EP1280783A2 - Methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma modulators - Google Patents

Methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma modulators

Info

Publication number
EP1280783A2
EP1280783A2 EP01935404A EP01935404A EP1280783A2 EP 1280783 A2 EP1280783 A2 EP 1280783A2 EP 01935404 A EP01935404 A EP 01935404A EP 01935404 A EP01935404 A EP 01935404A EP 1280783 A2 EP1280783 A2 EP 1280783A2
Authority
EP
European Patent Office
Prior art keywords
hydrogen
halogen
condition
alkyl
alkoxy
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP01935404A
Other languages
German (de)
French (fr)
Inventor
Thomas P. Burris
Keith T. Demarest
Donald W. Combs
Philip J. Rybczynski
Ignatius J. Turchi
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Janssen Pharmaceuticals Inc
Original Assignee
Ortho McNeil Pharmaceutical Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ortho McNeil Pharmaceutical Inc filed Critical Ortho McNeil Pharmaceutical Inc
Publication of EP1280783A2 publication Critical patent/EP1280783A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D413/00Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms
    • C07D413/02Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings
    • C07D413/12Heterocyclic compounds containing two or more hetero rings, at least one ring having nitrogen and oxygen atoms as the only ring hetero atoms containing two hetero rings linked by a chain containing hetero atoms as chain links
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07DHETEROCYCLIC COMPOUNDS
    • C07D265/00Heterocyclic compounds containing six-membered rings having one nitrogen atom and one oxygen atom as the only ring hetero atoms
    • C07D265/281,4-Oxazines; Hydrogenated 1,4-oxazines
    • C07D265/341,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings
    • C07D265/361,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings condensed with one six-membered ring

Definitions

  • This invention relates to methods of using benzoxazinones for the treatment of Non-Insulin Dependant Diabetes Mellitus (NIDDM) and complications thereof and disorders related to lipid metabolism and energy homeostasis such as obesity. More particularly, the compounds act through the Peroxisome Proliterator Activated Receptor gamma (PPAR ⁇ ) .
  • NIDDM Non-Insulin Dependant Diabetes Mellitus
  • PPAR ⁇ Peroxisome Proliterator Activated Receptor gamma
  • Diabetes is a disease caused by multiple factors and characterized by hyperglycemia which may be associated with increased and premature mortality due to an increased risk for microvascular and macrovascular diseases such as nephropathy, neuropathy, retinopathy, atherosclerosis, polycystic ovary syndrome (PCOS) , hypertension, ischemia, stroke, and heart disease.
  • Type I diabetes results from genetic deficiency of insulin, the hormone regulating glucose metabolism.
  • Type II diabetes is known as non- insulin dependent diabetes mellitus (NIDDM) , and is due to a profound resistance to insulin regulatory effect on glucose and lipid metabolism in the main insulin-sensitive tissues, i.e., muscle, liver and adipose tissue.
  • NIDDM non- insulin dependent diabetes mellitus
  • This insulin resistance or reduced insulin sensitivity results in insufficient insulin activation of glucose uptake, oxidation and storage in muscle and inadequate insulin repression of lipolysis in adipose tissue as well as glucose production and secretion in liver.
  • Many Type II diabetics are also obese, and obesity is believed to cause and/or exacerbate many health and social problems such as coronary heart disease, stroke, obstructive sleep apnoea, gout, hyperlipidemia, osteoarthritis, reduced fertility, and impaired psychosocial function.
  • thiazolidinediones have been suggested to be capable of ameliorating many symptoms of NIDDM by binding to the peroxisome proliferator activated receptor (PPAR) family of receptors. They increase insulin sensitivity in muscle, liver and adipose tissue in several animal models of NIDDM resulting in correction of the elevated plasma levels of glucose, triglycerides and nonesterified free fatty acids without any occurrence of hypoglycemia .
  • PPAR peroxisome proliferator activated receptor
  • undesirable effects have occurred in animal and/or human studies including cardiac hypertrophy, hemadilution and liver toxicity.
  • PPAR ⁇ agonists currently in development have thiazolidinedione ring as their common chemical structure. PPAR ⁇ agonists have been demonstrated to be extremely useful for the treatment of NIDDM and other disorders involving insulin resistance. Recently, troglitazone, rosiglitazone, and pioglitazone have been approved for treatment of type II diabetes. There is also indication that benzimidazole-containing thiazolidinedione derivatives may be used to treat irritable bowel disorder
  • JP 09012576 (Yoshitake et al . ) discloses
  • JP 09012575 discloses benzoxazine and benzothiazine derivatives stated to be useful as 0 prophylactic drugs and/or therapeutic drugs in hyperlipemia, hyperglycemia, obesity, diseases attributable to sugar tolerance insufficiency, hypertension, osteoporosis, cachexia, and complications of diabetes such as retinopathy, nephrosis, neuropathy, cataract, coronary artery disease and arteriosclerosis.
  • WO 99/20614 discloses ⁇ -aryl- ⁇ - oxysubstituted alkylcarboxylic acids stated as antiobesity and hypocholesterolemic compounds which may have agonist activity against PPAR and/or PPAR ⁇ , and optionally inhibit HMG CoA reductase .
  • WO 99/38845 (De La Brouse-Elwood et al . ) discloses the following compounds,
  • substituents are as described in the reference, which are stated to modulate the PPAR ⁇ receptor and are stated as useful in the diagnosis and treatment of type II diabetes (and complications thereof) and inflammatory disorders.
  • the present invention is directed to a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I,
  • Q is a fused phenyl or fused pyridyl moiety
  • Z 1 is hydrogen, halogen, COOR- L , alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl ;
  • Z 2 is hydrogen or a halogen
  • X is hydrogen or oxygen
  • A is alkyl, alkylaryl or alkylheterocyclyl
  • aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with C ⁇ Cg alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo alkoxy, or methylsulfonylamino;
  • n is an integer from 0-3;
  • Y is selected from (a) NHR.R 2 , N ⁇ R ⁇ ;
  • R l t R 2 and R 3 are independently hydrogen, alkyl, or t-butoxycarbonyl
  • R 4 and R 5 are independently t-butoxycarbonyl or hydrogen, or R 4 and R 5 may be joined together to form an imidazoline, imidazolyl or pyrimidine ring;
  • R 6 is hydrogen, hydroxy, or halogen; and
  • R 7 is C0 2 H or C (O)NH (CH 2 ) p OH wherein p is an integer from 1-4.
  • Illustrative of the invention is a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein A is G ⁇ Cg alkylheterocyclyl when X is hydrogen and Y is
  • Also illustrating the invention is a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject a pharmaceutical composition comprising an effective amount of a compound of Formula I and a pharmaceutically acceptable carrier.
  • a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity comprises administering to said subject an effective amount of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein said condition is selected from NIDDM, obesity, nephropathy, neuropathy, retinopathy, atherosclerosis polycystic ovary syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataract.
  • Also included in the invention is a method of inhibiting in a subject the onset of a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof.
  • a process for making a pharmaceutical composition comprising mixing any of the compounds of Formula I and a pharmaceutically acceptable carrier.
  • the present invention provides a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I ,
  • Q is a fused phenyl or fused pyridyl moiety
  • Z 1 is hydrogen, halogen, COOR x , alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl;
  • Z 2 is hydrogen or a halogen
  • X is hydrogen or oxygen
  • A is C- L -C 8 alkyl, alkylheterocyclyl
  • aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo (C ⁇ Cg) alkoxy, or methylsulfonylamino; n is an integer from 0-3; and
  • Y is selected from
  • R 1# R 2 and R 3 are independently hydrogen, Ci-Cg alkyl, or t-butoxycarbonyl; R 4 and R 5 are independently t-butoxycarbonyl or hydrogen, or R 4 and R s may be joined together to form an imidazoline, i idazolyl or pyri idine ring; R 6 is hydrogen, hydroxy, or halogen; and R 7 is C0 2 H or C (0) NH (CH 2 ) p 0H wherein p is an integer from 1-4.
  • the subject is a human and the condition is a disorder in glucose or lipid metabolism. More particularly the condition is reduced insulin sensitivity such as NIDDM and obesity.
  • X is oxygen. More particularly R 6 is hydrogen or halogen when n is 1. Still More particularly A is C- L -Cg alkylheterocyclyl when X is hydrogen and Y is
  • the present invention also provides a method of inhibiting in a subject the onset of a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to the subject a prophylactically effective dose of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein
  • Q is a fused phenyl or fused pyridyl moiety
  • Z x is hydrogen, halogen, alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl;
  • Z 2 is hydrogen or a halogen
  • X is hydrogen or oxygen
  • A is C x -C 6 alkyl, alkylaryl or C..-Cg alkylheterocyclyl
  • aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with C 1 -C 6 alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo alkoxy, or methylsulfonylamino;
  • n is an integer from 0-3;
  • Y is selected from
  • R l t R 2 and R 3 are independently hydrogen, C ⁇ C- alkyl, or t-butoxycarbonyl; R 4 and R s are independently t-butoxycarbonyl or hydrogen, or R 4 and R 5 may be joined together to form an i idazoline, imidazolyl or pyrimidine ring;
  • R 6 is hydrogen, hydroxy, or halogen; and R 7 is C0 2 H or C(0)NH(CH 2 ) p OH wherein p is an integer from 1-4.
  • the subject is a human and the condition is a disorder in glucose or lipid metabolism such as NIDDM and obesity.
  • X is oxygen. More particularly R 6 is hydrogen or halogen when n is 1. More particularly A is Ci-Cg alkylheterocyclyl when X is hydrogen and Y is
  • alkyl and “alkoxy” as used herein, whether used alone or as part of a substituent group, include straight and branched chains having 1 to 10 carbon atoms, or any number within this range.
  • alkyl radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n- pentyl, 3- (2-methyl) butyl, 2-pentyl, 2-methylbutyl , neopentyl, n-hexyl, 2-hexyl, 2-methylpentyl, and the like.
  • Alkoxy radicals are oxygen ethers formed from the previously described straight or branched chain alkyl groups. Cycloalkyl groups contain 3 to 8 ring carbons and preferably 5 to 7 ring carbons. Similarly, alkenyl and alkynyl groups include straight and branched chain alkenes and alkynes having 1 to 10 carbon atoms, or any number within this range.
  • aryl employed alone or in combination with other terms (e.g., aryloxy, arylthioxy, arylalkyl) , is an aromatic radical which can be a single ring or multiple rings which are fused together or linked covalently.
  • Illustrative aryl groups may be phenyl or naphthyl optionally substituted with one or more of the following: H, C ⁇ C ⁇ alkyl, C 3 -C 8 cycloalkyl, COOR 1 , CONR ⁇ 2 , OH, C ⁇ C ⁇ alkyl ether, aryl or heterocyclyl ether, OC(0)R x , 0C(0)NR 1 R 2 , NR , NR 3 C(0)OR 1 ,
  • Heterocyclyl or “heterocycle” is a 3- to 8-member saturated or unsaturated heterocyclic group containing 1-4 nitrogens, an oxygen, or a sulfur atom; or one nitrogen and either oxygen or sulfur.
  • composition is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts .
  • subject refers to an animal, preferably a mammal, most preferably a human, who has been the object of treatment, observation or experiment . Methods are known in the art for determining therapeutically and prophylactically effective doses for the instant pharmaceutical composition.
  • therapeutically effective amount means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the disease or disorder being treated.
  • prophylactically effective amount refers to that amount of active compound or pharmaceutical agent that inhibits in a subject the onset of a disorder as being sought by a researcher, veterinarian, medical doctor or other clinician, the delaying of which disorder is mediated by the modulation of PPAR ⁇ activity.
  • these compounds can activate or block the actions of PPAR ⁇ .
  • the utility of the compounds to treat disorders associated with Peroxisome Proliferator Activated Receptor gamma activity can be determined according to the procedures described herein.
  • the present invention therefore provides a method of treating disorders associated with Peroxisome Proliferator Activated Receptor gamma activity in a subject in need thereof which comprises administering any of the compounds as defined herein in a quantity effective to treat such disorders.
  • the compound may be administered to a patient by any conventional route of administration, including, but not limited to, intravenous, oral, subcutaneous, intramuscular, intradermal and parenteral.
  • the present invention also provides pharmaceutical compositions comprising one or more compounds of this invention in association with a pharmaceutically acceptable carrier.
  • the pharmaceutical composition may contain between about 0.1 mg and 1000 mg, preferably about 100 to 500 mg, of the compound, and may be constituted into any form suitable for the mode of administration selected.
  • Carriers include necessary and inert pharmaceutical excipients, including, but not limited to, binders, suspending agents, lubricants, flavorants, sweeteners, preservatives, dyes, and coatings.
  • compositions suitable for oral administration include solid forms, such as pills, tablets, caplets, capsules (each including immediate release, timed release and sustained release formulations) , granules, and powders, and liquid forms, such as solutions, syrups, elixirs, emulsions, and suspensions.
  • forms useful for parenteral administration include sterile solutions, emulsions and suspensions.
  • compositions of this invention one or more compounds of Formula I or salt thereof of the invention as the active ingredient, is intimately admixed with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques, which carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral such as intramuscular.
  • a pharmaceutical carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral such as intramuscular.
  • any of the usual pharmaceutical media may be employed.
  • suitable carriers and additives include water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like;
  • suitable carriers and additives include starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents and the like. Because of their ease in administration, tablets and capsules represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be sugar coated or enteric coated by standard techniques.
  • the carrier will usually comprise sterile water, though other ingredients, for example, for purposes such as aiding solubility or for preservation, may be included. Injectable suspensions may also be prepared, in which case appropriate liquid carriers, suspending agents and the like may be employed.
  • the pharmaceutical compositions herein will contain, per dosage unit, e.g., tablet, capsule, powder, injection, teaspoonful and the like, an amount of the active ingredient necessary to deliver an effective dose as described above.
  • the pharmaceutical compositions herein will contain, per unit dosage unit, e.g., tablet, capsule, powder, injection, suppository, teaspoonful and the like, from about 0.01 mg to 30 mg/kg of body weight per day.
  • the range is from about 0.03 to about 15 mg/kg of body weight per day, most preferably, from about 0.05 to about 10 mg/kg of body weight per day.
  • the compounds may be administered on a regimen of 1 to 2 times per day. The dosages, however, may be varied depending upon the requirement of the patients, the severity of the condition being treated and the compound being employed. The use of either daily administration or post-periodic dosing may be employed.
  • compositions are in unit dosage forms such as tablets, pills, capsules, powders, granules, sterile parenteral solutions or suspensions, metered aerosol or liquid sprays, drops, ampoules, auto-injector devices or suppositories; for oral parenteral, intranasal, sublingual or rectal administration, or for administration by inhalation or insufflation.
  • the composition may be presented in a form suitable for once- weekly or once-monthly administration; for example, an insoluble salt of the active compound, such as the decanoate salt, may be adapted to provide a depot preparation for intramuscular injection.
  • a pharmaceutical carrier e.g.
  • a solid preformulation composition containing a homogeneous mixture of a compound of the present invention, or a pharmaceutically acceptable salt thereof.
  • preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective dosage forms such as tablets, pills and capsules.
  • This solid preformulation composition is then subdivided into unit dosage forms of the type described above containing from 0.1 to about 500 • mg of the active ingredient of the present invention.
  • the tablets or pills of the novel composition can be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action.
  • the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former.
  • the two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release.
  • enteric layers or coatings such materials including a number of polymeric acids with such materials as shellac, cetyl alcohol and cellulose acetate.
  • liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include, aqueous solutions, suitably flavoured syrups, aqueous or oil suspensions, and flavoured emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil or peanut oil, as well as elixirs and similar pharmaceutical vehicles.
  • Suitable dispersing or suspending agents for aqueous suspensions include synthetic and natural gums such as tragacanth, acacia, alginate, dextran, sodium carboxymethylcellulose, methylcellulose, polyvinyl- pyrrolidone or gelatin.
  • liquid forms in suitably flavored suspending or dispersing agents may also include the synthetic and natural gums, for example, tragacanth, acacia, methyl-cellulose and the like.
  • tragacanth for example, tragacanth, acacia, methyl-cellulose and the like.
  • methyl-cellulose for example, tragacanth, acacia, methyl-cellulose and the like.
  • sterile suspensions and solutions are desired.
  • Isotonic preparations which generally contain suitable preservatives are employed when intravenous administration is desired.
  • compounds of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily.
  • compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal skin patches well known to those of ordinary skill in that art.
  • the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
  • the active drug component can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like.
  • suitable binders include, without limitation, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like.
  • Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum and the like.
  • the daily dosage of the products may be varied over a wide range from 1 to 1000 mg per adult human per day.
  • the compositions are preferably provided in the form of tablets containing, 0.01,0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 150, 200, 250 and 500 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated.
  • An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.01 mg/kg to about 30 mg/kg of body weight per day.
  • the range is from about 0.03 to about 15 mg/kg of body weight per day, and more particularly, from about 0.05 to about 10 mg/kg of body weight per day.
  • the compounds may be administered on a regimen of 1 to 2 times per day.
  • Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular compound used, the mode of administration, the strength of the preparation, the mode of administration, and the advancement of the disease condition. In addition, factors associated with the particular patient being treated, including patient age, weight, diet and time of administration, will result in the need to adjust dosages.
  • the compound of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles.
  • Liposomes can be formed from a variety of lipids, including but not limited to amphipathic lipids such as phosphatidylcholines, sphingomyelins, phosphatidylethanolamines, phophatidylcholines, cardiolipins, phosphatidylserines, phosphatidylglycerols, phosphatidic acids, phosphatidylinositols, diacyl trimethylammonium propanes, diacyl dimethylammonium propanes, and stearylamine, neutral lipids such as triglycerides, and combinations thereof. They may either contain cholesterol or may be cholesterol-free.
  • stereochemically pure isomeric forms may be obtained by the application of art known principles. Diastereoisomers may be separated by physical separation methods such as fractional crystallization and chromatographic techniques, and enantiomers may be separated from each other by the selective crystallization of the diastereomeric salts with optically active acids or bases or by chiral chromatography. Pure stereoisomers may also be prepared synthetically from appropriate stereochemically pure starting materials, or by using stereoselective reactions.
  • Some of the compounds of the present invention may have trans and cis isomers.
  • these isomers may be separated by conventional techniques such as preparative chromatography.
  • the compounds may be prepared as a single stereoisomer or in racemic form as a mixture of some possible stereoisomers.
  • the non-racemic forms may be obtained by either synthesis or resolution.
  • the compounds may, for example, be resolved into their component enantiomers by standard techniques, such as the formation of diastereomeric pairs by salt formation.
  • the compounds may also be resolved by covalent linkage to a chiral auxiliary, followed by chromatographic separation and/or crystallographic separation, and removal of the chiral auxiliary.
  • the compounds may be resolved using chiral chromatography.
  • the scope of the present invention is intended to cover all such isomers or stereoisomers per se, as well as mixtures of cis and trans isomers, mixtures of diastereomers and racemic mixtures of enantiomers (optical isomers) as well.
  • the aqueous mixture was washed with 4 X 60 mL of 2:1 ethyl acetate/diethyl ether.
  • the combined organic extracts were washed with 4 X 30 mL 1 N HC1, 4 X 30 mL water, and 30 mL brine.
  • the organic phase was dried (Na 2 S0 4 ) , filtered, and solvent was removed in vacuo. Obtain 5.52 g (24.9 mmol).
  • the differentiation assay may be initiated.
  • Medium may be removed and replaced with 150 ⁇ l of differentiation medium containing vehicle (DMSO) or test compounds with a known aP2 activator or such aP2 activator alone. Cells may be returned to incubator for 24 hours culture.
  • DMSO differentiation medium containing vehicle
  • aP2 activator or such aP2 activator alone.
  • Cells may be returned to incubator for 24 hours culture.
  • 100 ⁇ l of lysis buffer may be added to initiate the bDNA aP2 mRNA assay.
  • the branched DNA assay may be performed according to the manufacturer's protocol (Bayer Diagnostics; Emeryville, CA) . Result may be expressed as percent inhibition of aP2 mRNA production activated by the aP2 activator.
  • IC 50 's may be determined by non-linear regression with a sigmoidal fit curve.
  • cells may be lysed with lysis buffer (Bayer Diagnostics) containing the aP2 oligonucleotides. After a 15 minutes incubation at 53°C or 30 minutes at 37°C incubator, 70 ⁇ l of the lysis buffer from each well may be added to a corresponding capture well (preincubated with 70 ⁇ l of blocking buffer (Bayer Diagnostics) ) . The capture plate may be incubated overnight at 53°C in a plate incubator
  • bDNA and labeled probes may be annealed as directed by the manufacturer. Following a 30-minute incubation with the luminescent alkaline phosphatase substrate, dioxitane, the luminescence may be quantitated in a Dynex MLX microtiter plate luminometer.
  • Oligonucleotide probes designed to anneal to the aP2 mRNA and function in the bDNA mRNA detection system are designed with ProbeDesigner software (Bayer Diagnostics) . This software package analyzes a target sequence of interest with a series of algorithms in order to determine which regions of the sequence can perform as locations for capture, label, or spacer probe annealing. The sequences of the oligonucleotides are as follows :

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Obesity (AREA)
  • Diabetes (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Medicinal Chemistry (AREA)
  • Hematology (AREA)
  • Engineering & Computer Science (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)

Abstract

The invention is directed to methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma (PPARη) agonists or antagonists.

Description

MBTHODS OF TREATMENT USING BENZOXAZINONES AS PEROXISOME PROLIFERATOR ACTIVATED RECEPTOR GAMMA MODULATORS
Cross Reference to Related Applications
This application claims priority from U.S. Serial No. 60/203,861, filed May 12, 2000.
Field of the Invention
This invention relates to methods of using benzoxazinones for the treatment of Non-Insulin Dependant Diabetes Mellitus (NIDDM) and complications thereof and disorders related to lipid metabolism and energy homeostasis such as obesity. More particularly, the compounds act through the Peroxisome Proliterator Activated Receptor gamma (PPARγ) .
Background of the Invention
Diabetes is a disease caused by multiple factors and characterized by hyperglycemia which may be associated with increased and premature mortality due to an increased risk for microvascular and macrovascular diseases such as nephropathy, neuropathy, retinopathy, atherosclerosis, polycystic ovary syndrome (PCOS) , hypertension, ischemia, stroke, and heart disease. Type I diabetes (IDDM) results from genetic deficiency of insulin, the hormone regulating glucose metabolism. Type II diabetes is known as non- insulin dependent diabetes mellitus (NIDDM) , and is due to a profound resistance to insulin regulatory effect on glucose and lipid metabolism in the main insulin-sensitive tissues, i.e., muscle, liver and adipose tissue. This insulin resistance or reduced insulin sensitivity results in insufficient insulin activation of glucose uptake, oxidation and storage in muscle and inadequate insulin repression of lipolysis in adipose tissue as well as glucose production and secretion in liver. Many Type II diabetics are also obese, and obesity is believed to cause and/or exacerbate many health and social problems such as coronary heart disease, stroke, obstructive sleep apnoea, gout, hyperlipidemia, osteoarthritis, reduced fertility, and impaired psychosocial function.
A class of compounds, thiazolidinediones (glitazones) , have been suggested to be capable of ameliorating many symptoms of NIDDM by binding to the peroxisome proliferator activated receptor (PPAR) family of receptors. They increase insulin sensitivity in muscle, liver and adipose tissue in several animal models of NIDDM resulting in correction of the elevated plasma levels of glucose, triglycerides and nonesterified free fatty acids without any occurrence of hypoglycemia . However, undesirable effects have occurred in animal and/or human studies including cardiac hypertrophy, hemadilution and liver toxicity.
Most PPARγ agonists currently in development have thiazolidinedione ring as their common chemical structure. PPARγ agonists have been demonstrated to be extremely useful for the treatment of NIDDM and other disorders involving insulin resistance. Recently, troglitazone, rosiglitazone, and pioglitazone have been approved for treatment of type II diabetes. There is also indication that benzimidazole-containing thiazolidinedione derivatives may be used to treat irritable bowel disorder
(IBD) , inflammation, and cataract (JP 10195057) .
JP 09012576 (Yoshitake et al . ) discloses
5. benzothiazine derivatives stated as useful therapeutic agents for circulatory system disease and glaucoma.
JP 09012575 (Hiroaki et al . ) discloses benzoxazine and benzothiazine derivatives stated to be useful as 0 prophylactic drugs and/or therapeutic drugs in hyperlipemia, hyperglycemia, obesity, diseases attributable to sugar tolerance insufficiency, hypertension, osteoporosis, cachexia, and complications of diabetes such as retinopathy, nephrosis, neuropathy, cataract, coronary artery disease and arteriosclerosis.
WO 99/20614 (Lohray et al . ) discloses β-aryl-α- oxysubstituted alkylcarboxylic acids stated as antiobesity and hypocholesterolemic compounds which may have agonist activity against PPAR and/or PPARγ, and optionally inhibit HMG CoA reductase .
WO 97/17333 (Frechette et al . ) and U.S. Patent Nos. 5,696,117 and 5,854,242 to Frechette et al . disclose benzoxazine and pyrido-oxazine compounds including compounds of Formula I, all of which have a moiety of a fused phenyl or fused pyridyl, pharmaceutical compositions containing the compounds, and methods for their production and their use in treating bacterial infections.
U.S. Patent No. 5,859,051 to Adams et al . discloses the following acetylphenols,
wherein substituents are as described in the reference, which are stated to be useful as antiobesity and antidiabetic compounds lacking the thiazolidinedione moiety.
WO 99/38845 (De La Brouse-Elwood et al . ) discloses the following compounds,
wherein substituents are as described in the reference, which are stated to modulate the PPARγ receptor and are stated as useful in the diagnosis and treatment of type II diabetes (and complications thereof) and inflammatory disorders.
Summary of the Invention
The present invention is directed to a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I,
or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein
Q is a fused phenyl or fused pyridyl moiety;
Z1 is hydrogen, halogen, COOR-L, alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl ;
Z2 is hydrogen or a halogen;
X is hydrogen or oxygen;
A is alkyl, alkylaryl or alkylheterocyclyl
wherein said aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with C^Cg alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo alkoxy, or methylsulfonylamino;
n is an integer from 0-3; and
Y is selected from (a) NHR.R2, N^R^;
(b) NHC (NR4) NRS ;
( c ) C02H, CHO;
(d) CH (R6) COOH, CH (R6) COOCH3 , CH=CHR7 , CH=C (C00H) 2 ;
(e) a moiety of the formula
(f) 5-tetrazolyl, wherein
Rl t R2 and R3 are independently hydrogen, alkyl, or t-butoxycarbonyl;
R4 and R5 are independently t-butoxycarbonyl or hydrogen, or R4 and R5 may be joined together to form an imidazoline, imidazolyl or pyrimidine ring; R6 is hydrogen, hydroxy, or halogen; and R7 is C02H or C (O)NH (CH2)pOH wherein p is an integer from 1-4.
Illustrative of the invention is a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein A is G^Cg alkylheterocyclyl when X is hydrogen and Y is
Also illustrating the invention is a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject a pharmaceutical composition comprising an effective amount of a compound of Formula I and a pharmaceutically acceptable carrier.
Further illustrating the invention is a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein said condition is selected from NIDDM, obesity, nephropathy, neuropathy, retinopathy, atherosclerosis polycystic ovary syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataract.
Also included in the invention is a method of inhibiting in a subject the onset of a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof.
Further included in the invention is a process for making a pharmaceutical composition comprising mixing any of the compounds of Formula I and a pharmaceutically acceptable carrier.
Detailed Description of the Invention The present invention provides a method of treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula I ,
or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein
Q is a fused phenyl or fused pyridyl moiety;
Z1 is hydrogen, halogen, COORx, alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl;
Z2 is hydrogen or a halogen;
X is hydrogen or oxygen;
A is C-L-C8 alkyl, alkylheterocyclyl
wherein said aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo (C^Cg) alkoxy, or methylsulfonylamino; n is an integer from 0-3; and
Y is selected from
(a) NHRiRj. N R-.R3;
(b) NHC(NR4)NR5;
(c) C02H, CHO;
(d) CH(R6)COOH, CH(R6)COOCH3, CH=CHR7, CH=C(COOH)2;
(e) a moiety of the formula
(f) 5-tetrazolyl, wherein
R1# R2 and R3 are independently hydrogen, Ci-Cg alkyl, or t-butoxycarbonyl; R4 and R5 are independently t-butoxycarbonyl or hydrogen, or R4 and Rs may be joined together to form an imidazoline, i idazolyl or pyri idine ring; R6 is hydrogen, hydroxy, or halogen; and R7 is C02H or C (0) NH (CH2) p0H wherein p is an integer from 1-4.
Particularly, the subject is a human and the condition is a disorder in glucose or lipid metabolism. More particularly the condition is reduced insulin sensitivity such as NIDDM and obesity.
Particularly X is oxygen. More particularly R6 is hydrogen or halogen when n is 1. Still More particularly A is C-L-Cg alkylheterocyclyl when X is hydrogen and Y is
Another embodiment of the present invention is a method of treating a subject using an effective amount of a compound of Formula I wherein Y is selected from C02H, CHO, CH(R6)COOH, CH (R6) C00CH3, CH=CHR7, CH=C(COOH)2, a moiety of the formula
and 5-tetrazolyl, wherein R6 and R7 are as described above.
The present invention also provides a method of inhibiting in a subject the onset of a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to the subject a prophylactically effective dose of a compound of Formula I, or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein
Q is a fused phenyl or fused pyridyl moiety;
Zx is hydrogen, halogen, alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl;
Z2 is hydrogen or a halogen; X is hydrogen or oxygen;
A is Cx-C6 alkyl, alkylaryl or C..-Cg alkylheterocyclyl
wherein said aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with C1-C6 alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo alkoxy, or methylsulfonylamino;
n is an integer from 0-3; and
Y is selected from
(a) NHR1R2 , N RjR;, ;
(b) NHC (NR4) NR5 ; (c) C02H, CHO;
(d) CH (R6) COOH, CH (Rs) COOCH3 , CH=CHR7 , CH=C (C00H) 2 ;
(e) a moiety of the formula
(f) 5-tetrazolyl, wherein
Rl t R2 and R3 are independently hydrogen, C^C- alkyl, or t-butoxycarbonyl; R4 and Rs are independently t-butoxycarbonyl or hydrogen, or R4 and R5 may be joined together to form an i idazoline, imidazolyl or pyrimidine ring;
R6 is hydrogen, hydroxy, or halogen; and R7 is C02H or C(0)NH(CH2)pOH wherein p is an integer from 1-4.
Particularly, the subject is a human and the condition is a disorder in glucose or lipid metabolism such as NIDDM and obesity.
More particularly X is oxygen. More particularly R6 is hydrogen or halogen when n is 1. More particularly A is Ci-Cg alkylheterocyclyl when X is hydrogen and Y is
Unless otherwise noted, "alkyl" and "alkoxy" as used herein, whether used alone or as part of a substituent group, include straight and branched chains having 1 to 10 carbon atoms, or any number within this range. For example, alkyl radicals include methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, t-butyl, n- pentyl, 3- (2-methyl) butyl, 2-pentyl, 2-methylbutyl , neopentyl, n-hexyl, 2-hexyl, 2-methylpentyl, and the like. Alkoxy radicals are oxygen ethers formed from the previously described straight or branched chain alkyl groups. Cycloalkyl groups contain 3 to 8 ring carbons and preferably 5 to 7 ring carbons. Similarly, alkenyl and alkynyl groups include straight and branched chain alkenes and alkynes having 1 to 10 carbon atoms, or any number within this range.
Unless otherwise stated, "aryl," employed alone or in combination with other terms (e.g., aryloxy, arylthioxy, arylalkyl) , is an aromatic radical which can be a single ring or multiple rings which are fused together or linked covalently. Illustrative aryl groups may be phenyl or naphthyl optionally substituted with one or more of the following: H, C^C^ alkyl, C3-C8 cycloalkyl, COOR1, CONR^2, OH, C^C^ alkyl ether, aryl or heterocyclyl ether, OC(0)Rx, 0C(0)NR1R2, NR , NR3C(0)OR1,
NR3C(0)NR1R2, halogen or halo (F, Cl, Br, I).
"Heterocyclyl" or "heterocycle" is a 3- to 8-member saturated or unsaturated heterocyclic group containing 1-4 nitrogens, an oxygen, or a sulfur atom; or one nitrogen and either oxygen or sulfur.
It is intended that the definition of any substituent or variable at a particular location in a molecule be independent of its definitions elsewhere in that molecule. It is understood that substituents and substitution patterns on the compounds of this invention can be selected by one of ordinary skill in the art to provide compounds that are chemically stable and that can be readily synthesized by techniques known in the art as well as those methods set forth herein.
As used herein, the term "composition" is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product which results, directly or indirectly, from combinations of the specified ingredients in the specified amounts .
The term "subject" as used herein, refers to an animal, preferably a mammal, most preferably a human, who has been the object of treatment, observation or experiment . Methods are known in the art for determining therapeutically and prophylactically effective doses for the instant pharmaceutical composition. The term "therapeutically effective amount" as used herein, means that amount of active compound or pharmaceutical agent that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes alleviation of the symptoms of the disease or disorder being treated.
The term "prophylactically effective amount" refers to that amount of active compound or pharmaceutical agent that inhibits in a subject the onset of a disorder as being sought by a researcher, veterinarian, medical doctor or other clinician, the delaying of which disorder is mediated by the modulation of PPARγ activity.
Depending upon the biological environment (e.g., cell type, pathological condition of the host, etc.), these compounds can activate or block the actions of PPARγ. The utility of the compounds to treat disorders associated with Peroxisome Proliferator Activated Receptor gamma activity can be determined according to the procedures described herein. The present invention therefore provides a method of treating disorders associated with Peroxisome Proliferator Activated Receptor gamma activity in a subject in need thereof which comprises administering any of the compounds as defined herein in a quantity effective to treat such disorders. The compound may be administered to a patient by any conventional route of administration, including, but not limited to, intravenous, oral, subcutaneous, intramuscular, intradermal and parenteral.
The present invention also provides pharmaceutical compositions comprising one or more compounds of this invention in association with a pharmaceutically acceptable carrier. The pharmaceutical composition may contain between about 0.1 mg and 1000 mg, preferably about 100 to 500 mg, of the compound, and may be constituted into any form suitable for the mode of administration selected. Carriers include necessary and inert pharmaceutical excipients, including, but not limited to, binders, suspending agents, lubricants, flavorants, sweeteners, preservatives, dyes, and coatings. Compositions suitable for oral administration include solid forms, such as pills, tablets, caplets, capsules (each including immediate release, timed release and sustained release formulations) , granules, and powders, and liquid forms, such as solutions, syrups, elixirs, emulsions, and suspensions. Forms useful for parenteral administration include sterile solutions, emulsions and suspensions.
To prepare the pharmaceutical compositions of this invention, one or more compounds of Formula I or salt thereof of the invention as the active ingredient, is intimately admixed with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques, which carrier may take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral such as intramuscular. In preparing the compositions in oral dosage form, any of the usual pharmaceutical media may be employed. Thus, for liquid oral preparations, such as for example, suspensions, elixirs and solutions, suitable carriers and additives include water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like; for solid oral preparations such as, for example, powders, capsules, caplets, gelcaps and tablets, suitable carriers and additives include starches, sugars, diluents, granulating agents, lubricants, binders, disintegrating agents and the like. Because of their ease in administration, tablets and capsules represent the most advantageous oral dosage unit form, in which case solid pharmaceutical carriers are obviously employed. If desired, tablets may be sugar coated or enteric coated by standard techniques. For parenterals, the carrier will usually comprise sterile water, though other ingredients, for example, for purposes such as aiding solubility or for preservation, may be included. Injectable suspensions may also be prepared, in which case appropriate liquid carriers, suspending agents and the like may be employed. The pharmaceutical compositions herein will contain, per dosage unit, e.g., tablet, capsule, powder, injection, teaspoonful and the like, an amount of the active ingredient necessary to deliver an effective dose as described above. The pharmaceutical compositions herein will contain, per unit dosage unit, e.g., tablet, capsule, powder, injection, suppository, teaspoonful and the like, from about 0.01 mg to 30 mg/kg of body weight per day. Preferably, the range is from about 0.03 to about 15 mg/kg of body weight per day, most preferably, from about 0.05 to about 10 mg/kg of body weight per day. The compounds may be administered on a regimen of 1 to 2 times per day. The dosages, however, may be varied depending upon the requirement of the patients, the severity of the condition being treated and the compound being employed. The use of either daily administration or post-periodic dosing may be employed.
Preferably these compositions are in unit dosage forms such as tablets, pills, capsules, powders, granules, sterile parenteral solutions or suspensions, metered aerosol or liquid sprays, drops, ampoules, auto-injector devices or suppositories; for oral parenteral, intranasal, sublingual or rectal administration, or for administration by inhalation or insufflation. Alternatively, the composition may be presented in a form suitable for once- weekly or once-monthly administration; for example, an insoluble salt of the active compound, such as the decanoate salt, may be adapted to provide a depot preparation for intramuscular injection. For preparing solid compositions such as tablets, the principal active ingredient is mixed with a pharmaceutical carrier, e.g. conventional tableting ingredients such as corn starch, lactose, sucrose, sorbitol, talc, stearic acid, magnesium stearate, dicalcium phosphate or gums, and other pharmaceutical diluents, e.g. water, to form a solid preformulation composition containing a homogeneous mixture of a compound of the present invention, or a pharmaceutically acceptable salt thereof. When referring to these preformulation compositions as homogeneous, it is meant that the active ingredient is dispersed evenly throughout the composition so that the composition may be readily subdivided into equally effective dosage forms such as tablets, pills and capsules. This solid preformulation composition is then subdivided into unit dosage forms of the type described above containing from 0.1 to about 500 • mg of the active ingredient of the present invention. The tablets or pills of the novel composition can be coated or otherwise compounded to provide a dosage form affording the advantage of prolonged action. For example, the tablet or pill can comprise an inner dosage and an outer dosage component, the latter being in the form of an envelope over the former. The two components can be separated by an enteric layer which serves to resist disintegration in the stomach and permits the inner component to pass intact into the duodenum or to be delayed in release. A variety of materials can be used for such enteric layers or coatings, such materials including a number of polymeric acids with such materials as shellac, cetyl alcohol and cellulose acetate.
The liquid forms in which the novel compositions of the present invention may be incorporated for administration orally or by injection include, aqueous solutions, suitably flavoured syrups, aqueous or oil suspensions, and flavoured emulsions with edible oils such as cottonseed oil, sesame oil, coconut oil or peanut oil, as well as elixirs and similar pharmaceutical vehicles. Suitable dispersing or suspending agents for aqueous suspensions, include synthetic and natural gums such as tragacanth, acacia, alginate, dextran, sodium carboxymethylcellulose, methylcellulose, polyvinyl- pyrrolidone or gelatin. The liquid forms in suitably flavored suspending or dispersing agents may also include the synthetic and natural gums, for example, tragacanth, acacia, methyl-cellulose and the like. For parenteral administration, sterile suspensions and solutions are desired. Isotonic preparations which generally contain suitable preservatives are employed when intravenous administration is desired.
Advantageously, compounds of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily. Furthermore, compounds for the present invention can be administered in intranasal form via topical use of suitable intranasal vehicles, or via transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen.
For instance, for oral administration in the form of a tablet or capsule, the active drug component can be combined with an oral, non-toxic pharmaceutically acceptable inert carrier such as ethanol, glycerol, water and the like. Moreover, when desired or necessary, suitable binders; lubricants, disintegrating agents and coloring agents can also be incorporated into the mixture. Suitable binders include, without limitation, starch, gelatin, natural sugars such as glucose or beta-lactose, corn sweeteners, natural and synthetic gums such as acacia, tragacanth or sodium oleate, sodium stearate, magnesium stearate, sodium benzoate, sodium acetate, sodium chloride and the like. Disintegrators include, without limitation, starch, methyl cellulose, agar, bentonite, xanthan gum and the like.
The daily dosage of the products may be varied over a wide range from 1 to 1000 mg per adult human per day. For oral administration, the compositions are preferably provided in the form of tablets containing, 0.01,0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 150, 200, 250 and 500 milligrams of the active ingredient for the symptomatic adjustment of the dosage to the patient to be treated. An effective amount of the drug is ordinarily supplied at a dosage level of from about 0.01 mg/kg to about 30 mg/kg of body weight per day. Particularly, the range is from about 0.03 to about 15 mg/kg of body weight per day, and more particularly, from about 0.05 to about 10 mg/kg of body weight per day. The compounds may be administered on a regimen of 1 to 2 times per day.
Optimal dosages to be administered may be readily determined by those skilled in the art, and will vary with the particular compound used, the mode of administration, the strength of the preparation, the mode of administration, and the advancement of the disease condition. In addition, factors associated with the particular patient being treated, including patient age, weight, diet and time of administration, will result in the need to adjust dosages.
The compound of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles. Liposomes can be formed from a variety of lipids, including but not limited to amphipathic lipids such as phosphatidylcholines, sphingomyelins, phosphatidylethanolamines, phophatidylcholines, cardiolipins, phosphatidylserines, phosphatidylglycerols, phosphatidic acids, phosphatidylinositols, diacyl trimethylammonium propanes, diacyl dimethylammonium propanes, and stearylamine, neutral lipids such as triglycerides, and combinations thereof. They may either contain cholesterol or may be cholesterol-free.
From Formula I it is evident that some of the compounds of the invention may have one or more asymmetric carbon atoms in their structure. It is intended that the present invention includes within its scope the stereochemically pure isomeric forms of the compounds as well as their racemates . Stereochemically pure isomeric forms may be obtained by the application of art known principles. Diastereoisomers may be separated by physical separation methods such as fractional crystallization and chromatographic techniques, and enantiomers may be separated from each other by the selective crystallization of the diastereomeric salts with optically active acids or bases or by chiral chromatography. Pure stereoisomers may also be prepared synthetically from appropriate stereochemically pure starting materials, or by using stereoselective reactions.
Some of the compounds of the present invention may have trans and cis isomers. In addition, where the processes for the preparation of the compounds according to the invention give rise to mixture of stereoisomers, these isomers may be separated by conventional techniques such as preparative chromatography. The compounds may be prepared as a single stereoisomer or in racemic form as a mixture of some possible stereoisomers. The non-racemic forms may be obtained by either synthesis or resolution. The compounds may, for example, be resolved into their component enantiomers by standard techniques, such as the formation of diastereomeric pairs by salt formation. The compounds may also be resolved by covalent linkage to a chiral auxiliary, followed by chromatographic separation and/or crystallographic separation, and removal of the chiral auxiliary. Alternatively, the compounds may be resolved using chiral chromatography. The scope of the present invention is intended to cover all such isomers or stereoisomers per se, as well as mixtures of cis and trans isomers, mixtures of diastereomers and racemic mixtures of enantiomers (optical isomers) as well.
The chemistry of preparing compounds of Formula I is described in detail in U.S. Pat. Nos. 5,696,117 and 5,854,242, both to Frechette et al . , and WO 97/17333 (Frechette et al . ) , all of which are hereby incorporated by reference in their entirety.
This invention will be better understood by reference to the examples that follow, but those skilled in the art will readily appreciate that these are only illustrative of the invention as described more fully in the claims which follow thereafter.
The following examples are intended to illustrate the invention but not to limit it.
Example 1
6 8-Dimethyl-2- (2 -hydroxy ethyl) -4H-benzo [1, 4] oxazin-3 -one
A solution of 2-amino-4, 6-dimethylphenol (4.1 g, 30 mmol) in 40 mL of anhydrous DMF (N,N-dimethylformamide) , under N2, was cooled to 0 °C. Sodium hydride (75% dispersion in oil, 1.15 g, 36 mmol) was added in one portion, and the solution was stirred for 30 minutes at 0 °C. α-Bromo-γ-butyrolactone (3 mL, 36 mmol) was added dropwise via syringe, and the solution was heated to 70 °C for 18 h. The solution was cooled to room temperature, poured into 300 mL ice water, and stirred 30 minutes. The aqueous mixture was washed with 4 X 60 mL of 2:1 ethyl acetate/diethyl ether. The combined organic extracts were washed with 4 X 30 mL 1 N HC1, 4 X 30 mL water, and 30 mL brine. The organic phase was dried (Na2S04) , filtered, and solvent was removed in vacuo. Obtain 5.52 g (24.9 mmol).
Example 2
2- (2-tert-Butyldimethylsiloxyethyl) 6, 8-dimethyl-4ff- benzo [1,4] oxazin-3-one
A solution of 2- (2- tert-Butyldimethylsiloxyethyl) 6, 8- dimethyl-4H-benzo [1,4] oxazin-3-one (5.5 g, 24.8 mmol) in
30 mL of anhydrous DMF, under N2, was cooled to 0 °C. Imidazole (4.2 g, 62 mmol) was added in one portion, followed by addition of tert-butyldimethylsilyl chloride (5.6 g, 37.3 mmol) in one portion. The mixture was stirred 15 h as the ice bath thawed to room temperature. The reaction was poured into 300 mL water and washed with
4 X 50 mL of 7:3 diethyl ether/dichloromethane . The combined organics were washed with 4 X 30 mL water and 30 mL brine. The organics were dried (Na2S04) , filtered, and solvent was removed in vacuo. The product was isolated by silica gel chromatography with hexane/ethyl acetate. Obtain 7.0 g (20.9 mmol). Calcd for C18H29N03Si: C, 64.44; H, 8.71; N, 4.17. Found: C, 64.49; H, 8.61; N, 4.12. Exa ple 3
4- (4 -Chlorobenzyl) - 6 , 8 -dimethyl- 2 - (2 -hydroxy ethyl) -4Jϊ- benzo [l, 4] oxazin-3 -one
A solution of 2- (2- tert-Butyldimethylsiloxyethyl) 6, 8- dimethyl-4H-benzo [1,4] oxazin-3-one (1.0 g, 2.98 mmol) in 40 mL anhydrous DMF, under N2, was cooled to 0 °C. Sodium hydride (75% dispersion in oil, 0.115 g, 3.58 mmol) was added in one portion and the solution was stirred for 40 min at 0 °C. The ice bath was removed, 4-chlorobenzyl chloride (0.483 g, 3.0 mmol) was added and the solution was stirred at room temperature for 15 h. The mixture was poured into 200 mL ice water, salt was added, and stirring continued for 20 min. The aqueous mixture was washed with 4 X 50 mL diethyl ether. The combined organic were washed with 4 X 30 mL water and 30 mL brine. The organics were dried (Na2S04) , filtered, and solvent was removed in vacuo . The product was dissolved in 20 mL methanol and 0.5 mL water. Three drops of methanesulfonic acid were added and the mixture was stirred at room temperature for two hours. Solvent was removed in vacuo and the product was isolated by silica gel chromatography with hexane/ethyl acetate. Obtain 0.685 g (1.98 mmol). Calcd for C19H20ClNO3: C, 65.99; H, 5.83; N, 4.05. Found: C, 65.91; H, 5.87; N, 3.95.
Example 4 Methyl 2 - (2- (4- (4-chlorobenzyl) -6, 8 -dimethyl - 4ff- benzo [l, 4] oxazin-3-one-2-yl) ethoxy) phenylacetate
A solution of 4- (4-chlorobenzyl) -6, 8-dimethyl-2- (2- hydroxyethyl) -4H-benzo [1,4] oxazin-3-one (0.648 g, 1.87 mmol), (2-hydroxyphenyl) acetic acid (0.467 g, 2.81 mmol), and tributylphosphine (0.7 mL, 2.81 mmol) in 50 mL anhydrous benzene, under N2, was cooled to 10 °C. 1,1'- (Azodicarbonyl) dipiperidine (0.708 g, 2.81 mmol) was added in one portion, and the solution was stirred at 55 °C for 17 h. The solution was washed with 4 X 10 mL 1 N NaOH, 2 X 20 mL water, and 20 mL brine. The organics were dried (Na2S04) , filtered, and solvent was removed in vacuo. The product was purified by silica gel chromatography with hexane/ethyl acetate. Obtain 175 mg (0.35 mmol). Anal. Calcd for C28H28ClN05: C, 68.08; H, 5.71; N, 2.84. Found: C, 68.29; H, 5.69; N, 2.69.
Example 5
2- (2- (4- (4-Chlorobenzyl) -6, 8-dimethyl-4H-benzo [1,4] oxazin- 3-one-2-yl) ethoxy) henylacetic acid
To a solution of methyl 2- (2- (4- (4-chlorobenzyl) -6, 8- dimethyl-4ff-benzo [1,4] oxazin-3-one-2- yl) ethoxy) phenylacetate (0.165 g, 0.33 mmol) in 10 mL methanol was added 2 mL 2 N NaOH. The solution was stirred at 50 °C for three h open to air, the cooled to 0
°C. The solution was diluted with 10 L water, acidified with 0.5 mL cone. HCl (6 mmol), and extracted with 4 X 10 mL dichloromethane. The combined organics were washed with 15 mL water and 20 mL 1:1 water/brine, dried (Na2S04) , and filtered. Solvent was removed in vacuo to the title compound. Obtain 136 mg (0.28 mmol). Anal. Calcd. for C27H26C1N05: C, 67.57; H, 5.46; N, 2.92. Found: C, 67.26; H, 5.44; N, 2.72.
Example 6
2 - (2 -Hydroxyethyl) -7 -methoxy-4ff-benzo [1 , 4] oxazin-3 -orιe
A solution of 5-methoxy-2-nitrophenol (2.4 g, 13.2 mmol) in 50 mL anhydrous DMF, under N2, was cooled to 0 °C. Potassium carbonate (2.4 g, 17.2 mmol) was added, followed by dropwise addition of α-bromo-γ-butyrolactone (1.3 mL, 15.8 mmol) . The reaction was stirred at room temperature for 17 h. Acetic acid (1.5 mL) was added, the mixture was poured into 300 mL water, and the intermediate was obtained as a solid by filtration. The intermediate (3.37 g, 13.3 mmol) was suspended in 75 mL ethyl acetate and 50 mL ethanol, then shaken for six h with 10 % Pd/C and H2 (45 psi) atr room temperature. The solution was filtered through Celite and solvent was removed in vacuo. Obtain 2.97 g (13.3 mmol). Anal. Calcd. For C11H13N04: C, 59.19; H, 5.87; N, 6.27. Found: C, 59.07; H, 5.72; N, 6.27.
Example 7 2H- l, 4 -Benzoxazin-3 (4H) -one, 4-hexyl-2 - [2 - [2 - ( IH-tetrazol-
5-ylme hyl)phenoxy] ethyl] -, (212) -
As shown in the above scheme, to a solution of the nitrile (540 mg, 1.38 mmol) in toluene (3 mL) was added sodium azide (116 mg, 1.79 mmol) and triethylamine hydrochloride (246 mg, 1.79 mmol). The reaction was heated at 100 °C for 20 h. The, mixture was diluted with water and ethyl acetate (10 mL each) and acidified to pH=l with cone, hydrochloric acid. The organic layer was washed with brine, dried (Na2S04) and concentrated in vacuo to give 122 mg of the tetrazole as a white solid. MS: 458 (M+Na)
aP2 Assay for Antagonist
Twenty-four hours after the initial seeding of the 96-well plates by hand (around 20, 000/well) , the differentiation assay may be initiated. Medium may be removed and replaced with 150μl of differentiation medium containing vehicle (DMSO) or test compounds with a known aP2 activator or such aP2 activator alone. Cells may be returned to incubator for 24 hours culture. At the termination of the challenge, medium may be removed and 100 μl of lysis buffer may be added to initiate the bDNA aP2 mRNA assay. The branched DNA assay may be performed according to the manufacturer's protocol (Bayer Diagnostics; Emeryville, CA) . Result may be expressed as percent inhibition of aP2 mRNA production activated by the aP2 activator. IC50's may be determined by non-linear regression with a sigmoidal fit curve.
Following the challenge of the preadipocytes, cells may be lysed with lysis buffer (Bayer Diagnostics) containing the aP2 oligonucleotides. After a 15 minutes incubation at 53°C or 30 minutes at 37°C incubator, 70 μl of the lysis buffer from each well may be added to a corresponding capture well (preincubated with 70 μl of blocking buffer (Bayer Diagnostics) ) . The capture plate may be incubated overnight at 53°C in a plate incubator
(Bayer Diagnostics) . After this incubation, the bDNA and labeled probes may be annealed as directed by the manufacturer. Following a 30-minute incubation with the luminescent alkaline phosphatase substrate, dioxitane, the luminescence may be quantitated in a Dynex MLX microtiter plate luminometer. Oligonucleotide probes designed to anneal to the aP2 mRNA and function in the bDNA mRNA detection system are designed with ProbeDesigner software (Bayer Diagnostics) . This software package analyzes a target sequence of interest with a series of algorithms in order to determine which regions of the sequence can perform as locations for capture, label, or spacer probe annealing. The sequences of the oligonucleotides are as follows :
SEQ ID NO.l CATTTTGTGAGTTTTCTAGGATTATTCTTTTCTCTTGGAAAGAAAGT
SEQ ID NO.2 ATGTTAGGTTTGGCCATGCCTTTCTCTTGGAAAGAAAGT
SEQ ID NO.3 CCTCTCGTTTTCTCTTTATGGTTTTCTCTTGGAAAGAAAGT
SEQ ID NO. GCTTATGCTCTCTCATAAACTCTCGTGGTTTCTCTTGGAAAGAAAGT SEQ ID NO.5 CCAGGTACCTACAAAAGCATCACATTTAGGCATAGGACCCGTGTCT
SEQ ID NO.6 GCCCACTCCTACTTCTTTCATATAATCATTTAGGCATAGGACCCGTGTCT
SEQ ID NO.7 AGCCACTTTCCTGGTGGCAAATTTAGGCATAGGACCCGTGTCT
SEQ ID NO.8 CATCCCCATTCACACTGATGATCTTTAGGCATAGGACCCGTGTCT
SEQ ID NO.9 GTACCAGGACACCCCCATCTAAGGTTTTTAGGCATAGGACCCGTGTCT
SEQ ID NO.IOGGTTGATTTTCCATCCCATTTCTGCACATTTTAGGCATAGGACCCGTGTCT
SEQ ID NO.llGCATTCCACCACCAGTTTATCATTTTAGGCATAGGACCCGTGTCT
SEQ ID NO.12 GCGAACTTCAGTCCAGGTCAACGTCCCTTGTTTAGGCATAGGACCCGTGTCT
SEQ ID N0.13TCCCACAGAATGTTGTAGAGTTCAATTTTAGGCATAGGACCCGTGTCT
SEQ ID N0.14AAAACAACAATATCTTTTTGAACAATATATTTAGGCATAGGACCCGTGTCT
SEQ ID N0.15TCAAAGTTTTCACTGGAGACAAGTTT
SEQ ID N0.16AAAGGTACTTTCAGATTTAATGGTGATCA
SEQ ID N0.17CTGGCCCAGTATGAAGGAAATCTCAGTATTTTT
SEQ ID N0.18TCTGCAGTGACTTCGTCAAATTC
SEQ ID N0.19ATGGTGCTCTTGACTTTCCTGTCA
SEQ ID NO.20AAGTGACGCCTTTCATGAC
aP2 Assaγ for Agonist
The procedure is described in detail in Burris et al . , Molecular Endocrinology, 1999, 13:410, which is hereby incorporated by reference, and aP2 assay results of agonist intrinsic activity may be presented as fold increase over vehicle in induction of aP2 mRNA production. Tables 1-3 below set forth the mass spectra data and the agonist intrinsic activity of some compounds of the present invention.
Table 1
Compounds of this invention wherein Z1 and Z2 are both H
Table 2 Compounds of this invention where Z and Z2 are not both H
Keys:
Me=methyl; Et=ethyl; Pr=propyl ; Bu=butyl; Pent=pentyl; Hex=hexyl; Ac=acetyl; Bn=benzyl ,
Table 3
Reduced amines of this invention
While the foregoing specification teaches the principles of the present invention, with examples provided for the purpose of illustration, it will be understood that the practice of the invention encompasses all of the usual variations, adaptations and/or modifications as come within the scope of the following claims and their equivalents.
SEQUENCΞ LISTING
<110> Rybczynski, Philip et al.
<120> BIOLOGICALLY ACTIVE 4H-BENZ0 [1, 4] OXAZIN-3-ONES
<130> pm431, patin2.1 <140> <141>
<160> 15 <170> Patentln Ver. 2.1
<210> 1 <211> 47 <212> DNA <213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer <400> 1 cattttgtga gttttctagg attattcttt tctcttggaa agaaagt 47
<210> 2 <211> 39 <212> DNA <213> Artificial Sequence
<220> <223> Description of Artificial Sequence: primer
<400> 2 atgttaggtt tggccatgcc tttctcttgg aaagaaagt 39
<210> 3
<211> 41
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 3 cctctcgttt tctctttatg gttttctctt ggaaagaaag t 41
<210> 4 <211> 47 <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer <400> 4 gcttatgctc tctcataaac tctcgtggtt tctcttggaa agaaagt 47
<210> 5
<211> 46
<212> DNA
<213> Artificial Sequence
10 <220>
<223> Description of Artificial Sequence: primer
<400> 5 ccaggtacct acaaaagcat cacatttagg cataggaccc gtgtct 46
15
<210> 6 <211> 50 <212> DNA 20 <213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
25 <400> 6 gcccactcct acttctttca tataatcatt taggcatagg acccgtgtct 50
<210> 7 30 <211> 43 <212> DNA <213> Artificial Sequence
<220> 35 <223> Description of Artificial Sequence: primer
<400> 7 agccactttc ctggtggcaa atttaggcat aggacccgtg tct 43
40
<210> 8
<211> 45
<212> DNA
<213> Artificial Sequence
45
<220>
<223> Description of Artificial Sequence: primer
<400> 8 50 catccccatt cacactgatg atctttaggc ataggacccg tgtct 45
<210> 9 <211> 48 55 <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
60. <400> 9 gtaccaggac acccccatct aaggttttta ggcataggac ccgtgtct 48
<210> 10
<211> 51
<212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer
<400> 10 ggttgatttt ccatcccatt tctgcacatt ttaggcatag gacccgtgtc t 51
<210> 11 <211> 45 <212> DNA <213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer <400> 11 gcattccacc accagtttat cattttaggc ataggacccg tgtct 45
<210> 12 <211> 52 <212> DNA <213> Artificial Sequence
<220> <223> Description of Artificial Sequence: primer
<400> 12 gcgaacttca gtccaggtca acgtcccttg tttaggcata ggacccgtgt ct 52
<210> 13
<211> 48
<212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence: primer
<400> 13 tcccacagaa tgttgtagag ttcaatttta ggcataggac ccgtgtct 48
<210> 14 <211> 51 <212> DNA
<213> Artificial Sequence
<220>
<223> Description of Artificial Sequence : primer <400> 14 aaaacaacaa tatctttttg aacaatatat ttaggcatag gacccgtgtc t 51
<210> 15
<211> 26
<212> DNA
<213> Artificial Sequence <220>
<223> Description of Artificial Sequence: primer
<400> 15 tcaaagtttt cactggagac aagttt 26

Claims

WHAT IS CLAIMED IS:
1. A method of. treating a subject suffering from a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to said subject an effective amount of a compound of Formula (I) ,
or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein
Q is a fused phenyl or fused pyridyl moiety;
Z-L is hydrogen, halogen, COOR1# alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl ;
Z2 is hydrogen or a halogen;
X is hydrogen or oxygen;
A is CjL-Cg alkyl, C^Cg alkylaryl or C^Cg alkylheterocyclyl
wherein said aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with C^Cg alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo alkoxy, or methylsulfonylamino;
n is an integer from 0-3; and
Y is selected from
(a) HRiRj,, N+RXR2R3;
(b) NHC(NR4)NR5;
(c) C02H, CHO; (d) CH(R6)COOH, CH(R6)COOCH3, CH=CHR7, CH=C(COOH)2; (e) a moiety of the formula
(f) 5-tetrazolyl, wherein Rl t R2 and R3 are independently hydrogen, C^C- alkyl, or t-butoxycarbonyl; R4 and R5 are independently t-butoxycarbonyl or hydrogen, or R4 and R5 may be joined together to form an imidazoline, imidazolyl or pyrimidine ring; R6 is hydrogen, hydroxy, or halogen; and
R7 is C02H or C(0)NH(CH2)p0H wherein p is an integer from 1-4.
2. A method of Claim 1 wherein said condition is reduced insulin sensitivity.
3. A method of Claim 1 wherein said condition is selected from Non-Insulin Dependant Diabetes Mellitus, obesity, nephropathy, neuropathy, retinopathy, atherosclerosis polycystic ovary syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataract.
. A method of Claim 3 wherein said condition is Non- Insulin Dependant Diabetes Mellitus.
5. A method of Claim 1 wherein Y is selected from C02H,
CHO, CH(R6)COOH, CH (R6) COOCH3, CH=CHR7, CH=C(COOH)2, a moiety of the formula
5-tetrazolyl, wherein R6 and R7 are as claimed in Claim 1.
6. A method of Claim 1 wherein R6 is hydrogen or halogen when n is 1.
7. A method of Claim 6 wherein X is oxygen.
8. A method of Claim 6 wherein A is alkylheterocyclyl when X is hydrogen and Y is
9. A method of Claim 6 wherein Y is COOCH3 or COOH.
10. A method of Claim 9 wherein said condition is selected from Non-Insulin Dependant Diabetes Mellitus, obesity, nephropathy, neuropathy, retinopathy, atherosclerosis polycystic ovary syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataract .
11.A method of Claim 10 wherein said condition is Non- Insulin Dependant Diabetes Mellitus.
12.A method of Claim 10 wherein said condition is obesity.
13.A method of inhibiting in a subject the onset of a condition associated with Peroxisome Proliferator Activated Receptor gamma activity, which comprises administering to the subject a prophylactically effective dose of a compound of Formula (I) ,
or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein
Q is a fused phenyl or fused pyridyl moiety;
Z-L is hydrogen, halogen, alkyl, alkoxy, phenyl, hydroxy, amino, nitro, sulfonylamino or trifluoromethyl;
Z2 is hydrogen or a halogen;
X is hydrogen or oxygen;
A is Ci-Cg alkyl, alkylaryl or alkylheterocyclyl
wherein said aryl is biphenyl, naphthyl or phenyl; and said heterocyclyl is a 5- or 6-membered saturated or unsaturated heterocyclic group containing 1-4 nitrogen atoms, an oxygen or sulfur atom; wherein said aryl or heterocyclyl group is optionally substituted with C1-C6 alkyl, benzyl, oxybenzyl, phenoxy, hydroxy, alkoxy, halogen, dihalogen, nitro, amino, carboxyl, carbo (Cj-Cg) alkoxy, or methylsulfonylamino;
n is an integer from 0-3; and
Y is selected from
( a) NHRiRa , N+R1R2R3 ;
(b) NHC (NR4) NR5 ;
( c ) C02H , CHO ; (d) CH(R6)COOH, CH (R6) C00CH3, CH=CHR7, CH=C(C00H)2; (e) a moiety of the formula
(f) 5-tetrazolyl, wherein Rl t R2 and R3 are independently hydrogen, alkyl, or t-butoxycarbonyl; R4 and R5 are independently t-butoxycarbonyl or hydrogen, or R4 and R5 may be joined together to form an imidazoline, imidazolyl or pyrimidine ring; R6 is hydrogen, hydroxy, or halogen; and
R7 is C02H or C (O) NH (CH2) pOH wherein p is an integer from 1-4.
14. A method of Claim 13 wherein R6 is hydrogen or halogen when n is i.
15. A method of Claim 14 wherein X is oxygen.
16. A method of Claim 14 wherein A is C^Cg alkylheterocyclyl when X is hydrogen and Y is
17. method of Claim 16 wherein said condition is reduced insulin sensitivity.
18. A method of Claim 16 wherein said condition is selected from Non-Insulin Dependant Diabetes Mellitus, obesity, nephropathy, neuropathy, retinopathy, atherosclerosis polycystic ovary syndrome, hypertension, ischemia, stroke, heart disease, irritable bowel disorder, inflammation, and cataract.
19.A method of Claim 18 wherein said condition is Non- Insulin Dependant Diabetes Mellitus.
20.A method of Claim 18 wherein said condition is obesity.
21. A compound of Formula (la) :
la
or an optical isomer, enantiomer, diastereomer, racemate or racemic mixture thereof, ester, prodrug form, or a pharmaceutically acceptable salt thereof, wherein A, Q, X,
Y, R1# and n are as claimed in claim 1.
EP01935404A 2000-05-12 2001-05-11 Methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma modulators Withdrawn EP1280783A2 (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US20386100P 2000-05-12 2000-05-12
US203861P 2000-05-12
US85436801A 2001-05-11 2001-05-11
US854368 2001-05-11
PCT/US2001/015377 WO2001087861A2 (en) 2000-05-12 2001-05-11 Methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma modulators

Publications (1)

Publication Number Publication Date
EP1280783A2 true EP1280783A2 (en) 2003-02-05

Family

ID=26898968

Family Applications (1)

Application Number Title Priority Date Filing Date
EP01935404A Withdrawn EP1280783A2 (en) 2000-05-12 2001-05-11 Methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma modulators

Country Status (3)

Country Link
EP (1) EP1280783A2 (en)
AU (1) AU2001261503A1 (en)
WO (1) WO2001087861A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7041691B1 (en) 1999-06-30 2006-05-09 Amgen Inc. Compounds for the modulation of PPARγ activity
US6908908B2 (en) * 2000-05-12 2005-06-21 Ortho-Mcneil Pharmaceutical, Inc. Biologically active 4H-benzo [1,4] oxazin-3-ones
US20030171399A1 (en) 2000-06-28 2003-09-11 Tularik Inc. Quinolinyl and benzothiazolyl modulators
US7223761B2 (en) 2003-10-03 2007-05-29 Amgen Inc. Salts and polymorphs of a potent antidiabetic compound

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5089514A (en) * 1990-06-14 1992-02-18 Pfizer Inc. 3-coxazolyl [phenyl, chromanyl or benzofuranyl]-2-hydroxypropionic acid derivatives and analogs as hypoglycemic agents
WO1996004261A1 (en) * 1994-07-29 1996-02-15 Smithkline Beecham Plc Benzoxazoles and pryridine derivatives useful in the treatment of the type ii diabetes
US5696117A (en) * 1995-11-07 1997-12-09 Ortho Pharmaceutical Corporation Benzoxazine antimicrobial agents
US5707990A (en) * 1996-01-30 1998-01-13 Ortho Pharmaceutical Corporation 2-substituted amino and thio alkyl benzoxazine antimicrobial agents
JP2002507543A (en) * 1998-05-27 2002-03-12 ドクター・レディーズ・リサーチ・ファウンデーション Bicyclic compound, method for producing the same, and pharmaceutical composition containing them

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0187861A2 *

Also Published As

Publication number Publication date
AU2001261503A1 (en) 2001-11-26
WO2001087861A3 (en) 2002-03-28
WO2001087861A2 (en) 2001-11-22

Similar Documents

Publication Publication Date Title
US20070010670A1 (en) Nitrogen-containing fused ring compounds and use thereof
US20080305169A1 (en) Pharmaceutical Compositions Comprising Nitrogen-Containing Fused Ring Coumpounds
IL161351A (en) Activator for peroxisome proliferator-activated receptor delta and pharmaceutical compositions comprising the same
US4771050A (en) Thiolactam-n-acetic acid derivatives
KR100296191B1 (en) Benzoazine derivatives or salts thereof and pharmaceutical compositions containing the same
US5604225A (en) Substituted thiazoles and oxazoles and 2-hydroxy-morpholines
US6555536B2 (en) Biologically active 4H-benzo [1,4]oxazin-3-ones
JP4832897B2 (en) Ester derivatives and their pharmaceutical uses
US20070197512A1 (en) Carboxylic Acid Compounds and Use Thereof
US6599899B2 (en) Benzoxazinones as peroxisome proliferator activated receptor gamma modulators and method of treatment
NZ270565A (en) 5-(aminoalkyl and aminoalkoxy)-benzodioxane derivatives; pharmaceutical compositions
EP1280783A2 (en) Methods of treatment using benzoxazinones as peroxisome proliferator activated receptor gamma modulators
RU2695383C2 (en) Bendamustine derivatives, related compounds and their medical application for treating cancer
US6908908B2 (en) Biologically active 4H-benzo [1,4] oxazin-3-ones
JP2005519117A (en) Quinoline derivatives
JP3398391B2 (en) N&#39;-alkyl-spiro-isoquinoline-pyrrolidine tetraones and analogs useful as aldose reductase inhibitors
CA2595975A1 (en) Novel heterocyclic oxime derivatives, method for preparing same and use thereof as hypoglycaemic or hypolipidemic agents
US4886814A (en) Substituted thiazoles and oxazoles and 2-hydroxy-morpholines
JP3988832B2 (en) Nitrogen-containing fused ring compounds and uses thereof
US5219852A (en) Substituted thiazoles and oxazoles and pharmaceutical compositions and methods thereof
JP2007039466A (en) Nitrogen-containing condensed ring compound and application thereof
JP2001039957A (en) New benzoxazole derivative
JPH0479344B2 (en)

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20021113

AK Designated contracting states

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Extension state: AL LT LV MK RO SI

17Q First examination report despatched

Effective date: 20030624

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20040106