EP1334112A2 - Cell lines expressing a mch receptor - Google Patents
Cell lines expressing a mch receptorInfo
- Publication number
- EP1334112A2 EP1334112A2 EP01989984A EP01989984A EP1334112A2 EP 1334112 A2 EP1334112 A2 EP 1334112A2 EP 01989984 A EP01989984 A EP 01989984A EP 01989984 A EP01989984 A EP 01989984A EP 1334112 A2 EP1334112 A2 EP 1334112A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- mchrl
- cell
- neuroblastoma
- activity
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N5/00—Undifferentiated human, animal or plant cells, e.g. cell lines; Tissues; Cultivation or maintenance thereof; Culture media therefor
- C12N5/06—Animal cells or tissues; Human cells or tissues
- C12N5/0602—Vertebrate cells
- C12N5/0693—Tumour cells; Cancer cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2503/00—Use of cells in diagnostics
- C12N2503/02—Drug screening
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
Definitions
- MCH Melanin-concentrating hormone
- MCH has been localized primarily to neuronal cell bodies of the hypothalamus which are implicated in the control of food intake, including perikarya of the lateral hypothalamus and zona inertia. (Knigge, et al, 1996. Peptides 17, 1063- 1073.)
- MCH mRNA is up regulated in fasted mice and rats, in the ob/ob mouse and in mice with targeted disruption in the gene for neuropeptide Y (NPY).
- NPY neuropeptide Y
- Injection of MCH centrally (ICV) stimulates food intake and MCH antagonizes the hypophagic effects seen with ⁇ melanocyte stimulating hormone (o-MSH).
- o-MSH ⁇ melanocyte stimulating hormone
- MCH action is not limited to modulation of food intake as effects on the hypothalamic-pituitary-axis have been reported. (Nahon, 1994. Critical Rev. in Neurobiol. 8, 221-262.) MCH may be involved in the body response to stress as MCH can modulate the stress-induced release of CRF from the hypothalamus and ACTH from the pituitary. In addition, MCH neuronal systems may be involved in reproductive or maternal function.
- the present invention features neuroblastoma and skin cell carcinoma cell lines functionally expressing MCHRl and the use of such cells to measure
- MCHRl activity Functional expression is preferably achieved in a neuroblastoma or skin cell carcinoma using a recombinant gene expressing MCHRl.
- the presence of a recombinant MCHRl gene increases the level of MCHRl expression facilitating the production and detection of MCHRl activity.
- a first aspect of the present invention describes a neuroblastoma or skin cell carcinoma comprising a recombinant MCHRl gene that expresses functional MCHRl.
- Functional MCHRl produces a detectable signal upon MCH stimulation.
- the recombinant MCHRl gene may be part of a genome or may be present outside of the genome.
- An MCHRl gene contains nucleic acid encoding for MCHRl and regulatory elements needed for functional expression.
- regulatory elements useful for functional expression include a promoter, a terminator, a ribosome binding site, and a polyadenylation region.
- the nucleic acid encoding for MCHRl can be contiguous or may contain one or more introns.
- a recombinant MCHRl gene encodes for MCHRl and contains one or more regions not naturally associated with each other. Examples of recombinant MCHRl genes include those containing a human nucleic acid sequence encoding for MCHRl present with a regulatory sequence not naturally associated with the encoding nucleic acid; and those containing a non-naturally occurring encoding region.
- a non- naturally encoding region contains one or more combinations of nucleotides not present in the naturally occurring encoding nucleic acid. Recombinant genes can be produced with, or without, intron(s).
- Another aspect of the present invention describes a neuroblastoma or skin cell carcinoma having increased MCHRl expression produced by a process comprising the step of coupling endogenous nucleic acid encoding for MCHRl to an exogenous promoter. The process results in the production of a recombinant MCHRl gene having the same chromosomal location as the native MCHRl gene.
- Another aspect of the present invention describes a method of measuring the ability of a compound to affect MCHRl activity.
- the method comprises the steps of: (a) providing a compound to a neuroblastoma or skin cell carcinoma expressing MCHRl; and (b) measuring MCHRl activity.
- Human neuroblastoma and skin cell carcinoma cell lines able to produce MCHRl transcripts and to provide a suitable environment for measuring MCHRl activity are identified herein.
- Human cell lines expressing MCHRl provide a human cellular environment that naturally expresses MCHRl.
- Cells expressing functional MCHRl provide a system for screening for compounds active at MCHRl, measuring the effect of a compound at MCHRl, and measuring the effect of MCHRl activity.
- MCHRl expression in a neuroblastoma or skin cell carcinoma is preferably increased using a recombinant MCHRl gene that either makes use of endogenous nucleic acid encoding for MCHRl or provides exogenous nucleic acid encoding MCHRl.
- Compounds modulating MCHRl activity have a variety of different uses including utility as a tool to further study MCHRl activity and as an agent to achieve a beneficial effect in a patient.
- Beneficial effects of modulating MCHRl activity include one or more of the following: weight loss, weight gain, cancer treatment (e.g., colon or breast), pain reduction, diabetes treatment, stress reduction and sexual dysfunction treatment.
- Modulating MCHRl activity includes evoking a response at the receptor and altering a response evoked by a MCHRl agonist or antagonist.
- MCH receptor antagonists and allosteric modulators negatively affecting activity may be used to achieve weight loss, treat cancer (e.g., colon or breast), reduce pain, reduce stress or treat sexual dysfunction; and MCH receptor agonists and allosteric modulators positively affecting activity may be used to produce a weight gain.
- a patient is a mammal, preferably a human. Reference to patient does not necessarily indicate the presence of a disease or disorder.
- patient includes subjects treated prophylactically and subjects afflicted with a disease or disorder.
- MCHRl activity is modulated to treat diabetes, to obtain a weight loss, or to obtain a weight gain.
- Diabetes mellitus can be treated by, for example, one or both of the following: enhancing glucose tolerance and decreasing insulin resistance.
- Excessive weight is a contributing factor to different diseases including hypertension, diabetes, dyslipidemias, cardiovascular disease, gall stones, osteoarthritis and certain forms of cancers. Bringing about a weight loss can be used, for example, to reduce the likelihood of such diseases and as part of a treatment for such diseases. Weight reduction can be achieved by, for example, one or more of the following: reducing appetite, increasing metabolic rate, reducing fat intake or reducing carbohydrate craving.
- Increasing weight is particularly useful for a patient having a disease or disorder, or under going a treatment, accompanied by weight loss.
- diseases or disorders accompanied by weight loss include anorexia, AIDS, wasting, cachexia, and frail elderly.
- treatments accompanied by weight loss include chemotherapy and radiation therapy.
- MCHRl MCHRl employed in the present invention includes naturally occurring human MCHRl having the amino acid sequence provided by SEQ. ID. NO.
- Variants of MCHRl have a substantially identical amino acid sequence as SEQ. ID. NO. 1 and have MCH receptor activity. Examples of SEQ. ID.
- SEQ. ID. NO. 1 variants include naturally occurring allelic variants and artificially produced mutants.
- SEQ. ID. NO. 1 and the naturally occurring encoding nucleic acid sequence were initially identified as the somatostatin-like receptor "SLC-1.” (Lalcaye, et al, 1998. Biochimica et Biophysica ACTA 1401:216-220.) Subsequently, SLC-1 was shown to be MCHRl. cDNA and genomic sequences encoding for MCHRl are provided by SEQ. ID. NOs. 2 and 3.
- SEQ. ID. NO. 1 variants have a sequence identity of at least about 90%, preferably, at least about 95%, with SEQ. ID. NO. 1; and/or contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid modifications from SEQ. ID. NO. 1.
- Amino acid modifications are additions, deletions, and substitutions. Sequence similarity for polypeptides can be determined by BLAST.
- sequence similarity is determined using tBLASTn search program with the following parameters: MATRIX:BLOSUM62, PER RESIDUE GAP COST: 11, and Lambda ratio: 1.
- Artificial variants of MCHRl can be produced in a cell by introducing nucleic acid encoding for the variant. Nucleic acid sequences encoding for variants can be obtained by altering the nucleic acid sequence encoding for SEQ. ID. NO. 1. The translation of a particular codon into a particular amino acid is well known in the art (see, e.g., Lewin, GENES IV, p. 119, Oxford University Press, 1990):
- Changes to SEQ. ID. NO. 1 to produce functional variants may be empirically determined. Techniques for measuring MCH receptor activity are well known in the art.
- One method of producing functional variants of SEQ. ID. NO. 1 expected to retain some MCH receptor activity takes into account differences in amino acid R groups.
- An R group effects different properties of an amino acid such as physical size, charge, and hydrophobicity.
- Amino acids can be divided into different groups as follows: neutral and hydrophobic (alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, and methionine); neutral and polar (glycine, serine, threonine, tyrosine, cysteine, asparagine, and glutamine); basic
- such changes are made taking into account the position of the amino acid to be substituted in the polypeptide.
- arginine can substitute more freely for nonpolor amino acids in the interior of a polypeptide then glutamate because of its long aliphatic side chain.
- Recombinant MCHRl Gene A recombinant MCHRl gene can be used to increase the level of
- Methods for producing a recombinant MCHRl gene include those altering the endogenous MCHRl gene and those introducing an MCHRl gene or coding region into a host cell. Alterations of an endogenous MCHRl gene producing a recombinant gene include the use of regulatory elements such as a promoter or enhancer not naturally associated with the MCHRl coding region; and using a non-naturally encoding region containing one or more combinations of nucleotides not present in the naturally occurring encoding nucleic acid. Examples of exogenous promoters include the human cytomegalovirus promoter ("CMN"), ⁇ -MHC promoter, PrP (prion promoter), potent neuronal promoter and Thy-1 promoter.
- CCN human cytomegalovirus promoter
- PrP prion promoter
- Thy-1 promoter potent neuronal promoter
- ⁇ on-naturally occurring encoding regions can be produced based on the degeneracy of the genetic code. If desired, the nucleic acid encoding for MCHRl can be altered based on the genetic code to adjust codon frequency.
- Exogenous nucleic acid can be targeted to the MCHRl gene using homologous recombination targeting sequences.
- Homologous recombination targeting sequences for insertion into the MCHRl gene include coding and non-coding regions.
- an exogenous promoter such as the CMN promoter
- the GOTO MCHRl genomic sequence can be cloned into a plasmid vector.
- the MCHRl promoter region (2-3 kb) upstream of coding sequence can be replaced by a CMN promoter cassette containing a loxP-neomycin-loxP gene.
- the resulting promoter-exchange vector would have sufficient MCHRl genomic sequences flanking the CMN promoter cassette for homologous recombination.
- the vector can then be electroporated into the GOTO cell.
- ⁇ eomycin resistant clones can be selected and verified by genomic Southern analysis for successful promoter exchange.
- the neomycin gene can be removed by loxP mediated recombination to reduce its possible interference with promoter activity.
- Introducing an MCHRl gene or coding region into a host can be achieved by inserting a MCHRl coding region or gene into the host genome or through the use of an independently replicating vector.
- Techniques for inserting nucleic acid into the host genome include those targeting and selecting for insertion in a particular region and those involving random insertion.
- Techniques for measuring MCHRl activity include detecting a change in the intracellular conformation of MCHRl, measuring G-protein activity, and measuring the level of intracellular messengers. Assays measuring different G-protein activities, such as Gi, Gs, and Gq can be carried out using techniques that are well known in the art. MCHRl activity is preferably assayed for by measuring either Gi or Gq activity.
- Gi and Gs activity can be measured using techniques such as a melonaphore assay, assaying cAMP production, assaying inhibition of cAMP accumulation, intracellular acidification, and assaying 35S-GTP binding.
- cAMP can be measured using different techniques such as a radioimmunoassay and indirectly by cAMP responsive gene reporter proteins.
- Gq and Gi activity can be measured using techniques such as those detecting intracellular Ca 2+ and intracellular acidification.
- techniques well known in the art that can be employed to measure Ca include the use of dyes such as Fura-2 and the use of Ca 2+ -bioluminescent sensitive reporter proteins such as aequorin. (Button, et al.,1993. Cell Calcium 14, 663-671, and Feighner, et al, 1999. Science 284, 2184-2188, both of which are hereby incorporated by reference herein.)
- Functional assays can be performed using individual compounds or preparations containing different compounds. A preparation containing different compounds where one or more compounds affect MCHRl activity can be divided into smaller groups of compounds to identify the compound(s) affecting MCHRl activity. In an embodiment of the present invention a test preparation containing at least 10 compounds is used in a functional assay.
- Human cell lines able to express MCHRl transcripts include neuroblastoma and skin cell carcinoma.
- the ability of different neuroblastoma cell lines and a squamous cell carcinoma is illustrated in the Examples provided below.
- the squamous cell carcinoma provides an example of a skin cell carcinoma.
- the skin cell carcinoma is a squamous cell carcinoma or a kertinocyte cell carcinoma.
- the ability of different neuroblastoma cells lines and a skin cell carcinoma to express MCHRl transcripts points to these types of cell lines as containing members able to express MCHRl. Additional neuroblastoma and skin cell carcinoma cell lines able to express MCHRl transcripts can be identified using routine experimentation, for example, by measuring the ability of neuroblastoma and skin cell carcinoma cell lines present in depositories such as American Type Culture Collection (Virginia, US) and Health Science Research Resources Bank (Osaka, Japan) to express MCHRl transcripts.
- a guide compounds able to modulate MCHRl activity can be obtained and used as a research tool to further explore the affects of MCHRl activation or as a therapeutic to achieve a beneficial effect in a patient.
- Beneficial effects can be obtained, for example, by using a compound active at MCHRl to achieve one or more of the following: weight loss, weight gain, treat cancer (e.g., colon or breast), reduce pain, treat diabetes, reduce stress or teat sexual dysfunction. Altering weight is particularly useful for gaining weight in an under weight patient or losing weight in an over weight patient.
- farm animals can be treated to gain weight.
- Under weight patients include those having a body weight about ' 10% or less, 20% or less, or 30% or less, than the lower end of a "normal” weight range or Body Mass Index ("BMI").
- Over weight patients include those having a body weight about 10% or more, 20% or more, 30% or more, or 50% or more, than the upper end of a "normal” weight range or BMI.
- "Normal" weight ranges are well known in the art and take into account factors such as a patient age, height, and body type.
- BMI measures your height/weight ratio. It is determined by calculating weight in kilograms divided by the square of height in meters. The BMI "normal" range is 19-22.
- MCHRl modulating compounds can be provided in kit.
- a kit typically contains an active compound in dosage form for administration.
- a dosage form contains a sufficient amount of active compound such that a beneficial effect can be obtained when administered to a patient during regular intervals, such as 1 to 6 times a day, during the course of 1 or more days.
- a kit contains instructions indicating the use of the dosage form to achieve a beneficial effect and the amount of dosage form to be taken over a specified time period.
- MCHRl active compounds having appropriate functional groups can be prepared as acid or base salts.
- Pharmaceutically acceptable salts include conventional non-toxic salts or the quaternary ammonium salts that are formed, e.g., from inorganic or organic acids or bases.
- salts include acid addition salts such as acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2- hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thio
- MCHRl active compounds can be administered using different routes including oral, nasal, by injection, and transmucosally.
- Active ingredients to be administered orally as a suspension can be prepared according to techniques well known in the art of pharmaceutical formulation and may contain microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners/flavoring agents.
- these compositions may contain microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and lactose and/or other excipients, binders, extenders, disintegrants, diluents and lubricants.
- compositions When administered by nasal aerosol or inhalation, compositions can be prepared according to techniques well known in the art of pharmaceutical formulation.
- formulation components include solutions in saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents.
- the compounds may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form.
- the injectable solutions or suspensions may be formulated using suitable non-toxic, parenterally-acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
- compositions When rectally administered in the form of suppositories, compositions may be prepared by mixing the drug with a suitable non-irritating excipient, such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquidify and/or dissolve in the rectal cavity to release the drug.
- a suitable non-irritating excipient such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquidify and/or dissolve in the rectal cavity to release the drug.
- Suitable dosing regimens for the therapeutic applications can be selected taking into account factors well known in the art including age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound employed.
- Optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug.
- the daily dose for a patient is expected to be between 0.01 and 1,000 mg per adult patient per day.
- RT-PCR experiments were performed to determine whether different human cell lines expressed mRN A for the MCHRl.
- Purified poly (A)+ mRNA was isolated from cultured cells using an oligo-dT kit (Poly (A) Pure, Ambion, Austin, TX).
- RT-PCR using ⁇ 1 ⁇ g of isolated mRNA was performed using Superscript II reverse transcriptase (Life Technologies, Gaithersberg, MD) essentially following the manufacturer's instructions.
- PCR cycling conditions were: 94°C for 1 minute (one cycle), 94°C for 30 seconds then 72°C for 4 minutes (four cycles); 94°C for 30 seconds then 70°C for 4 minutes (four cycles); 94°C for 30 seconds then 68°C for 4 minutes (25 cycles); and 68°C for 10 minutes (one cycle).
- PCR primers were chosen based on the human MCHRl DNA sequence to flank the mRNA splice junction on either side of the single intron between exon 1 and exon 2. Forward sense primers had the following sequences: SEQ. ID. NO. 4:
- SEQ. ID. NO. 5 GCCAGCAACACCTCTGATGGC
- SEQ. ID. NO. 6 GGCCCCGATAACCTCACTTCGGC.
- Reverse (anti sense) primers had the following sequences: SEQ. ID. NO. 7: GAGGAGATCTACTACCGAGAGG, SEQ. ID. NO. 8: GCCCATGAGCTGGTGGATCATG and SEQ. ID. NO. 9: GTGGACAGTGGCCAGGTAGAGGTC.
- Neuroblastoma cells lines GOTO, CHP-212, CHP-243, SK-N-BE(2), and SH-SY5Y were found to produce mRNA encoding for human MCHRl.
- the squamous cell carcinoma cell line SCC-25 was found to produce mRNA encoding for human MCHRl.
- MCH receptor activity was measured using GOTO cells employing an aequorin bioluminescence assay.
- the aequorin bioluminescence assay can be used to measure the activity of G protein-coupled receptors that couple through the Ga protein subunit family consisting of Gq, Gil, and Gi leading to the activation of phospholipase C, mobilization of intracellular calcium and activation of protein kinase C.
- Measurement of functional MCHRl expression in GOTO cells transiently expressing aequorin was performed using a Luminoskan RT luminometer (Labsystems Inc., Gaithersburg, MD) controlled by custom software written for a Macintosh PowerPC 6100.
- GOTO cells (1.2 x 10 7 cells plated 18 hours before transfection in a T75 flask) were transfected with human MCHRl plasmid DNA and aequorin cDNA using the Lipofectamine 2000 procedure (Life Technologies, Gaithersburg, MD).
- Human MCHRl plasmid DNA contained the open reading frame cDNA (SEQ. ID. NO. 2) encoding the human MCHRl receptor inserted in the mammalian expression vector pcDNA-3 (Invitrogen, Carlsbad,CA).
- An aequorin expressing plasmid contained the cDNA for aequorin (Button, et al, 1993. Cell Calcium 14, 663-671), inserted in pcDNA-3.
- the cells were harvested, washed once in ECB medium and resuspended to 500,000 cells/ml or l,000,000cells/ml.
- lysophosphatidic acid 100 ⁇ l of MCH or, for control responses, lysophosphatidic acid were injected into a cell suspension (corresponding to 5 x 10 4 cells or 100,000 cells). Lysophosphatidic acid triggers native edg receptors coupled to PLC activation present on GOTO cells.
- the integrated light emission was recorded over 30 seconds, in 0.5 second units.
- 20 ⁇ L of lysis buffer (0.1% final Triton X-100 concentration) was then injected and the integrated light emission recorded over 10 seconds, in 0.5 second units.
- the "fractional response" values for each well were calculated by taking the ratio of the integrated response to the initial challenge to the total integrated luminescence including the Triton X-100 lysis response. The results are shown in Table 2.
- LPA lysophosphatic acid
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention features neuroblastoma and skin cell carcinoma cell lines functionally expressing MCHR1 and the use of such cells to measure MCHR1 activity. Functional expression is preferably achieved in a neuroblastoma or skin cell carcinoma using a recombinant gene expressing MCHR1. The presence of a recombinant MCHR1 gene increases the level of MCHR1 expression facilitating the production and detection of MCHR1 activity.
Description
TΓΓLE OF THE INVENTION
CELL LINES EXPRESSING A MCH RECEPTOR
CROSS-REFERENCE TO RELATED APPLICATIONS The present application claims priority to provisional application U.S.
Serial No. 60/244,700, filed October 31, 2000, hereby incorporated by reference herein.
BACKGROUND OF THE INVENTION The references cited herein are not admitted to be prior art to the claimed invention.
Neuropeptides present in the hypothalamus play a major role in mediating the control of body weight. (Flier, et al, 1998. Cell, 92, 437-440.) Melanin-concentrating hormone (MCH) is a cyclic 19-amino acid neuropeptide synthesized as part of a larger pre-prohormone precursor in the hypothalamus which also encodes neuropeptides NEI andNGE. (Nahon, et al, 1990. Mol. Endocrinol 4, 632-637.) MCH was first identified in salmon pituitary, and in fish MCH affects melanin aggregation thus affecting skin pigmentation. In trout and in eels MCH has also been shown to be involved in stress induced or CRF-stimulated ACTH release. (Kawauchi, et al, 1983. Nature 305, 321-323.)
In humans two genes encoding MCH have been identified that are expressed in the brain. (Breton, et al, 1993. Mol. Brain Res. 18, 297-310.) In mammals MCH has been localized primarily to neuronal cell bodies of the hypothalamus which are implicated in the control of food intake, including perikarya of the lateral hypothalamus and zona inertia. (Knigge, et al, 1996. Peptides 17, 1063- 1073.)
Pharmacological and genetic evidence suggest that the primary mode of MCH action is to promote feeding (orexigenic). MCH mRNA is up regulated in fasted mice and rats, in the ob/ob mouse and in mice with targeted disruption in the gene for neuropeptide Y (NPY). (Qu, et al, 1996. Nature 380, 243-247, and Erickson, et al, 1996. Nature 381, 415-418.) Injection of MCH centrally (ICV) stimulates food intake and MCH antagonizes the hypophagic effects seen with α melanocyte stimulating hormone (o-MSH). (Qu, et al, 1996. Nature 380, 243-247.) MCH deficient mice are lean, hypophagic and have increased metabolic rate. (Shimada, et al, 1998. Nature 396, 670-673.)
MCH action is not limited to modulation of food intake as effects on the hypothalamic-pituitary-axis have been reported. (Nahon, 1994. Critical Rev. in Neurobiol. 8, 221-262.) MCH may be involved in the body response to stress as MCH can modulate the stress-induced release of CRF from the hypothalamus and ACTH from the pituitary. In addition, MCH neuronal systems may be involved in reproductive or maternal function.
Several references describe a receptor that is indicated to bind MCH (human MCHRl). (Chambers, et al, 1999. Nature 400, 261-265; Saito, et al, 1999. Nature 400, 265-269; Bachner, et al, 1999. FEBS Letters 457, 522-524; Shimomura, et al, 1999. Biochemical and Biophysical Research Communications 261, 622-626; and Lembo, et al, 1999. Nat. Cell Biol. 1, 267-271.)
SUMMARY OF THE INVENTION
The present invention features neuroblastoma and skin cell carcinoma cell lines functionally expressing MCHRl and the use of such cells to measure
MCHRl activity. Functional expression is preferably achieved in a neuroblastoma or skin cell carcinoma using a recombinant gene expressing MCHRl. The presence of a recombinant MCHRl gene increases the level of MCHRl expression facilitating the production and detection of MCHRl activity. Thus, a first aspect of the present invention describes a neuroblastoma or skin cell carcinoma comprising a recombinant MCHRl gene that expresses functional MCHRl. Functional MCHRl produces a detectable signal upon MCH stimulation. The recombinant MCHRl gene may be part of a genome or may be present outside of the genome. An MCHRl gene contains nucleic acid encoding for MCHRl and regulatory elements needed for functional expression. Examples of regulatory elements useful for functional expression include a promoter, a terminator, a ribosome binding site, and a polyadenylation region. The nucleic acid encoding for MCHRl can be contiguous or may contain one or more introns. A recombinant MCHRl gene encodes for MCHRl and contains one or more regions not naturally associated with each other. Examples of recombinant MCHRl genes include those containing a human nucleic acid sequence encoding for MCHRl present with a regulatory sequence not naturally associated with the encoding nucleic acid; and those containing a non-naturally occurring encoding region. A non- naturally encoding region contains one or more combinations of nucleotides not
present in the naturally occurring encoding nucleic acid. Recombinant genes can be produced with, or without, intron(s).
Another aspect of the present invention describes a neuroblastoma or skin cell carcinoma having increased MCHRl expression produced by a process comprising the step of coupling endogenous nucleic acid encoding for MCHRl to an exogenous promoter. The process results in the production of a recombinant MCHRl gene having the same chromosomal location as the native MCHRl gene.
Another aspect of the present invention describes a method of measuring the ability of a compound to affect MCHRl activity. The method comprises the steps of: (a) providing a compound to a neuroblastoma or skin cell carcinoma expressing MCHRl; and (b) measuring MCHRl activity.
Other features and advantages of the present invention are apparent from the additional descriptions provided herein including the different examples. The provided examples illustrate different components and methodology useful in practicing the present invention. The examples do not limit the claimed invention. Based on the present disclosure the skilled artisan can identify and employ other components and methodology useful for practicing the present invention.
DETAILED DESCRIPTION OF THE INVENTION Human neuroblastoma and skin cell carcinoma cell lines able to produce MCHRl transcripts and to provide a suitable environment for measuring MCHRl activity are identified herein. Human cell lines expressing MCHRl provide a human cellular environment that naturally expresses MCHRl.
Cells expressing functional MCHRl provide a system for screening for compounds active at MCHRl, measuring the effect of a compound at MCHRl, and measuring the effect of MCHRl activity. MCHRl expression in a neuroblastoma or skin cell carcinoma is preferably increased using a recombinant MCHRl gene that either makes use of endogenous nucleic acid encoding for MCHRl or provides exogenous nucleic acid encoding MCHRl. Compounds modulating MCHRl activity have a variety of different uses including utility as a tool to further study MCHRl activity and as an agent to achieve a beneficial effect in a patient. Beneficial effects of modulating MCHRl activity include one or more of the following: weight loss, weight gain, cancer treatment (e.g., colon or breast), pain reduction, diabetes treatment, stress reduction and sexual dysfunction treatment.
Modulating MCHRl activity includes evoking a response at the receptor and altering a response evoked by a MCHRl agonist or antagonist. Generally, MCH receptor antagonists and allosteric modulators negatively affecting activity may be used to achieve weight loss, treat cancer (e.g., colon or breast), reduce pain, reduce stress or treat sexual dysfunction; and MCH receptor agonists and allosteric modulators positively affecting activity may be used to produce a weight gain.
A patient is a mammal, preferably a human. Reference to patient does not necessarily indicate the presence of a disease or disorder. The term patient includes subjects treated prophylactically and subjects afflicted with a disease or disorder.
Preferably, MCHRl activity is modulated to treat diabetes, to obtain a weight loss, or to obtain a weight gain. Diabetes mellitus can be treated by, for example, one or both of the following: enhancing glucose tolerance and decreasing insulin resistance.
Excessive weight is a contributing factor to different diseases including hypertension, diabetes, dyslipidemias, cardiovascular disease, gall stones, osteoarthritis and certain forms of cancers. Bringing about a weight loss can be used, for example, to reduce the likelihood of such diseases and as part of a treatment for such diseases. Weight reduction can be achieved by, for example, one or more of the following: reducing appetite, increasing metabolic rate, reducing fat intake or reducing carbohydrate craving.
Increasing weight is particularly useful for a patient having a disease or disorder, or under going a treatment, accompanied by weight loss. Examples of diseases or disorders accompanied by weight loss include anorexia, AIDS, wasting, cachexia, and frail elderly. Examples of treatments accompanied by weight loss include chemotherapy and radiation therapy.
MCHRl MCHRl employed in the present invention includes naturally occurring human MCHRl having the amino acid sequence provided by SEQ. ID. NO.
1 and variants thereof. Variants of MCHRl have a substantially identical amino acid sequence as SEQ. ID. NO. 1 and have MCH receptor activity. Examples of SEQ. ID.
NO. 1 variants include naturally occurring allelic variants and artificially produced mutants.
SEQ. ID. NO. 1 and the naturally occurring encoding nucleic acid sequence were initially identified as the somatostatin-like receptor "SLC-1." (Lalcaye, et al, 1998. Biochimica et Biophysica ACTA 1401:216-220.) Subsequently, SLC-1 was shown to be MCHRl. cDNA and genomic sequences encoding for MCHRl are provided by SEQ. ID. NOs. 2 and 3.
In general, SEQ. ID. NO. 1 variants have a sequence identity of at least about 90%, preferably, at least about 95%, with SEQ. ID. NO. 1; and/or contain 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid modifications from SEQ. ID. NO. 1. Amino acid modifications are additions, deletions, and substitutions. Sequence similarity for polypeptides can be determined by BLAST.
(Altschul, et al, 1997. Nucleic Acids Res. 25, 3389-3402, hereby incorporated by reference herein.) In one embodiment, sequence similarity is determined using tBLASTn search program with the following parameters: MATRIX:BLOSUM62, PER RESIDUE GAP COST: 11, and Lambda ratio: 1. Artificial variants of MCHRl can be produced in a cell by introducing nucleic acid encoding for the variant. Nucleic acid sequences encoding for variants can be obtained by altering the nucleic acid sequence encoding for SEQ. ID. NO. 1. The translation of a particular codon into a particular amino acid is well known in the art (see, e.g., Lewin, GENES IV, p. 119, Oxford University Press, 1990):
A=Ala=Alanine: codons GCA, GCC, GCG, GCU C=Cys=Cysteine: codons UGC, UGU D=Asp=Aspartic acid: codons GAC, GAU E=Glu=Glutamic acid: codons GAA, GAG F=Phe=Phenylalanine: codons UUC, UUU
G=Gly=Glycine: codons GGA, GGC, GGG, GGU H=His=Histidine: codons CAC, CAU I=He=Isoleucine: codons AUA, AUC, AUU K=Lys=Lysine: codons AAA, AAG L=Leu=Leucine: codons UUA, UUG, CUA, CUC, CUG, CUU M=Met=Methionine: codon AUG N=Asn=Asparagine: codons AAC, AAU P=Pro=Proline: codons CCA, CCC, CCG, CCU Q=Gln=Glutamine: codons CAA, CAG R=Arg=Arginine: codons AGA, AGG, CGA, CGC, CGG, CGU
S=Ser=Serine: codons AGC, AGU, UCA, UCC, UCG, UCU
T=Thr=Threonine: codons ACA, ACC, ACG, ACU
V=Nal=Naline: codons GUA, GUC, GUG, GUU
W=Trρ=Tryptophan: codon UGG Y=Tyr=Tyrosine: codons UAC, UAU
Changes to SEQ. ID. NO. 1 to produce functional variants may be empirically determined. Techniques for measuring MCH receptor activity are well known in the art.
One method of producing functional variants of SEQ. ID. NO. 1 expected to retain some MCH receptor activity takes into account differences in amino acid R groups. An R group effects different properties of an amino acid such as physical size, charge, and hydrophobicity. Amino acids can be divided into different groups as follows: neutral and hydrophobic (alanine, valine, leucine, isoleucine, proline, tryptophan, phenylalanine, and methionine); neutral and polar (glycine, serine, threonine, tyrosine, cysteine, asparagine, and glutamine); basic
(lysine, arginine, and histidine); and acidic (aspartic acid and glutamic acid).
Generally, in substituting different amino acids it is preferable to exchange amino acids having similar properties. Substituting different amino acids within a particular group, such as substituting valine for leucine, arginine for lysine, and asparagine for glutamine are good candidates for not causing a change in polypeptide functioning.
Changes outside of different amino acid groups can also be made.
Preferably, such changes are made taking into account the position of the amino acid to be substituted in the polypeptide. For example, arginine can substitute more freely for nonpolor amino acids in the interior of a polypeptide then glutamate because of its long aliphatic side chain. (See , Ausubel, Current Protocols in Molecular Biology,
John Wiley, 1987-1998, Supplement 33 Appendix lC.)
Recombinant MCHRl Gene A recombinant MCHRl gene can be used to increase the level of
MCHRl expression in a neuroblastoma or skin cell carcinoma thereby facilitating the production and detection of MCHRl activity. Methods for producing a recombinant MCHRl gene include those altering the endogenous MCHRl gene and those introducing an MCHRl gene or coding region into a host cell.
Alterations of an endogenous MCHRl gene producing a recombinant gene include the use of regulatory elements such as a promoter or enhancer not naturally associated with the MCHRl coding region; and using a non-naturally encoding region containing one or more combinations of nucleotides not present in the naturally occurring encoding nucleic acid. Examples of exogenous promoters include the human cytomegalovirus promoter ("CMN"), α-MHC promoter, PrP (prion promoter), potent neuronal promoter and Thy-1 promoter.
Νon-naturally occurring encoding regions can be produced based on the degeneracy of the genetic code. If desired, the nucleic acid encoding for MCHRl can be altered based on the genetic code to adjust codon frequency.
Techniques that can be used for creating a recombinant chromosomal gene are well known in the art. (See Ausubel, Current Protocols in Molecular Biology, John Wiley, 1987-1998). Exogenous nucleic acid can be targeted to the MCHRl gene using homologous recombination targeting sequences. Homologous recombination targeting sequences for insertion into the MCHRl gene include coding and non-coding regions.
An exogenous promoter, such as the CMN promoter, can be functionally coupled to MCHRl nucleic acid using standard techniques. For example, the GOTO MCHRl genomic sequence can be cloned into a plasmid vector. The MCHRl promoter region (2-3 kb) upstream of coding sequence can be replaced by a CMN promoter cassette containing a loxP-neomycin-loxP gene. The resulting promoter-exchange vector would have sufficient MCHRl genomic sequences flanking the CMN promoter cassette for homologous recombination. The vector can then be electroporated into the GOTO cell. Νeomycin resistant clones can be selected and verified by genomic Southern analysis for successful promoter exchange. The neomycin gene can be removed by loxP mediated recombination to reduce its possible interference with promoter activity.
Introducing an MCHRl gene or coding region into a host can be achieved by inserting a MCHRl coding region or gene into the host genome or through the use of an independently replicating vector. Techniques for inserting nucleic acid into the host genome include those targeting and selecting for insertion in a particular region and those involving random insertion.
Functional Assays
Techniques for measuring MCHRl activity include detecting a change in the intracellular conformation of MCHRl, measuring G-protein activity, and measuring the level of intracellular messengers. Assays measuring different G-protein activities, such as Gi, Gs, and Gq can be carried out using techniques that are well known in the art. MCHRl activity is preferably assayed for by measuring either Gi or Gq activity.
Gi and Gs activity can be measured using techniques such as a melonaphore assay, assaying cAMP production, assaying inhibition of cAMP accumulation, intracellular acidification, and assaying 35S-GTP binding. cAMP can be measured using different techniques such as a radioimmunoassay and indirectly by cAMP responsive gene reporter proteins.
Gq and Gi activity can be measured using techniques such as those detecting intracellular Ca2+ and intracellular acidification. Examples of techniques well known in the art that can be employed to measure Ca include the use of dyes such as Fura-2 and the use of Ca2+-bioluminescent sensitive reporter proteins such as aequorin. (Button, et al.,1993. Cell Calcium 14, 663-671, and Feighner, et al, 1999. Science 284, 2184-2188, both of which are hereby incorporated by reference herein.) Functional assays can be performed using individual compounds or preparations containing different compounds. A preparation containing different compounds where one or more compounds affect MCHRl activity can be divided into smaller groups of compounds to identify the compound(s) affecting MCHRl activity. In an embodiment of the present invention a test preparation containing at least 10 compounds is used in a functional assay.
MCHRl Expressing Cell Lines
Human cell lines able to express MCHRl transcripts include neuroblastoma and skin cell carcinoma. The ability of different neuroblastoma cell lines and a squamous cell carcinoma is illustrated in the Examples provided below. The squamous cell carcinoma provides an example of a skin cell carcinoma. In different embodiments of the present invention concerning a skin cell carcinoma, the skin cell carcinoma is a squamous cell carcinoma or a kertinocyte cell carcinoma.
The ability of different neuroblastoma cells lines and a skin cell carcinoma to express MCHRl transcripts points to these types of cell lines as containing members able to express MCHRl. Additional neuroblastoma and skin cell
carcinoma cell lines able to express MCHRl transcripts can be identified using routine experimentation, for example, by measuring the ability of neuroblastoma and skin cell carcinoma cell lines present in depositories such as American Type Culture Collection (Virginia, US) and Health Science Research Resources Bank (Osaka, Japan) to express MCHRl transcripts.
Modulating MCHRl Activity
Using the present application as a guide compounds able to modulate MCHRl activity can be obtained and used as a research tool to further explore the affects of MCHRl activation or as a therapeutic to achieve a beneficial effect in a patient. Beneficial effects can be obtained, for example, by using a compound active at MCHRl to achieve one or more of the following: weight loss, weight gain, treat cancer (e.g., colon or breast), reduce pain, treat diabetes, reduce stress or teat sexual dysfunction. Altering weight is particularly useful for gaining weight in an under weight patient or losing weight in an over weight patient. In addition, for example, farm animals can be treated to gain weight. Under weight patients include those having a body weight about' 10% or less, 20% or less, or 30% or less, than the lower end of a "normal" weight range or Body Mass Index ("BMI"). Over weight patients include those having a body weight about 10% or more, 20% or more, 30% or more, or 50% or more, than the upper end of a "normal" weight range or BMI. "Normal" weight ranges are well known in the art and take into account factors such as a patient age, height, and body type.
BMI measures your height/weight ratio. It is determined by calculating weight in kilograms divided by the square of height in meters. The BMI "normal" range is 19-22.
MCHRl modulating compounds can be provided in kit. Such a kit typically contains an active compound in dosage form for administration. A dosage form contains a sufficient amount of active compound such that a beneficial effect can be obtained when administered to a patient during regular intervals, such as 1 to 6 times a day, during the course of 1 or more days. Preferably, a kit contains instructions indicating the use of the dosage form to achieve a beneficial effect and the amount of dosage form to be taken over a specified time period.
Dosing For Therapeutic Applications
Guidelines for pharmaceutical administration in general are provided in, for example, Remington's Pharmaceutical Sciences 18th Edition, Ed. Gennaro, Mack Publishing, 1990, and Modern Pharmaceutics 2nd Edition, Eds. Banker and Rhodes, Marcel Dekker, Inc., 1990, both of which are hereby incorporated by reference herein.
MCHRl active compounds having appropriate functional groups can be prepared as acid or base salts. Pharmaceutically acceptable salts (in the form of water- or oil-soluble or dispersible products) include conventional non-toxic salts or the quaternary ammonium salts that are formed, e.g., from inorganic or organic acids or bases. Examples of such salts include acid addition salts such as acetate, adipate, alginate, aspartate, benzoate, benzenesulfonate, bisulfate, butyrate, citrate, camphorate, camphorsulfonate, cyclopentanepropionate, digluconate, dodecylsulfate, ethanesulfonate, fumarate, glucoheptanoate, glycerophosphate, hemisulfate, heptanoate, hexanoate, hydrochloride, hydrobromide, hydroiodide, 2- hydroxyethanesulfonate, lactate, maleate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, oxalate, pamoate, pectinate, persulfate, 3-phenylpropionate, picrate, pivalate, propionate, succinate, tartrate, thiocyanate, tosylate, and undecanoate; and base salts such as ammonium salts, alkali metal salts such as sodium and potassium salts, alkaline earth metal salts such as calcium and magnesium salts, salts with organic bases such as dicyclohexylamine salts, N-methyl-D-glucamine, and salts with amino acids such as arginine and lysine.
MCHRl active compounds can be administered using different routes including oral, nasal, by injection, and transmucosally. Active ingredients to be administered orally as a suspension can be prepared according to techniques well known in the art of pharmaceutical formulation and may contain microcrystalline cellulose for imparting bulk, alginic acid or sodium alginate as a suspending agent, methylcellulose as a viscosity enhancer, and sweeteners/flavoring agents. As immediate release tablets, these compositions may contain microcrystalline cellulose, dicalcium phosphate, starch, magnesium stearate and lactose and/or other excipients, binders, extenders, disintegrants, diluents and lubricants.
When administered by nasal aerosol or inhalation, compositions can be prepared according to techniques well known in the art of pharmaceutical formulation. Examples of formulation components include solutions in saline,
employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance bioavailability, fluorocarbons, and/or other solubilizing or dispersing agents.
The compounds may also be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous, topical with or without occlusion, or intramuscular form. When administered by injection, the injectable solutions or suspensions may be formulated using suitable non-toxic, parenterally-acceptable diluents or solvents, such as mannitol, 1,3-butanediol, water, Ringer's solution or isotonic sodium chloride solution, or suitable dispersing or wetting and suspending agents, such as sterile, bland, fixed oils, including synthetic mono- or diglycerides, and fatty acids, including oleic acid.
When rectally administered in the form of suppositories, compositions may be prepared by mixing the drug with a suitable non-irritating excipient, such as cocoa butter, synthetic glyceride esters or polyethylene glycols, which are solid at ordinary temperatures, but liquidify and/or dissolve in the rectal cavity to release the drug.
Suitable dosing regimens for the therapeutic applications can be selected taking into account factors well known in the art including age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular compound employed.
Optimal precision in achieving concentrations of drug within the range that yields efficacy without toxicity requires a regimen based on the kinetics of the drug's availability to target sites. This involves a consideration of the distribution, equilibrium, and elimination of a drug. The daily dose for a patient is expected to be between 0.01 and 1,000 mg per adult patient per day.
EXAMPLES
Examples are provided below to further illustrate different features of the present invention. The examples also illustrate useful methodology for practicing the invention. These examples do not limit the claimed invention.
Example 1: MCHRl Expression in Different Cell Lines
RT-PCR experiments were performed to determine whether different human cell lines expressed mRN A for the MCHRl. Purified poly (A)+ mRNA was
isolated from cultured cells using an oligo-dT kit (Poly (A) Pure, Ambion, Austin, TX). RT-PCR using ~1 μg of isolated mRNA was performed using Superscript II reverse transcriptase (Life Technologies, Gaithersberg, MD) essentially following the manufacturer's instructions. PCR cycling conditions were: 94°C for 1 minute (one cycle), 94°C for 30 seconds then 72°C for 4 minutes (four cycles); 94°C for 30 seconds then 70°C for 4 minutes (four cycles); 94°C for 30 seconds then 68°C for 4 minutes (25 cycles); and 68°C for 10 minutes (one cycle). PCR primers were chosen based on the human MCHRl DNA sequence to flank the mRNA splice junction on either side of the single intron between exon 1 and exon 2. Forward sense primers had the following sequences: SEQ. ID. NO. 4:
ATGGACCTGGAAGCCTCGCTGCTG, SEQ. ID. NO. 5: GCCAGCAACACCTCTGATGGC, and SEQ. ID. NO. 6: GGCCCCGATAACCTCACTTCGGC. Reverse (anti sense) primers had the following sequences: SEQ. ID. NO. 7: GAGGAGATCTACTACCGAGAGG, SEQ. ID. NO. 8: GCCCATGAGCTGGTGGATCATG and SEQ. ID. NO. 9: GTGGACAGTGGCCAGGTAGAGGTC.
Amplified products were electrophoresed on an agarose gel, and Southern blotted with a human MCHRl radiolabeled probe. The probe was random prime labeled with 32p. Post-hybridization washing stringency was at 65°C, 1 X SSC, after which the filters were dried and exposed to X-ray film for 3 hours at -70°C. The results are shown in Table 1.
Table 1
1- JCRB0612, 11, obtained from Health Science Research Resources Bank (Osaka, Japan), see Sekiguchi, et al, 1979. Japan J. Exp. Med. 49, 67-83).
Neuroblastoma cells lines GOTO, CHP-212, CHP-243, SK-N-BE(2), and SH-SY5Y were found to produce mRNA encoding for human MCHRl. In addition, the squamous cell carcinoma cell line SCC-25 was found to produce mRNA encoding for human MCHRl.
Example 2: MCH Receptor Activity in Neurobastoma Cells Lines
To assess whether neuroblastoma cells provide an environment for functional MCHRl, MCH receptor activity was measured using GOTO cells employing an aequorin bioluminescence assay. The aequorin bioluminescence assay can be used to measure the activity of G protein-coupled receptors that couple through the Ga protein subunit family consisting of Gq, Gil, and Gi leading to the activation of phospholipase C, mobilization of intracellular calcium and activation of protein kinase C. Measurement of functional MCHRl expression in GOTO cells transiently expressing aequorin was performed using a Luminoskan RT luminometer (Labsystems Inc., Gaithersburg, MD) controlled by custom software written for a Macintosh PowerPC 6100.
GOTO cells (1.2 x 107 cells plated 18 hours before transfection in a T75 flask) were transfected with human MCHRl plasmid DNA and aequorin cDNA using the Lipofectamine 2000 procedure (Life Technologies, Gaithersburg, MD). Human MCHRl plasmid DNA contained the open reading frame cDNA (SEQ. ID.
NO. 2) encoding the human MCHRl receptor inserted in the mammalian expression vector pcDNA-3 (Invitrogen, Carlsbad,CA). An aequorin expressing plasmid contained the cDNA for aequorin (Button, et al, 1993. Cell Calcium 14, 663-671), inserted in pcDNA-3. Following approximately 40 hours of expression the apo- aequorin in the cells was charged for 1 hour with coelenterazine (10 μM) under reducing conditions (300 μM reduced glutathione) in ECB buffer (140 mM NaCl, 20 mM KC1, 20 mM HEPES-NaOH [pH=7.4], 5 mM glucose, 1 mM MgCl2, 1 mM CaCl2, 0.1 mg/ml bovine serum albumin). The cells were harvested, washed once in ECB medium and resuspended to 500,000 cells/ml or l,000,000cells/ml.
100 μl of MCH or, for control responses, lysophosphatidic acid were injected into a cell suspension (corresponding to 5 x 104 cells or 100,000 cells). Lysophosphatidic acid triggers native edg receptors coupled to PLC activation present on GOTO cells. The integrated light emission was recorded over 30 seconds, in 0.5 second units. 20 μL of lysis buffer (0.1% final Triton X-100 concentration) was then injected and the integrated light emission recorded over 10 seconds, in 0.5 second units. The "fractional response" values for each well were calculated by taking the ratio of the integrated response to the initial challenge to the total integrated luminescence including the Triton X-100 lysis response. The results are shown in Table 2.
Table 2
The results are in bioluminescence (cps). "No Aeq" indicates the absence of plasmids encoding for aequorin and MCHRl. "AEQ" indicates the presence of a plasmid encoding for aequorin, and the absence of a plasmid encoding for MCHRl . "AEQ + MCHRl" indicates the presence of plasmids encoding for aequorin and MCHRl.
Transfection of the reporter gene aequorin into GOTO cells permitted the detection of functional MCHRl when co-transfected with a cDNA encoding the human MCHRl using 1 μM MCH to evoke a bioluminescent response. This
observation indicates that neuroblastoma cells expressing MCHRl are appropriate host cells for expressing the MCHRl gene. In the absence of exogenous MCHRl, no signal over background (buffer injection only, ECB) could be observed suggesting that the level of MCHRl naturally present in GOTO cells is insufficient to permit detection using the employed conditions. A control response evoked by the application of 1 μM lysophosphatic acid (LPA) suggests the presence of an edg receptor (Im, et al, 2000. J. Biol. Chem. 275, 14281-14286), on GOTO cells linked to calcium mobilization.
Other embodiments are within the following claims. While several embodiments have been shown and described, various modifications may be made without departing from the spirit and scope of the present invention.
Claims
1. A neuroblastoma cell or a skin cell carcinoma comprising a recombinant melanin-concentrating hormone receptor 1 (MCHRl) gene that expresses functional MCHR 1.
2. The cell of claim 1, wherein said cell is a human neuroblastoma cell.
3. The neuroblastoma cell of claim 2, wherein said recombinant
MCHRl gene is present in the neuroblastoma cell genome and comprises endogenous nucleic acid encoding for MCHRl transcriptionally coupled to an exogenous promoter.
4. The neuroblastoma cell of claim 3, wherein said exogenous promoter is a CMV promoter.
5. The neuroblastoma of claim 3, wherein said cell further comprises a recombinant gene encoding for aequorin.
6. The neuroblastoma cell of claim 3, wherein said neuroblastoma cell is selected from the group consisting of: GOTO, CHP-212, CHP-243, SK-N- BE(2), and SH-S Y5Y.
7. The cell of claim 1, wherein said cell is SCC-25.
8. A neuroblastoma cell or skin cell carcinoma having increased MCHRl expression produced by a process comprising the step of coupling endogenous nucleic acid encoding for MCHRl to an exogenous promoter.
The cell of claim 8, wherein said promoter is a CMV promoter.
10. The cell of claim 8, wherein said cell is a neuroblastoma cell selected from the group consisting of: GOTO, CHP-212, SK-N-BE(2), CHP-243,and SH-SY5Y.
11. The cell of claim 8, wherein said cell is a skin cell carcinoma.
12. The cell of claim 11 , wherein said cell is SCC-25.
13. A method of measuring the ability of a compound to effect MCHRl activity comprising the steps of: a) providing said compound to the cell of any one of claims 1-12; and b) measuring MCHRl activity.
14. The method of claim 13, wherein said step (a) further comprises the presence of an MCHRl agonist.
15. The method of claim 14, wherein said MCHRl agonist is human melanin-concentrating hormone.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US24470000P | 2000-10-31 | 2000-10-31 | |
| US244700P | 2000-10-31 | ||
| PCT/US2001/047027 WO2002036076A2 (en) | 2000-10-31 | 2001-10-26 | Cell lines expressing a mch receptor |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1334112A2 true EP1334112A2 (en) | 2003-08-13 |
Family
ID=22923783
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01989984A Withdrawn EP1334112A2 (en) | 2000-10-31 | 2001-10-26 | Cell lines expressing a mch receptor |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP1334112A2 (en) |
| CA (1) | CA2427763A1 (en) |
| WO (1) | WO2002036076A2 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7078484B2 (en) | 2001-04-19 | 2006-07-18 | Neurogen Corporation | Melanin concentrating hormone receptors |
| US7078187B2 (en) | 2001-04-19 | 2006-07-18 | Neurogen Corporation | Melanin concentrating hormone receptors |
| US7141391B2 (en) | 2001-11-13 | 2006-11-28 | Neurogen Corporation | Monkey and canine melanin concentrating hormone receptors |
-
2001
- 2001-10-26 CA CA002427763A patent/CA2427763A1/en not_active Abandoned
- 2001-10-26 EP EP01989984A patent/EP1334112A2/en not_active Withdrawn
- 2001-10-26 WO PCT/US2001/047027 patent/WO2002036076A2/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0236076A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2002036076A3 (en) | 2002-11-21 |
| CA2427763A1 (en) | 2002-05-10 |
| WO2002036076A2 (en) | 2002-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20050071498A (en) | Ghrh analogues | |
| KR20210117271A (en) | Use of annexin to prevent and treat myofascial injuryUse of annexin to prevent and treat muscle damage | |
| PT1465923E (en) | Corticotropin releasing factor receptor 2 agonists | |
| US7198910B1 (en) | Nucleic acid encoding melanin-concentrating hormone receptor | |
| EP1334112A2 (en) | Cell lines expressing a mch receptor | |
| US6593108B1 (en) | Nucleic acid molecule encoding a melanin-concentrating hormone receptor 2 polypeptide | |
| US6242572B1 (en) | Human G protein coupled lysophosphatidic acid receptor | |
| JP2004522422A (en) | Cell lines expressing MCH receptor | |
| US20040072287A1 (en) | Cell lines expressing a mch receptor | |
| EP1037655B1 (en) | use of novel ligands of the neuropeptide receptor hfgan72 and antagonists thereof in therapy | |
| US20040248129A1 (en) | Rhesus monkey, dog and feeret melanin-concentrating hormone type 1 receptor | |
| US7148026B2 (en) | Dog melanin-concentrating hormone receptor | |
| US6162899A (en) | Human HNEAA81 receptor | |
| US7208282B2 (en) | Rhesus monkey, dog and ferret melanin-concentrating hormone type 2 receptor | |
| US6849600B2 (en) | Corticotropin-releasing hormone analogs | |
| US20050069883A1 (en) | Melanin-concentrating hormone receptor antagonist binding protein | |
| US20040053827A1 (en) | Novel polypeptide human polyadenylation binding protein 20.13 and polynucleotide encoding it | |
| Hu et al. | Molecular cloning of grass carp growth hormone receptor and its functional interaction with silver carp growth hormone | |
| US7220832B2 (en) | Dermacentor variabilis GABA-gated chloride channels | |
| Starka et al. | The role of corticosteroids in the homeostasis of the eye | |
| JP2000191696A (en) | Use of peptide | |
| CN1390936A (en) | Human atrial natriuretic peptide gene, its strong mutant and its application in treating relative diseases | |
| US20040087525A1 (en) | Polypeptide-human rna binding protein 19 and the polynucleotide encoding it |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20030602 |
|
| AK | Designated contracting states |
Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN WITHDRAWN |
|
| 18W | Application withdrawn |
Effective date: 20030925 |