EP1292323A1 - Inhibition of smad3 to prevent fibrosis and improve wound healing - Google Patents
Inhibition of smad3 to prevent fibrosis and improve wound healingInfo
- Publication number
- EP1292323A1 EP1292323A1 EP00932586A EP00932586A EP1292323A1 EP 1292323 A1 EP1292323 A1 EP 1292323A1 EP 00932586 A EP00932586 A EP 00932586A EP 00932586 A EP00932586 A EP 00932586A EP 1292323 A1 EP1292323 A1 EP 1292323A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- smad3
- tgf
- wound healing
- gene
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
- A61P17/02—Drugs for dermatological disorders for treating wounds, ulcers, burns, scars, keloids, or the like
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P19/00—Drugs for skeletal disorders
- A61P19/04—Drugs for skeletal disorders for non-specific disorders of the connective tissue
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
Definitions
- the invention is related to inhibition of Smad3 to prevent fibrosis and improve wound healing.
- Smad3 and Smad3 are intracellular mediators of TGF- ⁇ function, acting as nuclear transcriptional activators (Massague, J. TGF-beta signal transduction. Annu. Rev. Biochem. 67, 753-791 (1998)); (Derynck, R., Zhang Y. & Feng, X. H. Smads: transcriptional activators of TGF-beta responses. Ce// 95, 737- 740 (1998)).
- Smad2 and Smad3 mediate intracellular signaling from TGF- ⁇ s 1, 2, 3 and activin, each of which has been implicated as an important factor in the cellular proliferation, differentiation and migration pivotal to cutaneous wound healing (Roberts, A. B.
- TGF-beta activity and efficacy in animal models of wound healing. Wound Repair Regen. 3, 408-418 (1995)); (O'Kane, S. & Ferguson, M. W. J. TGF-beta s and wound healing. Int. J. Biochem. Cell Biol. 29, 63-78 (1997)).
- Mice null for Smad3 Smad3 ex8t ⁇ l8 mice survive into adulthood, unlike Smad2-null mice which do not survive embryogenesis (Yang, X. et al. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J. 188, 1280-1291 (1999)); (Datto, M. B.
- Smad3 e ⁇ ,8 ' x8 keratinocytes showed altered patterns of growth and migration, and Smad3 ex8,ex8 monocytes exhibited a selectively blunted chemotactic response to TGF- ⁇ .
- FIG. 3 Smad3 is required for TGF- ⁇ induced monocyte chemotaxis and TGF- ⁇ expression
- a Smad3-null monocytes showed a significant decrease in chemotaxis to TGF- ⁇ 1 compared with wild-type cells but a normal response to the classical chemoattractant fMet-Leu-Phe (fMet).
- Data shown are the means ⁇ s.e.m. of five experiments. * P ⁇ 0.01 compared with media alone, b. Impaired upregulation of TGF- ⁇ 1 expression by TGF- ⁇ itself in Smad3-null monocytes. Data shown are the means ⁇ s.e.m. of four experiments. * P ⁇ 0.01 compared with media alone.
- Smad3 is a member of the Smad family of cytoplasmic proteins that functions to mediate signals from TGF- ⁇ and activin receptors to promoters of target genes in the nucleus. To identify selective pathways downstream of the Smad3
- mice in which the Smad3 gene has been disrupted by homologous recombination have been disrupted by homologous recombination.
- the data indicate that the disruption of the Smad3 pathway in vivo, optionally coupled with exogenous TGF signalling through intact alternative pathways, is to be of therapeutic benefit in accelerating all aspects of impaired wound healing.
- Smad3 inhibitors as anti-fibrotic agents that have a protective effect against induction of fibrosis.
- the data indicate that Smad3 null mice are protected from fibrosis in response to high dose radiation.
- Inhibitors of Smad3 are to have clinical application in prevention of fibrosis, including radiation-induced fibrosis. Definitions
- isolated requires that a material be removed from its original environment (e.g., the natural environment if it is naturally occurring).
- a naturally occurring polynucleotide or polypeptide present in a living cell is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
- purified does not require absolute purity; rather it is intended as a relative definition, with reference to the purity of the material in its natural state. Purification of natural material to at least one order of magnitude, preferably two or three magnitudes, and more preferably four or five orders of magnitude is expressly contemplated.
- enriched means that the concentration of the material is at least about 2, 5, 10, 100, or 1000 times its natural concentration (for example), advantageously 0.01 % by weight. Enriched preparations of about 0.5%, 1 %, 5%, 10%, and 20% by weight are also contemplated.
- Smadl, 5, and Smad ⁇ all mediate signal transduction from BMPs, while Smad2 and Smad3 mediate signal transduction from TGF- ⁇ s and activins.
- Smad4 has been shown to be a shared hetero- oligomerization partner to the pathway-restricted Smads and is known as the common mediator.
- S ad ⁇ and 7 act to inhibit the Smad signaling cascades often by forming unproductive dimers with other Smads and therefore classified as antagonistic Smads (Heldin et al., Nature, 1997, 390, 465-471; Kretzschmar and Massague, Curr. Opin. Genet. Dev., 1998, 8, 103-111).
- GenBank accession number U68019 and provided as SEQ ID N0:1.
- the deduced amino acid sequence is provided as SEQ ID N0:2.
- the genomic sequence is also known.
- the Smad3 nucleotide sequences of the invention include: (a) the cDNA sequence given in SEQ ID N0:1; (b) the nucleotide sequence that encodes the amino acid sequence given in SEQ ID N0:2; (c) any nucleotide sequence that hybridizes to the complement of the cDNA sequence given in SEQ ID N0:1 under highly stringent conditions, e.g., hybridization to filter-bound DNA in 0.5 M NaHP04, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65° C, and washing in O.l .times. SSC/0.1 % SDS at 68° C. (Ausubel F. M.
- Smad3 include naturally occurring Smad3 present in other species, and mutant Smad3s whether naturally occurring or engineered.
- the invention also includes degenerate variants of sequences (a) through (d).
- the invention also includes nucleic acid molecules, preferably DNA molecules, that hybridize to, and are therefore the complements of, the nucleotide sequences (a) through (d), in the preceding paragraph.
- Such hybridization conditions may be highly stringent or less highly stringent, as described above.
- highly stringent conditions may refer, e.g., to washing in 6X SSC/0.05% sodium pyrophosphate at 37° C.
- Smad3 antisense molecules useful, for example, in Smad3 gene regulation (for and/or as antisense primers in amplification reactions of Smad3 gene nucleic acid sequences).
- Smad3 gene regulation such techniques can be used to regulate, for example, radiation-induced fibrosis and/or cutaneous wound healing. Further, such sequences may be used as part of ribozyme and/or triple helix sequences, also useful for Smad3 gene regulation.
- Smad3 nucleotide sequences described above full length Smad3 cDNA or gene sequences present in the same species and/or homologs of the Smad3 gene present in other species can be identified and readily isolated, without undue experimentation, by molecular biological techniques well known in the art.
- the identification of homologs of Smad3 in related species can be useful for developing animal model systems more closely related to humans for purposes of drug discovery.
- expression libraries of cDNAs synthesized from mRNA derived from the organism of interest can be screened using labeled TGF- ⁇ or activin receptors (or Smads involved in forming dimers with Smad3) derived from that species.
- cDNA libraries or genomic DNA libraries derived from the organism of interest can be screened by hybridization using the nucleotides described herein as hybridization or amplification probes.
- genes at other genetic loci within the genome that encode proteins which have extensive homology to one or more domains of the Smad3 gene product can also be identified via similar techniques.
- screening techniques can identify clones derived from alternatively spliced transcripts in the same or different species.
- Screening can be by filter hybridization, using duplicate filters.
- the labeled probe can contain at least 15-30 base pairs of the Smad3 cDNA sequence.
- the hybridization washing conditions used should be of a lower stringency when the cDNA library is derived from an organism different from the type of organism from which the labeled sequence was derived.
- hybridization can, for example, be performed at 65° C. overnight in Church's buffer (7% SDS, 250 mM NaHP04, 2 ⁇ U EDTA, 1 % BSA). Washes can be done with 2X SSC, 0.1 % SDS at 65°C.
- Low stringency conditions are well known to those of skill in the art, and will vary predictably depending on the specific organisms from which the library and the labeled sequences are derived. For guidance regarding such conditions see, for example, Sambrook et al., 1989, Molecular Cloning, A Laboratory Manual, Cold Springs Harbor Press, N.Y.; and Ausubel et al., 1989, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y.
- the labeled Smad3 nucleotide probe may be used to screen a genomic library derived from the organism of interest, again, using appropriately stringent conditions.
- sequences derived from regions adjacent to the intron/exon boundaries of the human gene can be used to design primers for use in amplification assays to detect mutations within the exons, introns, splice sites (e.g. splice acceptor and/or donor sites), etc.
- a Smad3 gene homolog may be isolated from nucleic acid of the organism of interest by performing PCR using two degenerate oligonucleotide primer pools designed on the basis of amino acid sequences within the Smad3 gene product disclosed herein.
- the template for the reaction may be cDNA obtained by reverse transcription of mRNA prepared from, for example, human or non-human cell lines or tissue known or suspected to express a Smad3 gene allele.
- the PCR product may be subcloned and sequenced to ensure that the amplified sequences represent the sequences of a Smad3 gene.
- the PCR fragment may then be used to isolate a full length cDNA clone by a variety of methods.
- the amplified fragment may be labeled and used to screen a cDNA library, such as a bacteriophage cDNA library.
- the labeled fragment may be used to isolate genomic clones via the screening of a genomic library.
- RNA may be isolated, following standard procedures, from an appropriate cellular or tissue source (i.e., one known, or suspected, to express the Smad3gene).
- a reverse transcription reaction may be performed on the RNA using an oligonucleotide primer specific for the most 5" end of the amplified fragment for the priming of first strand synthesis.
- the resulting RNA/DNA hybrid may then be "tailed" with guanines using a standard terminal transf erase reaction, the hybrid may be digested with RNAase H, and second strand synthesis may then be primed with a poly-C primer.
- cDNA sequences upstream of the amplified fragment may easily be isolated.
- the Smad3 gene sequences may additionally be used to isolate mutant Smad3 gene alleles. Such mutant alleles may be isolated from individuals either known or proposed to have a genotype which contributes to fibrosis and or wound healing. Mutant alleles and mutant allele products may then be utilized in the therapeutic systems described below. Additionally, such Smad3 gene sequences can be used to detect Smad3 gene regulatory (e.g., promoter or promotor/enhancer) defects which can affect fibrosis or wound healing.
- Smad3 gene regulatory e.g., promoter or promotor/enhancer
- a cDNA of a mutant Smad3 gene may be isolated, for example, by using PCR, a technique which is well known to those of skill in the art.
- the first cDNA strand may be synthesized by hybridizing an oligo-dT oligonucleotide to mRNA isolated from tissue known or suspected to be expressed in an individual putatively carrying the mutant Smad3 allele, and by extending the new strand with reverse transcriptase.
- the second strand of the cDNA is then synthesized using an oligonucleotide that hybridizes specifically to the 5' end of the normal gene.
- the product is then amplified via PCR, cloned into a suitable vector, and subjected to DNA sequence analysis through methods well known to those of skill in the art.
- a genomic library can be constructed using DNA obtained from an individual suspected of or known to carry the mutant Smad3 allele, or a cDNA library can be constructed using RNA from a tissue known, or suspected, to express the mutant Smad3 allele.
- the normal Smad3 gene or any suitable fragment thereof may then be labeled and used as a probe to identify the corresponding mutant Smad3 allele in such libraries.
- Clones containing the mutant Smad3 gene sequences may then be purified and subjected to sequence analysis according to methods well known to those of skill in the art.
- an expression library can be constructed utilizing cDNA synthesized from, for example, RNA isolated from a tissue known, or suspected, to express a mutant Smad3 allele in an individual suspected of or known to carry such a mutant allele.
- gene products made by the putatively mutant tissue may be expressed and screened using standard antibody screening techniques in conjunction with antibodies raised against the normal Smad3 gene product, as described, below, in the sections.
- screening techniques see, for example, Harlow, E. and Lane, eds., 1988, "Antibodies: A Laboratory Manual", Cold Spring Harbor Press, Cold Spring Harbor.
- screening can be accomplished by screening with labeled Smad3 fusion proteins.
- a polyclonal set of antibodies to Smad3 are likely to cross-react with the mutant Smad3 gene product.
- Library clones detected via their reaction with such labeled antibodies can be purified and subjected to sequence analysis according to methods well known to those of skill in the art.
- the invention also encompasses nucleotide sequences that encode mutant Smad3s, peptide fragments of
- Smad3, truncated Smad3s, and Smad3 fusion proteins include, but are not limited to nucleotide sequences encoding mutant Smad3s described in subsequent sections or peptides corresponding to a domain of Smad3 or portions of these domains; truncated Smad3s in which one or two of the domains is deleted, or a truncated, nonfunctional Smad3 lacking all or a portion of a domain.
- Nucleotides encoding fusion proteins may include but are not limited to full length Smad3, truncated Smad3 or peptide fragments of Smad3 fused to an unrelated protein or peptide, such as for example, a transmembrane sequence, which anchors the Smad3 to the cell membrane; an lg Fc domain which increases the stability and half life of the resulting fusion protein in the bloodstream; or an enzyme, fluorescent protein, luminescent protein which can be used as a marker.
- the invention also encompasses (a) DNA vectors that contain any of the foregoing Smad3 coding sequences and/or their complements (i.e., antisense); (b) DNA expression vectors that contain any of the foregoing Smad3 coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences; and (c) genetically engineered host cells that contain any of the foregoing Smad3 coding sequences operatively associated with a regulatory element that directs the expression of the coding sequences in the host cell.
- regulatory elements include but are not limited to inducible and non-inducible promoters, enhancers, operators and other elements known to those skilled in the art that drive and regulate expression.
- Such regulatory elements include but are not limited to the cytomegalovirus hCMV immediate early gene, the early or late promoters of SV40 adenovirus, the lac system, the trp system, the TAC system, the TRC system, the major operator and promoter regions of phage A, the control regions of fd coat protein, the promoter for 3-phosphoglycerate kinase, the promoters of acid phosphatase, and the promoters of the yeast ⁇ -mating factors.
- Particular polynucleotides are DNA sequences having three sequential nucleotides, four sequential nucleotides, five sequential nucleotides, six sequential nucleotides, seven sequential nucleotides, eight sequential nucleotides, nine sequential nucleotides, ten sequential nucleotides, eleven sequential nucleotides, twelve sequential nucleotides, thirteen sequential nucleotides, fourteen sequential nucleotides, fifteen sequential nucleotides, sixteen sequential nucleotides, seventeen sequential nucleotides, eighteen sequential nucleotides, nineteen sequential nucleotides, twenty sequential nucleotides, twenty-one, twenty-two, twenty-three, twenty -four, twenty-five, twenty- six, twenty-seven, twenty-eight, twenty-nine, thirty, thirty-one, thirty-two, thirty-three, thirty-four, thirty-five, thirty- six, thirty-seven, thirty-eight, thirty-nine, forty, forty-one, forty-two, forty-
- Smad3 protein, polypeptides and peptide fragments, mutated, truncated or deleted forms of Smad3 and/or Smad3 fusion proteins can be prepared for a variety of uses, including but not limited to the generation of antibodies, as reagents for research purposes, or the identification of other cellular gene products involved in the regulation of fibrosis and wound healing, as reagents in assays for screening for compounds that can be used in the prevention of fibrosis and improvement of wound healing, and as pharmaceutical reagents useful in protecting against fibrosis and improving wound healing related to Smad3.
- Smad3 amino acid sequences of the invention include the amino acid sequence, or the amino acid sequence encoded by the cDNA or encoded by the gene. Further, Smad3 of other species are encompassed by the invention. In fact, any Smad3 encoded by the Smad3 nucleotide sequences described in the sections above are within the scope of the invention.
- the invention also encompasses proteins that are functionally equivalent to Smad3 encoded by the nucleotide sequences described in the above sections, as judged by any of a number of criteria, including but not limited to the ability to bind TGF- ⁇ or activin receptors or Smads involved in forming dimers with Smad3, the binding affinity for these ligands, the resulting biological effect of Smad3 binding, e.g., signal transduction, a change in cellular metabolism or change in phenotype when the Smad3 equivalent is present in an appropriate cell type, or the regulation of fibrosis or wound healing.
- Such functionally equivalent Smad3 proteins include but are not limited to additions or substitutions of amino acid residues within the amino acid sequence encoded by the Smad3 nucleotide sequences described in the sections above, but which result in a silent change, thus producing a functionally equivalent gene product.
- Amino acid substitutions may be made on the basis of similarity in polarity, charge, solubility, hydrophobicity, hydrophilicity, and/or the amphipathic nature of the residues involved.
- nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, proline, phenylalanine, tryptophan, and methionine;
- polar neutral amino acids include glycine, serine, threonine, cysteine, tyrosine, asparagine, and glutamine;
- positively charged (basic) amino acids include arginine, lysine, and histidine; and negatively charged (acidic) amino acids include aspartic acid and glutamic acid.
- mutant Smad3s While random mutations can be made to Smad3 DNA (using random mutagenesis techniques well known to those skilled in the art) and the resulting mutant Smad3s tested for activity, site-directed mutations of the Smad3 coding sequence can be engineered (using site-directed mutagenesis techniques well known to those skilled in the art) to generate mutant Smad3s with altered function, e.g., different binding affinity for TGF- ⁇ or activin receptors or Smads involved in forming dimers with Smad3, and/or different signalling capacity.
- site-directed mutations of the Smad3 coding sequence can be engineered (using site-directed mutagenesis techniques well known to those skilled in the art) to generate mutant Smad3s with altered function, e.g., different binding affinity for TGF- ⁇ or activin receptors or Smads involved in forming dimers with Smad3, and/or different signalling capacity.
- identical amino acid residues of a mouse form of Smad3 and the human Smad3 homolog can be aligned so that regions of identity are maintained, whereas the variable residues are altered, e.g., by deletion or insertion of an amino acid residue(s) or by substitution of one or more different amino acid residues.
- Conservative alterations at the variable positions can be engineered in order to produce a mutant Smad3 that retains function; e.g., ligand binding affinity or signal transduction capability or both.
- Non-conservative changes can be engineered at these variable positions to alter function, e.g., ligand binding affinity or signal transduction capability, or both.
- deletion or non-conservative alterations of the conserved regions can be engineered.
- deletion or non-conservative alterations (substitutions or insertions) of a domain can be engineered to produce a mutant Smad3 that binds a ligand but is signalling-incompetent.
- Non- conservative alterations to residues of identical amino acids can be engineered to produce mutant Smad3s with altered binding affinity for ligands.
- the same mutation strategy can also be used to design mutant Smad3s based on the alignment of other non-human Smad3s and the human Smad3 homolog by aligning identical amino acid residues.
- Smad3 coding sequence can be made to generate Smad3s that are better suited for expression, scale up, etc. in the host cells chosen.
- cysteine residues can be deleted or substituted with another amino acid in order to eliminate disulfide bridges; N-linked glycosylation sites can be altered or eliminated to achieve, for example, expression of a homogeneous product that is more easily recovered and purified from yeast hosts which are known to hyperglycosylate N-linked sites.
- Peptides corresponding to one or more domains of Smad3, as well as fusion proteins in which the full length Smad3, a Smad3 peptide or truncated Smad3 is fused to an unrelated protein are also within the scope of the invention and can be designed on the basis of the Smad3 nucleotide and Smad3 amino acid sequences given in SEQ ID NO: 1
- Such fusion proteins include but are not limited to IgFc fusions which stabilize the Smad3 protein or peptide and prolong half-life in vivo; or fusions to any amino acid sequence that allows the fusion protein to be anchored to the cell membrane; or fusions to an enzyme, fluorescent protein, or luminescent protein which provide a marker function. While the Smad3 polypeptides and peptides can be chemically synthesized (e.g., see Creighton, 1983,
- large polypeptides derived from Smad3 and the full length Smad3 itself may advantageously be produced by recombinant DNA technology using techniques well known in the art for expressing nucleic acid containing Smad3 gene sequences and/or coding sequences.
- Such methods can be used to construct expression vectors containing the Smad3 nucleotide sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination. See, for example, the techniques described in Sambrook et al., 1989, supra, and Ausubel et al., 1989, supra.
- RNA capable of encoding Smad3 nucleotide sequences may be chemically synthesized using, for example, synthesizers. See, for example, the techniques described in "Oligonucleotide Synthesis", 1984, Gait, M. J. ed., IRL Press, Oxford.
- a variety of host-expression vector systems may be utilized to express the Smad3 nucleotide sequences of the invention.
- the peptide or polypeptide can be recovered from the culture, ie., from the host cell in cases where the Smad3 peptide or polypeptide is not secreted, and from the culture media in cases where the Smad3 peptide or polypeptide is secreted by the cells.
- the expression systems also encompass engineered host cells that express the Smad3 or functional equivalents in situ, i.e., anchored in the cell membrane. Purification or enrichment of the Smad3 from such expression systems can be accomplished using appropriate detergents and lipid micelles and methods well known to those skilled in the art. However, such engineered host cells themselves may be used in appropriate situations.
- the expression systems that may be used for purposes of the invention include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid
- DNA or cosmid DNA expression vectors containing Smad3 nucleotide sequences yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing the Smad3 nucleotide sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing the Smad3 sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing Smad3 nucleotide sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.
- a number of expression vectors may be advantageously selected depending upon the use intended for the Smad3 gene product being expressed.
- vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
- Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., 1983, EMBO J. 2:1791), in which the Smad3 coding sequence may be ligated individually into the vector in frame with the lacZ coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, 1985, Nucleic
- pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S-transferase (GST).
- GST glutathione S-transferase
- fusion proteins are soluble and can easily be purified from lysed cells by adsorption to glutathione-agarose beads followed by elution in the presence of free glutathione.
- the PGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
- Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes.
- the virus grows in Spodoptera frugiperda cells.
- the Smad3 gene coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).
- Successful insertion of Smad3 gene coding sequence will result in inactivation of the polyhedrin gene and production of non-occluded recombinant virus, (i.e., virus lacking the proteinaceous coat coded for by the polyhedrin gene).
- the Smad3 nucleotide sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
- This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non-essential region of the viral genome (e.g., region E1 or E3) will result in a recombinant virus that is viable and capable of expressing the Smad3 gene product in infected hosts.
- Specific initiation signals may also be required for efficient translation of inserted Smad3 nucleotide sequences. These signals include the ATG initiation codon and adjacent sequences. In cases where an entire Smad3 gene or cDNA, including its own initiation codon and adjacent sequences, is inserted into the appropriate expression vector, no additional translational control signals may be needed. However, in cases where only a portion of the Smad3 coding sequence is inserted, exogenous translational control signals, including, perhaps, the ATG initiation codon, must be provided.
- initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert.
- exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic.
- the efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (See Bittner et al., 1987, Methods in Enzymol. 153:516-544).
- a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
- Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
- eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
- mammalian host cells include but are not limited to CHO, VERO, BHK, HeLa, COS, MDCK, 293, 3T3, and WI38.
- cell lines which stably express the Smad3 sequences described above may be engineered.
- host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
- appropriate expression control elements e.g., promoter, enhancer sequences, transcription terminators, polyadenylation sites, etc.
- engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
- the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
- This method may advantageously be used to engineer cell lines which express the Smad3 gene product.
- Such engineered cell lines may be particularly useful in screening and evaluation of compounds that affect the endogenous activity of the Smad3 gene product.
- a number of selection systems may be used, including but not limited to the herpes simplex virus thymidine kinase (Wigler, et al., 1977, Cell 11 :223), hypoxanthine-guanine phosphoribosyltransf erase (Szybalska & Szybalski,
- genes can be employed in tk-, hgprt- or aprt- cells, respectively.
- antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci.
- any fusion protein may be readily purified by utilizing an antibody specific for the fusion protein being expressed.
- a system described by Janknecht et al. allows for the ready purification of non- denatured fusion proteins expressed in human cell lines (Janknecht, et al., 1991, Proc. Natl. Acad. Sci. USA 88: 8972- 8976).
- the gene of interest is subcloned into a vaccinia recombination plasmid such that the gene's open reading frame is translationally fused to an amino-terminal tag consisting of six histidine residues.
- Extracts from cells infected with recombinant vaccinia virus are loaded onto Ni2+.nitriloacetic acid-agarose columns and histidine- tagged proteins are selectively eluted with imidazole-containing buffers.
- the Smad3 gene products can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, guinea pigs, pigs, micro-pigs, goats, and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate Smad3 transgenic animals.
- Particular polypeptides are amino acid sequences having three sequential residues, four sequential residues, five sequential residues, six sequential residues, seven sequential residues, eight sequential residues, nine sequential residues, ten sequential residues, eleven sequential residues, twelve sequential residues, thirteen sequential residues, fourteen sequential residues, fifteen sequential residues, sixteen sequential residues, seventeen sequential residues, eighteen sequential residues, nineteen sequential residues, twenty sequential residues, twenty-one, twenty-two, twenty-three, twenty-four, twenty-five, twenty-six, twenty-seven, thirty, forty, fifty, sixty, seveny, eighty, ninety, or more sequential residues.
- the following assays are designed to identify compounds that inhibit Smad3, compounds that interfere with the interaction of Smad3 with intracellular proteins, and compounds that interfere with the interaction of Smad3 with transmembrane proteins, e.g., TGF- ⁇ and activin receptors, and compounds which inhibit the activity of the Smad3 gene or modulate the level of Smad3.
- Assays may additionally be utilized which identify compounds which bind to Smad3 gene regulatory sequences (e.g., promoter sequences) and which may inhibit Smad3 gene expression.
- Assays may additionally be utilized to identify compounds which interfere with the interaction of Smad3 with promoters of target genes.
- the compounds which may be screened in accordance with the invention include, but are not limited to peptides, antibodies and fragments thereof, and other organic compounds (e.g., peptidomimetics) that bind to Smad3, or to intracellular proteins that interact with Smad 3, or to transmembrane proteins that interact with Smad3, and inhibit the activity triggered by Smad3 or mimic the inhibitors of Smad3; as well as peptides, antibodies or fragments thereof, and other organic compounds that mimic the ligands of Smad3 (or a portion thereof) and bind to and "neutralize" Smad3.
- organic compounds e.g., peptidomimetics
- Such compounds may include, but are not limited to, peptides such as, for example, soluble peptides, including but not limited to members of random peptide libraries; (see, e.g., Lam, K. S. et al., 1991, Nature 354:82-84;
- Other compounds which can be screened in accordance with the invention include but are not limited to small organic molecules that affect the expression of the Smad3 gene or some other gene balancing the interaction of intracellular proteins with Smad3 or the interaction of transmembrane proteins with Smad3 (e.g., by interacting with the regulatory region or transcription factors involved in gene expression); or such compounds that affect the activity of Smad3 or the activity of some other intracellular protein that interacts with Smad3 or of some other transmembrane protein that interacts with Smad3 or of promoters of target genes regulated by Smad3.
- Such active sites might typically be ligand binding sites, such as the interaction domains of the ligand with Smad3 itself.
- the active site can be identified using methods known in the art including, for example, from the amino acid sequences of peptides, from the nucleotide sequences of nucleic acids, or from study of complexes of the relevant compound or composition with its ligand. In the latter case, chemical or X- ray crystallographic methods can be used to find the active site by finding where on the factor the complexed ligand is found.
- the three dimensional geometric structure of the active site is determined. This can be done by known methods, including X-ray crystallography, which can determine a complete molecular structure. On the other hand, solid or liquid phase NMR can be used to determine certain intra-molecular distances. Any other experimental method of structure determination can be used to obtain partial or complete geometric structures.
- the geometric structures may be measured with a complexed ligand, natural or artificial, which may increase the accuracy of the active site structure determined.
- Smad interaction domains have been determined for known inhibitors of Smad3, including the transcriptional repressors TGIF and SIP1, the adenoviral oncoprotein E1A, and the human oncogenes Ski, SnoN, and Evi-1 and may serve as the basis for rational drug design.
- the methods of computer based numerical modelling can be used to complete the structure or improve its accuracy.
- Any recognized modelling method may be used, including parameterized models specific to particular biopolymers such as proteins or nucleic acids, molecular dynamics models based on computing molecular motions, statistical mechanics models based on thermal ensembles, or combined models.
- standard molecular force fields representing the forces between constituent atoms and groups, are necessary, and can be selected from force fields known in physical chemistry.
- the incomplete or less accurate experimental structures can serve as constraints on the complete and more accurate structures computed by these modeling methods.
- candidate inhibiting compounds can be identified by searching databases containing compounds along with information on their molecular structure. Such a search seeks compounds having structures that match the determined active site structure and that interact with the groups defining the active site. Such a search can be manual, but is preferably computer assisted. The compounds found from this search are potential Smad3 inhibiting compounds.
- these methods can be used to identify improved inhibiting compounds from an already known inhibiting compound or ligand.
- the composition of the known compound can be modified and the structural effects of modification can be determined using the experimental and computer modelling methods described above applied to the new composition.
- the altered structure is then compared to the active site structure of the compound to determine if an improved fit or interaction results. In this manner systematic variations in composition, such as by varying side groups, can be quickly evaluated to obtain modified inhibiting compounds or ligands of improved specificity or activity.
- CHARMM CHARMm
- QUANTA performs the construction, graphic modelling and analysis of molecular structure. QUANTA allows interactive construction, modification, visualization, and analysis of the behavior of molecules with each other.
- Compounds identified via assays such as those described herein may be useful, for example, in elaborating the biological function of the Smad3 gene product, and for preventing fibrosis and improving wound healing.
- In vitro systems may be designed to identify compounds capable of interacting with (e.g., binding to) Smad3.
- Compounds identified may be useful, for example, in inhibiting the activity of wild type and/or mutant Smad3 gene products; may be useful in elaborating the biological function of Smad3; may be utilized in screens for identifying compounds that disrupt normal Smad3 interactions; or may in themselves disrupt such interactions.
- the principle of the assays used to identify compounds that bind to Smad3 involves preparing a reaction mixture of Smad3 and the test compound under conditions and for a time sufficient to allow the two components to interact and bind, thus forming a complex which can be removed and/or detected in the reaction mixture.
- the Smad3 species used can vary depending upon the goal of the screening assay.
- the full length Smad3 protein a peptide corresponding to a domain or a fusion protein containing a Smad3 domain fused to a protein or polypeptide that affords advantages in the assay system (e.g., labeling, isolation of the resulting complex, etc.) can be utilized.
- the screening assays can be conducted in a variety of ways.
- one method to conduct such an assay would involve anchoring the Smad3 protein, polypeptide, peptide or fusion protein or the test substance onto a solid phase and detecting Smad3/test compound complexes anchored on the solid phase at the end of the reaction.
- the Smad3 reactant may be anchored onto a solid surface, and the test compound, which is not anchored, may be labeled, either directly or indirectly.
- microtiter plates may conveniently be utilized as the solid phase.
- the anchored component may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished by simply coating the solid surface with a solution of the protein and drying.
- an immobilized antibody preferably a monoclonal antibody, specific for the protein to be immobilized may be used to anchor the protein to the solid surface.
- the surfaces may be prepared in advance and stored.
- the nonimmobilized component is added to the coated surface containing the anchored component. After the reaction is complete, unreacted components are removed (e.g., by washing) under conditions such that any complexes formed will remain immobilized on the solid surface.
- the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the previously nonimmobilized component is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed.
- an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the previously nonimmobilized component (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-lg antibody).
- a reaction can be conducted in a liquid phase, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for Smad3 protein, polypeptide, peptide or fusion protein or the test compound to anchor any complexes formed in solution, and a labeled antibody specific for the other component of the possible complex to detect anchored complexes.
- cell-based assays can be used to identify compounds that interact with Smad3.
- cell lines that express Smad3, or cell lines e.g., COS cells, CHO cells, fibroblasts, etc.
- Smad3 e.g., by transfection or transduction of Smad3 DNA
- Interaction of the test compound with, for example, the Smad3 expressed by the host cell can be determined by comparison or competition with native ligand.
- any method suitable for detecting protein-protein interactions may be employed for identifying transmembrane proteins or intracellular proteins that interact with Smad3.
- traditional methods which may be employed are co-immunoprecipitation, crosslinking and co-purification through gradients or chromatographic columns of cell lysates or proteins obtained from cell lysates and the Smad3 protein to identify proteins in the lysate that interact with the Smad3 protein.
- the Smad3 component used can be a full length Smad3 protein, a peptide corresponding to a domain of Smad3 or a fusion protein containing a domain of Smad3.
- an intracellular or transmembrane protein can be identified and can, in turn, be used, in conjunction with standard techniques, to identify proteins with which it interacts. For example, at least a portion of the amino acid sequence of an intracellular or transmembrane protein which interacts with Smad3 can be ascertained using techniques well known to those of skill in the art, such as via the Edman degradation technique. (See, e.g., Creighton, 1983, "Proteins: Structures and Molecular Principles", W.H. Freeman & Co., N.Y., pp.34-49).
- the amino acid sequence obtained may be used as a guide for the generation of oligonucleotide mixtures that can be used to screen for gene sequences encoding such intracellular and transmembrane proteins. Screening may be accomplished, for example, by standard hybridization or PCR techniques. Techniques for the generation of oligonucleotide mixtures and the screening are well-known. (See, e.g., Ausubel et al., 1989, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y., and PCR Protocols: A Guide to Methods and Applications, 1990, Innis, M. et al., eds.
- methods may be employed which result in the simultaneous identification of genes which encode the transmembrane or intracellular proteins interacting with Smad3.
- These methods include, for example, probing expression, libraries, in a manner similar to the well known technique of antibody probing of ⁇ gtl 1 libraries, using labeled Smad3 protein, or a Smad3 polypeptide, peptide or fusion protein, e.g., a Smad3 polypeptide or Smad3 domain fused to a marker (e.g., an enzyme, fluor, luminescent protein, or dye), or an Ig-Fc domain.
- a marker e.g., an enzyme, fluor, luminescent protein, or dye
- the assay identifies proteins that interact with Smad3, whether physiologically or pharmacologically.
- plasmids are constructed that encode two hybrid proteins: one plasmid consists of nucleotides encoding the DNA-binding domain of a transcription activator protein fused to a Smad3 nucleotide sequence encoding Smad3, a Smad3 polypeptide, peptide or fusion protein, and the other plasmid consists of nucleotides encoding the transcription activator protein's activation domain fused to a cDNA encoding an unknown protein which has been recombined into this plasmid as part of a cDNA library.
- the DNA-binding domain fusion plasmid and the cDNA library are transformed into a strain of the yeast Saccharomyces cerevisiae that contains a reporter gene whose regulatory region contains the transcription activator's binding site. Either hybrid protein alone cannot activate transcription of the reporter gene: the DNA-binding domain hybrid cannot because it does not provide activation function and the activation domain hybrid cannot because it cannot localize to the activator's binding sites. Interaction of the two hybrid proteins reconstitutes the functional activator protein and results in expression of the reporter gene, which is detected by an assay for the reporter gene product.
- the two-hybrid system or related methodology may be used to screen activation domain libraries for proteins that interact with the "bait" gene product.
- Smad3 may be used as the bait gene product. Total genomic or cDNA sequences are fused to the DNA encoding an activation domain. This library and a plasmid encoding a hybrid of a bait Smad3 gene product fused to the DNA-binding domain are co- transformed into a yeast reporter strain, and the resulting transformants are screened for those that express the reporter gene.
- a bait Smad3 gene sequence such as the open reading frame of Smad3 (or a domain of Smad3), can be cloned into a vector such that it is translationally fused to the DNA encoding the DNA-binding domain of the GAL4 protein. These colonies are purified and the library plasmids responsible for reporter gene expression are isolated. DNA sequencing is then used to identify the proteins encoded by the library plasmids.
- a cDNA library of the cell line from which proteins that interact with bait Smad3 gene product are to be detected can be made using methods routinely practiced in the art. According to the particular system described herein, for example, the cDNA fragments can be inserted into a vector such that they are translationally fused to the transcriptional activation domain of GAL4.
- This library can be co-transformed along with the bait Smad3 gene-GAL4 fusion plasmid into a yeast strain which contains a lacZ gene driven by a promoter which contains GAL4 activation sequence.
- a cDNA encoded protein, fused to GAL4 transcriptional activation domain, that interacts with bait Smad3 gene product will reconstitute an active GAL4 protein and thereby drive expression of the HIS3 gene.
- Colonies which express HIS3 can be detected by their growth on petri dishes containing semi-solid agar based media lacking histidine. The cDNA can then be purified from these strains, and used to produce and isolate the bait Smad3 gene-interacting protein using techniques routinely practiced in the art.
- ligands The acromolecules that interact with Smad3 are referred to, for purposes of this discussion, as "ligands". These ligands are likely to be involved in the Smad3 signal transduction pathway, and therefore, in the role of Smad3 in wound healing and fibrosis. Therefore, it is desirable to identify compounds that interfere with or disrupt the interaction of such ligands with Smad3 which may be useful in regulating the activity of Smad3 and control wound healing and fibrosis associated with Smad3 activity.
- the basic principle of the assay systems used to identify compounds that interfere with the interaction between Smad3 and its ligand or ligands involves preparing a reaction mixture containing the Smad3 protein, polypeptide, peptide or fusion protein and the ligand under conditions and for a time sufficient to allow the two to interact and bind, thus forming a complex.
- the reaction mixture is prepared in the presence and absence of the test compound.
- the test compound may be initially included in the reaction mixture, or may be added at a time subsequent to the addition of the Smad3 moiety and its ligand. Control reaction mixtures are incubated without the test compound or with a placebo. The formation of any complexes between the Smad3 moiety and the ligand is then detected.
- complex formation within reaction mixtures containing the test compound and normal Smad3 protein may also be compared to complex formation within reaction mixtures containing the test compound and a mutant Smad3. This comparison may be important in those cases wherein it is desirable to identify compounds that disrupt interactions of mutant but not normal Smad3 proteins.
- the assay for compounds that interfere with the interaction of Smad3 and ligands can be conducted in a heterogeneous or homogeneous format.
- Heterogeneous assays involve anchoring either the Smad3 moiety product or the ligand onto a solid phase and detecting complexes anchored on the solid phase at the end of the reaction.
- homogeneous assays the entire reaction is carried out in a liquid phase.
- the order of addition of reactants can be varied to obtain different information about the compounds being tested.
- test compounds that interfere with the interaction by competition can be identified by conducting the reaction in the presence of the test substance; i.e., by adding the test substance to the reaction mixture prior to or simultaneously with the Smad3 moiety and interactive ligand.
- test compounds that disrupt preformed complexes e.g. compounds with higher binding constants that displace one of the components from the complex
- test compounds that disrupt preformed complexes can be tested by adding the test compound to the reaction mixture after complexes have been formed.
- the various formats are described briefly below.
- either the Smad3 moiety or the interactive ligand is anchored onto a solid surface, while the non-anchored species is labeled, either directly or indirectly.
- microtiter plates are conveniently utilized.
- the anchored species may be immobilized by non-covalent or covalent attachments. Non-covalent attachment may be accomplished simply by coating the solid surface with a solution of the Smad3 gene product or ligand and drying.
- an immobilized antibody specific for the species to be anchored may be used to anchor the species to the solid surface.
- the surfaces may be prepared in advance and stored.
- the partner of the immobilized species is exposed to the coated surface with or without the test compound. After the reaction is complete, unreacted components are removed (e.g., by washing) and any complexes formed will remain immobilized on the solid surface.
- the detection of complexes anchored on the solid surface can be accomplished in a number of ways. Where the non-immobilized species is pre-labeled, the detection of label immobilized on the surface indicates that complexes were formed.
- an indirect label can be used to detect complexes anchored on the surface; e.g., using a labeled antibody specific for the initially non-immobilized species (the antibody, in turn, may be directly labeled or indirectly labeled with a labeled anti-lg antibody).
- the antibody in turn, may be directly labeled or indirectly labeled with a labeled anti-lg antibody.
- test compounds which inhibit complex formation or which disrupt preformed complexes can be detected.
- the reaction can be conducted in a liquid phase in the presence or absence of the test compound, the reaction products separated from unreacted components, and complexes detected; e.g., using an immobilized antibody specific for one of the binding components to anchor any complexes formed in solution, and a labeled antibody specific for the other partner to detect anchored complexes.
- test compounds which inhibit complex or which disrupt preformed complexes can be identified.
- a homogeneous assay can be used.
- a preformed complex of the Smad3 moiety and the interactive ligand is prepared in which either the Smad3 or its ligand is labeled, but the signal generated by the label is quenched due to formation of the complex (see, e.g., U.S. Pat. No. 4,109,496 by Rubenstein which utilizes this approach for immunoassays).
- the addition of a test substance that competes with and displaces one of the species from the preformed complex will result in the generation of a signal above background. In this way, test substances which disrupt Smad3/ligand interaction can be identified.
- a Smad3 fusion can be prepared for immobilization.
- Smad3, or a peptide fragment, e.g., corresponding to a domain can be fused to a glutathione-S-transferase (GST) gene using a fusion vector, such as pGEX-5X-1, in such a manner that its binding activity is maintained in the resulting fusion protein.
- GST glutathione-S-transferase
- the interactive ligand can be purified and used to raise a monoclonal antibody, using methods routinely practiced in the art.
- This antibody can be labeled with the radioactive isotope 125 l, for example, by methods routinely practiced in the art.
- the GST-Smad3 fusion protein can be anchored to glutathione- agarose beads.
- the interactive ligand can then be added in the presence or absence of the test compound in a manner that allows interaction and binding to occur.
- unbound material can be washed away, and the labeled monoclonal antibody can be added to the system and allowed to bind to the complexed components.
- the interaction between the Smad3 gene product and the interactive ligand can be detected by measuring the amount of radioactivity that remains associated with the glutathione-agarose beads. A successful inhibition of the interaction by the test compound will result in a decrease in measured radioactivity.
- the GST-Smad3 fusion protein and the interactive ligand can be mixed together in liquid in the absence of the solid glutathione-agarose beads.
- the test compound can be added either during or after the species are allowed to interact. This mixture can then be added to the glutathione-agarose beads and unbound material is washed away. Again the extent of inhibition of the Smad3/ligand interaction can be detected by adding the labeled antibody and measuring the radioactivity associated with the beads.
- these same techniques can be employed using peptide fragments that correspond to the binding domains of Smad3 and/or the interactive ligand (in cases where the ligand is a protein), in place of one or both of the full length proteins.
- any number of methods routinely practiced in the art can be used to identify and isolate the binding sites. These methods include, but are not limited to, mutagenesis of the gene encoding one of the proteins and screening for disruption of binding in a co-immunoprecipitation assay. Compensating mutations in the gene encoding the second species in the complex can then be selected. Sequence analysis of the genes encoding the respective proteins will reveal the mutations that correspond to the region of the protein involved in interactive binding. Alternatively, one protein can be anchored to a solid surface using methods described above, and allowed to interact with and bind to its labeled ligand, which has been treated with a proteolytic enzyme, such as trypsin.
- a proteolytic enzyme such as trypsin.
- a short, labeled peptide comprising the binding domain may remain associated with the solid material, which can be isolated and identified by amino acid sequencing. Also, once the gene coding for the interactive ligand is obtained, short gene segments can be engineered to express peptide fragments of the protein, which can then be tested for binding activity and purified or synthesized.
- a Smad3 gene product can be anchored to a solid material as described above, by making a GST-Smad3 fusion protein and allowing it to bind to glutathione agarose beads.
- the interactive ligand can be labeled with a radioactive isotope, such as 3S S, and cleaved with a proteolytic enzyme such as trypsin. Cleavage products can then be added to the anchored GST-Smad3 fusion protein and allowed to bind. After washing away unbound peptides, labeled bound material, representing the interactive ligand binding domain, can be eluted, purified, and analyzed for amino acid sequence by well-known methods.
- the "ligand” is Smad4, with which Smad3 heteroligomerizes upon receptor activation.
- the "ligand” is SARA (Smad anchor for receptor activation), which recruits the cytoplasmic signal transducer Smad3.
- the "ligand” is the cognate DNA binding site for Smad3.
- Smad MH2 domains are the locus of Smad-dependent transcriptional activation activity, and are the site of protein-protein interactions responsible for oligomerization of Smad proteins as well as hetero erization with other transcription factors.
- the MH2 domain of Smad3 is substituted for Smad3 itself in the assays described herein.
- Compounds including, but not limited to, binding compounds identified via assay techniques such as those described in the preceding sections, can be tested for the ability to prevent fibrosis and improve wound healing.
- the assays described above can identify compounds which affect Smad3 activity (e.g., compounds that bind to Smad3, inhibit binding of a natural ligand, and either block activation (antagonists) or mimic inhibitors of activation (agonists), and compounds that bind to a natural ligand of Smad3 and neutralize ligand activity); or compounds that affect Smad3 gene activity (by affecting Smad3 gene expression, including molecules, e.g., proteins or small organic molecules, that affect or interfere with splicing events so that expression of the full length or a truncated form of Smad3 can be modulated).
- Smad3 activity e.g., compounds that bind to Smad3, inhibit binding of a natural ligand, and either block activation (antagonists) or mimic inhibitors of activation (agonists), and compounds that
- the assays described can also identify compounds that inhibit Smad3 signal transduction (e.g., compounds which affect upstream or downstream signalling events).
- compounds that affect another step in the Smad3 signal transduction pathway in which the Smad3 gene and/or Smad3 gene product is involved and, by affecting this same pathway may modulate the effect of Smad3 on fibrosis and wound healing are within the scope of the invention.
- Such compounds can be used as part of a method for the prevention of fibrosis and improvement of wound healing.
- the invention encompasses cell-based and animal model-based assays for the identification of compounds exhibiting such an ability to prevent fibrosis and improve wound healing.
- Cell-based systems can be used to identify compounds which may act to prevent fibrosis and improve wound healing.
- Such cell systems can include, for example, recombinant or non-recombinant cells, such as cell lines, which express the Smad3 gene.
- recombinant or non-recombinant cells such as cell lines, which express the Smad3 gene.
- monocyte cells, keratinocyte cells, or cell lines derived from monocytes or keratinocytes can be used.
- cells may be exposed to a compound suspected of exhibiting an ability to protect against fibrosis and improve wound healing, at a sufficient concentration and for a time sufficient to elicit a cellular phenotype associated with such a protection against fibrosis and improvement of wound healing in the exposed cells, e.g., altered migration and selective chemotactic response to TGF- ⁇ .
- the cells can be assayed to measure alterations in the expression of the Smad3 gene, e.g., by assaying cell lysates for Smad3 mRNA transcripts (e.g., by Northern analysis) or for Smad3 protein expressed in the cell; compounds which inhibit expression of the Smad3 gene are good candidates as therapeutics.
- the cells are examined to determine whether one or more cellular phenotype associated with fibrosis or impaired wound healing has been altered to resemble a cellular phenotype associated with protection against fibrosis and improvement of wound healing. Still further, the expression and/or activity of components of the signal transduction pathway of which Smad3 is a part, or the activity of Smad3 signal transduction pathway itself can be assayed.
- the cell lysates can be assayed for the presence of host cell proteins, as compared to lysates derived from unexposed control cells.
- the ability of a test compound to inhibit expression of specific Smad3 target genes in these assay systems indicates that the test compound inhibits signal transduction initiated by Smad3 activation.
- the cell lysates can be readily assayed using a Western blot format; i.e., the host cell proteins are resolved by gel electrophoresis, transferred and probed using a anti-host cell protein detection antibody (e.g., an anti-host cell protein detection antibody labeled with a signal generating compound, such as radiolabel, fluor, enzyme, etc.).
- a signal generating compound such as radiolabel, fluor, enzyme, etc.
- an ELISA format could be used in which a particular host cell protein is immobilized using an antibody specific for the target host cell protein, and the presence or absence of the immobilized host cell protein is detected using a labeled second antibody.
- ion flux such as calcium ion flux
- assays for compounds that interfere with Smad3 binding to its cognate DNA binding site utilize specific reporter constructs, such as (SBE)4- luciferase reporter, driven by four repeats of the sequence identified as a Smad binding element in the JunB promoter.
- animal-based systems for protection against fibrosis and improvement of wound healing may be used to identify compounds capable of protecting against fibrosis and improving wound healing.
- Such animal models may be used as test substrates for the identification of drugs, pharmaceuticals, therapies and interventions which may be effective in protecting against fibrosis and improving wound healing.
- animal models may be exposed to a compound, suspected of protecting against fibrosis or improving wound healing, at a sufficient concentration and for a time sufficient to elicit a protection against fibrosis and improvement of wound healing in the exposed animals.
- the response of animals to the exposure may be monitored by assessing radioprotection or cutaneous wound healing.
- any treatments which protect against any aspect of fibrosis or improve any aspect of wound healing should be considered as candidates for human therapeutic intervention in protecting against fibrosis and improving wound healing.
- Dosages of test agents may be determined by deriving dose-response curves, as discussed in the sections below. Inhibition of Smad3 Expression or Smad3 Activity to Prevent Fibrosis or Improve Wound Healing
- Any method which neutralizes Smad3 or inhibits expression of the Smad3 gene can be used to protect against fibrosis and improve wound healing.
- Such approaches can be used to reduce the size of wounds, to treat chronic non-healing wounds, to promote closure in surgical wounds, to speed the re-epithelialization of wounds, to treat ulcers, e.g., decubitus ulcers, diabetic ulcers, and venous stasis ulcers, to improve the growth of autologous skin grafts, and to hasten the recovery of severe burn patients.
- Such methods can also be useful for imparting resistance to fibrosis resulting from chronic inflammation, e.g., pulmonary fibrosis, glomerulosclerosis, and cirrhosis, protecting against radiation-induced fibrosis, supporting members of the armed forces who might be expected to encounter high dose radiation, permitting dose escalation of radiation treatment, e.g., in cancer patients, and decreasing the accumulation of scar tissue.
- chronic inflammation e.g., pulmonary fibrosis, glomerulosclerosis, and cirrhosis
- soluble peptides, proteins, fusion proteins, or antibodies that bind to and "neutralize” Smad3 can be used to protect against fibrosis and improve wound healing.
- peptides corresponding to the cytoplasmic domain of the TGF- ⁇ or activin receptor (or a domain of a Smad involved in forming dimers with Smad3) can be utilized.
- anti-idiotypic antibodies or Fab fragments of antiidiotypic antibodies that mimic the cytoplasmic domain of the TGF- ⁇ or activin receptor (or the domain of a Smad involved in forming dimers with Smad3) and that neutralize Smad3 can be used.
- Such Smad3 peptides, proteins, fusions proteins, antibodies, anti-idiotypic antibodies or Fabs are administered to a subject in amounts sufficient to neutralize Smad3 and protect against fibrosis or improve wound healing.
- the peptides, proteins, fusions proteins, antibodies, anti-idiotypic antibodies or Fabs are cell-permeable compounds.
- cells are genetically engineered using recombinant DNA techniques to introduce the coding sequence for the peptide, protein, fusion protein, antibody, anti-idiotypic antibody or Fab into the cell, e.g., by transduction (using viral vectors, such as retroviruses, adenoviruses, and adeno-associated viruses) or transfection procedures, including but not limited to the use of naked DNA or RNA, plasmids, cosmids, YACs, electroporation, liposomes, etc.
- the coding sequence can be placed under the control of a strong constitutive or inducible promoter, or a tissue-specific promoter, to achieve expression of the gene product.
- the engineered cells which express the gene product can be produced in vitro and introduced into the patient, e.g., systemically, intraperitoneally, at the site of cutaneous wound healing, or the cells can be incorporated into a matrix and implanted in the body, e.g., genetically engineered cells can be implanted as part of a skin graft.
- the engineered cells which express the gene product can be produced following in vivo gene therapy approaches.
- monoclonal antibodies are produced in one of three different ways. They can be generated as mouse antibodies that are subsequently "humanized” by recombination with human antibody genes (Kohler and Milstein, Nature 256,495 (1975); Winter and Harris, Trends Pharmacol. Sci. 14, 139 (1993); and Queen et al., Proc. Natl. Acad. Sci. USA 86, 10029 (1989)). Alternatively, human antibodies are raised in nude mice grafted with human immune cells (Bruggemann and Neuberger, Immunol. Today 8, 391 (1996)).
- various host animals may be immunized by injection with Smad3, a Smad3 peptide, functional equivalents or mutants of Smad3.
- Such host animals may include but are not limited to rabbits, mice, and rats, to name but a few.
- adjuvants may be used to increase the immunological response, depending on the host species, including but not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanin, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
- BCG Bacille Calmette-Guerin
- Monoclonal antibodies which are homogeneous populations of antibodies to a particular antigen, may be obtained by any technique which provides for the production of antibody molecules by continuous cell lines in culture. These include, but are not limited to, the hybridoma technique of Kohler and Milstein, (1975, Nature 256:495-497; and U.S. Pat. No. 4,376,110), the human B-cell hybridoma technique (Kosbor et al., 1983, Immunology Today 4:72; Cole et al., 1983, Proc. Natl. Acad. Sci. USA 80:2026-2030), and the EBV-hybridoma technique (Cole et al., 1985, Monoclonal Antibodies And Cancer Therapy, Alan R.
- Such antibodies may be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof.
- the hybridoma producing the mAb of this invention may be cultivated in vitro or in vivo. Production of high titers of mAbs in vivo makes this the presently preferred method of production. In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., 1984, Proc.
- a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region.
- Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
- Antibody fragments which recognize specific epitopes may be generated by known techniques.
- such fragments include but are not limited to: the F(ab')2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab fragments which can be generated by reducing the disulfide bridges of the F(ab')2 fragments.
- Fab expression libraries may be constructed (Huse et al., 1989, Science, 246:1275-1281) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
- Antibodies to ligands of Smad3 can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" these ligands, using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, 1993, FASEB J 7(5):437-444; and Nissinoff, 1991, J. Immunol. 147(8):2429-2438).
- antibodies which bind to the cytoplasmic domain of the TGF- ⁇ or activin receptor (or the domain of a Smad involved in forming dimers with Smad3) and competitively inhibit the binding of Smad3 to the TGF- ⁇ or activin receptor (or a Smad involved in forming dimers with Smad3) can be used to generate anti-idiotypes that "mimic" these ligands and, therefore, bind and neutralize Smad3.
- Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize Smad3 and protect against fibrosis and improve wound healing.
- interventions to prevent fibrosis and improve wound healing can be designed by reducing the level of endogenous Smad3 gene expression, e.g., using antisense or ribozyme approaches to inhibit or prevent translation of Smad3 mRNA transcripts; triple helix approaches to inhibit transcription of the Smad3 gene; or targeted homologous recombination to inactivate or "knock out" the Smad3 gene or its endogenous promoter. Delivery techniques could be preferably designed for a systemic approach. Alternatively, the antisense, ribozyme or DNA constructs described herein could be administered directly to the site containing the target cells, e.g., sites of cutaneous wound healing.
- Antisense approaches involve the design of oligonucleotides (either DNA or RNA) that are complementary to Smad3 mRNA.
- the antisense oligonucleotides will bind to the complementary Smad3 mRNA transcripts and prevent translation. Absolute complementarity, although preferred, is not required.
- a sequence "complementary" to a portion of an RNA, as referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double-stranded antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
- the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the longer the hybridizing nucleic acid, the more base mismatches with an RNA it may contain and still form a stable duplex (or triplex, as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
- Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
- sequences complementary to the 3' untranslated sequences of mRNAs have recently shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
- oligonucleotides complementary to either the 5'- or 3'- non-translated, non-coding regions of Smad3 could be used in an antisense approach to inhibit translation of endogenous Smad3 mRNA.
- Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
- Antisense oligonucleotides complementary to mRNA coding regions could also be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'- or coding region of Smad3 mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 6 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
- in vitro studies are first performed to quantitate the ability of the antisense oligonucleotide to inhibit gene expression. It is preferred that these studies utilize controls that distinguish between antisense gene inhibition and nonspecific biological effects of oligonucleotides. It is also preferred that these studies compare levels of the target RNA or protein with that of an internal control RNA or protein. Additionally, it is envisioned that results obtained using the antisense oligonucleotide are compared with those obtained using a control oligonucleotide.
- control oligonucleotide is of approximately the same length as the test oligonucleotide and that the nucleotide sequence of the oligonucleotide differs from the antisense sequence no more than is necessary to prevent specific hybridization to the target sequence.
- the oligonucleotides can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
- the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
- the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. W088/09810, published Dec.
- the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
- the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including but not limited to 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4 acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5 carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5 methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D mannosylqueo
- the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group consisting of a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
- Oligonucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Bios ⁇ stems, etc.).
- an automated DNA synthesizer such as are commercially available from Biosearch, Applied Bios ⁇ stems, etc.
- phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209)
- methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451 ), etc.
- the antisense molecules should be delivered to cells which express the Smad3 protein in vivo, e.g., sites of cutaneous wound healing.
- a number of methods have been developed for delivering antisense DNA or RNA to cells; e.g., antisense molecules can be injected directly into the tissue site, or modified antisense molecules, designed to target the desired cells (e.g., antisense linked to peptides or antibodies that specifically bind receptors or antigens expressed on the target cell surface) can be administered systemically.
- a preferred approach utilizes a recombinant DNA construct in which the antisense oligonucleotide is placed under the control of a strong pol III or pol II promoter.
- the use of such a construct to transfect target cells in the patient will result in the transcription of sufficient amounts of single stranded RNAs that will form complementary base pairs with the endogenous Smad3 transcripts and thereby prevent translation of the Smad3 mRNA.
- a vector can be introduced in vivo such that it is taken up by a cell and directs the transcription of an antisense RNA.
- Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
- Such vectors can be constructed by recombinant DNA technology methods standard in the art.
- Vectors can be plasmid, viral, or others known in the art, used for replication and expression in mammalian cells.
- Expression of the sequence encoding the antisense RNA can be by any promoter known in the art to act in mammalian, preferably human cells. Such promoters can be inducible or constitutive.
- Such promoters include but are not limited to: the SV40 early promoter region (Bernoist and Chambon, 1981, Nature 290:304-310), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al., 1980, Cell 22:787-797), the herpes thymidine kinase promoter (Wagner et al., 1981, Proc. Natl. Acad. Sci. U.S.A. 78:1441- 1445), the regulatory sequences of the metallothionein gene (Brinster et al., 1982, Nature 296:39-42), etc.
- An epidermal specific promoter may be desireable, such as a keratin based vector that has its expression induced by a variety of appropriate stimuli including wounding.
- Any type of plasmid, cosmid, YAC or viral vector can be used to prepare the recombinant DNA construct which can be introduced directly into the tissue site; e.g., the site of cutaneous wound healing.
- viral vectors can be used which selectively infect the desired tissue; (e.g., for skin, papillomavirus vectors may be used), in which case administration may be accomplished by another route (e.g., systemically).
- Ribozyme molecules-designed to catalytically cleave Smad3 mRNA transcripts can also be used to prevent translation of Smad3 mRNA and expression of Smad3.
- PCT International Publication W090/11364 published Oct. 4, 1990; Sarver et al., 1990, Science 247:1222-1225.
- ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy Smad3 mRNAs
- the use of hammerhead ribozymes is preferred.
- Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA.
- the sole requirement is that the target mRNA have the following sequence of two bases: 5'- UG-3'.
- the construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, 1988, Nature, 334:585-591.
- the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the Smad3 mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
- the ribozymes of the present invention also include RNA endoribonucleases (hereinafter "Cech-type ribozymes”) such as the one which occurs naturally in Tetrahymena Thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-
- Cech-type ribozymes such as the one which occurs naturally in Tetrahymena Thermophila (known as the IVS, or L-19 IVS RNA) and which has been extensively described by Thomas Cech and collaborators (Zaug, et al., 1984, Science, 224:574-
- the Cech- type ribozymes have an eight base pair active site which hybridizes to a target RNA sequence whereafter cleavage of the target RNA takes place.
- the invention encompasses those Cech-type ribozymes which target eight base-pair active site sequences that are present in Smad3.
- the ribozymes can be composed of modified oligonucleotides (e.g.
- a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous Smad3 messages and inhibit translation. Because ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
- Endogenous Smad3 gene expression can also be reduced by inactivating or "knocking out” the Smad3 gene or its promoter using targeted homologous recombination.
- endogenous Smad3 gene expression can also be reduced by inactivating or "knocking out" the Smad3 gene or its promoter using targeted homologous recombination.
- a mutant, non- functional Smad3 protein flanked by DNA homologous to the endogenous Smad3 gene (either the coding regions or regulatory regions of the Smad3 gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express Smad3 in vivo. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the Smad3 gene.
- recombinant DNA constructs are directly administered or targeted to the required site using appropriate viral vectors, e.g., papillomavirus vectors for in vivo delivery to sites of cutaneous wound healing, or retrovirus vectors for in vitro transduction of autologous skin grafts.
- appropriate viral vectors e.g., papillomavirus vectors for in vivo delivery to sites of cutaneous wound healing, or retrovirus vectors for in vitro transduction of autologous skin grafts.
- endogenous Smad3 gene expression can be reduced by targeting deoxyribonucleotide sequences complementary to the regulatory region of the Smad3 gene (i.e., the Smad3 promoter and/or enhancers) to form triple helical structures that prevent transcription of the Smad3 gene in target cells in the body.
- deoxyribonucleotide sequences complementary to the regulatory region of the Smad3 gene i.e., the Smad3 promoter and/or enhancers
- the activity of Smad3 can be reduced using a "dominant negative" approach to protect against fibrosis and improve wound healing.
- constructs which encode defective Smad3 proteins can be used in gene therapy approaches to diminish the activity of Smad3 in appropriate target cells.
- nucleotide sequences that direct host cell expression of Smad3 in which a domain or portion of a domain is deleted or mutated can be introduced into cells at sites of high-dose radiation exposure or cutaneous wound healing (by gene therapy methods described above).
- targeted homologous recombination can be utilized to introduce such deletions or mutations into the subject's endogenous Smad3 gene at sites of high-dose radiation exposure or cutaneous wound healing.
- the engineered cells will express non-functional Smad3 (i.e., a Smad 3 that is capable of binding its natural ligand, but incapable of signal transduction).
- Smad3 i.e., a Smad 3 that is capable of binding its natural ligand, but incapable of signal transduction.
- Such engineered cells at sites of high- dose radiation exposure or cutaneous wound healing should demonstrate a heightened response to TGF- ⁇ , resulting in protection against fibrosis and improved wound healing.
- the compounds that are determined to affect Smad3 gene expression or Smad3 activity can be administered to a patient at therapeutically effective doses to protect against fibrosis and improve wound healing.
- a therapeutically effective dose refers to that amount of the compound sufficient to result in protection against fibrosis and improvement of wound healing.
- the compounds of the invention are generally administered to animals, including humans. Effective Dose Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 /ED50.
- the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
- levels in plasma may be measured, for example, by high performance liquid chromatography.
- the pharmacologically active compounds of this invention can be processed in accordance with conventional methods of galenic pharmacy to produce medicinal agents for administration to patients, e.g., mammals including humans.
- the compounds of this invention can be employed in admixture with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for parenteral, enteral (e.g., oral) or topical application, which do not deleteriously react with the active compounds.
- Suitable pharmaceutically acceptable carriers include but are not limited to water, salt solutions, alcohols, gum arabic, vegetable oils, benzyl alcohols, polyethylene glycols, gelatin, carbohydrates such as lactose, amylose or starch, magnesium stearate, talc, silicic acid, viscous paraffin, perfume oil, fatty acid monoglycerides and diglycerides, pentaerythritol fatty acid esters, hydroxy methylcellulose, polyvinyl pyrrolidone, etc.
- the pharmaceutical preparations can be sterilized and if desired mixed with auxiliary agents, e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and/or aromatic substances and the like which do not deleteriously react with the active compounds. They can also be combined where desired with other active agents, e.g., vitamins.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and/or aromatic substances and the like which do not deleteriously react with the active compounds.
- auxiliary agents e.g., lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, coloring, flavoring and/or aromatic substances and the like which do not deleter
- compositions can be formulated, e.g., by inclusion in liposomes or incorporation into an epidermal patch with a suitable carrier, for example DMSO. It is also possible to freeze-dry these compounds and use the lyophilizates obtained, for example, for the preparation of products for injection.
- viscous to semi-solid or solid forms comprising a carrier compatible with topical application and having a dynamic viscosity preferably greater than water.
- suitable formulations include but are not limited to solutions, suspensions, emulsions, creams, ointments, powders, liniments, salves, aerosols, etc., which are, if desired, sterilized or mixed with auxiliary agents, e.g., preservatives, stabilizers, wetting agents, buffers or salts for influencing osmotic pressure, etc.
- sprayable aerosol preparations wherein the active ingredient, preferably in combination with a solid or liquid inert carrier material, is packaged in a squeeze bottle or in admixture with a pressurized volatile, normally gaseous propellant, e.g., a freon.
- a pressurized volatile, normally gaseous propellant e.g., a freon.
- compositions may, if desired, be presented in a pack or dispenser device which may contain one or more unit dosage forms containing the active ingredient.
- the pack may for example comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the wound areas of the Smad3 Bx8ta ⁇ mice were significantly smaller than those of wild-type mice, with reduced quantities of granulation tissue present at all time points. Wound contraction occurs through the relative contributions of re-epithelialization and myofibroblast action, and thus the accelerated re-epithelialization in the Smad3 B B ' Bx8 mice, and/or increased contractility of wound fibroblasts, presumably contribute to this phenotype. This observation corroborates earlier controversial studies indicating that central granulation tissue may not be critical to wound closure (Gross, J. et al. On the mechanism of skin wound "contraction”: a granulation tissue "knockout” with a normal phenotype. Proc. Natl Acad. Sci. USA 92, 5982-5986 (1995)).
- TGF- ⁇ released from degranulating platelets at wound sites has a broad spectrum of effects on, and is secreted by, each of the diverse cell types involved in wound healing.
- these cells include the keratinocyte, responsible for reconstruction of the cutaneous barrier, the fibroblast, responsible for matrix production, and the monocyte, which infiltrates the wound at an early stage and secretes a vast array of cell-regulatory cytokines, including TGF- ⁇ (Roberts, A. B. TGF-beta: activity and efficacy in animal models of wound healing. Wound Repair Regen. 3, 408-418 (1995)); (O'Kane, S. & Ferguson, M. W. J. TGF-beta s and wound healing. Int.
- TGF- ⁇ 1 Transforming growth factor beta: a matter of life and death. J Leuk. Biol. 55, 401-109 (1994)).
- TGF- ⁇ 1 was present at equivalent levels in the serum of all animals, probably representing TGF- ⁇ 1 released from platelet ⁇ - granules (Fig. 2a)
- the null mice showed reduced immunostaining for TGF- ⁇ isoforms in wound leukocytes and decreased TGF- ⁇ 1 RNA levels, particularly at day 3 (Fig. 2b), supporting our hypothesis that a reduction in local TGF- ⁇ l amounts contribute to the aberrant wound-healing phenotype of these mice.
- TGF- ⁇ 1 topical TGF- ⁇ 1 immediately before wounding. Following treatment with TGF- ⁇ l, inflammatory-cell numbers were increased in the heterozygote but not in the Smad3 e 8,Bx8 wounds, indicating that Smad3 may be critical for TGF- ⁇ -mediated chemotaxis.
- Transforming growth factor beta reverses the glucocorticoid-induced wound-healing deficit in rats: possible regulation in macrophages by platelet-derived growth factor. Proc. Natl. Acad. Sci. USA 86, 2229-2233 (1989)).
- Exogenous TGF- ⁇ l stimulated matrix deposition, most notably in the null and heterozygous mice, without evidence of increasing fibroblast numbers, consistent with the idea that reduced local levels of TGF- ⁇ 1 in the Smad3 ex8,Bx8 mice underlie the decreased matrix deposition in these animals.
- these data indicate that expression of TGF- ⁇ receptors in the wounds of the null mice is adequate for matrix production.
- the SMAD signaling pathway may be important for collagen expression, whereas fibronectin (matrix) synthesis may be induced by TGF- ⁇ through a c-Jun (SMAD-independent) pathway (Vindevoghel, L. et al. SMAD3/4-dependent transcriptional activation of the human type VII collagen gene (C0L7A1) promoter by transforming growth factor beta. Proc. Natl Acad. Sci. USA 95, 14769-14774 (1998)); (Chen, S.J. et al. Stimulation of type I collagen transcription in human skin fibroblasts by TGF-beta: involvement of Smad3. J. Invest. Dermatol.
- TGF- ⁇ is a key factor in this response because, in vivo, femtomolar concentrations of TGF- ⁇ induce the most potent known chemoattractant response by circulating blood monocytes (Wahl, S.M. et al. Transforming growth factor type beta induces monocyte chemotaxis and growth factor production. Proc. Natl Acad. Sci.
- TGF beta Transforming growth factor-beta
- Smad3 ex8,Bx8 monocytes exhibited significantly reduced specific chemotaxis to TGF- ⁇ 1, but migrated normally to the classical chemoattractant fMet-Leu-Phe (FMLP), a G-protein-mediated response (Fig. 3a).
- Smad3 Bx8,Bx8 monocytes also showed a failure to upregulate TGF- ⁇ 1 expression in an autocrine fashion (Fig. 3b) despite a TGF- ⁇ mediated increase in levels of TGF- ⁇ receptor II (TGF- ⁇ RII).
- TGF- ⁇ 1 and its receptor may occur independently, with Smad3 being involved in induction of TGF- ⁇ 1 expression and Smad3-independent pathways (such as those involving Smad2 or MAP kinase) regulating receptor expression. Smad3-independent events may also be involved in TGF- ⁇ -mediated expression of integrins by monocytes (Fig. 3c).
- Smad3 ex8 ' ex8 wounds Direct addition of wild-type monocytes at the time of wounding has a similar effect to that of injection of TGF- ⁇ . That is, reduced matrix deposition in the wounds of the Smad3 ex8 ' ex8 mice does not reflect impairment of the ability of Smad3 ex8,ex8 fibroblasts to elaborate matrix proteins per se, but instead results from the reduced levels of TGF- ⁇ in the wounds of the Smad3 ex8,Bx8 mice (reduced TGF- ⁇ levels being themselves a direct result of the reduced monocytic infiltrate). Injection of neither monocytes nor TGF- ⁇ affected re-epithelialization, so these two effects - matrix deposition and re-epithelialization - can be distinguished.
- Smad2 and Smad3 occasionally appear to function interchangeably when overexpressed in vitro, the unique abilities Smad3 to bind DNA directly and to interact with oncogenes such Evil and nuclear receptors such as the vitamin D3 receptor indicate that these two SMADs may regulate distinct target genes in vivo (Yanagisawa, K. et al. Induction of apoptosis by Smad3 and down-regulation of Smad3 expression in response to TGF-beta in human normal lung epithelial cells. Oncogene 17, 1743-1747 (1998)); (Dennler, S., Huet, S. & Gauthier,
- the oncoprotein Evi-1 represses TGF-beta signaling by inhibiting Smad3. Nature 2, 92-96 (1998)). This idea is supported by the striking differences in their respective null phenotypes (Yang, X. et al. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J. 18, 1280-1291 (1999)); (Datto, M. B. et al. Targeted disruption of Smad3 reveals an essential role in transforming growth factor beta-mediated signal transduction Mol. Cell biol.
- Fig. 4b The results show that high levels of exogenous TGF- ⁇ can inhibit the growth of the heterozygous and wild- type keratinocytes equally. However, we interpret the intermediate result in terms of re-epithelialization of cutaneous wounds in the heterozygous mice to result from the reduced level of endogenous TGF- ⁇ produced (compared with wild- type levels), as the inflammatory response is still blunted compared with the wild-type response.
- a further aspect of re-epithelialization involves cell migration across matrix components in response to a chemoattractant gradient.
- Smad3 ex8 ' e 8 keratinocytes exhibited reduced adhesion to matrix and migration towards TGF- ⁇ and keratinocyte growth factor (KGF), while maintaining a normal response towards growth factors present in conditioned media (Fig. 4c).
- KGF keratinocyte growth factor
- An increasing number of cytokines and alternative signaling pathways have been shown to affect SMAD activity (Ulloa, L, Doody, J. & Massague, J. Inhibition of transforming growth factor-beta/SMAD signaling by the interferon-gam a/STAT pathway. Nature 397, 710-713 (1999)); (Yanagisawa, J.
- Smad3 Smad3. Nature 2, 92-96 (1998)); (de Caestecker, M.P. et al. Smad2 transduces common signals from receptor serine- threonine and tyrosine kinases. Genes Dev. 12, 587-592 (1998)), so it is possible that KGF may mediate some of its effects on wild-type cells through interplay with the Smad3 signaling pathway. Because integrins are pivotal in mediating cell migration, we reasoned that Smad3 may be required for TGF- ⁇ -induced integrin expression by keratinocytes.
- TGF- ⁇ 1 upregulated expression of ⁇ , integrins but not of the ⁇ 5 subunit in the null cells; this may represent an underlying mechanism for impaired migration across fibronectin (Fig. 4d).
- This effect differs from that of altered Smad3 signaling in the monocyte, indicating that the effects of Smad3 disruption on a particular gene target depend on the cellular context and cannot be generalized.
- one possible mechanism of enhanced re-epithelialization in the Smad3 e 8 ' ex8 mice may involve increased keratinocyte proliferation (compared with wild-type keratinocytes) in the presence of TGF- ⁇ , coupled with a migratory response stimulated by growth factors other than TGF- ⁇ and KGF in a Smad3-independent process.
- mice Male wildtype or Smad3 null littermates, 6 weeks of age, were exposed to radiation on the right thigh region. The left leg served as an internal control. In this initial experiment, mice were either not radiated, or given 30 or 60 Gy in a single dose. Mice were killed at 2 weeks and 5 weeks post-radiation. Tatoo marks 1 cm apart were used to assess contraction of the skin and a torsion test was used to measure contractility of the leg. Sections of the skin and muscle were fixed in neutral buffered formalin for histology.
- Smad3 ex8,ex8 mice were generated by targeted disruption of the Smad3 gene by homologous recombination. Targeted embryonic-stem-cell clones were injected into germline transmission. Mice heterozygous for the targeted disruption were intercrossed to produce homozygous offspring (Yang, X. et al. Targeted disruption of SMAD3 results in impaired mucosal immunity and diminished T cell responsiveness to TGF-beta. EMBO J. 188, 1280-1291 (1999)). 48
- mice (Smad3 wild-type, heterozygotes and null mice) were anaesthetized with methoxyfluorane, and the dorsum was shaved and cleaned with alcohol.
- Four equidistant 1-cm full-thickness incisional wounds were made through the skin and panniculus carnosus muscle.
- the area to be incised was injected subcutaneously with 50 ⁇ l of either vehicle (PBS + 4 mM HCI) or TGF- ⁇ 1 (1 ⁇ g), or was left unmanipulated. Treatments were rotated to ensure no site bias.
- Histological sections were prepared from wound tissue fixed in 10% buffered formal saline and embedded in paraffin. 7- ⁇ m sections were stained with haematoxylin and eosin, Masson's trichrome or Giemsa, or were subjected to immunohistochemistry with antibodies to TGF- ⁇ 1, 2 and 3 (Santa Cruz) or fibronectin, used at a dilution of 1:20 in PBS. Image analysis and quantification of cell numbers per unit area, of wound area (measured below the clot and above the panniculus muscle) and of re-epithelialization was done using an Optimas program as described (Ashcroft, G.S. et al.
- Chemotaxis of monocytes was stimulated in a 12-well chemotaxis chamber (Corning Costar Transwell Plate), in triplicate wells containing 400 ml FMLP (1 ⁇ M), control media, or TGF- ⁇ (1 pgml "1 ). Monocytes were resuspended in chemotaxis buffer (Hank's buffer with 0.5% BSA) at a final concentration of 3 x 10 5 per 100 ⁇ l; 100 ⁇ l was added to the upper chamber, and the monocytes were incubated for 90 min at 37°C in a humidified atmosphere (5% C0 2 ).
- Keratinocytes were isolated from the skin of newborn mice from crosses of Smad3 heterozygote adults by standard methods ( Dlugosz, A.A., Glick, A.B., Tennenbaum, T., Weinberg, W.C. & Yuspa, S.H. Isolation and utilization of epidermal keratinocytes for oncogene research. Methods Enzymol. 254, 3-20 (1995)). Cells were plated in EMEM medium, 8% chelexed fetal bovine serum, 0.2mM CaCI 2 with antibiotics, and then switched to the same media with 0.05 mM CaCI 2 .
- Each value represents the average number of cells migrated from triplicate wells.
- cells were seeded at 80,000 cells per well in a 24-well tissue-culture tray and allowed to proliferate for 3 days.
- Porcine TGF- ⁇ 1 R&D Systems
- Radioactivity incorporated into DNA was determined by established methods (Danielpour, D. et al. Immunodetection and quantitation of the two forms of transforming growth factor-beta (TGF- beta 1 and TGF-beta 2) secreted by cells in culture. J. Cell Physio/. 138, 79-86 (1989)).
- TGF- beta 1 and TGF-beta 2 secreted by cells in culture. J. Cell Physio/. 138, 79-86 (1989)
- Reverse transcription with polymerase chain reaction was done using the following primers (band intensities were normalized to those of the keratinoc ⁇ te/monocyte housekeeping gene HPRT (hypoxanthine phosphoribosyl transf erase); ⁇ , integrin, 5 '-CATTTCCGAGTCTGGGCCA (SEQ ID N0:3) and 5 '-TGGAGGCTTGAGCTGAGCTT (SEQ ID N0:4); ⁇ , integrin, 5 ' -TGTTCAGTGCAGAGCCTTCA (SEQ ID N0:5) and 5 CCTCATACTTCGGATTGACC (SEQ ID N0:6); intercellular adhesion molecule (ICAM), 5 TTCAACCCGTGCCAAGCCCACGCT (SEQ ID N0:7) and 5 '-GCCAGCACCGTGAATGTGATCTCC (SEQ ID N0:8); E cadherin, 5 '-TCAGCACCCACACACATACA (SEQ ID N0:9) and 5 '-G
- Band densities were normalized to those of the keratinocyte monocyte housekeeping gene 132 for both the cytokine and the receptor templates, using an image-analysis program (Image Quant, Molecular Dynamics). All data were analyzed by Student's t-test or analysis of variance.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biomedical Technology (AREA)
- Dermatology (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Epidemiology (AREA)
- Immunology (AREA)
- Physical Education & Sports Medicine (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
Description
Claims
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| PCT/US2000/013725 WO2001089556A1 (en) | 2000-05-19 | 2000-05-19 | Inhibition of smad3 to prevent fibrosis and improve wound healing |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1292323A1 true EP1292323A1 (en) | 2003-03-19 |
Family
ID=21741399
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00932586A Withdrawn EP1292323A1 (en) | 2000-05-19 | 2000-05-19 | Inhibition of smad3 to prevent fibrosis and improve wound healing |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1292323A1 (en) |
| JP (1) | JP2004510696A (en) |
| AU (2) | AU2000250285B2 (en) |
| CA (1) | CA2410987A1 (en) |
| WO (1) | WO2001089556A1 (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB0100762D0 (en) * | 2001-01-11 | 2001-02-21 | Smithkline Beecham Plc | Novel use |
| GB0302315D0 (en) * | 2003-02-01 | 2003-03-05 | Univ East Anglia | Novel therapeutic target |
| US20110213011A1 (en) * | 2010-02-26 | 2011-09-01 | Dean Nicholas M | Modulation of smad3 expression |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5866693A (en) * | 1996-10-16 | 1999-02-02 | Smithkline Beecham Corporation | DNA encoding human MAD proteins |
| EP0894856A1 (en) * | 1997-08-01 | 1999-02-03 | Smithkline Beecham Corporation | A human sMAD3 splice variant |
| GB9802475D0 (en) * | 1998-02-06 | 1998-04-01 | Glaxo Group Ltd | Method |
| DE60001229T2 (en) * | 1999-04-09 | 2003-10-30 | Smithkline Beecham Corp., Philadelphia | triarylimidazoles |
-
2000
- 2000-05-19 CA CA002410987A patent/CA2410987A1/en not_active Abandoned
- 2000-05-19 JP JP2001585799A patent/JP2004510696A/en active Pending
- 2000-05-19 AU AU2000250285A patent/AU2000250285B2/en not_active Ceased
- 2000-05-19 AU AU5028500A patent/AU5028500A/en active Pending
- 2000-05-19 EP EP00932586A patent/EP1292323A1/en not_active Withdrawn
- 2000-05-19 WO PCT/US2000/013725 patent/WO2001089556A1/en not_active Ceased
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0189556A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2001089556A1 (en) | 2001-11-29 |
| JP2004510696A (en) | 2004-04-08 |
| AU2000250285B2 (en) | 2006-05-04 |
| AU2000250285A1 (en) | 2002-02-21 |
| CA2410987A1 (en) | 2001-11-29 |
| AU5028500A (en) | 2001-12-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6410693B1 (en) | Inhibitors of the JNK signal transduction pathway and methods of use | |
| US20030171295A1 (en) | Screening methods for compounds useful in the regulation of body weight | |
| JP2004536579A (en) | Vascular endothelial growth factor 2 | |
| US8536128B2 (en) | Granulin/epithelin precursor (GEP), a chondrogenic growth factor and target in cartilage disorders | |
| JPH11500309A (en) | Compositions and methods for treatment and diagnosis of cardiovascular disease | |
| AU2001234721B8 (en) | Human Cyr61 | |
| CA2264485A1 (en) | Gata-6 transcription factor: compositions and methods | |
| US7585497B2 (en) | Induction of apoptosis and cell growth inhibition by protein 4.33 | |
| AU2001234721A1 (en) | Human Cyr61 | |
| US20060040253A1 (en) | Use of Smad3 inhibitor in the treatment of fibrosis dependent on epithelial to mesenchymal transition as in the eye and kidney | |
| KR100942880B1 (en) | Bv8 Nucleic Acids and Polypeptides with Mitogenic Activity | |
| US6004936A (en) | Method of use of serum amyloid a protein | |
| AU2000250285B2 (en) | Inhibition of SMAD3 to prevent fibrosis and improve wound healing | |
| US20060079449A1 (en) | Inhibition of Smad3 to prevent fibrosis and improve wound healing | |
| AU767068B2 (en) | Methods and compositions for control of bone formation via modulation of leptin activity | |
| WO1998011222A1 (en) | Screening methods for compounds useful in the treatment of schizophrenia | |
| US20040247596A1 (en) | TRANCE regulation of chondrocyte differentiation | |
| WO2001052883A1 (en) | Inhibitors of protease-activated receptor-2 (par-2) as novel asthma therapeutics | |
| AU6118296A (en) | Serum amyloid a protein | |
| EP1191945A1 (en) | Methods and compositions for control of bone formation via modulation of leptin activity | |
| WO2000053630A2 (en) | COMPOUNDS THAT DISRUPT MAMMALIAN Rad51 ACTIVITY | |
| KR100961345B1 (en) | EV-VEEP nucleic acids and polypeptides and methods of use | |
| WO2001032925A9 (en) | Modulation of neuroendocrine differentiation by protein 25.1 | |
| EP1892250A2 (en) | CYR61 compositions and methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20021218 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| AX | Request for extension of the european patent |
Extension state: AL LT LV MK RO SI |
|
| 17Q | First examination report despatched |
Effective date: 20030530 |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: MITCHELL, JAMES, B. Inventor name: RUSSO, ANGELO Inventor name: ASHCROFT, GILLIAN, S. Inventor name: ROBERTS, ANITA, B. |
|
| 17Q | First examination report despatched |
Effective date: 20030530 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20071030 |