EP1345931A2 - Cysteine protease inhibitors - Google Patents
Cysteine protease inhibitorsInfo
- Publication number
- EP1345931A2 EP1345931A2 EP01996110A EP01996110A EP1345931A2 EP 1345931 A2 EP1345931 A2 EP 1345931A2 EP 01996110 A EP01996110 A EP 01996110A EP 01996110 A EP01996110 A EP 01996110A EP 1345931 A2 EP1345931 A2 EP 1345931A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- ethyl
- oxo
- ylcarbamoyl
- pyran
- methyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
- C07D307/02—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
- C07D307/26—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
- C07D307/30—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D307/32—Oxygen atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/06—Antimalarials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P33/00—Antiparasitic agents
- A61P33/02—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis
- A61P33/08—Antiprotozoals, e.g. for leishmaniasis, trichomoniasis, toxoplasmosis for Pneumocystis carinii
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/08—Antiallergic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
- C07D307/02—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
- C07D307/04—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
- C07D307/18—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D307/22—Nitrogen atoms not forming part of a nitro radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
- C07D307/02—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings
- C07D307/34—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D307/56—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D307/68—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D307/00—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom
- C07D307/77—Heterocyclic compounds containing five-membered rings having one oxygen atom as the only ring hetero atom ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D307/78—Benzo [b] furans; Hydrogenated benzo [b] furans
- C07D307/82—Benzo [b] furans; Hydrogenated benzo [b] furans with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to carbon atoms of the hetero ring
- C07D307/84—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen
- C07D307/85—Carbon atoms having three bonds to hetero atoms with at the most one bond to halogen attached in position 2
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D309/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings
- C07D309/02—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having no double bonds between ring members or between ring members and non-ring members
- C07D309/08—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having no double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D309/14—Nitrogen atoms not forming part of a nitro radical
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D309/00—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings
- C07D309/16—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member
- C07D309/28—Heterocyclic compounds containing six-membered rings having one oxygen atom as the only ring hetero atom, not condensed with other rings having one double bond between ring members or between a ring member and a non-ring member with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D309/30—Oxygen atoms, e.g. delta-lactones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
- C07D405/02—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings
- C07D405/12—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing two hetero rings linked by a chain containing hetero atoms as chain links
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D405/00—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom
- C07D405/14—Heterocyclic compounds containing both one or more hetero rings having oxygen atoms as the only ring hetero atoms, and one or more rings having nitrogen as the only ring hetero atom containing three or more hetero rings
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D409/00—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms
- C07D409/02—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings
- C07D409/12—Heterocyclic compounds containing two or more hetero rings, at least one ring having sulfur atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
Definitions
- This invention relates to inhibitors of cysteine proteases, especially those ofthe papain superfamily.
- the invention provides novel compounds useful in the prophylaxis or treatment of disorders stemming from misbalance of physiological proteases such as cathepsin F or S, or pathogenic proteases such as malarial falcipain.
- the papain superfamily of cysteine proteases are widely distributed in diverse species including mammals, invertebrates, protozoa, plants and bacteria.
- Pathogenic cathepsin like enzymes include the bacterial gingipains, the malarial falcipains I, II, III et seq and cysteine proteases from Pneumocystis carinii, Trypanosoma cruzei and brucei, Crithidia fusiculata, Schistosoma spp.
- Cathepsin S is a highly active cysteine protease belonging to the papain superfamily. Its primary structure is 57%, 41% and 45% homologous with that ofthe human cathepsin L and H and plant cysteine proteases papain respectively, although only 31% homologous with Cathepsin B. It is found mainly in lymph nodes, spleen, and macrophages and this limited occurrence suggests the potential involvement of this enzyme in the pathogenesis of degenerative disease.
- WO 98/50533 describes the use of compounds according to the formula (I).
- the compounds of this formula are useful as inhibitors to proteases, in particular the papain superfamily; specifically those ofthe Cathepsin family; and particularly Cathepsin K.
- the ketone bearing ring structure in these compounds has a tendency to spontaneously racemise, limiting their clinical utility.
- Other SKB applications describing ketone cathepsin K inhibitors include WO 98/46582, WO99/ 64399, WO00/29408, WO00/38687 and WO00/49011. However none of these applications disclose an ⁇ - ring substituent adjacent to the linkage to the peptidomimetic chain.
- a first aspect ofthe invention provides a compound according to formula IN
- R" single or multiple ring substitution combinations taken from:
- R3 Cl-7-alkyl, C2-C7 alkenyl, C2-C7 alkenyl, C3-7-cycloalkyl, Ar, Ar-Cl-7alkyl;
- R4 H, Cl-7-alkyl, C3-7-cycloalkyl; C2-7alkenyl, Ar, Ar-Cl-C7-alkyl;
- R5 Cl-7-alkyl, hydroxy- or halo-substituted Cl-C7alkyl, halogen, Ar-Cl-7-alkyl, C0-3-alkyl-CONR3R4 or R iv ;
- R v , R vi H, Cl -7-alkyl
- R viii O, Cl -7-alkyl
- R6 H, Cl-7-alkyl, Ar-Cl -7-alkyl, Cl-3-alkyl-SO2-R ix , Cl-3-alkyl-C(O)-NHR ix or CH 2 XAr
- R ix is CI -7-alkyl, Ar-Cl -7-alkyl or C3-6-cycloalkyl.
- any Cl- 7-alkyl may optionally be substituted by one or two halogens and/or a heteroatom S, O, NH. If the heteroatom is located at a chain terminus then it is appropriately substituted with one or 2 hydrogen atoms, for example as hydroxymethyl.
- An S heteroatom may be oxidised to the sulphone, especially in the case of R3 Cl-7 alkyl or ArCl-7alkyl.
- 'Cl-3-alkyT as applied herein includes methyl, ethyl, propyl, isopropyl, cyclopropyl, any of which may be optionally substituted as described in the paragraph above.
- 'Amine' includes NH2, NHCl-3-alkyl or N(Cl-3-alkyl)2.
- 'Halogen' as applied herein is meant to include F, CI, Br, I, particularly chloro and preferably fluoro.
- 'C3-6-cycloalkyT (or C3-C7 cycloalkyl) as applied herein is meant to include any variation of 'CI -7-alkyl' which additionally contains a C3-6 (or C3-7) carbocyclic ring such as cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl.
- the C3-6 or C3- 7 cyclopropyl may be spiro bound to the adjacent carbon without an intervening C1-C7 alkyl.
- 'Ar- CI -7-alkyl' as applied herein is meant to include a phenyl, pyrazolyl, pyridyl, imidazolyl, oxazolyl, isoxazolyl, thiazinolyl, isothiazinolyl, thiazolyl, oxadiazolyl, 1,2,3-triazolyl, 1 ,2,4-triazolyl, furanyl or thienyl aromatic ring (Ar) attached through a 'CI -7-alkyl' (defined above) to the dihydro-(3H)-furanone ring system or in the case of R2, R3 or R4 linked directly to the molecule backbone.
- the aromatic ring Ar may be substituted with halogen, Cl-3-alkyl, OH, OCl-3-alkyl, SH, SCl-3-alkyl, amine and the like.
- R lv ' as applied herein is meant to include straight or branched carbon chain substituted with a 1°, 2° or 3° carboxamide wherein R'", R IV includes H and Me.
- 'Cl-3-alkyl-SO 2 -R lx as applied herein is meant to include straight or branched carbon chain substituted with a sulphone wherein R 1X includes 'CI -7-alkyl', 'Ar- CI -7-alkyl', 'C3-6-cycloalkyl'.
- 'Cl-3-alkyl-C(O)-NHR lx as applied herein is meant to include straight or branched carbon chain substituted with a secondary carboxamide wherein R 1X includes 'Cl-7- alkyl', 'Ar- CI -7-alkyl', *C3-6-cycloal yl'.
- the compound displays selective inhibition of a single protease in the complex mixture of proteolytic enzymes characterising the physiological environment, for example a greater than 10 fold selectivity, preferably greater than 100.
- inhibitory specificity is exhibited over other members ofthe same enzyme class or family, such as the Cathepsin family, which have a high degree of homology, as incorrect regulation of proteolytic activity can lead to unwanted pathological conditions such as hypertension, blood clotting or worse. This is especially desirable for disorders such as autoimmune disorders where administration ofthe drug is likely to be protracted.
- compounds can be useful notwithstanding .that they exhibit a degree of promiscuity in relation to inhibition of physiological proteases.
- physiological functions of many cathepsins are redundant, that is inhibition of a particular cysteine protease can be compensated by the presence or upregulation of other non-inhibited proteases or alternative metabolic routes.
- treatments of short duration can result only in transient toxicity or other side effects.
- cysteine proteases for a given putative inhibitor (ie the selectivity if the inhibitor) is readily ascertained with conventional enzyme and cell culture assays, for instance as depicted in the examples in relation to cathepsins S, K and L.
- a further aspect ofthe invention comprises a method employing the compounds of formula IV for the treatment of diseases wherein cathepsin S is a factor, ie diseases or conditions alleviated or modified by inhibition of cathepsin S, preferably without substantial concomitant inhibition of other members ofthe papain superfamily.
- diseases or conditions include those enumerated in WO 97/40066, such as autoimmune diseases, allergies, multiple sclerosis, rheumatoid arthritis and the like.
- the invention further provides the use ofthe compounds of formula IV in therapy and in the manufacture of a medicament for the treatment of diseases or conditions alleviated or moderated by inhibition of cathepsin S.
- R3 n-butyl, t-butyl, 3-(2,2-dimethylpropyl), 4-(2-methylbutyl), 4-(3,3- dimethylbutyl), 4-(3,3-dimethyl-2-methylbutyl), 4-(3-methyl-2-methylbutyl), 5-
- R5 CH 3 , C 2 H 5 , CH 2 OH, CH 2 Ar, CH 2 CONH 2 , (CH 2 ) 2 CONH 2 ,
- a favoured group of cathepsin S inhibitors comprises compounds otherwise as defined in the immediately preceding paragraph, wherein R5 is methyl, ethyl, propyl or hydroxymethyl.
- a further group of cathepsin inhibitors comprises compounds as defined in the paragraph above, but wherein R' as phenyl bears multiple substitutions, such as Cl-C7alkyl, hydroxy, halo and the like, typically at the 3 and 4 positions.
- Additional preferred definitions for R3 in formula IV include sulphone substituted Cl- 7 alkyl and especially sulphone substituted ArCl-7alkyl, such as benzenesulphonylmethyl, phenylsulphonylmethyl and phenylethylsulphonylmethyl.
- a further aspect ofthe invention provides methods for the treatment or prophylaxis of a parasitic infection, such as a protozoal or bacterial infection, comprising the administration of a compound of formula IV, to a mammal in need thereof.
- a method for the control of protozoal parasites comprising the administration of a compound of formula IV, to an invertebrate vector and/or to a locus prone to infestation of such a vector.
- the protozoal or bacterial parasite is a Plasmodium, Leishmania, Schistosoma, Giardia, Entamoeba, Trypansoma, Crithidia, Pneumocystis or Porphyromonas species.
- the treatment or prophylaxis of Plasmodium falciparium comprises inhibition of a falcipain II enzyme.
- Preferred R3 groups for parasite treatment and prophylaxis include 2-methylpropen-l- yl, isobutyl and benzyl, especially the enantiomers defining the side chain of L-leucine or L-phenylalanine.
- the compounds ofthe invention can form salts which form an additional aspect ofthe invention.
- Appropriate pharmaceutically acceptable salts ofthe compounds of Formula IV include salts of organic acids, especially carboxylic acids, including but not limited to acetate, trifluoroacetate, lactate, gluconate, citrate, tartrate, maleate, malate, pantothenate, isethionate, adipate, alginate, aspartate, benzoate, butyrate, digluconate, cyclopentanate, glucoheptanate, glycerophosphate, oxalate, heptanoate, hexanoate, fumarate, nicotinate, palmoate, pectinate, 3-phenylpropionate, picrate, pivalate, proprionate, tartrate, lactobionate, pivolate, camphorate, undecanoate and succinate, organic sulphonic acids such as methanesulphonate, ethanesulphonate, 2-
- the invention extends to prodrugs, solvates, complexes and other forms releasing a compound of formula IV in vivo.
- the active agent While it is possible for the active agent to be administered alone, it is preferable to present it as part of a pharmaceutical formulation.
- a pharmaceutical formulation will comprise the above defined active agent together with one or more acceptable carriers/excipients and optionally other therapeutic ingredients.
- the carrier(s) must be acceptable in the sense of being compatible with the other ingredients ofthe formulation and not deleterious to the recipient.
- the formulations include those suitable for rectal, nasal, topical (including buccal and sublingual), vaginal or parenteral (including subcutaneous, intramuscular, intravenous and intradermal) administration, but preferably the formulation is an orally administered formulation.
- the formulations may conveniently be presented in unit dosage form, e.g. tablets and sustained release capsules, and may be prepared by any methods well known in the art of pharmacy.
- Such methods include the step of bringing into association the above defined active agent with the carrier.
- the formulations are prepared by uniformly and intimately bringing into association the active agent with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
- the invention extends to methods for preparing a pharmaceutical composition comprising bringing a compound of Formula IV or its pharmaceutically acceptable salt in conjunction or association with a pharmaceutically acceptable carrier or vehicle. If the manufacture of pharmaceutical formulations involves intimate mixing of pharmaceutical excipients and the active ingredient in salt form, then it is often preferred to use excipients which are non-basic in nature, i.e. either acidic or neutral.
- Formulations for oral administration in the present invention may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount ofthe active agent; as a powder or granules; as a solution or a suspension of the active agent in an aqueous liquid or a non-aqueous liquid; or as an oil-in- water liquid emulsion or a water in oil liquid emulsion and as a bolus etc.
- suitable carrier includes vehicles such as common excipients e.g. binding agents, for example syrup, acacia, gelatin, sorbitol, tragacanth, polyvinylpyrrolidone (Povidone), methylcellulose, ethylcellulose, sodium carboxymethylcellulose, hydroxypropylmethylcellulose, sucrose and starch; fillers and carriers, for example corn starch, gelatin, lactose, sucrose, microcrystalline cellulose, kaolin, mannitol, dicalcium phosphate, sodium chloride and alginic acid; and lubricants such as magnesium stearate, sodium stearate and other metallic stearates, glycerol stearate stearic acid, silicone fluid, talc waxes, oils and colloidal silica.
- Flavouring agents such as peppermint, oil of wintergreen, cherry flavouring or the like can also be used. It may be desirable to add
- a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active agent in a free flowing form such as a powder or granules, optionally mixed with a binder, lubricant, inert diluent, preservative, surface-active or dispersing agent.
- Moulded tablets may be made by moulding in a suitable machine a mixture ofthe powdered compound moistened with an inert liquid diluent.
- the tablets may be optionally be coated or scored and may be formulated so as to provide slow or controlled release ofthe active agent.
- compositions suitable for oral administration include lozenges comprising the active agent in a flavoured base, usually sucrose and acacia or tragacanth; pastilles comprising the active agent in an inert base such as gelatin and glycerin, or sucrose and acacia; and mouthwashes comprising the active agent in a suitable liquid carrier.
- the appropriate dosage for the compounds or formulations ofthe invention will depend upon the indication and the patient and is readily determined by conventional animal trials. Dosages providing intracellular (for inhibition of physiological proteases ofthe papain superamily) concentrations ofthe order 0.01-100 uM, more preferably .01-10 uM, such as 0.1-5uM are typically desirable and achievable. Ex vivo or topical administration against parasites will typically involve higher concentrations.
- QSI -protecting group Q or CN-protectedQand the like as used herein refers to those groups intended to protect the N-terminus of an amino acid or peptide or to protect an amino group against undesirable reactions during synthetic procedures.
- N-protecting groups include acyl groups such as formyl, acetyl, propionyl, pivaloyl, t-butylacetyl, 2-chloroacetyl, 2-bromoacetyl, trifluoracetyl, trichloroacetyl.
- Favoured N-protecting groups include formyl, acetyl, allyl, Fmoc, benzoyl, pivaloyl, t-butylacetyl, phenylsulfonyl, benzyl, t-butoxycarbonyl (Boc) and benzyloxycarbonyl (Cbz).
- Hydroxy and/or carboxy protecting groups are also extensively reviewed in Greene ibid and include ethers such as methyl, substituted methyl ethers such as methoxymethyl, methylthiomethyl, benzyloxymethyl, t-butoxymethyl, 2-methoxyethoxymethyl and the like, silyl ethers such as trimethylsilyl (TMS), t-butyldimethylsilyl (TBDMS) tribenzylsilyl, triphenylsilyl, t-butyldiphenylsilyl (TBDPS), triisopropyl silyl and the like, substituted ethyl ethers such as 1-ethoxymethyl, 1 -methyl- 1-methoxyethyl, t-butyl, allyl, benzyl, p-methoxybenzyl, dipehenylmethyl, triphenylmethyl and the like, aralkyl groups such as trityl, and pixyl (9-hydroxy-9-
- Ester hydroxy protecting groups include esters such as formate, benzylformate, chloroacetate, methoxyacetate, phenoxyacetate, pivaloate, adamantoate, mesitoate, benzoate and the like.
- Carbonate hydroxy protecting groups include methyl vinyl, allyl, cinnamyl, benzyl and the like.
- R5 confers many beneficial qualities to molecules of general formula IV including improvements in potency and offers the potential to append inhibitor molecules with a basic functionality to improve solubility and pharmacokinetic properties.
- molecules of formula IN where R5 is alkyl or other substituent and not simply hydrogen show good chiral stability at the pyranone alpha carbon (unless the context otherwise requires referred to as ring position 4 or C4 herein).
- chirally stable is meant that the compounds ofthe invention exist as a predominant stereoisomer rather than an equal mixture of stereoisomers differing in stereochemistry at C4.
- the compounds ofthe invention are greater than 90% diastereomically pure after a protracted time period..
- active inhibitors contain commercially available amino acid residues such as L- leucine, L-norleucine etc .
- active inhibitors contain new and novel hydrophobic amino acids, which are prepared following the chemistry detailed in scheme 7.
- the synthesis detailed in Scheme 7 was adapted from Dexter, C. S. and Jackson, R. F. W. Chem.Commun. 75-76, 1998, and allows ready access to analogues embraced by R3 in formula IN.
- the side chains of some ofthe novel, multiply branched alpha-amino acid building blocks exemplified herein can be thought of as hybrids ofthe properties of combinations of other amino acid side chains, such as those of norleucine and t-butylalanine.
- Access to sulphonyl bearing Cl-C7alkyl or ArCl-C7alkyl R3 groups, for instance arylalkylC0-2sulphonylmethyl functionalities can come from the suitably protected amino acid cysteine. Mitsunobu coupling ofthe cysteinyl thiol with aryl alcohols such as phenol yield the protected amino acid containing the phenylthiomethyl R3 sidechain that is readily oxidised using m-chloroperbenzoic acid to provide the R3 sidechain phenylsulphonylrnethyl.
- the benzylsulphonylrnethyl and phenethylsulphonylrnethyl R3 sidechain containing amino acids can be prepared by nucleophilic substitution of the cysteinyl thiol with benzyl bromide and phenethyl bromide respectively. Oxidation ofthe resulting sulphides with m-chloroperbenzoic acid provides the suitably protected amino acids with the benzylsulphonylrnethyl and phenethylsulphonylrnethyl R3 sidechain.
- Conversion ofthe alcohol 9-Scheme-l to the methyl derivative 10-Scheme 1 can be achieved utilising methods that are known in the art, such as tosylation with tosylchloride and pyridine, with subsequent reaction with the higher order cuprate prepared from methyl lithium. Removal of the Cbz protecting group from 10-Scheme 1 may be achieved with 10% Pd on carbon in the presence of hydrogen to provide 11 -Scheme- 1.
- the amine 11 -Scheme- 1 can be coupled with a carboxylic acid by methods that are known in the art, such as coupling with a pentafluorophenol derivative in the presence of HOBT and ⁇ MM, to provide the amide 12-Scheme-l.
- the tert-butoxycarbonyl group may be removed by treatment with an acid, such as hydrogen chloride in dioxane and the amine salt subsequently coupled with a carboxylic acid by methods that are known in the art, such as coupling with an acid in the presence of HBTU and HOBT, to provide the amide 13-Scheme-l. Removal of the ketal functionality from 13 -Scheme- 1 may be achieved with trifluoroacetic acid in the presence of sodium hydrogen carbonate to provide 14- Scheme-1. Building blocks toward compounds of general formula IV are additionally conveniently prepared by Schemes 2-4:
- 13 14 a) pyridine, acetic anhydride; b) triethylsilane, trimethylsilyl triflate; c) sodium methoxide, methanol; d) cyclohexanone diethylacetal; e) Swern oxidation; f) PPh 3 CHCH3, THF; g) H 2 , palladium on carbon, sodium bicarbonate; h) 80% aqueous acetic acid; i) sodium hydride, benzyl bromide; j) mesyl chloride, pyridine; k) sodium azide, DMF; I) H 2 , palladium on carbon, di-(fetf- butyloxy)carbonyl; m) Dess-Martin periodinane Lyxose 1-scheme-2 can be peracetylated to give 2-Scheme-2 with acetic anhydride in pyridine at room temperature overnight.
- Reduction at the anomeric centre to afford 3-Scheme-2 may be achieved using triethylsilane in the presence of trimethylsilyl triflate. Hydrolysis of the triacetate 3-Scheme-2 affords 4-Scheme-2 whereupon the vicinal diol can be protected as the cyclohexanone acetal 5-Scheme-2. Swern oxidation of the unprotected alcohol functionality gives 6-Scheme-2, a key intermediate for the introduction of the required C5 pyranone substitution. Ethyl substitution is achieved here by treatment with ethyl triphenylphosphonium bromide with potassium tert- butoxide in THF at 0°C to produce 7-Scheme-2.
- L-lyxose can be acylated with a suitable acylating agent such as acid anhydride, acyl halide in an organic solvent like pyridine or other mixed organic solvents, to give the peracylated compound l-scheme-2A.
- a suitable acylating agent such as acid anhydride, acyl halide in an organic solvent like pyridine or other mixed organic solvents
- This compound can then be subjected to anomeric reduction with a trialkyl silane together with a Lewis acid such as triethyl silane and trimethylsilyl frifluormethanesulphonate.
- Transforming the compound into the corresponding halo-, sulpho- or thiocarbo-glycoside followed by a radical reduction, using known methodology, can also bring about the anomeric reduction.
- Deacylation under basic condition provides the triol 3-scheme-2A- which can be selectively protected on the 2,3-hydroxylgroups forming a ketal 4-scheme 2A by using standard protecting group methodology.
- Oxidation ofthe 4-OH group into the keto function 5-scheme-2A can be performed with the Swern procedure, Dess-Martin or any other suitable oxidation method.
- Various 4-substituted alkenes 6-scheme-2A can be achieved by using appropriate Wittig reagents for example triphenylalkylphosphonium halide or triphenylalkylarylphosphonium halide together with a base.
- Catalytic hydrogenation ofthe Wittig product in the presence of a buffer provides predominantly compound 8-scheme-2A.
- the compound with the other configuration at this position 10-scheme-2A can be obtained by removal ofthe ketal protecting group prior to the hydrogenation.
- the alkene compound can also be subjected to hydroboration, which will introduce a hydroxyl group, suitable for further modifications.
- Another possibility to achieve the 4-alkyl compounds is to transform the 4-OH group into a leaving group for example a sulphonate followed by displacement by a cuprous or Grignard reagent ofthe desired alkylgroup.
- the ketal protecting group can be removed under acidic conditions such as 1M HC1/THF 1 :1 at room temperature or heating to 80 °C in aqueous acetic acid which will give the diol 8-scheme-2A.
- acidic conditions such as 1M HC1/THF 1 :1 at room temperature or heating to 80 °C in aqueous acetic acid which will give the diol 8-scheme-2A.
- Selective protection ofthe 2-OH group with an alkylating agent such as benzyl halide or any other similar reagent in the presence of a base can give exclusively or predominantly the 2-O-protected compound 11,12- scheme-2A.
- the 3 -OH can be converted to a suitable leaving group such as a sulphonate, which subsequently can be displaced by an azide 13,14-scheme-2A.
- a Mitsunobu reaction can be used to produce the azide-substituted compound.
- Hydrogenation ofthe azide-compound in the presence of a carbamoylating agent like di-tert-butyl dicarbonate provides the desired l,5-anhydro-3-[(tert- butoxycarbonyl)amino]-3,4-dideoxy-4-ethyl-D-xylitol and 1 ,5-anhydro-3-[(tert- butoxycarbonyl)amino] -2,3 -dideoxy-2-ethyl-L-arabinitol.
- the series of compounds with the other configuration at carbon 3 can be prepared by inversion ofthe configuration ofthe 3 -OH in compound l l,12-scheme-2A by methods that are known in the art, followed by the above procedure i.e. putting on a leaving group and azide displacement. They can also be prepared by the following sequence. Oxidation ofthe 3 -OH into a ketone, using the oxidation reagents previously described, transformation ofthe ketone into an oxime, utilising reagents such as benzyloxyamine halide and finally reduction ofthe oxime into the amino function. This will provide a mixture ofthe compounds with the two different configurations, which can be separated using known methodology. Boc-protection ofthe amino group and reductive removal ofthe benzyl protecting group provides the compounds with the remaining two configurations 4R,5S and 4R,5R. Scheme 3 Bno 2 ⁇ c ⁇ 2Bn
- Alcohol 2-Scheme-3 can be prepared following the literature procedure reported by J. E. Baldwin et al. (Tetrahedron, 1995, 51 (43), 11581). Removal of the ester functionality from 2-Scheme-3 can be achieved with trifluoroacetic acid to provide the lactone 3-Scheme-3. Lactone 3-Scheme-3 can be ring opened by MeONHMe in the presence of Me 3 Al to provide the alcohol 4-Scheme-3. The tert- butoxycarbonyl group may be introduced onto alcohol 4-Scheme-3 to provide 5 ⁇ Scheme-3. The Weinreb amide 5-Scheme-3 can then be treated with lithium aluminum hydride to provide the aldehyde 6-Scheme-3.
- Oxidation of the aldehyde 6-Scheme-3 can be effected by sodium chlorite to provide the acid 7-Scheme-3.
- the Weinreb amide 5-Scheme-3 can then be treated with potassium-tert-butoxide to provide the acid 7-Scheme-3.
- Activation of the acid 7-Scheme-3 with isobutyl chloroformate and 4-methylmorpholine provides 8-Scheme-3.
- Subsequent treatment of 8-Scheme-3 with diazomethane provides the diazoketone 9-Scheme-3.
- Cyclization of diazoketone 9-Scheme-3 can be effected by lithium chloride/aqueous acetic acid to give the dihydro-3(2H)-furanone 10-Scheme-3.
- stereochemistry at R3 is that ofthe corresponding L-amino acid.
- stereochemistry at R5 is S, especially when the adjacent linkage from the ring to the amine ofthe backbone, (ie C4) is also S.
- the compounds ofthe invention are R,R at the latter stereo centres.
- Furan-3 -carboxylic acid (15)-[2-cyclohexyl- 1 -(3 -propyl-5 -oxo-tetral ⁇ ydro-pyran-4- ylcarbamoyl)-ethyl] -amide
- Trimethylsilyl frifluormethanesulphonate 60 ml, 333 mmol was added to a solution of crude 1,2,3,4-tetra-O-acetyl-L-lyxopyroanose constituting the yield from the step above in acetonitrile (200 ml), the solution was cooled on an ice bath and triethylsilane (80 ml, 500 mmol) was added dropwise. The solution was stirred at room temperature and reaction was monitored by GC. When the reaction was complete (after 3 hours), the solution was neutralised with sodium hydrogen carbonate (s), diluted with dichloromethane and washed with water. The organic phase was dried with magnesium sulphate, filtered and concentrated. The obtained oil was purified by silica gel flash column chromatography (pentane: ethyl acetate 5:1, 4:1, 3:1) which gave 32 g, 74 % (from free lyxose) ofthe reduced compound.
- the oxidation was also performed by the Dess-Martin procedure: A suspension of 2,3-O-cyclohexylidene-l-deoxy-L-lyxopyroanose (0.5 g, 2.33 mmol) and Dess-Martin periodinane (1.39 g, 3.29 mmol) in dichloromethane (5 ml) was stirred for 10 min then "wet dichloromethane Q (46 ⁇ l water in 10 ml dichloromethane) was added dropwise during 15 min. After lh tic (toluene: ethyl acetate 1:1) indicated complete conversion ofthe starting material into a higher migrating spot.
- reaction mixture was diluted with diethyl ether (100 ml) and washed with an aqueous solution of sodium hydrogen carbonate/sodium thiosulphate 1:1 (50 ml), dried with sodium sulphate, filtered and concentrated. Purification ofthe residue by flash column chromatography on silica gel (eluent pentane: diethyl ether 1:1) gave the title compound, 0.42 g, 84%, as a crystalline solid.
- NMR data 400 MHz (CDC1 3 ): 1H, ⁇ 1.39-1.43 (m, 2H), 1.56-1.72 (m, 8H), 3.92-4.07 (m, 3H), 4.18-4.23 (m, IH), 4.45 (d, J 6.8 Hz, IH), 4.64-4.67 (m, IH). 13 C, ⁇ 23.9, 24.1, 25.1, 35.3, 36.8, 68.5, 74.1, 75.1, 76.3, 112.4, 205.0.
- the above solution was diluted with ethyl acetate (30 ml), Pd/C ( 10%, 0.2 g) was added and the mixture was hydrogenated at atmospheric pressure. Additional Pd/C was added (0.16 g + 0.20 g) after 40 and 90 minutes. After 100 minutes tic indicated almost complete consumption ofthe starting material.
- the reaction mixture was filtered through celite, concentrated into a liquid (5 ml) and purified by flash column chromatography on silica gel (eluent pentane:ethyl acetate 95:5, 9:1). Appropriate fractions were concentrated to 2.08 g and this solution was used directly in the next step.
- reaction mixture was diluted with ethyl acetate (100 ml), washed with water (3x50 ml), dried with sodium sulphate, filtered and concentrated. Purification of residue by flash column chromatography on silica gel (eluent pentane:ethyl acetate 9:1, 4:1) gave 0.52 g, 64% of a colourless solid.
- Methanesulphonyl chloride (0.34 g, 2.96 mmol) was added to a stirred solution of 1,5- anhydro-2-O-benzyl-4-deoxy-4-ethyl-D-ribitol (0.28 g, 1.18 mmol) in pyridine (5 ml). The reaction mixture was warmed to 50 °C and stirred for one hour. Dichloromethane (100 ml) was added and the reaction mixture was washed successively with IM aqueous sulphuric acid (2x50 ml), IM aqueous sodium hydrogen carbonate, dried with sodium sulphate, filtered and concentrated.
- lactone ring of (4-methyl-2-oxo-tetrahydro-furan-3-yl)-carbamic acid benzyl ester can be opened using ⁇ /,O-dimethylhydroxylamine hydrochloride in the presence of Me 3 AI to give the title compound.
- N-extended 4-aminopyranone from example 1 step b) is treated with a solution of 4.0M HCl in dioxan (5mL) at room temperature for lhr.
- the solvents were removed in vacuo and the residue azeotroped with 2 x toluene to give the hydrochloride salt.
- Hydrochloride salt was dissolved in dry DCM (2mL) and furan-3 -sulphonylchloride added followed by diisopropylethylamine (3 eq) and catalytic N,N- dimethylaminopyridine (2mg).
- Zinc dust (150mg, 2.3mmol, 3.0eq, Aldrich) was weighed into a 25mL round bottom flask with a side arm and fitted with a three way tap. The zinc powder was heated with a heat gun under vacuum and the flask was flushed with nitrogen and evacuated and flushed a further three times. With the flask filled with nitrogen, dry DMF (lmL) was added. Trimethylsilylchloride (30 ⁇ l, 0.23mmol, 0.3eq) was added and the zinc slurry was vigorously stirred for a further 30mins.
- CuBr.SMe 2 (20mg, O.lmmol, 0.13eq) was weighed into a 25ml round bottom flask fitted with a three way tap and dried "gently Q with a heat gun under vacuum until CuBr.SMe 2 changed appearance from a brown powder to give a light green powder. Dry DMF (0.5mL) was then added followed by addition ofthe elecfrophile (either l-bromo-2-methylbut-2-ene, toluene-4- sulfonic acid-(E)-2-methyl-but-2-enyl ester or l-bromo-2,3-dimethylbut-2-ene) (l.Ommol, 1.3eq). The reaction mixture was then cooled to -15°C.
- the alkene (l.Ommol) was dissolved in ethanol (lOmL), 10% palladium on carbon (80mg) added and hydrogen introduced. Once the reaction had been deemed to have reached completion, the hydrogen was removed, the reaction filtered through Celite and the catalyst washed with ethanol (30mL). The combined organic filtrate was concentrated in vacuo and the alkane used directly in the subsequent reaction.
- the N-Boc protected material (l.Ommol) was dissolved in DCM (2mL) and cooled to 0°C. Trifluoroacetic acid (2mL) was added dropwise and when the reaction was deemed to have reached completion, the solvents were removed in vacuo to yield the amine used directly in the subsequent reaction.
- the N-Boc protected material (l.Ommol) was cooled to 0°C and 4M HCl in dioxane (5mL) added dropwise and when the reaction was deemed to have reached completion, the solvents were removed in vacuo to yield the amine used directly in the subsequent reaction.
- Molecules are assembled using pyranone building blocks and novel protected aminoacids described earlier, by solid phase procedures on Chiron multipins following the protocols detailed below.
- the compounds are synthesised in parallel fashion using the appropriately loaded Fmoc-Building block-linker-DA MDA derivatised macrocrowns (see above) loaded at approximately 3.5 — 9.1 ⁇ moles per crown. Prior to synthesis each crown is connected to its respective stem and slotted into the 8 x 12 stem holder. Coupling ofthe amino acids employs standard Fmoc amino acid chemistry as described in 'Solid Phase Peptide Synthesis', E. Atherton and R.C. Sheppard, IRL Press Ltd, Oxford, UK, 1989. Removal of N ⁇ -Fmoc Protection
- a 250 mL solvent resistant bath is charged with 200 mL of a 20% piperidine/DMF solution.
- the multipin assembly is added and deprotection allowed to proceed for 30 minutes.
- the assembly is then removed and excess solvent removed by brief shaking.
- the assembly is then washed consecutively with (200 mL each), DMF (5 minutes) and MeOH (5 minutes, 2 minutes, 2 minutes) and left to air dry for 15 minutes.
- a lcm path length UN cell is charged with 1.2 mL of a 20% piperidine/DMF solution and used to zero the absorbance ofthe UN spectrometer at a wavelength of 290nm.
- Coupling reactions are performed by charging the appropriate wells of a polypropylene 96 well plate with the pattern of activated solutions required during a particular round of coupling. Macrocrown standard couplings were performed in DMF (500 ⁇ l).
- the appropriate ⁇ ⁇ -Fmoc amino acid pfp esters (10 equivalents calculated from the loading of each crown) and HOBt (10 equivalents) required for the particular round of coupling are accurately weighed into suitable containers.
- the appropriate N ⁇ -Fmoc amino acids (10 equivalents calculated from the loading of each crown), desired coupling agent e.g. HBTU (9.9 equivalents calculated from the loading of each crown) and activation e.g. HOBt (9.9 equivalents calculated from the loading of each crown), NMM (19.9 equivalents calculated from the loading of each crown) are accurately weighed into suitable containers.
- the protected and activated Fmoc amino acid derivatives are then dissolved in DMF (500 ⁇ l for each macrocrown e.g. for 20 macrocrowns, 20 x 10 eq. x 7 ⁇ moles of derivative would be dissolved in 10 mL DMF).
- the appropriate derivatives are then dispensed to the appropriate wells ready for commencement ofthe 'coupling cycle'. As a standard, coupling reactions are allowed to proceed for 6 hours. The coupled assembly was then washed as detailed below.
- the multipin assembly is briefly shaken to remove excess solvent washed consecutively with (200 mL each), MeOH (5 minutes) and DMF (5 minutes) and de- protected. If the multipin assembly is to be stored or reacted further, then a full washing cycle consisting brief shaking then consecutive washes with (200 mL each), DMF (5 minutes) and MeOH (5 minutes, 2 minutes, 2 minutes) is performed.
- the appropriate acid capping group (10 equivalents calculated from the loading of each crown), desired coupling agent e.g. HBTU (9.9 equivalents calculated from the loading of each crown) and activation e.g. HOBt (9.9 equivalents calculated from the loading of each crown), NMM (19.9 equivalents calculated from the loading of each crown) are accurately weighed into suitable containers.
- the acid derivatives / coupling agents are then dissolved in DMF (500 ⁇ l for each macrocrown e.g. for 20 macrocrowns, 20 x 10 eq. of derivative would be dissolved in 10 mL DMF) and left to activate for 5 minutes.
- the appropriate derivatives are then dispensed to the appropriate wells ready for commencement ofthe 'capping cycle'. As a standard, capping reactions are allowed to proceed for 18 hours overnight. The capped assembly was then washed as detailed above.
- Acid mediated cleavage protocols are strictly performed in a fume hood.
- 96 well plate (1 mL/well) is labelled and weighed to the nearest mg. Appropriate wells are then charged with a frifluoroacetic acid/water (95:5, v/v, 600 ⁇ l) cleavage solution, in a pattern corresponding to that ofthe multipin assembly to be cleaved.
- the multipin assembly is added, the entire construct covered in tin foil and left for 2 hours.
- the multipin assembly in then added to another polystyrene 96 well plate (1 mL/well) containing frifluoroacetic acid/water (95:5, v/v, 600 ⁇ l) (as above) for 5 minutes.
- the primary polystyrene cleavage plate (2 hour cleavage) and the secondary polystyrene plate (5 minute wash) are then placed in the Gene Vac evaporator and the solvents removed (minimum drying rate) for 90 minutes.
- the contents ofthe secondary polystyrene plate are transferred to their corresponding wells on the primary plate using an acetonitrile/water (50: 50 v/v/v) solution (3 x 150 ⁇ l) and the spent secondary plate discarded. Aliqouts (5-20 ⁇ L) are taken for analysis.
- the plate was covered in tin foil, pin-pricked over wells containing compounds, placed into the freezer for lhr, then lyophilised.
- Cathepsin S (Mammalian, murine and rat)
- Assays were performed in 100 mM sodium phosphate, 100 mM NaCl, pH 6.5 (buffer) in white 384 well plates (Corning Costar). Eight inhibitors were assayed per plate.
- Inhibitor dilutions were performed on a 96 well N-bottomed polypropylene plate (Corning Costar). 100 ⁇ l of buffer was placed in wells 2-5 and 7-12 of rows A, B, C and D. Sufficient of each inhibitor at 10 mM in DMSO was placed into wells Al-Dl and A6-D6 to give the desired final concentration when the volume in the well was made up to 200 ⁇ l with buffer. Column 1 was made up to 200 ⁇ l with buffer, mixed by aspirating and dispensing 100 ⁇ l in the well, and 100 ⁇ l transferred to column 2. The pipette tips were changed and the mixing and fransferral repeated to column 5. This process was repeated for columns 6-10.
- Substrate dilutions were performed on a 96 deep well polypropylene plate (Beckman Coulter). 280 ⁇ l of buffer was placed in wells B-H of columns 1 and 2. 70 ⁇ l of 10 mM boc-Nal-Leu-Lys-AMC was placed in Al and A2. 2 x 250 ⁇ l of buffer was added to wells Al and A2, mixed by aspirating and dispensing 280 ⁇ l in the well, and 280 ⁇ l transferred to row B. The pipette tips were changed and the process repeated down the plate to row H.
- Column 1 ofthe substrate dilution plate was distributed at 10 ⁇ l per well into alternate rows beginning at row A.
- Column 2 was distributed to alternate rows beginning at row B.
- Row A ofthe inhibitor dilution plate was distributed at 10 ⁇ l per well to alternate rows and columns starting at Al .
- Row B was distributed to alternate rows and columns starting at A2.
- Row C was distributed to alternate rows and columns starting at Bl and row D was distributed to alternate rows and columns starting at B2.
- the assay was started by the addition of 30 ⁇ l per well of 20 nM cathepsin S in buffer containing 10 mM 2-mercaptoethanol.
- Assays were performed essentially as above.
- the buffer used was 100 mM sodium acetate, 1 mM EDTA, pH 5.5 and the substrate was J> ⁇ Nal-Leu-Lys-AMC with a highest concentration of 100 ⁇ M.
- the buffer used was 100 mM MES/Tris, 1 mM EDTA, pH 7.0 and the substrate was E>-Ala-Leu-Lys-AMC with a highest concentration of 250 ⁇ M.
- Convenient assays for cathepsin K arere carried out using human recombinant enzyme, as described above.
- Standard assay conditions for the determination of kinetic constants used a fluorogenic peptide substrate, typically H-£>-Ala-Leu-Lys-AMC, and were determined in either 100 mM Mes/Tris, pH 7.0 containing 1 mM EDTA and 10 mM 2-mercaptoethanol or 100 mM Na acetate, pH 5.5 containing 5 mM EDTA and 20 mM cysteine.
- the enzyme concentration used was 5 nM.
- the stock substrate solution was prepared at 10 mM in DMSO.
- v ⁇ is the velocity ofthe reaction, Vis the maximal velocity, Sis the concentration of substrate with Michaelis constant of K M , and /is the concentration of inhibitor.
- the deoxyoligonucleotide primers are The deoxyoligonucleotide primers:
- 5'CGCGTCGACTTAATGATGATGATGATGATGTTCAATTAATGGAATGAATG CATCAGT-3' were designed based on sequences deposited at the Sanger Centre, Cambridge, UK (httpJ/www.sanger.ac.uk/Proiects/P falciparurn/blast server, shlmf). These primers were designed to amplify a portion ofthe cDNA sequence ofthe cysteinyl proteinase now known as Falcipain 2 and to include relevant terminal cloning enzymes sites and a carboxy-terminal hexahistidine coding sequence immediately upsfream ofthe stop codon.
- Polymerase chain reaction was performed with the above primers and Plasmodium falciparum phage library DNA as a template using the following conditions; 94°C for 2 minutes then 35 cycles of 94°C for 10 seconds, 50°C for 1 minute, and 60°C for 2 minutes, this was followed by a 60°C 5 minute incubation.
- the 880bp PCR amplicon was purified and phosphorylated using T4 polynucleotide kinase. This DNA was then ligated into EcoRV cleaved, dephosphorylated Bluescript II cloning vector and transformed into DH5 alpha E.coli.
- the DNA sequence of the plasmid inserts in isolated recombinant E.coli clones were determined using an Amersham Megabace sequencing instrument.
- a three-way ligation was conducted bringing together the N-terminus of truncated falcipain-2 (Ncol/Ndel), the C-terminus of falcipain-2 (Ndel Ba Hl) and the vector ⁇ QE-60 (NcoI/BamHI).
- the TF2.10 insert was excised from the pQE-60 vector using the restriction enzymes ⁇ col and BamHI, ligated into ⁇ coI/BamHI cut expression vector pET-l lD and transformed into DH5 alpha E.coli.
- the presence of a recombinant expression plasmid (pET-TF2.10) in an isolated E.coli colony was confirmed by restriction enzyme digest of plasmid D ⁇ A.
- BL21(DE3) E.coli were transformed with pET-TF2.10 and used for expression ofthe recombinant cysteinyl proteinase.
- pET-TF2.10-Transformed BL21(DE3) E.coli (BLTF2.10) were grown up overnight at 200 rpm, 37°C in Luria broth containing 100 ⁇ g/ml ampicillin. Fresh medium was then inoculated and grown to an OD 6 oo nm of 0.8 before protein expression was induced using 1 mM IPTG. Induction was performed for 3 hours at 200 rpm, 37°C then the bacterial cells harvested by centrifugation and stored at -80°C until protein purification performed. Protein Purification and Refolding
- E.coli cell pellet equivalent to 250ml culture was lysed by resuspension in solubilisation buffer (6M guanidine hydrochloride, 20mM Tris-HCl, 250mM NaCl, 20mM imidazole, pH8.0) for 30 minutes at room temperature. After centrifugation at 12000g for 10 minutes at 4°C the cleared lysate was applied to 1 ml nickel-NTA agarose, and agitated for 1 hour at room temperature.
- solubilisation buffer 6M guanidine hydrochloride, 20mM Tris-HCl, 250mM NaCl, 20mM imidazole, pH8.0
- the protein bound to nickel-NTA was batch washed with 6M guanidine hydrochloride, 20mM Tris-HCl, pH 8.o, 250mM NaCl then 8M urea, Tris-HCl, pH 8.0, 500mM NaCl then 8M urea, Tris-HCl, pH 8.0 including 30 mM imidazole and protein elution performed using 8M urea, Tris-HCl, pH 8.0 with 1 M imidazole.
- the eluted protein was then diluted 100 fold in refolding buffer (lOOmM Tris-HCl, lmM EDTA, 20% glycerol, 250mM L-arginine, lmM reduced glutathione, O.lmM oxidised glutatione, pH8.0) and left stirring overnight at 4°C.
- the protein could then be concentrated either by filter centrifugation or repurification using a nickel-agarose column (after dialysis to remove the EDTA).
- the protein bound to nickel-NTA was batch washed with 8M urea, Tris-HCl, 500mM NaCl, pH 8.0 then 8M urea, Tris-HCl, pH 8.0 including 20 mM imidazole, then 2M urea, Tris-HCl, pH 8.0.
- the protein was then refolded on the column by the addition of lOOmM Tris-HCl, pH8.0, 250mM L-arginine, lmM reduced glutathione, O.lmM oxidised glutatione with incubation at 4°C and protein elution performed using, lOOmM Tris-HCl, pH 8.0 with 0.5 M imidazole.
- Convenient assays for falcipain 2 are carried out using the above recombinant enzyme.
- Sijali et al. Prot Exp Purif 22 128-134 2001 describes a useful assay.
- Standard assay conditions for the determination of kinetic constants used a fluorogenic peptide substrate, typically Boc-Nal-Leu-Lys-AMC, and were determined in either 100 mM Mes/Tris/acetate, pH 7.0 containing 1 M ⁇ aCl and 10 mM 2-mercaptoethanol or 100 mM ⁇ a phosphate, pH 5.5 containing 1 M ⁇ aCl and 10 mM 2- mercaptoethanol.
- the enzyme concentration used was 2 nM.
- the stock substrate solution was prepared at 10 mM in DMSO. Screens were carried out at a fixed substrate concentration of 80 ⁇ M and detailed kinetic studies with doubling dilutions of substrate from 250 ⁇ M. The total DMSO concentration in the assay was kept below 3%>. All assays were conducted at ambient temperature. Product fluorescence (excitation at 390 nm, emission at 460 nm) was monitored with a Labsystems Fluoroskan Ascent fluorescent plate reader. Product progress curves were generated over 15 minutes following generation of AMC product.
- v ⁇ is the velocity ofthe reaction
- J ⁇ is the maximal velocity
- S is the concentration of substrate with Michaelis constant of KM
Landscapes
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Veterinary Medicine (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Life Sciences & Earth Sciences (AREA)
- Tropical Medicine & Parasitology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Rheumatology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Communicable Diseases (AREA)
- Pulmonology (AREA)
- Pain & Pain Management (AREA)
- Biomedical Technology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pyrane Compounds (AREA)
- Plural Heterocyclic Compounds (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US25284000P | 2000-11-17 | 2000-11-17 | |
| US252840P | 2000-11-17 | ||
| PCT/US2001/046486 WO2002040462A2 (en) | 2000-11-17 | 2001-11-16 | Cysteine protease inhibitors |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1345931A2 true EP1345931A2 (en) | 2003-09-24 |
Family
ID=22957768
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01996110A Withdrawn EP1345931A2 (en) | 2000-11-17 | 2001-11-16 | Cysteine protease inhibitors |
Country Status (6)
| Country | Link |
|---|---|
| EP (1) | EP1345931A2 (en) |
| JP (1) | JP2004513942A (en) |
| AU (1) | AU2002227222A1 (en) |
| CA (1) | CA2428863A1 (en) |
| IL (1) | IL155961A0 (en) |
| WO (1) | WO2002040462A2 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7132449B2 (en) | 2001-01-17 | 2006-11-07 | Amura Therapeutics Limited | Inhibitors of cruzipain and other cysteine proteases |
| IL156776A0 (en) | 2001-01-17 | 2004-02-08 | Amura Therapeutics Ltd | Inhibitors of cruzipain and other cysteine proteases |
| WO2002057270A1 (en) | 2001-01-17 | 2002-07-25 | Amura Therapeutics Limited | Inhibitors of cruzipain and other cysteine proteases |
| US7297714B2 (en) * | 2003-10-21 | 2007-11-20 | Irm Llc | Inhibitors of cathepsin S |
| TWI402072B (en) * | 2010-10-19 | 2013-07-21 | Lilly Co Eli | Cathepsin s inhibitor compounds |
| IL313712A (en) * | 2021-12-23 | 2024-08-01 | Syncrest Inc | Organic copper compound, and method for producing organic copper compound |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AR013079A1 (en) * | 1997-05-06 | 2000-12-13 | Smithkline Beecham Corp | SUBSTITUTED DERIVATIVES OF TETRAHIDROFURANO-3-ONAS, TETRAHIDROPIRANO-3- ONAS AND TETRAHIDROTIOFEN-3-ONAS, A PROCEDURE FOR THE PREPARATION OF A PHARMACEUTICAL COMPOSITION OF A MEDICINAL PRODUCT USEFUL AS INTERMEDIATE PROTEIN INHIBITORS |
| DZ3083A1 (en) * | 1999-02-19 | 2004-06-02 | Smithkline Beecham Corp | New protease inhibitor compounds, process for their preparation and pharmaceutical compositions containing them |
-
2001
- 2001-11-16 WO PCT/US2001/046486 patent/WO2002040462A2/en not_active Ceased
- 2001-11-16 AU AU2002227222A patent/AU2002227222A1/en not_active Abandoned
- 2001-11-16 JP JP2002543473A patent/JP2004513942A/en not_active Withdrawn
- 2001-11-16 IL IL15596101A patent/IL155961A0/en unknown
- 2001-11-16 EP EP01996110A patent/EP1345931A2/en not_active Withdrawn
- 2001-11-16 CA CA002428863A patent/CA2428863A1/en not_active Abandoned
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0240462A2 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2002227222A1 (en) | 2002-05-27 |
| WO2002040462A3 (en) | 2003-02-13 |
| IL155961A0 (en) | 2003-12-23 |
| JP2004513942A (en) | 2004-05-13 |
| WO2002040462A2 (en) | 2002-05-23 |
| CA2428863A1 (en) | 2002-05-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP1178986B1 (en) | Furanone derivatives as inhibitors of cathepsin s | |
| US20230190698A1 (en) | Bicyclic compound and use thereof for medical purposes | |
| WO2007129745A1 (en) | Heteroarylamide lower carboxylic acid derivative | |
| JP2002504081A (en) | Novel benzo-1,3-dioxolyl- and benzofuranyl-substituted pyrrolidine derivatives as endothelin antagonists | |
| NZ337889A (en) | Cysteine Protease inhibitors of the Papain superfamily comprising cathepsin K protease inhibitors | |
| JP2001512119A (en) | Endothelin antagonist | |
| EP1358183B1 (en) | Cysteine protease inhibitors | |
| EP1345931A2 (en) | Cysteine protease inhibitors | |
| CA2744888A1 (en) | Cysteine protease inhibitors | |
| WO2006064286A1 (en) | Cathepsin s inhibitors | |
| US20030203900A1 (en) | Cysteine protease inhibitors | |
| CN101300226B (en) | Alkylcarbamoyl naphthoxyoctenoylhydroxyamide derivatives having inhibitory activity against histone deacetylase and process for preparing the same | |
| US20030186962A1 (en) | Cysteine protease inhibitors | |
| WO2007144379A1 (en) | Bicyclic compounds useful as cathepsin s inbhibitors | |
| KR100814092B1 (en) | Alkyl carbamoyl naphthalenyloxy octenoyl hydroxyamide derivatives having histone deacetylase inhibitory activity, preparation method thereof, and pharmaceutical composition for anticancer agent comprising the same as an active ingredient | |
| AU2001297800A1 (en) | Cysteine protease inhibitors | |
| US6566373B2 (en) | Protease inhibitors | |
| HUP0301964A2 (en) | Protease inhibitors | |
| CN1976710B (en) | Compounds and compositions as cathepsin S inhibitors | |
| CN100469780C (en) | cysteine protease inhibitors | |
| KR100402561B1 (en) | Hydrazine derivatives | |
| WO2005082876A1 (en) | C-5 substituted furanone dipeptide cathepsin s inhibitors | |
| MXPA99010254A (en) | Protease inhibitors | |
| MXPA06007730A (en) | Cysteine protease inhibitors | |
| HK1178878A (en) | New cathepsin s protease inhibitors, useful in the treatment of e.g. autoimmune disorders, allergy and chronic pain conditions |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030616 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: MORISSON, VERONIQUE,MEDIVIR UK LTD. Inventor name: NILSSON, MAGNUS,MEDIVIR AB Inventor name: GRABOWSKA, URSZULA,MEDIVIR UK LTD. Inventor name: TAYLOR, STEVEN Inventor name: QUIBELL, MARTIN |
|
| 17Q | First examination report despatched |
Effective date: 20031125 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20040608 |