102
ABCC1 28 intron 20 + 2730 gcgtgaggtctgtctctcta C/T ccttccgtccaggtgagcaa 4103
ABCC1 29 intron 20 + 2789 cttggccccagataggttcc G/C cacccccgcctttctttccc 4104
ABCC1 30 intron 20 + 2919 gatgcaaatgccgcccacca C/T cctggcacctcgtgcgttca 4105
ABCC1 31 intron 20 + 3024 cttacatcaaactggggcac C/T cccctctctcaccacccacc 4106
ABCC1 32 intron 20 + 9718 gtggctgcgctcagtgacga A/C caggagaagtgaaggctgag 4107
ABCC1 33 intron 20 + 9733 gacgaacaggagaagtgaag G/C ctgaggcttataggagggtg 4108
ABCC1 34 intron 20 + (9895-9896) gctggttcccagtgtcacac AT/Δ gtgtgtgaggacaggctgca 4109
ABCC1 35 intron 20 + 9952 ggtatcattcttccttcctg G/A gtgatgtggctatttgtgtt 4110
ABCC1 36 intron 20 + 11120 gcggagtgggggcagtagtc A/G tcatcatcactgagttattg 4111
>—* ABCC1 37 intron 20 + 11147 tcactgagttattgtgaacc G/A ggaaagagatatgatctgtg 4112
VO ABCC1 38 intron 20 + (11629-11631) tattttgaatatcacttctt CTT/Δ tcaatgcttgggaatcacgg 4113
ABCC1 39 intron 20 + 11864 gagctccagataccacctgc C/T ccacaaccagacagcctgtt 4114
ABCC1 40 intron 21 + 3860 tggagagtgacatggtgggg G/Δ tgtggtgcatatattcatat 4115
ABCC1 41 intron 22 + 878 ttaaagatcgtcta tttgg G/A caagtgttaataattctcca 4116
ABCC1 42 intron 22 + (4445-4446) gtggggctggggctggggct (GGGGCT) gggtgcgtgeatgtgctaag 4117
ABCC1 42 intron 22 + (4445-4446) gtggggctggggctggggct gggtgcgtgeatgtgctaag 4118
ABCC1 43 intron 23 + 62 gttgtggctttgtctaatta T/C agaaatggatccttagagtc 4119
ABCC1 44 intron 24 + 3171 aaccatgaggctcaecatat C/T tcaaaccacgctgcacagct 4120
ABCC1 45 intron 24 + (3349-3368) ctcttgaaattggtgccagc (T) 19-22 cectgcatttaccaaatatg 4121
ABCC1 46 intron 24 + 3369 tttttttttttttttttttt T/C cectgcatttaccaaatatg 4122
ABCC1 47 intron 24 + 3584 ccaaggatttttat tttca A/G caacaaaggaaatgatttta 4123
ABCC1 48 exon 25 + 60 gag cggtcagccgctcccc G/A gtctattcccatttcaacga 4124
ABCC1 49 intron 27 + 4539 tcttttttactcactgcagt G/A tgaggaacaaatcacattta 4125
ABCC1 50 intron 30 + (1708-1714) gacccaacactatctcctgg (T)6-7 cttccggtcaagtgtcgggc 4126
ABCC1 51 exon 32 + 652 tggagaaaateattttctec C/T cttggcagtgtcccagggcc 4127
ABCC1 52 3 ' flanking + 158 ctgatgctcttccaggacac G/A aaaagaacccatctttgaat 4128
ABCC1 53 3 ' flanking + (187-199) ccatctttgaatatcaatga (T) 11-13 aagtactgttccggggagaa 4129
ABCC1 54 3 ' lanking + 2227 cattagaataggtagtatca G/A ccagccgggcatggtggctc 4130
ABCC2 1 exonl+77 catattaatagaagagtctt C/T gttccagacgcagtccagga 4131
ABCC2 2 intronl+413 gataagttctagaactggca A/C ctaatgatatggactagaag 4132
ABCC2 3 intron2+192 atcaaagtggctttgatttt T/G gcataagaatggtgactctt 4133
ABCC2 4 intron2+1020 agtgctgcgattacaagcct G/C agccacctgcacagcctctg 4134
Table 1 77/161
Table 1 78/161
GENE number position SEQ. SEQ ID NO.
ABCC3 7 intron 1 + 6189 agtgaccatgaagtctgcca T/C gagggggcctctgccacgtg 4178
ABCC3 8 intron 2 + 268 ttgtatttttagtagagatg G/A ggttttgccattttggcagg 4179
ABCC3 9 intron 2 + 376 tgtgcccagccagcattctg G/C ttttaatgaggccctctccc 4180
ABCC3 10 intron 2 + 446 ctcacctgacctgcttgggg C/T catgggaatctgacaactga 4181
ABCC3 11 intron 8 + 2323 gaggctggtggtgagagcgt C/G atcgatagggcgtgcagcag 4182
ABCC3 12 intron 12 + 85 ctcattggactctaccctga C/Δ accacctccacgctgctcag 4183
ABCC3 13 intron 19 + 1581 ttcttgttgccctttcaatc C/T ccctcattttattttcatgc 4184
ABCC3 14 exon 22 + 180 aacacttccctgaggctggg C/T gtctatgctgctttaggaat 4185
ABCC3 15 intron 30 + 1979 cctctgtctgttccatccct C/G tcctaccctcaccccccact 4186
ABCC3 16 intron 30 + 2340 atgcaccagccaggcctgaa A/C gaatgagtaagagttggagg 4187
ABCC3 17 3'flanking + (555-558) ttttcttgagcaagccaaca AAGA/Δ gtttcttttctgcaggtcag 4188
ABCC3 18 3'flanking + 1455 aaccccctatgattagaact G/A tagtgctgtttaggaagcca 4189
ABCC3 19 3'flanking + (1650-1659) aattcacagttaacaaagct (A) 9-11 tccttgttataaattacaca 4190
ABCC4 1 5'flanking - 644 attcatctgggtcatactct C/T gagttacccggctttcttga 4191
ABCC4 2 exon 1 + 67 ggagcggagcccgcggccac C/T gccgcctgatcagcgcgacc 4192
ABCC4 3 intron 1 + (864-865) ctttgaccagcttctttccc CT/Δ gtttccaatactttcacttc 4193
ABCC4 4 intron 1 + 21255 ggatggaaatggtgagcaca A/G accttggcatttaaggaccg 4194
ABCC4 5 intron 1 + 21503 ctgttttctacccactgggg T/C cagcaaatcagcccctttta 4195
ABCC4 6 intron 1 + 21900 tgatgctcaaagcaatacaa C/G tagaaaatataggaggctgg 4196
ABCC4 7 intron 1 + 22005 aagggggagtcatactccag C/T gtgcattttagtttgtgctt 4197
>—> ABCC4 8 intron 1 + (22256-22264) tttgtgttgttatttgcgtc (T)8-9 cctggaaggaagtgattggc 4198
ABCC4 9 intron 1 + 27784 ccagggaactggtggcacac C/G ctgagtctgctaggtgggct 4199
ABCC4 10 intron 1 + 27821 ggctaaagactcacaacctg A/T gggaaggggccaggaaagaa 4200
ABCC4 11 intron 1 + 27837 cctgagggaaggggccagga A/G agaaaggaagccatggccta 4201
ABCC4 12 intron 1 + 27880 gggtgtta ttgggacccca C/T gcccatccaggccgacagag 4202
ABCC4 13 intron 1 + 40310 accaagcaggggaggtgaga A/T ttgtgcagactggggatatt 4203
ABCC4 14 intron 1 + 40372 ttgcttgaataaaaggatgc G/A agtcactgtattggtgaagt 4204
ABCC4 15 intron 1 + 40413 ttctttcaaatccaattcct G/A actgatttccttgccttcca 4205
ABCC4 16 intron 1 + 40958 gaagtttaccgaaaaacaaa A/G caagaaactccccagtaaaa 4206
ABCC4 17 intron 1 + 50060 tgtggctatggggaacatga G/A gctcatagaaactgaagact 4207
ABCC4 18 intron 2 + 181 gcctgggggaaactcctgtt G/T cctgtgcctccgtagaggtc 4208
ABCC4 19 intron 2 + 254 gaggtctgtccctctaggtg G/A aagtgttgtggttggaggag 4209
ABCC4 20 intron 2 + 290 aggaggttgtctggcttatc T/C gtgctactgatggggcttca 4210
ABCC4 21 intron 2 + 543 ttacgaagctttttcctcat T/C gtaggttctgggataaagaa 4211
ABCC4 22 intron 3 + 557 ggccttgcacctgggctggc G/A gtggtgccccagaggctgga 4212
ABCC4 23 intron 3 + 718 gtgtgtcttccttgttgtcg G/A agtggattgctggttggaag 4213
ABCC4 24 intron 3 + 801 acattccatgaaaaatcaaa G/A acagccagaagggcaataac 4214
ABCC4 25 intron 3 + 1022 aggggtggatgttgctgttg T/C tacaaaagggtggctttaaa 4215
ABCC4 26 intron 3 + 1471 tgctggggtgtcccagcgat A/G gtgtttccacatggccccga 4216
ABCC4 27 intron 3 + 1490 tagtgtttccacatggcccc G/A atcagtttcagttggaaaga 4217
ABCC4 28 intron 3 + (1833-1834) gggctgccagccacttgggg (G) tggggtctctaacccacaga 4218
ABCC4 28 intron 3 + (1833-1834) gggctgccagccacttgggg tggggtctctaacccacaga 4219
ABCC4 29 intron 3 + 1870 cagatggtgactggactaca G/A tgagatttgggtaagctttt 4220
Table 1 79/161
GENE number position SEQ. SEQ ID NO.
ABCC4 30 intron 3 + 1927 gaagtagaggctgtagaagc G/A tgaatttctcctgagacttg 4221
ABCC4 31 intron 3 + 1970 gacaggccccactctggtgc A/T aggagcatggtaatctttac 4222
ABCC4 32 intron 3 + 2039 gatcgaggggagctttaata T/C gggtacagttggtggagagc 4223
ABCC4 33 intron 3 + (2067-2068) ttggtggagagctggtcttt (CTTT) tagcggggtggttattgggc 4224
ABCC4 33 intron 3 + (2067-2068) ttggtggagagctggtcttt tagcggggtggttattgggc 4225
ABCC4 34 intron 3 + 3563 cattgactgatggtctgggc G/A gatgtcaagttccctgtttt 4226
ABCC4 35 intron 3 + 3696 tgcttggcaaggatgaagac C/G ccagatgagtcactagtatg 4227
ABCC4 36 intron 3 + 4093 aagtaatccttggatttttt T/C ttttcttttccttctagcag 4228
ABCC4 37 intron 3 + 4097 aatccttggatttttttttt T/Δ cttttccttctagcagtgaa 4229
ABCC4 38 intron 3 + 9724 aaaaaccagcattactcacc A/G atgagcccatttgcttgact 4230
ABCC4 39 intron 3 + 9988 aaaggcaaagagcactgagc G/A tctggctgatagcccaggtg 4231
ABCC4 40 intron 3 + 10952 gttaaaattgcattccctac A/G tcttgttcagaaggtaagcc 4232
ABCC4 41 intron 3 + 11125 gctcaatttctgctgtgttt A/G atttttgactccacactacc 4233
ABCC4 42 intron 3 + 11244 ccaagagcctggaatcctcc C/Δ aagtctggttcttttcccca 4234
ABCC4 43 intron 3 + 11916 gtcttgaccaaaaaaaaaaa A/Δ tttagctctacatgatggtg 4235
ABCC4 44 intron 3 + 12047 actatactccagcatgggtg A/G cagagcaagcaatatctgaa 4236
ABCC4 45 exon 4 + 205 tgaggttacgagtagccatg T/G gccatatgatttatcggaag 4237
ABCC4 46 intron 4 + (412-414) ttatggaaatttttgttgtt GTT/Δ cattaaaaccttcacttaca 4238
ABCC4 47 intron 4 - (9757-9756) tgacatctgtcatttttttt (T) cctgctgcacaaatctcttc 4239
ABCC4 47 intron 4 - (9757-9756) tgacatctgtcatttttttt cctgctgcacaaatctcttc 4240
ABCC4 48 intron 4 - 6373 a gttttgttctagatagta C/G agttttcttgtaatctcaaa 4241
ABCC4 49 intron 4 - 6267 acttccaccattcacagtat T/C gttcttaatggcatgcggat , 4242
ABCC4 50 intron 4 - 6096 agatec teatttectaggg T/C gtacaaatttcaaggctttt 4243
ABCC4 51 intron 4 - 6057 ttgctatgctagattgattt C/T ctccccaagagttgttaatt 4244
ABCC4 52 intron 4 - 5295 agttgtctggcttacagtag A/G tgcttactaaatggtagctt 4245
ABCC4 53 intron 4 - 803 agcttcacctgtttcagccc C/T gcttccatgagcttcacctg 4246
ABCC4 54 intron 4 - 736 attcagcagcctccacatcc C/T ccttctccgtacttctgtcc 4247
ABCC4 55 intron 4 - 728 gcctccacatcctcc tctc C/T gtacttctgtcctagctagg 4248
ABCC4 56 intron 4 - 624 ccacccagtgtccctcagtt A/C gaactgtccccagttctctg 4249
ABCC4 57 intron 4 - 470 ttgatactccatatttgtca C/T ttcccattgaacacattgaa 4250
ABCC4 58 intron 4 - 411 ggtgaagagactaaggcccc G/A tgtgtttaataatgttgcac 4251
ABCC4 59 intron 4 - 323 tgttcctctgacagcctctc C/T gttcttccctaatttggctc 4252
ABCC4 60 intron 4 - 246 gtccttttgtacttgggggc A/G tgtccaaattcattaaatga 4253
ABCC4 61 intron 4 - 199 agattt tcttcttcctacc C/T ctcgctttgctgtcctgaca 4254
ABCC4 62 intron 5 + 73 ccttttattctttctggagg C/T aggggctcactctgttcaca 4255
ABCC4 63 intron 5 + 403 aagggatcacgccttgttgc G/A caggctggtctcaagattct 4256
ABCC4 64 intron 5 + 937 ccagaatggcttcacctgtg G/C tgggtgcttggctttctgct 4257
ABCC4 65 intron 6 + 150 ggctcagccaagggggcctc C/T gtccttatgctgaaggcaaa 4258
ABCC4 66 intron 6 + (380-381) tgtgttagagctgttttcac (AT) gtgtatatatgtgtgttatt 4259
ABCC4 66 intron 6 + (380-381) tgtgttagagctgttttcac gtgtatatatgtgtgttatt 4260
ABCC4 67 intron 7 + 894 tttgttgttgttgcccagga A/T ggtctcaaactcctgggttc 4261
ABCC4 68 intron 8 + 82 tatttagcatcactatgttc C/G agtgtaatgacatttaactc 4262
ABCC4 69 intron 8 + 100 tccagtgtaatgacatttaa C/T tctctcataaccaaaacgtg 4263
Table 1 80/161
GENE number position SEQ. SEQ ID NO.
ABCC4 70 intron 8 + 5212 tcagggaattgtggtccaat A/T tgcagctagggaagaaatcc 4264
ABCC4 71 intron 8 + 5444 gaaaccttaatttcccctca T/G gtacatagtttctggtggga 4265
ABCC4 72 intron 8 + 8969 tcaccctcctgagtgactag A/G gaaagtccagctagcccctc 4266
ABCC4 73 intron 8 + 9106 ccagtgctcaataggtttac T/C gtgtgcatagttttttattt 4267
ABCC4 74 intron 8 + 9412 tgtttgtaagtgcaggatgg G/A ggacacatctctgccctgta 4268
ABCC4 75 intron 9 + 116 tggcttgcttatttactgaa A/G ctatgttacaaagattctca 4269
ABCC4 76 intron 9 + 1384 cacggcaggaagctgcaccc T/C ggggctggagatgatgtctg 4270
ABCC4 77 intron 9 + 1459 agatttgggagcagagggcg A/G gggtctcttctgagggtact 4271
ABCC4 78 intron 9 + 1632 agcagcactcctgcccagcc C/A cactgcctccgtcctcccct 4272
ABCC4 79 intron 9 + 3630 gtaaatttttcattttgaag G/Δ ttatcttgatctcttattcc 4273
ABCC4 80 intron 9 + 3830 ggtgttccacccttcaggga C/T gccagattcattttgaagaa 4274
ABCC4 81 intron 9 + 3940 gagcatttaccaaagtgtgt C/T gtgcagaagaatagccactt 4275
ABCC4 82 intron 10 + 1504 gggcaaggctgcattgcagt G/A gcttattcttgtctcgagtg 4276
ABCC4 83 intron 11 + 1817 ttttagggagttgagaaaca G/C atggcaaattttgctagttt 4277
ABCC4 84 intron 11 + 3342 actggaattattctggcttg T/C aggtacagagattgcatgtg 4278
ABCC4 85 intron 11 + 3377 catgtgtaatcaaaacctgc T/C ggacagaaatggtcctgagc 4279
ABCC4 86 intron 11 + (3610-3625) tcetggccaecetccccegc (A) 15-17 gtcctagaggaaaaaatagg 4280
ABCC4 87 intron 11 + 3737 ataagttcatcgagctaaaa A/G tatatttgagataaaataat 4281
ABCC4 88 intron 11 + 6953 agagtagagacaaagaaatg C/A caccttgatctgtaagaggg 4282
ABCC4 89 intron 13 + 442 ctatgacaggttagaagtga G/C gtccttgggaccaacatagg 4283
ABCC4 90 intron 13 + 459 tgacgtccttgggaccaaca T/C agggctttcttgggaaggct 4284
4-- ABCC4 91 intron 13 + 633 tgaacacttaaaacccacag G/A catgtaggcctggcttgcct 4285 ) ABCC4 92 intron 13 + 645 acccacaggcatgtaggcct G/T gcttgcctttgaaactagtt 4286
ABCC4 93 intron 13 + 3306 aatgttctcaacgagttaga A/C aattggattgaacaatatgc 4287
ABCC4 94 intron 14 + 252 taatttagaactttttgttt A/G cctcttccatgacttaattc 4288
ABCC4 95 intron 15 + 124 tggattctgtggtttcaggg C/T tctattccatgatattggta 4289
ABCC4 96 intron 15 + 1552 tttggacttctgcctgtttc C/T ccacagctttgtcaacagag 4290
ABCC4 97 intron 16 + 157 cctactggtgttccatgtcc G/A ttacaaagacctgcgaaaaa 4291
ABCC4 98 intron 17 + 329 cccaaattgtggttcatttt T/C aaaaaaatgtatttatctaa 4292
ABCC4 99 exon 18 + 56 atggaggaggaaatgtaacc G/A agaagctagatcttaactgg 4293
ABCC4 100 intron 19 + 7202 aattaaaaataatgtttttt T/Δ cacataacaatggttatatg 4294
ABCC4 101 intron 19 + 7445 ttttggcataatttttaatc T/C actagaatgttctgattcat 4295
ABCC4 102 intron 19 + 9018 tacgtgatggcctgaagaga A/G aaaccgtacattggttcttt 4296
ABCC4 103 intron 19 + 11388 aagagttcagagattttggg A/G gttggaggaaaaaatagcat 4297
ABCC4 104 intron 19 + 11646 cattatttttaatttttttt T/Δ cctcctgttggtgtcagaat 4298
ABCC4 105 intron 19 + 13517 gagaaacttacattattttt A/T aaaaatgctataactagtcc 4299
ABCC4 106 intron 19 + 21033 tgggagtgccctgggctagc G/A ctgaaacttcaggttttcag 4300
ABCC4 107 intron 19 + 21095 agacttttggaagaagcaga A/T ctgaaggtaagactgagtaa 4301
ABCC4 108 intron 19 + 21634 gtgctatttctgagcactca C/T ggccccattgggcatgggct 4302
ABCC4 109 intron 19 + 21715 tgttttgctcaccccctaca C/T agcttgccctcatgcttctc 4303
ABCC4 110 intron 19 + 23090 agcaacagacttggagactt G/A agcttctaaaagtttcatta 4304
ABCC4 111 intron 19 + 24297 cgaatgtgatgaatgtggga A/G cctttttgagatagcagcac 4305
ABCC4 112 intron 19 + 25947 gagtctaaattaaatatgag C/A aaaactagaaaccatttaaa 4306
Table 1 81/161
GENE number position SEQ. SEQ ID NO.
ABCC4 113 intron 19 + 30193 acagatttgcaagagtctac A/C aaagtgataatattctgtca 4307
ABCC4 114 intron 19 + 36938 aagccgagtcaatctcttgg C/G tatcttctgtggactacttt 4308
ABCC4 115 intron 19 + 37322 gttcccatgagggctgaccc C/T gcctcaccctggtaacccgc 4309
ABCC4 116 intron 19 + (38361-38362) cggggttagcttccctagct (T) gcggagggtttctgagaaaa 4310
ABCC4 116 intron 19 + (38361-38362) cggggttagcttccctagct gcggagggtttctgagaaaa 4311
ABCC4 117 intron 19 + 38746 taaagacatgctggtaatta T/C gtaaaataaagataagtcaa 4312
ABCC4 118 intron 19 + 42343 tgtaagggcagaatcagcag C/T aacgattggatgttcccgga 4313
ABCC4 119 intron 19 + 44733 agcaggctggggaaaaaaaa A/Δ tacagaggttatcattatgt 4314
ABCC4 120 intron 20 + (405-419) aagggcaaatacttaggcac (T)13-15 ggatagaaccaggtgtggtt 4315
ABCC4 121 intron 20 + (637-648) ctaagtettaagctgtcttt (A)l2-13 eeaaeaatcetacagaaata 4316
ABCC4 122 intron 20 + 842 caagctggggcacttttttt T/Δ tcccaagtgtttattttgga 4317
ABCC4 123 intron 20 + 843 aagctggggcactttttttt T/C cccaagtgtttattttggaa 4318
ABCC4 124 intron 20 + 1347 ggacctctgatttttttttt T/Δ cttttgcaaacatttttaaa 4319
ABCC4 125 intron 20 + (14553-14567) tccctacacacecctcatct (A) 13 -15 tcagcagcttgactgagctt 4320
ABCC4 126 intron 20 + 15487 ggttttttccagtgtgatag C/T acatgtagaaagcagtactg 4321
ABCC4 127 intron 20 + 16161 gcgttgagtcatgaagccga T/C agtgccgcttgtgcatcgca 4322
ABCC4 128 intron 20 + 30891 acgtcccccactgttctatc C/T ttctcaagaagcaagcgttg 4323
ABCC4 129 intron 20 + 31180 ccttgcacgtgctcatacat G/A tcatttgctattgttatcat 4324
ABCC4 130 intron 20 + 31283 gtgttaaagctaaaaaaaaa A/Δ ccctgttagacattttgact 4325
ABCC4 131 intron 21 + 4204 ttgaccctgccctgaaaccc A/T gttggagataaaacagtggc 4326
ABCC4 132 intron 22 + 1026 gtgccctactccacgtaaaa A/C tcttctgtagctcaactgag 4327
ABCC4 133 intron 23 + 377 gcctggtgcatgaggttgag A/G aaaattctcagcaggagagt 4328
ABCC4 134 intron 25 + 4122 cccttttgattaaaattgca C/G/T tgggacaagaaccaccccca 4329
ABCC4 135 intron 25 + 6418 ttgcactgaggtaatggctg C/A agaaattaaagtgagggtat 4330
ABCC4 136 intron 25 + (8765-8775) tgcatcctgtgatttttttc (T)5-ll aatcctgccgcetggatctc 4331
ABCC4 137 intron 26 + 67 tatgtttaattgcttttact G/C ttattgctttttttaattgg 4332
ABCC4 138 intron 26 + (101-109) taattggatgaaaggattgt (T)8-9 cacccaatagagcatgtttt 4333
ABCC4 139 intron 28 + 391 tagatatgatcttttttttt T/Δ aaatctctattgtgaagtag 4334
ABCC4 140 intron 29 + 2569 atcctcttttttctaatacg C/T accactatctccacattaaa 4335
ABCC4 141 intron 29 + 7820 gaaaaacaacctgtgtcctg C/T ttggaggttcagcatattct 4336
ABCC4 142 intron 30 + 6269 tagatgttctttgggcattg A/G aaagatggtgttatctgttt 4337
ABCC4 143 intron 30 + 6320 gtttaataaggtttaattag C/T tctactttgttaattacatt 4338
ABCC4 144 intron 30 + 6474 ctttgatgctatggttttca A/G tccacagatgttcataactt 4339
ABCC4 145 intron 30 + 6519 ttccactatgaattatattt C/T ctgccattttaacacacctt 4340
ABCC4 146 intron 30 + 6574 aatggttttggtcctaaatc C/T acactggttcaaaactagac 4341
ABCC4 147 intron 30 + 6680 aggtgtgtctcctgtatatg A/G cgtggttaggttttactctg 4342
ABCC4 148 intron 30 - 704 acgtttatcagaaaacctgt A/C tctcttctagttcagctaga 4343
ABCC4 149 intron 30 - 228 a ctatgaatcagagtgatc A/G gaactaaaatggatctacag 4344
ABCC4 150 intron 30 - (14-5) acattctttttatgcttacc (T)9-10 ctaggtatacttcaaaagaa 4345
ABCC4 151 exon 31 + 146 agtccgttccgaaggcattt G/T ccactagtttttggactatg 4346
ABCC4 152 3 ' flanking + 173 atttttaaaggagtaggaca A/G agttgtcacaggtttttgtt 4347
ABCC4 153 3 ' flanking + (430-440) tgtaccccttactccccatc (A) 10-11 tggatacatggttaaaggat 4348
ABCC4 154 3 'flanking + 556 aaaggtgctttgatactgaa G/A gacacaaatgtgaccgtcca 4349
Table 1
GENE number position SEQ. SEQ ID NO.
ABCC4 155 3 'flanking + 1144 cctccctgaaattgcatata T/C gtatatagacatgcacacgt 4350
ABCC4 156 3 ' flanking + 1426 tttaggtgactgaaattgca A/T cagtgatcataatgaggttt 4351
ABCC5 1 intron 1 + 628 ttctgccacacagagccgcg G/C gtggctttgtgtttatcaca 4352
ABCC5 2 intron 1 + 1834 tgagttccagtgacctcctc C/T gtttcaaactgctcaccgcc 4353
ABCC5 3 intron 1 + 3055 agaaagtctttaaaaaaaaa A/Δ ccaacctttctattgtatac 4354
ABCC5 4 intron 2 - 20280 gaatgcatcgctactaagta T/C ttttgtaagttcagacacca 4355
ABCC5 5 intron 2 - 20260 tttttgtaagttcagacacc A/T tctagaatctgcttgaccgt 4356
ABCC5 6 intron 2 - 19204 tgaaataaagcattcgcaca C/T ctacccactttcttcgggac 4357
ABCC5 7 intron 2 - 19043 ttggctggcattaggctggc G/A ttacttcagctaacatgaag 4358
ABCC5 8 intron 2 - 18824 ttgaacactcttcaagatgc A/G tgcacagcactgaaccgagt 4359
ABCC5 9 intron 2 - 18807 tgcatgcacagcactgaacc G/A agtggtctggtgcagataaa 4360
ABCC5 10 intron 2 - (18735-18734) atagaagcttaaactcacaa (A) cacgtactctacatagatga 4361
ABCC5 10 intron 2 - (18735-18734) atagaagcttaaactcacaa cacgtactctacatagatga 4362
ABCC5 11 intron 2 - 15903 taccaaagcctgctcatgga G/A gtagaaagcaagactgacat 4363
ABCC5 12 intron 2 - 15901 ccaaagcctgctcatggagg C/T agaaagcaagactgacatgt 4364
ABCC5 13 intron 2 - 15847 tggatggaacctcaaaggcc G/A tcttgcccagtccccattta 4365
ABCC5 14 intron 2 - 15605 aggagacgccacgacactga C/T agctgtacctgacctgaggg 4366
ABCC5 15 intron 2 - 13571 ccgattgtgccccagatacc G/A ctttatttgaggggtgtgcc 4367
ABCC5 16 intron 2 - 13402 taccctgctgttgtccggcc G/T ccaggaagggattggattgt 4368
ABCC5 17 intron 2 - 13325 cccagaggcctccgtgcagg G/C gaaaagcccttggttgccct 4369
ABCC5 18 intron 2 - 7293 tttgttaggataaaattgca C/T tgagtgcctgttctaaacca 4370
ABCC5 19 intron 5 + 374 ccgggctggtgagccagcac C/T gggaacataccaagtgcctg 4371
ABCC5 20 intron 5 + (2212-2213) cgcctcctgcagtgctctct CT/Δ tggtgaatgctaactctgct 4372
ABCC5 21 intron 5 + 3283 acccagagagagtctgggtt C/T tggaattcagcgtagctacc 4373
ABCC5 22 intron 5 + 3469 ttggctttcttttgttgtgg C/T tttttgttttatttttgtca 4374
ABCC5 23 intron 7 + 443 cacttttattaaagacagta C/T gattacataacatttggccc 4375
ABCC5 24 intron 7 + 458 cagtacgattacataacatt T/G ggcccatcctagcaagcagg 4376
ABCC5 25 intron 9 + 176 caaaacaaaacaaacaaaca A/G acaaaaaaaaaataccacat 4377
ABCC5 26 intron 9 + 214 catatggagatgatgctgtg G/T tcctctccttactggacctg 4378
ABCC5 27 intron 10 + 703 tgtgggctggaattccttga T/C gttgccactgcatagattag 4379
ABCC5 28 intron 10 + 3580 catggggctggagctgtgaa A/G accagtaggtactggcatgt 4380
ABCC5 29 intron 10 + 3655 atcctttgaataactcttta G/A gggagagaaatgatggaaat 4381
ABCC5 30 intron 10 + 3854 gaagtttagaatcatgacac T/C tcggggaagataggatcagg 4382
ABCC5 31 intron 10 + 5040 ctttgaagacatgagagttt C/T ttggcaagaagatgttctct 4383
ABCC5 32 intron 10 + 5316 cagttaaatgtcattaggtc C/T gctttaggctggctgagggg 4384
ABCC5 33 intron 12 + 234 gactgttgteccagetgga G/A ccatttggtctcatgccttc 4385
ABCC5 34 intron 12 + 300 tgccacaggtatgcccgtgt A/G ttgaaaatgtcagagataag 4386
ABCC5 35 intron 12 + 318 gtattgaaaatgtcagagat A/G agagatgagcagacacccta 4387
ABCC5 36 intron 12 + 1545 gtagcatccctaaaccaaga C/T aaatgtctactatcagtccc 4388
ABCC5 37 intron 13 + 20 ggcaaggaatgtttggcttc T/C gtcatgctttccatcttggc 4389
ABCC5 38 intron 14 + 278 ttctatccagatatttttaa A/G actacaagtaagcgtgtgca 4390
ABCC5 39 intron 16 + 1663 tgactggagacttttttttt T/Δ aaatattattagatcaattc 4391
ABCC5 40 intron 16 + 1664 gactggagactttttttttt A/T aatattattagatcaattca 4392
Table 1 83/161
Table 1 84/161
GENE number posi •ti•on SEQ. SEQ ID NO.
ABCC7 17 intron 3 + 13758 tattaaagaacatgatgctt A/G aaacagattagggaaaacta 4434
ABCC7 18 intron 4 + 240 ctctgttgtagttttttttt T/Δ ctcctaatcatgttatcatt 4435
ABCC7 19 intron 4 + 376 ttatgttcagcaagaagagt A/G taatatatgattgttaatga 4436
ABCC7 20 intron 4 + 586 tgtccagacaagagaccaaa T/C tgccgaggcatcatttaggt 4437
ABCC7 21 intron 4 + 1089 tttcaatctgaacattttac G/A taagtgaagactttgttaga 4438
ABCC7 22 intron 4 + 1615 aaagttaggtggtattgtat C/T tgtcttcctttctcaatgtt 4439
ABCC7 23 intron 4 + 1946 aatacaaacaaacttgagct T/C tgcctatacttttcaagaat 4440
ABCC7 24 intron 6 + 783 tatctaagttttggagtcaa A/G tagcactttgtttgaatccc 4441
ABCC7 25 intron 6 + (1104-1131) gattgattgattgattgatt (GATT) 6-7 tacagagatcagagagctgg 4442
ABCC7 26 intron 7 + (731-732) gtagcaatgagaccattttt (T) cttcagttgagctccatgtt 4443
ABCC7 26 intron 7 + (731-732) gtagcaatgagaccattttt cttcagttgagctccatgtt 4444
ABCC7 27 intron 7 + 1434 gaatgtttggttgtaacctg T/C ataatctggcatgaaattgt 4445
ABCC7 28 intron 8 + 752 catgctctcttctcagtccc A/G ttccttcattatatcaccta 4446
ABCC7 29 intron 8 + 1109 tatggccaagacttcagtat G/A cgtggacttaattcttcctt 4447
ABCC7 30 intron 8 + 1312 atgaagacattcattttttt T/Δ ctccgtccaatgttggatta 4448
ABCC7 31 intron 9 + (6521-6522) gtgtgtgtgtgtgtgtgtgt (GT) ttttttaacagggatttggg 4449
ABCC7 31 intron 9 + (6521-6522) gtgtgtgtgtgtgtgtgtgt ttttttaacagggatttggg 4450
ABCC7 32 intron 10 + 2119 gaacactttatagttttttt T/G ggacaaaagatctagctaaa 4451
ABCC7 33 intron 11 + 3867 tttttcttcaagaaattaga A/Δ gaggggagaaattggtttaa 4452
ABCC7 34 intron 11 + 11844 tgaatcaaaatcatctaaaa A/Δ gctttcagaaaccagacttt 4453
ABCC7 35 intron 11 + 12144 atattaaacagagttacata T/C acttacaacttcatacatat 4454
ABCC7 36 intron 11 + 20975 gtgtggatagtaaatgccag G/A gtaaatcacatagcatctaa 4455
ABCC7 37 intron 11 + 27057 atggaagagaagttttagta G/A aggggaggaaggaggaggtg 4456
ABCC7 38 intron 11 + 27131 gagagagacttttttttttt T/Δ aaggcgagagtttactacct 4457
ABCC7 39 intron 13 + 152 gtattaactcaaatctgatc T/A gccctactgggccaggattc 4458
ABCC7 40 intron 13 + 287 tttgcagtatcattgccttg T/C gatatatattactttaatta 4459
ABCC7 41 intron 15 + (85-86) atacatatatatgcacacac AT/Δ aaatatgtatatatacacat 4460
ABCC7 42 intron 15 + 106 taaatatgtatatatacaca T/A gtatacatgtataagtatgc 4461
ABCC7 43 intron 15 + 3341 ggaagtataaatttgtaaat A/C actgagacccaaacttacaa 4462
ABCC7 44 intron 15 + 5556 tgctattgactaatagtaat A/T attttagggcagctttatga 4463
ABCC7 45 intron 15 + 5919 tggtagttctatgtggaaac C/A gtgaggaaataattttatat 4464
ABCC7 46 intron 17 + 2479 caaaaaggtatggaagtcag A/C ggagaaggagacccctatgt 4465
ABCC7 47 intron 18 - 81 aagtatgcaaaaaaaaaaaa A/Δ gaaataaatcactgacacac 4466
ABCC7 48 intron 19 + 751 cattaataaaataacaaatc A/G tatctattcaaagaatggca 4467
ABCC7 49 intron 19 + 820 tgacatttgtgatatgatta T/C tctaatttagtctttttcag 4468
ABCC7 50 intron 21 + 1532 ttacctttaacttttttttt T/Δ agtttgatcagctctcttta 4469
ABCC7 51 intron 21 + 1607 atgcttttggagttgggtct C/T ataaatgtatagaaatgttt 4470
ABCC7 52 intron 21 + 11260 atgtggaacaatcatgacta T/C atgccttttactttctctat 4471
ABCC7 53 intron 22 + (130-131) agaatcaata taaacacac AT/Δ gttttattatatggagtcat 4472
ABCC7 54 intron 23 + 1837 ctgtcctaaagtttaaaaag A/Δ aaaaaaaaaggaagaaggaa 4473
ABCC7 55 intron 24 + (7100-7112) cctttacaaactcttagaca (T) 12-14 agtttaacatgttacaaaac 4474
ABCC7 56 intron 25 + 237 actcttcccccttgtcaaca C/T atgatgaagcttttaaatac 4475
ABCC7 57 exon 27 + 115 gggtgaagctctttccccac C/T ggaactcaagcaagtgcaag 4476
Table 85/161
-. 0
Table 1 86/161
GENE number position SEQ. SEQ ID NO.
ABCC8 42 intron 12 + 356 accaagaatgaggccatccc G/T tccccacgtggctgccccat 4520
ABCC8 43 intron 12 + 934 tgggttcaaagatggaatgg G/T gcataactcagcaaaattat 4521
ABCC8 44 intron 12 + 1370 gggagggaggctggacaggg C/G atgaaggcagagcctggtgg 4522
ABCC8 45 intron 15 + 412 ggaggtgggacccaggatgg C/T gtttcttgggaccacaagga 4523
ABCC8 46 intron 15 + 688 actcccccggccccactcac A/G tctgccaccttccctccctg 4524
ABCC8 47 intron 16 + 4464 actcattccaagtattgatc G/A agaagagaggtaggtactgg 4525
ABCC8 48 intron 16 + 4574 ttgaagatcttaagttgttt T/C tggttcactcatttcgcaaa 4526
ABCC8 49 intron 16 + 5011 agc aaaagcaaaacagcct C/T tgacctggcaagcattccca 4527
ABCC8 50 intron 16 + 7608 tgtcctacttttcttttgac C/G cttataacttcctgacttcg 4528
ABCC8 51 intron 16 + 7730 ccagctcctagtgggctgga G/A ggaaggacatgcggttgggg 4529
ABCC8 52 intron 16 + 8369 ttgcaaactgagttagggcc T/C ggagagcttactgtgtgctg 4530
ABCC8 53 intron 16 + 9708 tgcacttgccgcctacttat T/G ccagacccaatgattgggtc 4531
ABCC8 54 intron 17 + 651 tatagattaatgaggctctg A/G gtccctcaaaaccttccctc 4532
ABCC8 55 intron 17 + 692 cccttacctctccaaaaaac A/G cttgagataccctagaggtg 4533
ABCC8 56 intron 17 + 1541 ctcaggatcttcctggagga C/T atggttcactcccatgagag 4534
ABCC8 57 intron 18 + 580 actaagcagatttctaccaa C/T tgcacctccccatccccttg 4535
ABCC8 58 intron 18 + 658 gaacaagcccctgagaatgc C/T ttccgcaccccctactcccg 4536
ABCC8 59 intron 18 + 660 acaagcccctgagaatgcct T/C ccgcaccccctactcccgcc 4537
ABCC8 60 intron 19 + 93 gcccttccatcgatcaccca T/C acccagccatctcactcccc 4538
ABCC8 61 intron 19 + 123 tctcactccccaggtgctta T/C ctgcactccagcctctccat 4539
4-- ABCC8 62 intron 19 + 219 cataggggagagggcaggaa C/T ggagggaagggagagagccc 4540 vθ ABCC8 63 intron 19 + 845 tagtatttaacctgcccaaa C/T gctgtgtgaagtgctgacct 4541
ABCC8 64 intron 20 + 338 tcccctccacaagcttagac A/G aacaggattctcctgtgact 4542
ABCC8 65 exon 21 + 10 t tggtgacagggcatcaac C/T tgtctggtggtcaacgccag 4543
ABCC8 66 intron 21 + 192 caaggatagcacaaatgacc c/Δ attgcagacttcagatggag 4544
ABCC8 67 intron 23 + 17 gaaggtgggtatatccaggg A/G tggccaagcagccacccctg 4545
ABCC8 68 intron 23 + 67 gttctgctagaacctgaact C/T ataaaggtcttcctgtcctt 4546
ABCC8 69 intron 26 + 268 gtgagcgtctgcacatccaa G/C taaagattgttttctcc cc 4547
ABCC8 70 intron 26 + 308 cgataagtgggtgtaatttg C/T ccatccccacccatgagttc 4548
ABCC8 71 intron 26 + 348 cagctccctgccctcccctc A/G ctctctctccctcagccagc 4549
ABCC8 72 intron 26 + 807 gacagctgctgagtcaggcc G/A agccggcagctgagaaaggc 4550
ABCC8 73 intron 26 + 834 cagctgagaaaggcggcagt G/C gtcagatgggcttgagaaac 4551
ABCC8 74 intron 28 + (118-121) cctccaaaaaataaaaacaa AAAA/Δ cagaaatgaaggaaatagaa 4552
ABCC8 75 intron 28 + 1348 tggggtaagcggaagacggg G/A ttgaacgctttgagtttggt 4553
ABCC8 76 intron 29 + 1253 ctcttagggatcttgtctaa G/T taaagaagagcagagcaaag 4554
ABCC8 77 intron 29 + 1589 cagatcccagcttectgtaa A/G cagcctcagatcaggccaaa 4555
ABCC8 78 intron 29 + 2322 gcgcctcacactcctataac G/A cgcacatgccctgatgcaca 4556
ABCC8 79 intron 29 + 2348 a gccctgatgcacacacat T/C ttcaacacgcacttacteta 4557
ABCC8 80 intron 29 + 2418 agacacgtcaccctcccaca C/T gtctccaccctgggggtgtg 4558
ABCC8 81 intron 29 + 2494 tcagtcccctcagacacatg C/A cctctctccacgcagagaca 4559
ABCC8 82 intron 29 + 2735 gcggccaaggagagtgatga C/T ggcagcccaggttgatcaga 4560
ABCC8 83 intron 30 + 386 gctcc ggggctccagcctt C/T gcagcccttgtgtgtgtctg 4561
ABCC8 84 intron 33 + 93 ggcttcgcagtcacctcgtg G/T ccctccagggccgaggcctc 4562
Table 1 87/161
l
Table 1 88/161
Table 1 89/161
Table 1 90/161
Table 1 91/161
Ul
4--
Table 1 92/161
Ul Ul
Table 1
Ul σ.
Table 1 94/1
Ul ^1
Table 1
Table 1
Table 1 97/161
O oN
Table 1 98/161
Table 1 99/161
ON to
Table 1 100/161
Table 1 101/161
ON J__.
Table 1 102/161
Table 1 103/161
Table 1 104/161
Table 1
Table 1 106/161
Table 1 107/161
Table 1
Table 1 109/161
Table 1 110/161
Table 1 111/161
GENE number position SEQ. SEQ ID NO.
ALDH1A2 2 intron 1 + 314 cggtcccgactgccgcgggg G/Δ aaggcgtcggaaccgcttag 5556
ALDH1A2 3 intron 1 + (664-675) ttttgaactgaagaacttac (T) 11-13 ataacgaacgttgacatctt 5557
ALDH1A2 4 intron 1 + 1370 gcatgcagcttagaagtttt A/G ttttatgagggtctctaacc 5558
ALDH1A2 5 intron 1 + 1557 ggtacgtttttcagaattta A/Δ tttggaagctcttccagttc 5559
ALDH1A2 6 intron 1 + 1934 tcagctctttagtgagactt C/G taaattttctaagacaagca 5560
ALDH1A2 7 intron 1 + (1971-1980) agcatagtggacaagcagta (T)9-ll aaacgtgaagagcagaagct 5561
ALDH1A2 8 intron 1 + 2295 tactgtaagacaatatgtta T/C tgttttttgtcttgctaaac 5562
ALDH1A2 9 intron 1 + 2387 ttgggacccacatagagtca C/T tacttaaaataaatgaccag 5563
ALDH1A2 10 intron 1 + 2841 aggaatgtgctttttaaaac T/Δ agatggtgttagtcaaggag 5564
ALDH1A2 11 intron 1 + 3035 gacttttataattttgtata A/G ctgatattataggaatacac 5565
ALDH1A2 12 intron 1 + 3319 aaagagttatgttttttttt T/Δ ctgcatctgatattatatgg 5566
ALDH1A2 13 intron 1 + 3474 ttgtctttttatttatteat T/C taaacttctgttttctgggg 5567
ALDH1A2 14 intron 1 + 4186 ccttccaaacctttacttaa G/C attgtctgttttggtcataa 5568
ALDH1A2 15 intron 1 + 4222 cataaattgtcagtcaaact A/G catgttaatagaggacttca 5569
ALDH1A2 16 intron 1 + 4254 aggacttcaggttttttttt T/Δ aaatactttttcataactat 5570
ALDH1A2 17 intron 1 + 4397 cccttccactacatgggcct A/G tgttaccatgtggaattatc 5571
ALDH1A2 18 intron 1 + 5935 aactccaggttgcaaataga T/C gtttctggtattttaagtag 5572
ALDH1A2 19 intron 1 + 6206 ttttgaaagccctcctagca T/G ttctttaatttctttattga 5573
ALDH1A2 20 intron 1 + 9559 agataaattgatgaattatt C/T actctgtgctgctgatagat 5574
ALDH1A2 21 intron 1 + (963l-9632) taaaaagaatttctaaaaga (AAGA) ccttttttttgaataactct 5575
^1 ALDH1A2 21 intron 1 + (963l-9632) taaaaagaatttctaaaaga ccttttttttgaataactct 5576 4-- ALDH1A2 22 intron 1 + 12731 ctgaaatagaaacctttcag T/A gtaccttgcagagcagtgaa 5577
ALDH1A2 23 intron 1 + 13442 cagtgtcataaagatccagc G/A gaaatcaaaatgtttcatat 5578
ALDH1A2 24 intron 1 + (14173-14176) tctaaaaaaataaataaata AAAA/Δ gagaaaattaagtttaagat 5579
ALDH1A2 25 intron 1 + 14586 actcatttat ggttcaaag C/G cttcttcaaccttaggatat 5580
ALDH1A2 26 intron 1 + 14595 ttggttcaaagccttcttca A/G ccttaggatatgcattgagg 5581
ALDH1A2 27 intron 1 + 14711 gtttgagacattaacttcta A/G ttcaactgaagatgctagtt 5582
ALDH1A2 28 intron 1 + (15327-15337) gaagagcacagtagaaagac (T)9-ll aaccctagcaatactattga 5583
ALDH1A2 29 intron 1 + 17258 atcagtacaatgtgttgggc A/G tacaacacttaatttaaaat 5584
ALDH1A2 30 intron 1 + 18277 taatacaaatcatttgaagc A/G tttactattaaaaaaacaaa 5585
ALDH1A2 31 intron 1 + 18734 ctttgagcacctactgcatt T/A taagtgctgttaagatgtgg 5586
ALDH1A2 32 intron 1 + 19081 ttaatcacctcaatctttaa C/T gaatttcttgatttttcttt 5587
ALDH1A2 33 intron 1 + 21514 aatcaggatatggggggttc G/A ttctttattctgccacaaat 5588
ALDH1A2 34 intron 1 + 21732 cattttaaaatagtgcttta A/G taggacttggctgttaaagt 5589
ALDH1A2 35 intron 1 + 21865 tggcataggtttaaaaatgt C/T tgttgtaggactcttttcca 5590
ALDH1A2 36 intron 1 + 26282 taaagaaggagaaaaaaaaa A/Δ ctaatctgagactttgcagg 5591
ALDH1A2 37 intron 1 + 27805 ggatgatgctacccaaggaa T/C tgcacacttccagacagtac 5592
ALDH1A2 38 intron 1 + 28204 tcactccattttttaactgt C/G cttcctaaatgtgtggttaa 5593
ALDH1A2 39 intron 1 + 28521 tctttgttacacttcttaaa T/C cggggtatcagataatcttc 5594
ALDH1A2 40 intron 1 + 49478 gaataaaaggatagggacat G/T ggtaagaccactttttccct 5595
ALDH1A2 41 intron 1 + 49834 gcctctcaattttctcatgt G/T taatagagagaaaaccctgc 5596
ALDH1A2 42 intron 1 + 50351 gactgactggttcataagtt C/G agaaatttcactgtggtgct 5597
ALDH1A2 43 intron 1 + 51181 tgttattaccatagtagttc C/T gtaacacttggccgttgact 5598
Table 1 112/161
Table 113/161
Table 1 114/161
Table 1 115/161
Table 1 116/161
Table 1 117/161
GENE number position SEQ. SEQ ID NO.
ALDHILI 55 intron 12 - 470 gggatggggccacctctcca T/C ctctggagatgccaggctca 5814
ALDHILI 56 intron 12 - 334 aagggcagcctcttgggcca T/C gacccctttgctgtctgcag 5815
ALDHILI 57 intron 12 - 325 ctcttgggccatgacccctt T/C gctgtctgcagcaagtgggt 5816
ALDHILI 58 intron 12 - 221 gaaggaagcgagggaagatc G/c aggaaaggagagagggacag 5817
ALDHILI 59 intron 12 - 4 cccgcttcccctcaccctgg T/C caggttggcagatcteatgg 5818
ALDHILI 60 intron 13 + 34 tcccacccagtgtgagcaca T/C gcagactggcccagccatat 5819
ALDHILI 61 intron 13 + 58 gactggcccagccatatagg A/G gaactccaagggcagcacag 5820
ALDHILI 62 intron 13 + 125 ccacaactggtggcttggaa T/C gacacctgtttattagcttg 5821
ALDHILI 63 intron 13 + 126 cacaactggtggcttggaat G/A acacctgtttattagcttgt 5822
ALDHILI 64 intron 13 + 281 acctgcatccagacgagttc T/G ggtgttgacagagttcagtt 5823
ALDHILI 65 intron 13 + 299 tcgggtgttgacagagttca A/G ttccgtgtggatgcagggct 5824
ALDHILI 66 intron 14 + 121 catttatcaaacagccatcc A/G tgtgcttcttgagcacctgc 5825
ALDHILI 67 intron 14 + 167 gccaggcattgttgtaagga C/T ttgaggacaattgtatttaa 5826
ALDHILI 68 intron 14 + 205 taatctcccagtaacactgg A/C tcagtcaggtccacggtggg 5827
ALDHILI 69 intron 14 + 219 cactggatcagtcaggtcca C/G ggtgggaaacaagagtaaac 5828
ALDHILI 70 intron 14 + 2275 tctcatctgtgatgcatccg T/C cagacctctgctcccagcct 5829
ALDHILI 71 intron 14 + 2431 agaatgactgagtgatcaga C/G ctagagagccccagccccgg 5830
ALDHILI 72 intron 14 + 2660 agccaagcatttcttgggga C/T accaagaaaccttgcttggt 5831
ALDHILI 73 intron 14 + 2740 aactccaccctcaccgtcca T/C gcagctccccaggagcgtca 5832
ALDHILI 74 intron 14 + 2756 tccatgcagctccccaggag T/C gtcagagggcagaggagggg 5833
ALDHILI 75 intron 14 + 2805 ccgcacagcaggagaatggc T/C ccaagggagggagggacggg 5834
ALDHILI 76 intron 14 + (3636-3637) tctcctgggtgtgtgtgggg (G) tgtggggcagctcccctatc 5835
ALDHILI 76 intron 14 + (3636-3637) tctcctgggtgtgtgtgggg tgtggggcagctcccctatc 5836
ALDHILI 77 intron 14 + 4347 tccaggacagaaacagcagg C/T gtgagctgcctctcagaggg 5837
ALDHILI 78 intron 15 + 380 atgtcccttatgtggcttcc A/G agaccagaagtcctggagag 5838
ALDHILI 79 intron 15 + (1055-1056) gccacaatctgcagctactc (C) tcccagcttgctgctgggct 5839
ALDHILI 79 intron 15 + (1055-1056) gccacaatctgcagctactc tcccagcttgctgctgggct 5840
ALDHILI 80 intron 17 + 15 gaaaaggtgcgtggctgggg G/C tggagcagaggaggggctgc 5841
ALDHILI 81 intron 17 + 44 aggaggggctgctgtgagtg C/T gcctgggacatggcagtgct 5842
ALDHILI 82 intron 17 + 51 gctgctgtgagtgcgcctgg G/A acatggcagtgctgtccaca 5843
ALDHILI 83 intron 17 - (2224-2223) ctggtgtcatctcccagact CT/Δ gtcactaaaccacaatatga 5844
ALDHILI 84 intron 18 + 140 agcgtcatcacaagcatagc G/A tggcaggcagcaggcttagg 5845
ALDHILI 85 intron 19 + (51-52) tggttcactgggacagcagc GC/Δ ctggctggagggggttggag 5846
ALDHILI 86 intron 19 + 399 tcaggtcagcctgggcctga C/A catggacaggggccctggag 5847
ALDHILI 87 intron 19 + 608 ccaccagatttatccactca A/G ccacacctggaagagcaggc 5848
ALDHILI 88 intron 19 + (669-670) atgggccatcctgagtcccc (C) ttgggaggtttgtaatgcct 5849
ALDHILI 88 intron 19 + (669-670) atgggccatcctgagtcccc ttgggaggtttgta tgcct 5850
ALDHILI 89 intron 19 + 1794 gtcctgtctgggggtcttaa G/C ggagtcatgagacttccaca 5851
ALDHILI 90 intron 19 + 1969 tgatcggggtgcggtttggg G/T cgacaggacaggagcagaga 5852
ALDHILI 91 intron 19 + 1972 tcggggtgcggtttggggcg A/G caggacaggagcagagaata 5853
ALDHILI 92 intron 19 + 2083 tgagaagagcagaggggtgt G/T ccgggtgctcgagtcacacc 5854
ALDHILI 93 intron 19 + 2119 acacctgtgtctgattaggg C/T tgattaggggtgcagagttt 5855
ALDHILI 94 intron 20 + 1388 ttaccctcttcccactcccg C/T tggactgtgagttccatgag 5856
Table 1 118/161
Table 1 119/161
Table 1 120/161
Table 1 121/161
Table 1 122/161
Table 1
Table 1 124/161
Table 1 125/161
Table 1 126/161
Table 1 127/161
Table 1 12B/161
Table 1 129/161
Table 1 130/161
Table 1 131/161
Table 1 132/161
Table 1 133/161
Table 1 134/161
Table 1 135/161
Table 1 136/161
Table 1 137/161
t oo o
Table 1 138/161
Table 1 139/161
Table 1 140/161
to o LO
Table 1 141/161
to o
4--
Table 1 142/161
to o Ul
Table 1 143/161
Table 1 144/161
Table 1 145/1
t o oo
Table 1 146/1
t
V oO
Table 1 147/16
Table 1 148/16
GENE number position SEQ. SEQ ID NO.
CYP3A5 12 intron 4 + 3885 acaattcacttcacgtggca C/T tgcaatagcgtcctctcgct 7100
CYP3A5 13 intron 4 + 5061 tacctacttttcaaaaaaaa A/Δ tcaccacatcatggcatccc 7101
CYP3A5 14 intron 4 + 5316 ccagatggctgggtctcccc A/T ctcccacccccgccccacat 7102
CYP3A5 15 intron 9 + 77 gttctgaaaatgtgcaggaa G/T tattccaggaagatgagaat 7103
CYP3A5 16 intron 9 + 1791 aaatttttattgggaaaaag C/T ctaccccatatttacttaca 7104
CYP3A5 17 intron 12 ■ 1408 atttaaataaaaaaaaaaaa A/Δ cacgagtccacaagaatttg 7105
CYP3A5 18 3 ' flanking + 542 tggagaaaa attcatag t T/C cattctgccttctttgaaga 7106
CYP3A5 19 3 ' flanking + 737 atgaacactgaataaaaaat T/G gtcaattcgtcagttgattg 7107
CYP3A5 20 3 ' flanking + 804 ttttccttttttattctttc A/C ttttccctccttttctgaat 7108
CYP3A7 1 5 ' flanking - 1680 cccaaggaacatgtggctcc C/A ggcacatacctggcacaaca 7109
CYP3A7 2 5 ' flanking - 1191 tagaaaatcctccacttgtc A/C aaaaggaagccatttgcttt 7110
CYP3A7 3 intron 1 + 1173 cccccatttcaaatacacct G/A cttagcaggttatcctaaac 7111
CYP3A7 4 intron 1 + 1597 tttttctgttagcctcttca T/C tgtaaccaaaagcagcatta 7112
CYP3A7 5 intron 3 + 762 tccagtgtctgcctattccc T/C tcttctttttttcttccctt 7113
CYP3A7 6 intron 7 + (1060 - 1069) atggtttcgttttctgttgg (T)9-10 ctacagaagtctttccattc 7114
CYP3A7 7 intron 11 ► (592 - 594) taagacaaggtagggaggag AAG/ Δ gaggagaattagaaaaacaa 7115
CYP3A7 8 intron 12 • 911 ccccctccattaacaatatc C/T tctcattttattccatttaa 7116
CYP3A7 9 intron 12 . 1137 gtctgtctgcagggaaaata T/Δ attcatgccttttgaaaatt 7117
CYP3A7 10 intron 12 • 2147 tattgtcagtaatttttttt T/Δ actttgatgctatactttct 7118
CYP3A7 11 exon 13 + 218 ttcatccaatgtgc gcata A/C ataatcagggattctgtacg 7119
CYP3A43 1 intron 1 + 3579 tcatgctcactttttttttt T/Δ ctcaaaatgatcagtcacac 7120
CYP3A43 2 intron 2 + 2427 tagagggaatcttttttttt T/Δ cctttttttctgctgcccag 7121
CYP3A43 3 intron 3 + 3034 tttttatatagctagggaga T/C tgtaaattaacaagtttcct 7122
CYP3A43 4 intron 3 + 3433 agtcaagataactttttttt T/Δ cataaaggaccacagtatgt 7123
CYP3A43 5 intron 3 + 3504 catgactcagtttccaacca T/C aacttttcattttggcatag 7124
CYP3A43 6 intron 4 + 2767 tagtgacttttgaaaaaaaa A/Δ ttagtaataagcaaaagact 7125
CYP3A43 7 exon 5 + 22 aaaacttaaggcacttttca G/A aaatcccattggacctaaag 7126
CYP3A43 8 intron 12 + (1585-1584) tactttgagccctcattctc (A) ccaagtcacttcagtgtcag 7127
CYP3A43 8 intron 12 • (1585-1584) tactttgagccctcattctc ccaagtcacttcagtgtcag 7128
CYP4B1 1 5 * flanking - 333 gaaacattcacagtgcttgt A/T tgagaagacagtggttatta 7129
CYP4B1 2 5'flanking - 18 gagcagctgaaggcaggtca G/T atgaaggctaggtggctgga 7130
CYP4B1 3 intron 1 + 341 tccaaaacctctggatagta C/T atagaagtaggcaatccatt 7131
CYP4B1 4 intron 1 + 542 cctatgggtggctcaggagc C/T gtgacaccttcccaggttca 7132
CYP4B1 5 intron 1 + 2856 gaggactttgcacatagtag G/A tgctcagctatattgttggc 7133
CYP4B1 6 intron 1 + (2923-2938) caacaaattggtgtgtgtgg (GT)7-8 agaatgccagctcccagatc 7134
CYP4B1 7 intron 1 + 6086 tttggaatctaaagactggg G/T cacgatgctagttgtgtgac 7135
CYP4B1 8 intron 1 + 6598 ttttggggtgtggggagagg G/A cccatagtagggagacagct 7136
CYP4B1 9 intron 1 + 6660 acctaagggtgtccatcctg A/G aggagagcagtcctaggggg 7137
CYP4B1 10 intron 1 + 7242 ccctggtctcccttaactca T/C gctggactgttccctttggt 7138
CYP4B1 11 intron 2 + 107 gcctgtgtactaagtctgcg C/G agctgaggttcccaccctac 7139
CYP4B1 12 intron 3 + 361 atggtgtggtggtaggacca C/T ggctggtcaccagaggctgt 7140
CYP4B1 13 intron 4 - 492 aaaggctttcacatctaaaa C/A gtgtctcctcattttctgtc 7141
CYP4B1 14 intron 4 - 315 ggattacttacatatacacc A/G tgcgggggagctcaccacct 7142
Table 1
Table 1 150/161
GENE number position SEQ. SEQ ID NO.
CYP4F2 23 intron 7 + (3096-3097) ggggtgggggttgggggggg (G) ttactgccttctctccagga 7186
CYP4F2 23 intron 7 + (3096-3097) ggggtgggggttgggggggg ttactgccttctctccagga 7187
CYP4F2 24 intron 8 + 145 ggtgctgtctaccttcgggt G/A ctgaagcagcccagagaccc 7188
CYP4F2 25 exon 9 + 44 ctctcctgggtcctgtacca C/T cttgcaaagcacccagaata 7189
CYP4F2 26 exon 11 + 48 gaacccatcacaacccagct G/A tgtggccggaccctgaggtg 7190
CYP4F2 27 intron 12 + 108 tggtccaagttccagctctc C/T ttccctcacctcctctggag 7191
CYP4F2 28 intron 12 + 285 gcatggggatccaggcacgg A/T taccccc tctcta tcctc 7192
CYP4F2 29 exon 13 + 238 aagtgaagcctagaattacc C/A taagaccctgttccacagtc 7193
CYP4F2 30 exon 13 + 342 tgtgcgtgaatgtteatggc G/A gccctattcacagtagccaa 7194
CYP4F2 31 exon 13 + 563 tagtgtactgtccttttata T/C gaaatttccagaacaggcca 7195
CYP4F2 32 exon 13 + 707 aaatgttccggacctagata G/C tgacgaaggtagcacgacac 7196
CYP4F3 1 intron 2 + 258 cattaatgcacctctgcggg G/T ctcttgggcagggggttggg 7197
CYP4F3 2 intron 2 + 916 ttagggacatgtcctgagtc C/T acactgctccccacaaacct 7198
CYP4F3 3 intron 2 + 3417 atccaggtctcacacagtgt C/T acttcctctcttggctttag 7199
CYP4F3 4 intron 2 + 4090 gagagcatgaattgggtcct G/A tgtctttctctccagattca 7200
CYP4F3 5 intron 3 + 89 tgtgctgcctccagcgggtc G/A cgtgcccatgtgcagacagg 7201
CYP4F3 6 intron 3 + 243 tcaagtctgctgtacggcta C/T gtcttgtcacctgtatattt 7202
CYP4F3 7 intron 3 + 502 aggtctgggacccagggtcc G/C taagtgaactgtctgagaca 7203
CYP4F3 8 intron 3 + 755 ttttgtggccatgtcaggac A/T tgtgaacacatgtcagtgtc 7204
CYP4F3 9 intron 3 + 855 gggacagacagggtgtccta G/A gtccttgtgaaggcattctg 7205 to CYP4F3 10 intron 3 + 970 cctgacatagctcctacgtg C/T catgttaggcagtgtcattg 7206
>— - CYP4F3 11 intron 6 + 122 gaggagttgttatacctgat C/T gttgaaggactggtatgaat 7207 LO
CYP4F3 12 exon 7 + 159 ggtgcacgacttcacagatg C/A cgtcatccaggagcggcgcc 7208
CYP4F3 13 intron 7 + 2107 caggttgccagtgatttttt τ/Δ ctcagaaagttttcatcaag 7209
CYP4F3 14 intron 7 + 2255 gaccaagaagggtctaggag T/A gcaagatgggcttgggtttc 7210
CYP4F3 15 intron 8 + 132 cctcaatgcaaggttgctgt A/C caccctcgggtgctgaagca 7211
CYP4F3 16 exon 9 + 59 taccaccttgcaaagcaccc G/A gaataccaggagcgctgtcg 7212
CYP4F3 17 intron 9 + 13 attgaatggtgagtgcaggt G/A ctggtgccctgttcctgagc 7213
CYP4F3 18 intron 9 + 36 ggtgccctgttcctgagcct G/C tctcat ggctctgttcccc 7214
CYP4F3 19 intron 9 + 167 acccatcctgactgtctggg C/G aaaggttataggcccttagg 7215
CYP4F3 20 intron 9 + 369 tccctaattcctaccc tcc G/A tccagtccagggatttataa 7216
CYP4F3 21 intron 9 + 458 tcattcatccatccagtcct T/C gttcagcaaatactctcata 7217
CYP4F3 22 intron 10 + 46 ctcctgggtaggaagagggg A/C ccctcaggcagggagcattg 7218
CYP4F3 23 intron 10 + 63 gggcccctcaggcagggagc C/A ttgtcctgactgcccccttc 7219
CYP4F3 24 intron 11 + 14 ccctgaggtgcgggcccccc C/G tctctgtttttgtccattcc 7220
CYP4F3 25 intron 11 + 84 gatcaggagaatccaacatc G/A cctccctccaagacacacac 7221
CYP4F3 26 intron 11 + 113 caagacacacaccactgtct T/C tccaaggctggcggactggg 7222
CYP4F3 27 intron 11 + 164 cggcaacccttcttggtctc T/G cctccaggtctatgacccct 7223
CYP4F3 28 intron 11 + 165 ggcaacccttcttggtctcg T/C ctccaggtctatgacccctt 7224
CYP4F3 29 intron 12 + 156 gaaaaggcccacagagtagg G/A ttgggttg tcctagaagga 7225
CYP4F3 30 intron 12 + 253 gagctcggctaggctcgcag T/G atatgcaagcccacatgggg 7226
CYP4F3 31 intron 12 + 346 tgggtgtcccaggccaggtt A/C ccggcttgatggggccagga 7227
CYP4F8 1 5'flanking - 61 accatgtttacccatcattg G/T tcctggagctccccagcccc 7228
Table 1 151/161
N- 4--
Table
GENE number position SEQ. SEQ ID NO.
AADAC 18 intron 4 + 679 ttagagattcagacgaattc A/G tataatcttcgatggtgtat 7272
AADAC 19 intron 4 + 1680 gttaaaatgtggataaatac C/T acaatttgcaaaatatttgg 7273
AADAC 20 intron 4 + 1748 atttagaagttctatacatc T/C ttta ag atattacacact 7274
AADAC 21 intron 4 + 1771 tatagtatattacacacttc G/A aaaacacaaaattatttttt 7275
AADAC 22 exon 5 + 238 caagtcatctcttcaaattt A/G ttaattggagttccctgctc 7276
AADAC 23 exon 5 + 678 ttagaaattggtctttctta A/G aatggtctagttaagttcca 7277
AADAC 24 3'flanking + 208 aatgctaaaaaaaaaaaaaa A/Δ tcactgtggtactttgggga 7278
CES1 1 5'flanking - 983 tatttccttagccagcggta T/C cacagtgtgtt agtgaatt 7279
CES1 2 5'flanking - 814 tcacattgccttgacatcac A/C cctactgctcctccacccta 7280
CES1 3 5'flanking - 248 agtcctgcaagggtgacacc G/Δ ttatgccacaagcagttggg 7281
CES1 4 intron 1 + 22 tgagtccttctgaagtcaaa τ/Δ atgcggggcactttttgaaa 7282
CES1 5 intron 1 + 30 tctgaagtcaaatatgcggg G/T cactttttgaaatccttgtt 7283
CES1 6 intron 1 + 1662 aagggaatccctgagctgag C/A atgaccagcccagtggtttc 7284
CES1 7 intron 1 + 1726 cctccctgaagtcctcagca A/C tcttagctggttcctcgccc 7285
CES1 8 intron 1 + 2716 tgcttccaaggaagttcatc T/G cagtattatttgtaattagc 7286
CES1 9 intron 1 + (2747-2749) tgtaattagcaacaacaaca AAA/Δ gaaaagaagctaaatattga 7287
CES1 10 intron 1 + 3288 ttatttgtccattaaagaaa A/Δ ctcaagcgcttagcctggca 7288
CES1 11 intron 1 + 3691 gagaatatgggacacccctt T/G ttcatcctctcatccagcat 7289
CES1 12 intron 1 + 3819 tccttcttgcatttattttt A/G gctggatgtttttatgcctc 7290 to CES1 13 intron 1 + 3880 aaccagctcaatgggttagg G/A aggacattgatcg catccc 7291
CES1 14 intron 2 + 74 gagtcaaggcagtcccctga T/C gggctgatcctttgctctgg 7292
Ul
CES1 15 intron 2 + 552 atggaaggtgtgtccattca C/A cctggccaagctgggaagaa 7293
CES1 16 intron 2 + 885 cagtattttagatggtaaag T/C attatgatgtaatatattgt 7294
CES1 17 intron 2 + 2001 ttggcatgtcagggctgcaa G/A actcatgtagaaatcactcc 7295
CES1 18 intron 3 + 2119 cgctgagtgcatgaatagtc T/C aggcttgagggtgatgggag 7296
CES1 19 intron 4 + 127 taaggcatccaagccccttc G/A taattggacactacctaccc 7297
CES1 20 intron 4 + 347 tctgtcatgacacttagcag T/G cagcccagcaggtgaaggtt 7298
CES1 21 intron 4 + (1984-1985) gtggtcctgaaggtcctgca (C) tgacatctctgctccccacc 7299
CES1 21 intron 4 + (1984-1985) gtggtcctgaaggtcctgca tgacatctctgctccccacc 7300
CES1 22 intron 5 + 766 gaggtgggcagagggtcagc T/C cactactggat cctcagtc 7301
CES1 23 intron 5 + 825 ggagtagatctagcctggaa T/G agcgagtgagtcactgaccc 7302
CES1 24 intron 5 + 828 gtagatctagcctggaatag C/T gagtgagtcactgaccccac 7303
CES1 25 intron 5 + 868 c cctgagcatgaactctcc T/A cccctccactctgctgtcag 7304
CES1 26 intron 7 + 68 act ct ca ttcagctgtc C/G tcttgcccagggacagtttc 7305
CES1 27 intron 7 + 681 cctccaaaatcaacaatcca A/G ttatcgcctgtctgctagtt 7306
CES1 28 intron 7 + 885 aggaactatccaaagagaaa T/C acattcatatacttcgcagg 7307
CES1 29 intron 7 + 2151 gtcgtgtaaactgaaaatct C/G aggagttgatggcttcaggc 7308
CES1 30 intron 7 + 2470 atatagatatacgaattcac G/A gagtgatgcgggaagaacct 7309
CES1 31 intron 8 + 128 cgtgtttgtttctgaggccc A/C gagaggggtagtgactcacc 7310
CES1 32 intron 8 + 2618 cctgatggcaacacatgagt T/C gggctctctctaatctgtga 7311
CES1 33 intron 8 + 2665 aaaaattattcatcaaaggt G/A aaacctaaaattaagacatg 7312
CES1 34 intron 8 + 3785 ccatggcgcatggccatgcc G/A gtctatggtactggtctcac 7313
CES1 35 intron 8 + 3791 cgcatggccatgccggtcta T/C ggtactggtctcaccctcag 7314
Table 1 153/161
Table 1 154/16
Table 1 155/161
GENE number position SEQ. SEQ ID NO.
CEL 20 intron 1 + 49040 gaaactgcactgacactaat T/G taaattttacaagtaatttt 7401
CEL 21 intron 1 + 49256 acatgagaaaagaaatggag C/A taagtttaaaaacagaatga 7402
CEL 22 intron 1 + 49386 aatagttctcagtagatatt C/A ttttacctatatttagtata 7403
CEL 23 intron 1 + 50786 tactttgtcctcaccaatgc G/A tattcttcccctaaacagat 7404
CEL 24 intron 1 + 50977 ctccagccagagaggacaga T/C agctgagtttctgtttggct 7405
CEL 25 intron 1 + 51150 agcaccatggactgtttttg C/G agtcctcctctttattatgc 7406
CEL 26 intron 1 + 52333 tcagtcaaacttaaaggctc A/C gagatctattaatgcttatg 7407
CEL 27 intron 1 + 52589 gtgtcagcatctgtagagta C/A gggagggtgttgaaagaaaa 7408
CEL 28 intron 1 + 55838 tctcgcaggtaaatgaggat G/A gaatactttaaatacaaatc 7409
CEL 29 intron 1 + 56028 ataagtttggaaaatttgtg G/C taaaatacactaaatatttc 7410
CEL 30 intron 1 + 58738 tggtggagaaataggttata G/A tgctggtcaaactgtcccat 7411
CEL 31 intron 1 + 59358 cagaaattgtactttaaaat A/G cgaactgcaagcactgcagt 7412
CEL 32 intron 1 + 59359 agaaattgtactttaaaata C/T gaactgcaagcactgcagtc 7413
CEL 33 intron 1 + 59464 acccagaaaggagcatgtcc C/G tttgtcatttgtggtgaaac 7414
CEL 34 intron 1 + 61340 aaaaaaaacttcaaaatact C/G caatatccaaagttggtaca 7415
CEL 35 intron 1 + 62739 cagtctttaggcacaaagag A/G caaagagtcttctcatctct 7416
CEL 36 intron 1 + (64764-64779) ctgggttgtttctcataaag (T)14-17 aatgtgggatagtggtataa 7417
CEL 37 intron 1 + 65243 tttcaggcttctggacagaa T/C agtattatgataaaagctat 7418
CEL 38 intron 1 + 65269 tatgataaaagctattaata T/A ttaggaagattcctctgact 7419
CEL 39 intron 1 + 65325 aattagaaaagcaagttttg G/C gggggggggtgcaaaacaaa 7420
CEL 40 intron 1 + (65326-65334) attagaaaagcaagttttgg (G)7-9 tgcaaaacaaaaaagaaaaa 7421
CEL 41 intron 1 + 65524 cacacccataaccaccagtt A/C gttgcctctcctgagccatg 7422
CEL 42 intron 1 + 65869 cagagtaacattcgggctcc A/T actgtcctttcttatagaga 7423
CEL 43 intron 1 + 65910 aaggctgtctcctgctgttt G/C tggatccaaggcctgctgaa 7424
CEL 44 intron 1 + 66000 gctgtgtttgcatgcctcac C/A gagcatattcactgtcctat 7425
CEL 45 intron 1 + (66226-66235) tctgtttttgaaaaaacaag (A) 9-10 tctctccctgcctttggaaa 7426
CEL 46 intron 1 + 81816 aatgttgccttactttccac A/G tatttccagaagccctgatc 7427
CEL 47 intron 1 + 83480 tatgactgtcaggaagaaaa T/C tagaattatctttgtgtcct 7428
CEL 48 intron 1 + 83732 ggggtttgaaatctatggag T/C catttccttctttttaaaaa 7429
CEL 49 intron 1 + 85507 ctggaaagaaattttgtgtc A/T ctgcattatttaaatgttag 7430
CEL 50 intron 1 + 87299 caatggtcattatatcttcc G/A tgtgtgaagacagtcaagaa 7431
CEL 51 intron 1 + 87426 caacaggataatcccagaat G/C ctctgtctgcccttggctct 7432
CEL 52 intron 1 + 87670 tattttgttcctcatattca T/C gacatgacacaccaacataa 7433
CEL 53 intron 1 - (77494-77503) ttggttcctgttttttcttt (A) 9-10 caactctgctaacaggggcc 7434
CEL 54 intron 1 - 77368 agctcaggggagagaacact G/C gggggaggcaagaaagcggg 7435
CEL 55 intron 1 - (75135-75129) tggcggctggcccaaggggt (G)6-7 tgggactcctctgacgcctc 7436
CEL 56 intron 1 - 74785 gctgcccacggaagctgggg G/C ctgttcgcctcttctcctgt 7437
CEL 57 intron 1 - 74755 tcttctcctgtgtccatgaa A/G cctcaggcctccaggtgcag 7438
CEL 58 intron 1 - 73099 ccccggggtctcctcctggc C/T tcttcttgccgccgcctgct 7439
CEL 59 intron 1 - 72559 agcagcagctgggccgg cc G/A tgcagggagtgaggtgggca 7440
CEL 60 intron 1 - 70098 acagggaggaaacagcaaaa T/C ctcaacactgttgatctcat 7441
CEL 61 intron 1 - 69440 gttggccatgagagaaaaca C/T aggaaggtattggaaaatga 7442
CEL 62 intron 1 - 65270 attctgcactggctgggaag G/Δ cttggcttgggcttcctggc 7443
Table 1 156/161
Table 1 157/161
GENE number position SEQ. SEQ ID NO.
UCHL3 8 intron 2 + 7862 aggtggattcacaccaccca G/A gctaactgctaacattttag 7487
UCHL3 9 intron 2 + (7936-7947) tgatcatttcaaacacaggg (T) 11-12 aattgtaaaagtaggacatt 7488
UCHL3 10 intron 2 + (7975-7988) aaagtaggacattttaatga (T)12-14 gaagacgtgagtggtaaaag 7489
UCHL3 11 intron 2 + 8117 cctgactcatggcaatctgg A/C gtcaggatctaacaatatat 7490
UCHL3 12 intron 2 + 8361 ttgttagc ttggctgacat G/A gagtagatttgcagtgaact 7491
UCHL3 13 intron 2 + 9800 taagatatagtgatgcattt C/T taatatgatttttgtttcct 7492
UCHL3 14 intron 2 + (10738-10747) taccaactaatgttccattg (T)9-10 ctttctttcttttaccagtt 7493
UCHL3 15 intron 3 + 11 tacagaaaaggtaattgtta A/T gtaaaatagaaagtttctgg 7494
UCHL3 16 intron 3 + (662-675) cttaaatacagttttttcaa (TA)6-7 aggaatcttctttgcttatt 7495
UCHL3 17 intron 3 + 866 tcaagtctacatattttagt T/C tttttttctagaatgatata 7496 tacatacgtatacgtatata
(TGTATACGTATACATACGTATACATA ATACATACGTATATA) 7497
UCHL3 18 intron 3 + (944-945) cgtacgtatatacgtatacg tacatacgtatacgtatata
7498
UCHL3 18 intron 3 + (944-945) cgtacgtatatacgtatacg
UCHL3 19 intron 3 + 5052 aggcagtcagctatagagcc T/C acatttttgatgcttattat 7499
UCHL3 20 intron 3 + 5282 acctctattaagtttttgca T/C accctttcagactttccaat 7500
UCHL3 21 intron 6 + 2191 tttctaggggtttcctagtg C/T gtagagcagtgattctcaag 7501
UCHL3 22 intron 6 + 8264 tctgcaagtcaaatgtgaag G/C caagaaagaaaaatccaaaa 7502
UCHL3 23 intron 6 + (8741-8744) atgtgagtaaaccacaattt ATTT/Δ ttcatttccttaacttttga 7503 to UCHL3 24 intron 6 + 9411 tectctgtttagaatc act T/G ggcttttttggcccagccag 7504 t oo UCHL3 25 intron 6 + 9459 tgtcagtggcagtaaatagt T/A taaagtttcatcttcattag 7505
UCHL3 26 intron 6 + 9772 gaaacaatacatgtatcatg T/C ggttcaagatgtagagtcca 7506
UCHL3 27 intron 6 + 10158 ttattttaaaggaaaattct C/T agaccgaacttaccagttca 7507
UCHL3 28 intron 6 + 10839 tttactaaaaaatctacaga A/C atccatttagaattaattta 7508
UCHL3 29 intron 6 + 12493 agtcaaattagttgacagtt A/G atgggcgagtgaccttgcaa 7509
UCHL3 30 intron 6 + (20435-20437) ttttttaattatgtagtcct CCT/Δ cgccatcctcatcacagcct 7510
UCHL3 31 intron 6 + 21202 ttgatctgatctttcctgcc C/T attcagtttctaaagatctt 7511
UCHL3 32 intron 6 + 21295 caaatttatgatttctcttt T/C ataggctaatgatatctgca 7512
UCHL3 33 intron 6 + 21639 taagaacaattaaaagtcaa C/T ggcaagcattctttccttcc 7513
UCHL3 34 intron 6 + 21778 tccatttctgctgagtatca A/G caaactcacatctctttcta 7514
UCHL3 35 intron 6 + 23299 cttttagattaaaggtgcaa T/C gatgcacaattttgagtcac 7515
UCHL3 36 intron 6 + 23498 tattcagttctctgactcca A/G ttgtactacttttacctcta 7516
UCHL3 37 intron 6 + 23790 ttagccttaaaaaattggac A/T ctcttctgattattgataaa 7517
UCHL3 38 intron 6 + 23894 actcattatcactgtcttca A/C atatttaaagaaatatgttc 7518
UCHL3 39 intron 6 + (24729-24732) agtcttaatttcaaattgtt TGTT/Δ aagcatcaaagcaagagaaa 7519
UCHL3 40 intron 6 + (25083-25084) catg atteatttcattcag (A) taagtatgcaatgtgcatat 7520
UCHL3 40 intron 6 + (25083-25084) catgtattcatttcattcag taagtatgcaatgtgcatat 7521
UCHL3 41 intron 6 + 25084 catgtatteatttca tcag C/T aagtatgcaatgtgcatata 7522
UCHL3 42 intron 7 + 1342 gaagaagtcattattttggt G/A gtatataatggacctccagg 7523
UCHL3 43 intron 7 + 1387 ttttgaagatgtgccttgct G/A attgagtctacaaaatctgc 7524
UCHL3 44 intron 7 + 1760 actcggttttactagttaga T/G agctgtcttggctcagaggc 7525
UCHL3 45 intron 7 + 2096 taggtacattacaaagatgg G/A cagttgctgattcattgcaa 7526
Table 1 158/161
Table 1 159/1
Table 1 160/1
Table 161/1
--
In Table 1, the name of the gene encoding the drug metabolizing enzyme is recorded in the gene name column. The base in capital letters is the SNP data in the sequence column. Two bases separated by a forward slash indicate the SNP of homo and hetero bases. For example, A/G indicates a homo allele A/A and G/G as well as a hetero allele A/G. The sequences in this table have 20 bases before and after the SNP. Here, the base in parentheses, for example the 26th (T) in ABCB4, indicates a polymoφhism with an inserted base, and D, such as the 10th spot in NAT2, indicates a polymorphism with a deleted base. In Sequence No. 674, n is VNTR and (cctgy)x, where x is an integer between 1 and 50, indicates a repeated sequence. The bases with numbers in parentheses indicate the number of times they are repeated. For example, "(T) 9-12" in Sequence No. 1552 (ABCB11 No. 55 in Table 1) indicates T is repeated 9 to 12 times.
Here, "position" indicates the position of the SNP genome. The position of SNPs in the 5' flanking region, intron region and 3' flanking region are intron base sequences counted as a single number starting at the exon-intron junction. The position of SNPs in the exon region are exon base sequences counted as a single number starting at the exon- intron junction. Also, (+) or no symbol indicates a number counted in the 3' upstream direction and (-) indicates a number counted in the 5' downstream direction. The number in the "number" column indicates the position of the SNP in the gene maps of the various genes (FIG 9 through FIG 141 and FIG 144 through 312).
The sequence represented by the SEQ ID Nos. 1-3360 and 3361-7669 can readily be associated with the corresponding gene, chromosome, and chromosomal position. Each of the genes shown in Table 1 correlates to a corresponding Figure in the present application. The Figures show a map of the gene with positional identifiers for each of the polymoφhisms. The Figures also provide an accession number that correlates to public genome databases, allowing the genetic context of the polymoφhism and the gene to be understood. Using the information in Table 1, the Figures, and public genome databases, one skilled in the art is able to identify flanking sequences. This allows, for example, the development of PCR primers that flank the polymoφhism. Considerations for PCR primer design are known in the art for both single PCR reactions and multiplex reactions (See e.g., Henegariu et al., BioTechniques 23:504-511 [1997] and PCR Applications, edited by Innis, Gelfand, and Sninsky, Academic Press, San Diego, CA 1999), each of which is herein incoφorated by references in its entirety). Examples of primers that find use in the amplification of sequences containing polymoφhisms, as well as amplification conditions, are found at the HVIS-JST JSNP database website (See, submissions from Laboratory for Genotyping, The SNP Research Center, The Institute of Physical and Chemical Research (RIKEN)).
One example of information generated using SEQ ID Nos. 1-3360 and 3361-7669 and information in publicly available databases is provided in Figure 143. The first column in this figure shows that 3360 entries are made, corresponding to the 3360 entries found in Table 1. The second column, entitled "GENE" provides a gene name abbreviation, while the next column provides a long gene name. The next columns show the chromosome (CHROM), a reference mRNA accession number (REF. MRNA), a locus link database accession number (L-LINK), an OMBVI database accession number (OMHVIJD) which allows disease association information to be readily obtained, the exon count for the gene (EXONS), and the number of polymoφhisms in the gene (NO GENE).
Creating an Oligonucleotide Probe or Oligonucleotide Primer
In some embodiments, an oligonucleotide used as a primer and/or probe in the detection method of the present invention serves as the template of the base sequences (Sequence No. 1 through 3360 and 3361 through 7669) shown in Table 1 if, for example, a SNP is to be detected. The primer/probe can be designed so it is synthesized as the base sequence itself or as a portion of the base sequence. In preferred embodiments, the SNP is included in the base sequence of the primer/probe (and denoted in capital letters in the base sequence column of Table 1). The primers/probes may also be complementary to the non-mutant sequence.
The SNP in the following example is designed so it is on the 3' or 5' end of the base sequence. It is designed to be within four bases of the 3' or 5' end, and ideally within two bases of the end. The SNP can also be in the center of the oligonucleotide base sequence. Here, "center" means the number of the bases from the SNP base to the 5' end is substantially equal to the number of bases from the SNP base to the 3' end. If there is an odd number of bases in the oligonucleotide, the central region should be essentially five bases in length, preferably three bases in length, and ideally one base in length. In a base sequence with 41 bases, for example, the central region should be bases 19 through 23, preferably bases 20 through 22, and ideally base 21. If there is an even number of bases, the central region should be four bases and ideally two bases. In a base sequence of 40 bases, for example, the central region should be bases 19 through 22 and ideally base 20.
If the polymoφhism consists of a plurality of bases, in some embodiments, the probe/primer is designed so the full polymoφhism sequence is contained in the probe/primer. In some preferred embodiments, it is designed so one of the bases 1 through 4 on the 5' end or 3' end complementing the primer DNA corresponds to the base at the very end of the polymoφhism bases. (This is called the "corresponding base"; ideally, it is the base at the 5' or 3' end). For example, in the INVADER assay, if a probe and INVADER oligonucleotide are prepared to detect a genetic polymoφhism (CAGAGGCT) in No. 12 of NDUFA7 in Table 1 (Sequence No. 828), the position of the corresponding base in the probe in FIG 4a (a "T" base in the figure) is designed to become "C" at the far left of sequence CAGAGGCT, and the N base in the INVADER oligonucleotide shown in FIG 4b is designed to replace the "C" at the far left of CAGAGGCT with A, T, C or G). Conversely, if designed so the position of the corresponding base in the INVADER oligonucleotide is the far right "T" in CAGAGGCT, the "N" base is such that the corresponding base in the probe is "T." Further, the corresponding base of the INVADER oligonucleotide and the allele probe can be set anywhere in the CAGAGGCT sequence.
In preferred embodiments, the length of the base sequence is at least 13 bases, preferably between 13 and 60 bases, more preferably between 15 and 40 bases, and ideally between 18 and 30 bases. These oligonucleotide base sequences can be used as probes, as forward (sense) primers or as reverse (anti-sense) primers to detect target genes.
These oligonucleotides can link regions hybridized with genome DNA in tandem to unhybridized regions. The linking order can be upstream or downstream. The hybridized regions in these oligonucleotides can be designed from base sequence data containing the SNP described in Table 1, and created so the sequence containing the region hybridized with genome DNA closest to the 5' or 3' end is the SNP. These oligonucleotides can be used as probes to detect SNP using the INVADER assay.
The primer used in some embodiments of the present invention is designed to determine the functional change caused by the SNPs in the base sequences in Table 1, to determine whether the change is effective or ineffective, and to determine the existence of side effects. It is designed to include the SNP in the PCR-amplified base sequence. In some preferred embodiments, the primer should have at least 15 base sequences, preferably between 15 and 30 base sequences, and ideally between 18 and 24 base sequences. The template DNA regions in the primer base sequence should contain 500 bp or less amplified fragments, preferably between 100 and 300 bp fragments, and ideally between 100 and 150 bp fragments.
The oligonucleotide probes and primers designed in this manner can be synthesized chemically using any method commonly known in the art. For example, the oligonucleotides can be synthesized using a commercially available chemical synthesis device. The production of probes can be conducted automatically by adding fluorescent tags (e.g., FAM, VIC, Cy3) or other labels.
These oligonucleotides can be included in genetic polymoφhism detection kits along with polymerase (e.g., Taq polymerase), a buffering solution (e.g., a Tris buffering solution), dNTP, fluorescent dyes (e.g., VIC, FAM), or other desired kit components.
Detection
In some embodiments, the oligonucleotides prepared in the examples above are used as primers/probes, and the genes or a portion thereof (template DNA) encoding the drug metabolizing enzyme is amplified using DNA polymerase. A primer/probe prepared in this manner can be hybridized with template DNA and used to detect DNA with the target genetic polymoφhism. The DNA used as the template can be prepared using any method commonly known in the art. Examples include cesium chloride density gradient ultra centrifugation method, the SDS solvency method or the phenol chloroform extraction method. 1 Detection Using PCR
The amplification can be performed using a polymerase chain reaction (PCR). The DNA polymerase can be LA Taq DNA polymerase (Takara), Ex Taq polymerase (Takara), Gold Taq polymerase (Perkin Elmer), AmpliTaq (Perkin Elmer) or Pfu DNA polymerase (Stratagene), as well as other polymerases.
An illustrative example of amplification conditions is provided below. The present invention is not limited to the conditions provided in this example. In preferred embodiments, each cycle in the transforming phase should last between 10 and 40 seconds at 85SC to 105eC and preferably 20 and 30 seconds at 94SC, each cycle in the annealing phase should last 30 seconds to 1 minute at 50QC to 72SC and preferably 20 seconds to 1 minute at 60QC, and each cycle in the elongation phase should last 1 minute to 4 minutes between 65QC and 75QC and preferably 2 minutes to 3 minutes at 72QC. There should be 30 to 40 cycles, although fewer or more cycles are contemplated. In order to completely transform the template DNA and the primer, each cycle in the transforming phase should last 1 minute to 5 minutes at 95SC before the amplifying cycle. If AMPLITAQ GOLD polymerase manufactured by Applied Biosystems is used, it should last from 8 minutes to 15 minutes and ideally from 10 minutes to 12 minutes. In order to completely elongate the amplified DNA, the elongation phase should last between 1 minute and 10 minutes at 72QC after the amplification cycle. If the amplified product is not immediately detected, it should be processed again at 4eC to make sure the amplification was not irregular. In this way, the gene encoding the drug metabolizing enzyme is amplified.
After amplification, gel electrophoresis is performed on the amplified product, the amplified product is stained using ethidium bromide or SYBR Green, and one, two or three bands are detected in the amplified product (DNA fragments) to determine the portion (DNA fragment) of the drug metabolizing enzyme containing the genetic polymoφhism in the gene encoding the drug metabolizing enzyme. Polyacrylamide gel electrophoresis or capillary electrophoresis can be performed instead of aerogel electrophoresis. PCR can be performed using a primer tagged with a fluorescent dye to detect the amplified product. A detection method that does not require electrophoresis can also be used, such as bonding the amplified product in solid phase to a microplate and detecting the amplified product using a fluorescent or enzymatic reaction.
2. Detection Using the TAQMAN PCR Method In the TAQMAN PCR method, the PCR reaction is performed using a fluorescent dye-tagged allele-specific oligo and Taq DNA polymerase. The allele-specific oligo used in the TAQMAN PCR method (TAQMAN probe) can be designed based on the SNP data. The 5' end of the TAQMAN probe is tagged using a fluorescent reporter dye R such as FAM or VIC, and the 3' end is tagged using a quencher Q (light-quenching substance). (See FIG 1.). Here, the fluorescent light energy absorbed by the quencher is not detected. Because the 3' end of the TAQMAN probe is phosphorylated, there is no elongation reaction from the TAQMAN probe in the PCR reaction (FIG 1). However, a PCR reaction is performed on the TAQMAN probe with TaqDNA polymerase and a primer designed to amplify the region containing the SNP. The following reaction occurs. First, the TAQMAN probe is hybridized in a specific sequence of template DNA
(FIG 2a) and an elongation reaction is simultaneously performed from the PCR primer (FIG 2b). Because the Taq DNA polymerase has 5' nuclease activity, the hybridized TAQMAN probe is severed as the PCR primer elongation reaction continues. When the TAQMAN probe is severed, the quencher has no effect on the fluorescent dye, and the fluorescent light is detected (FIG 2c).
For example, suppose there is an A allele (Allele 1) and a G allele (Allele 2) at the SNP position as shown in FIG 3. Allele 1 is tagged by a specific TAQMAN probe with FAM and Allele 2 is tagged by a specific TAQMAN probe with VIC (see FIG 3). Two different allele-specific oligos are added to the PCR drug, and TAQMAN PCR is performed on the detected template. The fluorescence detector then detects the fluorescent intensity of the FAM and VIC. When the SNP position in the allele and the position corresponding to the SNP in the TAQMAN probe are complementary, the probe is hybridized with the allele, the fluorescent dye in the probe is severed by the Taq polymerase, the effect of the quencher is eliminated, and the intensity of the fluorescence is detected. If the template is homozygous for Allele 1, strong FAM fluorescence is detected and hardly any VIC fluorescence is detected. If the template is hetermozygous for Allele 1 and Allele 2, both FAM and VIC fluorescence are detected.
3. SNP Detection Using the INVADER assay
In the INVADER assay, an allele-specific oligo and the template are hydridized to detect the SNP. In the INVADER assay, two different non-tagged oligos and one fluorescent dye-tagged oligo are used. One of the two non-tagged oligos is known as the probe. In some embodiments, the probe has a region hybridized to the genome DNA (template DNA) and a region (called a flap) that is not hydridized with the genome DNA, and that has a sequence unrelated to the sequence of the genomic DNA. The hybridized region has base sequences corresponding to the SNP (FIG 4a). The flap sequence is complementary to a FRET probe (described below). The other of the two non-tagged oligos is called the INVADER oligonucleotide. This oligonucleotide is designed so that it is hybridized in complementary fashion from the SNP position towards the 3' end of the genome DNA (FIG 4b). In some preferred embodiments, the sequence corresponding to the SNP position can be any base (denoted by N in FIG 4b). When the template DNA genome is hybridized with the two probes, the base (N) from the INVADER oligonucleotide is inserted in the SNP position (FIG 4c) forming a cleavage structure at the SNP position.
In some embodiments, the fluorescent dye-tagged oligonucleotide is a sequence completely unrelated to the alleles. This probe is a FRET (fluorescence resonance energy transfer) probe (FIG 5). The fluorescent dye R tags the base (reporter) at the 5' end of the FRET prove. A quencher Q absorbs the fluorescence. Here, the quencher absorbs the fluorescent light and the light is not detected. A specific region (Region 1) is designed on the 5' end of the FRET probe (reporter base) to face the 3' end from Region 1 (This region is Region 2). As a result, Region 1 and Region 2 form a complementary duplex (FIG 5). The 3'-region from the regions forming the complementary duplex can be hybridized with the flap of the allele probe to form a complementary chain (FIG 5). In the INVADER assay, a cleavage agent (e.g., CLEAVASE enzyme, Third Wave
Technologies, Madison, WI) is used, which is an enzyme (5' nuclease) with specific endonuclease activity for identifying and cleaving a specific DNA structure. When the genome DNA, the probe and the INVADER oligonucleotide form a cleavage structure at the SNP position, the cleavage agent severs 3' of the SNP position on the allele probe. The section with three bases forming a flap with the 5' end is identified as shown in FIG 4c, and the flap is severed. The structure with the SNP position is identified by the cleavage agent (FIG 6a), the probe is severed at the flap position, and the flap is separated (FIG 6b). Next, the released flap from the probe bonds with the FRET probe in complementary fashion to form a duplex (FIG 6c). The cleavage agent identifies this structure and cleaves the section with the fluorescent dye. The cleaved fluorescent dye is no longer affected by the quencher and fluorescent light becomes detectable (FIG 6d). If the SNP position does not match the sequence corresponding to the SNP in the allele probe as shown in FIG 7, the specific DNA structure is not identified by the cleavage agent, the probe is not severed, and fluorescent light is not detected.
When the SNP is T/C, for example, a T INVADER oligonucleotide, a T probe, a FRET probe with FAM bonded to the reporter for the T SNP, a C INVADER oligonucleotide, a C probe and a FRET probe with VIC bonded to the reporter for the C SNP are prepared. These are combined and SNP detection is performed. If there is a T/T homo, FAM fluorescence is generated. If there is a C/C homo, VIC fluorescence is detected. If there is a T/C hetero, both FAM and VIC fluorescence are detected. Because the FAM and VIC fluorescence wavelengths are different, both can be readily identified.
Detection Using the SniPer Method
In order to detect SNP using the SniPer method, an allele identifier is amplified using RCA. The genome DNA template is a straight chain, and a probe is hybridized with the genome DNA. When there is a complementary match between the probe sequence and the genome DNA template sequence and a complementary chain forms, a ligation reaction on the genome DNA forms a ring. As a result, RCA continues on cyclic DNA. If the end of the probe does not match the genome DNA, the RCA reaction does not occur because there is no ligation and no ring. In the SniPer method, therefore, a single chain probe is designed to anneal the genome DNA and create a ring. This single chain probe is called a padlock probe. The severed end of the padlock probe is the sequence corresponding to the target SNP. The padlock probe and the genome DNA mix and a ligation reaction occurs. If the severed end of the padlock probe and the SNP section of the genome DNA are complementary, the severed end of the padlock probe connects and forms a ring during the ligation reaction. If they are not complementary, a ring does not form. Therefore, only a padlock probe corresponding to the target SNP forms a ring and is amplified by the DNA polymerase. The presence of amplification is used to detect the SNP. A synthetic oligonucleotide with a haiφin structure and a fluorescent dye and quencher on both ends can be used in the detection process.
Detection Using the MALDI-TOF/MS Method
In the matrix assisted laser desoφtion-time of flight/mass spectroscopy (MALDI- TOF/MS) method, SNP typing is performed using a mass spectrometer. A preferred embodiments of this method has the following steps.
(i) PCR Amplification and Refinement of DNA Fragments Containing SNP
After making sure the base at the SNP location and the PCR primer do not overlap, the DNA fragment is amplified, exonuclease or alkali phosphatase processing is performed on the amplified product, the dNTP is removed, and the amplified fragment is refined. (ii) Primer Extension Reaction (Thermal Cycle) and Refinement
A primer ten or more times the template in the region identified as the PCR product is added, a thermal cycle reaction is performed, and a primer elongation reaction is performed. The primer used here is designed so the 3' end is next to the base corresponding to the SNP position. The primer length should be 15 to 30 bases, ideally 20 to 25 bases. If there is a multiplex reaction, a sequence that is not complementary to the template is added to the 5' end. There should be 20 to 30 (ideally 25) thermal cycles at two different temperatures. These should be 85 to 105SC (ideally 94QC) and 35 to 40°C (ideally 37QC).
The reaction product is then refined using a refining kit so it can be used in the mass spectrometer.
(iii) Mass Spectroscopy Using a Mass Spectrometer The elongated and refined reaction product is applied to the mass spectrometer, and a quality of the target product is measured. In other words, the refined product is mixed with the matrix and 0.5 to 1.0 mL spots are formed on the MALDI plate. After drying the plate, the substance is irradiated by a laser beam and a spectrogram is produced.
Detection Using the Base Sequence Determining Method
In the present invention, a polymoφhism can be detected using an elongation reaction on a single base. In other words, four different types of dideoxynucleotides identified by different fluorescent compounds are added to reaction systems including the gene to be detected and a single base elongation reaction is performed. Here, the base to be elongated is the polymoφhism. Two reactions are performed; one to stop the DNA synthesis and another to identify the 3' end of the DNA molecule with fluorescence. Electrophoresis is performed on four different reaction solutions with the same lanes and capillaries for the sequencing gel. The sequence is determined by detecting the differences in the fluorescent dyes identifying the DNA bands using a fluorescence detector. The oligonucleotides with one base elongated have the elongation confirmed using different types of fluorescent dyes in a fluorescence detector and mass spectrometer. Instead of fluorescent-tagged dideoxynucleotides, the primer can be identified using fluorescence used with non-tagged dideoxynucleotides.
Drug Evaluation
Using information obtained by the methods of the present invention, the efficacy and stability of the drug metabolized by the drug metabolizing enzyme can be evaluated. For example, in some embodiments, the drug can be evaluated using a typing system. In other words, the frequency of expressed and unexpressed alleles (e.g., toxic alleles that cause undesired side effects) can be compared using any one of the detection methods mentioned above. Once they have been compared, markers can be selected to indicate, for example, a toxic expression where the allele frequency differs. In statistical analysis, this is usually set as x2. However, this is different in other methods such as the Fisher method. The active components (altered and metabolized drug components) in the drug will be reflected in blood and tissue concentrations. All of the genetic polymoφhisms can be checked against the causes of the toxic effects to isolate specific correlating genetic polymoφhisms. The substances corresponding to the probes or primers used to analyze all of the genetic polymoφhisms are prepared beforehand on reaction plates, cards or glass plates, and unprepared human genome DNA is added and reacted to determine the allele pattern. If there are genetic polymoφhisms correlating with toxicity or other phenotypes, then human side-effects can be expected or predicted. The same is true of drug effectiveness. Because the genetic polymoφhisms correlating to effectiveness and side-effects differ depending on the drug, typing performed using genetic polymoφhisms can be performed to anticipate effectiveness and side-effects. Differences in allele frequency can be determined in certain instances by comparing the frequency of genetic polymoφhisms to effectiveness/ineffectiveness or the presence/absence of side-effects. If, for example, an SNP analysis is performed on persons with a toxic reaction (side-effect) to Drug A, the results may show a 90% of the people have T/T (e.g., detected based on the intensity of fluorescent FAM light). The same results may show 10% of people with no toxic reaction have a T/T and 90% have a C/C. As a result of the SNP analysis, the evaluation may be not to administer Drug A to persons with T/T.
Exemplary drugs and drug-related data and other information that find use in or with the present invention, including but are not limited to the methods and databases described herein, are described in the PHYSICIANS' DESK REFERENCE (PDR). (e.g., 2002 Edition, Medical Economics Company, Inc., Montvale, NJ). The PDR is expressly incoφorated by reference herein as if fully set forth.
Drug Screening
In the present invention, the genetic polymoφhism data obtained as described above is compared to genetic polymoφhism data from genes encoding certain drug metabolizing enzymes to indicate the safety and effectiveness of drugs metabolized by these drug metabolizing enzymes. Therefore, the genetic polymoφhism data obtained using the method of the present invention can be used to determine the likely effectiveness of certain drug therapies and to select the appropriate drug. The evaluation methods described above can be used. Genetic polymoφhisms with correlations to side-effects and effectiveness are said to be influenced by the activation, transfer and translation of certain enzymes. The cause and effect relationship with the side-effect or effectiveness expression mechanism may be indirect. The metabolization of drugs is being studied by pharmaceutical companies in laboratory and clinical testing. If there are genetic polymoφhisms in enzyme genes correlating with severe side-effects, they can be removed and used under different conditions. The same is true of effectiveness. Drugs can be screened, therefore, using side-effects and effectiveness data. A wide variety of conditions and diseases (See e.g., Physician's Desk Reference) benefit from analysis using the systems and methods of the present invention. In some embodiments of the present invention, a sample is taken from a subject (e.g., by a drug company) and sent to a laboratory for analysis using a detection assay. The laboratory results (e.g., detection assay test result data) is returned to the party providing the sample such that an appropriate decision can be made, including, but not limited to, development or administration of a drug to a subject.
In clinical testing (Tests I through III), the frequency of the expression of genetic polymoφhisms can be studied in volunteers exhibiting certain side-effects and volunteers not exhibiting the same side-effects to a drug. In this way, novel genetic polymoφhisms correlating with side-effects and effectiveness can be detected. This information can be used to screen drugs.
EXPERIMENTAL EXAMPLES
The following examples are provided in order to demonstrate and further illustrate certain preferred embodiments and aspects of the present invention and are not to be construed as limiting the scope thereof.
Example 1 Obtaining SNP Data
(1) DNA Extraction Blood was extracted from 48 unrelated people in the presence of EDTA. The DNA was extracted in the following way based on the method in the Genome Analysis Manual (Yusuke Nakamura ed., Springer- Verlag Tokyo).
Ten milliliters of blood was transferred to a 50 ml test tube and centrifuged for five minutes at room temperature and 3000 φm. After the supernatant (blood serum) had been removed using a pipette, 30 ml of RBC-dissolving buffer (10 mM NH4 HCO3, 144 mM NH3C1) was added. After mixing until there was no sediment, it was allowed to stand for 20 minutes at room temperature. After being centrifuged for five minutes at room temperature and 3000 φm, the supernatant (blood serum) was again removed using a pipette to obtain white blood cells. Another 30 ml of RBC-dissolving buffer was added and the process was repeated twice. Then, 4 ml of proteinase K buffer [50 mM Tris-HCl (pH 7.4), 100 mM NaCI, 1 mM EDTA (pH 8.0)] was added to the white blood cells, 200 ml of SDS was added, 200 ml of 10 mg/ml proteinase K was added, and the solution was tumble-mixed. The solution was then allowed to stand overnight at 37SC. The next day, 4 ml of phenol was added, and the solution was slowly tumble-mixed for four hours using a Taitec T-50 Rotator. After being centrifuged for 10 minutes at room temperature and 3000 φm, the supernatant was removed using a new tube. Then, 4 ml of phenol- chloroform-isoamylalcohol (volume ratio 25:24:1) was added, the solution was tumble- mixed for two hours in the manner described above, and the solution was centrifuged. The supernatant was removed using a new tube, 4 ml of chloroform-isoamylalcohol (volume ratio 24:1) was added, and the solution was tumble-mixed. Fibrous white precipitate (DNA) was removed using a 2 ml tube, 1 ml of 70% ethanol was added, and the solution was tumble-mixed. The DNA was transferred to a new tube, dried and dissolved in 500 ml of TE solution [10 mM Tris-HCl (pH 4.7), 1 mM EDTA (pH 7.4)] to obtain a genome DNA sample. (2) PCR
A genome sequence was obtained from the GenBank DNA Database. After removing the repeating sequences using the RepMask computer program, the PCR primer was set so there would be approximately 1 kb of PCR product. The genome DNA from 48 unrelated people was prepared at the same concentration. After mixing the same amount of DNA from three people in a single tube, 60 ng was used in the PCR. The PCR was Ex-Taq (Takara 2.5 U) and performed using the GeneAmp PCR System 9700 (PE Applied Biosystems). After reacting for two hours at 94δC, denaturing was performed for 30 seconds at 96SC, annealing was performed for 30 seconds at 55SC or 60QC, and elongation was performed for one minute at 72SC in each cycle. There were 35 cycles. (3) Sequence
After refining the PCR product using Arraylt (Telechem), the sequence reaction was performed using the BigDye Terminator RR Mix (PE Applied Biosystems). After reacting for two hours at 96SC, denaturing was performed for 20 seconds at 96QC, annealing was performed for 30 seconds at 50QC, and elongation was performed for 4 minutes at 60δC in each cycle using the GeneAmp PCR System 9700 (PE Applied
Biosysytems). There were 25 cycles. After the sequencing reaction, the sequencing was analyzed using the ABI Prism 3700 DNA Analyzer.
(4) SNP Detection
An analysis was performed on the SNP detection using the PolyPhred computer program (Nickerson et al., 1997, Nucleic Acid Res., 25, 2745-2751).
(5) Results
The SNP results shown in Table 1 were obtained. The analyzed drug metabolizing enzyme, the abbreviation of the enzyme, the databank (GenBank) accession number, the structure of the gene for the drug metabolizing enzyme, and the position of the SNPs are shown in FIG 9 through FIG 141 and FIG 144 through 312. In FIG 9 through FIG 141 and FIG 144 through 312, the exons are blank boxes or black lines in the genes denoted by the horizontal lines. The position of the SNPs is denoted above the genes with solid lines and numbers.
Example 2
Typing
Typing was performed on two different groups of patients using the INVADER assay. In FIG 142, the x-axis (Allele 1) indicates the intensity of the FAM fluorescent light corresponding to T, and the x-axis (Allele 2) indicates the intensity of the VIC fluorescent light corresponding to C. The slanted line indicates the SNP pattern for T/T, the black circles denote the pattern for C/C, and the white circles denote the pattern for T/C. The black squares indicate the background values. The x marks indicate where the detection failed. The group of patients in the graph for panel A (top) had many C/C SNP patterns and the group of patients in the graph for panel B (bottom) had many T/T SNP patterns.
Example 3 SNP Detection
Genome DNA was extracted from five unrelated people using the method described in Example 1, and the SNPs in three different drug metabolizing enzyme genes (EPHXl, ABCB2, AANAT) were detected using the INVADER assay method. The INVADER oligonucleotides and probes were designed using base sequence No. 3 (Sequence No. 49) and No. 17 (Sequence No. 63) in the case of EPHXl, base sequence No. 4 (Sequence No. 4) and No. 11 (Sequence No. 11) in the case of ABCB2, and base sequence No. 3 (Sequence No. 561) in the case of AANAT. The positions of the SNPs are shown in Table 1.
The results are shown in Table 2.
Table 2
As shown in Table 2, the SNPs in the drug metabolizing genes of patients can be detected and the patterns determined using the method of the present invention. Example 4 Correlation between SNP genotypes and optimal amounts of a medicament for treatment validity and safety
In this example, validity and safety of medicaments were investigated using SNP analysis.
Thiopurine S-methyltransf erase (TPMT) is an enzyme that transfers a methyl group to a sulfur atom attached to a purine ring, and is one of the major enzymes for metabolizing drugs such as the anti-cancer agents 6-mercaptopurine and 6-thioguanine, and thiopurine derivatives such as the immunosuppressive agent azathioprine. This example shows a correlation between optimal amounts of azathioprine and various combinations of the alleles at the 868th SNP of intron 3 of TPMTfAccession No. AB045146.1) (G or T alleles) and the 2682nd SNP of intron 3 (C or A alleles)(Table 3 and Table 4).
Table 3
Optimal amounts of azathioprine were determined by adopting suppression of rejection after renal transplantation as an index. A group of patients in which the validity of treatment with 100 mg/day of azathioprine was confirmed was designated as a high dose group, and a group of patients in which side effects developed with treatment of 100 mg/day, but in which validity was confirmed with a treatment of 50 mg/day was designated as a low dose group. Table 3 indicates the number of patients having each combination of alleles, with the columns labeled "High" and "Low" representing the numbers of patients of each genotype in the high dose and the low dose groups, respectively. Side effects include leukopenia, anthema, angiitis, nausea/vomiting, anorexia, diarrhea, malaise, myalgia, arthralgia, fever, chill, and dizziness. More serious side effects include, for example, blood disorders, shock-like symptoms, infectious diseases, and hepatic disorders, and renal disorders.
Investigation of a correlation between the high dose and low dose groups and the two types of SNPs indicated above revealed that when G is present in at least one allele at the 868th SNP of intron 3 (G/G homozygous or G/T heterozygous) and A is present in at least one allele at the 2682nd SNP of intron 3 (A/A homozygous or A/T heterozygous), side effects were developed with 100 mg/day and 50 mg/day was an optimal amount for 10 out of 12 patients (low dose group), while 100 mg/day was an optimal amount for 11 out of 12 patients with other allele combinations (high dose group) (Table 4). Investigation of this combination of two SNP loci in patients enables prediction of optimal amounts of azathioprine for treatment prior to the administration of the drug, for improved validity and safety. These results indicate that the validity and safety of medicaments can be predicted using analysis of SNPs associated with medicament metabolic enzymes, e.g., as described in this specification and including but not limited to the DME-associated SNPs listed in Table 1. As used in this example only, the term "optimal amount" refers to the best dosage selected from the tested amounts of 50 mg/day or 100/mg per day. It will be appreciated by those skilled in the art that a study testing additional amounts of a medicament (e.g., a study in which amounts are varied in smaller increments, such as 40, 50, 60, 70, 80, 90, etc. mg/day) would provide additional information regarding ranges of amounts giving optimal performance for patients having a particular genotype, and that optimal amounts of this or any other medicament are not limited to the particular amounts of 50 or 100 mg/day tested in this example. Table 4
(Fisher exact test: p=0.0003)
Sequence Listing Free Text
SEQ ID NO 3510 n represents at or deletion (Location 21). SEQ ID NO 3512 n represents c or deletion (Location 21). SEQ ID NO 3513 n represents t or deletion (Location 21). SEQ ID NO 3514 n represents t or deletion (Location 21). SEQ ID NO 3515 n represents g or deletion (Location 21).
SEQ ID NO 3517 n represents c or deletion (Location 21). SEQ ID NO 3519 n represents t or deletion (Location 21). SEQ ID NO 3521 n represents c or deletion (Location 21). SEQ ID NO 3649 n represents 14 to 16 repeats of tea (from Location 21). SEQ ID NO 3650 n represents 8 to 10 repeats of a (from Location 21).
SEQ ID NO 3651 n represents cacagtcat or deletion (Location 21). SEQ ID NO3652 : n represents tt or deletion (Location 21). SEQ ID NO 3653 n represents 10 to 12 repeats of a (from Location 21). SEQ ID NO 3654 n represents c or deletion (Location 21). SEQ ID NO 3655 n represents 16 to 18 repeats of a (from Location 21).
SEQ ID NO 3656 n represents g or deletion (Location 21). SEQ ID NO 3658 n represents c or deletion (Location 21). SEQ ID NO 3659 n represents t or deletion (Location 21). SEQ ID NO 3660 n represents a or deletion (Location 21). SEQ ID NO 3661 n represents tg or deletion (Location 21). SEQ ID NO 3663 n represents 10 to 13 repeats of t (from Location 21). SEQ ID NO 3664 n represents 11 to 13 repeats of gt (from Location 21). SEQ ID NO 3665 n represents a or deletion (Location 21). SEQ ID NO 3666 n represents g or deletion (Location 21).
SEQ ID NO 3667 n represents g or deletion (Location 21). SEQ ID NO 3668 n represents 9 to 11 repeats of t (from Location 21). SEQ ID NO 3669 n represents g or deletion (Location 21). SEQ ID NO 3671 n represents tt or deletion (Location 21). SEQ ID NO 3672 n represents 7 to 9 repeats of a (from Location 21).
SEQ ID NO 3673 n represents 9 to 11 repeats of t (from Location 21). SEQ ID NO 3674 n represents 9 to 10 repeats of a (from Location 21). SEQ ID NO 3675 n represents gt or deletion (Location 21). SEQ ID NO 3676 n represents a or deletion (Location 21). SEQ ID NO 3677 n represents t or deletion (Location 21).
SEQ ID NO 3679 n represents a or deletion (Location 21). SEQ ID NO 3680 n represents ct or deletion (Location 21). SEQ ID NO 3681 n represents g or deletion (Location 21). SEQ ID NO 3682 n represents a or deletion (Location 21). SEQ ID NO 3683 n represents a or deletion (Location 21).
SEQ ID NO 3684 n represents a or deletion (Location 21). SEQ ID NO 3685 n represents c or deletion (Location 21). SEQ ID NO 3686 n represents aaag or deletion (Location 21). SEQ ID NO 3751 n represents 22 to 26 repeats of t (from Location 21). SEQ ID NO 3752 n represents 8 to 10 repeats of g (from Location 21).
SEQ ID NO 3753 n represents 6 to 7 repeats of c (from Location 21). SEQ ID NO 3754 n represents 12 to 14 repeats of a (from Location 21). SEQ ID NO 3833 n represents tt or deletion (Location 21). SEQ ID NO 3834 n represents 9 to 11 repeats of a (from Location 21). SEQ ED NO 3835 n represents 8 to 12 repeats of a (from Location 21). SEQ ID NO 3836 n represents t or deletion (Location 21). SEQ ID NO 3837 n represents t or deletion (Location 21). SEQ ID NO 3838 n represents t or deletion (Location 21).
SEQ ID NO 3839 n represents a or deletion (Location 21). SEQ ID NO 3840 n represents t or deletion (Location 21). SEQ ID NO 3841 n represents t or deletion (Location 21). SEQ ID NO 3842 n represents 11 to 15 repeats of t (from Location 21). SEQ ID NO 3843 n represents cat or deletion (Location 21).
SEQ ID NO 3844 n represents t or deletion (Location 21). SEQ ID NO 3845 n represents a or deletion (Location 21). SEQ ID NO 3846 n represents a or deletion (Location 21). SEQ ID NO 3847 n represents t or deletion (Location 21). SEQ ID NO 3848 n represents a or deletion (Location 21).
SEQ ID NO 3857 n represents g or deletion (Location 21). SEQ ID NO 3879 n represents a or deletion (Location 21). SEQ ID NO 3885 n represents aaag or deletion (Location 21). SEQ ID NO 3915 n represents t or deletion (Location 21). SEQ ID NO 3918 n represents a or deletion (Location 21).
SEQ ID NO 3926 n represents at or deletion (Location 21). SEQ ID NO 3933 n represents a or deletion (Location 21). SEQ ID NO 3950 n represents c or deletion (Location 21). SEQ ID NO 3953 n represents gg or deletion (Location 21). SEQ ID NO 3962 n represents gtc or deletion (Location 21).
SEQ ID NO 3984 n represents t or deletion (Location 21). SEQ ID NO 3991 n represents tt or deletion (Location 21). SEQ ID NO 3994 n represents 9 to 12 repeats of t (from Location 21). SEQ ID NO 3996 n represents a or deletion (Location 21). SEQ ID NO 3998 n represents 10 to 13 repeats of a (from Location 21). SEQ ID NO 4001 n represents ct or deletion (Location 21). SEQ ID NO 4004 n represents cagatcttcttcagctaatttagaaatgt or deletion (Location 21).
SEQ ID NO 4030 n represents a or deletion (Location 21). SEQ ID NO 4037 n represents c or deletion (Location 21). SEQ ID NO 4042 n represents t or deletion (Location 21). SEQ ID NO 4049 n represents 9 to 12 repeats of t (from Location 21). SEQ ID NO4052 : n represents t or deletion (Location 21).
SEQ ID NO 4054 n represents g (a)4, a (a)4 or a (Location 21). SEQ ID NO 4058 n represents t or deletion (Location 21). SEQ ID NO 4067 n represents c or deletion (Location 21). SEQ ID NO 4069 n represents a or deletion (Location 21). SEQ ID NO 4070 n represents c or deletion (Location 21).
SEQ ID NO 4077 n represents g or deletion (Location 21). SEQ ID NO 4079 n represents 18 to 20 repeats of t (from Location 21). SEQ ID NO 4084 n represents 11 to 13 repeats of a (from Location 21). SEQ ID NO 4085 n represents gaaa or deletion (Location 21). SEQ ID NO 4089 n represents 10 to 12 repeats of a (from Location 21).
SEQ ID NO 4092 n represents c or deletion (Location 21). SEQ ID NO 4102 n represents ca or deletion (Location 21). SEQ ID NO 4109 n represents at or deletion (Location 21). SEQ ID NO 4113 n represents ctt or deletion (Location 21). SEQ ID NO 4115 n represents g or deletion (Location 21).
SEQ ID NO 4117 n represents ggggct or deletion (Location 21). SEQ ID NO 4121 n represents 19 to 22 repeats of t (from Location 21). SEQ ID NO 4126 n represents 6 to 7 repeats of t (from Location 21). SEQ ID NO 4129 n represents 11 to 13 repeats of t (from Location 21). SEQ ID NO 4173 n represents 7 to 8 repeats of c (from Location 21). SEQ ID NO 4175 n represents 10 to 12 repeats of a (from Location 21). SEQ ID NO 4183 n represents c or deletion (Location 21). SEQ ID NO 4188 n represents aaga or deletion (Location 21).
SEQ ID NO 4190 n represents 9 to 11 repeats of a (from Location 21). SEQ ID NO 4193 n represents ct or deletion (Location 21). SEQ ID NO 4198 n represents 8 to 9 repeats of t (from Location 21). SEQ ID NO 4218 n represents g or deletion (Location 21). SEQ ID NO 4224 n represents cttt or deletion (Location 21).
SEQ ID NO 4229 n represents t or deletion (Location 21). SEQ ID NO 4234 n represents c or deletion (Location 21). SEQ ID NO 4235 n represents a or deletion (Location 21). SEQ ID NO 4238 n represents gtt or deletion (Location 21). SEQ ID NO 4239 n represents t or deletion (Location 21).
SEQ ID NO 4259 n represents at or deletion (Location 21). SEQ ID NO 4273 n represents g or deletion (Location 21). SEQ ID NO 4280 n represents 15 to 17 repeats of a (from Location 21). SEQ ID NO 4294 n represents t or deletion (Location 21). SEQ ID NO 4298 n represents t or deletion (Location 21).
SEQ ID NO 4310 n represents t or deletion (Location 21). SEQ ID NO 4314 n represents a or deletion (Location 21). SEQ ID NO 4315 n represents 13 to 15 repeats of t (from Location 21). SEQ ID NO 4316 n represents 12 to 13 repeats of a (from Location 21). SEQ ID NO 4317 n represents t or deletion (Location 21).
SEQ ID NO 4319 n represents t or deletion (Location 21). SEQ ID NO 4320 n represents 13 to 15 repeats of a (from Location 21). SEQ ID NO 4325 n represents a or deletion (Location 21). SEQ ID NO 4331 n represents 5 to 11 repeats of t (from Location 21). SEQ ID NO 4333 n represents 8 to 9 repeats of t (from Location 21). SEQ ID NO 4334 n represents t or deletion (Location 21). SEQ ID NO 4345 n represents 9 to 10 repeats of t (from Location 21). SEQ ID NO 4348 n represents 10 to 11 repeats of a (from Location 21).
SEQ ID NO 4354 n represents a or deletion (Location 21). SEQ ID NO 4361 n represents a or deletion (Location 21). SEQ ID NO 4372 n represents ct or deletion (Location 21). SEQ ID NO 4391 n represents t or deletion (Location 21). SEQ ID NO 4397 n represents a or deletion (Location 21).
SEQ ID NO 4398 n represents at or deletion (Location 21). SEQ ID NO 4408 n represents tgtccaaaggaaggacacg or deletion (Location 21). SEQ ID NO 4414 n represents 6 to 8 repeats of tc (from Location 21). SEQ ID NO 4416 n represents c or deletion (Location 21). SEQ ID NO 4419 n represents t or deletion (Location 21).
SEQ ID NO 4424 n represents t or deletion (Location 21). SEQ ID NO 4425 n represents c or deletion (Location 21). SEQ ID NO 4433 n represents a or deletion (Location 21). SEQ ID NO 4435 n represents t or deletion (Location 21). SEQ ID NO 4442 n represents 6 to 7 repeats of gatt (from Location 21).
SEQ ID NO 4443 n represents t or deletion (Location 21). SEQ ID NO 4448 n represents t or deletion (Location 21). SEQ ID NO 4449 n represents gt or deletion (Location 21). SEQ ID NO 4452 n represents a or deletion (Location 21). SEQ ID NO 4453 n represents a or deletion (Location 21).
SEQ ID NO 4457 n represents t or deletion (Location 21). SEQ ID NO 4460 n represents at or deletion (Location 21). SEQ ID NO 4466 n represents a or deletion (Location 21). SEQ ID NO 4469 n represents t or deletion (Location 21). SEQ ID NO 4472 n represents at or deletion (Location 21). SEQ ID NO 4473 n represents a or deletion (Location 21). SEQ ID NO 4474 n represents 12 to 14 repeats of t (from Location 21). SEQ ID NO 4477 n represents t or deletion (Location 21).
SEQ ID NO 4479 n represents cac or deletion (Location 21). SEQ ID NO 4486 n represents cca or deletion (Location 21). SEQ ID NO 4514 n represents t or deletion (Location 21). SEQ ID NO 4544 n represents c or deletion (Location 21). SEQ ID NO 4552 n represents aaaa or deletion (Location 21).
SEQ ID NO 4565 n represents c or deletion (Location 21). SEQ ID NO 4575 n represents 8 to 9 repeats of t (from Location 21). SEQ ID NO 4576 n represents a or deletion (Location 21). SEQ ID NO 4588 n represents taac or deletion (Location 21). SEQ ID NO 4589 n represents ctcttt or deletion (Location 21).
SEQ ID NO 4590 n represents ct or deletion (Location 21). SEQ ED NO 4597 n represents a or deletion (Location 21). SEQ ID NO 4600 n represents t or deletion (Location 21). SEQ ID NO 4603 n represents g or deletion (Location 21). SEQ ID NO 4606 n represents aattagaa or deletion (Location 21).
SEQ ID NO 4607 n represents tttaaaa or ttttaa (Location 21). SEQ ID NO 4610 n represents t or deletion (Location 21). SEQ ID NO 4615 n represents t or deletion (Location 21). SEQ ID NO 4627 n represents c or deletion (Location 21). SEQ ID NO 4652 n represents 11 to 14 repeats of t (from Location 21).
SEQ ID NO 4653 n represents t or deletion (Location 21). SEQ ID NO 4654 n represents 10 to 13 repeats of t (from Location 21). SEQ ID NO 4655 n represents t or deletion (Location 21). SEQ ID NO 4657 n represents t or deletion (Location 21). SEQ ED NO 4658 n represents ta or deletion (Location 21). SEQ ED NO 4660 n represents 13 to 15 repeats of t (from Location 21). SEQ ID NO 4661 n represents c or deletion (Location 21). SEQ ID NO 4662 n represents 17 to 20 repeats of a (from Location 21). SEQ ID NO 4663 n represents 11 to 13 repeats of t (from Location 21). SEQ ID NO 4664 n represents 8 to 9 repeats of t (from Location 21). SEQ ED NO 4665 n represents 10 to 11 repeats of a (from Location 21). SEQ ID NO 4666 n represents 16 to 19 repeats of a (from Location 21). SEQ ID NO 4758 n represents g or deletion (Location 21). SEQ ID NO 4760 n represents 6 to 7 repeats of a (from Location 21). SEQ ID NO 4761 n represents c or deletion (Location 21). SEQ ID NO 4763 n represents tcctcaggg or deletion (Location 21). SEQ ID NO 4764 n represents 8 to 10 repeats of cgc (from Location 21). SEQ ID NO 4765 n represents 10 to 12 repeats of a (from Location 21). SEQ ID NO 4766 n represents caccaggcagcagactctgatgaggaggggaggggg or deletion (Location 21).
SEQ ID NO 4768 n represents g or deletion (Location 21). SEQ ID NO 4808 n represents tcac or deletion (Location 21). SEQ ID NO 4809 n represents t or deletion (Location 21). SEQ ED NO 4810 n represents 9 to 11 repeats of t (from Location 21). SEQ ID NO 4811 n represents 7 to 8 repeats of a (from Location 21). SEQ ID NO 4847 n represents agg or deletion (Location 21). SEQ ID NO 4848 n represents taacatt or deletion (Location 21). SEQ ID NO 4849 n represents 10 to 12 repeats of a (from Location 21). SEQ ID NO 4850 n represents 15 to 17 repeats of t (from Location 21). SEQ ID NO 4851 n represents 11 to 13 repeats of a (from Location 21). SEQ ID NO 4877 n represents 11 to 13 repeats of t (from Location 21). SEQ ID NO 4878 n represents t or deletion (Location 21). SEQ ID NO 4879 n represents t or deletion (Location 21). SEQ ID NO 4880 n represents 10 to 12 repeats of a (from Location 21). SEQ ID NO 4881 n represents t or deletion (Location 21) SEQ ID NO 4883 n represents 7 to 9 repeats of c (from Location 21).
SEQ ID NO 4884 n represents a or deletion (Location 21) SEQ ID NO 4891 n represents 13 to 16 repeats of t (from Location 21). SEQ ID NO 4892 n represents 9 to 10 repeats of t (from Location 21). SEQ ID NO 4893 n represents 14 to 16 repeats of t (from Location 21). SEQ ID NO 4894 n represents 13 to 17 repeats of t (from Location 21).
SEQ ED NO 4895 n represents t or deletion (Location 21). SEQ ID NO 4897 n represents 8 to 9 repeats of a (from Location 21). SEQ ID NO 4898 n represents 8 to 9 repeats of t (from Location 21). SEQ ID NO 4899 n represents gcagtattactgtagt or deletion (Location 21). SEQ ID NO 4900 n represents 13 to 14 repeats of t (from Location 21).
SEQ ID NO 4901 n represents 9 to 10 repeats of t (from Location 21). SEQ ID NO 4902 n represents 10 to 11 repeats of t (from Location 21). SEQ ID NO 4907 n represents 10 to 14 repeats of a (from Location 21). SEQ ID NO 4908 n represents 13 to 15 repeats of a (from Location 21). SEQ ID NO 4909 n represents a or deletion (Location 21).
SEQ ID NO 4910 n represents t or deletion (Location 21). SEQ ID NO 4918 n represents 13 to 15 repeats of a (from Location 21). SEQ ID NO 4919 n represents 12 to 15 repeats of a (from Location 21). SEQ ID NO 4936 n represents g or deletion (Location 21). SEQ ED NO 4938 n represents aa or deletion (Location 21).
SEQ ID NO 4983 n represents a or deletion (Location 21). SEQ ID NO 4985 n represents aa or deletion (Location 21). SEQ ID NO 4986 n represents ca or deletion (Location 21). SEQ ID NO 6173 n represents tat or deletion (Location 21). SEQ ID NO 6174 n represents 14 to 17 repeats of ac (from Location 21). SEQ ID NO 6175 n represents 16 to 27 repeats of a (from Location 21). SEQ ID NO 6176 n represents t or deletion (Location 21). SEQ ED NO 6177 n represents 8 to 10 repeats of a (from Location 21).
SEQ ID NO 6178 n represents 9 to 11 repeats of gt (from Location 21). SEQ ID NO 6179 n represents aa or deletion (Location 21). SEQ ED NO 6180 n represents t or deletion (Location 21). SEQ ID NO 6181 n represents 8 to 12 repeats of ac (from Location 21). SEQ ID NO 6182 n represents a or deletion (Location 21).
SEQ ID NO 6202 n represents agg or deletion (Location 21). SEQ ID NO 6204 n represents 11 to 15 repeats of a (from Location 21). SEQ ID NO 6205 n represents 11 to 14 repeats of a (from Location 21). SEQ ID NO 6208 n represents gt or deletion (Location 21). SEQ ID NO 6224 n represents ta or deletion (Location 21).
SEQ ID NO 6307 n represents 16 to 19 repeats of a (from Location 21). SEQ ID NO 6308 n represents aa or deletion (Location 21). SEQ ID NO 6310 n represents t or deletion (Location 21). SEQ ID NO 6311 n represents 10 to 12 repeats of t (from Location 21). SEQ ID NO 6312 n represents aa or deletion (Location 21).
SEQ ID NO 6313 n represents ttgacagtccaatat, ttgaca, gtccaatat or deletion (Location 21).
SEQ ID NO 6314 n represents eta or deletion (Location 21). SEQ ID NO 6315 n represents a or deletion (Location 21). SEQ ID NO 6317 n represents 9 to 11 repeats of t (From Location 21).
SEQ ED NO 6318 n represents c or deletion (Location 21). SEQ ID NO 6320 n represents gagatgttgtggctcacat or deletion (Location 21). SEQ ID NO 6322 n represents cc or deletion (Location 21). 256 SEQ ID NO 6323 n represents act or deletion (Location 21). SEQ ID NO 6405 n represents a or deletion (Location 21). SEQ ED NO 6415 n represents 8 to 11 repeats of t (from Location 21). SEQ ID NO 6416 n represents 10 to 13 repeats of t (from Location 21). SEQ ID NO 6472 n represents g or deletion (Location 21). SEQ ID NO 6473 n represents c or deletion (Location 21). SEQ ID NO 6554 n represents t or deletion (Location 21). SEQ ID NO 6555 n represents 12 to 15 repeats of t (from Location 21). SEQ ID NO 6609 n represents a or deletion (Location 21). SEQ ID NO 6610 n represents at or deletion (Location 21). SEQ ID NO 6725 n represents 16 repeats of cctgc or 16 repeats of cctgt (from Location 21).
SEQ ID NO 6726 n represents t or deletion (Location 21). SEQ ID NO 6728 n represents c or deletion (Location 21). SEQ ID NO 6739 n represents acac or deletion (Location 21). SEQ ID NO 6748 n represents gatttgtggtatccag or deletion (Location 21). SEQ ID NO 6750 n represents ag or deletion (Location 21). SEQ ID NO 6751 n represents ta or deletion (Location 21). SEQ ID NO 6757 n represents t or deletion (Location 21). SEQ ID NO 6759 n represents 12 to 14 repeats of gt from Location 21).
SEQ ID NO 6771 : n represents cagaggct or deletion (Location 21).
SEQ ID NO 6772 n represents ct or deletion (Location 21). SEQ ID NO 6773 n represents ag or deletion (Location 21). SEQ ID NO 6785 n represents gtaaa or deletion (Location 21). SEQ ID NO 6786 n represents aaaaa or deletion (Location 21). SEQ ID NO 6787 n represents a or deletion (Location 21). SEQ ID NO 6828 n represents tc or deletion (Location 21). SEQ ID NO 6830 n represents t or deletion (Location 21). 257 SEQ ID NO 6831 n represents t or deletion (Location 21). SEQ ID NO 6832 n represents gaagaaactgttgacagttt or deletion (Location 21). SEQ ID NO 6833 n represents cct or deletion (Location 21). SEQ ID NO 6834 n represents tttc or deletion (Location 21). SEQ ID NO 6835 n represents ttcttttaaaattg or deletion (Location 21).
SEQ ID NO 6837 n represents ttcaggccttt or deletion (Location 21). SEQ ID NO 6839 n represents ggcctg or deletion (Location 21). SEQ ID NO 6841 n represents a or deletion (Location 21). SEQ ID NO 6870 n represents 9 to 11 repeats of c (from Location 21). SEQ ID NO 6871 n represents 15 to 21 repeats of a (from Location 21).
SEQ ID NO 6872 n represents ggggtggcggggtggg or deletion (Location 21). SEQ ID NO 6873 n represents t or deletion (Location 21). SEQ ID NO 6874 n represents a or deletion (Location 21). SEQ ID NO 6876 n represents a or deletion (Location 21). SEQ ID NO 6877 n represents 10 to 12 repeats of t (from Location 21).
SEQ ID NO 6878 n represents tt or deletion (Location 21). SEQ ID NO 6880 n represents tccctccttgaagctgatcgt or deletion (Location 21). SEQ ID NO 6881 n represents 12 to 18 repeats of ca (from Location 21). SEQ ID NO 6894 n represents gtt or deletion (Location 21). SEQ ID NO 6897 n represents ga or deletion (Location 21).
SEQ ED NO 6921 n represents t or deletion (Location 21). SEQ ED NO 6940 n represents t or deletion (Location 21). SEQ ID NO 6941 n represents t or deletion (Location 21). SEQ ID NO 6942 n represents t or deletion (Location 21). SEQ ID NO 6965 n represents at or deletion (Location 21).
SEQ ID NO 6966 n represents a or deletion (Location 21). SEQ ID NO 6967 n represents c or deletion (Location 21). SEQ ID NO 6997 n represents c or deletion (Location 21). 258 SEQ ID NO 7005 n represents t or deletion (Location 21). SEQ ID NO 7006 n represents ttc or deletion (Location 21). SEQ ID NO 7017 n represents ctt or deletion (Location 21). SEQ ID NO 7049 n represents 8 to 9 repeats of a (from Location 21). SEQ ID NO 7053 n represents 10 to 12 repeats of t (from Location 21).
SEQ ID NO 7059 n represents 22 to 25 repeats of t (from Location 21). SEQ ID NO 7070 n represents t or deletion (Location 21). SEQ ID NO 7073 n represents a or deletion (Location 21). SEQ ID NO 7074 n represents a or deletion (Location 21). SEQ ID NO 7076 n represents c or deletion (Location 21).
SEQ ID NO 7077 n represents 10 to 12 repeats of t (from Location 21). SEQ ID NO 7078 n represents a or deletion (Location 21). SEQ ID NO 7079 n represents 9 to 11 repeats of t (from Location 21). SEQ ID NO 7082 n represents a or deletion (Location 21). SEQ ID NO 7085 n represents t or deletion (Location 21).
SEQ ID NO 7089 n represents a or deletion (Location 21). SEQ ID NO 7101 n represents a or deletion (Location 21). SEQ ED NO 7105 n represents a or deletion (Location 21). SEQ ID NO 7114 n represents 9 to 10 repeats of t (from Location 21). SEQ ID NO 7115 n represents aag or deletion (Location 21).
SEQ ID NO 7117 n represents t or deletion (Location 21). SEQ ID NO 7118 n represents t or deletion (Location 21). SEQ ID NO 7120 n represents t or deletion (Location 21). SEQ DD NO 7121 n represents t or deletion (Location 21). SEQ ID NO 7123 n represents t or deletion (Location 21).
SEQ ED NO 7125 n represents a or deletion (Location 21). SEQ ID NO 7127 n represents a or deletion (Location 21). SEQ ID NO 7134 n represents 7 to 8 repeats of gt (from Location 21). 259 SEQ ID NO 7146 n represents cct or deletion (Location 21). SEQ ID NO 7148 n represents tc or deletion (Location 21). SEQ ID NO 7164 n represents ca or deletion (Location 21). SEQ ED NO 7186 n represents g or deletion (Location 21). SEQ ID NO 7209 n represents t or deletion (Location 21).
SEQ ID NO 7238 n represents gccag or deletion (Location 21). SEQ ID NO 7278 n represents a or deletion (Location 21). SEQ ID NO 7281 n represents g or deletion (Location 21). SEQ ID NO 7282 n represents t or deletion (Location 21). SEQ ED NO 7287 n represents aaa or deletion (Location 21).
SEQ ED NO 7288 n represents a or deletion (Location 21). SEQ ID NO 7299 n represents c or deletion (Location 21). SEQ ID NO 7329 n represents 17 to 19 repeats of a (from Location 21). SEQ ID NO 7332 n represents 16 to 18 repeats of a (from Location 21). SEQ ID NO 7333 n represents 4 to 6 repeats of ga (from Location 21).
SEQ ID NO 7346 n represents a or deletion (Location 21). SEQ ID NO 7375 n represents 2 to 3 repeats of tc (from Location 21). SEQ ED NO 7381 n represents 6 to 7 repeats of a (from Location 21). SEQ ID NO 7383 n represents 13 to 15 repeats of a (from Location 21). SEQ ID NO 7385 n represents 9 to 10 repeats of t (from Location 21).
SEQ ID NO 7387 n represents 11 to 14 repeats of a (from Location 21). SEQ ID NO 7389 n represents 14 to 17 repeats of t (from Location 21). SEQ ID NO 7390 n represents 8 to 9 repeats of a (from Location 21). SEQ ED NO 7397 n represents g or deletion (Location 21). SEQ ID NO 7417 n represents 14 to 17 repeats of t (from Location 21).
SEQ ID NO 7421 n represents 7 to 9 repeats of g (from Location 21). SEQ ED NO 7426 n represents 9 to 10 repeats of a (from Location 21). SEQ ID NO 7434 n represents 9 to 10 repeats of a (from Location 21). 260 SEQ ID NO 7436 n represents 6 to 7 repeats of g (from Location 21). SEQ ED NO 7443 n represents g or deletion (Location 21). SEQ ID NO 7458 n represents 8 to 9 repeats of a (from Location 21). SEQ ID NO 7461 n represents 4 to 6 repeats of c (from Location 21). SEQ ID NO 7483 n represents ggcgaaggcggcggc or deletion (Location 21).
SEQ ID NO 7485 n represents ata or deletion (Location 21). SEQ ID NO 7488 n represents 11 to 12 repeats of t (from Location 21). SEQ ID NO 7489 n represents 12 to 14 repeats of t (from Location 21). SEQ ID NO 7493 n represents 9 to 10 repeats of t (from Location 21). SEQ ID NO 7495 n represents 6 to 7 repeats of ta (from Location 21).
SEQ ID NO 7497 n represents tgtatacgtatacatacgtatacatatatacatacgtatata or deletion (Location 21).
SEQ ID NO 7503 n represents attt or deletion (Location 21).
SEQ ID NO 7510 n represents cct or deletion (Location 21). SEQ ID NO 7519 n represents tgtt or deletion (Location 21).
SEQ ID NO 7520 n represents a or deletion (Location 21). SEQ ID NO 7531 n represents 9 to 10 repeats of t (from Location 21). SEQ ED NO 7538 n represents a or deletion (Location 21). SEQ ID NO 7566 n represents a or deletion (Location 21). SEQ ID NO 7615 n represents a or deletion (Location 21).
SEQ ID NO 7649 n represents gtg or deletion (Location 21). SEQ ID NO 7651 n represents gg or tggtggggtgga (Location 21). SEQ ID NO 7667 n represents ct or deletion (Location 21).
All publications and patents mentioned in the above specification are herein incoφorated by reference. Various modifications and variations of the described method and system of the invention will be apparent to those skilled in the art without
261 departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are obvious to those skilled in the relevant fields are intended to be within the scope of the following claims.
262

Claims

1. A method of identifying individuals having a polymoφhism, comprising; a. providing nucleic acid from a subject; and b. detecting the presence of at least one polymoφhism in said nucleic acid, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361- 7669.
2. The method of Claim 1, further comprising step c) providing a prognosis to said subject based on the presence or absence of said at least one polymoφhism.
3. The method of Claim 2, wherein said prognosis comprises a genotype relative risk.
4. The method of Claim 2, wherein said prognosis comprises a population attributable risk.
5. The method of Claim 1, wherein said detecting step comprises use of a hybridization assay.
6. The method of Claim 1, wherein said detecting step comprises use of a TAQMAN assay.
7. The method of Claim 1, wherein said detecting step comprises use of an invasive cleavage assay.
8. The method of Claim 1, wherein said detecting step comprises use of mass spectroscopy.
263
9. The method of Claim 1, wherein said detecting step comprises use of a microarray.
10. The method of Claim 1, wherein said detecting step comprises use of a polymerase chain reaction.
11. The method of Claim 1, wherein said detecting step comprises use of a rolling circle extension assay.
12. The method of Claim 1, wherein said detecting step comprises use of a sequencing assay.
13. The method of Claim 1, wherein said detecting step comprises use of a hybridization assay employing a probe complementary to a polymoφhism.
14. The method of Claim 1, wherein said detecting step comprises use of a bead array assay.
15. The method of Claim 1, wherein said detecting step comprises use of a primer extension assay.
16. The method of Claim 1, wherein said detecting step comprises use of an enzyme mismatch cleavage assay.
17. The method of Claim 1, wherein said detecting step comprises use of a branched hybridization assay.
18. The method of Claim 1, wherein said detecting step comprises use of a NASBA assay.
264
19. The method of Claim 1, wherein said detecting step comprises use of a molecular beacon assay.
20. The method of Claim 1, wherein said detecting step comprises use of a cycling probe assay.
21. The method of Claim 1, wherein said detecting step comprises use of a ligase chain reaction assay.
22. The method of Claim 1, wherein said detection step comprises use of a sandwich hybridization assay.
23. A composition comprising a nucleic acid, said nucleic acid comprising a sequence selected from the group consisting of SEQ ID NO: 1-3360 and 3361-7669 or complements thereof.
24. The composition of Claim 23, wherein said nucleic acid is 200 or less nucleotides in length.
25. The composition of Claim 23, wherein said nucleic acid molecule comprises a label.
26. The composition of Claim 23, wherein said nucleic acid comprises a gene sequence.
27. The composition of Claim 23, wherein said nucleic acid is attached to a solid support.
28. The vector comprising the nucleic acid of Claim 23.
29. A host cell comprising the vector of Claim 28.
265
30. A polypeptide encoded by the nucleic acid of Claim 23.
31. A kit for detecting a polymoφhism, comprising at least one reagent that specifically detects a polymoφhism in a sequence selected from the group consisting of SEQ ID Nos:3360 and 3361-.
32. The kit of Claim 31, further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
33. The kit of Claim 31 , wherein said at least one reagent comprises a nucleic acid probe.
34. The kit of Claim 31, wherein said kit comprises an in vitro diagnostic detection assay.
35. The kit of Claim 31 , wherein said kit comprises an analyte specific reagent detection assay.
36. The kit of Claim 31, wherein said kit comprises a research-use-only detection assay.
37. A method for screening subjects for genetic markers associated with drug metabolizing enzyme(s), comprising: a) providing a biological sample comprising a nucleic acid from a subject; b) testing said nucleic acid for a polymoφhism in a genetic marker associated with a drug metabolizing enzyme, said genetic marker comprising one or more nucleotide polymoφhisms designated by n, said n selected from a base substitution, an insertion, or a deletion found in a sequence selected from the group consisting of SEQ ID
Nos: 1-3360 and 3361-7669.
266
38. The method of Claim 37, wherein said biological sample is selected from the group consisting of blood, saliva, amniotic fluid, and tissue.
39. The method of Claim 37, wherein said subject is a human.
40. The method of Claim 37, wherein said nucleic acid comprises DNA.
41. The method of Claim 37, wherein said nucleic acid comprises RNA.
42. A composition comprising an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymoφhism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymoφhisms designated by n in SEQ ID Nos: 1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
43. The composition of Claim 42, wherein said detection assay is selected from the group consisting of a sequencing assay, a polymerase chain reaction assay, a hybridization assay, a hybridization assay employing a probe complementary to a polymoφhism, a microarray assay, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a rolling circle replication assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
44. A composition comprising a detection probe for determining the presense or absence a single nucleotide polymoφhism in a gene encoding a drug metabolizing enzyme, said gene comprising a sequence selected from the group consisting of SEQ ID Nos: 1-3360 and 3361-7669.
45. A kit comprising the detection probe of Claim 44, and at least one
267 PCR primer for amplifying at least a portion of said gene.
46. A method of determining the effectiveness of or side-effect of a drug or treatment protocol, comprising; a. administering a drug or treatment protocol to one or more subjects; b. obtaining nucleic acid from said one or more subjects; c. using a detection assay to detect the presence of at least one polymoφhism in said nucleic acid from said one or more of subjects, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361-7669; and, d. assigning an effectiveness rating, side-effect rating, or score for said drug or treatment protocol based upon a result of one or more said detection assays.
47. The method of Claim 46, wherein said detection assay comprises a hybridization assay.
48. The method of Claim 46, wherein said detection assay comprises a TAQMAN assay.
49. The method of Claim 46, wherein said detection assay comprises an invasive cleavage assay.
50. The method of Claim 46, wherein said detection assay comprises mass spectroscopy.
51. The method of Claim 46, wherein said detection assay comprises a microarray.
268
52. The method of Claim 46, wherein said detection assay comprises a polymerase chain reaction.
53. The method of Claim 46, wherein said detection assay comprises a rolling circle extension assay.
54. The method of Claim 46, wherein said detection assay comprises a sequencing assay.
55. The method of Claim 46, wherein said detection assay comprises a hybridization assay employing a probe complementary to a polymoφhism.
56. The method of Claim 46, wherein said detection assay comprises a bead array assay.
57. The method of Claim 46, wherein said detection assay comprises a primer extension assay.
58. The method of Claim 46, wherein said detection assay comprises an enzyme mismatch cleavage assay.
59. The method of Claim 46, wherein said detection assay comprises a branched hybridization assay.
60. The method of Claim 46, wherein said detection assay comprises a
NASBA assay.
61. The method of Claim 46, wherein said detection assay comprises a molecular beacon assay.
269
62. The method of Claim 46, wherein said detection assay comprises a cycling probe assay.
63. The method of Claim 46, wherein said detection assay comprises a ligase chain reaction assay.
64. The method of Claim 46, wherein said detection step comprises a sandwich hybridization assay.
65. The method of Claim 46, in which said detection assay comprises a kit for detecting a polymoφhism, said kit comprising at least one reagent that specifically detects a polymoφhism in a sequence selected from the group consisting of SEQ ID Nos: 1-3360 and 3361-7669.
66. The method of Claim 65, further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
67. The method of Claim 65, wherein said at least one reagent comprises a nucleic acid probe.
68. The method of Claim 65, wherein said kit comprises an analyte specific reagent detection assay.
69. The method of Claim 65, wherein said kit comprises a research-use-only detection assay.
70. The method of Claim 46, wherein said nucleic acid is obtained from a biological sample, said sample being selected from the group consisting of blood, saliva, amniotic fluid, and tissue.
71. The method of Claim 70, wherein said subject is a mammal.
270
72. The method of Claim 70, wherein said nucleic acid comprises DNA.
73. The method of Claim 70, wherein said nucleic acid comprises RNA.
74. The method of Claim 65, wherein said kit comprises PCR primers.
75. The method of Claim 74, in which said kit comprises an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymoφhism detection assays, one or more of said detection assays being capable of detecting one or more nucleotide polymoφhisms designated by n in SEQ ED Nos: 1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
76. A method of prescribing a drug to or treatment protocol for a subject, comprising; a. providing nucleic acid from said subject; b. using a detection assay to detect the presence of at least one polymoφhism in said nucleic acid, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID
Nos: 1-3360 and 3361-7669; and, c. prescribing said drug or treatment protocol based upon the result of said detection assay.
77. The method of Claim 76, further comprising step d) providing a prognosis to said subject based on the presence or absence of said at least one polymoφhism.
78. The method of Claim 77, wherein said prognosis comprises a genotype relative risk.
271
79. The method of Claim 77, wherein said prognosis comprises a population attributable risk.
80. The method of Claim 76, wherein said detection assay comprises a hybridization assay.
81. The method of Claim 76, wherein said detection assay comprises a TAQMAN assay.
82. The method of Claim 76, wherein said detection assay comprises an invasive cleavage assay.
83. The method of Claim 76, wherein said detection assay comprises mass spectroscopy.
84. The method of Claim 76, wherein said detection assay comprises a microarray.
85. The method of Claim 76, wherein said detection assay comprises a polymerase chain reaction.
86. The method of Claim 76, wherein said detection assay comprises a rolling circle extension assay.
87. The method of Claim 76, wherein said detection assay comprises a sequencing assay.
88. The method of Claim 76, wherein said detection assay comprises a hybridization assay employing a probe complementary to a polymoφhism.
272
89. The method of Claim 76, wherein said detection assay comprises a bead array assay.
90. The method of Claim 76, wherein said detection assay comprises a primer extension assay.
91. The method of Claim 76, wherein said detection assay comprises an enzyme mismatch cleavage assay.
92. The method of Claim 76, wherein said detection assay comprises a branched hybridization assay.
93. The method of Claim 76, wherein said detection assay comprises a NASBA assay.
94. The method of Claim 76, wherein said detection assay comprises a molecular beacon assay.
95. The method of Claim 76, wherein said detection assay comprises a cycling probe assay.
96. The method of Claim 76, wherein said detection assay comprises a ligase chain reaction assay.
97. The method of Claim 76, wherein said detection step comprises a sandwich hybridization assay.
98. The method of Claim 76, in which said detection assay comprises a kit for detecting a polymoφhism, said kit comprising at least one reagent that specifically detects a polymoφhism in a sequence selected from the group consisting of SEQ ED Nos: 1-3360 and 3361-7669.
273
99. The method of Claim 98, further comprising instructions for determining whether the subject is at increased risk of having a drug metabolism disorder.
100. The method of Claim 99, wherein said at least one reagent comprises a nucleic acid probe.
101. The method of Claim 98, wherein said kit comprises an in vitro diagnostic detection assay.
102. The method of Claim 98, wherein said kit comprises an analyte specific reagent detection assay.
103. The method of Claim 98, wherein said kit comprises a research-use-only detection assay.
104. The method of Claim 76, wherein said nucleic acid is obtained from a biological sample, said sample being selected from the group consisting of blood, saliva, amniotic fluid, and tissue.
105. The method of Claim 104, wherein said subject is a human.
106. The method of Claim 104, wherein said nucleic acid comprises DNA.
107. The method of Claim 104, wherein said nucleic acid comprises RNA.
108. The method of Claim 104, wherein said kit comprises PCR primers.
109. The method of claim 98, in which said kit comprises an array of detection assays, said array comprising a plurality of drug metabolizing enzyme nucleotide polymoφhism detection assays, one or more of said detection assays being capable of
274 detecting one or more nucleotide polymoφhisms designated by n in SEQ ID Nos: 1-3360 and 3361-7669, wherein n represents a base substitution, insertion, or deletion compared to a wild-type sequence.
110. The method of Claim 109, wherein said detection assay is selected from the group consisting of a sequencing assay, a polymerase chain reaction assay, a hybridization assay, a hybridization assay employing a probe complementary to a polymoφhism, a microarray assay, a bead array assay, a primer extension assay, an enzyme mismatch cleavage assay, a branched hybridization assay, a rolling circle replication assay, a NASBA assay, a molecular beacon assay, a cycling probe assay, a ligase chain reaction assay, and a sandwich hybridization assay.
111. A method for generating assay data comprising: a. obtaining a sample from a subject containing nucleic acid; b. transferring said sample to a laboratory; and c. receiving data from said laboratory, wherein said data corresponds to the presence of at least one polymoφhism in said nucleic acid, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361-7669.
112. A data set generated by the method of Claim 111.
113. A composition comprising a nucleic acid, said nucleic acid comprising a gene sequence, said gene sequence having at least one polymoφhism, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ED NOs: 1-3360 and 3361-7669.
114. The composition of Claim 113, wherein said at least one polymoφhism is located in a non-coding portion of said gene.
275
115. The composition of Claim 113, wherein said at least one polymoφhism is located in an intron.
116. The composition of Claim 113, wherein said at least one polymoφhism is located in an exon.
117. The composition of Claim 113, wherein said at least one polymoφhism is located in a 5' untranslated portion of said gene.
118. The composition of Claim 113, wherein said at least one polymoφhism is located in a 3' untranslated portion of said gene.
119. The composition of Claim 113, wherein said at least one polymoφhism is located in an untranslated regulatory portion of said gene.
120. The composition of Claim 113, wherein said at least one polymoφhism is located in a region of said gene affecting splicing.
121. The composition of Claim 113, wherein said at least one polymoφhism is located in a region of said gene affecting level of transcription of said gene.
122. The composition of Claim 113, wherein two or more of said polymoφhisms are located in a gene sequence, said gene sequence comprising an intron, an exon, a 5' untranslated portion of said gene, a 3' untranslated portion of said gene, a regulatory portion of said gene, a portion of said gene affecting splicing, and a portion of said gene affecting level or transcription of said gene.
123. A composition comprising an oligonucleotide, said oligonucleotide comprising at least one polymoφhism, said at least one polymoφhism selected from the group consisting of polymoφhisms found in SEQ ID Nos: 1-3360 and 3361-7669, and
276 said oligonucleotide comprising at least five bases upstream or five bases downstream of said polymoφhism.
277
EP01272361A 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics Withdrawn EP1348031A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP06024411A EP1816212A2 (en) 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics

Applications Claiming Priority (7)

Application Number Priority Date Filing Date Title
JP2000399443 2000-12-27
JP2000399443 2000-12-27
JP2001135256 2001-05-02
JP2001135256 2001-05-02
JP2001256862 2001-08-27
JP2001256862 2001-08-27
PCT/JP2001/011592 WO2002052044A2 (en) 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP06024411A Division EP1816212A2 (en) 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics

Publications (1)

Publication Number Publication Date
EP1348031A2 true EP1348031A2 (en) 2003-10-01

Family

ID=27345593

Family Applications (2)

Application Number Title Priority Date Filing Date
EP01272361A Withdrawn EP1348031A2 (en) 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics
EP06024411A Withdrawn EP1816212A2 (en) 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics

Family Applications After (1)

Application Number Title Priority Date Filing Date
EP06024411A Withdrawn EP1816212A2 (en) 2000-12-27 2001-12-27 Detection of genetic polymorphisms in genes associated with pharmacogenomics

Country Status (3)

Country Link
EP (2) EP1348031A2 (en)
CA (1) CA2433135A1 (en)
WO (1) WO2002052044A2 (en)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20060240419A1 (en) * 2002-05-17 2006-10-26 Yusuke Nakamura Method of detecting gene polymorphism
US20040241714A1 (en) * 2003-02-04 2004-12-02 Branch Robert A. Methods of assessment of drug metabolizing enzymes
WO2004078968A1 (en) * 2003-03-04 2004-09-16 Hideko Kanazawa System for evaluating drug metabolism capacity and method of using the same
CA2921196C (en) * 2003-11-26 2019-03-05 Celera Corporation Single nucleotide polymorphisms associated with cardiovascular disorders and statin response, methods of detection and uses thereof
JP2008522597A (en) * 2004-12-13 2008-07-03 エフ.ホフマン−ラ ロシュ アーゲー Single nucleotide polymorphism (SNP) associated with type II diabetes
WO2008062105A1 (en) * 2006-11-24 2008-05-29 Licentia Ltd. Method for predicting the response to a therapy
WO2009029321A2 (en) * 2007-06-08 2009-03-05 Musc Foundation For Research Development Carboxylesterase-1 polymorphisms and methods of use therefor
US7951542B2 (en) 2009-11-04 2011-05-31 Surgene, LLC Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype
US7985551B2 (en) 2009-11-04 2011-07-26 Suregene, Llc Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype
US7951543B2 (en) 2009-11-04 2011-05-31 Suregene, Llc Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype
US7972793B2 (en) 2009-11-04 2011-07-05 Suregene, Llc Methods and compositions for the treatment of psychotic disorders through the identification of the SULT4A1-1 haplotype
JP5757908B2 (en) * 2011-05-02 2015-08-05 アークレイ株式会社 Polymorph detection probe, polymorph detection method, drug efficacy evaluation method, disease prediction method, and polymorph detection reagent kit
JP5757909B2 (en) * 2011-05-02 2015-08-05 アークレイ株式会社 Polymorph detection probe, polymorph detection method, efficacy determination method, and polymorph detection reagent kit
WO2014201104A2 (en) * 2013-06-11 2014-12-18 Courtagen Life Sciences, Inc. Methods and kits for treating and classifying individuals
GB201706009D0 (en) * 2017-04-13 2017-05-31 Proqr Therapeutics Ii Bv Antisense oligonucleotides for the treatment of stargardt disease
TWI831792B (en) * 2018-06-12 2024-02-11 合一生技股份有限公司 Nucleic acid aptamers targeting lymphocyte activation gene 3 (lag-3) and uses thereof
CN113215243A (en) * 2021-05-19 2021-08-06 北京华诺奥美医学检验实验室有限公司 Fluorescent quantitative PCR (polymerase chain reaction) probe primer group and kit for detecting high-frequency pathogenic variation of SLC22A5 gene

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6183963B1 (en) * 1998-10-23 2001-02-06 Signalgene Detection of CYP1A1, CYP3A4, CYP2D6 and NAT2 variants by PCR-allele-specific oligonucleotide (ASO) assay

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO02052044A3 *

Also Published As

Publication number Publication date
WO2002052044A3 (en) 2003-03-20
EP1816212A2 (en) 2007-08-08
CA2433135A1 (en) 2002-07-04
WO2002052044A9 (en) 2003-04-17
WO2002052044A2 (en) 2002-07-04

Similar Documents

Publication Publication Date Title
US20040072156A1 (en) Detection of genetic polymorphisms
US8153377B2 (en) Method for detecting and quantifying rare mutations/polymorphisms
US8129120B2 (en) Methods for genetic analysis of DNA to detect sequence variances
EP1816212A2 (en) Detection of genetic polymorphisms in genes associated with pharmacogenomics
EP2240601B1 (en) Biomarkers for the prediction of renal injury
US20110300535A1 (en) Method of identifying individuals at risk of thiopurine drug resistance and intolerance
US20140193809A1 (en) Methods for genetic analysis of dna to detect sequence variances
Pickering et al. Flow cytometric assay for genotyping cytochrome p450 2C9 and 2C19: comparison with a microelectronic DNA array
JP2004000039A (en) Gene polymorphism detection method
AU2002219546A1 (en) Detection of genetic polymorphisms in genes associated with pharmacogenomics
EP1781811B1 (en) Method of detecting mutations in the gene encoding cytochrome p450-2d6
WO2021026293A1 (en) Compositions and methods relating to identification of genetic variants
US20080248466A1 (en) Method Of Detecting Mutations In The Gene Encoding Cytochrome P450-2C19
Geistlinger et al. Largescale detection of genetic variation: the key to personalized medicine
WO2009101619A2 (en) Methods for predicting a patient&#39;s response to lithium treatment
Earl et al. Single-nucleotide polymorphism (SNP) analysis to associate cancer risk
EP2118316B1 (en) Use of oligonucleotide probes and method for the genomic typing of erythrocyte systems.
AU2005314732A1 (en) Method for identifying gene with varying expression levels
Sepulveda Microarray technology and other methods in pharmacogenomics testing
US20160160282A1 (en) Neprilysin Gene Polymorphism and Amyloid Beta Plaques in Traumatic Brain Injury
HK1098789B (en) Method for detecting and quantifying rare mutations/polymorphisms

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030717

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20061128