EP1294914A2 - Promoters for regulation of plant gene expression - Google Patents
Promoters for regulation of plant gene expressionInfo
- Publication number
- EP1294914A2 EP1294914A2 EP01943720A EP01943720A EP1294914A2 EP 1294914 A2 EP1294914 A2 EP 1294914A2 EP 01943720 A EP01943720 A EP 01943720A EP 01943720 A EP01943720 A EP 01943720A EP 1294914 A2 EP1294914 A2 EP 1294914A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- plant
- gene
- nucleic acid
- nucleotide sequence
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8222—Developmentally regulated expression systems, tissue, organ specific, temporal or spatial regulation
- C12N15/8223—Vegetative tissue-specific promoters
- C12N15/8227—Root-specific
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8237—Externally regulated expression systems
- C12N15/8238—Externally regulated expression systems chemically inducible, e.g. tetracycline
Definitions
- the present invention relates generally to the field of plant molecular biology. More specifically, it relates to the regulation of gene expression in plants.
- Manipulation of crop plants to alter and/or improve phenotypic characteristics requires the expression of heterologous genes in plant tissues.
- Such genetic manipulation relies on the availability of a means to drive and to control gene expression as required.
- genetic manipulation relies on the availability and use of suitable promoters which are effective in plants and which regulate gene expression so as to give the desired effect(s) in the transgenic plant. It is advantageous to have the choice of a variety of different promoters so that the most suitable promoter may be selected for a particular gene, construct, cell, tissue, plant or environment.
- PTU plant transcription units
- Promoters and other regulatory components from bacteria, viruses, fungi and plants have been used to control gene expression in plant cells. Numerous plant transformation experiments using DNA constructs comprising various promoter sequences fused to various foreign genes (for example, bacterial marker genes) have led to the identification of useful promoter sequences. It has been demonstrated that sequences up to 500-1000 bases in most instances are sufficient to allow for the regulated expression of foreign genes. However, it has also been shown that sequences much longer than 1000 bases may have useful features which permit desirable, e.g., high, levels of gene expression in transgenic plants.
- One desirable source for promoters which have different expression profiles is plant genomic DNA. Plant development is precisely coordinated and regulated through transcription and translation of different gene products in each cell. The expression level for each gene present in a cell not only reflects the physiological status of the cell, but also determines the range of different functions the cell can perform. Identification of genes expressed constitutively, in a specific cell type or tissue, or at a specific developmental stage, and the analysis of the abundance of the corresponding gene product can provide valuable insights into basic molecular processes and identity promoters with desirable properties.
- cDNA and high density oligonucleotide array technology allows analysis of mRNA transcripts of hundreds to thousands of genes in parallel (Schena et al., 1995; Chee et al, 1996; Lockhart et al., 1996; DeRisi et al., 1997; Lashkari et al., 1997).
- genomicme scale transcription profiling enables not only parallel monitoring of gene expression, but also a more subjective approach for gene discovery because objective selection of gene probes to be put on microarrays is not required (Lockhart and Winzeler, 2000).
- the present invention provides an isolated nucleic acid molecule (polynucleotide) having a plant nucleotide sequence that directs root-specific (i.e., preferential) transcription of a linked nucleic acid segment in a plant, e.g., a linked plant DNA comprising an open reading frame for a structural or regulatory gene.
- the nucleotide sequence preferably is obtained or isolatable from plant genomic DNA.
- the nucleotide sequence is obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%, amino acid sequence identity, to a polypeptide encoded by an Arabidopsis gene comprising any one of SEQ ID NOs: 1-51 or a fragment (portion) thereof (i.e., a promoter isolatable from any one of SEQ ID NOs: 1-51) or to a polypeptide encoded by an Oryza gene comprising SEQ ID NO:825 or 843 or a fragment (portion) thereof (i.e.,
- Preferred root-specific promoters comprise DNA obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
- root-specific promoters comprising DNA obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%, amino acid sequence identity, to a polypeptide encoded by an Arabidopsis gene comprising an open reading frame having any one of SEQ ID NOs: 358-366, or a fragment thereof which directs root-specific transcription, or to a polypeptide encoded by an Oryza gene comprising an open reading frame having SEQ ID NO:774 or 792, or a fragment thereof which directs root-specific transcription.
- the present invention also provides an isolated nucleic acid molecule having a plant nucleotide sequence that directs constitutive transcription of a linked nucleic acid segment in a host cell, e.g., a plant cell.
- the nucleotide sequence preferably is obtained or isolatable from plant genomic DNA.
- Preferred constitutive promoters comprise DNA obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%,
- constitutive promoters comprising DNA obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%, amino acid sequence identity, to a polypeptide encoded by an Arabidopsis gene comprising an open reading frame having any one of SEQ ID NOs:441-476 and 527-529 or a fragment thereof which directs constitutive transcription, or to a polypeptide encoded by an Oryza gene comprising an open reading frame having any one of SEQ ID NOs:775-791 or 793-824 or a fragment thereof which directs constitutive transcription.
- the present invention further provides an isolated nucleic acid molecule which comprises a plant nucleotide sequence that directs leaf-specific (i.e., preferential) transcription of a linked nucleic acid segment in a plant.
- the nucleotide sequence preferably is obtained or isolatable from plant genomic DNA.
- the nucleotide sequence is obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%o, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%, amino acid sequence identity, to a polypeptide encoded by an Arabidopsis gene comprising any one of SEQ ID NOs: 693-773 or a fragment thereof (i.e., isolatable from any one of SEQ ID NOs:693-773) which directs leaf-specific transcription of a linked nucleic acid segment.
- leaf specific promoters comprising DNA obtained or isolatable from a gene encoding a polypeptide which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99%, amino acid sequence identity, to a polypeptide encoded by an Arabidopsis gene comprising an open reading frame having any one of SEQ ID NOs:601-692 or a fragment thereof which directs leaf-specific transcription.
- the invention also provides uses for an isolated nucleic acid molecule, e.g., DNA or RNA, comprising a plant nucleotide sequence comprising an open reading frame that is preferentially expressed in leaves, roots or constitutively, and which is substantially similar, and preferably has at least 70%, e.g., 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, and even 90% or more, e.g., 91%, 92%, 93%, 94%o, 95%;, 96%), 97%, 98%, and 99%), amino acid sequence identity, to a polypeptide encoded by an Arabidopsis gene comprising an open reading frame having any one of SEQ ID NOs:358-366, 441-476, 527-529 and 601-692 or the complement thereof, e.g., SEQ ID NOs:601-692 comprise the
- root-specific DNA having open reading frames which encode peroxidases, transport proteins, defense-related proteins, proteins involved in metabolism and DNA binding proteins, and constitutive open reading frames which encode cell cycle proteins, ribosomal proteins, transcription factors, defense-related proteins, stress-related proteins, transport protein, membrane proteins, structural proteins, proteins involved in metabolism, signaling proteins, kinases and synthases, may be useful to prepare plants that over- or underexpress the encoded product or to prepare knockout plants.
- nucleic acid molecules comprising a nucleotide sequence having an open reading frame comprising SEQ ID NO:457, 476, or 527 (constitutive) or SEQ ID NO:602, 604, 609-610 (leaf). These sequences, while being useful to over- or underexpress the encoded product, or prepare knockout plants, may be used as a control for genes that are constitutively expressed or in a leaf-specific manner.
- the promoters and open reading frames of the invention can be identified by employing an array of nucleic acid samples, e.g., each sample having a plurality of oligonucleotides, and each plurality corresponding to a different plant gene, on a solid substrate, e.g., a DNA chip, and probes corresponding to nucleic acid expressed in, for example, one or more plant tissues and/or at one or more developmental stages, or probes corresponding to nucleic acid expressed in the cells of the leaves or root of a plant relative to control nucleic acid from cellular sources other than leaves or root.
- a solid substrate e.g., a DNA chip
- genes that are upregulated or downregulated in the majority of tissues at a majority of developmental stages, or upregulated or downregulated in one tissue such as in root or in leaves can be systematically identified.
- GeneChip® technology was utilized to discover genes that are preferentially (or exclusively) expressed in various tissues including root and leaf, as well as those that are constitutively expressed, using labeled cRNA probes, determining expression levels by laser scanning and generally selecting for expression levels that were > 2 fold over the control.
- the Arabidopsis oligonucleotide probe array consists of probes from about 8,100 unique Arabidopsis genes, which covers approximately one third of the genome. This genome array permits a broader, more complete and less biased analysis of gene expression.
- the promoters of the invention may be employed to express an open reading frame from an insect resistance gene, a bacterial disease resistance gene, a fungal disease resistance gene, a viral disease resistance gene, a nematode disease resistance gene, a herbicide resistance gene, a gene affecting grain composition or quality, a nutrient utilization gene, a mycotoxin reduction gene, a male sterility gene, a selectable marker gene, a screenable marker gene, a negative selectable marker, a gene affecting plant agronomic characteristics, or an environment or stress resistance gene, i.e., one or more genes that confer herbicide resistance or tolerance, insect resistance or tolerance, disease resistance or tolerance (viral, bacterial, fungal, oomycete, or nematode), stress tolerance or resistance (as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress, or oxidative stress), increased yields, food content and makeup, physical appearance, male sterility, drydown, standability, prolific
- resistant is meant a plant which exhibits substantially no phenotypic changes as a consequence of agent administration, infection with a pathogen, or exposure to stress.
- tolerant is meant a plant which, although it may exhibit some phenotypic changes as a consequence of infection, does not have a substantially decreased reproductive capacity or substantially altered metabolism.
- root-specific promoters may be useful for expressing defense-related genes, including those conferring insecticidal resistance and stress tolerance genes, e.g., salt, cold or drought tolerance, and genes for altering nutrient uptake
- leaf-specific promoters may be useful for producing large quantities of protein, for expressing oils or proteins of interest, genes for increasing the nutritional value of a plant, and for expressing defense-related genes (e.g., against pathogens such as a virus or fungus), including genes encoding insecticidal polypeptides.
- Constitutive promoters are useful for expressing a wide variety of genes including those which alter metabolic pathways, confer disease resistance, for protein production, e.g., antibody production, or to improve nutrient uptake.
- Constitutive promoters may be modified so as to be regulatable, e.g., inducible.
- the genes and promoters described hereinabove can be used to identify orthologous genes and their promoters which are also likely expressed in a particular tissue and/or development manner.
- the orthologous promoters are useful to express linked open reading frames.
- novel cis elements can be identified that are useful to generate synthetic promoters.
- the isolated nucleic acid molecules of the invention include the orthologs of the Arabidopsis sequences disclosed herein, i.e., the corresponding nucleotide sequences in organisms other than Arabidopsis, including, but not limited to, plants other than Arabidopsis, preferably cereal plants, e.g., corn, wheat, rye, turfgrass, sorghum, millet, sugarcane, soybean, barley, alfalfa, sunflower, canola, soybean, cotton, peanut, tobacco, sugarbeet, or rice.
- cereal plants e.g., corn, wheat, rye, turfgrass, sorghum, millet, sugarcane, soybean, barley, alfalfa, sunflower, canola, soybean, cotton, peanut, tobacco, sugarbeet, or rice.
- orthologous gene is a gene from a different species that encodes a product having the same or similar function, e.g., catalyzing the same reaction as a product encoded by a gene from a reference organism.
- an ortholog includes polypeptides having less than, e.g., 65% amino acid sequence identity, but which ortholog encodes a polypeptide having the same or similar function.
- Databases such GenBank or one found at http://bioserver.myongjiac.kr/rjce.html (for rice) may be employed to identify sequences related to the Arabidopsis sequences, e.g., orthologs in cereal crops such as rice, wheat, sunflower or alfalfa.
- SEQ ID NOs:598-600 are the rice promoter, open reading frame and amino acid sequence for rice polyubiquitin, the ortholog of the Arabidopsis gene comprising SEQ ID NO: 155.
- SEQ ID NOs:774 and 792 are rice orthologs of the Arabidopsis gene comprising SEQ ID NO:360;
- SEQ ID NOs:789-790, 799, and 813 are rice orthologs of the Arabidopsis gene comprising SEQ ID NO:441;
- SEQ ID NOs: 781, 804-805, 810, 816-817, and 822 are rice orthologs of the Arabidopsis gene comprising SEQ ID NO:442;
- SEQ ID NOs:777, 782- 783, 806, and 820 are rice orthologs of the Arabidopsis gene comprising SEQ ID NO:443;
- SEQ ID NOs:791, 793, and 808 are rice orthologs of the Arabidopsis gene comprising S
- Additional orthologs of Arabidopsis genes herein are identified herein, such as rice orthologs for SEQ ID NOs:359-360, 441-443, 446-447, 449-450, 465-467 and 527-529; corn orthologs for SEQ ID NOs:360, 441-442, 465-467, 527, 529; wheat orthologs for SEQ ID NOs:441-442; sunflower orthologs for SEQ ID NOs:441-442; and alfalfa orthologs for SEQ ID NOs:365 and 529 (Table 15).
- promoter sequences within the scope of the invention are those which direct expression of an open reading frame which encodes a polypeptide that is substantially similar to an Arabidopsis polypeptide encoded by a gene having a promoter selected from the group consisting of SEQ ID NOs: 1-339, 447-515, 517-526, 536-579 and 693-773 or a polypeptide that is substantially similar to an Oryza polypeptide encoded by a gene having a promoter selected from the group consisting of SEQ ID NOs:825-875.
- the promoters of the invention include a consecutive stretch of about 25 to
- 2000 including 50 to 500 or 100 to 250, and up to 1000 or 1500, contiguous nucleotides, e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, of any one of SEQ ID NOs:l-339, 477-515, 517-526, 536-579, and 693-773, or the promoter orthologs thereof, e.g., SEQ ID NOs: 825-875, which include the minimal promoter region.
- contiguous nucleotides e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, of any one of SEQ ID NOs:l-339, 477-515, 517-526, 536-579, and 693-773, or the promoter orthologs thereof, e.g., SEQ ID NOs: 825-875, which include
- said consecutive stretch of about 25 to 2000 including 50 to 500 or 100 to 250, and up to 1000 or 1500, contiguous nucleotides, e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, has at least 75%, preferably 80%, more preferably 90% and most preferably 95% sequence identity with a corresponding consecutive stretch of about 25 to 2000, including 50 to 500 or 100 to 250, and up to 1000 or 1500, contiguous nucleotides, e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, of any one of SEQ ID NOs: 1-339, 477-515, 517-526, 536-579, and 693-773, or the promoter orthologs thereof, which include the minimal promoter region.
- said consecutive stretch of about 25 to 2000 including 50 to 500 or 100 to 250, and up to
- contiguous nucleotides e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, has at least 75%, preferably 80%, more preferably 90% and most preferably 95% sequence identity with a corresponding consecutive stretch of about 25 to 2000, including 50 to 500 or 100 to 250, and up to 1000 or 1500, contiguous nucleotides, e.g., 40 to about 743, 60 to about 743, 125 to about 743, 250 to about 743, 400 to about 743, 600 to about 743, of any one of SEQ ID NOs: 536-579, preferably of any one of SEQ ID Nos: 536; 537; 539-542; 548; 550-553; 555-558; 560; 565-568; 571-576, 578 and 579, or the promoter orthologs thereof, which include
- the nucleotide sequence that includes the promoter region includes at least one copy of a TATA box and, for leaf-specific expression, preferably a light responsive element, e.g., SEQ ID NO:587.
- the invention provides plant promoters, including orthologs of Arabidopsis promoters corresponding to any one of SEQ ID NOs: 1-339, 477- 515, 517-526, 536-579, 693-773, e.g., SEQ ID NOs:825-875 and orthologs thereof.
- the present invention further provides a composition, an expression cassette or a recombinant vector containing the nucleic acid molecule of the invention, and host cells comprising the expression cassette or vector, e.g., comprising a plasmid.
- the present invention provides an expression cassette or a recombinant vector comprising a promoter of the invention linked to a nucleic acid segment which, when present in a plant, plant cell or plant tissue, results in transcription of the linked nucleic acid segment.
- nucleotide sequence is part of a gene which encodes a polypeptide having substantially the same structure and function as a polypeptide encoded by a gene for the reference nucleotide sequence, e.g., the nucleotide sequence comprises a promoter from a gene that is the ortholog of the gene corresponding to the reference nucleotide sequence, as well as promoter sequences that are structurally related the promoter sequences particularly exemplified herein, i.e., the substantially similar promoter sequences hybridize to the complement of the promoter sequences exemplified herein under high or very high stringency conditions.
- substantially similar thus includes nucleotide sequences wherein the sequence has been modified, for example, to optimize expression in particular cells, as well as nucleotide sequences encoding a variant polypeptide having one or more amino acid substitutions relative to the (unmodified) polypeptide encoded by the reference sequence, which substitution(s) does not alter the activity of the variant polypeptide relative to the unmodified polypeptide.
- the term “substantially similar” when used herein with respect to polypeptide means that the polypeptide has substantially the same structure and function as the reference polypeptide.
- Sequence comparisons maybe carried out using a Smith- Waterman sequence alignment algorithm (see e.g., Waterman (1995) or http ://www hto . use. edu/software/seqaln/index. html) .
- the locals program, version 1.16 is preferably used with following parameters: match: 1, mismatch penalty: 0.33, open-gap penalty: 2, extended-gap penalty: 2.
- nucleotide sequence that is "substantially similar" to a reference nucleotide sequence hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in IX SSC, 0.1% SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1% SDS at 50°C, preferably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing
- compositions, expression cassettes, e.g., recombinant vectors, and host cells comprising the nucleic acid molecule which comprises a nucleic acid segment which encodes a polypeptide which is preferentially expressed in leaves or roots (e.g., SEQ ID NOs:358-366, 441-476, 527- 529, 774, 729 and 601-692), or constitutively expressed, in either sense or antisense orientation.
- the invention provides an expression cassette or vector containing an isolated nucleic acid molecule having a nucleotide sequence that directs root-specific, constitutive, or leaf-specific transcription of a linked nucleic acid segment in a cell, which nucleotide sequence is from a gene which encodes a polypeptide having, e.g., at least 70% identity to an Arabidopsis polypeptide encoded by a gene having one of SEQ ID NOs: 1-339, 477-515, 517-526, 536-579 or 693-773, preferably one of SEQ ID NOs: 536-579, more preferably one of SEQ ID Nos: 536; 537; 539-542; 548; 550-553; 555-558; 560; 565-568; 571-576, 578 and 579, or the promoter orthologs thereof, e.g., SEQ ID NOs:825-875, and which nucleotide sequence is optionally operably linked to other suitable regulatory sequences
- This expression cassette or vector may be contained in a host cell.
- the expression cassette or vector may augment the genome of a transformed plant or may be maintained extrachromosomally.
- the expression cassette may be operatively linked to a structural gene, the open reading frame thereof, or a portion thereof.
- the expression cassette may further comprise a Ti plasmid and be contained in an Agrobacterium tumefaciens cell; it may be carried on a microparticle, wherein the microparticle is suitable for ballistic transformation of a plant cell; or it may be contained in a plant cell or protoplast.
- the expression cassette or vector can be contained in a transformed plant or cells thereof, and the plant may be a dicot or a monocot. In particular, the plant may be a cereal plant.
- the method comprises crossing a fertile transgenic plant comprising a particular nucleic acid molecule of the invention with itself or with a second plant, e.g., one lacking the particular nucleic acid molecule, to prepare the seed of a crossed fertile transgenic plant comprising the particular nucleic acid molecule.
- the seed is then planted to obtain a crossed fertile transgenic plant.
- the plant may be a monocot or a dicot.
- the plant is a cereal plant.
- the various breeding steps are characterized by well-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate progeny plants. Depending on the desired properties different breeding measures are taken.
- the relevant techniques are well known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, multiline breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
- Hybridization techniques also include the sterilization of plants to yield male or female sterile plants by mechanical, chemical or biochemical means. Cross pollination of a male sterile plant with pollen of a different line assures that the genome of the male sterile but female fertile plant will uniformly obtain properties of both parental lines.
- the present invention also provides a method to identify a nucleotide sequence that directs root-specific transcription of linked nucleic acid in the genome of a plant cell by contacting a probe of plant nucleic acid, e.g., cRNA, isolated from root as well as other tissues of a plant, with a plurality of isolated nucleic acid samples on one or more, i.e., a plurality of, solid substrates so as to form a complex between at least a portion of the probe and a nucleic acid sample(s) having sequences that are structurally related to the sequences in the probe.
- Each sample comprises one or a plurality of oligonucleotides corresponding to at least a portion of a plant gene.
- the probe and/or samples may be nucleic acid from a dicot or from a monocot.
- the present invention also provides a method to identify a nucleotide sequence that directs constitutive transcription of nucleic acid in the genome of a plant cell by contacting a probe of plant nucleic acid, e.g., cRNA, isolated from various tissues of a plant and at various developmental stages with a plurality of isolated nucleic acid samples on one or more, i.e., a plurality of, solid substrates so as to form a complex between at least a portion of the probe and a nucleic acid sample(s) having sequences that are structurally related to the sequences in the probe.
- Each sample comprises one or a plurality of oligonucleotides corresponding to at least a portion of a plant gene.
- the invention also provides a gene, the expression of which is useful to normalize the expression of other genes.
- a gene the expression of which is useful to normalize the expression of other genes.
- it is important to normalize the gene expression of the unknown to a known constitutive expressing gene.
- the expression of the gene of interest is compared to the expression of a gene whose expression does not vary with experimental treatment. This comparison is essential for accurate relative quantification because this normalization process el-iminates any remaining error that may arise from sample quality variance.
- APX3 and TRX3 ascorbate peroxidase and thioredoxin
- Probes and primer sets were prepared to measure the expression levels of these genes using quantitative PCR. Whereas the expression level of a pathogenesis related gene in infected Arabidopsis rises upon infection compared to the same gene in the noninfected control plant, the expression levels of APX3 and TRX3 remained consistent in mock and experimentally treated plants. APX3 and TRX3 gene expression levels also remained consistent between normal and cold-treated plants. These genes and their plant kingdom orthologs are useful as normalization standards for quantitative gene expression analysis in Arabidopsis, as well as other dicots and monocots.
- the present invention also provides a method to identify a nucleotide sequence that directs transcription of nucleic acid in the genome of a plant cell in leaf tissue, by contacting a probe of plant nucleic acid, e.g., cRNA, isolated from leaf as well as other tissues of a plant with a plurality of isolated nucleic acid samples on one or more, i.e., a plurality of, solid substrates, so as to form a complex between at least a portion of the probe and a nucleic acid sample(s) having sequences that are structurally related to the sequences in the probe.
- Each sample comprises one or a plurality of, oligonucleotides corresponding to at least a portion of a plant gene. Then complex formation is determined or detected to identify which samples represent genes that are expressed in leaf.
- the probe and/or samples may be nucleic acid from a dicot or from a monocot.
- compositions of the invention include plant nucleic acid molecules, and the amino acid sequences for the polypeptides or partial-length polypeptides encoded by the nucleic acid molecule which comprises an open reading frame. These sequences can be employed to alter expression of a particular gene corresponding to the open reading frame by decreasing or eliminating expression of that plant gene or by overexpressing a particular gene product.
- Methods of this embodiment of the invention include stably transforming a plant with the nucleic acid molecule which includes an open reading frame operably linked to a promoter capable of driving expression of that open reading frame (sense or antisense) in a plant cell.
- portion or fragment as it relates to a nucleic acid molecule which comprises an open reading frame or a fragment thereof encoding a partial-length polypeptide having the activity of the full length polypeptide, is meant a sequence having at least 80 nucleotides, more preferably at least 150 nucleotides, and still more preferably at least 400 nucleotides. If not employed for expressing, a "portion” or “fragment” means at least 9, preferably 12, more preferably 15, even more preferably at least 20, consecutive nucleotides, e.g., probes and primers (oligonucleotides), corresponding to the nucleotide sequence of the nucleic acid molecules of the invention.
- the method comprises introducing to a plant, plant cell, or plant tissue an expression cassette comprising a promoter linked to an open reading frame so as to yield a transformed differentiated plant, transformed cell or transformed tissue.
- Transformed cells or tissue can be regenerated to provide a transformed differentiated plant.
- the transformed differentiated plant or cells thereof preferably expresses the open reading frame in an amount that alters the amount of the gene product in the plant or cells thereof, which product is encoded by the open reading frame.
- the present invention also provides a transformed plant prepared by the method, progeny and seed thereof.
- the invention further includes a nucleotide sequence which is complementary to one (hereinafter "test" sequence) which hybridizes under stringent conditions with a nucleic acid molecule of the invention as well as RNA which is transcribed from the nucleic acid molecule.
- test sequence a nucleotide sequence which is complementary to one (hereinafter "test" sequence) which hybridizes under stringent conditions with a nucleic acid molecule of the invention as well as RNA which is transcribed from the nucleic acid molecule.
- either a denatured test or nucleic acid molecule of the invention is preferably first bound to a support and hybridization is effected for a specified period of time at a temperature of, e.g., between 55 and 70°C, in double strength citrate buffered saline (SC) containing 0.1% SDS followed by rinsing of the support at the same temperature but with a buffer having a reduced SC concentration.
- SC citrate buffered saline
- SC citrate buffered saline
- a buffer having a reduced SC concentration buffers are typically single strength SC containing 0.1% SDS, half strength SC containing 0.1% SDS and one-tenth strength SC containing 0.1% SDS.
- a computer readable medium containing one or more of the nucleotide sequences of the invention as well as methods of use for the computer readable medium are provided.
- This medium allows a nucleotide sequence corresponding to at least one of SEQ ID NOs: 1-339, 477-515, 517-526, 536-579, 693-773 or 825-875 (promoters), and 358-366, 441-476, 527- 529, 601-692 or 774-824 (open reading frames), to be used as a reference sequence to search against a database.
- nucleotide sequence is obtained from plant genomic DNA from a gene encoding a polypeptide which is substantially similar and preferably has, e.g., at least 70% amino acid sequence identity to a polypeptide encoded by an Arabidopsis gene having any one of SEQ ID NOs: 1-51, 518-526 and 536-544 (root-specific promoters) or orthologs thereof, e.g., SEQ ID Nos:825 or 843, or 693-773 (leaf-specific promoters) or a fragment thereof which directs root- or leaf-specific expression, respectively.
- these nucleotide sequences exhibit promoter activity in root or leaf tissues.
- Constructs of this embodiment invention comprise regulated transcription initiation regions associated with protein translation elongation and the compositions of this embodiment of the present invention are drawn to novel nucleotide sequences for tissue-independent, tissue-general, or constitutive plant promoters.
- tissue-independent tissue-general
- constitutive is intended expression in the cells throughout a plant at most times and in most tissues.
- other promoters classified as “constitutive” e.g., ubiquitin
- some variation in absolute levels of expression can exist among different tissues or stages.
- the present invention thus provides for isolated nucleic acid molecules comprising a plant nucleotide sequence that directs constitutive transcription of a linked nucleic acid fragment in a plant cell.
- the nucleotide sequence is obtained from plant genomic DNA from a gene encoding a polypeptide which is substantially similar and preferably has, e.g. at least 70% amino acid sequence identity to a polypeptide encoded by an Arabidopsis gene having any one of SEQ ID NOs:52-339, 477-515, 517, 545-579, 826-842, 844-875 or a fragment thereof which exhibits promoter activity in a constitutive fashion (i.e., at most times and in most tissues).
- Constitutive promoter sequences may be obtained from other plant species by using the constitutive Arabidopsis promoter sequences or corresponding genes described herein as probes to screen for homologous structural genes in other plants by hybridization under low, moderate or stringent hybridization conditions. Regions of the constitutive promoter sequences of the present invention which are conserved among species could also be used as PCR primers to amplify a segment from a species other than
- constitutive promoter sequences could be employed to identify structurally related sequences in a database using computer algorithms. These constitutive promoters are capable of driving the expression of a coding sequence in a target cell, particularly in a plant cell.
- the promoter sequences and methods disclosed herein are useful in regulating constitutive expression of any heterologous nucleotide sequence in a host plant in order to vary the phenotype of that plant. These promoters can be used with combinations of enhancer, upstream elements, and/or activating sequences from the 5' flanking regions of plant expressible structural genes.
- the upstream element can be used in combination with various plant promoter sequences.
- the promoter and upstream element are used together to obtain at least 10-fold higher expression of an introduced gene in monocot transgenic plants than is obtained with the maize ubiquitin 1 promoter.
- all of the promoters of the invention are useful to modify the phenotype of a plant. Narious changes in the phenotype of a transgenic plant are desirable, i.e., modifying the fatty acid composition in a plant, altering the amino acid content of a plant, altering a plant's pathogen defense mechanism, and the like. These results can be achieved by providing expression of heterologous products or increased expression of endogenous products in plants. Alternatively, the results can be achieved by providing for a reduction of expression of one or more endogenous products, particularly enzymes or cofactors in the plant. These changes result in an alteration in the phenotype of the transformed plant.
- genes include coding sequences and/or the regulatory sequences required for their expression.
- gene refers to a nucleic acid fragment that expresses mRNA or functional RNA, or encodes a specific protein, and which includes regulatory sequences.
- Genes also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins.
- Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.
- a chimeric gene refers to any gene that contains 1) DNA sequences, including regulatory and coding sequences, that are not found together in nature, or 2) sequences encoding parts of proteins not naturally adjoined, or 3) parts of promoters that are not naturally adjoined. Accordingly, a chimeric gene may comprise regulatory sequences and coding sequences that are derived from different sources, or comprise regulatory sequences and coding sequences derived from the same source, but arranged in a manner different from that found in nature.
- transgene refers to a gene that has been introduced into the genome by transformation and is stably maintained.
- Transgenes may include, for example, genes that are either heterologous or homologous to the genes of a particular plant to be transformed. Additionally, transgenes may comprise native genes inserted into a non-native organism, or chimeric genes.
- endogenous gene refers to a native gene in its natural location in the genome of an organism.
- a “foreign” gene refers to a gene not normally found in the host organism but that is introduced by gene transfer.
- oligonucleotide corresponding to a nucleotide sequence of the invention, e.g., for use in probing or amplification reactions, may be about 30 or fewer nucleotides in length (e.g., 9, 12, 15, 18, 20, 21 or 24, or any number between 9 and 30).
- primers are upwards of 14 nucleotides in length.
- primers 16 to 24 nucleotides in length may be preferred.
- probing can be done with entire restriction fragments of the gene disclosed herein which may be 100's or even lOOO's of nucleotides in length.
- the terms “protein,” “peptide” and “polypeptide” are used interchangeably herein.
- the nucleotide sequences of the invention can be introduced into any plant.
- the genes to be introduced can be conveniently used in expression cassettes for introduction and expression in any plant of interest.
- Such expression cassettes will comprise the transcriptional initiation region of the invention linked to a nucleotide sequence of interest.
- Preferred promoters include constitutive, tissue-specific, developmental-specific, inducible and/or viral promoters.
- Such an expression cassette is provided with a plurality of restriction sites for insertion of the gene of interest to be under the transcriptional regulation of the regulatory regions.
- the expression cassette may additionally contain selectable marker genes.
- the cassette will include in the 5 -3' direction of transcription, a transcriptional and translational initiation region, a DNA sequence of interest, and a transcriptional and translational termination region functional in plants.
- the termination region may be native with the transcriptional initiation region, may be native with the DNA sequence of interest, or may be derived from another source.
- Convenient termination regions are available from the Ti-plasmid of A. tumefaciens, such as the octopine synthase and nopaline synthase termination regions.
- Coding sequence refers to a DNA or RNA sequence that codes for a specific amino acid sequence and excludes the non-coding sequences. It may constitute an "uninterrupted coding sequence", i.e., lacking an intron, such as in a cDNA or it may include one or more introns bounded by appropriate splice junctions.
- An "intron” is a sequence of RNA which is contained in the primary transcript but which is removed through cleavage and re-ligation of the RNA within the cell to create the mature mRNA that can be translated into a protein.
- open reading frame and “ORF” refer to the amino acid sequence encoded between translation initiation and termination codons of a coding sequence.
- initiation codon and “termination codon” refer to a unit of three adjacent nucleotides ('codon') in a coding sequence that specifies initiation and chain termination, respectively, of protein synthesis (mRNA translation).
- a “functional RNA” refers to an antisense RNA, ribozyme, or other RNA that is not translated.
- RNA transcript refers to the product resulting from RNA polymerase catalyzed transcription of a DNA sequence.
- the primary transcript When the RNA transcript is a perfect complementary copy of the DNA sequence, it is referred to as the primary transcript or it may be a RNA sequence derived from posttranscriptional processing of the primary transcript and is referred to as the mature RNA.
- Messenger RNA (mRNA) refers to the RNA that is without introns and that can be translated into protein by the cell.
- cDNA refers to a single- or a double-stranded DNA that is complementary to and derived from mRNA.
- regulatory sequences each refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding sequence, and which influence the transcription, RNA processing or stability, or translation of the associated coding sequence. Regulatory sequences include enhancers, promoters, translation leader sequences, introns, and polyadenylation signal sequences. They include natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences. As is noted above, the term “suitable regulatory sequences” is not limited to promoters. "5' non-coding sequence” refers to a nucleotide sequence located 5' (upstream) to the coding sequence. It is present in the fully processed mRNA upstream of the initiation codon and may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency (Turner et al, 1995).
- 3' non-coding sequence refers to nucleotide sequences located 3' (downstream) to a coding sequence and include polyadenylation signal sequences and other sequences encoding regulatory signals capable of affecting mRNA processing or gene expression.
- the polyadenylation signal is usually characterized by affecting the addition of polyadenylic acid tracts to the 3' end of the mRNA precursor.
- the use of different 3' non-coding sequences is exemplified by Ingelbrecht et al., 1989.
- the term “translation leader sequence” refers to that DNA sequence portion of a gene between the promoter and coding sequence that is transcribed into RNA and is present in the fully processed mRNA upstream (5 * ) of the translation start codon.
- the translation leader sequence may affect processing of the primary transcript to mRNA, mRNA stability or translation efficiency.
- the term “mature” protein refers to a post-translationally processed polypeptide without its signal peptide.
- Precursor protein refers to the primary product of translation of an mRNA.
- Signal peptide refers to the amino terminal extension of a polypeptide, which is translated in conjunction with the polypeptide forming a precursor peptide and which is required for its entrance into the secretory pathway.
- signal sequence refers to a nucleotide sequence that encodes the signal peptide.
- Intracellular localization sequence refers to a nucleotide sequence that encodes an intracellular targeting signal.
- Intracellular targeting signal is an amino acid sequence that is translated in conjunction with a protein and directs it to a particular sub- cellular compartment.
- Endoplasmic reticulum (ER) stop transit signal refers to a carboxy- terminal extension of a polypeptide, which is translated in conjunction with the polypeptide and causes a protein that enters the secretory pathway to be retained in the ER.
- ER stop transit sequence refers to a nucleotide sequence that encodes the ER targeting signal.
- Other intracellular targeting sequences encode targeting signals active in seeds and/or leaves and vacuolar targeting signals.
- Promoter refers to a nucleotide sequence, usually upstream (5 to its coding sequence, which controls the expression of the coding sequence by providing the recognition for RNA polymerase and other factors required for proper transcription.
- Promoter includes a minimal promoter that is a short DNA sequence comprised of a TATA box and other sequences that serve to specify the site of transcription initiation, to which regulatory elements are added for control of expression.
- Promoter also refers to a nucleotide sequence that includes a minimal promoter plus regulatory elements that is capable of controlling the expression of a coding sequence or functional RNA. This type of promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers.
- an "enhancer” is a DNA sequence which can stimulate promoter activity and may be an innate element of the promoter or a heterologous element inserted to enhance the level or tissue specificity of a promoter. It is capable of operating in both orientations (normal or flipped), and is capable of functioning even when moved either upstream or downstream from the promoter. Both enhancers and other upstream promoter elements bind sequence-specific DNA-binding proteins that mediate their effects. Promoters may be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even be comprised of synthetic DNA segments. A promoter may also contain DNA sequences that are involved in the binding of protein factors which control the effectiveness of transcription initiation in response to physiological or developmental conditions.
- the "initiation site” is the position surrounding the first nucleotide that is part of the transcribed sequence, which is also defined as position +1. With respect to this site all other sequences of the gene and its controlling regions are numbered. Downstream sequences (i.e., further protein encoding sequences in the 3' direction) are denominated positive, while upstream sequences (mostly of the controlling regions in the 5' direction) are denominated negative.
- promoter elements particularly a TATA element, that are inactive or that have greatly reduced promoter activity in the absence of upstream activation are referred to as "minimal or core promoters.”
- minimal or core promoters In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription.
- a “minimal or core promoter” thus consists only of all basal elements needed for transcription initiation, e.g., a TATA box and/or an initiator.
- Constant expression refers to expression using a constitutive or regulated promoter.
- Consditional and regulated expression refer to expression controlled by a regulated promoter.
- Constant promoter refers to a promoter that is able to express the open reading frame (ORF) that it controls in all or nearly all of the plant tissues during all or nearly all developmental stages of the plant.
- ORF open reading frame
- Each of the transcription-activating elements do not exhibit an absolute tissue-specificity, but mediate transcriptional activation in most plant parts at a level of >1% of the level reached in the part of the plant in which transcription is most active.
- Regular promoter refers to promoters that direct gene expression not constitutively, but in a temporally- and/or spatially-regulated manner, and includes both tissue- specific and inducible promoters. It includes natural and synthetic sequences as well as sequences which may be a combination of synthetic and natural sequences. Different promoters may direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental conditions. New promoters of various types useful in plant cells are constantly being discovered, numerous examples may be found in the compilation by Okamuro et al. (1989).
- Typical regulated promoters useful in plants include but are not limited to safener-inducible promoters, promoters derived from the tetracycline-inducible system, promoters derived from salicylate-inducible systems, promoters derived from alcohol-inducible systems, promoters derived from glucocorticoid-inducible system, promoters derived from pathogen-inducible systems, and promoters derived from ecdysone-inducible systems.
- tissue-specific promoter refers to regulated promoters that are not expressed in all plant cells but only in one or more cell types in specific organs (such as leaves or seeds), specific tissues (such as embryo or cotyledon), or specific cell types (such as leaf parenchyma or seed storage cells). These also include promoters that are temporally regulated, such as in early or late embryogenesis, during fruit ripening in developing seeds or fruit, in fully differentiated leaf, or at the onset of senescence.
- “Inducible promoter” refers to those regulated promoters that can be turned on in one or more cell types by an external stimulus, such as a chemical, light, hormone, stress, or a pathogen.
- “Operably-linked” refers to the association of nucleic acid sequences on single nucleic acid fragment so that the function of one is affected by the other.
- a regulatory DNA sequence is said to be “operably linked to” or “associated with” a DNA sequence that codes for an RNA or a polypeptide if the two sequences are situated such that the regulatory DNA sequence affects expression of the coding DNA sequence (i.e., that the coding sequence or functional RNA is under the transcriptional control of the promoter). Coding sequences can be operably-linked to regulatory sequences in sense or antisense orientation.
- “Expression” refers to the transcription and/or translation of an endogenous gene, ORF or portion thereof, or a transgene in plants.
- expression may refer to the transcription of the antisense DNA only.
- expression refers to the transcription and stable accumulation of sense (mRNA) or functional RNA. Expression may also refer to the production of protein.
- Specific expression is the expression of gene products which is limited to one or a few plant tissues (spatial limitation) and/or to one or a few plant developmental stages (temporal limitation). It is acknowledged that hardly a true specificity exists: promoters seem to be preferably switch on in some tissues, while in other tissues there can be no or only little activity. This phenomenon is known as leaky expression. However, with specific expression in this invention is meant preferable expression in one or a few plant tissues.
- the "expression pattern" of a promoter is the pattern of expression levels which shows where in the plant and in what developmental stage transcription is initiated by said promoter.
- Expression patterns of a set of promoters are said to be complementary when the expression pattern of one promoter shows little overlap with the expression pattern of the other promoter.
- the level of expression of a promoter can be determined by measuring the 'steady state' concentration of a standard transcribed reporter mRNA. This measurement is indirect since the concentration of the reporter mRNA is dependent not only on its synthesis rate, but also on the rate with which the mRNA is degraded. Therefore, the steady state level is the product of synthesis rates and degradation rates.
- the rate of degradation can however be considered to proceed at a fixed rate when the transcribed sequences are identical, and thus this value can serve as a measure of synthesis rates.
- promoters are compared in this way techniques available to those skilled in the art are hybridization Sl-RNAse analysis, northern blots and competitive RT-PCR. This list of techniques in no way represents all available techniques, but rather describes commonly used procedures used to analyze transcription activity and expression levels of mRNA.
- a commonly used procedure to analyze expression patterns and levels is through determination of the 'steady state' level of protein accumulation in a cell.
- Commonly used candidates for the reporter gene known to those skilled in the art are 3-glucuronidase (GUS), chloramphenicol acetyl transferase (CAT) and proteins with fluorescent properties, such as green fluorescent protein (GFP) from Aequora victoria.
- GFP green fluorescent protein
- Detection systems can readily be created or are available which are based on, e.g., immunochemical, enzymatic, fluorescent detection and quantification. Protein levels can be determined in plant tissue extracts or in intact tissue using in situ analysis of protein expression.
- average expression is used here as the average level of expression found in all lines that do express detectable amounts of reporter gene, so leaving out of the analysis plants that do not express any detectable reporter mRNA or protein.
- Root expression level indicates the expression level found in protein extracts of complete plant roots. Likewise, leaf, and stem expression levels, are determined using whole extracts from leaves and stems. It is acknowledged however, that within each of the plant parts just described, cells with variable functions may exist, in which promoter activity may vary.
- Non-specific expression refers to constitutive expression or low level, basal ('leaky') expression in nondesired cells or tissues from a 'regulated promoter'.
- altered levels refers to the level of expression in transgenic organisms that differs from that of normal or untransformed organisms.
- “Overexpression” refers to the level of expression in transgenic cells or organisms that exceeds levels of expression in normal or untransformed (nontransgenic) cells or organisms.
- Antisense inhibition refers to the production of antisense RNA transcripts capable of suppressing the expression of protein from an endogenous gene or a transgene.
- Codon and transwitch each refer to the production of sense RNA transcripts capable of suppressing the expression of identical or substantially similar transgene or endogenous genes (U.S. Patent No. 5,231,020).
- Gene silencing refers to homology-dependent suppression of viral genes, transgenes, or endogenous nuclear genes. Gene silencing may be transcriptional, when the suppression is due to decreased transcription of the affected genes, or post-transcriptional, when the suppression is due to increased turnover (degradation) of RNA species homologous to the affected genes (English et al., 1996). Gene silencing includes virus-induced gene silencing (Ruiz et al. 1998). "Silencing suppressor” gene refers to a gene whose expression leads to counteracting gene silencing and enhanced expression of silenced genes. Silencing suppressor genes may be of plant, non-plant, or viral origin.
- heterologous D ⁇ A sequence refers to a sequence that originates from a source foreign to the particular host cell or, if from the same source, is modified from its original form.
- a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell but has been modified through, for example, the use of D ⁇ A shuffling.
- the terms also include non-naturally occurring multiple copies of a naturally occurring D ⁇ A sequence.
- the terms refer to a D ⁇ A segment that is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous D ⁇ A segments are expressed to yield exogenous polypeptides.
- a "homologous" D ⁇ A sequence is a D ⁇ A sequence that is naturally associated with a host cell into which it is introduced. "Homologous to" in the context of nucleotide sequence identity refers to the similarity between the nucleotide sequence of two nucleic acid molecules or between the amino acid sequences of two protein molecules.
- amino acid sequences that are substantially similar to a particular sequence are those wherein overall amino acid identity is at least 65% or greater to the instant sequences. Modifications that result in equivalent nucleotide or amino acid sequences are well within the routine skill in the art. Moreover, the skilled artisan recognizes that equivalent nucleotide sequences encompassed by this invention can also be defined by their ability to hybridize, under low, moderate and/or stringent conditions (e.g., 0.1X SSC, 0.1% SDS, 65°C), with the nucleotide sequences that are within the literal scope of the instant claims.
- stringent conditions e.g., 0.1X SSC, 0.1% SDS, 65°C
- Target gene refers to a gene on the replicon that expresses the desired target coding sequence, functional RNA, or protein.
- the target gene is not essential for replicon replication.
- target genes may comprise native non- viral genes inserted into a non-native organism, or chimeric genes, and will be under the control of suitable regulatory sequences.
- the regulatory sequences in the target gene may come from any source, including the virus.
- Target genes may include coding sequences that are either heterologous or homologous to the genes of a particular plant to be transformed. However, target genes do not include native viral genes.
- Transcription Stop Fragment refers to nucleotide sequences that contain one or more regulatory signals, such as polyadenylation signal sequences, capable of terminating transcription. Examples include the 3' non-regulatory regions of genes encoding nopaline synthase and the small subunit of ribulose bisphosphate carboxylase.
- Replication gene refers to a gene encoding a viral replication protein. In addition to the ORF of the replication protein, the replication gene may also contain other overlapping or non-overlapping ORF(s), as are found in viral sequences in nature. While not essential for replication, these additional ORFs may enhance replication and/or viral DNA accumulation. Examples of such additional ORFs are AC3 and AL3 in ACMN and TGMN geminiviruses, respectively.
- Chimeric transacting replication gene refers either to a replication gene in which the coding sequence of a replication protein is under the control of a regulated plant promoter other than that in the native viral replication gene, or a modified native viral replication gene, for example, in which a site specific sequence(s) is inserted in the 5' transcribed but untranslated region. Such chimeric genes also include insertion of the known sites of replication protein binding between the promoter and the transcription start site that attenuate transcription of viral replication protein gene. "Chromosomally-integrated” refers to the integration of a foreign gene or D ⁇ A construct into the host D ⁇ A by covalent bonds.
- Transient expression of a gene refers to the expression of a gene that is not integrated into the host chromosome but functions independently, either as part of an autonomously replicating plasmid or expression cassette, for example, or as part of another biological system such as a virus.
- Production tissue refers to mature, harvestable tissue consisting of non-dividing, terminally-differentiated cells. It excludes young, growing tissue consisting of germline, meristematic, and not-fully-differentiated cells.
- “Germline cells” refer to cells that are destined to be gametes and whose genetic material is heritable.
- Trans-activation refers to switching on of gene expression or replicon replication by the expression of another (regulatory) gene in trans.
- transgenic refers to the transfer of a nucleic acid fragment into the genome of a host cell, resulting in genetically stable inheritance.
- Host cells containing the transformed nucleic acid fragments are referred to as "transgenic” cells, and organisms comprising transgenic cells are referred to as "transgenic organisms".
- transgenic organisms Examples of methods of transformation of plants and plant cells include Agrobacterium-mediated transformation (De Blaere et al., 1987) and particle bombardment technology (Klein et al. 1987; U.S. Patent No. 4,945,050).
- Whole plants may be regenerated from transgenic cells by methods well known to the skilled artisan (see, for example, Fromm et al., 1990).
- Transformed,” “transgenic,” and “recombinant” refer to a host organism such as a bacterium or a plant into which a heterologous nucleic acid molecule has been introduced.
- the nucleic acid molecule can be stably integrated into the genome generally known in the art and are disclosed in Sambrook et al., 1989. See also Innis et al., 1995 and Gelfand, 1995; and Innis and Gelfand, 1999.
- Known methods of PCR include, but are not limited to, methods using paired primers, nested primers, single specific primers, degenerate primers, gene-specific primers, vector-specific primers, partially mismatched primers, and the like.
- transformed For example, “transformed,” “transformant,” and “transgenic” plants or calli have been through the transformation process and contain a foreign gene integrated into their chromosome.
- untransformed refers to normal plants that have not been through the transformation process.
- Transiently transformed refers to cells in which transgenes and foreign DNA have been introduced (for example, by such methods as Agrobacterium-mediated transformation or biolistic bombardment), but not selected for stable maintenance.
- “Stably transformed” refers to cells that have been selected and regenerated on a selection media following transformation. “Transient expression” refers to expression in cells in which a virus or a transgene is introduced by viral infection or by such methods as Agrobacterium-m.edia.ted transformation, electroporation, or biolistic bombardment, but not selected for its stable maintenance.
- Genetically stable and “heritable” refer to chromosomally-integrated genetic elements that are stably maintained in the plant and stably inherited by progeny through successive generations.
- Primary transformant and “TO generation” refer to transgenic plants that are of the same genetic generation as the tissue which was initially transformed (i.e., not having gone through meiosis and fertilization since transformation).
- Secondary transformants and the “Tl, T2, T3, etc. generations” refer to transgenic plants derived from primary transformants through one or more meiotic and fertilization cycles. They may be derived by self-fertilization of primary or secondary transformants or crosses of primary or secondary transformants with other transformed or untransformed plants.
- Wild-type refers to a virus or organism found in nature without any known mutation.
- Gene refers to the complete genetic material of an organism.
- nucleic acid refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form, composed of monomers (nucleotides) containing a sugar, phosphate and a base which is either a purine or pyrimidine. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides which have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides.
- nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., 1991; Ohtsuka et al, 1985; Rossolini et al. 1994).
- a "nucleic acid fragment" is a fraction of a given nucleic acid molecule.
- nucleotide sequence refers to a polymer of DNA or RNA which can be single- or double-stranded, optionally containing synthetic, non-natural or altered nucleotide bases capable of incorporation into DNA or RNA polymers.
- an "isolated” or “purified” DNA molecule or an “isolated” or “purified” polypeptide is a DNA molecule or polypeptide that, by the hand of man, exists apart from its native environment and is therefore not a product of nature.
- An isolated DNA molecule or polypeptide may exist in a purified form or may exist in a non-native environment such as, for example, a transgenic host cell.
- an "isolated” or “purified” nucleic acid molecule or protein, or biologically active portion thereof is substantially free of other cellular material, or culture medium when produced by recombinant techniques, or substantially free of chemical precursors or other chemicals when chemically synthesized.
- an "isolated" nucleic acid is free of sequences (preferably protein encoding sequences) that naturally flank the nucleic acid (i.e., sequences located at the 5' and 3' ends of the nucleic acid) in the genomic DNA of the organism from which the nucleic acid is derived.
- the isolated nucleic acid molecule can contain less than about 5 kb, 4 kb, 3 kb, 2 kb, 1 kb, 0.5 kb, or 0.1 kb of nucleotide sequences that naturally flank the nucleic acid molecule in genomic DNA of the cell from which the nucleic acid is derived.
- a protein that is substantially free of cellular material includes preparations of protein or polypeptide having less than about 30%, 20%, 10%, 5%, (by dry weight) of contaminating protein.
- culture medium represents less than about 30%, 20%, 10%, or 5% (by dry weight) of chemical precursors or non-protein of interest chemicals.
- nucleotide sequences of the invention include both the naturally occurring sequences as well as mutant (variant) forms. Such variants will continue to possess the desired activity, i.e., either promoter activity or the activity of the product encoded by the open reading frame of the non- variant nucleotide sequence.
- variants are intended substantially similar sequences.
- variants include those sequences that, because of the degeneracy of the genetic code, encode the identical amino acid sequence of the native protein.
- Naturally occurring allelic variants such as these can be identified with the use of well-known molecular biology techniques, as, for example, with polymerase chain reaction (PCR) and hybridization techniques.
- variant nucleotide sequences also include synthetically derived nucleotide sequences, such as those generated, for example, by using site-directed mutagenesis and for open reading frames, encode the native protein, as well as those that encode a polypeptide having amino acid substitutions relative to the native protein.
- nucleotide sequence variants of the invention will have at least 40, 50, 60, to 70%, e.g., preferably 71%), 72%, 73%, 74%, 75%, 76%, 77%, 78%, to 79%, generally at least 80%, e.g., 81%-84%, at least 85%, e.g., 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, to 98% and 99% nucleotide sequence identity to the native (wild type or endogenous) nucleotide sequence.
- Consatively modified variations of a particular nucleic acid sequence refers to those nucleic acid sequences that encode identical or essentially identical amino acid sequences, or where the nucleic acid sequence does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given polypeptide. For instance the codons CGT, CGC, CGA, CGG, AGA, and AGG all encode the amino acid arginine. Thus, at every position where an arginine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded protein.
- the nucleic acid molecules of the invention can be "optimized" for enhanced expression in plants of interest. See, for example, EPA 035472; WO 91/16432; Perlak et al., 1991; and Murray et al., 1989. In this manner, the open reading frames in genes or gene fragments can be synthesized utilizing plant-preferred codons. See, for example, Campbell and Gowri, 1990 for a discussion of host-preferred codon usage.
- the nucleotide sequences can be optimized for expression in any plant. It is recognized that all or any part of the gene sequence may be optimized or synthetic. That is, synthetic or partially optimized sequences may also be used.
- Variant nucleotide sequences and proteins also encompass sequences and protein derived from a mutagenic and recombinogenic procedure such as DNA shuffling. With such a procedure, one or more different coding sequences can be manipulated to create a new polypeptide possessing the desired properties. In this manner, libraries of recombinant polynucleotides are generated from a population of related sequence polynucleotides comprising sequence regions that have substantial sequence identity and can be homologously recombined in vitro or in vivo. Strategies for such DNA shuffling are known in the art.
- variant polypeptide is intended a polypeptide derived from the native protein by deletion (so-called truncation) or addition of one or more amino acids to the N-terminal and/or C-terminal end of the native protein; deletion or addition of one or more amino acids at one or more sites in the native protein; or substitution of one or more amino acids at one or more sites in the native protein.
- variants may result from, for example, genetic polymorphism or from human manipulation. Methods for such manipulations are generally known in the art.
- polypeptides may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art.
- amino acid sequence variants of the polypeptides can be prepared by mutations in the DNA. Methods for mutagenesis and nucleotide sequence alterations are well known in the art. See, for example, Kunkel, 1985; Kunkel et al., 1987; U. S. Patent No. 4,873,192; Walker and Gaastra, 1983 and the references cited therein.
- Guidance as to appropriate amino acid substitutions that do not affect biological activity of the protein of interest may be found in the model of Dayhoff et al. (1978). Conservative substitutions, such as exchanging one amino acid with another having similar properties, are preferred.
- “Expression cassette” as used herein means a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
- the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction.
- the expression cassette comprising the nucleotide sequence of interest may be chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
- the expression cassette may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression.
- the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus.
- the promoter can also be specific to a particular tissue or organ or stage of development.
- Vector is defined to include, inter alia, any plasmid, cosmid, phage or Agrobacterium binary vector in double or single stranded linear or circular form which may or may not be self transmissible or mobilizable, and which can transform prokaryotic or eukaryotic host either by integration into the cellular genome or exist extrachromosomally (e.g. autonomous replicating plasmid with an origin of replication).
- shuttle vectors by which is meant a DNA vehicle capable, naturally or by design, of replication in two different host organisms, which may be selected from actinomycetes and related species, bacteria and eukaryotic (e.g. higher plant, mammalian, yeast or fungal cells).
- the nucleic acid in the vector is under the control of, and operably linked to, an appropriate promoter or other regulatory elements for transcription in a host cell such as a microbial, e.g. bacterial, or plant cell.
- a host cell such as a microbial, e.g. bacterial, or plant cell.
- the vector may be a bi-functional expression vector which functions in multiple hosts. In the case of genomic DNA, this may contain its own promoter or other regulatory elements and in the case of cDNA this may be under the control of an appropriate promoter or other regulatory elements for expression in the host cell.
- Coding vectors typically contain one or a small number of restriction endonuclease recognition sites at which foreign DNA sequences can be inserted in a determinable fashion without loss of essential biological function of the vector, as well as a marker gene that is suitable for use in the identification and selection of cells transformed with the cloning vector. Marker genes typically include genes that provide tetracycline resistance, hygromycin resistance or ampicillin resistance.
- a “transgenic plant” is a plant having one or more plant cells that contain an expression vector.
- Plant tissue includes differentiated and undifferentiated tissues or plants, including but not limited to roots, stems, shoots, leaves, pollen, seeds, tumor tissue and various forms of cells and culture such as single cells, protoplast, embryos, and callus tissue.
- the plant tissue may be in plants or in organ, tissue or cell culture.
- sequence relationships between two or more nucleic acids or polynucleotides are used to describe the sequence relationships between two or more nucleic acids or polynucleotides: (a) “reference sequence”, (b) “comparison window”, (c) “sequence identity”, (d) “percentage of sequence identity”, and (e) “substantial identity”.
- reference sequence is a defined sequence used as a basis for sequence comparison.
- a reference sequence may be a subset or the entirety of a specified sequence; for example, as a segment of a full length cDNA or gene sequence, or the complete cDNA or gene sequence.
- comparison window makes reference to a contiguous and specified segment of a polynucleotide sequence, wherein the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- the comparison window is at least 20 contiguous nucleotides in length, and optionally can be 30, 40, 50, 100, or longer.
- Such implementations include, but are not limited to: CLUSTAL in the PC/Gene program (available from Intelligenetics, Mountain View, California); the ALIGN program (Version 2.0) and GAP, BESTFIT, BLAST, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Version 8 (available from Genetics Computer Group (GCG), 575 Science Drive, Madison, Wisconsin, USA). Alignments using these programs can be performed using the default parameters.
- the CLUSTAL program is well described by Higgins et al. 1988; Higgins et al. 1989; Corpet et al. 1988; Huang et al. 1992; and Pearson et al. 1994.
- the ALIGN program is based on the algorithm of Myers and Miller, supra.
- the BLAST programs of Altschul et al, 1990, are based on the algorithm of Karlin and Altschul supra.
- HSPs high scoring sequence pairs
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0).
- M forward score for a pair of matching residues
- N penalty score for mismatching residues; always ⁇ 0.
- a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when the cumulative alignment score falls off by the quantity X from its maximum achieved value, the cumulative score goes to zero or below due to the accumulation of one or more negative-scoring residue alignments, or the end of either sequence is reached.
- the BLAST algorithm In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin & Altschul (1993).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a test nucleic acid sequence is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid sequence to the reference nucleic acid sequence is less than about 0.1, more preferably less than about 0.01, and most preferably less than about 0.001.
- Gapped BLAST in BLAST 2.0
- PSI-BLAST in BLAST 2.0
- the default parameters of the respective programs e.g. BLASTN for nucleotide sequences, BLASTX for proteins
- W wordlength
- E expectation
- BLASTP program uses as defaults a wordlength (W) of 3, an expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, 1989). See http://www.ncbi.nlm.nih.gov. Alignment may also be performed manually by inspection.
- comparison of nucleotide sequences for determination of percent sequence identity to the promoter sequences disclosed herein is preferably made using the BlastN program (version 1.4.7 or later) with its default parameters or any equivalent program.
- equivalent program is intended any sequence comparison program that, for any two sequences in question, generates an alignment having identical nucleotide or amino acid residue matches and an identical percent sequence identity when compared to the corresponding alignment generated by the preferred program.
- sequence identity or “identity” in the context of two nucleic acid or polypeptide sequences makes reference to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
- percentage of sequence identity is used in reference to proteins it is recognized that residue positions which are not identical often differ by conservative amino acid substitutions, where amino acid residues are substituted for other amino acid residues with similar chemical properties (e.g., charge or hydrophobicity) and therefore do not change the functional properties of the molecule.
- sequences differ in conservative substitutions the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution.
- Sequences that differ by such conservative substitutions are said to have "sequence similarity" or "similarity.” Means for making this adjustment are well known to those of skill in the art. Typically this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non-conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is calculated, e.g., as implemented in the program PC/GENE (Intelligenetics, Mountain View, California).
- percentage of sequence identity means the value determined by comparing two optimally aligned sequences over a comparison window, wherein the portion of the polynucleotide sequence in the comparison window may comprise additions or deletions (i.e., gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. The percentage is calculated by determining the number of positions at which the identical nucleic acid base or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison, and multiplying the result by 100 to yield the percentage of sequence identity.
- polynucleotide sequences means that a polynucleotide comprises a sequence that has at least 70%, 71%, 72%, 73%), 74%, 75%, 76%, 77%, 78%, or 79%), preferably at least 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%, 91%), 92%), 93%), or 94%, and most preferably at least
- nucleotide sequences are substantially identical if two molecules hybridize to each other under stringent conditions (see below).
- stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence at a defined ionic strength and pH.
- T m thermal melting point
- stringent conditions encompass temperatures in the range of about 1°C to about 20°C, depending upon the desired degree of stringency as otherwise qualified herein.
- Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the polypeptides they encode are substantially identical. This may occur, e.g., when a copy of a nucleic acid is created using the maximum codon degeneracy permitted by the genetic code.
- nucleic acid sequences are substantially identical is when the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.
- substantially identity in the context of a peptide indicates that a peptide comprises a sequence with at least 70%, 71%, 72%, 73%, 74%), 75%, 76%), 77%, 78%, or 79%, preferably 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, or 89%, more preferably at least 90%), 91%), 92%, 93%, or 94%), or even more preferably, 95%), 96%), 97%, 98% or 99%, sequence identity to the reference sequence over a specified comparison window.
- optimal alignment is conducted using the homology alignment algorithm of
- a peptide is substantially identical to a second peptide, for example, where the two peptides differ only by a conservative substitution.
- sequence comparison typically one sequence acts as a reference sequence to which test sequences are compared.
- test and reference sequences are input into a computer, subsequence coordinates are designated if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.
- hybridizing specifically to refers to the binding, duplexing, or hybridizing of a molecule only to a particular nucleotide sequence under stringent conditions when that sequence is present in a complex mixture (e.g., total cellular) DNA or RNA.
- Bod(s) substantially refers to complementary hybridization between a probe nucleic acid and a target nucleic acid and embraces minor mismatches that can be accommodated by reducing the stringency of the hybridization media to achieve the desired detection of the target nucleic acid sequence.
- Stringent hybridization conditions and “stringent hybridization wash conditions” in the context of nucleic acid hybridization experiments such as Southern and Northern hybridization are sequence dependent, and are different under different environmental parameters.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of the target sequence hybridizes to a perfectly matched probe. Specificity is typically the function of post-hybridization washes, the critical factors being the ionic strength and temperature of the final wash solution.
- T m can be approximated from the equation of Meinkoth and Wahl, 1984; T m 81.5°C + 16.6 (log M) +0.41 (%GC) - 0.61 (% form) - 500/L; where M is the molarity of monovalent cations, %GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs.
- T m is reduced by about 1°C for each 1% of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of the desired identity.
- the T m can be decreased 10°C.
- stringent conditions are selected to be about 5°C lower than the thermal melting point I for the specific sequence and its complement at a defined ionic strength and pH.
- severely stringent conditions can utilize a hybridization and/or wash at 1, 2, 3, or 4°C lower than the thermal melting point I;
- moderately stringent conditions can utilize a hybridization and/or wash at 6, 7, 8, 9, or 10°C lower than the thermal melting point I;
- low stringency conditions can utilize a hybridization and/or wash at 11, 12, 13, 14, 15, or 20°C lower than the thermal melting point I.
- hybridization and wash compositions those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T of less than 45°C (aqueous solution) or 32°C (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used.
- An extensive guide to the hybridization of nucleic acids is found in Tijssen, 1993.
- highly stringent hybridization and wash conditions are selected to be about 5°C lower than the thermal melting point T m for the specific sequence at a defined ionic strength and pH.
- An example of highly stringent wash conditions is 0.15 M NaCl at 72°C for about 15 minutes.
- An example of stringent wash conditions is a 0.2X SSC wash at 65°C for 15 minutes (see, Sambrook, infra, for a description of SSC buffer).
- a high stringency wash is preceded by a low stringency wash to remove background probe signal.
- An example medium stringency wash for a duplex of, e.g., more than 100 nucleotides is IX SSC at 45°C for 15 minutes.
- An example low stringency wash for a duplex of, e.g., more than 100 nucleotides is 4-6X SSC at 40°C for 15 minutes.
- stringent conditions typically involve salt concentrations of less than about 1.5 M, more preferably about 0.01 to 1.0 M, Na ion concentration (or other salts) at pH 7.0 to 8.3, and the temperature is typically at least about 30°C and at least about 60°C for long robes (e.g., >50 nucleotides).
- Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide.
- a signal to noise ratio of 2X (or higher) than that observed for an unrelated probe in the particular hybridization assay indicates detection of a specific hybridization. Nucleic acids that do not hybridize to each other under stringent conditions are still substantially identical if the proteins that they encode are substantially identical.
- Very stringent conditions are selected to be equal to the T ra for a particular probe.
- An example of stringent conditions for hybridization of complementary nucleic acids which have more than 100 complementary residues on a filter in a Southern or Northern blot is 50% formamide, e.g., hybridization in 50% formamide, 1 M NaCl, 1% SDS at 37°C, and a wash in 0. IX SSC at 60 to 65°C.
- Exemplary moderate stringency conditions include hybridization in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37°C, and a wash in 0.5X to IX SSC at 55 to 60°C.
- a reference nucleotide sequence preferably hybridizes to the reference nucleotide sequence in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 2X SSC, 0.1% SDS at 50°C, more desirably in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO , 1 mM EDTA at 50°C with washing in IX SSC, 0.1% SDS at 50°C, more desirably still in 7% sodium dodecyl sulfate (SDS), 0.5 M NaPO 4 , 1 mM EDTA at 50°C with washing in 0.5X SSC, 0.1 % SDS at 50°C, preferably in 7% sodium dode
- DNA shuffling is a method to introduce mutations or rearrangements, preferably randomly, in a DNA molecule or to generate exchanges of DNA sequences between two or more DNA molecules, preferably randomly.
- the DNA molecule resulting from DNA shuffling is a shuffled DNA molecule that is a non-naturally occurring DNA molecule derived from at least one template DNA molecule.
- the shuffled DNA preferably encodes a variant polypeptide modified with respect to the polypeptide encoded by the template DNA, and may have an altered biological activity with respect to the polypeptide encoded by the template DNA.
- Plant refers to any plant, particularly to seed plant
- plant cell is a structural and physiological unit of the plant, which comprises a cell wall but may also refer to a protoplast.
- the plant cell may be in form of an isolated single cell or a cultured cell, or as a part of higher organized unit such as, for example, a plant tissue, or a plant organ.
- Signal increase is an increase that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 2-fold or greater.
- “Significantly less” means that the decrease is larger than the margin of error inherent in the measurement technique, preferably a decrease by about 2-fold or greater.
- Virtually any DNA composition may be used for delivery to recipient plant cells, e.g., monocotyledonous cells, to ultimately produce fertile transgenic plants in accordance with the present invention.
- DNA segments in the form of vectors and plasmids, or linear DNA fragments, in some instances containing only the DNA element to be expressed in the plant, and the like, may be employed.
- the construction of vectors which may be employed in conjunction with the present invention will be known to those of skill of the art in light of the present disclosure (see, e.g., Sambrook et al, 1989; Gelvin et al., 1990).
- Vectors, plasmids, cosmids, YACs (yeast artificial chromosomes), BACs (bacterial artificial chromosomes) and DNA segments for use in transforming such cells will, of course, generally comprise the cDNA, gene or genes which one desires to introduce into the cells. These DNA constructs can further include structures such as promoters, enhancers, polylinkers, or even regulatory genes as desired.
- the DNA segment or gene chosen for cellular introduction will often encode a protein which will be expressed in the resultant recombinant cells, such as will result in a screenable or selectable trait and/or which will impart an improved phenotype to the regenerated plant. However, this may not always be the case, and the present invention also encompasses transgenic plants incorporating non-expressed transgenes.
- replication- competent viral vectors in monocot transformation.
- Such vectors include, for example, wheat dwarf virus (WDV) "shuttle" vectors, such as pWl-11 and PW1-GUS (Ugaki et al., 1991). These vectors are capable of autonomous replication in maize cells as well as E. coli, and as such may provide increased sensitivity for detecting DNA delivered to transgenic cells.
- WDV wheat dwarf virus
- a replicating vector may also be useful for delivery of genes flanked by DNA sequences from transposable elements such as Ac, Ds, or Mu. It has been proposed (Laufs et al., 1990) that transposition of these elements within the maize genome requires DNA replication.
- transposable elements would be useful for introducing DNA fragments lacking elements necessary for selection and maintenance of the plasmid vector in bacteria, e.g., antibiotic resistance genes and origins of DNA replication. It is also proposed that use of a transposable element such as Ac, Ds, or Mu would actively promote integration of the desired DNA and hence increase the frequency of stably transformed cells. The use of a transposable element such as Ac, Ds, or Mu may actively promote integration of the DNA of interest and hence increase the frequency of stably transformed cells. Transposable elements may be useful to allow separation of genes of interest from elements necessary for selection and maintenance of a plasmid vector in bacteria or selection of a transformant.
- DNA useful for introduction into plant cells includes that which has been derived or isolated from any source, that may be subsequently characterized as to structure, size and/or function, chemically altered, and later introduced into plants.
- An example of DNA "derived" from a source would be a DNA sequence that is identified as a useful fragment within a given organism, and which is then chemically synthesized in essentially pure form.
- DNA isolated from a source
- a useful DNA sequence that is excised or removed from said source by chemical means, e.g., by the use of restriction endonucleases, so that it can be further manipulated, e.g., amplified, for use in the invention, by the methodology of genetic engineering.
- DNA is commonly referred to as "recombinant DNA.”
- DNA includes completely synthetic DNA, semi-synthetic DNA, DNA isolated from biological sources, and DNA derived from introduced RNA.
- the introduced DNA is not originally resident in the plant genotype which is the recipient of the DNA, but it is within the scope of the invention to isolate a gene from a given plant genotype, and to subsequently introduce multiple copies of the gene into the same genotype, e.g., to enhance production of a given gene product such as a storage protein or a protein that confers tolerance or resistance to water deficit.
- the introduced DNA includes but is not limited to, DNA from plant genes, and non- plant genes such as those from bacteria, yeasts, animals or viruses.
- the introduced DNA can include modified genes, portions of genes, or chimeric genes, including genes from the same or different maize genotype.
- the term "chimeric gene” or “chimeric DNA” is defined as a gene or DNA sequence or segment comprising at least two DNA sequences or segments from species which do not combine DNA under natural conditions, or which DNA sequences or segments are positioned or linked in a manner which does not normally occur in the native genome of untransformed plant.
- the introduced DNA used for transformation herein may be circular or linear, double- stranded or single-stranded.
- the DNA is in the form of chimeric DNA, such as plasmid DNA, that can also contain coding regions flanked by regulatory sequences which promote the expression of the recombinant DNA present in the resultant plant.
- the DNA may itself comprise or consist of a promoter that is active in a plant which is derived from a source other than that plant, or may utilize a promoter already present in a plant genotype that is the transformation target.
- the introduced DNA will be relatively small, i.e., less than about 30 kb to minimize any susceptibility to physical, chemical, or enzymatic degradation which is known to increase as the size of the DNA increases.
- the number of proteins, RNA transcripts or mixtures thereof which is introduced into the plant genome is preferably preselected and defined, e.g., from one to about 5-10 such products of the introduced DNA may be formed.
- Overexpression can be achieved by insertion of one or more than one extra copy of the selected gene. It is, however, not unknown for plants or their progeny, originally transformed with one or more than one extra copy of a nucleotide sequence, to exhibit the effects of underexpression as well as overexpression.
- underexpression there are two principle methods which are commonly referred to in the art as “antisense downregulation” and “sense downregulation” (sense downregulation is also referred to as “cosuppression”).
- gene silencing Both of these methods lead to an inhibition of expression of the target gene.
- heterologous DNA sequences in a plant host is dependent upon the presence of an operably linked promoter that is functional within the plant host. Choice of the promoter sequence will determine when and where within the organism the heterologous DNA sequence is expressed.
- promoters combining elements from more than one promoter may be useful.
- U.S. Patent No. 5,491,288 discloses combining a Cauliflower Mosaic Virus promoter with a histone promoter.
- the elements from the promoters disclosed herein may be combined with elements from other promoters.
- Promoters which are useful for plant transgene expression include those that are inducible, viral, synthetic, constitutive (Odell et al, 1985), temporally regulated, spatially regulated, tissue-specific, and spatio-temporally regulated. Where expression in specific tissues or organs is desired, tissue-specific promoters may be used. In contrast, where gene expression in response to a stimulus is desired, inducible promoters are the regulatory elements of choice. Where continuous expression is desired throughout the cells of a plant, constitutive promoters are utilized. Additional regulatory sequences upstream and/or downstream from the core promoter sequence may be included in expression constructs of transformation vectors to bring about varying levels of expression of heterologous nucleotide sequences in a transgenic plant.
- promoter will vary depending on the temporal and spatial requirements for expression, and also depending on the target species. In some cases, expression in multiple tissues is desirable. While in others, tissue-specific, e.g., leaf-specific, expression is desirable. Although many promoters from dicotyledons have been shown to be operational in monocotyledons and vice versa, ideally dicotyledonous promoters are selected for expression in dicotyledons, and monocotyledonous promoters for expression in monocotyledons. However, there is no restriction to the provenance of selected promoters; it is sufficient that they are operational in driving the expression of the nucleotide sequences in the desired cell.
- promoters include, but are not limited to, constitutive, inducible, temporally regulated, developmentally regulated, spatially-regulated, chemically regulated, stress- responsive, tissue-specific, viral and synthetic promoters.
- Promoter sequences are known to be strong or weak. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression.
- An inducible promoter is a promoter that provides for the turning on and off of gene expression in response to an exogenously added agent, or to an environmental or developmental stimulus.
- a bacterial promoter such as the P tac promoter can be induced to varying levels of gene expression depending on the level of isothiopropylgalactoside added to the transformed bacterial cells.
- An isolated promoter sequence that is a strong promoter for heterologous nucleic acid is advantageous because it provides for a sufficient level of gene expression to allow for easy detection and selection of transformed cells and provides for a high level of gene expression when desired.
- the core promoter region contains the characteristic CAAT and TATA boxes plus surrounding sequences, and represents a transcription initiation sequence that defines the transcription start point for the structural gene.
- the presence of the core promoter region defines a sequence as being a promoter: if the region is absent, the promoter is non-functional. Furthermore, the core promoter region is insufficient to provide full promoter activity.
- a series of regulatory sequences upstream of the core constitute the remainder of the promoter. The regulatory sequences determine expression level, the spatial and temporal pattern of expression and, for an important subset of promoters, expression under inductive conditions (regulation by external factors such as light, temperature, chemicals, hormones).
- a range of naturally-occurring promoters are known to be operative in plants and have been used to drive the expression of heterologous (both foreign and endogenous) genes in plants: for example, the constitutive 35S cauliflower mosaic virus (CaMV) promoter, the ripening-enhanced tomato polygalacturonase promoter (Bird et al., 1988), the E8 promoter (Diekman & Fischer, 1988) and the fruit specific 2A1 promoter (Pear et al., 1989) and many others, e.g., U2 and U5 snRNA promoters from maize, the promoter from alcohol dehydrogenase, the Z4 promoter from a gene encoding the Z4 22 kD zein protein, the Z10 promoter from a gene encoding a 10 kD zein protein, a Z27 promoter from a gene encoding a 27 kD zein protein, the A20 promoter from the gene encoding a 19
- nucleotide sequences of this invention can also be expressed under the regulation of promoters that are chemically regulated. This enables the nucleic acid sequence or encoded polypeptide to be synthesized only when the crop plants are treated with the inducing chemicals.
- Chemical induction of gene expression is detailed in EP 0 332 104 (to Ciba-Geigy) and U.S. Patent 5,614,395.
- a preferred promoter for chemical induction is the tobacco PR- la promoter.
- Examples of some constitutive promoters which have been described include the rice actin 1 (Wang et al., 1992; U.S. Patent No. 5,641,876), CaMV 35S (OdeU et al., 1985), CaMV 19S (Lawton et al., 1987), nos, Adh, sucrose synthase; and the ubiquitin promoters.
- tissue specific promoters which have been described include the lectin (Vodkin, 1983; Lindstrom et al, 1990) corn alcohol dehydrogenase 1 (Vogel et al., 1989; Dennis et al, 1984), corn light harvesting complex (Simpson, 1986; Bansal et al, 1992), corn heat shock protein (Odell et al, 1985), pea small subunit RuBP carboxylase (Poulsen et al, 1986), Ti plasmid mannopine synthase (Langridge et al, 1989), Ti plasmid nopaline synthase (Langridge et al, 1989), petunia chalcone isomerase (vanTunen et al, 1988), bean glycine rich protein 1 (Keller et al, 1989), truncated CaMV 35s (Odell et al, 1985), potato patatin (Wenzler et al, 1989), root cell (Yamamoto
- Inducible promoters that have been described include the ABA- and turgor-inducible promoters, the promoter of the auxin-binding protein gene (Schwob et al, 1993), the UDP glucose flavonoid glycosyl-transferase gene promoter (Ralston et al, 1988), the MPI proteinase inhibitor promoter (Cordero et al, 1994), and the glyceraldehyde-3-phosphate dehydrogenase gene promoter (Kohler et al, 1995; Quigley et al, 1989; Martinez et al., 1989).
- Several other tissue-specific regulated genes and/or promoters have been reported in plants.
- genes encoding the seed storage proteins such as napin, cruciferin, beta- conglycinin, and phaseolin
- zein or oil body proteins such as oleosin
- genes involved in fatty acid biosynthesis including acyl carrier protein, stearoyl-ACP desaturase. And fatty acid desaturases (fad 2-1)
- genes expressed during embryo development such as Bce4, see, for example, EP 255378 and Kridl et al, 1991.
- Particularly useful for seed-specific expression is the pea vicilin promoter (Czako et al, 1992). (See also U.S. Pat. No. 5,625,136, herein incorporated by reference.)
- Other useful promoters for expression in mature leaves are those that are switched on at the onset of senescence, such as the SAG promoter from Arabidopsis (Gan et al, 1995).
- tissue-specific promoters include those that direct expression in leaf cells following damage to the leaf (for example, from chewing insects), in tubers (for example, patatin gene promoter), and in fiber cells (an example of a developmentally-regulated fiber cell protein is E6 (John et al, 1992). The E6 gene is most active in fiber, although low levels of transcripts are found in leaf, ovule and flower.
- tissue-specificity of some "tissue-specific" promoters may not be absolute and may . be tested by one skilled in the art using the diphtheria toxin sequence.
- tissue-specific expression with "leaky” expression by a combination of different tissue-specific promoters (Beals et al, 1997).
- Other tissue-specific promoters can be isolated by one skilled in the art (see U.S. 5,589,379).
- inducible promoters (“gene switches") have been reported. Many are described in the review by Gatz (1996) and Gatz (1997).
- Regulated expression of the chimeric transacting viral replication protein can be further regulated by other genetic strategies.
- Cre-mediated gene activation as described by Odell et al 1990.
- a DNA fragment containing 3' regulatory sequence bound by lox sites between the promoter and the replication protein coding sequence that blocks the expression of a chimeric replication gene from the promoter can be removed by Cre-mediated excision and result in the expression of the trans-acting replication gene.
- the chimeric Cre gene, the chimeric trans-acting replication gene, or both can be under the control of tissue- and developmental- specific or inducible promoters.
- An alternate genetic strategy is the use of tRNA suppressor gene.
- the regulated expression of a tRNA suppressor gene can conditionally control expression of a trans-acting replication protein coding sequence containing an appropriate termination codon as described by Ulmasov et al. 1997.
- a trans-acting replication protein coding sequence containing an appropriate termination codon as described by Ulmasov et al. 1997.
- either the chimeric tRNA suppressor gene, the chimeric transacting replication gene, or both can be under the control of tissue- and developmental-specific or inducible promoters.
- RNA transcript that interferes with translation of the mRNA of the native DNA sequence.
- a DNA segment representing the promoter region is removed from the 5' region of the gene of interest and operably linked to the coding sequence of a marker (reporter) gene by recombinant DNA techniques well known to the art.
- the reporter gene is operably linked downstream of the promoter, so that transcripts initiating at the promoter proceed through the reporter gene.
- Reporter genes generally encode proteins which are easily measured, including, but not limited to, chloramphenicol acetyl transferase (CAT), beta-glucuronidase (GUS), green fluorescent protein (GFP), beta-galactosidase ( beta- GAL), and luciferase.
- the construct containing the reporter gene under the control of the promoter is then introduced into an appropriate cell type by transfection techniques well known to the art.
- cell lysates are prepared and appropriate assays, which are well known in the art, for the reporter protein are performed.
- CAT were the reporter gene of choice
- the lysates from cells transfected with constructs containing CAT under the control of a promoter under study are mixed with isotopically labeled chloramphenicol and acetyl-coenzyme A (acetyl-CoA).
- the CAT enzyme transfers the acetyl group from acetyl-CoA to the 2- or 3-position of chloramphenicol.
- the reaction is monitored by thin-layer chromatography, which separates acetylated chloramphenicol from unreacted material
- the reaction products are then visualized by autoradiography.
- the level of enzyme activity corresponds to the amount of enzyme that was made, which in turn reveals the level of expression from the promoter of interest.
- This level of expression can be compared to other promoters to determine the relative strength of the promoter under study.
- the level of the reporter mRNA can be measured directly, such as by Northern blot analysis.
- mutational and/or deletional analyses may be employed to determine the minimal region and/or sequences required to initiate transcription.
- sequences can be deleted at the 5' end of the promoter region and/or at the 3' end of the promoter region, and nucleotide substitutions introduced. These constructs are then introduced to cells and their activity determined.
- the promoter may be a gamma zein promoter, an oleosin olel ⁇ promoter, a globulinl promoter, an actin I promoter, an actin cl promoter, a sucrose synthetase promoter, an INOPS promoter, an EXM5 promoter, a globulin2 promoter, a b-32, ADPG- pyrophosphorylase promoter, an Ltpl promoter, an Ltp2 promoter, an oleosin olel7 promoter, an oleosin olel ⁇ promoter, an actin 2 promoter, a pollen-specific protein promoter, a pollen- specific pectate lyase promoter, an anther-specific protein promoter, an anther-specific gene RTS2 promoter, a pollen- specific gene promoter, a tapetum-specific gene promoter, tapetum-specific gene RAB24 promoter,
- the 3N nontranslated regulatory DNA sequence preferably includes from about 50 to about 1,000, more preferably about 100 to about 1,000, nucleotide base pairs and contains plant transcriptional and translational termination sequences.
- Appropriate transcriptional terminators and those which are known to function in plants include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, the pea rbcS E9 terminator, the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3N end of the protease inhibitor I or II genes from potato or tomato, although other 3N elements known to those of skill in the art can also be employed.
- Preferred 3' elements include those from the nopaline synthase gene of Agrobacterium tumefaciens (Bevan et al, 1983), the terminator for the T7 transcript from the octopine synthase gene of Agrobacterium tumefaciens, and the 3' end of the protease inhibitor I or II genes from potato or tomato.
- leader sequences are contemplated to include those which include sequences predicted to direct optimum expression of the attached gene, i.e., to include a preferred consensus leader sequence which may increase or maintain mRNA stability and prevent inappropriate initiation of translation.
- sequences will be known to those of skill in the art in light of the present disclosure. Sequences that are derived from genes that are highly expressed in plants will be most preferred.
- leader sequences e.g., fromAdhl, bronzel, actinl, actin 2 (WO 00/760067), or the sucrose synthase intron
- viral leader sequences e.g., from TMV, MCMV and AMV
- TMV Tobacco Mosaic Virus
- MCMV Maize Chlorotic Mottle Virus
- AMV Alfalfa Mosaic Virus
- Other leaders known in the art include but are not limited to: Picornavirus leaders, for example,
- EMCV leader (Encephalomyocarditis 5 noncoding region) (Elroy-Stein et al, 1989); Potyvirus leaders, for example, TEV leader (Tobacco Etch Virus); MDMV leader (Maize Dwarf Mosaic Virus); Human immunoglobulin heavy-chain binding protein (BiP) leader, (Macejak et al, 1991); Untranslated leader from the coat protein mRNA of alfalfa mosaic virus (AMV RNA 4), (Jobling et al, 1987; Tobacco mosaic virus leader (TMV), (Gallie et al, 1989; and Maize Chlorotic Mottle Virus leader (MCMV) (Lommel et al., 1991. See also, Della-Cioppa et al, 1987.
- TEV leader Tobacco Etch Virus
- MDMV leader Mainze Dwarf Mosaic Virus
- Human immunoglobulin heavy-chain binding protein (BiP) leader (Macejak et al,
- Adh intron 1 (Callis et al, 1987), sucrose synthase intron (Vasil et al, 1989) or TMV omega element (Gallie, et al, 1989), may further be included where desired.
- enhancers include elements from the CaMV 35S promoter, octopine synthase genes (Ellis el al, 1987), the rice actin I gene, the maize alcohol dehydrogenase gene (Callis et al, 1987), the maize shrunken I gene (Vasil et al, 1989), TMV Omega element (Gallie et al, 1989) and promoters from non-plant eukaryotes (e.g. yeast; Ma et al, 1988).
- Vectors for use in accordance with the present invention may be constructed to include the ocs enhancer element.
- This element was first identified as a 16 bp palindromic enhancer from the octopine synthase (ocs) gene of ultilane (Ellis et al, 1987), and is present in at least 10 other promoters (Bouchez et al, 1989).
- ocs octopine synthase
- the use of an enhancer element, such as the ocs element and particularly multiple copies of the element, will act to increase the level of transcription from adjacent promoters when applied in the context of monocot transformation.
- the most desirable DNA segments for introduction into for example a monocot genome may be homologous genes or gene families which encode a desired trait (e.g., increased yield per acre) and which are introduced under the control of novel promoters or enhancers, etc., or perhaps even homologous or tissue specific (e.g., root-, collar/sheath-, whorl-, stalk-, earshank-, kernel- or leaf-specific) promoters or control elements.
- a desired trait e.g., increased yield per acre
- tissue specific e.g., root-, collar/sheath-, whorl-, stalk-, earshank-, kernel- or leaf-specific
- a particular use of the present invention will be the targeting of a gene in a constitutive manner or a root-specific manner.
- insect resistant genes may be expressed specifically in the whorl and collar/sheath tissues which are targets for the first and second broods, respectively, of ECB.
- genes encoding proteins with particular activity against rootworm may be targeted directly to root tissues.
- tissue-specific promoters for use in tissue-specific targeting of genes in transgenic plants will typically include tissue-specific promoters and may also include other tissue-specific control elements such as enhancer sequences. Promoters which direct specific or enhanced expression in certain plant tissues will be known to those of skill in the art in light of the present disclosure. These include, for example, the rbcS promoter, specific for green tissue; the ocs, nos and mas promoters which have higher activity in roots or wounded leaf tissue; a truncated (-90 to +8) 35S promoter which directs enhanced expression in roots, an alpha-tubulin gene that directs expression in roots and promoters derived from zein storage protein genes which direct expression in endosperm.
- ocs octopine synthase
- Tissue specific expression may be functionally accomplished by introducing a constitutively expressed gene (all tissues) in combination with an antisense gene that is expressed only in those tissues where the gene product is not desired.
- a gene coding for the crystal toxin protein from B. thuringiensis (Bt) may be introduced such that it is expressed in all tissues using the 35S promoter from Cauliflower Mosaic Virus.
- Expression of an antisense transcript of the Bt gene in a maize kernel, using for example a zein promoter, would prevent accumulation of the Bt protein in seed.
- the protein encoded by the introduced gene would be present in all tissues except the kernel. Expression of some genes in transgenic plants will be desired only under specified conditions.
- genes that confer resistance to environmental stress factors such as drought will be desired only under actual stress conditions. It is contemplated that expression of such genes throughout a plants development may have detrimental effects. It is known that a large number of genes exist that respond to the environment. For example, expression of some genes such as rbcS, encoding the small subunit of ribulose bisphosphate carboxylase, is regulated by light as mediated through phytochrome. Other genes are induced by secondary stimuli. For example, synthesis of abscisic acid (ABA) is induced by certain environmental factors, including but not limited to water stress. A number of genes have been shown to be induced by ABA (Skriver and Mundy, 1990). It is also anticipated that expression of genes conferring resistance to insect predation would be desired only under conditions of actual insect infestation. Therefore, for some desired traits inducible expression of genes in transgenic plants will be desired.
- ABA abscisic acid
- vectors may be constructed and employed in the intracellular targeting of a specific gene product within the cells of a transgenic plant or in directing a protein to the extracellular environment. This will generally be achieved by joining a DNA sequence encoding a transit or signal peptide sequence to the coding sequence of a particular gene. The resultant transit, or signal, peptide will transport the protein to a particular intracellular, or extracellular destination, respectively, and will then be post-translationally removed.
- Transit or signal peptides act by facilitating the transport of proteins through intracellular membranes, e.g., vacuole, vesicle, plastid and mitochondrial membranes, whereas signal peptides direct proteins through the extracellular membrane.
- a particular example of such a use concerns the direction of a herbicide resistance gene, such as the EPSPS gene, to a particular organelle such as the chloroplast rather than to the cytoplasm. This is exemplified by the use of the rbcs transit peptide which confers plastid- specific targeting of proteins.
- these sequences may increase the accumulation of gene product protecting them from proteolytic degradation.
- These sequences also allow for additional mRNA sequences from highly expressed genes to be attached to the coding sequence of the genes. Since mRNA being translated by ribosomes is more stable than naked mRNA, the presence of translatable mRNA in front of the gene may increase the overall stability of the mRNA transcript from the gene and thereby increase synthesis of the gene product. Since transit and signal sequences are usually post- translationally removed from the initial translation product, the use of these sequences allows for the addition of extra translated sequences that may not appear on the final polypeptide. Targeting of certain proteins may be desirable in order to enhance the stability of the protein (U.S. Patent No. 5,545,818).
- Other elements include those that can be regulated by endogenous or exogenous agents, e.g., by zinc finger proteins, including naturally occurring zinc finger proteins or chimeric zinc finger proteins (see, e.g., U.S. Patent No. 5,789,538, WO 99/48909; WO 99/45132; WO 98/53060; WO 98/53057; WO 98/53058; WO 00/23464; WO 95/19431; and WO 98/54311) or myb-like transcription factors.
- zinc finger proteins including naturally occurring zinc finger proteins or chimeric zinc finger proteins (see, e.g., U.S. Patent No. 5,789,538, WO 99/48909; WO 99/45132; WO 98/53060; WO 98/53057; WO 98/53058; WO 00/23464; WO 95/19431; and WO 98/54311) or myb-like transcription factors.
- a chimeric zinc finger protein may include amino acid sequences which bind to a specific DNA sequence (the zinc finger) and amino acid sequences that activate (e.g., GAL 4 sequences) or repress the transcription of the sequences linked to the specific DNA sequence.
- the invention relates to an isolated plant, e.g., Arabidopsis and rice, nucleic acid molecule, which directs the expression of linked nucleic acid fragment in a plant, e.g., in root or leaf or constitutively, as well as the corresponding open reading frame and encoded product.
- the nucleic acid molecule e.g., one which comprises a promoter can be used to overexpress a linked nucleic acid fragment so as to express a product in a constitutive or tissue-specific manner, or to alter the expression of the product, e.g., via the use of antisense vectors or by "knocking out" the expression of at least one genomic copy of the gene.
- Preferred sources from which the nucleic acid molecules of the invention can be obtained or isolated include, but are not limited to, corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B. juncea), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panicum miliaceum), foxtail millet (Setaria italica), finger millet (Eleusine coracana)), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberos
- Duckweed (Lemna, see WO 00/07210) includes members of the family Lemnaceae. There are known four genera and 34 species of duckweed as follows: genus Lemna (L. aequinoctialis, L. disperma, L. ecuadoriensis, L. gibba, L. japonica, L. minor, L. miniscula, L. obscura, L. perpusilla, L. tenera, L. trisulca, L. turionifera, L. valdiviana); genus Spirodela (S. intermedia, S. polyrrhiza, S. punctata); genus Wojfia (Wa. Angusta, Wa.
- genus Lemna L. aequinoctialis, L. disperma, L. ecuadoriensis, L. gibba, L. japonica, L. minor, L. miniscula, L. obscura, L. per
- Lemna gibba, Lemna minor, and Lemna miniscula are preferred, with Lemna minor and Lemna miniscula being most preferred.
- Lemna species can be classified using the taxonomic scheme described by Landolt, Biosystematic Investigation on the Family of Duckweeds: The family of Lemnaceae - A Monograph Study. Geobotanisches Institut ETH, Stainless Rubel, Zurich (1986)).
- Vegetables from which to obtain or isolate the nucleic acid molecules of the invention include, but are not limited to, tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathy rus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- tomatoes Locopersicon esculentum
- lettuce e.g., Lactuca sativa
- green beans Phaseolus vulgaris
- lima beans Phaseolus limensis
- peas Lathy rus spp.
- members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. mel
- Ornamentals from which to obtain or isolate the nucleic acid molecules of the invention include, but are not limited to, azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tulips (Tulipa spp.), daffodils (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.
- Conifers that may be employed in practicing the present invention include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus ellioti ⁇ ), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga ultilane); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis).
- pines such as loblolly pine (Pinus taeda), slash pine (P
- Leguminous plants from which the nucleic acid molecules of the invention can be isolated or obtained include, but are not limited to, beans and peas.
- Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, and the like.
- Legumes include, but are not limited to, Arachis, e.g., peanuts, Vicia, e.g., crown vetch, hairy vetch, adzuki bean, mung bean, and chickpea, Lupinus, e.g., lupine, trifolium, Phaseolus, e.g., common bean and lima bean, Pisum, e.g., field bean, Melilotus, e.g., clover, Medicago, e.g., alfalfa, Lotus, e.g., trefoil, lens, e.g., lentil, and false indigo.
- Arachis e.g., peanuts
- Vicia e.g., crown vetch, hairy vetch, adzuki bean, mung bean, and chickpea
- Lupinus e.g., lupine, trifolium
- Phaseolus e.g., common bean and lim
- Preferred forage and turf grass from which the nucleic acid molecules of the invention can be isolated or obtained for use in the methods of the invention include, but are not limited to, alfalfa, orchard grass, tall fescue, perennial ryegrass, creeping bent grass, and redtop.
- nucleic acid molecules of the invention include Acacia, aneth, artichoke, arugula, blackberry, canola, cilantro, Clementines, escarole, eucalyptus, fennel, grapefruit, honey dew, jicama, kiwifruit, lemon, lime, mushroom, nut, okra, orange, parsley, persimmon, plantain, pomegranate, poplar, radiata pine, radicchio, Southern pine, sweetgum, tangerine, triticale, vine, yams, apple, pear, quince, cherry, apricot, melon, hemp, buckwheat, grape, raspberry, chenopodium, blueberry, nectarine, peach, plum, strawberry, watermelon, eggplant, pepper, cauliflower, Brassica, e.g., broccoli, cabbage, ultilan sprouts, onion, carrot, leek, beet, broad bean, celery
- nucleic acid molecules are ornamental plants including, but not limited to, impatiens, Begonia, Pelargonium, Viola, Cyclamen, Verbena, Vinca, Tagetes, Primula, Saint Paulia, Agertum, Amaranthus, Antihirrhinum, Aquilegia, Cineraria, Clover, Cosmo, Cowpea, Dahlia, Datura, Delphinium, Gerbera, Gladiolus, Gloxinia, Hippeastrum, Mesembryanthemum, Salpiglossos, and Zinnia, and plants such as those shown in Table 1.
- Preferred forage and turf grass nucleic acid sources for the nucleic acid molecules of the invention include, but are not limited to, alfalfa, orchard grass, tall fescue, perennial ryegrass, creeping bent grass, and redtop.
- Yet other preferred sources include, but are not limited to, crop plants and in particular cereals (for example, corn, alfalfa, sunflower, rice, Brassica, canola, soybean, barley, soybean, sugarbeet, cotton, safflower, peanut, sorghum, wheat, millet, tobacco, and the like), and even more preferably corn, rice and soybean.
- the present invention is directed to a nucleic acid molecule comprising a nucleotide sequence isolated or obtained from any plant which encodes a polypeptide having, e.g. at least 70% amino acid sequence identity to a polypeptide encoded by a gene comprising any one of SEQ ID NOs:l-339, 477-515, 517-526, 536-579, and 693- 773, preferably any one of SEQ ID NOs: 536-579, more preferably of any one of SEQ ID Nos: 536; 537; 539-542; 548; 550-553; 555-558; 560; 565-568; 571-576, 578 and 579, or the promoter orthologs thereof, e.g., SEQ ID NOs:825-875, which include the minimal promoter region.
- orthologs may be identified or isolated from the genome of any desired organism, preferably from another plant, according to well known techniques based on their sequence similarity to the Arabidopsis nucleic acid sequences, e.g., hybridization, PCR or computer generated sequence comparisons. For example, all or a portion of a particular Arabidopsis nucleic acid sequence is used as a probe that selectively hybridizes to other gene sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen source organism. Further, suitable genomic and cDNA libraries may be prepared from any cell or tissue of an organism.
- Such techniques include hybridization screening of plated DNA libraries (either plaques or colonies; see, e.g., Sambrook et al, 1989) and amplification by PCR using oligonucleotide primers preferably corresponding to sequence domains conserved among related polypeptide or subsequences of the nucleotide sequences provided herein (see, e.g., Innis et al, 1990).
- oligonucleotide primers preferably corresponding to sequence domains conserved among related polypeptide or subsequences of the nucleotide sequences provided herein (see, e.g., Innis et al, 1990).
- These methods are particularly well suited to the isolation of gene sequences from organisms closely related to the organism from which the probe sequence is derived.
- the application of these methods using the Arabidopsis sequences as probes is well suited for the isolation of gene sequences from any source organism, preferably other plant species.
- oligonucleotide primers can be designed for use in PCR reactions to amplify corresponding DNA sequences from cDNA or genomic DNA extracted from any plant of interest.
- Methods for designing PCR primers and PCR cloning are generally known in the art.
- hybridization techniques all or part of a known nucleotide sequence is used as a probe that selectively hybridizes to other corresponding nucleotide sequences present in a population of cloned genomic DNA fragments or cDNA fragments (i.e., genomic or cDNA libraries) from a chosen organism.
- the hybridization probes may be genomic DNA fragments, cDNA fragments, RNA fragments, or other oligonucleotides, and may be labeled with a detectable group such as 32 P, or any other detectable marker.
- probes for hybridization can be made by labeling synthetic oligonucleotides based on the sequence of the invention.
- sequences that hybridize to the sequences disclosed herein will have at least 40% to 50%, about 60% to 70% and even about 80% 85%, 90%), 95% to 98%) or more identity with the disclosed sequences. That is, the sequence similarity of sequences may range, sharing at least about 40% to 50%, about 60% to 70%, and even about 80%), 85%, 90%, 95% to 98% sequence similarity.
- nucleic acid molecules of the invention can also be identified by, for example, a search of known databases for genes encoding polypeptides having a specified amino acid sequence identity or DNA having a specified nucleotide sequence identity. Methods of alignment of sequences for comparison are well known in the art and are described hereins. For example, to identify orthologs of the sequences described herein, similarity searches are carried out in databases using a BLAST (see above) algorithm followed by analysis using SCAN (the Sequence Comparison Analysis, program version 1.Ok licensed from the Los Almos National Laboratories) software with added filters. A rice database is searched (Table 14) as well as a database constructed from GenBank
- GenBank database (GenBank version 123.0).
- GenBank version 123.0 The database contains all of the plant translated regions from GenBank, with the exception of Arabidopsis thaliana sequences.
- GenBank subset database retains annotation from following fields: product, function, note, as well as protein and nucleotide accession numbers and organisms.
- a promoter to, for example, potentially improve the utility of the elements for the expression of transgenes in plants.
- the mutagenesis of these elements can be carried out at random and the mutagenized promoter sequences screened for activity in a trial-by-error procedure.
- sequences which provide the promoter with desirable expression characteristics, or the promoter with expression enhancement activity could be identified and these or similar sequences introduced into the sequences via mutation. It is further contemplated that one could mutagenize these sequences in order to enhance their expression of transgenes in a particular species.
- the means for mutagenizing a DNA segment encoding a promoter sequence of the current invention are well-known to those of skill in the art. As indicated, modifications to promoter or other regulatory element may be made by random, or site-specific mutagenesis procedures. The promoter and other regulatory element may be modified by altering their structure through the addition or deletion of one or more nucleotides from the sequence which encodes the corresponding un-modified sequences.
- Mutagenesis may be performed in accordance with any of the techniques known in the art, such as, and not limited to, synthesizing an oligonucleotide having one or more mutations within the sequence of a particular regulatory region.
- site-specific mutagenesis is a technique useful in the preparation of promoter mutants, through specific mutagenesis of the underlying DNA.
- the technique further provides a ready ability to prepare and test sequence variants, for example, incorporating one or more of the foregoing considerations, by introducing one or more nucleotide sequence changes into the DNA.
- Site-specific mutagenesis allows the production of mutants through the use of specific oligonucleotide sequences which encode the DNA sequence of the desired mutation, as well as a sufficient number of adjacent nucleotides, to provide a primer sequence of sufficient size and sequence complexity to form a stable duplex on both sides of the deletion junction being traversed.
- a primer of about 17 to about 75 nucleotides or more in length is preferred, with about 10 to about 25 or more residues on both sides of the junction of the sequence being altered.
- the technique of site-specific mutagenesis is well known in the art, as exemplified by various publications.
- the technique typically employs a phage vector which exists in both a single stranded and double stranded form.
- Typical vectors useful in site-directed mutagenesis include vectors such as the Ml 3 phage. These phage are readily commercially available and their use is generally well known to those skilled in the art.
- Double stranded plasmids also are routinely employed in site directed mutagenesis which eliminates the step of transferring the gene of interest from a plasmid to a phage.
- site-directed mutagenesis in accordance herewith is performed by first obtaining a single-stranded vector or melting apart of two strands of a double stranded vector which includes within its sequence a DNA sequence which encodes the promoter.
- An oligonucleotide primer bearing the desired mutated sequence is prepared, generally synthetically. This primer is then annealed with the single-stranded vector, and subjected to DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment, in order to complete the synthesis of the mutation-bearing strand.
- DNA polymerizing enzymes such as E. coli polymerase I Klenow fragment
- This heteroduplex vector is then used to transform or transfect appropriate cells, such as E. coli cells, and cells are selected which include recombinant vectors bearing the mutated sequence arrangement.
- Vector DNA can then be isolated from these cells and used for plant transformation.
- a genetic selection scheme was devised by Kunkel et al. (1987) to enrich for clones incorporating mutagenic oligonucleotides.
- the use of PCR with commercially available thermostable enzymes such as Taq polymerase may be used to incorporate a mutagenic oligonucleotide primer into an amplified DNA fragment that can then be cloned into an appropriate cloning or expression vector.
- a PCR employing a thermostable ligase in addition to a thermostable polymerase also may be used to incorporate a phosphorylated mutagenic oligonucleotide into an amplified DNA fragment that may then be cloned into an appropriate cloning or expression vector.
- the mutagenesis procedure described by Michael (1994) provides an example of one such protocol.
- the preparation of sequence variants of the selected promoter-encoding DNA segments using site-directed mutagenesis is provided as a means of producing potentially useful species and is not meant to be limiting as there are other ways in which sequence variants of DNA sequences may be obtained. For example, recombinant vectors encoding the desired promoter sequence may be treated with mutagenic agents, such as hydroxylamine, to obtain sequence variants.
- an unmodified or modified nucleotide sequence of the present invention can be varied by shuffling the sequence of the invention.
- the sequence of interest is operably linked to a selectable or screenable marker gene and expression of the marker gene is tested in transient expression assays with protoplasts or in stably transformed plants. It is known to the skilled artisan that DNA sequences capable of driving expression of an associated nucleotide sequence are build in a modular way. Accordingly, expression levels from shorter DNA fragments may be different than the one from the longest fragment and may be different from each other.
- deletion of a down-regulating upstream element will lead to an increase in the expression levels of the associated nucleotide sequence while deletion of an up-regulating element will decrease the expression levels of the associated nucleotide sequence. It is also known to the skilled artisan that deletion of development-specific or a tissue-specific element will lead to a temporally or spatially altered expression profile of the associated nucleotide sequence.
- Embraced by the present invention are also functional equivalents of the promoters of the present invention, i.e. nucleotide sequences that hybridize under stringent conditions to any one of SEQ ID NOs: 1-339, 477-515, 517-526, 536-579, or 693-773, preferably to any one of SEQ ID NOs: 536-579, more preferably to any one of SEQ ID Nos: 536; 537; 539-542; 548; 550-553; 555-558; 560; 565-568; 571-576, 578 and 579, or the promoter orthologs thereof.
- oligonucleotide directed mutagenesis procedure refers to template- dependent processes and vector-mediated propagation which result in an increase in the concentration of a specific nucleic acid molecule relative to its initial concentration, or in an increase in the concentration of a detectable signal, such as amplification.
- oligonucleotide directed mutagenesis procedure also is intended to refer to a process that involves the template-dependent extension of a primer molecule.
- template- dependent process refers to nucleic acid synthesis of an RNA or a DNA molecule wherein the sequence of the newly synthesized strand of nucleic acid is dictated by the well- known rules of complementary base pairing (see, for example, Watson and Rarnstad, 1987).
- vector mediated methodologies involve the introduction of the nucleic acid fragment into a DNA or RNA vector, the clonal amplification of the vector, and the recovery of the amplified nucleic acid fragment. Examples of such methodologies are provided by U.S. Patent No. 4,237,224.
- a number of template dependent processes are available to amplify the target sequences of interest present in a sample, such methods being well known in the art and specifically disclosed herein below.
- a clone comprising a promoter has been isolated in accordance with the instant invention, one may wish to delimit the essential promoter regions within the clone.
- One efficient, targeted means for preparing mutagenizing promoters relies upon the identification of putative regulatory elements within the promoter sequence. This can be initiated by comparison with promoter sequences known to be expressed in similar tissue-specific or developmentally unique manner. Sequences which are shared among promoters with similar expression patterns are likely candidates for the binding of transcription factors and are thus likely elements which confer expression patterns. Confirmation of these putative regulatory elements can be achieved by deletion analysis of each putative regulatory region followed by functional analysis of each deletion construct by assay of a reporter gene which is functionally attached to each construct. As such, once a starting promoter sequence is provided, any of a number of different deletion mutants of the starting promoter could be readily prepared.
- deletion mutants, deletion mutants of the promoter of the invention also could be randomly prepared and then assayed. With this strategy, a series of constructs are prepared, each containing a different portion of the clone (a subclone), and these constructs are then screened for activity.
- a suitable means for screening for activity is to attach a deleted promoter or intron construct which contains a deleted segment to a selectable or screenable marker, and to isolate only those cells expressing the marker gene. In this way, a number of different, deleted promoter constructs are identified which still retain the desired, or even enhanced, activity. The smallest segment which is required for activity is thereby identified through comparison of the selected constructs. This segment may then be used for the construction of vectors for the expression of exogenous genes.
- a selectable or screenable marker gene as, or in addition to, the expressible gene of interest.
- Marker genes are genes that impart a distinct phenotype to cells expressing the marker gene and thus allow such transformed cells to be distinguished from cells that do not have the marker. Such genes may encode either a selectable or screenable marker, depending on whether the marker confers a trait which one can v selecf for by chemical means, i.e., through the use of a selective agent (e.g., a herbicide, antibiotic, or the like), or whether it is simply a trait that one can identify through observation or testing, i.e., by 'screening' (e.g., the R-locus trait, the green fluorescent protein (GFP)).
- a selective agent e.g., a herbicide, antibiotic, or the like
- GFP green fluorescent protein
- selectable or screenable marker genes are also genes which encode a "secretable marker” whose secretion can be detected as a means of identifying or selecting for transformed cells. Examples include markers which encode a secretable antigen that can be identified by antibody interaction, or even secretable enzymes which can be detected by their catalytic activity.
- Secretable proteins fall into a number of classes, including small, diffusible proteins detectable, e.g., by ELISA; small active enzymes detectable in extracellular solution (e.g., alpha-amylase, beta-lactamase, phosphinothricin acetyltransferase); and proteins that are inserted or trapped in the cell wall (e.g., proteins that include a leader sequence such as that found in the expression unit of extensin or tobacco PR-S).
- small, diffusible proteins detectable e.g., by ELISA
- small active enzymes detectable in extracellular solution e.g., alpha-amylase, beta-lactamase, phosphinothricin acetyltransferase
- proteins that are inserted or trapped in the cell wall e.g., proteins that include a leader sequence such as that found in the expression unit of extensin or tobacco PR-S.
- a gene that encodes a protein that becomes sequestered in the cell wall, and which protein includes a unique epitope is considered to be particularly advantageous.
- a secreted antigen marker would ideally employ an epitope sequence that would provide low background in plant tissue, a promoter- leader sequence that would impart efficient expression and targeting across the plasma membrane, and would produce protein that is bound in the cell wall and yet accessible to antibodies.
- a normally secreted wall protein modified to include a unique epitope would satisfy all such requirements.
- HPRG hydroxyproline rich glycoprotein
- the maize HPRG (Steifel et al, 1990) molecule is well characterized in terms of molecular biology, expression and protein structure.
- any one of a variety of ultilane and/or glycine-rich wall proteins could be modified by the addition of an antigenic site to create a screenable marker.
- a secretable screenable marker concerns the use of a maize sequence encoding the wall protein HPRG, modified to include a 15 residue epitope from the pro-region of murine interleukin, however, virtually any detectable epitope may be employed in such embodiments, as selected from the extremely wide variety of antigen- antibody combinations known to those of skill in the art.
- the unique extracellular epitope can then be straightforwardly detected using antibody labeling in conjunction with chromogenic or fluorescent adjuncts.
- Possible selectable markers for use in connection with the present invention include, but are not limited to, a neo gene (Potrykus et al, 1985) which codes for kanamycin resistance and can be selected for using kanamycin, G418, paromomycin, and the like; a bar gene which codes for bialaphos or phosphinothricin resistance; a gene which encodes an altered EPSP synthase protein (Hinchee et al, 1988) thus conferring glyphosate resistance; a nitrilase gene such as bxn from Klebsiella ozaenae which confers resistance to bromoxynil (Stalker et al, 1988); a mutant acetolactate synthase gene (ALS) which confers resistance to imidazolinone, sulfonylurea or other ALS -inhibiting chemicals (European Patent Application 154,204, 1985); a methotrexate-resistant DHFR gene (Thillet
- Preferred selectable marker genes encode phosphinothricin acetyltransferase; glyphosate resistant EPSPS, aminoglycoside phosphotransferase; hygromycin phosphotransferase, or neomycin phosphotransferase. Where a mutant EPSP synthase gene is employed, additional benefit may be realized through the incorporation of a suitable chloroplast transit peptide, CTP (European Patent Application 0,218,571, 1987).
- a selectable marker gene capable of being used in systems to select transformants is the genes that encode the enzyme phosphinothricin acetyltransferase, such as the bar gene from Streptomyces hygroscopicus or the pat gene from Streptomyces viridochromogenes.
- the enzyme phosphinothricin acetyl transferase (PAT) inactivates the active ingredient in the herbicide bialaphos, phosphinothricin (PPT). PPT inhibits glutamine synthetase, (Murakami et al, 1986; Twell et al, 1989) causing rapid accumulation of ammonia and cell death.
- a particularly useful gene for this purpose is the bar or pat genes obtainable from species of Streptomyces (e.g., ATCC No. 21,705).
- Streptomyces e.g., ATCC No. 21,705
- the cloning of the bar gene has been described (Murakami et al, 1986; Thompson et al, 1987) as has the use of the bar gene in the context of plants other than monocots (De Block et al, 1987; De Block et al,_1989).
- Selection markers resulting in positive selection such as a phosphomannose isomerase gene, as described in patent application WO 93/05163, may also be used.
- Alternative genes to be used for positive selection are described in WO 94/20627 and encode xyloisomerases and phosphomanno-isomerases such as mannose-6-phosphate isomerase and mannose- 1 -phosphate isomerase; phosphomanno mutase; mannose epimerases such as those which convert carbohydrates to mannose or mannose to carbohydrates such as glucose or galactose; phosphatases such as mannose or xylose phosphatase, mannose-6-phosphatase and mannose- 1 -phosphatase, and permeases which are involved in the transport of mannose, or a derivative, or a precursor thereof into the cell.
- Transformed cells are identified without damaging or killing the non-transformed cells in the population and without co-introduction of antibiotic or herbicide resistance genes.
- the positive selection method is often far more efficient than traditional negative selection.
- Screenable markers that may be employed include, but are not limited to, a beta- glucuronidase (GUS) or uidA gene which encodes an enzyme for which various chromogenic substrates are known; an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al, 1988); a beta-lactamase gene (Sutcliffe, 1978), which encodes an enzyme for which various chromogenic substrates are known (e.g., PAD AC, a chromogenic cephalosporin); ax /E gene (Zukowsky et al, 1983) which encodes a catechol dioxygenase that can convert chromogenic catechols; an ⁇ -amylase gene (Ikuta et al, 1990); a tyrosinase gene (Katz et al, 1983) which encodes an enzyme capable of oxidizing tyrosine
- Genes from the maize R gene complex are contemplated to be particularly useful as screenable markers.
- the R gene complex in maize encodes a protein that acts to regulate the production of anthocyanin pigments in most seed and plant tissue.
- a gene from the R gene complex was applied to maize transformation, because the expression of this gene in transformed cells does not harm the cells. Thus, an R gene introduced into such cells will transformed cells does not harm the cells. Thus, an R gene introduced into such cells will cause the expression of a red pigment and, if stably incorporated, can be visually scored as a red sector.
- a maize line is carries dominant " ultila for genes encoding the enzymatic intermediates in the anthocyanin biosynthetic pathway (C2, Al, A2, Bzl and Bz2), but carries a recessive allele at the R locus, transformation of any cell from that line with R will result in red pigment formation.
- Exemplary lines include Wisconsin 22 which contains the rg-Stadler allele and TR112, a K55 derivative which is r-g, b, PL Alternatively any genotype of maize can be utilized if the Cl and R alleles are introduced together.
- R gene regulatory regions may be employed in chimeric constructs in order to provide mechanisms for controlling the expression of chimeric genes. More diversity of phenotypic expression is known at the R locus than at any other locus (Coe et al, 1988). It is contemplated that regulatory regions obtained from regions 5' to the structural R gene would be valuable in directing the expression of genes, e.g., insect resistance, drought resistance, herbicide tolerance or other protein coding regions. For the purposes of the present invention, it is believed that any of the various R gene family members may be successfully employed (e.g., P, S, Lc, etc.). However, the most preferred will generally be Sn (particularly Sn:bol3).
- Sn is a dominant member of the R gene complex and is functionally similar to the R and B loci in that Sn controls the tissue specific deposition of anthocyanin pigments in certain seedling and plant cells, therefore, its phenotype is similar to R.
- a further screenable marker contemplated for use in the present invention is firefly luciferase, encoded by the lux gene.
- the presence of the lux gene in transformed cells may be detected using, for example, X-ray film, scintillation counting, fluorescent spectrophotometry, low-light video cameras, photon counting cameras or multiwell luminometry. It is also envisioned that this system may be developed for populational screening for bioluminescence, such as on tissue culture plates, or even for whole plant screening.
- a screenable marker gene such as lux or GFP
- benefit may be realized by creating a gene fusion between the screenable marker gene and a selectable marker gene, for example, a GFP-NPTII gene fusion.
- a selectable marker gene for example, a GFP-NPTII gene fusion.
- This could allow, for example, selection of transformed cells followed by screening of transgenic plants or seeds.
- Genes of interest are reflective of the commercial markets and interests of those involved in the development of the crop. Crops and markets of interest changes, and as developing nations open up world markets, new crops and technologies will also emerge. In addition, as the understanding of agronomic traits and characteristics such as yield and heterosis increase, the choice of genes for transformation will change accordingly.
- genes of interest include, for example, those genes involved in information, such as zinc fingers, those involved in communication, such as kinases, and those involved in housekeeping, such as heat shock proteins. More specific categories of transgenes, for example, include genes encoding important traits for agronomics, insect resistance, disease resistance, herbicide resistance, sterility, grain characteristics, and commercial products. Genes of interest include, generally, those involved in starch, oil, carbohydrate, or nutrient metabolism, as well as those affecting kernel size, sucrose loading, zinc finger proteins, see, e.g., U.S. Patent No.
- transgene expression level and regulation of a transgene in a plant can vary significantly from line to line. Thus, one has to test several lines to find one with the desired expression level and regulation. Once a line is identified with the desired regulation specificity of a chimeric Cre transgene, it can be crossed with lines carrying different inactive replicons or inactive transgene for activation.
- sequences which may be linked to the gene of interest which encodes a polypeptide are those which can target to a specific organelle, e.g., to the mitochondria, nucleus, or plastid, within the plant cell.
- Targeting can be achieved by providing the polypeptide with an appropriate targeting peptide sequence, such as a secretory signal peptide (for secretion or cell wall or membrane targeting, a plastid transit peptide, a chloroplast transit peptide, e.g., the chlorophyll a b binding protein, a mitochondrial target peptide, a vacuole targeting peptide, or a nuclear targeting peptide, and the like.
- a secretory signal peptide for secretion or cell wall or membrane targeting
- a plastid transit peptide for secretion or cell wall or membrane targeting
- chloroplast transit peptide e.g., the chlorophyll a b binding protein
- mitochondrial target peptide e.g
- the small subunit of ribulose bisphosphate carboxylase transit peptide, the EPSPS transit peptide or the dihydrodipicolinic acid synthase transit peptide may be used.
- Plastids are a class of plant organelles derived from proplastids and include chloroplasts, leucoplasts, aravloplasts, and chromoplasts. The plastids are major sites of biosynthesis in plants. In addition to photosynthesis in the chloroplast, plastids are also sites of lipid biosynthesis, nitrate reduction to ammonium, and starch storage. And while plastids contain their own circular genome, most of the proteins localized to the plastids are encoded by the nuclear genome and are imported into the organelle from the cytoplasm.
- Transgenes used with the present invention will often be genes that direct the expression of a particular protein or polypeptide product, but they may also be non-expressible DNA segments, e.g., transposons such as Ds that do no direct their own transposition.
- an "expressible gene” is any gene that is capable of being transcribed into RNA (e.g., mRNA, antisense RNA, etc.) or translated into a protein, expressed as a trait of interest, or the like, etc., and is not limited to selectable, screenable or non-selectable marker genes.
- the invention also contemplates that, where both an expressible gene that is not necessarily a marker gene is employed in combination with a marker gene, one may employ the separate genes on either the same or different DNA segments for transformation. In the latter case, the different vectors are delivered concurrently to recipient cells to maximize cotransformation.
- the choice of the particular DNA segments to be delivered to the recipient cells will often depend on the purpose of the transformation.
- One of the major purposes of transformation of crop plants is to add some commercially desirable, agronomicaUy important traits to the plant.
- Such traits include, but are not limited to, herbicide resistance or tolerance; insect resistance or tolerance; disease resistance or tolerance (viral, bacterial, fungal, nematode); stress tolerance and/or resistance, as exemplified by resistance or tolerance to drought, heat, chilling, freezing, excessive moisture, salt stress; oxidative stress; increased yields; food content and makeup; physical appearance; male sterility; drydown; standability; prolificacy; starch properties; oil quantity and quality; and the like.
- the present invention contemplates the transformation of a recipient cell with more than one advantageous transgene.
- Two or more transgenes can be supplied in a single transformation event using either distinct transgene-encoding vectors, or using a single vector incorporating two or more gene coding sequences.
- plasmids bearing the bar and aroA expression units in either convergent, divergent, or colinear orientation are considered to be particularly useful.
- Further preferred combinations are those of an insect resistance gene, such as a Bt gene, along with a protease inhibitor gene such as pinll, or the use of bar in combination with either of the above genes.
- any two or more transgenes of any description such as those conferring herbicide, insect, disease (viral, bacterial, fungal, nematode) or drought resistance, male sterility, drydown, standability, prolificacy, starch properties, oil quantity and quality, or those increasing yield or nutritional quality may be employed as desired.
- the bar and pat genes code for an enzyme, phosphinothricin acetyltransferase (PAT), which inactivates the herbicide phosphinothricin and prevents this compound from inhibiting glutamine synthetase enzymes.
- PAT phosphinothricin acetyltransferase
- the enzyme 5- enolpyruvylshikimate 3-phosphate synthase (EPSP Synthase) is normally inhibited by the herbicide N-(phosphonomethyl)glycine (glyphosate).
- genes are known that encode glyphosate-resistant EPSP Synthase enzymes.
- the deh gene encodes the enzyme dalapon dehalogenase and confers resistance to the herbicide dalapon.
- the bxn gene codes for a specific nitrilase enzyme that converts bromoxynil to a non-herbicidal degradation product.
- An important aspect of the present invention concerns the introduction of insect resistance-conferring genes into plants. Potential insect resistance genes which can be introduced include Bacillus thuringiensis crystal toxin genes or Bt genes (Watrud et al, 1985). Bt genes may provide resistance to lepidopteran or coleopteran pests such as European Corn Borer (ECB) and corn rootworm (CRW).
- ECB European Corn Borer
- CRW corn rootworm
- Preferred Bt toxin genes for use in such embodiments include the Cry ⁇ A(b) and Cry ⁇ A(c) genes. Endotoxin genes from other species of B. thuringiensis which affect insect growth or development may also be employed in this regard.
- Et toxin genes in plants are well-documented phenomenon, and the use of different promoters, fusion proteins, and leader sequences has not led to significant increases in Bt protein expression (Vaeck et al, 1989; Barton et al., 1987). It is therefore contemplated that the most advantageous Bt genes for use in the transformation protocols disclosed herein will be those in which the coding sequence has been modified to effect increased expression in plants, and more particularly, those in which maize preferred codons have been used. Examples of such modified Bt toxin genes include the variant Bt Cry ⁇ A(b) gene termed Iab6 (Perlak et al, 1991) and the synthetic Cry ⁇ A(c) genes termed 1800a and 1800b.
- Protease inhibitors may also provide insect resistance (Johnson et al, 1989), and will thus have utility in plant transformation.
- the use of a protease inhibitor II gene, pinll, from tomato or potato is envisioned to be particularly useful. Even more advantageous is the use of a. pinll gene in combination with a Bt toxin gene, the combined effect of which has been discovered by the present inventors to produce synergistic insecticidal activity.
- Other genes which encode inhibitors of the insects' digestive system, or those that encode enzymes or co- factors that facilitate the production of inhibitors may also be useful. This group may be exemplified by oryzacystatin and amylase inhibitors, such as those from wheat and barley.
- genes encoding lectins may confer additional or alternative insecticide properties.
- Lectins (originally termed phytohemagglutinins) are multivalent carbohydrate-binding proteins which have the ability to agglutinate red blood cells from a range of species. Lectins have been identified recently as insecticidal agents with activity against weevils, ECB and rootworm (Murdock et al, 1990; Czapla and Lang, 1990). Lectin genes contemplated to be useful include, for example, barley and wheat germ agglutinin (WGA) and rice lectins (Gatehouse et al, 1984), with WGA being preferred.
- WGA barley and wheat germ agglutinin
- rice lectins Gatehouse et al, 1984
- Genes controlling the production of large or small polypeptides active against insects when introduced into the insect pests form another aspect of the invention.
- the expression of juvenile hormone esterase directed towards specific insect pests, may also result in insecticidal activity, or perhaps cause cessation of metamorphosis (Hammock et al., 1990).
- Transgenic plants expressing genes which encode enzymes that affect the integrity of the insect cuticle form yet another aspect of the invention.
- genes include those encoding, e.g., chitinase, proteases, Upases and also genes for the production of nikkomycin, a compound that inhibits chitin synthesis, the introduction of any of which is contemplated to produce insect resistant maize plants.
- Genes that code for enzymes that facilitate the production of compounds that reduce the nutritional quaUty of the host plant to insect pests are also encompassed by the present invention. It may be possible, for instance, to confer insecticidal activity on a plant by altering its sterol composition. Sterols are obtained by insects from their diet and are used for hormone synthesis and membrane stability. Therefore alterations in plant sterol composition by expression of novel genes, e.g., those that directly promote the production of undesirable sterols or those that convert desirable sterols into undesirable forms, could have a negative effect on insect growth and/or development and hence endow the plant with insecticidal activity.
- Lipoxygenases are naturaUy occurring plant enzymes that have been shown to exhibit anti-nutritional effects on insects and to reduce the nutritional quaUty of their diet. Therefore, further embodiments of the invention concern transgenic plants with enhanced Upoxygenase activity which may be resistant to insect feeding.
- the present invention also provides methods and compositions by which to achieve qualitative or quantitative changes in plant secondary metaboUtes.
- One example concerns transforming plants to produce DIMBOA which, it is contemplated, wiU confer resistance to European corn borer, rootworm and several other maize insect pests.
- Candidate genes that are particularly considered for use in this regard include those genes at the bx locus known to be involved in the synthetic DIMBOA pathway (Dunn et al, 1981).
- the introduction of genes that can regulate the production of maysin, and genes involved in the production of dhurrin in sorghum, is also contemplated to be of use in faciUtating resistance to earworm and rootworm, respectively.
- Tripsacum dactyloides is a species of grass that is resistant to certain insects, including corn root worm. It is anticipated that genes encoding proteins that are toxic to insects or are involved in the biosynthesis of compounds toxic to insects wiU be isolated from Tripsacum and that these novel genes wiU be useful in conferring resistance to insects. It is known that the basis of insect resistance in Tripsacum is genetic, because said resistance has been transferred to Zea mays via sexual crosses (Branson and Guss, 1972). Further genes encoding proteins characterized as having potential insecticidal activity may also be used as transgenes in accordance herewith.
- Such genes include, for example, the cowpea trypsin inhibitor (CpTI; HUder et al, 1987) which may be used as a rootworm deterrent; genes encoding avermectin (CampbeU, 1989; Ikeda et al, 1987) which may prove particularly useful as a corn rootworm deterrent; ribosome inactivating protein genes; and even genes that regulate plant structures.
- Transgenic maize including anti-insect antibody genes and genes that code for enzymes that can covert a non-toxic insecticide (pro-insecticide) appUed to the outside of the plant into an insecticide inside the plant are also contemplated.
- Improvement of a plant's ability to tolerate various environmental stresses can also be effected through expression of heterologous, or overexpression of homologous genes.
- Benefits may be realized in terms of increased resistance to freezing temperatures through the introduction of an "antifreeze" protein such as that of the Winter Flounder (Cutler et al, 1989) or synthetic gene derivatives thereof.
- Improved chilling tolerance may also be conferred through increased expression of glycerol-3-phosphate acetyltransferase in chloroplasts (Murata et al, 1992; Wolter et al, 1992).
- Resistance to oxidative stress can be conferred by expression of superoxide dismutase (Gupta et al, 1993), and may be improved by glutathione reductase (Bowler et al, 1992).
- superoxide dismutase Gupta et al, 1993
- glutathione reductase Bowler et al, 1992
- Such strategies may aUow for tolerance to freezing in newly emerged fields as weU as extending later maturity higher yielding varieties to earUer relative maturity zones.
- Expression of novel genes that favorably effect plant water content, total water potential, osmotic potential, and turgor can enhance the abiUty of the plant to tolerate drought.
- the terms “drought resistance” and “drought tolerance” are used to refer to a plants increased resistance or tolerance to stress induced by a reduction in water avaUabiUty, as compared to normal circumstances, and the abiUty of the plant to function and survive in lower-water environments, and perform in a relatively superior manner.
- the expression of a gene encoding the biosynthesis of osmoticaUy-active solutes can impart protection against drought.
- DNAs encoding mannitol dehydrogenase Lee and Saier, 1982
- trehalose-6-phosphate synthase Kaasen et al, 1992.
- alanopine or propionic acid or membrane integrity (e.g., alanopine) has been documented (Loomis et al, 1989), and therefore expression of gene encoding the biosynthesis of these compounds can confer drought resistance in a manner similar to or compUmentary to mannitol.
- osmoticaUy active solutes which are not sugars include, but are not limited to, proUne and glycine-betaine (Wyn- Jones and Storey, 1981).
- proUne and glycine-betaine Wyn- Jones and Storey, 1981.
- myoinositol O-methyltransferase the enzyme myoinositol O-methyltransferase. It is contemplated that the expression of specific proteins may also increase drought tolerance.
- Three classes of Late Embryogenic Proteins have been assigned based on structural simUarities (see Dure et al, 1989).
- Type-II dehydrin- type
- HVA-1 Type-Ill LEA
- proteins induced during water stress include thiol proteases, aldolases and transmembrane transporters (Guerrero et al, 1990), which may confer various protective and/or repair-type functions during drought stress.
- the expression of a gene that effects Upid biosynthesis and hence membrane composition can also be useful in conferring drought resistance on the plant.
- genes that improve drought resistance have complementary modes of action. Thus, combinations of these genes might have additive and/or synergistic effects in improving drought resistance in plants. Many of these genes also improve freezing tolerance (or resistance); the physical stresses incurred during freezing and drought are si ⁇ lar in nature and may be mitigated in similar fashion. Benefit may be conferred via constitutive expression of these genes, but the preferred means of expressing these novel genes may be through the use of a turgor-induced promoter (such as the promoters for the turgor-induced genes described in Guerrero et al. 1990 and Shagan et al, 1993). Spatial and temporal expression patterns of these genes may enable maize to better withstand stress.
- a turgor-induced promoter such as the promoters for the turgor-induced genes described in Guerrero et al. 1990 and Shagan et al, 1993. Spatial and temporal expression patterns of these genes may enable maize to better withstand stress.
- genes that are involved with specific morphological traits that aUow for increased water extractions from drying soU would be of benefit. For example, introduction and expression of genes that alter root characteristics may enhance water uptake. Expression of genes that enhance reproductive fitness during times of stress would be of significant value. For example, expression of DNAs that improve the synchrony of poUen shed and receptiveness of the female flower parts, i.e., silks, would be of benefit. In addition, expression of genes that minimize kernel abortion during times of stress would increase the amount of grain to be harvested and hence be of value.
- cytokinin levels in monocots such as maize
- isopentenyl transferase gene with appropriate regulatory sequences can improve monocot stress resistance and yield (Gan et al, Science. 270:1986 (1995)).
- Resistance to viruses may be produced through expression of novel genes.
- expression of a viral coat protein in a transgenic plant can impart resistance to infection of the plant by that virus and perhaps other closely related viruses (Cuozzo et al, 1988, Hemenway et al, 1988, Abel et al, 1986).
- expression of antisense genes targeted at essential viral functions may impart resistance to said virus.
- an antisense gene targeted at the gene responsible for repUcation of viral nucleic acid may inhibit said repUcation and lead to resistance to the virus.
- interference with other viral functions through the use of antisense genes may also increase resistance to viruses. Further it is proposed that it may be possible to achieve resistance to viruses through other approaches, including, but not limited to the use of satellite viruses.
- Peptide antibiotics are polypeptide sequences which are inhibitory to growth of bacteria and other microorganisms.
- the classes of peptides referred to as cecropins and magainins inhibit growth of many species of bacteria and fungi. It is proposed that expression of PR proteins in plants may be useful in conferring resistance to bacterial disease.
- genes are induced foUowing pathogen attack on a host plant and have been divided into at least five classes of proteins (Bol et al, 1990). Included amongst the PR proteins are beta-1,3- glucanases, chitinases, and osmotin and other proteins that are beUeved to function in plant resistance to disease organisms. Other genes have been identified that have antifungal properties, e.g., UDA (stinging nettle lectin) and hevein (Broakgert et al., 1989; Barkai-Golan et al, 1978). It is known that certain plant diseases are caused by the production of phyto toxins.
- UDA stinging nettle lectin
- hevein Broakgert et al., 1989; Barkai-Golan et al, 1978. It is known that certain plant diseases are caused by the production of phyto toxins.
- Resistance to these diseases could be achieved through expression of a novel gene that encodes an enzyme capable of degrading or otherwise inactivating the phytotoxin.
- Expression novel genes that alter the interactions between the host plant and pathogen may be useful in reducing the abiUty the disease organism to invade the tissues of the host plant, e.g., an increase in the waxiness of the leaf cuticle or other morphological characteristics.
- Plant parasitic nematodes are a cause of disease in many plants. It is proposed that it would be possible to make the plant resistant to these organisms through the expression of novel genes.
- mycotoxins including aflatoxin and fumonisin
- fungi associated with plants are a significant factor in rendering the grain not useful.
- These fungal organisms do not cause disease symptoms and/or interfere with the growth of the plant, but they produce chemicals (mycotoxins) that are toxic to animals. Inhibition of the growth of these fungi would reduce the synthesis of these toxic substances and, therefore, reduce grain losses due to mycotoxin contamination.
- Novel genes may be introduced into plants that would inhibit synthesis of the mycotoxin without interfering with fungal growth. Expression of a novel gene which encodes an enzyme capable of rendering the mycotoxin nontoxic would be useful in order to achieve reduced mycotoxin contamination of grain. The result of any of the above mechanisms would be a reduced presence of mycotoxins on grain.
- Genes may be introduced into plants, particularly commercially important cereals such as maize, wheat or rice, to improve the grain for which the cereal is primarUy grown.
- a wide range of novel transgenic plants produced in this manner may be envisioned depending on the particular end use of the grain.
- the largest use of maize grain is for feed or food.
- Introduction of genes that alter the composition of the grain may greatly enhance the feed or food value.
- the primary components of maize grain are starch, protein, and oU. Each of these primary components of maize grain may be improved by altering its level or composition. Several examples may be mentioned for lustrative purposes but in no way provide an exhaustive Ust of possibiUties.
- the protein of many cereal grains is suboptimal for feed and food purposes especiaUy when fed to pigs, poultry, and humans.
- the protein is deficient in several amino acids that are essential in the diet of these species, requiring the addition of supplements to the grain.
- Limiting essential amino acids may include lysine, methionine, tryptophan, threonine, valine, arginine, and histidine.
- Some amino acids become Umiting only after the grain is supplemented with other inputs for feed formulations. For example, when the grain is supplemented with soybean meal to meet lysine requirements, methionine becomes Umiting.
- the levels of these essential amino acids in seeds and grain may be elevated by mechanisms which include, but are not limited to, the introduction of genes to increase the biosynthesis of the amino acids, decrease the degradation of the amino acids, increase the storage of the amino acids in proteins, or increase transport of the amino acids to the seeds or grain.
- One mechanism for increasing the biosynthesis of the amino acids is to introduce genes that deregulate the amino acid biosynthetic pathways such that the plant can no longer adequately control the levels that are produced. This may be done by deregulating or bypassing steps in the amino acid biosynthetic pathway which are normaUy regulated by levels of the amino acid end product of the pathway. Examples include the introduction of genes that encode deregulated versions of the enzymes aspartokinase or dihydrodipicoUnic acid (DHDP)- synthase for increasing lysine and threonine production, and anthranUate synthase for increasing tryptophan production.
- DHDP dihydrodipicoUnic acid
- Reduction of the cataboUsm of the amino acids may be accomplished by introduction of DNA sequences that reduce or eUminate the expression of genes encoding enzymes that catalyse steps in the cataboUc pathways such as the enzyme lysine-ketoglutarate reductase.
- the protein composition of the grain may be altered to improve the balance of amino acids in a variety of ways including elevating expression of native proteins, decreasing expression of those with poor composition, changing the composition of native proteins, or introducing genes encoding entirely new proteins possessing superior composition.
- DNA may be introduced that decreases the expression of members of the zein fam y of storage proteins. This DNA may encode ribozymes or antisense sequences directed to impairing expression of zein proteins or expression of regulators of zein expression such as the opaque-2 gene product.
- the protein composition of the grain may be modified through the phenomenon of cosuppression, i.e., inhibition of expression of an endogenous gene through the expression of an identical structural gene or gene fragment introduced through transformation (Goring et al, 1991).
- the introduced DNA may encode enzymes which degrade seines.
- the decreases in zein expression that are achieved may be accompanied by increases in proteins with more desirable amino acid composition or increases in other major seed constituents such as starch.
- a chimeric gene may be introduced that comprises a coding sequence for a native protein of adequate amino acid composition such as for one of the globulin proteins or 10 kD zein of maize and a promoter or other regulatory sequence designed to elevate expression of said protein.
- the coding sequence of said gene may include additional or replacement codons for essential amino acids.
- a coding sequence obtained from another species, or, a partiaUy or completely synthetic sequence encoding a completely unique peptide sequence designed to enhance the amino acid composition of the seed may be employed.
- genes that alter the oil content of the grain may be of value. Increases in oU content may result in increases in metabolizable energy content and density of the seeds for uses in feed and food.
- the introduced genes may encode enzymes that remove or reduce rate-limitations or regulated steps in fatty acid or Upid biosynthesis. Such genes may include, but are not limited to, those that encode acetyl-CoA carboxylase, ACP- acyltransferase, beta-ketoacyl-ACP synthase, plus other weU known fatty acid biosynthetic activities.
- Other possibiUties are genes that encode proteins that do not possess enzymatic activity such as acyl carrier protein.
- Additional examples include 2-acetyltransferase, oleosin pyruvate dehydrogenase complex, acetyl Co A synthetase, ATP citrate lyase, ADP-glucose pyrophosphorylase and genes of the caraitine-CoA- acetyl-CoA shuttles. It is anticipated that expression of genes related to oU biosynthesis wiU be targeted to the plastid, using a plastid transit peptide sequence and preferably expressed in the seed embryo. Genes may be introduced that alter the balance of fatty acids present in the oU providing a more healthful or nutritive feedstuff. The introduced DNA may also encode sequences that block expression of enzymes involved in fatty acid biosynthesis, altering the proportions of fatty acids present in the grain such as described below.
- Genes may be introduced that enhance the nutritive value of the starch component of the grain, for example by increasing the degree of branching, resulting in improved utilization of the starch in cows by delaying its metaboUsm.
- genes may be introduced that affect a variety of other nutritive, processing, or other quaUty aspects of the grain as used for feed or food.
- pigmentation of the grain may be increased or decreased.
- Enhancement and stabiUty of yeUow pigmentation is desirable in some animal feeds and may be achieved by introduction of genes that result in enhanced production of xanthophyUs and carotenes by eliminating rate-limiting steps in their production.
- genes may encode altered forms of the enzymes phytoene synthase, phytoene desaturase, or lycopene synthase.
- unpigmented white corn is desirable for production of many food products and may be produced by the introduction of DNA which blocks or eliminates steps in pigment production pathways.
- Feed or food comprising some cereal grains possesses insufficient quantities of vitamins and must be supplemented to provide adequate nutritive value.
- Introduction of genes that enhance vitamin biosynthesis in seeds may be envisioned including, for example, vitamins A, E, B ⁇ 2 , choline, and the like.
- maize grain also does not possess sufficient mineral content for optimal nutritive value. Genes that affect the accumulation or avaUabiUty of compounds containing phosphorus, sulfur, calcium, manganese, zinc, and iron among others would be valuable.
- An example may be the introduction of a gene that reduced phytic acid production or encoded the enzyme phytase which enhances phytic acid breakdown. These genes would increase levels of avaUable phosphate in the diet, reducing the need for supplementation with mineral phosphate.
- Numerous other examples of improvement of cereals for feed and food purposes might be described. The improvements may not even necessarUy involve the grain, but may, for example, improve the value of the grain for silage. Introduction of DNA to accompUsh this might include sequences that alter Ugnin production such as those that result in the "brown midrib" phenotype associated with superior feed value for cattle.
- genes may also be introduced which improve the processing of grain and improve the value of the products resulting from the processing.
- the primary method of processing certain grains such as maize is via wetmilUng.
- Maize may be improved though the expression of novel genes that increase the efficiency and reduce the cost of processing such as by decreasing steeping time.
- Improving the value of wetmilUng products may include altering the quantity or quaUty of starch, oU, corn gluten meal, or the components of corn gluten feed. Elevation of starch may be achieved through the identification and elimination of rate Umiting steps in starch biosynthesis or by decreasing levels of the other components of the grain resulting in proportional increases in starch.
- An example of the former may be the introduction of genes encoding ADP-glucose pyrophosphorylase enzymes with altered regulatory activity or which are expressed at higher level.
- Examples of the latter may include selective inhibitors of, for example, protein or oil biosynthesis expressed during later stages of kernel development.
- the properties of starch may be beneficiaUy altered by changing the ratio of amylose to amylopectin, the size of the starch molecules, or their branching pattern. Through these changes a broad range of properties may be modified which include, but are not Umited to, changes in gelatinization temperature, heat of gelatinization, clarity of films and pastes, Theological properties, and the like. To accompUsh these changes in properties, genes that encode granule-bound or soluble starch synthase activity or branching enzyme activity may be introduced alone or combination. DNA such as antisense constructs may also be used to decrease levels of endogenous activity of these enzymes.
- the introduced genes or constructs may possess regulatory sequences that time their expression to specific intervals in starch biosynthesis and starch granule development. Furthermore, it may be advisable to introduce and express genes that result in the in vivo derivatization, or other modification, of the glucose moieties of the starch molecule.
- the covalent attachment of any molecule may be envisioned, Umited only by the existence of enzymes that catalyze the derivatizations and the accessibiUty of appropriate substrates in the starch granule.
- important derivations may include the addition of functional groups such as amines, carboxyls, or phosphate groups which provide sites for subsequent in vitro derivatizations or affect starch properties through the introduction of ionic charges. Examples of other modifications may include direct changes of the glucose units such as loss of hydroxyl groups or their oxidation to aldehyde or carboxyl groups.
- OU is another product of wetmilUng of corn and other grains, the value of which may be improved by introduction and expression of genes.
- the quantity of oil that can be extracted by wetmilling may be elevated by approaches as described for feed and food above.
- OU properties may also be altered to improve its performance in the production and use of cooking oil, shortenings, lubricants or other oil-derived products or improvement of its health attributes when used in the food-related appUcations.
- Novel fatty acids may also be synthesized which upon extraction can serve as starting materials for chemical syntheses.
- the changes in oU properties may be achieved by altering the type, level, or Upid arrangement of the fatty acids present in the oU.
- DNA sequences may be introduced which slow or block steps in fatty acid biosynthesis resulting in the increase in precursor fatty acid intermediates.
- Genes that might be added include desaturases, epoxidases, hydratases, dehydratases, and other enzymes that catalyze reactions involving fatty acid intermediates.
- Representative examples of catalytic steps that might be blocked include the desaturations from stearic to oleic acid and oleic to Unolenic acid resulting in the respective accumulations of stearic and oleic acids.
- Improvements in the other major cereal wetmilUng products, gluten meal and gluten feed may also be achieved by the introduction of genes to obtain novel plants.
- Representative possibihties include but are not limited to those described above for improvement of food and feed value.
- the plant be used for the production or manufacturing of useful biological compounds that were either not produced at aU, or not produced at the same level, in the plant previously.
- the novel plants producing these compounds are made possible by the introduction and expression of genes by transformation methods.
- the possibilities include, but are not limited to, any biological compound which is presently produced by any organism such as proteins, nucleic acids, primary and intermediary metaboUtes, carbohydrate polymers, etc.
- the compounds may be produced by the plant, extracted upon harvest and/or processing, and used for any presently recognized useful purpose such as pharmaceuticals, fragrances, industrial enzymes to name a few.
- Further possibihties to exemplify the range of grain traits or properties potentiaUy encoded by introduced genes in transgenic plants include grain with less breakage susceptibiUty for export purposes or larger grit size when processed by dry milling through introduction of genes that enhance gamma-zein synthesis, popcorn with improved popping quaUty and expansion volume through genes that increase pericarp thickness, corn with whiter grain for food uses though introduction of genes that effectively block expression of enzymes involved in pigment production pathways, and improved quaUty of alcohoUc beverages or sweet corn through introduction of genes which affect flavor such as the shrunken gene (encoding sucrose synthase) for sweet corn.
- shrunken gene encoding sucrose synthase
- Two of the factors determining where plants can be grown are the average daUy temperature during the growing season and the length of time between frosts.
- the plant to be grown in a particular area is selected for its abiUty to mature and dry down to harvestable moisture content within the required period of time with maximum possible yield. Therefore, plant of varying maturities are developed for different growing locations. Apart from the need to dry down sufficiently to permit harvest is the desirabiUty of having maximal drying take place in the field to minimize the amount of energy required for additional drying post-harvest.
- genes that influence maturity and/or dry down can be identified and introduced into plant lines using transformation techniques to create new varieties adapted to different growing locations or the same growing location but having improved yield to moisture ratio at harvest.
- Expression of genes that are involved in regulation of plant development may be especiaUy useful, e.g., the Uguleless and rough sheath genes that have been identified in plants.
- Genes may be introduced into plants that would improve standabiUty and other plant growth characteristics. For example, expression of novel genes which confer stronger stalks, improved root systems, or prevent or reduce ear droppage would be of great value to the corn farmer. Introduction and expression of genes that increase the total amount of photoassim ate avaUable by, for example, increasing Ught distribution and/or interception would be advantageous. In addition the expression of genes that increase the efficiency of photosynthesis and/or the leaf canopy would further increase gains in productivity. Such approaches would aUow for increased plant populations in the field.
- the abiUty to utilize avaUable nutrients and minerals may be a limiting factor in growth of many plants. It is proposed that it would be possible to alter nutrient uptake, tolerate pH extremes, mobilization through the plant, storage pools, and avaUabiUty for metaboUc activities by the introduction of novel genes. These modifications would aUow a plant to more efficiently utilize avaUable nutrients. It is contemplated that an increase in the activity of, for example, an enzyme that is normaUy present in the plant and involved in nutrient utilization would increase the avaUabiUty of a nutrient. An example of such an enzyme would be phytase. It is also contemplated that expression of a novel gene may make a nutrient source avaUable that was previously not accessible, e.g., an enzyme that releases a component of nutrient value from a more complex molecule, perhaps a macromolecule.
- male sterihty is useful in the production of hybrid seed. It is proposed that male sterUity may be produced through expression of novel genes. For example, it has been shown that expression of genes that encode proteins that interfere with development of the male inflorescence and/or gametophyte result in male ster ity. Chimeric ribonuclease genes that express in the anthers of transgenic tobacco and oUseed rape have been demonstrated to lead to male sterUity (Mariani et al, 1990).
- T cytoplasm a mutation in particular, referred to as T cytoplasm
- a DNA sequence, designated TURF-13 (Levings, 1990) was identified that correlates with T cytoplasm. It would be possible through the introduction of TURF-13 via transformation to separate male sterUity from disease sensitivity. As it is necessary to be able to restore male fertiUty for breeding purposes and for grain production, it is proposed that genes encoding restoration of male fertiUty may also be introduced.
- genes encoding traits that can be selected against may be useful for eliminating undesirable Unked genes.
- the genes wiU be linked together on the host chromosome.
- a gene encoding a Bt gene that confers insect resistance on the plant may be introduced into a plant together with a bar gene that is useful as a selectable marker and confers resistance to the herbicide Ignite® on the plant.
- a bar gene that is useful as a selectable marker and confers resistance to the herbicide Ignite® on the plant may not be desirable to have an insect resistant plant that is also resistant to the herbicide Ignite®. It is proposed that one could also introduce an antisense bar gene that is expressed in those tissues where one does not want expression of the bar gene, e.g., in whole plant parts.
- the bar antisense gene is a negative selectable marker. Negative selection is necessary in order to screen a population of transformants for rare homologous recombinants generated through gene targeting. For example, a homologous recombinant may be identified through the inactivation of a gene that was previously expressed in that ceU.
- the antisense gene to neomycin phosphotransferase II (nptll) has been investigated as a negative selectable marker in tobacco (Nicotiana tabacum) and Arabidopsis thaliana (Xiang and Guerra, 1993).
- both sense and antisense nptll genes are introduced into a plant through transformation and the resultant plants are sensitive to the antibiotic kanamycin.
- An introduced gene that integrates into the host ceU chromosome at the site of the antisense nptll gene, and inactivates the antisense gene, wiU make the plant resistant to kanamycin and other aminoglycoside antibiotics. Therefore, rare site specific recombinants may be identified by screening for antibiotic resistance.
- any gene, native to the plant or introduced through transformation, that when inactivated confers resistance to a compound may be useful as a negative selectable marker.
- negative selectable markers may also be useful in other ways.
- One appUcation is to construct transgenic lines in which one could select for transposition to unlinked sites. In the process of tagging it is most common for the transposable element to move to a geneticaUy Unked site on the same chromosome.
- a selectable marker for recovery of rare plants in which transposition has occurred to an unUnked locus would be useful.
- the enzyme cytosine deaminase may be useful for this purpose (Stouggard, 1993). In the presence of this enzyme the compound 5-fluorocytosine is converted to 5-fluoruracU which is toxic to plant and annual ceUs.
- transposable element is Unked to the gene for the enzyme cytosine deaminase
- one may select for transposition to unlinked sites by selecting for transposition events in which the resultant plant is now resistant to 5-fluorocytosine.
- the parental plants and plants containing transpositions to Unked sites wUl remain sensitive to 5- fluorocytosine.
- Resistance to 5-fluorocytosine is due to loss of the cytosine deaminase gene through genetic segregation of the transposable element and the cytosine deaminase gene.
- Other genes that encode proteins that render the plant sensitive to a certain compound wiU also be useful in this context.
- T-DNA gene 2 from Agrobacterium tumefaciens encodes a protein that catalyzes the conversion of alpha-naphthalene acetamide (NAM) to alpha-napthalene acetic acid (NAA) renders plant ceUs sensitive to high concentrations of NAM (Depicker et al, 1988).
- NAM alpha-naphthalene acetamide
- NAA alpha-napthalene acetic acid
- negative selectable markers may be useful in the construction of transposon tagging lines. For example, by marking an autonomous transposable element such as Ac, Master Mu, or En/Spn with a negative selectable marker, one could select for transformants in which the autonomous element is not stably integrated into the genome.
- RNA may be introduced into plants for the purpose of expressing RNA transcripts that function to affect plant phenotype yet are not translated into protein. Two examples are antisense RNA and RNA with ribozyme activity. Both may serve possible functions in reducing or eliminating expression of native or introduced plant genes.
- Genes may be constructed or isolated, which when transcribed, produce antisense RNA that is complementary to aU or part(s) of a targeted messenger RNA(s).
- the antisense RNA reduces production of the polypeptide product of the messenger RNA.
- the polypeptide product may be any protein encoded by the plant genome.
- the aforementioned genes wiU be referred to as antisense genes.
- An antisense gene may thus be introduced into a plant by transformation methods to produce a novel transgenic plant with reduced expression of a selected protein of interest.
- the protein may be an enzyme that catalyzes a reaction in the plant.
- Reduction of the enzyme activity may reduce or eUminate products of the reaction which include any enzymaticaUy synthesized compound in the plant such as fatty acids, amino acids, carbohydrates, nucleic acids and the Uke.
- the protein may be a storage protein, such as a zein, or a structural protein, the decreased expression of which may lead to changes in seed amino acid composition or plant morphological changes respectively.
- the possibUities cited above are provided only by way of example and do not represent the fuU range of appUcations.
- Genes may also be constructed or isolated, which when transcribed produce RNA enzymes, or ribozymes, which can act as endoribonucleases and catalyze the cleavage of RNA molecules with selected sequences.
- the cleavage of selected messenger RNA's can result in the reduced production of their encoded polypeptide products.
- These genes may be used to prepare novel transgenic plants which possess them.
- the transgenic plants may possess reduced levels of polypeptides including but not Umited to the polypeptides cited above that may be affected by antisense RNA.
- genes may be introduced to produce novel transgenic plants which have reduced expression of a native gene product by a mechanism of cosuppression. It has been demonstrated in tobacco, tomato, and petunia (Goring et al, 1991; Smith et al, 1990; NapoU et al, 1990; van der Krol et al, 1990) that expression of the sense transcript of a native gene wiU reduce or eUminate expression of the native gene in a manner simUar to that observed for antisense genes.
- the introduced gene may encode aU or part of the targeted native protein but its translation may not be required for reduction of levels of that native protein.
- DNA elements including those of transposable elements such as Ds, Ac, or Mu, may be inserted into a gene and cause mutations. These DNA elements may be inserted in order to inactivate (or activate) a gene and thereby "tag" a particular trait. In this instance the transposable element does not cause instabiUty of the tagged mutation, because the utility of the element does not depend on its abiUty to move in the genome.
- the introduced DNA sequence may be used to clone the corresponding gene, e.g., using the introduced DNA sequence as a PCR primer together with PCR gene cloning techniques (Shapiro, 1983; DeUaporta et al, 1988).
- the entire gene(s) for the particular trait may be isolated, cloned and manipulated as desired.
- the utUity of DNA elements introduced into an organism for purposed of gene tagging is independent of the DNA sequence and does not depend on any biological activity of the DNA sequence, i.e., transcription into RNA or translation into protein.
- the sole function of the DNA element is to disrupt the DNA sequence of a gene. It is contemplated that unexpressed DNA sequences, including novel synthetic sequences could be introduced into ceUs as proprietary "labels" of those ceUs and plants and seeds thereof.
- a label DNA element it would not be necessary for a label DNA element to disrupt the function of a gene endogenous to the host organism, as the sole function of this DNA would be to identify the origin of the organism. For example, one could introduce a unique DNA sequence into a plant and this DNA element would identify aU ceUs, plants, and progeny of these ceUs as having arisen from that labeled source. It is proposed that inclusion of label DNAs would enable one to distinguish proprietary germplasm or germplasm derived from such, from unlabeUed germplasm.
- MAR matrix attachment region element
- Plant species may be transformed with the DNA construct of the present invention by the DNA-mediated transformation of plant ceU protoplasts and subsequent regeneration of the plant from the transformed protoplasts in accordance with procedures weU known in the art.
- Any plant tissue capable of subsequent clonal propagation, whether by organogenesis or embryogenesis, may be transformed with a vector of the present invention.
- organogenesis means a process by which shoots and roots are developed sequentiaUy from meristematic centers
- embryogenesis as used herein, means a process by which shoots and roots develop together in a concerted fashion (not sequentiaUy), whether from somatic ceUs or gametes.
- tissue targets include leaf disks, poUen, embryos, cotyledons, hypocotyls, megagametophytes, caUus tissue, existing meristematic tissue (e.g., apical meristems, axUlary buds, and root meristems), and induced meristem tissue (e.g., cotyledon meristem and ultUane meristem).
- Plants of the present invention may take a variety of forms.
- the plants may be chimeras of transformed ceUs and non-transformed ceUs; the plants may be clonal transformants (e.g., aU ceUs transformed to contain the expression cassette); the plants may comprise grafts of transformed and untransformed tissues (e.g., a transformed root stock grafted to an untransformed scion in citrus species).
- the transformed plants may be propagated by a variety of means, such as by clonal propagation or classical breeding techniques. For example, first generation (or Tl) transformed plants may be selfed to give homozygous second generation (or T2) transformed plants, and the T2 plants further propagated through classical breeding techniques.
- a dominant selectable marker (such as npt II) can be associated with the expression cassette to assist in breeding.
- the present invention provides a transformed (transgenic) plant ceU, in planta or explanta, including a transformed plastid or other organeUe, e.g., nucleus, mitochondria or chloroplast.
- the present invention may be used for transformation of any plant species, including, but not limited to, cells from corn (Zea mays), Brassica sp. (e.g., B. napus, B. rapa, B.
- juncea particularly those Brassica species useful as sources of seed oU, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), miUet (e.g., pearl m-Ulet (Pennisetum glaucum), proso m-Ulet (Panicum miliaceum), foxtaU miUet (Setaria italica), finger miUet (Eleusine coracan ⁇ )), sunflower (Helianthus annum), safflower (Carthamus tinctorius), wheat (Triticum aestivum), soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanuts (Arachis hypogaea), cotton (Gossypium barbadense, Gossypium hirsutum), sweet potato (Ipomoea batatas),
- Duckweed (Lemna, see WO 00/07210) includes members of the famUy Lemnaceae. There are known four genera and 34 species of duckweed as foUows: genus Lemna (L. aequinoctialis, L. disperma, L. ecuadoriensis, L. gibba, L. japonica, L. minor, L. miniscula, L. obscura, L. perpusilla, L. tenera, L. trisulca, L.turionifera, L. valdiviana); genus Spirodela (S. intermedia, S. polyrrhiza, S. punctata); genus Woffia (Wa. Angusta, Wa.
- genus Lemna L. aequinoctialis, L. disperma, L. ecuadoriensis, L. gibba, L. japonica, L. minor, L. miniscula, L. obscur
- Lemna gibba, Lemna minor, and Lemn ⁇ miniscula are preferred, with Lemna minor and Lemna miniscula being most preferred.
- Lemna species can be classified using the taxonomic scheme described by Landolt, Biosystematic Investigation on the FamUy of Duckweeds: The famUy of Lemnaceae - A Monograph Study. Geobotanisches Institut ETH, Stainless Rubel, Zurich (1986)).
- Vegetables within the scope of the invention include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- tomatoes Locopersicon esculentum
- lettuce e.g., Lactuca sativa
- green beans Phaseolus vulgaris
- lima beans Phaseolus limensis
- peas Lathyrus spp.
- members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C. cantalupensis), and musk melon (C. melo).
- Ornamentals include azalea (Rhododendron spp.), hydrangea (Macrophylla hydrangea), hibiscus (Hibiscus rosasanensis), roses (Rosa spp.), tuUps (Tulipa spp.), daffodUs (Narcissus spp.), petunias (Petunia hybrida), carnation (Dianthus caryophyllus), poinsettia (Euphorbia pulcherrima), and chrysanthemum.
- Conifers that may be employed in practicing the present invention include, for example, pines such as lobloUy pine (Pinus taeda), slash pine (Pinus elliotii), ponderosa pine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata), Douglas-fir (Pseudotsuga menziesii); Western hemlock (Tsuga ultilane); Sitka spruce (Picea glaucd); redwood (Sequoia sempervirens); true firs such as sUver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yeUow-cedar (Chamaecyparis nootkatensis).
- pines such as lobloUy pine (Pinus t
- Leguminous plants include beans and peas.
- Beans include guar, locust bean, fenugreek, soybean, garden beans, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
- Legumes include, but are not limited to, Arachis, e.g., peanuts, Vicia, e.g., crown vetch, hairy vetch, adzuki bean, mung bean, and chickpea, Lupinus, e.g., lupine, trifoUum, Phaseolus, e.g., common bean and lima bean, Pisum, e.g., field bean, Melilotus, e.g., clover, Medicago, e.g., alfalfa, Lotus, e.g., trefoU, lens, e.g., lentil, and false indigo.
- Preferred forage and turf grass for use in the methods of the invention include alfalfa, orchard grass, taU fescue, perennial ryegrass, creeping bent grass, and redtop.
- plants within the scope of the invention include Acacia, aneth, artichoke, arugula, blackberry, canola, cilantro, Clementines, escarole, eucalyptus, fennel, grapefruit, honey dew, jicama, kiwifruit, lemon, Ume, mushroom, nut, okra, orange, parsley, persimmon, plantain, pomegranate, poplar, radiata pine, radicchio, Southern pine, sweetgum, tangerine, triticale, vine, yams, apple, pear, quince, cherry, apricot, melon, hemp, buckwheat, grape, raspberry, chenopodium, blueberry, nectarine, peach, plum, strawberry, watermelon, eggplant, pepper, cauliflower, Brassica, e.g., broccoU, cabbage, ultUan sprouts, onion, carrot, leek, beet, broad bean, celery,
- Ornamental plants within the scope of the invention include impatiens, Begonia, Pelargonium, Viola, Cyclamen, Verbena, Vinca, Tagetes, Primula, Saint PauUa, Agertum, Amaranthus, Antihirrhinum, AquUegia, Cineraria, Clover, Cosmo, Cowpea, DahUa, Datura, Delphinium, Gerbera, Gladiolus, Gloxinia, Hippeastrum, Mesembryanthemum, Salpiglossos, and Zinnia. Other plants within the scope of the invention are shown in Table 1 (above).
- transgenic plants of the present invention are crop plants and in particular cereals (for example, corn, alfalfa, sunflower, rice, Brassica, canola, soybean, barley, soybean, sugarbeet, cotton, safflower, peanut, sorghum, wheat, mUlet, tobacco, etc.), and even more preferably corn, rice and soybean.
- cereals for example, corn, alfalfa, sunflower, rice, Brassica, canola, soybean, barley, soybean, sugarbeet, cotton, safflower, peanut, sorghum, wheat, mUlet, tobacco, etc.
- Transformation of plants can be undertaken with a single DNA molecule or multiple DNA molecules (i.e., co-transformation), and both these techniques are suitable for use with the expression cassettes of the present invention.
- Numerous transformation vectors are available for plant transformation, and the expression cassettes of this invention can be used in conjunction with any such vectors.
- the selection of vector wUl depend upon the preferred transformation technique and the target species for transformation.
- Expression vectors containing genomic or synthetic fragments can be introduced into protoplasts or into intact tissues or isolated ceUs.
- expression vectors are introduced into intact tissue.
- General methods of culturing plant tissues are provided for example by Maki et al, (1993); and by PhiUips et al. (1988).
- expression vectors are introduced into maize or other plant tissues using a direct gene transfer method such as microprojectUe- mediated deUvery, DNA injection, electroporation and the Uke. More preferably expression vectors are introduced into plant tissues using the microprojectUe media deUvery with the bioUstic device. See, for example, Tomes et al. (1995).
- the vectors of the invention can not only be used for expression of structural genes but may also be used in exon-trap cloning, or promoter trap procedures to detect differential gene expression in varieties of tissues, (Lindsey et al, 1993; Auch & Reth et al).
- Ti-derived vectors transform a wide variety of higher plants, including monocotyledonous and dicotyledonous plants, such as soybean, cotton, rape, tobacco, and rice (Pacciotti et al, 1985: Byrne et al, 1987; Sukhapinda et al, 1987; Park et al, 1985: Hiei et al, 1994).
- the use of T-DNA to transform plant ceUs has received extensive study and is amply described (EP 120516; Hoekema, 1985; Knauf, et al., 1983; and An et al, 1985).
- the chimeric genes of the invention can be inserted into binary vectors as described in the examples.
- transformation methods are avaUable to those skiUed in the art, such as direct uptake of foreign DNA constructs (see EP 295959), techniques of electroporation (Fromm et al, 1986) or high velocity baUistic bombardment with metal particles coated with the nucleic acid constructs (Kline et al, 1987, and U.S. Patent No. 4,945,050).
- direct uptake of foreign DNA constructs see EP 295959
- techniques of electroporation fromm et al, 1986
- high velocity baUistic bombardment with metal particles coated with the nucleic acid constructs Kline et al, 1987, and U.S. Patent No. 4,945,050.
- Suitable methods of transforming plant ceUs include, but are not Umited to, microinjection (Crossway et al, 1986), electroporation (Riggs et al, 1986), Agr ⁇ b ⁇ cte ⁇ wm-mediated transformation (Hinchee et al, 1988), direct gene transfer (Paszkowski et al, 1984), and baUistic particle acceleration using devices avaUable from Agracetus, Inc., Madison, Wis. And BioRad,
- the protoplast transformation method for maize is employed (European Patent AppUcation EP 0292435, U. S. Pat. No. 5,350,689).
- a nucleotide sequence of the present invention is directly transformed into the plastid genome. Plastid transformation technology is extensively described in U.S. Patent Nos. 5,451,513, 5,545,817, and 5,545,818, in PCT appUcation no. WO 95/16783, and in McBride et al, 1994.
- the basic technique for chloroplast transformation involves introducing regions of cloned plastid DNA flanking a selectable marker together with the gene of interest into a suitable target tissue, e.g., using bioUstics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation).
- a suitable target tissue e.g., using bioUstics or protoplast transformation (e.g., calcium chloride or PEG mediated transformation).
- the 1 to 1.5 kb flanking regions termed targeting sequences, facUitate orthologous recombination with the plastid genome and thus aUow the replacement or modification of specific regions of the plastome.
- InitiaUy point mutations in the chloroplast 16S rRNA and rpsl2 genes conferring resistance to spectinomycin and/or streptomycin are utilized as selectable markers for transformation (Svab et al, 1990; Staub et al, 1992). This resulted in stable homoplasmic transformants at a frequency of approximately one per 100 bombardments of target leaves. The presence of cloning sites between these markers aUowed creation of a plastid targeting vector for introduction of foreign genes (Staub et al, 1993).
- Substantial increases in transformation frequency are obtained by replacement of the recessive rRNA or r-protein antibiotic resistance genes with a dominant selectable marker, the bacterial aadA gene encoding the spectinomycin-detoxifying enzyme aminoglycoside-3N-adenyltransferase (Svab et al, 1993).
- selectable markers useful for plastid transformation are known in the art and encompassed within the scope of the invention. TypicaUy, approximately 15-20 ceU division cycles foUowing transformation are required to reach a homoplastidic state.
- Plastid expression in which genes are inserted by orthologous recombination into aU of the several thousand copies of the circular plastid genome present in each plant ceU, takes advantage of the enormous copy number advantage over nuclear-expressed genes to permit expression levels that can readUy exceed 10% of the total soluble plant protein.
- a nucleotide sequence of the present invention is inserted into a plastid targeting vector and transformed into the plastid genome of a desired plant host. Plants homoplastic for plastid genomes containing a nucleotide sequence of the present invention are obtained, and are preferentiaUy capable of high expression of the nucleotide sequence.
- Agrobacterium tumefaciens ceUs containing a vector comprising an expression cassette of the present invention, wherein the vector comprises a Ti plasmid are useful in methods of making transformed plants. Plant ceUs are infected with an Agrobacterium tumefaciens as described above to produce a transformed plant ceU, and then a plant is regenerated from the transformed plant ceU. Numerous Agrobacterium vector systems useful in carrying out the present invention are known.
- vectors are avaUable for transformation using Agrobacterium tumefaciens. These typicaUy carry at least one T-DNA border sequence and include vectors such as pBIN19 (Bevan, 1984).
- the expression cassettes of the present invention may be inserted into either of the binary vectors pCIB200 and pCIB2001 for use with Agrobacterium. These vector cassettes for Agrobacterium-mediated transformation wear constructed in the foUowing manner.
- PTJS75kan was created by Narl digestion of pTJS75 (Schmidhauser & Helinski, 1985) aUowing excision of the tetracycUne-resistance gene, followed by insertion of an Accl fragment from pUC4K carrying an NPTII (Messing & Vierra, 1982; Bevan et al, 1983; McBride et al, 1990).
- Xhol linkers were Ugated to the EcoRV fragment of pCIB7 which contains the left and right T-DNA borders, a plant selectable nos/nptll chimeric gene and the pUC polylinker (Rothstein et al, 1987), and the Xhol- digested fragment was cloned into S all-digested pTJS75kan to create pCIB200 (see also EP 0 332 104, example 19).
- PCIB200 contains the foUowing unique polyUnker restriction sites: EcoRI, Sstl, Kpnl, Bglll, Xbal, and Sail.
- the plasmid ⁇ CIB2001 is a derivative of ⁇ CIB200 which was created by the insertion into the polyUnker of additional restriction sites.
- Unique restriction sites in the polyUnker of pCIB2001 are EcoRI, Sstl, Kpnl, Bglll, Xbal, Sail, M , Bell, Avrll, Apal, Hpal, and Stul.
- PCIB2001 in addition to containing these unique restriction sites also has plant and bacterial kanamycin selection, left and right T-DNA borders for Agrobacterium-mediated transformation, the RK2-derived trf A function for mobilization between E. coli and other hosts, and the OriT and OriV functions also from RK2.
- the pCIB2001 polyUnker is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
- An additional vector useful for Agrobacterium-mediated transformation is the binary vector pCIB 10, which contains a gene encoding kanamycin resistance for selection in plants, T-DNA right and left border sequences and incorporates sequences from the wide host- range plasmid pRK252 aUowing it to repUcate in both E. coli and Agrobacterium. Its construction is described by Rothstein et al, 1987.
- Various derivatives of pCIBlO have been constructed which incorporate the gene for hygromycin B phosphotransferase described by Gritz et al, 1983. These derivatives enable selection of transgenic plant ceUs on hygromycin only ( ⁇ CIB743), or hygromycin and kanamycin (pCIB715, pCIB717).
- Methods using either a form of direct gene transfer or Agr ⁇ b ⁇ cter ⁇ Mm-mediated transfer usuaUy, but not necessarUy, are undertaken with a selectable marker which may provide resistance to an antibiotic (e.g., kanamycin, hygromycin or methotrexate) or a herbicide (e.g., phosphinothricin).
- a selectable marker which may provide resistance to an antibiotic (e.g., kanamycin, hygromycin or methotrexate) or a herbicide (e.g., phosphinothricin).
- antibiotic e.g., kanamycin, hygromycin or methotrexate
- phosphinothricin e.g., phosphinothricin
- selection markers used routinely in transformation include the nptll gene which confers resistance to kanamycin and related antibiotics (Messing & Vierra, 1982; Bevan et al, 1983), the bar gene which confers resistance to the herbicide phosphinothricin (White et al, 1990, Spencer et al, 1990), the hph gene which confers resistance to the antibiotic hygromycin (Blochinger & Diggelmann), and the dhfr gene, which confers resistance to methotrexate (Bourouis et al, 1983).
- pCIB3064 One such vector useful for direct gene transfer techniques in combination with selection by the herbicide Basta (or phosphinothricin) is pCIB3064.
- This vector is based on the plasmid pCIB246, which comprises the CaMV 35S promoter in operational fusion to the ⁇ . coU GUS gene and the CaMV 35S transcriptional terminator and is described in the PCT pubUshed appUcation WO 93/07278, herein incorporated by reference.
- One gene useful for conferring resistance to phosphinothricin is the bar gene from Streptomyces viridochromogenes (Thompson et al, 1987). This vector is suitable for the cloning of plant expression cassettes containing their own regulatory signals.
- An additional transformation vector is pSOG35 which utilizes the E. coli gene dihydrofolate reductase (DHFR) as a selectable marker conferring resistance to methotrexate.
- PCR was used to amplify the 35S promoter (about 800 bp), intron 6 from the maize Adhl gene (about 550 bp) and 18 bp of the GUS untranslated leader sequence frompSOGlO. A 250 bp fragment encoding the E.
- coli dihydrofolate reductase type II gene was also amplified by PCR and these two PCR fragments were assembled with a Sacl-Pstl fragment from pBI221 (Clontech) which comprised the pUC19 vector backbone and the nopaline synthase terminator. Assembly of these fragments generated pSOG19 which contains the 35S promoter in fusion with the intron 6 sequence, the GUS leader, the DHFR gene and the nopaline synthase terminator. Replacement of the GUS leader in pSOG19 with the leader sequence from Maize Chlorotic Mottle Virus check (MCMV) generated the vector ⁇ SOG35. ⁇ SOG19 and ⁇ SOG35 carry the pUC-derived gene for ampiciUin resistance and have Hindlll, Sphl, Pstl and ⁇ coRI sites avaUable for the cloning of foreign sequences.
- MCMV Maize Chlorotic Mottle Virus check
- Transgenic plant cells are then placed in an appropriate selective medium for selection of transgenic ceUs which are then grown to caUus.
- Shoots are grown from caUus and plantlets generated from the shoot by growing hi rooting medium.
- the various constructs normaUy wiU be joined to a marker for selection in plant ceUs.
- the marker may be resistance to a biocide (particularly an antibiotic, such as kanamycin, G418, bleomycin, hygromycin, chloramphenicol, herbicide, or the Uke).
- the particular marker used wUl aUow for selection of transformed ceUs as compared to ceUs lacking the DNA which has been introduced.
- compositions of DNA constructs including transcription cassettes of this invention may be prepared from sequences which are native (endogenous) or foreign (exogenous) to the host.
- foreign it is meant that the sequence is not found in the wUd-type host into which the construct is introduced.
- Heterologous constructs wiU contain at least one region which is not native to the gene from which the transcription-initiation-region is derived.
- assays include, for example, "molecular biological” assays weU known to those of skUl in the art, such as Southern and Northern blotting, in situ hybridization and nucleic acid-based amplification methods such as PCR or RT-PCR; "biochemical” assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISAs and Western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and also, by analyzing the phenotype of the whole regenerated plant, e.g., for disease or pest resistance.
- DNA may be isolated from ceU lines or any plant parts to determine the presence of the preselected nucleic acid segment through the use of techniques weU known to those skiUed in the art. Note that intact sequences wiU not always be present, presumably due to rearrangement or deletion of sequences in the ceU.
- nucleic acid elements introduced through the methods of this invention may be determined by polymerase chain reaction (PCR). Using this technique discreet fragments of nucleic acid are amplified and detected by gel electrophoresis. This type of analysis permits one to determine whether a preselected nucleic acid segment is present in a stable transformant, but does not prove integration of the introduced preselected nucleic acid segment into the host ceU genome. In addition, it is not possible using PCR techniques to determine whether transformants have exogenous genes introduced into different sites in the genome, i.e., whether transformants are of independent origin. It is contemplated that using PCR techniques it would be possible to clone fragments of the host genomic DNA adjacent to an introduced preselected DNA segment.
- PCR polymerase chain reaction
- Positive proof of DNA integration into the host genome and the independent identities of transformants may be determined using the technique of Southern hybridization. Using this technique specific DNA sequences that were introduced into the host genome and flanking host DNA sequences can be identified. Hence the Southern hybridization pattern of a given transformant serves as an identifying characteristic of that transformant. In addition it is possible through Southern hybridization to demonstrate the presence of introduced preselected DNA segments in high molecular weight DNA, i.e., confirm that the introduced preselected DNA segment has been integrated into the host ceU genome.
- the technique of Southern hybridization provides information that is obtained using PCR, e.g., the presence of a preselected DNA segment, but also demonstrates integration into the genome and characterizes each individual transformant. It is contemplated that using the techniques of dot or slot blot hybridization which are modifications of Southern hybridization techniques one could obtain the same information that is derived from PCR, e.g., the presence of a preselected DNA segment.
- RNA may only be expressed in particular ceUs or tissue types and hence it wUl be necessary to prepare RNA for analysis from these tissues.
- PCR techniques may also be used for detection and quantitation of RNA produced from introduced preselected DNA segments. In this application of PCR it is first necessary to reverse transcribe RNA into DNA, using enzymes such as reverse transcriptase, and then through the use of conventional PCR techniques amplify the DNA. In most instances PCR techniques, whUe useful, wUl not demonstrate integrity of the RNA product. Further information about the nature of the RNA product may be obtained by Northern blotting.
- This technique wiU demonstrate the presence of an RNA species and give information about the integrity of that RNA.
- the presence or absence of an RNA species can also be determined using dot or slot blot Northern hybridizations. These techniques are modifications of Northern blotting and wiU only demonstrate the presence or absence of an RNA species.
- WhUe Southern blotting and PCR may be used to detect the preselected DNA segment in question, they do not provide information as to whether the preselected DNA segment is being expressed. Expression may be evaluated by specificaUy identifying the protein products of the introduced preselected DNA segments or evaluating the phenotypic changes brought about by their expression. Assays for the production and identification of specific proteins may make use of physical-chemical, structural, functional, or other properties of the proteins.
- Unique physical- chemical or structural properties aUow the proteins to be separated and identified by electrophoretic procedures, such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography.
- electrophoretic procedures such as native or denaturing gel electrophoresis or isoelectric focusing, or by chromatographic techniques such as ion exchange or gel exclusion chromatography.
- the unique structures of individual proteins offer opportunities for use of specific antibodies to detect their presence in formats such as an ELISA assay. Combinations of approaches may be employed with even greater specificity such as Western blotting in which antibodies are used to locate individual gene products that have been separated by electrophoretic techniques. Additional techniques may be employed to absolutely confirm the identity of the product of interest such as evaluation by amino acid sequencing foUowing purification. Although these are among the most commonly employed, other procedures may be additionaUy used.
- Assay procedures may also be used to identify the expression of proteins by their functionaUty, especiaUy the abiUty of enzymes to catalyze specific chemical reactions involving specific substrates and products. These reactions may be foUowed by providing and quantifying the loss of substrates or the generation of products of the reactions by physical or chemical procedures. Examples are as varied as the enzyme to be analyzed.
- bioassays Very frequently the expression of a gene product is determined by evaluating the phenotypic results of its expression. These assays also may take many forms including but not limited to analyzing changes in the chemical composition, morphology, or physiological properties of the plant. Morphological changes may include greater stature or thicker stalks. Most often changes in response of plants or plant parts to imposed treatments are evaluated under carefuUy controUed conditions termed bioassays.
- an expression cassette of the invention may be propagated in that species or moved into other varieties of the same species, particularly including commercial varieties, using traditional breeding techniques.
- Particularly preferred plants of the invention include the agronomicaUy important crops Usted above.
- the genetic properties engineered into the transgenic seeds and plants described above are passed on by sexual reproduction and can thus be maintained and propagated in progeny plants.
- the present invention also relates to a transgenic plant ceU, tissue, organ, seed or plant part obtained from the transgenic plant. Also included within the invention are transgenic descendants of the plant as weU as transgenic plant ceUs, tissues, organs, seeds and plant parts obtained from the descendants.
- the expression cassette in the transgenic plant is sexuaUy transmitted.
- the coding sequence is sexuaUy transmitted through a complete normal sexual cycle of the RO plant to the RI generation.
- the expression cassette is expressed in the ceUs, tissues, seeds or plant of a transgenic plant in an amount that is different than the amount in the ceUs, tissues, seeds or plant of a plant which only differs in that the expression cassette is absent.
- Transgenic plants produced herein are thus expected to be useful for a variety of commercial and research purposes.
- Transgenic plants can be created for use in traditional agriculture to possess traits beneficial to the grower (e.g., agronomic traits such as resistance to water deficit, pest resistance, herbicide resistance or increased yield), beneficial to the consumer of the grain harvested from the plant (e.g., improved nutritive content in human food or animal feed; increased vitamin, amino acid, and antioxidant content; the production of antibodies (passive immunization) and nutriceuticals), or beneficial to the food processor (e.g., improved processing traits).
- the plants are generaUy grown for the use of their grain in human or animal foods.
- root-specific promoters in transgenic plants can provide beneficial traits that are localized in the consumable (by animals and humans) roots of plants such as carrots, parsnips, and beets.
- other parts of the plants including stalks, husks, vegetative parts, and the Uke, may also have utiUty, including use as part of animal sUage or for ornamental purposes.
- chemical constituents e.g., oils or starches
- transgenic plants may be created which have enhanced or modified levels of such components.
- Transgenic plants may also find use in the commercial manufacture of proteins or other molecules, where the molecule of interest is extracted or purified from plant parts, seeds, and the Uke. CeUs or tissue from the plants may also be cultured, grown in vitro, or fermented to manufacture such molecules.
- the transgenic plants may also be used in commercial breeding programs, or may be crossed or bred to plants of related crop species. Improvements encoded by the expression cassette may be transferred, e.g., from maize ceUs to ceUs of other species, e.g., by protoplast fusion.
- the transgenic plants may have many uses in research or breeding, including creation of new mutant plants through insertional mutagenesis, in order to identify beneficial mutants that might later be created by traditional mutation and selection.
- An example would be the introduction of a recombinant DNA sequence encoding a transposable element that may be used for generating genetic variation.
- the methods of the invention may also be used to create plants having unique "signature sequences" or other marker sequences which can be used to identify proprietary lines or varieties.
- the transgenic plants and seeds according to the invention can be used in plant breeding which aims at the development of plants with improved properties conferred by the expression cassette, such as tolerance of drought, disease, or other stresses.
- the various breeding steps are characterized by weU-defined human intervention such as selecting the lines to be crossed, directing pollination of the parental lines, or selecting appropriate descendant plants. Depending on the desired properties different breeding measures are taken.
- the relevant techniques are weU known in the art and include but are not limited to hybridization, inbreeding, backcross breeding, " ultUane breeding, variety blend, interspecific hybridization, aneuploid techniques, etc.
- Hybridization techniques also include the sterilization of plants to yield male or female sterUe plants by mechanical, chemical or biochemical means.
- the transgenic seeds and plants according to the invention can be used for the breeding of improved plant lines which for example increase the effectiveness of conventional methods such as herbicide or pesticide treatment or aUow to dispense with said methods due to their modified genetic properties.
- new crops with improved stress tolerance can be obtained which, due to their optimized genetic "equipment", yield harvested product of better quaUty than products which were not able to tolerate comparable adverse developmental conditions.
- the invention also provides a computer readable medium having stored thereon a data structure containing nucleic acid sequences having at least 70% sequence identity to a nucleic acid sequence selected from those Usted in SEQ ID Nos: 1-339, 358-366, 441-515, 517-529, 536-579 and 601-773, as weU as complementary, ortholog, and variant sequences thereof.
- Storage and use of nucleic acid sequences on a computer readable medium is weU known in the art. (See for example U.S. Patent Nos.
- nucleic acid sequences contained on the computer readable medium may be compared through use of a module that receives the sequence information and compares it to other sequence information.
- examples of other sequences to which the nucleic acid sequences of the invention may be compared include those maintained by the National Center for Biotechnology Information (NCBI)(http://www.ncbi.nlm.nih.gov/) and the Swiss Protein Data Bank.
- NCBI National Center for Biotechnology Information
- a computer is an example of such a module that can read and compare nucleic acid sequence information.
- the invention also provides the method of comparing a nucleic acid sequence of the invention to another sequence.
- a sequence of the invention may be submitted to the NCBI for a Blast search as described herein where the sequence is compared to sequence information contained within the NCBI database and a comparison is returned.
- the invention also provides nucleic acid sequence information in a computer readable medium that aUows the encoded polypeptide to be optimized for a desired property. Examples of such properties include, but are not Umited to, increased or decreased: thermal stabiUty, chemical stabUity, hydrophyUcity, hydrophobicity, and the Uke.
- the invention wiU be further described by the foUowing non-limiting examples.
- Total RNA from plant tissue is extracted and quantified.
- T7 (dT) 24 Primer (100 pmol final)- 1 ul pmol 5X 1 st strand cDNA buffer-4 ul 0.1M DTT (10 mM final)- 2 ul 10 mM dNTP mix (500 uM final)- 1 ul Superscript II RT 200 U/ul- 1 ul
- Example 2 Characterization of Gene Expression Profiles During Plant Development using the GeneChip The Arabidopsis GeneChip provides a method to simultaneously scan over 30% of the genome for the expression profile of each gene on chip. By using RNA extracted from different tissue and developmental stages of development, a scan of the entire Arabidopsis plant is achieved.
- the advantages of a gene chip in such an analysis include a global gene expression analysis, quantitative results, a highly reproducible system, and a higher sensitivity than Northern blot analyses.
- a gene chip with Arabidopsis DNA has a further advantage in that the Arabidopsis genome is weU characterized.
- the objective was to identify known and novel genes that are expressed in specific organs (spatial expression) or developmental stages (temporal expression versus constitutive expression).
- the represented genes included approximately 1,000 known fuU length cDNAs, a coUection of approximately 500 ESTs or fuU length sequences, 3,500 annotated Genbank genomic sequences (the transcripts of which were confirmed by the presence of ESTs in the database) and about 3,700 annotated Genbank sequences with a predicted translated open reading frame with 2 or more "hits" with a protein in the protein database having a defined function.
- RNA total RNA (5 ⁇ g) from each sample was reverse transcribed using an oUgo dT (24 ) primer containing a 5' T7 RNA polymerase promoter sequence (5'- GGCCAGTGAATTGTAATACGACTCACTATAGGGAGGCGG-(dT) 24 -3' ; SEQ ID NO: 1
- cRNAs Biotinylated complementary RNAs
- T7 RNA Polymerase Enzo
- cRNAs were in vitro transcribed by T7 RNA Polymerase (ENZO BioArray High Yield RNA Transcript Labeling Kit, Enzo).
- cRNAs were purified using an affinity resin (Qiagen Rneasy Spin Columns) and randomly fragmented by incubating at 94° C for 35 minutes in a buffer containing 40 mM Tris-acetate, pH 8.1, 100 mM potassium acetate, and 30 mM magnesium acetate to produce molecules of approximately 35 to 200 bases.
- the labeled samples were denatured at 99° C for 5 minutes, equUibrated at 45°C for 5 minutes, and hybridized to the Arabidopsis GeneChip® genome array (Affymetrix) at 45 °C for 16 hours on a rotisserie at 60 rpm.
- the hybridized arrays were then rinsed with IX STT and stained with streptavidin phycoerythrin at 25 °C for 10 minutes twice with a rinse in between. After staining, arrays were washed with IX STT at 25°C for 20 minutes and stained with biotinylated anti-streptavidin antibody at 25°C for 10 minutes.
- the probe array was stained with SAPE at 25°C for 10 minutes and washed with wash buffer A at 30°C for 30 minutes. AU of the wash and stain procedures were completed using a fluidic station (Affymetrix). The probe array was scanned twice and the intensities were averaged with a Hewlett-Packard GeneArray Scanner.
- Genechip Suite 3.2 (Affymetrix) was used for data normaUzation. The overaU intensity of all probe sets of each chip was scaled to 100 so that the hybridization intensity of aU arrays was equivalent. False positives are defined based on experiments in which samples are spUt, hybridized to GeneChip ® expression arrays and the results compared. A false positive is indicated if a probe set is scored quaUtatively as an "Increase” or "Decrease” and quantitatively as changing by at least 2-fold and the average difference is greater than 25. A significant change is defined as 2-fold change or above with an expression baseline of 25, which is determined as the threshold level according to the scaUng.
- the data from each chip was loaded into GeneSpring software and analyzed for fold differences with the leaf samples.
- the 2-week leaf samples were used to find genes expressed 4-fold or higher in the leaf sample at 2 weeks of age versus aU the other tissues.
- the remaining leaf samples at 5, 6, 8, and 11 weeks were not analyzed at this stage, but were analyzed independently.
- the leaf sample at 5 weeks was also analyzed against aU other tissues except the remainmg leaf samples for genes expressed 4-fold or higher in leaf tissue at 5 weeks.
- the other leaf samples were analyzed in a simUar fashion. This aUowed the selection of genes that were at least 4-fold elevated in expression in a leaf sample in at least one stage of development. When these genes were combined, there were 92 genes that were preferentiaUy expressed in leaf tissue.
- a high-density Arabidopsis oUgonucleotide array was used that includes probes for 8,100 Arabidopsis genes and 40 probes for spiking and negative controls. For each gene, there are 16 probe pairs (probe sets) including perfect match probes and mismatch probes for nonspecific binding control.
- the Arabidopsis genes are represented by known genes, predicted genes and approximately 100 clusters of ESTs. Predicted gene sequences were extracted and confirmed computationaUy by matching the genome sequence with ESTs and protein sequences. The reproducibiUty of the array was characterized by calculation of the rate of false changes (number of genes significantly changed over the total number of genes on the array; Lipshultz, 1999).
- Two cDNA and subsequently cRNA (the antisense RNA synthesized by in vitro transcription using cDNAs as templates in the presence of biotinylated ribonucleotides) samples were prepared in paraUel from the same total RNA samples, and hybridized to two different arrays manufactured in the same lot or different lots. Genes that showed changes of > 2-fold and a signal threshold above the background (calculated according to the setting of the global scaUng factor) were counted as false changes. Data from 15 pairs of array experiments indicated that false changes between two experiments using arrays of the same lot is 0.17% (based on 8 pairs), whUe the false change using arrays of two different lots is 0.22% (based on 7 pairs). Further analyses of these genes indicate that the fold change and expression levels are low and close to the threshold (Zhu and Wang, 2000).
- Selected housekeeping genes are used to ensure the quaUty of the array experiments, because the quaUty of the total RNA and subsequently synthesized cDNA and cRNA samples has direct impact on the array results.
- Sample quaUty, specificaUy, labeled cR A quaUty was monitored by comparing the ratio of the hybridization signal of 3N and 5N probe sets for GAPDH and ubiqutinl 1. Only data with a consistent 3N/5N ratio (Zhu and Wang, 2000) was archived in the database and used. Specific Selection Criteria
- the foUowing criteria selection were employed to identify Arabidopsis genes that were constitutively expressed.
- composition of the constitutively and organ differentiaUy expressed transcripts were characterized.
- a total of 347 constitutive expressed genes with median or high-level transcripts were selected from the commonly expressed gene pool. These genes are constantly expressed above median expression level (average difference greater than 500) for aU organs and developmental stages examined.
- Functional categorization indicated that majority of the known constitutive genes are involved in metaboUsm (28%) and ribosomal protein synthesis (15%), foUowed by genes involving transcription (8%), signaling (6%), transport (5%), membrane (5%), synthases (5%), membrane (5%), and stress and defense related (7%) (Table 8). About 15% of the genes identified have no function assigned.
- Organ differential expressed genes were also analyzed. These genes were expressed at median level (average difference greater than 50) in certain organ at aU developmental stages, e.g., compared to other organs, the expression level for these genes in the organ are 4-fold higher than others. By these criteria, genes differentiaUy expressed in root (64), leaf (94), inflorescence stem (3), and flower (36) were identified, and functionaUy categorized. To examine the organ-specificity of the differential expression, the expression level of differentiaUy expressed genes were plotted against represented samples. The root differential expressed genes are expressed almost exclusively in root and young whole seedlings. There were 51 genes that were expressed only in root. Twenty-three percent of these genes had no known function while peroxidases and defense genes represented 51 % of the genes.
- genes with transcripts detected in various developmental stages were analyzed.
- a total of 5,247 genes expressed during leaf development were subject to cluster analysis.
- clustering methods including self-organizing map (SOM, Tamayo et al, 1999), hierarchical cluster (Eisen et al, 1998) and K-mean, generated simUar clusters. Sixteen groups of genes formed according to their expression patterns when SOM was used. Four groups of genes were examined in detaU.
- Cluster 15 shows a group of genes down regulated during leaf development. Genes in this group generaUy have a very high transcription level. However, they reduce then- expression level by least 2-fold toward senescence. Among 34 genes in the cluster, 28 of them were photosynthesis related. Interestingly, some of the genes related to photosynthesis are also found in cluster 6, which shows a more gradual reduction in expression. These genes, such as ferredoxin-NADP+ reductase and NADPH protochlorophylUde oxidoreductase B, have relatively low level of transcripts, and their reduction is not as dramatic as others.
- Cluster 8 was also analyzed. The expression of this group of genes shows a dramatic increase towards senescence. DetaUed examination of this cluster revealed 8 genes involved in senescence. Other senescence genes also increased their transcription level during late development, however, those changes were not as dramatic as the eight genes identified in cluster 8. These genes were found in cluster 2.
- Cluster analysis also identifies co-regulated genes, and organizes the samples or array experiments according to their overaU expression patterns. In order to vaUdate the expression data, cluster analysis was performed on 6,626 genes with an expression level above background (average difference greater or equal 25) in any of the samples. AU data were normalized to their median, organized into a SOM, and into a hierarchical cluster using Cluster program (Eisen et al. 1998).
- samples form three major clusters: a cluster of leaf samples, a cluster of supporting axis, including root, inflorescence stem and seedling samples, and a cluster of the reproductive organ samples, including samples of flowers, siUques, and inflorescences (including flowers and siUques).
- genes also organized into several major classes according to their expression levels: organ-differentiaUy expressed genes were easUy highUghted.
- AUgnACE telo-box motif
- telo-box binds a protein related to Pura conserved nuclear protein that has been impUcated in the control of gene transcription and DNA repUcation (Safak et al, 1999).
- Another motif identified in the ribosomal promoter regions was the Dof binding site (AAAG).
- the Dof binding site has been shown in the promoters of a diverse set of plant genes, suggesting various roles of Dof proteins in plants (Yanagisawa and Schmidt, 1999), including carbon metaboUsm (Yanagisawa, 2000). Additional motifs observed include a poUen specific motif (AGAAA) and a RAVI binding motif (Kagaya et al, 1999).
- the promoter regions from leaf-specific genes were also analyzed by AUgnAce software to discover putative cis elements. Those that were found include a GATA box and a Ught regulatory element "ACGTGGCA". These elements are known to be necessary for Ught induced genes.
- a putative element that did not contain a known binding site was "TGGTTCGGACC” (SEQ ID NO:586). This element was located in 16 of the promoters analyzed.
- the accuracy of the microarray data was vaUdated by two measures.
- genes that are co-regulated can be analyzed to identify the regulatory elements.
- constitutive and organ-specific genes were identified through the screening of 8,100 genes, but also regulatory elements, such as telo-box, Dof binding site, as weU as other motifs, which are important for the constitutive expression of the ribosomal proteins.
- organ- or tissue-specific gene promoter elements, and various treatment-induced gene promoter elements have been identified. Such results not only faciUtate the dissection of the regulatory pathway, but also provide an opportunity in genetic engineering of metaboUc pathways. Methods such as chimeraplasty (Zhu et al. 1999, 2000) can be used to precisely modify these regions and thus regulate a group of genes of interest.
- a standard curve of 50, 10, 2, 0.4, and 0.08 ng total RNA was generated for each primer/probe set tested.
- the 50 ng sample yielded a C t value of 24.5 and the 10 ng sample yields a value of 26.7.
- the value is defined as the threshold cycle whereby ampUfication occurs at an exponential rate. A low value correlates with high gene expression.
- the threshold is determined empirically from the standard curve. By raising or lowering the threshold, the data set is maximized to represent optimal exponential ampUfication.
- a correlation coefficient (R 2 of the best-fit line from the standard curve) greater than 99% and a slope of -3.3 (most efficient amplification) is ideal. For accurate repeatable results, the previous criteria must be met and the unknowns must faU within the range of the curve. The expression levels of the unknown can be interpolated from the unknown values using the standard curve.
- TaqMan chemistry employs three gene-specific oUgonucleotides for the detection of nucleic acids. Two of the oUgonucleotides are primers used for the amplification of the molecule and the third ohgonucleotide is a probe that is labeled with a 5' fluorescent reporter dye (6-FAM) and a 3' quencher dye (TAMRA).
- 6-FAM 5' fluorescent reporter dye
- TAMRA 3' quencher dye
- the 5' to 3' exonuclease activity of the polymerase aUows it to degrade the probe in its path, thereby releasing the 5' reporter dye.
- the thermocycler is equipped with a detection system to measure the fluorescence from the released reporter dye. Since fluorescence increases with amplification of the molecule, fluorescence can be directly related to the amount of molecules in the starting sample.
- the primers that were employed for one set were: TRX3T 5' 6-FAM agacttcactgcaacatggtgcccac TAMRA 3' (SEQ ID NO:587); TRX3F 5' gtgtggaaatgacacagattgtga3' (SEQ ID NO:588), and TRX3R 5'agacgggtgcaatgaaacg3' (SEQ ID NO:589); and for the other set were: APX3 T 5' 6- FAM cgcgaacaagaactgtgctcctatcatg TAMRA 3' (SEQ ID NO:590), APX3 F 5'gccgtgagctccgttctct3' (SEQ ID NO:591); and APX3 R 5'tcgtgccatgccaatcg3' (SEQ ID NO: 592).
- TaqMan chemistries were used with the ABI
- Part A represents expression data for 2 genes from wUd-type plants infected or not infected with Pseudomonas syringae pv. macuUcola strain ES4326 at 30 hours post-inoculation.
- Part B represents expression data from wUd-type Arabidopsis plants infected or not infected with 5 different viruses at 1 and 4 days after inoculation, whUe part C represents expression data for 2 genes in 9 different tissue types.
- TRX3 thioredoxin
- APX3 ascorbate peroxidase
- Probe and primer sets were prepared for ubiquitin 5 (UBQ5), PRl (a pathogenesis related gene whose expression is induced upon infection), TRX3 and APX3.
- TaqMan was used to quantify relative expression levels of these genes in Arabidopsis mutants and in uninfected and P. syringae infected plants. Table 5 shows that the PRl expression increased rapidly upon infection. TRX3 and APX3 expression levels did not change as much as UBQ5, a commonly used gene for normalization.
- TRX3 and APX3 genes do not have significant simUarity to genes in the Arabidopsis genome database, and the respective primer/probe sets described herein did not significantly cross-hybridize with other genes in the Arabidopsis genome database. AdditionaUy, the promoters for these genes may be useful for constitutive gene expression.
- the promoter fragment in the vector is recombined via the LR reaction with a binary Agrobacterium destination vector containing the GUS coding region with an intron that has an ⁇ ttR site 5' to the GUS reporter (pNOV2374).
- the orientation of the inserted fragment was maintained by the att sequences and the final construct was verified by sequencing.
- the construct was then transformed into Agrobacterium tumefaciens strains by electroporation.
- pNOV2374 is a binary vector with a VS 1 origin of repUcation, a copy of the Agrobacterium virG gene in the backbone and a Basta resistance selectable marker cassette between the left and right border sequences of the T-DNA (SEQ ID NO:581).
- the Basta selectable marker cassette comprises the Agrobacterium tumefaciens manopine synthase promoter (AtMas et al, 1983) operably Unked to the gene encoding Basta resistance (denoted here as "BAR", phosphinothricin acetyl transferase, White et al, 1990) and the 35S terminator.
- BAR Agrobacterium tumefaciens manopine synthase promoter
- BAR phosphinothricin acetyl transferase
- the AtMas promoter, BAR coding sequence and 35S terminator are located at nt 4211 to 4679, nt 4680 to 5228, and nt 5263 to 5488, respectively, of pNOV2374.
- the vector contains GATEWAYTM recombination components which were introduced into the binary vector backbone by Ugating a blunt-ended cassette containing ⁇ ttR sites, ccdB and chloramphenicol resistance marker using the GATEWAYTM Vector Conversion System (LifeTechnologies, www.lifetech.com.).
- the GATEWAYTM cassette is located between nt 126 and 1818 of pNO V2374.
- the promoter cassettes are inserted through an LR recombination reaction whereby the DNA sequence of pNOV2374 between nt 126 and nt 1818 are removed and replaced with the promoter of interest flanked by att sequences.
- the recombination results in the promoter sequence fused to the GUS reporter gene with intron (GIG) sequence.
- the GIG gene contains the ST-LS 1 intron from Solanum tuberosum at nt 385 to nt 576 of GUS (SEQ ID NO:582) (obtained from Dr. Stanton Gelvin, and described in Narasimhulu et al, 1996). Shown below in Table 7 are the orientations of the selectable marker and promoter-reporter cassettes in the binary vector constructs. Table 7
- RB--AC9 promoter fragment (SEQ ID NO: 548)+GIG gene + nos ⁇ x -LB RB-AC11 promoter fragment (SEQ ID NO: 550)+GIG gene + nos - x -LB RB-AC12 promoter fragment (SEQ ID NO: 551)+GIG gene + nos ⁇ x -LB
- RB-AC13 promoter fragment (SEQ ID NO: 552)+GIG gene + nos ⁇ x -LB RB--AC14 promoter fragment (SEQ ID NO: 553)+GIG gene + nos - x -LB RB-AC16 promoter fragment (SEQ ID NO: 555)+GIG gene + nos - x -LB RB-AC19 promoter fragment (SEQ ID NO: 556)+GIG gene + nos - x -LB RB-AC20 promoter fragment (SEQ ID NO: 557)+GIG gene + nos - x -LB
- RB-AC21 promoter fragment (SEQ ID NO: 558)+GIG gene + nos - x -LB RB-AC23 promoter fragment (SEQ ID NO: 560)+GIG gene + nos ⁇ x -LB RB-AC31 promoter fragment (SEQ ID NO: 565)+GIG gene + nos - x -LB RB-AC32 promoter fragment (SEQ ID NO: 566)+GIG gene + nos ⁇ x --LB RB-AC34 promoter fragment (SEQ ED NO: 567)+GIG gene + nos - x -LB
- RB-AC35 promoter fragment (SEQ ID NO: 568)+GIG gene + nos - x -LB RB-AC40 promoter fragment (SEQ ID NO: 571)+GIG gene + nos - x -LB RB--AC42 promoter fragment (SEQ ID NO: 572)+GIG gene + nos ⁇ x -LB RB-AC44 promoter fragment (SEQ ID NO: 573)+GIG gene + nos - x --LB RB-AC46 promoter fragment (SEQ ID NO: 575)+GIG gene + nos - x -LB
- RB-AC47 promoter fragment (SEQ ID NO: 576)+GIG gene + nos ⁇ x -LB RB-1B-1 promoter fragment (SEQ ID NO: 578)+GIG gene + nos - x -LB RB-1G-2 promoter fragment (SEQ ID NO: 579)+GIG gene + nos - x -LB RB-lAMixl-C promoter fragment (SEQ ID NO: 577)+GIG gene + nos ⁇ x -LB RB-AR1 promoter fragment (SEQ ID NO: 536)+GIG gene + nos - x -LB
- RB--AR2 promoter fragment (SEQ ID NO: 537)+GIG gene + nos - x -LB RB--AR6 promoter fragment (SEQ ID NO: 539)+GIG gene + nos - x --LB RB--AR8 promoter fragment (SEQ ID NO: 540)+GIG gene + nos ⁇ x --LB RB--AR9 promoter fragment (SEQ ID NO: 541)+GIG gene + nos - x -LB RB-AR10 promoter fragment (SEQ ID NO: 542)+GIG gene + nos - x -LB
- Example 5 In vitro Promoter Assays and Arabidopsis Transformation Plant preparation and growth Arabidopsis seeds are sown on moistened Fafard Germinatmg Mix at a density of 9 seeds per 4" square pot, placed in a flat, covered with a plastic dome to retain moisture and moved to a growth chamber. FoUowing germination the dome is removed and plants are grown for 3-5 weeks under short days (8 hrs Ught) to encourage vegetative growth and production of large plants with many flowers. Flowering is induced by providing long days (16 hrs. Ught) for 2-3 weeks, at which time plants are ready for dip inoculation into Agrobacterium to generate transgenic plants.
- the binary promoter reporter plasmids are introduced into Agrobacteria by electroporation.
- the binary plasmid confers spectinomycin resistance to the bacteria aUowing cells containing the plasmid to be selected by growth of colonies on plates of LB + spectinomycin (50 mg/L). Presence of the correct promoter:: GUS plasmid is confirmed by sequence analysis of the plasmid DNA isolated from the bacteria.
- the Agrobacterium ceUs are resuspended in 500 mL of modified Infiltration Media (IM+MOD: 50g/L sucrose, 10 mM MgCl, 10 uM benzylaminopurine ) to which 50 ul of IM+MOD: 50g/L sucrose, 10 mM MgCl, 10 uM benzylaminopurine ) to which 50 ul of IM+MOD: 50g/L sucrose, 10 mM MgCl, 10 uM benzylaminopurine ) to which 50 ul of IM+MOD: 50g/L sucrose, 10 mM MgCl, 10 uM benzylaminopurine ) to which 50 ul of IM+MOD: 50g/L sucrose, 10 mM MgCl, 10 uM benzylaminopurine ) to which 50 ul of IM+MOD: 50g/L sucrose, 10 mM Mg
- Resuspended ceUs are poured into IL tri-pour beakers. Flowering plants are inverted into the culture, making sure aU inflorescences are covered with the bacteria. The beakers are gently agitated for 30 seconds, keeping aU inflorescence tissue submerged. Plants are returned to growth chamber foUowing dip inoculation of the Agrobacterium. A second dip may be performed 5 days later to increase transformation frequency. Seeds are harvested ⁇ 4 to 6 weeks after transformation. Selection of transgenic Arabidopsis
- Promoter activity is evaluated quaUtatively and quantitatively using histochemical and florescence assays for expression of the ⁇ -glucuronidase (GUS) enzyme.
- GUS ⁇ -glucuronidase
- GUS staining solution contains 1 mM 5-bromo-4-chloro-3-indolyl glucuronide (X-Gluc, Duchefa, 20 mM stock in DMSO), 100 mM Na-phosphate buffer pH
- GUS expression is measured fluorometricaUy. Tissue samples are harvested and ground in ice cold GUS extraction buffer (50 mM Na 2 HPO 4 pH 7.0, 5 mM DTT, 1 mM Na 2 EDTA, 0.1 %
- Triton XI 00, 0.1% sarcosyl Ground samples are spun in a microfuge at 10,000 rpm for 15 minutes at 4 °C. FoUowing centrifugation the supernatant is removed for GUS assay and for protein concentration determination.
- GUS activity is expressed as relative fluorometric units (RFU)/mg protein.
- Example 6 Determination of the minimal promoter fragment
- the fuU-length promoter sequence as given in SEQ ID Nos: 536-579, more preferably in any one of SEQ ID Nos: 536; 537; 539-542; 548; 550-553; 555-558; 560; 565-568; 571- 576, 578 and 579, or the promoter orthologs thereof is fused to the ⁇ -glucuronidase (GUS) gene at the native ATG to obtain a chimeric gene cloned into plasmid DNA.
- the plasmid DNA is then digested with restriction enzymes to release a fragment comprising the fuU-length promoter sequence and the GUS gene, which is then used to construct the binary vector.
- This binary vector is transformed into Agrobacterium tumefaciens, which is in turn used to transform Arabidopsis plants (for further detaUs of the binary vector construction see above example 4)
- the above plasmid can also be used to form a series of 5' end deletion mutants having increasingly shorter promoter fragments fused to the GUS gene at the native ATG.
- Various restriction enzymes are used to digest the plasmid DNA to obtain the binary vectors with different lengths of promoter fragments.
- a binary vector 1 is constructed with a 1,900-bp long promoter fragment; a binary vector 2 is constructed with a 1,300-bp long promoter fragment; a binary vector 3 is constructed with a 1000-bp long promoter fragment; a binary vector 4 is constructed with a 800-bp long promoter fragment; a binary vector 5 is constructed with a 700-bp long promoter fragment; a binary vector 6 is constructed with a 600-bp long promoter fragment; a binary vector 6 is constructed with a 500-bp long promoter fragment; and a binary vector 7 is constructed with a 100-bp long promoter fragment.
- these 5' end deletion mutants are also transformed into Agrobacterium tumefaciens and, in turn, Arabidopsis plants (for further detaUs of Arbabidopsis transformation and promoter assay procedures see example 5 above) .
- the presence of the correct hybrid construct in the transgenic lines is confirmed by
- Minimal promoter fragments having lengths substantiaUy less than the fuU-length promoter can therefore be operatively Unked to coding sequences to form smaUer constructs than can be formed using the fuU-length promoter.
- shorter DNA fragments are often more amenable to manipulation than longer fragments.
- the chimeric gene constructs thus formed can then be transformed into hosts such as crop plants to enable at-wiU regulation of coding sequences in the hosts.
- Each of them contains a 8-10-bp mutation located between defined positions and included in a promoter fragment as given in SEQ ID Nos: 536-579, more preferably to any one of SEQ ID Nos: 536; 537; 539-542; 548; 550-553; 555-558; 560; 565-568; 571-576, 578 and 579, or the promoter orthologs thereof.
- Each construct is transformed into Arabidopsis and GUS activity is assayed for 19 to 30 independent transgenic lines.
- the presenceof the correct hybrid consstruct in transgenic Unes is confirmed by PCR ampUfication of aU lines containing the mutant constructs and by random sampling of Unes containing the other constructs.
- Amplified fragments are digested with restriction enzyme (e.g.Xbal) and separated on high resolution agarose gels to distinguish between the different mutant constructs, constructs.
- restriction enzyme e.g.Xbal
- the effect of each mutation on promoter activity is compared to an equivalent number of transgenic Unes containing the unmutated construct. Two repetitions resulting from independent plating of seeds are carried out in every case.
- GaUie et al Nucleic Acids Res.. 15:3257 (1987). GaUie et al, The Plant CeU. 1:301 (1989).
- Graham et al Biochem. Biophys. Res. Comm.. 101:1164 (1981). Graham et al, J. Biol. Chem.. 260:6555 (1985).
- OdeU et al Mol. Gen. Genet.. 113:369 (1990). OdeU et al, Homologous Recomb. Gene SUencing Plants. 219-70, Paszkowski & Jerzy (eds) (1994).
- Staub et al EMBO I. 12:601 (1993). Staub et al, Plant CeU. 4:39 (1992).
- Vas et al Biotechnology. 11:1553 (1993). VasU et al, Mol Microbiol. 3:371 (1989).
- Table 8 provides a description of the corresponding genes for the Arabidopsis sequences which are expressed in a root-specific manner.
- AC001645.50 15981_at gbl AAB63635.il (AC001645) jasmonate inducible protein isolog [Arabidopsis thaUana]
- AC003673.201 16481_s_at pirllT01626 peroxidase (EC 1.11.1.7) ATP22a - Arabidopsis thaUana >gil3004558lgbl AAC09031.11 (AC003673) peroxidase (ATP22a) [Arabidopsis thaUana]
- AC004005.104 19390_at pirllT00681 hypothetical protein F6E13.14 - Arabidopsis thaUana >gil3212858lgblAAC23409.1l (AC004005) unknown protein [Arabidopsis thaUana]
- Dr4 [Arabidopsis thaUana]
- HSR201 like protein [Arabidopsis thaUana] Accession # Affy # Description
- Table 9 shows expression results from an acute (3 hour) response to stress, either up or down, to cold, mannitol, or salt in roots but not in leaves.
- one (SEQ ID NO: 8) did not show a response to any of the stresses
- two (SEQ ID NOs. 47 and 48) were downregulated in response to cold, mannitol and stress
- four (SEQ ID NOs:4, 7, 28 and 30) were upregulated in response to at least one of the stresses and downregulated in response to at least one of the stresses
- two (SEQ ID NOs:25 and 28) were only downregulated by salt stress.
- Table 10A-D summarize the root genes up- or down-regulated in response to cold, mannitol or salt stress.
- AC006216.26 18571_at gblAAD12681.1l (AC006216) SimUar to gil3413714 T19L18.21 putative myrosinase-binding protein from Arabidopsis thaUana BAC gblAC004747.
- ESTs gbl65870 and gblT20812 come from this gene.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Physics & Mathematics (AREA)
- Medicinal Chemistry (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- General Chemical & Material Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
Claims
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP09157913A EP2221381A3 (en) | 2000-06-23 | 2001-06-22 | Promoters for regulation of plant expression |
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US21408700P | 2000-06-23 | 2000-06-23 | |
| US21384800P | 2000-06-23 | 2000-06-23 | |
| US214087P | 2000-06-23 | ||
| US213848P | 2000-06-23 | ||
| US25869200P | 2000-12-29 | 2000-12-29 | |
| US258692P | 2000-12-29 | ||
| PCT/IB2001/001104 WO2001098480A2 (en) | 2000-06-23 | 2001-06-22 | Promoters for regulation of plant gene expression |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1294914A2 true EP1294914A2 (en) | 2003-03-26 |
Family
ID=27395919
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09157913A Withdrawn EP2221381A3 (en) | 2000-06-23 | 2001-06-22 | Promoters for regulation of plant expression |
| EP01943720A Ceased EP1294914A2 (en) | 2000-06-23 | 2001-06-22 | Promoters for regulation of plant gene expression |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP09157913A Withdrawn EP2221381A3 (en) | 2000-06-23 | 2001-06-22 | Promoters for regulation of plant expression |
Country Status (4)
| Country | Link |
|---|---|
| EP (2) | EP2221381A3 (en) |
| AU (1) | AU2001266251A1 (en) |
| CA (1) | CA2413548C (en) |
| WO (1) | WO2001098480A2 (en) |
Families Citing this family (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9029523B2 (en) * | 2000-04-26 | 2015-05-12 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| US8877916B2 (en) | 2000-04-26 | 2014-11-04 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| US10329575B2 (en) | 1999-05-14 | 2019-06-25 | Ceres, Inc. | Regulatory sequence for plants |
| US20100017918A1 (en) * | 2000-06-23 | 2010-01-21 | Syngenta Participations Ag | Arabidopsis derived promoters for regulation of plant expression |
| US7615624B2 (en) * | 2000-06-23 | 2009-11-10 | Syngenta Participations Ag | Arabidopsis derived promoters for regulation of plant expression |
| JP4113952B2 (en) * | 2002-03-22 | 2008-07-09 | 独立行政法人農業・食品産業技術総合研究機構 | Functional plant, promoter used to produce the functional plant, and use thereof |
| CN1748032B (en) * | 2003-02-04 | 2012-07-18 | 作物培植股份有限公司 | Rice promoters |
| CA2630024A1 (en) * | 2003-02-27 | 2004-09-10 | Cropdesign N.V. | Arabidopsis promoters |
| GB0312449D0 (en) * | 2003-05-30 | 2003-07-09 | Horticulture Res Internat | Novel promoters |
| EP1711612B1 (en) | 2003-07-22 | 2007-07-25 | SunGene GmbH | Expression cassettes for the bi-directional transgenic expression of nucleic acids in plants |
| US7402667B2 (en) | 2003-10-14 | 2008-07-22 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| US11634723B2 (en) | 2003-09-11 | 2023-04-25 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| US20130117881A1 (en) * | 2003-10-14 | 2013-05-09 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| WO2009099899A2 (en) * | 2008-02-01 | 2009-08-13 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and use thereof |
| US11739340B2 (en) | 2003-09-23 | 2023-08-29 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| WO2005118818A1 (en) * | 2004-05-27 | 2005-12-15 | Ceres, Inc. | Nucleotide sequences and polypeptides encoded thereby useful for modifying plant characteristics |
| EP1794310A4 (en) * | 2004-08-25 | 2010-07-21 | Monsanto Technology Llc | NON-ENCODING REGULATORS OF ASPARTIC PROTEINASE PROTEIN GENES FOR USE IN PLANTS |
| EP2166098B1 (en) * | 2004-10-05 | 2013-11-06 | SunGene GmbH | Constitutive expression cassettes for regulation of plant expression |
| EP2163634A1 (en) * | 2004-12-08 | 2010-03-17 | SunGene GmbH | Expression cassettes for vascular tissue-preferential expression in plants |
| ATE447034T1 (en) | 2004-12-08 | 2009-11-15 | Sungene Gmbh | EXPRESSION CASSETTES FOR PREFERENTIAL VASCULAR EXPRESSION IN PLANTS |
| US7855164B1 (en) | 2005-02-22 | 2010-12-21 | Mendel Biotechnology, Inc. | Screening methods employing stress-related promoters |
| WO2006103211A2 (en) * | 2005-03-30 | 2006-10-05 | Basf Plant Science Gmbh | Expression cassettes for seed-preferential expression in plants |
| DE102005021365A1 (en) * | 2005-05-04 | 2006-11-09 | Sungene Gmbh & Co. Kgaa | Transgenic expression cassettes for expression of nucleic acids in flower tissues of plants |
| US7655786B2 (en) | 2006-03-15 | 2010-02-02 | E.I. Du Pont De Nemours And Company | Gene expression modulating element |
| US12331304B2 (en) | 2008-02-01 | 2025-06-17 | Ceres, Inc. | Promoter, promoter control elements, and combinations, and uses thereof |
| PT2262896E (en) | 2008-04-07 | 2014-04-28 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| CA2772267A1 (en) | 2009-08-31 | 2011-03-03 | Basf Plant Science Company Gmbh | Regulatory nucleic acid molecules for enhancing seed-specific gene expression in plants promoting enhanced polyunsaturated fatty acid synthesis |
| EP3156491B1 (en) | 2009-08-31 | 2019-10-09 | BASF Plant Science Company GmbH | Regulatory nucleic acid molecules for enhancing seed-specific and/or seed-preferential gene expression in plants |
| CN109468339B (en) * | 2009-08-31 | 2022-11-04 | 巴斯夫植物科学有限公司 | Regulatory nucleic acid molecules for enhancing constitutive gene expression in plants |
| US9447423B2 (en) * | 2010-07-09 | 2016-09-20 | Monsanto Technology Llc | Regulatory polynucleotides and uses thereof |
| MX2015012811A (en) * | 2013-03-15 | 2016-02-03 | Syngenta Participations Ag | Guard cell expression cassettes compositions and methods of use thereof. |
| CN107614516A (en) | 2015-05-11 | 2018-01-19 | 非凡食品有限公司 | Expression construct and method for genetic engineering transformation methylotrophic yeast |
| CN105087590B (en) * | 2015-09-23 | 2017-10-20 | 安徽省农业科学院水稻研究所 | A kind of promoter element POsCold8 and its application method and application |
| WO2018102721A1 (en) * | 2016-12-02 | 2018-06-07 | City Of Hope | Transgenic plants with upregulated heme biosynthesis |
| CR20240086A (en) | 2017-01-19 | 2024-09-30 | Monsanto Technology Llc | Plant regulatory elements and uses thereof |
| AU2019406778A1 (en) | 2018-12-17 | 2021-07-22 | Massachusetts Institute Of Technology | Crispr-associated transposase systems and methods of use thereof |
| KR20220004090A (en) | 2019-04-25 | 2022-01-11 | 임파서블 푸즈 인크. | Strains and methods for the production of heme-containing proteins |
| US20220213469A1 (en) | 2019-04-30 | 2022-07-07 | The Broad Institute, Inc. | Methods and compositions for barcoding nucleic acid libraries and cell populations |
| US20220249701A1 (en) | 2019-05-14 | 2022-08-11 | The Broad Institute, Inc. | Compositions and methods for targeting multinucleated cells |
| WO2020243371A1 (en) | 2019-05-28 | 2020-12-03 | Massachusetts Institute Of Technology | Methods and compositions for modulating immune responses |
| CN113296009B (en) * | 2021-04-23 | 2023-03-14 | 重庆大学 | A method for predicting and recombining the remaining life of decommissioned power lithium-ion batteries |
| CN114231535B (en) * | 2021-11-26 | 2023-08-25 | 广东省科学院南繁种业研究所 | Application of cassava MeRSZ21b gene in improving drought stress resistance of plants |
| CN114717352B (en) * | 2022-01-28 | 2023-11-17 | 上海市农业生物基因中心 | Molecular marker of rice high temperature resistant regulatory gene Hsp70 and application thereof |
| CN116284442B (en) * | 2023-02-08 | 2023-10-17 | 中国农业科学院生物技术研究所 | Fusion protein for controlling leaf color and application of fusion protein in research on interaction of plant transcription factors and DNA |
| CN117721111B (en) * | 2023-12-19 | 2024-06-07 | 海南省海洋与渔业科学院 | Mangrove plant avicennia marina endogenous promoter AMGT P5 and application thereof |
| CN118834985B (en) * | 2024-07-22 | 2025-04-18 | 福建省农业科学院作物研究所(福建省种质资源中心) | An internal reference gene for detecting and analyzing genes related to camellia fragrance formation and its application |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR910700346A (en) * | 1988-12-16 | 1991-03-14 | 제임스 제이. 플라인 | Overexpression of chitinase in transgenic plants |
| US5459252A (en) * | 1991-01-31 | 1995-10-17 | North Carolina State University | Root specific gene promoter |
| GB9524395D0 (en) * | 1995-11-29 | 1996-01-31 | Nickerson Biocem Ltd | Promoters |
| AU720780B2 (en) * | 1997-01-20 | 2000-06-15 | Plant Genetic Systems N.V. | Pathogen-induced plant promoters |
| BR9908624A (en) * | 1998-03-11 | 2000-11-14 | Novartis Ag | Plant plastid promoter sequence |
| CA2323789A1 (en) * | 1998-04-09 | 1999-10-21 | Arizona Board Of Regents, Acting On Behalf Of Arizona State University | Expression of alfin1 and methods for producing transgenic plants having increased root growth and root specific gene activation |
| US6433249B1 (en) * | 1998-11-10 | 2002-08-13 | Pioneer Hi-Bred International, Inc. | Use of β-glucosidase to enhance disease resistance and resistance to insects in crop plants |
-
2001
- 2001-06-22 WO PCT/IB2001/001104 patent/WO2001098480A2/en not_active Ceased
- 2001-06-22 EP EP09157913A patent/EP2221381A3/en not_active Withdrawn
- 2001-06-22 EP EP01943720A patent/EP1294914A2/en not_active Ceased
- 2001-06-22 AU AU2001266251A patent/AU2001266251A1/en not_active Abandoned
- 2001-06-22 CA CA2413548A patent/CA2413548C/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0198480A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2221381A3 (en) | 2010-10-27 |
| WO2001098480A8 (en) | 2005-05-19 |
| WO2001098480A3 (en) | 2003-01-09 |
| WO2001098480A2 (en) | 2001-12-27 |
| AU2001266251A1 (en) | 2002-01-02 |
| CA2413548A1 (en) | 2001-12-27 |
| CA2413548C (en) | 2015-12-22 |
| EP2221381A2 (en) | 2010-08-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2413548C (en) | Root-specific promoter from arabidopsis | |
| US8115058B2 (en) | Rice promoters for regulation of plant expression | |
| US8426576B2 (en) | Arabidopsis derived promoters for regulation of plant expression | |
| US7777097B2 (en) | Plant disease resistance genes | |
| US20030135888A1 (en) | Genes that are modulated by posttranscriptional gene silencing | |
| US8436162B2 (en) | Arabidopsis derived promoters for regulation of plant expression | |
| WO2003007699A2 (en) | Transcription factors of cereals | |
| US20050235375A1 (en) | Transcription factors of cereals | |
| AU2005242196B2 (en) | Expression cassettes for meristem-preferential expression in plants | |
| US7186887B2 (en) | Nucleic acids encoding oryza sativa nuclear cap binding protein 80 and methods of use | |
| AU2005247022B2 (en) | Promoters for regulation of plant gene expression | |
| WO2002081695A2 (en) | Genes that are modulated by posttranscriptional gene silencing | |
| AU2002302504A1 (en) | Oryza sativa nuclear cap binding protein 80 | |
| AU2011200429B2 (en) | Expression cassettes for root-preferential expression in plants | |
| EP1669455B1 (en) | Expression cassettes for vascular tissue-preferential expression in plants | |
| EP1662001B1 (en) | Expression cassettes for root-preferential expression in plants | |
| AU2011200965A1 (en) | Expression cassettes for vascular tissue-preferential expression in plants | |
| EP1399561A2 (en) | Plant disease resistance genes | |
| AU2006228605A1 (en) | Expression cassettes for seed-preferential expression in plants |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20021207 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: COOPER, BRET Inventor name: WANG, XUN Inventor name: HAN, BIN Inventor name: ZHU, TONG Inventor name: CHANG, HUR-SONG Inventor name: BROWN, DEVON Inventor name: BUDWORTH, PAUL |
|
| 17Q | First examination report despatched |
Effective date: 20060927 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED |
|
| 18R | Application refused |
Effective date: 20090518 |