EP1311278A1 - Method and composition for immunization using mixed pools of mutated nucleic acids or peptides - Google Patents

Method and composition for immunization using mixed pools of mutated nucleic acids or peptides

Info

Publication number
EP1311278A1
EP1311278A1 EP01961861A EP01961861A EP1311278A1 EP 1311278 A1 EP1311278 A1 EP 1311278A1 EP 01961861 A EP01961861 A EP 01961861A EP 01961861 A EP01961861 A EP 01961861A EP 1311278 A1 EP1311278 A1 EP 1311278A1
Authority
EP
European Patent Office
Prior art keywords
target antigen
nucleic acid
vaccine
species
immune response
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01961861A
Other languages
German (de)
French (fr)
Other versions
EP1311278A4 (en
Inventor
Manuel Engelhorn
Alan N. Houghton
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Memorial Sloan Kettering Cancer Center
Original Assignee
Memorial Sloan Kettering Cancer Center
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Memorial Sloan Kettering Cancer Center filed Critical Memorial Sloan Kettering Cancer Center
Publication of EP1311278A1 publication Critical patent/EP1311278A1/en
Publication of EP1311278A4 publication Critical patent/EP1311278A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • This application relates to a method for immunization which makes use of mixed pools of mutated nucleic acids (DNA or RNA) encoding variants of a target antigen as a nucleic acid vaccine or expressed peptides derived from such pools to stimulate an immune response to the target antigen.
  • mutated nucleic acids DNA or RNA
  • the immune system provides a sophisticated and multi-faceted defense against antigens which are recognized as foreign. Antigens which are recognized, and which therefore stimulate an immune response, are referred to as immunogenic. However, not all antigens are immunogenic, and there are many instances of disease that the immune system deals with poorly, if at all. These include most cancers and infectious organisms such as human immunodeficiency virus- 1, Mycobacterium tuberculosis, Borrelia burgdorferi (the causative organism of Lyme disease), Epstein Barr virus, papilloma virus, hepatitis viruses and cytomegalovirus (CMV) to which the immune system fails to mount an effective response. This maybe due to tolerance to self-antigens (i.e. the body does not recognize a cancer cell as foreign) or because the antigen is an inherently weak immunogen. Regardless of the cause, however, these factors make the product of vaccines targeting these conditions both desirable and difficult.
  • human immunodeficiency virus- 1 Mycobacterium tuberculosis
  • the present invention provides a method for inducing an immune response to a target antigen in a subject comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen.
  • the vaccine composition comprises a mixed pool of a plurality of DNA or RNA species encoding a plurality of mutant forms of the target antigen which are expressed by the subject, or a mixture of peptides derived from pre-administration expression of the mixed pool of nucleic acids.
  • the vaccine compositions of the invention are administered to a subject, for example a human subject, to induce an immune response to the target antigen.
  • Fig. 1 shows the number of tumor-free surviving mice immunized with nucleic acid vaccine derived from murine gp75 using various protocols
  • Fig. 2 shows the number of tumor-free surviving mice immunized with nucleic acid vaccine derived from murine TRP-2 using various protocols
  • Fig. 3 shows the quantitative survey of autoimmune depigmentation in mice immunized with nucleic acid vaccine derived from murine gp75 using various protocols.
  • the present invention provides a method and composition for inducing an immune response to a target antigen.
  • nucleic acid vaccine compositions are administered to a subject in a manner which results in expression of the nucleic acid and recognition of the resulting proteins or peptides by the immune system.
  • the target antigen against which the invention induces an immune response may be any antigen for which a therapeutic benefit is derived as a result of the induction of an immune response, including antigens associated with pathogenic microorganisms and antigens associated with cancers.
  • the invention is particularly applicable for inducing an immune response to inherently non-immunogenic or poorly immunogenic antigens.
  • target antigens include gp75/TRP-l, TRP-2, tyrosinase, gpl00/pMell7 on melanoma; prostate specific membrane antigen, prostate specific antigen and prostate stem cell antigen on prostate cancers; HER2/neu and the mucin MUC1 on breast cancers; CD 19 and CD20 on malignancies of B lymphocyte origin; MAGE, BAGE and GAGE, NY-ESO-1 and other "cancer-testes" antigens on a variety of cancer types; gene products from the human immunodeficiency virus- 1 ; angiogenic factors (such as VEGF, bFGF, angiopoietins, their cognate cell surface receptors, and ELR C-X-C chemokines); tumor suppressor genes such as p53; dipeptidyl peptidase IV and fibroblast activation protein- 1.
  • angiogenic factors such as VEGF, bFGF, angiopoietins, their
  • the phrase "inducing an immune response” refers to both the stimulation of a new immune response or to the enhancement of a pre-existing immune response to a target antigen.
  • the immune response may be a cytolytic T-cell mediated cellular immune response or a B-cell mediated humoral response, or some combination thereof.
  • subject refers to the living organism being treated to induce an immune response.
  • the subject will generally be mammalian or avian.
  • preferred “subjects” are human patients.
  • an immune response to a target antigen is induced in a subject comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen, wherein the vaccine composition comprises a plurality of vaccine molecule species corresponding to a plurality of mutant forms of the target antigen.
  • the term “vaccine molecule species” refers to either nucleic acids (DNA or RNA) or to peptides.
  • corresponding encompasses both mutant forms of the target antigen per se (i.e, peptide vaccine molecule species) and nucleic acid vaccine molecule species encoding the mutant forms of the target antigen.
  • the vaccine compositions of the invention comprise a mixture of mutated nucleic acids which encode mutant variants of the target antigen.
  • the present invention intentionally uses a mixture of different species of mutant nucleic acid all derived from a starting nucleic acid encoding the target antigen.
  • a nucleic acid sequence encoding the target antigen This sequence may be in the form of PCR amplicon, or it may be incorporated in a vector system to facilitate its reproduction in an appropriate host.
  • the sequence may be cDNA encoding the entire antigen or it may be a partial sequence encoding only a portion of the antigen. Although there is no absolute minimum size, partial sequences used will preferably be at least 24 bases, encoding 8 amino acids.
  • This "starting nucleic acid sequence" is used as the starting material for generating the vaccine compositions of the invention.
  • the starting nucleic acid sequence may be an accepted "wild-type” sequence derived from a normal source.
  • polymorphic sequences may have a multiplicity of "normal” or “wild-type” sequences, and that it is not critical which of these sequences are used as the starting sequence.
  • the starting nucleic acid sequence may also be a mutant sequence (i.e. a sequence which differs from the established norm.)
  • the starting nucleic acid sequence may also be (but does not have to be) derived from the subject. Thus, for example, in the latter case, a subject's own cancer cells could be used as a source for the starting nucleic acid sequence.
  • Mutations which can be insertions, deletions, translations, or inversions of one or more bases, can be introduced into the starting nucleic acid sequence using any of various known techniques. For example, random mutations can be introduced into the starting nucleic acid sequences using error-prone PCR as described in Cadwell et al. in PCR Methods and Applications 2:28-33 (1992) and PCR Methods and Applications 3:5136-5140 (1994). Mutations can also be introduced into the starting nucleic acid sequence by expressing the starting nucleic acid sequence in bacteria that are prone to mutations (for example Stratagene's XL 1-RED competent cells) or by exposing the starting nucleic acid to mutagenic principles such as chemicals, x-rays or ultraviolet radiation.
  • mutagenic principles such as chemicals, x-rays or ultraviolet radiation.
  • the result of these methods is a library of nucleic acid made up of many copies of mutated nucleic acid, with most individual nucleic acid molecules containing unique combinations of mutations. Aliquots of this library are then subcloned into an expression vector to make a "pool" of mutant nucleic acid for use in a vaccine. Such a pool will suitably contain at least 50, preferably at least 400, or even 2000-3000 different mutant nucleic acid species. If the starting sequence is a complex population of sequences (such as a cDNA library), the number of clones is driven by the sensitivity of the immunization protocol. This pool is used to form the vaccine compositions of the invention.
  • the nucleic acids in the pool may be either DNA or RNA since both are known to useful in vaccine compositions.
  • RNA Ribonucleic acid
  • one suitable mode of administration is subcutaneous injection of particles coated with the nucleic acid mixture using a GENE GUN.
  • the vaccine composition comprises carrier particles coated with the pool of nucleic acid, i.e. with a mixture comprising a plurality of nucleic acid species encoding a plurality of mutant forms of the target antigen.
  • the expressed mutant proteins or peptides are immunogenic and stimulate an immune response to the target antigen, even in the case where the target antigen is inherently non-immunogenic or only weakly immunogenic in the subject.
  • the carrier particles used in this composition may be any of various types of particles known for use in this purpose, including without limitation gold, clay and tungsten. The particles suitably are from 0.5 to 2 microns in diameter to facilitate transdermal injection.
  • nucleic acid vaccine compositions of the invention include the pressure delivery systems, for instance the BIOJECT system which delivers vaccines using carbon dioxide pressure cartridges, this case, particles are not required, but can be used.
  • the vaccine compositions can also be administered without a particle carrier using non-pressurized systems, for example syringe needles. Administration could also be accomplished using a mucosal route (e.g, a nasal spray).
  • the pool of mutated DNA may also be incorporated into a viral vector, which is then associated with particles for adminstration by the routes described above.
  • the vaccine composition above may be administered in a liquid carrier by subcutaneous injection.
  • the composition is suitably packaged into therapeutic administration units, sometimes referred to as "bullets". This is accomplished by drawing the composition into the lumen, a thin hollow tube, and then cutting the tube into lengths containing about 1 ⁇ g of nucleic acid.
  • the vaccine is apeptide vaccine created by expressing the pool of nucleic acids prior to administration. Expression is suitably carried out in host cells which may be bacterial or eukaryotic (for example, yeast, insect or mammalian). For such expression, the pool of nucleic acids are incorporated into an expression vector compatible with the host cells and then introduced into the host cells for expression without specific selection steps. Such expression systems are well known in the art.
  • the peptide vaccine compositions of the invention are different from known vaccine compositions, such as flu vaccines, which may contain mixtures of peptide antigens, because such mixtures are mixtures of several target antigens themselves rather than of mutant forms of one target antigen.
  • flu vaccines which may contain mixtures of peptide antigens, because such mixtures are mixtures of several target antigens themselves rather than of mutant forms of one target antigen.
  • the peptide antigens are selected to match the known epitopes of various strains of influenza.
  • the peptide vaccine of the invention can be administered using methods known in the art, including without limitation by intravenous, intramuscular and subcutaneous injection and by transdermal or intranasal administration.
  • the determination of the appropriate amount of peptide to vaccine to administer to arrive at the desired immune response is a routine matter within the ordinary skill in the art.
  • Example 1 To prepare mutant DNA, full length murine tyrosine-related protein 2 (mTRP-2) and murine gp75 were randomly mutated by PCR using the protocol of Cadwell et al., supra. Briefly, 20 ng of non-mutated plasmid encoding either protein served as a template for PCR. Mutagenic PCR was performed in Boehringer Mannheim's IX PCR buffer supplemented to contain 7 mM MgC12, 0.5 mM MnC12, 0.2 mM dATP and dGTP, and 1 mM dCTP and dTTP. 30 PCR cycles were performed with primers pairs specific for each coding sequence (mTRP-2 primers, upstream:
  • AAGGCGGCGCATGGGCCTTGTGGGATG (Seq. ID. No. 1), downstream: ATGCGGCCGCTAGGCTTCCTCCGTGTA (Seq. ID. No. 2); mgp75 primers, upstream: TTGCGGCCGCCATGAAATCTTACAACGTG (Seq. ID. No. 3), downstream: CGGAATTCTCAGACCATGGAGTGGTTA (Seq. ID. No. 4)) and Taq polymerase from Boehringer Mannheim.
  • the primers contained unique restriction sites for subsequent subcloning. Nonmutagenic control reactions were performed with the same template and primers using Stratagene's Pfu Turbo DNA polymerase in the corresponding buffer.
  • mutated and unmutated PCR products were subcloned into the CMV-based plasmid expression vector WRGBEN. Ross et al., Clin. Can. Res. 3: 2191-2196 (1997).
  • the clones deriving from mutagenic PCR were plated and grown, so as to obtain pools of approximately 2,500 clones.
  • the plasmid DNA of these clones was purified using QIAGEN 500 maxiprep columns in batches of variant plasmids containing random mutations. Each batch is referred to as a pool.
  • Tables 1 and 2 list the observed mutations by type and extrapolate the numbers to the full-length coding sequences for mgp75 mutagenesis and mTRP-2 mutagenesis, respectively.
  • the overall mutation frequency observed after 30 PCR cycles is 1.2 per 100 bp for mgp75, and 0.8 per 100 bp for mTRP-2.
  • Example 2 DNA from the plasmid pools was coated onto 1 m gold particles (BioRad) at a ratio of 100 g DNA for 50 mg of gold.
  • the gold/DNA precipitate was deposited in plastic tubing which was cut into "bullets", each representing 1 g of DNA. Bullets were loaded in a helium-pressure POWDER- JECT gene gun for genetic immunization of mice by delivery of the DNA-coated gold to the epidermis.
  • Example 3 C57BL/6 mice were depilated and immunized four times at intervals of 8-10 days, receiving 4 g of DNA at each immunization.
  • the DNA was delivered to the abdomen at three sites and the base of the tail. There were 5 mice per group.
  • Control groups received empty vector DNA, or the unmutated murine sequence or the human ortholog of either protein in the WRGBEN vector.
  • mice received 105 B16F10LM3 syngeneic melanoma cells in 50 1 of serum-free RPMI1640 medium, injected intradermally in the right flank. Tumor growth and coat color change (depigmentation) were measured every 2-3 days for 40 days minimum.
  • Depigmentation was quantified by densitometric analysis of digital images of the immunized animals. Mice were sacrificed upon ulceration of the tumor or when it reached a diameter of 20 mm. Tumor growth was monitored in untreated control animals, in animals injected with xenogeneic (human) gp75, in animals injected with wild-type syngeneic (mouse) gp75 and in animals injected with a mutant mgp75 pool in accordance with the invention. The results are summarized in Fig. 1.
  • Fig. 2 Tumor growth was also monitored in control animals injected with empty vector, in animals injected with xenogeneic (human) TRP-2, in animals injected with wild-type syngeneic (mouse) TRP-2 and in animals injected with a mutant mTRP-2 pool in accordance with the invention.
  • the results are summarized in Fig. 2.
  • the fraction of tumor free mice is shown in each figure.
  • the pools of mutagenized mgp75 or mTRP-2 conferred significant protection against tumor challenge, to an extent superior to that observed with any of the controls.
  • all mice which received one of the mutagenized pools displayed autoimmunity, as manifested by depigmentation. (see. Fig.
  • mice immunized with non-mutagenized syngeneic DNA No depigmentation was observed in mice immunized with non-mutagenized syngeneic DNA. In mice immunized with xenogeneic human antigen, depigmentation was observed, but it was consistently weaker, more sporadic and started later. This autoimmunity is indicative of the inducement of an immune response to the self-proteins gp75 and TRP-2.
  • mice from three different H-2 congenic strains (B10.A-H2a, B10.BR-H2k, B10.PL-H2u) were immunized with either of the following DNA preparations: unmutated mgp75, human gp75, and two independent pools of mutated mgp75 (2500 clones each).
  • B10.BR-H2k mice were immunized with either unmutated mTRP-2, human TRP-2 or two independent pools of mutated mTRP-2 (2500 clones each).
  • Autoimmune depigmentation was monitored in these mice as a measure of immunization efficiency. The fraction of depigmented mice over the total of each group is scored in Table 3.
  • Example 5 BALB/c mice were immunized with a pool of plasmid DNA containing mutagenized PSMA. Antibody responses were measured by ELISA assays using diluted mouse sera against purified recombinant mouse and human PSMA made by expression of recombinant baculovirus in insect cells. Often mice tested, 10 has a positive response to human PSMA. Of another ten mice tested, 2 had a positive response to mouse PSMA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

An immune response to a target antigen is induced in a subject be administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen. The vaccine composition contains a mixed pool of a plurality of DNA or RNA species encoding a plurality of mutant forms of the target antigen which are expressed of the mixed pool of nucleic acids. The vaccine compositions of the invention are administered to a subject, for example a human subject, to induce an immune response to the target antigen.

Description

METHOD AND COMPOSITION FOR IMMUNIZATION USΓNG MΓXED POOLS OF MUTATED NUCLEIC ACIDS OR PEPTIDES
DESCRIPTION
The research described in this application was supported by a grant from the National Cancer Institute, Award No. R0156821. The United States may have certain rights in this invention.
Background of the Invention
This application relates to a method for immunization which makes use of mixed pools of mutated nucleic acids (DNA or RNA) encoding variants of a target antigen as a nucleic acid vaccine or expressed peptides derived from such pools to stimulate an immune response to the target antigen.
The immune system provides a sophisticated and multi-faceted defense against antigens which are recognized as foreign. Antigens which are recognized, and which therefore stimulate an immune response, are referred to as immunogenic. However, not all antigens are immunogenic, and there are many instances of disease that the immune system deals with poorly, if at all. These include most cancers and infectious organisms such as human immunodeficiency virus- 1, Mycobacterium tuberculosis, Borrelia burgdorferi (the causative organism of Lyme disease), Epstein Barr virus, papilloma virus, hepatitis viruses and cytomegalovirus (CMV) to which the immune system fails to mount an effective response. This maybe due to tolerance to self-antigens (i.e. the body does not recognize a cancer cell as foreign) or because the antigen is an inherently weak immunogen. Regardless of the cause, however, these factors make the product of vaccines targeting these conditions both desirable and difficult.
Various approaches have been taken to try to overcome the inherent non-immunogenicity of cancer and other antigens. These approaches have included the identification of more immunogenic variants of the antigens of interest through modification of the epitope structure or through modification of MHC-binding regions, as well as the addition of adjuvants to enhance antigenicity. The general concept behind these prior approaches is the identification of a single species of antigen with improved immunogenicity. This can be based on structural information at the crystallographic level, information which is available for only a very limited number of human or animal MHC molecules, or extensive trial and error testing. The present invention represents a departure from this traditional approach.
Summary of the Invention
The present invention provides a method for inducing an immune response to a target antigen in a subject comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen. The vaccine composition comprises a mixed pool of a plurality of DNA or RNA species encoding a plurality of mutant forms of the target antigen which are expressed by the subject, or a mixture of peptides derived from pre-administration expression of the mixed pool of nucleic acids. The vaccine compositions of the invention are administered to a subject, for example a human subject, to induce an immune response to the target antigen.
Brief Description of the Drawings
Fig. 1 shows the number of tumor-free surviving mice immunized with nucleic acid vaccine derived from murine gp75 using various protocols;
Fig. 2 shows the number of tumor-free surviving mice immunized with nucleic acid vaccine derived from murine TRP-2 using various protocols; and
Fig. 3 shows the quantitative survey of autoimmune depigmentation in mice immunized with nucleic acid vaccine derived from murine gp75 using various protocols.
Detailed Description of the Invention
The present invention provides a method and composition for inducing an immune response to a target antigen. In accordance with the invention, nucleic acid vaccine compositions are administered to a subject in a manner which results in expression of the nucleic acid and recognition of the resulting proteins or peptides by the immune system.
The target antigen against which the invention induces an immune response may be any antigen for which a therapeutic benefit is derived as a result of the induction of an immune response, including antigens associated with pathogenic microorganisms and antigens associated with cancers. The invention is particularly applicable for inducing an immune response to inherently non-immunogenic or poorly immunogenic antigens. Specific, non-limiting examples of target antigens include gp75/TRP-l, TRP-2, tyrosinase, gpl00/pMell7 on melanoma; prostate specific membrane antigen, prostate specific antigen and prostate stem cell antigen on prostate cancers; HER2/neu and the mucin MUC1 on breast cancers; CD 19 and CD20 on malignancies of B lymphocyte origin; MAGE, BAGE and GAGE, NY-ESO-1 and other "cancer-testes" antigens on a variety of cancer types; gene products from the human immunodeficiency virus- 1 ; angiogenic factors (such as VEGF, bFGF, angiopoietins, their cognate cell surface receptors, and ELR C-X-C chemokines); tumor suppressor genes such as p53; dipeptidyl peptidase IV and fibroblast activation protein- 1.
As used in the specification and claims of this application, the phrase "inducing an immune response" refers to both the stimulation of a new immune response or to the enhancement of a pre-existing immune response to a target antigen. The immune response may be a cytolytic T-cell mediated cellular immune response or a B-cell mediated humoral response, or some combination thereof.
The term "subject" refers to the living organism being treated to induce an immune response. The subject will generally be mammalian or avian. Preferred "subjects" are human patients. h the method of the invention, an immune response to a target antigen is induced in a subject comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen, wherein the vaccine composition comprises a plurality of vaccine molecule species corresponding to a plurality of mutant forms of the target antigen. As used herein, the term "vaccine molecule species" refers to either nucleic acids (DNA or RNA) or to peptides. The term "corresponding" encompasses both mutant forms of the target antigen per se (i.e, peptide vaccine molecule species) and nucleic acid vaccine molecule species encoding the mutant forms of the target antigen.
In a first embodiment of the invention, the vaccine compositions of the invention comprise a mixture of mutated nucleic acids which encode mutant variants of the target antigen. Unlike prior methods which focus on using single, carefully selected mutant antigens, the present invention intentionally uses a mixture of different species of mutant nucleic acid all derived from a starting nucleic acid encoding the target antigen. To prepare such a mixture, one starts with a nucleic acid sequence encoding the target antigen. This sequence may be in the form of PCR amplicon, or it may be incorporated in a vector system to facilitate its reproduction in an appropriate host. The sequence may be cDNA encoding the entire antigen or it may be a partial sequence encoding only a portion of the antigen. Although there is no absolute minimum size, partial sequences used will preferably be at least 24 bases, encoding 8 amino acids. This "starting nucleic acid sequence" is used as the starting material for generating the vaccine compositions of the invention.
The starting nucleic acid sequence may be an accepted "wild-type" sequence derived from a normal source. In this regard, it will be appreciated that polymorphic sequences may have a multiplicity of "normal" or "wild-type" sequences, and that it is not critical which of these sequences are used as the starting sequence. The starting nucleic acid sequence may also be a mutant sequence (i.e. a sequence which differs from the established norm.) The starting nucleic acid sequence may also be (but does not have to be) derived from the subject. Thus, for example, in the latter case, a subject's own cancer cells could be used as a source for the starting nucleic acid sequence.
Mutations, which can be insertions, deletions, translations, or inversions of one or more bases, can be introduced into the starting nucleic acid sequence using any of various known techniques. For example, random mutations can be introduced into the starting nucleic acid sequences using error-prone PCR as described in Cadwell et al. in PCR Methods and Applications 2:28-33 (1992) and PCR Methods and Applications 3:5136-5140 (1994). Mutations can also be introduced into the starting nucleic acid sequence by expressing the starting nucleic acid sequence in bacteria that are prone to mutations (for example Stratagene's XL 1-RED competent cells) or by exposing the starting nucleic acid to mutagenic principles such as chemicals, x-rays or ultraviolet radiation.
The result of these methods is a library of nucleic acid made up of many copies of mutated nucleic acid, with most individual nucleic acid molecules containing unique combinations of mutations. Aliquots of this library are then subcloned into an expression vector to make a "pool" of mutant nucleic acid for use in a vaccine. Such a pool will suitably contain at least 50, preferably at least 400, or even 2000-3000 different mutant nucleic acid species. If the starting sequence is a complex population of sequences (such as a cDNA library), the number of clones is driven by the sensitivity of the immunization protocol. This pool is used to form the vaccine compositions of the invention.
The nucleic acids in the pool may be either DNA or RNA since both are known to useful in vaccine compositions. (See, for example, US Patents Nos. 5,580,859 and 5,589,466, Qiu et al., "Gene gun delivery of mRNA in situ results in efficient transgene expression and genetic immunization." Gene Ther. 3(3):262-8 (1996); Garrity RR., "Targeted immune design using RNA immunization"^^ N Y Acad Sci.894: 124-9 (1999); Zhou et al., "RΝA melanoma vaccine: induction of antitumor immunity by human glycoprotein 100 mRΝA immunization", Hum Gene Ther. 10(16):2719-24 (1999); Giraud et al., "Generation of monoclonal antibodies to native human immunodeficiency virus type 1 envelope glycoprotein by immunization of mice with naked RΝA", J Virol Methods. 79(l):75-84 (1999); Dalemans et al., "Protection against homologous influenza challenge by genetic immunization with SFV-RΝA encoding Flu-HA", Ann N YAcadSci. 772:255- 6 (1995); Heiser et al., "Human dendritic cells transfected with RΝA encoding prostate- specific antigen stimulate prostate-specific CTL responses hi vitro", J Immunol. 164(10):5508-14 (2000); Boczkowski et al., "induction of tumor immunity and cytotoxic T lymphocyte responses using dendritic cells transfected with messenger RΝA amplified from tumor cells", Cancer i?e_f.60(4):1028-34 (2000); Νair et al., "Induction of primary carcinoembryonic antigen (CEA)-specific cytotoxic T lymphocytes in vitro using human dendritic cells transfected with RΝA", Nat Biotechnol. 16(4):364-9 (1998); Ashley et al., "Bone marrow-generated dendritic cells pulsed with tumor extracts or tumor RΝA induce antitumor immunity against central nervous system tumors", JExp Med. 186(7):1177-82 (1997), all of which are incorporated herein by reference). Where the pool is DΝA, and the desired vaccine contains RΝA, transcription can be carried out using alpha viruses or in vitro transcription systems. It will be apparent that no individual pool will contain all of the possible mutant forms which could be made for a given target antigen. Indeed, a given pool need not even contain all of the mutant nucleic acid species formed in a given library. As shown in the examples below, however, the selection of specific mutant forms is not required and all five pools with mutant gp75 DNA acid were effective in stimulating an antitumorigenic immune response. Furthermore, because of the comparative ease of production, several alternative pools can be easily available for use if a vaccine based on a first pool were to prove ineffective.
Once the pool of mutant nucleic acid is created, it is formulated into a vaccine composition for administration to the subject. As discussed below, one suitable mode of administration is subcutaneous injection of particles coated with the nucleic acid mixture using a GENE GUN. Thus, one embodiment of the vaccine composition comprises carrier particles coated with the pool of nucleic acid, i.e. with a mixture comprising a plurality of nucleic acid species encoding a plurality of mutant forms of the target antigen. The expressed mutant proteins or peptides are immunogenic and stimulate an immune response to the target antigen, even in the case where the target antigen is inherently non-immunogenic or only weakly immunogenic in the subject. The carrier particles used in this composition may be any of various types of particles known for use in this purpose, including without limitation gold, clay and tungsten. The particles suitably are from 0.5 to 2 microns in diameter to facilitate transdermal injection.
Other delivery systems which can be used to administer the nucleic acid vaccine compositions of the invention include the pressure delivery systems, for instance the BIOJECT system which delivers vaccines using carbon dioxide pressure cartridges, this case, particles are not required, but can be used. The vaccine compositions can also be administered without a particle carrier using non-pressurized systems, for example syringe needles. Administration could also be accomplished using a mucosal route (e.g, a nasal spray). The pool of mutated DNA may also be incorporated into a viral vector, which is then associated with particles for adminstration by the routes described above.
The vaccine composition above may be administered in a liquid carrier by subcutaneous injection. For use in a Gene Gun, however, the composition is suitably packaged into therapeutic administration units, sometimes referred to as "bullets". This is accomplished by drawing the composition into the lumen, a thin hollow tube, and then cutting the tube into lengths containing about 1 μg of nucleic acid. In a second embodiment of the invention, the vaccine is apeptide vaccine created by expressing the pool of nucleic acids prior to administration. Expression is suitably carried out in host cells which may be bacterial or eukaryotic (for example, yeast, insect or mammalian). For such expression, the pool of nucleic acids are incorporated into an expression vector compatible with the host cells and then introduced into the host cells for expression without specific selection steps. Such expression systems are well known in the art.
The peptide vaccine compositions of the invention are different from known vaccine compositions, such as flu vaccines, which may contain mixtures of peptide antigens, because such mixtures are mixtures of several target antigens themselves rather than of mutant forms of one target antigen. Thus, for example in the case of a flu vaccine, the peptide antigens are selected to match the known epitopes of various strains of influenza.
The peptide vaccine of the invention can be administered using methods known in the art, including without limitation by intravenous, intramuscular and subcutaneous injection and by transdermal or intranasal administration. The determination of the appropriate amount of peptide to vaccine to administer to arrive at the desired immune response is a routine matter within the ordinary skill in the art.
The invention will now be further described with reference to the following, non-limiting examples.
Example 1 To prepare mutant DNA, full length murine tyrosine-related protein 2 (mTRP-2) and murine gp75 were randomly mutated by PCR using the protocol of Cadwell et al., supra. Briefly, 20 ng of non-mutated plasmid encoding either protein served as a template for PCR. Mutagenic PCR was performed in Boehringer Mannheim's IX PCR buffer supplemented to contain 7 mM MgC12, 0.5 mM MnC12, 0.2 mM dATP and dGTP, and 1 mM dCTP and dTTP. 30 PCR cycles were performed with primers pairs specific for each coding sequence (mTRP-2 primers, upstream:
AAGGCGGCGCATGGGCCTTGTGGGATG (Seq. ID. No. 1), downstream: ATGCGGCCGCTAGGCTTCCTCCGTGTA (Seq. ID. No. 2); mgp75 primers, upstream: TTGCGGCCGCCATGAAATCTTACAACGTG (Seq. ID. No. 3), downstream: CGGAATTCTCAGACCATGGAGTGGTTA (Seq. ID. No. 4)) and Taq polymerase from Boehringer Mannheim. The primers contained unique restriction sites for subsequent subcloning. Nonmutagenic control reactions were performed with the same template and primers using Stratagene's Pfu Turbo DNA polymerase in the corresponding buffer.
To generate pools of mutants, mutated and unmutated PCR products were subcloned into the CMV-based plasmid expression vector WRGBEN. Ross et al., Clin. Can. Res. 3: 2191-2196 (1997). The clones deriving from mutagenic PCR were plated and grown, so as to obtain pools of approximately 2,500 clones. The plasmid DNA of these clones was purified using QIAGEN 500 maxiprep columns in batches of variant plasmids containing random mutations. Each batch is referred to as a pool.
To assess the efficiency of PCR mutagenesis, four mutagenized clones of both mgp75 and mTRP-2 were sequenced over the first 600 bp of the coding sequence. Tables 1 and 2 list the observed mutations by type and extrapolate the numbers to the full-length coding sequences for mgp75 mutagenesis and mTRP-2 mutagenesis, respectively. The overall mutation frequency observed after 30 PCR cycles is 1.2 per 100 bp for mgp75, and 0.8 per 100 bp for mTRP-2.
Example 2 DNA from the plasmid pools was coated onto 1 m gold particles (BioRad) at a ratio of 100 g DNA for 50 mg of gold. The gold/DNA precipitate was deposited in plastic tubing which was cut into "bullets", each representing 1 g of DNA. Bullets were loaded in a helium-pressure POWDER- JECT gene gun for genetic immunization of mice by delivery of the DNA-coated gold to the epidermis.
Example 3 C57BL/6 mice were depilated and immunized four times at intervals of 8-10 days, receiving 4 g of DNA at each immunization. The DNA was delivered to the abdomen at three sites and the base of the tail. There were 5 mice per group. Control groups received empty vector DNA, or the unmutated murine sequence or the human ortholog of either protein in the WRGBEN vector. Seven days after the last immunization, mice received 105 B16F10LM3 syngeneic melanoma cells in 50 1 of serum-free RPMI1640 medium, injected intradermally in the right flank. Tumor growth and coat color change (depigmentation) were measured every 2-3 days for 40 days minimum. Depigmentation was quantified by densitometric analysis of digital images of the immunized animals. Mice were sacrificed upon ulceration of the tumor or when it reached a diameter of 20 mm. Tumor growth was monitored in untreated control animals, in animals injected with xenogeneic (human) gp75, in animals injected with wild-type syngeneic (mouse) gp75 and in animals injected with a mutant mgp75 pool in accordance with the invention. The results are summarized in Fig. 1. Tumor growth was also monitored in control animals injected with empty vector, in animals injected with xenogeneic (human) TRP-2, in animals injected with wild-type syngeneic (mouse) TRP-2 and in animals injected with a mutant mTRP-2 pool in accordance with the invention. The results are summarized in Fig. 2. The fraction of tumor free mice is shown in each figure. As this data reflects, the pools of mutagenized mgp75 or mTRP-2 conferred significant protection against tumor challenge, to an extent superior to that observed with any of the controls. In addition, all mice which received one of the mutagenized pools displayed autoimmunity, as manifested by depigmentation. (see. Fig. 3) No depigmentation was observed in mice immunized with non-mutagenized syngeneic DNA. In mice immunized with xenogeneic human antigen, depigmentation was observed, but it was consistently weaker, more sporadic and started later. This autoimmunity is indicative of the inducement of an immune response to the self-proteins gp75 and TRP-2.
These tests were repeated with three independent mutant pools of 2,500 clones of mgp75 and four three independent mutant pools of 2,500 clones of mTRP-2. Every pool elicited both tumor immunity and autoimmune depigmentation.
Example 4 To show applicability of the present approach in multiple MHC alleles, mice from three different H-2 congenic strains (B10.A-H2a, B10.BR-H2k, B10.PL-H2u) were immunized with either of the following DNA preparations: unmutated mgp75, human gp75, and two independent pools of mutated mgp75 (2500 clones each). In a separate experiment, B10.BR-H2k mice were immunized with either unmutated mTRP-2, human TRP-2 or two independent pools of mutated mTRP-2 (2500 clones each). Autoimmune depigmentation was monitored in these mice as a measure of immunization efficiency. The fraction of depigmented mice over the total of each group is scored in Table 3. These results show that immunization with mutant DNA vaccine pools can immunized multiple genetic backgrounds, suggesting that outbred populations such as humans will respond immunologically to this vaccine approach.
Example 5 BALB/c mice were immunized with a pool of plasmid DNA containing mutagenized PSMA. Antibody responses were measured by ELISA assays using diluted mouse sera against purified recombinant mouse and human PSMA made by expression of recombinant baculovirus in insect cells. Often mice tested, 10 has a positive response to human PSMA. Of another ten mice tested, 2 had a positive response to mouse PSMA.

Claims

Claims
1. A method for inducing an immune response to a target antigen in a subj ect comprising administering to the subject a vaccine composition in an amount sufficient to induce an immune response to the target antigen, wherein the vaccine composition comprises a plurality of vaccine molecule species corresponding to a plurality of mutant forms of the target antigen.
2. The method of claim 1, wherein the vaccine composition contains at least 50 vaccine molecule species.
3. The method of claim 1, wherein the vaccine composition contains at least 500 vaccine molecule species.
4. The method of any of claims 1 -3, wherein the vaccine molecule species are nucleic acids, and the nucleic acids are expressed by the subject after administration.
5. The method of any of claims 1-3, wherein the vaccine molecule species are peptides.
6. A method for creating a nucleic acid vaccine composition for inducing an immune response to a target antigen, comprising the steps of:
(a) obtaining a starting sequence corresponding to a wild-type or mutant sequence of the target antigen; and
(b) randomly introducing mutations into the starting sequence to generate a mixture containing a plurality of nucleic acid sequences encoding mutant forms of the target antigen;
(c) packaging the mixture into dosage unit form for administration as a vaccine.
7. The method of claim 6, wherein the mixture contains at least 50 species of nucleic acid sequences.
8. The method of claim 6, wherein the mixture contains at least 500 species of nucleic acid sequences.
9. A method for creating a peptide vaccine composition for inducing an immune response to a target antigen, comprising the steps of:
(a) obtaining a starting sequence corresponding to a wild-type or mutant sequence of the target antigen; and
(b) randomly introducing mutations into the starting sequence to generate a nucleic acid mixture containing a plurality of nucleic acid sequences encoding mutant forms of the target antigen;
(c) expressing the plurality of nucleic acids sequences in the mixture to produce a peptide mixture; and
(d) packaging the peptide mixture into dosage unit form for administration as a vaccine.
10. The method of claim 9, wherein the nucleic acid mixture contains at least 50 species of nucleic acid sequences.
11. The method of claim 9, wherein the nucleic acid mixture contains at least 500 species of nucleic acid sequences.
12. A vaccine composition for inducing an immune response to a target antigen comprising carrier particles having coated thereon a mixture comprising a plurality of nucleic acid species encoding a plurality of mutant forms of the target antigen.
13. A therapeutic administration unit comprising:
(a) a hollow tubular carrier having an interior lumen; and
(b) vaccine composition for inducing an immune response to a target antigen comprising carrier particles (i.e. gold) having coated thereon a mixture comprising a plurality of nucleic acid species encoding a plurality of mutant forms of the target antigen disposed within the lumen.
EP01961861A 2000-08-07 2001-08-02 METHOD AND COMPOUNDS FOR IMMUNIZING USING MIXED POOLS FROM MUTANT NUCLEIC ACIDS OR PEPTIDES Withdrawn EP1311278A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US22316500P 2000-08-07 2000-08-07
US223165P 2000-08-07
PCT/US2001/024286 WO2002011748A1 (en) 2000-08-07 2001-08-02 Method and composition for immunization using mixed pools of mutated nucleic acids or peptides

Publications (2)

Publication Number Publication Date
EP1311278A1 true EP1311278A1 (en) 2003-05-21
EP1311278A4 EP1311278A4 (en) 2005-01-05

Family

ID=22835326

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01961861A Withdrawn EP1311278A4 (en) 2000-08-07 2001-08-02 METHOD AND COMPOUNDS FOR IMMUNIZING USING MIXED POOLS FROM MUTANT NUCLEIC ACIDS OR PEPTIDES

Country Status (4)

Country Link
EP (1) EP1311278A4 (en)
AU (1) AU2001283094A1 (en)
CA (1) CA2417240A1 (en)
WO (1) WO2002011748A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
SG146662A1 (en) * 2003-10-10 2008-10-30 Powderject Vaccines Inc Method
US9884893B2 (en) 2012-05-21 2018-02-06 Distributed Bio, Inc. Epitope focusing by variable effective antigen surface concentration
KR20250108761A (en) 2014-10-01 2025-07-15 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 Vaccines having an antigen and interleukin-21 as an adjuvant
CN121586581A (en) * 2022-11-09 2026-02-27 森蒂瓦克斯公司 Low-dose vaccine composition

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE3546807C2 (en) * 1985-03-30 1991-03-28 Marc Genf/Geneve Ch Ballivet
FR2677363A1 (en) * 1991-06-07 1992-12-11 Pasteur Institut COMPOSITIONS BASED ON MULTIEPITOPIC PEPTIDES, PROCESS FOR OBTAINING SAME AND APPLICATIONS THEREOF, IN PARTICULAR AS VACCINES.
US5741492A (en) * 1996-01-23 1998-04-21 St. Jude Children's Research Hospital Preparation and use of viral vectors for mixed envelope protein vaccines against human immunodeficiency viruses
DE19907485B4 (en) * 1999-02-12 2008-01-17 Strathmann Ag & Co. Virus vaccine

Also Published As

Publication number Publication date
WO2002011748A1 (en) 2002-02-14
AU2001283094A1 (en) 2002-02-18
EP1311278A4 (en) 2005-01-05
CA2417240A1 (en) 2002-02-14

Similar Documents

Publication Publication Date Title
Irvine et al. Cytokine enhancement of DNA immunization leads to effective treatment of established pulmonary metastases
Tüting et al. Gene-based strategies for the immunotherapy of cancer
Casares et al. Immunization with a tumor‐associated CTL epitope plus a tumor‐related or unrelated Th1 helper peptide elicits protective CTL immunity
AU753738B2 (en) Use of MHC class II ligands as adjuvant for vaccination and of LAG-3 in cancer treatment
Ribas Genetically modified dendritic cells for cancer immunotherapy
JPH08509606A (en) Methods and materials for treating individuals infected with intracellular infectious agents
CN108472350A (en) Neoepitope rna cancer vaccine
Kalat et al. In vivo plasmid electroporation induces tumor antigen-specific CD8+ T-cell responses and delays tumor growth in a syngeneic mouse melanoma model
AU2003228229B2 (en) DNA vaccine against proliferating endothelial cells and methods of use thereof
AU2019361280A1 (en) Teleost invariant chain cancer vaccine
Burger et al. Plasmids encoding granulocyte–macrophage colony-stimulating factor and CD154 enhance the immune response to genetic vaccines
Kikuchi Genetically modified dendritic cells for therapeutic immunity
DK1802340T3 (en) A combination of recombinant mycobacteria and a biologically active agent as a vaccine
WO2002011748A1 (en) Method and composition for immunization using mixed pools of mutated nucleic acids or peptides
AU776795B2 (en) Chorionic gonadotropin DNA vaccines and methods
US20030157534A1 (en) DNA immunization with libraries of minigenes encoding degenerate variants of major histocompatability class l restricted epitopes
US6358933B1 (en) Formulation of nucleic acid and acemannan
US20030224392A1 (en) Method for identification of mutant antigens with enhanced immunogenicity
US20070042047A1 (en) Vaccines
Tüting et al. The immunology of DNA vaccines
WO2004076665A2 (en) Vaccines derived from epithelial cell mucin muc-1
JP2021180677A (en) Polyepitope constructs for use in immunotherapy
WO2006105255A9 (en) Cancer vaccines and therapeutic methods
Paterson Rational approaches to immune regulation
JP2005526511A (en) vaccine

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20030214

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

A4 Supplementary search report drawn up and despatched

Effective date: 20041123

17Q First examination report despatched

Effective date: 20050204

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060301