EP1276869A2 - Methods and compositions to modulate expression in plants - Google Patents
Methods and compositions to modulate expression in plantsInfo
- Publication number
- EP1276869A2 EP1276869A2 EP01942508A EP01942508A EP1276869A2 EP 1276869 A2 EP1276869 A2 EP 1276869A2 EP 01942508 A EP01942508 A EP 01942508A EP 01942508 A EP01942508 A EP 01942508A EP 1276869 A2 EP1276869 A2 EP 1276869A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- protein
- zinc finger
- target
- expression
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8287—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for fertility modification, e.g. apomixis
- C12N15/8289—Male sterility
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Definitions
- the invention relates to the field of plant and agricultural technology. More specifically, the invention relates to the use of zinc finger proteins and fusions of said proteins to regulate gene expression and metabolic pathways in plants.
- zinc finger domains which are responsible for specifically targeting a particular nucleotide sequence within a gene are generally coupled to additional amino acid sequences which serve to modulate expression either by activating (amplifying) or repressing it.
- typical transcription regulatory factors comprise both a zinc finger domain responsible for targeting the appropriate position of the genome and a functional portion which controls transcription of the gene once the fusion protein is bound.
- Synthetic zinc finger proteins have been synthesized and found to have binding affinity similar to those found in native transcription factors. Further, zinc finger proteins have been designed which are specific for TGA or for one of the triplets of the formula GNN. Thus, zinc finger proteins can be designed to target unique sequences of the formula (GNN) 6 or sequences containing 18 nucleotides wherein some of the GNN triplets have been substituted by TGA. As the design of zinc finger proteins progresses, appropriate zinc finger domains can be designed for any desired target sequence.
- a plant cell is considered different than a mammalian cell in numerous aspects even though they share most of the basic features of living organisms.
- plant cells have different subcellular biological structures, such as cell walls, which make the mechanism and procedure of transformation of foreign gene into plant cells significantly different from mammalian cells.
- the genetic recombination mechanism and frequency in plant cells differ from that in mammalian cells as well.
- the very critical step is integration into host genome, the mechanism of which differs between plant and mammalian cells.
- plant cells have much lower mtegration frequency.
- the present invention provides such means, and is exemplified by the control of expression of three genes in plants: (1) the reporter gene luciferase in tobacco and maize cells; (2) the APETALA3 (AP3) gene in Arabidopsis plant, and
- MIPS myo inositol 1 -phosphate synthase
- the invention relates to the field of plant and agricultural technology.
- the present invention is directed to a method to modulate the expression of a target gene in plant cells, which method comprises providing plant cells with a zinc finger protein, said zinc finger protein being capable of binding, and preferably, specifically binding, to a target nucleotide sequence, or a complementary strand thereof, within a target gene, and allowing said zinc finger protein binding to said target nucleotide sequence, whereby the expression of said target gene in said plant cells is modulated.
- the zinc finger protein can be provided to the plant cells via any suitable methods known in the art.
- the zinc finger protein can be exogenously added to the plant cells and the plant cells are maintained under conditions such that the zinc finger protein binds to the target nucleotide sequence and regulates the expression of the target gene in the plant cells.
- a nucleotide sequence e.g. , DNA or RNA, encoding the zinc finger protein can be expressed in the plant cells and the plant cells are maintained under conditions such that the expressed zinc finger protein binds to the target nucleotide sequence and regulates the expression of the target gene in the plant cells.
- a preferred method to modulate the expression of a target gene in plant cells comprises the following steps: a) providing plant cells with an expression system for a zinc finger protein, said zinc finger protein being capable of binding, and preferably specifically binding, to a target nucleotide sequence, or a complementary strand thereof, within a target gene; and b) culturing said plant cells under conditions wherein said zinc finger protein is produced and binds to said target nucleotide sequence, whereby expression of said target gene in said plant cells is modulated.
- any target nucleotide sequence can be modulated by the present method.
- the target nucleotide sequence can be endogenous or exogenous to the target gene.
- the target nucleotide sequence is endogenous to the plant but is in a non-naturally-occurring location.
- the target nucleotide sequence can be located in any suitable place in relation to the target gene.
- the target nucleotide sequence can be upstream or downstream of the coding region of the target gene.
- the target nucleotide sequence is within the coding region of the target gene.
- the target nucleotide sequence is a promoter of a regulatory protein.
- the target nucleotide sequence comprises 3, 6, 9, 12, 15 or 18 nucleotides. More preferably, the target nucleotide sequence comprises 18 nucleotides and wherem the zinc finger protein is a hexadactyl zinc finger protein. Further preferably, the targeted nucleotide sequence is of the formula (GNN) n , and wherein N is any one of the A, T, C or G and n is an integer from 1 to 6. More preferably, the targeted nucleotide sequence is of the formula (GNN) 6 , and wherein N is any one of the A, T, C or G.
- Plant cells containing any copy number of the target nucleotide sequence can be used in the present methods.
- the plant cells comprising at least two copies of the same or different target nucleotide sequence can be used.
- each target nucleotide sequence can be located within a different target gene so that more than one different target genes can be modulated.
- any target gene can be modulated by the present method.
- the target gene can encode a product that affects biosynthesis, modification, cellular trafficking, metabolism and degradation of a peptide, a protein, an oligonucleotide, a nucleic acid, a vitamin, an oligosaccharide, a carbohydrate, a lipid, or a small molecule.
- Exemplary proteins or peptides include enzymes, transport proteins such as ion channels and pumps, nutrient or storage proteins, contractile or motile proteins such as actins and myosins, structural proteins, defense proteins or regulatory proteins such as antibodies, hormones and growth factors.
- Exemplary nucleic acids mclude DNA, such as A-, B- or Z-form DNA, and RNA such as mRNA, tRNA and rRNA.
- the nucleic acids can be single-, double- and triple-stranded nucleic acids.
- Exemplary vitamins include water-soluble vitamins such as thiamine, riboflavin, nicotinic acid, pantothenic acid, pyridoxine, biotin, folate, vitamin B 12 and ascorbic acid, and fat-soluble vitamins such as vitamin A, vitamin D, vitamin E, and vitamin K.
- Exemplary lipids include triacylglycerols such as tristearin, tripalmitin and triolein, waxes, phosphoglycerides such as phosphatidylethanolamine, phosphatidylcholine, phosphatidylserine, phosphatidylinositol and cardiolipin, sphingolipids such as sphingomyelin, cerebrosides and gangliosides, sterols such as cholesterol and stigmasterol and sterol fatty acid esters.
- the fatty acids can be saturated fatty acids such as lauric acid, myristic acid, palmitic acid, stearic acid, arachidic acid and lignoceric acid, or can be unsaturated fatty acids such as palmitoleic acid, oleic acid, linoleic acid, linolenic acid and arachidonic acid.
- the target gene encodes a protein or an RNA.
- the target gene is a reporter gene, e.g., luciferase, the AP3 gene or the myo inositol 1 -phosphate synthase gene.
- the present method is used for treating a disorder in the plant cells, wherein the disorder is associated with abnormal expression of the target gene.
- the target gene encodes a target protein
- the present method can be used to modulate the expression of said encoded target protein.
- Expression of any target protein can be modulated by the present method in plant cells.
- the protein whose expression being modulated can be endogenous or exogenous to the plant cell.
- the modulation can be activation or inhibition.
- the protein whose expression being modulated is an antibody.
- the protein whose expression being modulated participates in a metabolic pathway or controls a metabolic pathway, e.g., an anabolic or a catabolic pathway.
- the present method can be used for modulating metabolic pathways of any desirable molecules such as vitamins, taste molecules, e.g., bad taste molecules, anti-oxidants, sugars and flavanoids.
- the metabolic pathway being modulated can be endogenous or exogenous to the plant cell.
- target gene encodes a structural protein, e.g., an enzyme or a co- factor in a metabolic pathway, or a regulatory protein.
- the metabolic pathway being modulated enhances an input or output trait in a plant or seed.
- the zinc finger protein is preferably fused to a protein which activates or represses gene expression, e.g., an activator domain of a regulatory protein or an active domain of a nucleic acid modifying protein.
- the zinc finger protein can bind to the target nucleotide sequence within the target gene.
- the zinc finger protein can bind to the complementary strand of the target nucleotide sequence.
- the zinc finger protein can specifically bind to an effector domain of the target sequence and whereby the expression of the target gene is modulated by competitive inhibition of said effector domain.
- the zinc finger protein preferably does not comprise an effector domain.
- the zinc finger protein used in the present methods can comprise a plurality of finger regions.
- the zinc finger protein can comprise linker regions among the plurality of finger regions.
- the zinc finger protein used in the present method can contain any number of the 3-finger region.
- the zinc finger protein can comprise at least two 3-fmger regions that are separated and linked together with a linker region.
- the linker region can be any suitable length, e.g., from about 2 to about 10 amino acid residues in length.
- the linker region between any said two 3-finger region is about 5 amino acid residues in length.
- the zinc finger protein can further comprise other desirable domains such as effector domains active in the host plant cells.
- Any types of zinc finger protein can be used in the present method. But preferably, the zinc finger protein comprising a framework from a plant zinc finger protein can be used. Alternatively, synthetic zinc finger proteins or non-naturally- occurring zinc finger proteins can be used.
- the zinc finger protein used in the present methods is ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPA ⁇ 3, alone or fused to an effector domain.
- the zinc finger protein used in the present methods is not any zinc finger protein that is disclosed in U.S. Patent No.
- 6,140,466 or WO 98/54311 e.g., a zinc fmger-nucleotide binding polypeptide variant comprising at least three zinc finger modules that bind to a target cellular nucleotide sequence and modulate the transcriptional function of the cellular nucleotide sequence, wherein the amino acid sequence of each zinc finger module that binds a target cellular nucleotide comprises two cysteines and two histidines whereby both cysteines are amino proximal to both histidines and wherein each of three modules of said variant has at least one amino acid sequence modification.
- the present methods can be used to modulate gene expression in any plant cells, e.g., monocot or dicot plant cells.
- the plant cells can be in any suitable forms.
- the plant cells can be included within an intact plant, and preferably the plant cells constitute all the cells of an intact plant.
- the plant cells can be contained in an in vitro culture, and preferably be cultured in planta.
- the plant cells can also be in the form of protoplasts or spheroplasts.
- the present method can be used to achieve any desirable degree of the modulation of a target gene expression.
- the modulation of the gene expression is at least two fold, e.g., at least five fold repression or at least two fold activation.
- the modulation changes the phenotype of the plant cells, the tissue(s) of the plant or the whole plant.
- any suitable promoters can be used in directing expression of the zinc finger protein.
- the expression system can comprise a constitutive promoter or an inducible promoter.
- the zinc finger protein can be expressed transiently or stably.
- the expression system can comprise a tissue-specific promoter.
- the expression of the zinc finger protein is controlled by a tissue-specific promoter and whereby tissue-specific modulation of the target gene expression is obtained.
- the zinc finger protein can be expressed in any desirable plant tissue, such as calli, meristem, leave, root or organ explant in tissue culture.
- the zinc finger protein can be expressed in a specific organelle, such as a mitochondria, a nucleus, a plastid or a vacuole.
- exemplary plastids include chloroplast, leucoplast, aravloplast and chromoplast.
- the nucleotide sequence encoding the zinc finger protein can be targeted to or stably integrated in a specific organelle. Such nucleotide sequence can be targeted to a specific organelle by any methods known in the art.
- the zinc finger protein can be targeted to plastid via a plastid transit peptide, to chloroplast via a chloroplast transit peptide, to mitochondrial via a mitochondrial target peptide or to nucleus via a nuclear targeting peptide.
- the nucleotide sequence encoding the zinc finger protein can comprise preferred codons of the host plant, e.g. , preferred translational start codon of the host plant.
- the present invention is directed to a method of modulating a level of a compound in a plant cell, which method comprises expressing in a plant cell a zinc finger protein that binds or specifically binds to a target nucleotide sequence within a target gene to modulate expression of said target gene which is involved in a compound's metabolism in said plant cell, whereby the level of said compound in said plant cell is modulated.
- the level of any compound, e.g., phytic acid, or target gene, e.g., AP3 can be modulated by the present method in plant cells.
- the zinc finger protein used in the present methods is not any zinc finger protein that is disclosed in U.S. Patent No.
- a zinc finger-nucleotide binding polypeptide variant comprising at least three zinc finger modules that bind to a target cellular nucleotide sequence and modulate the transcriptional function of the cellular nucleotide sequence, wherein the amino acid sequence of each zinc finger module that binds a target cellular nucleotide comprises two cysteines and two histidines whereby both cysteines are amino proximal to both histidines and wherein each of three modules of said variant has at least one amino acid sequence modification.
- the present invention is directed to an expression vector comprising a nucleotide sequence encoding a zinc finger protein, said zinc finger protein is capable of binding or specifically binding to a target nucleotide sequence, or a complementary strand thereof, within a target gene whose expression is to be modulated by said zinc finger protein.
- a plant that is regenerated from a plant transformed with the above expression vector is also provided.
- the zinc finger protein used in the present expression vectors is not any zinc finger protein that is disclosed in U.S. Patent No.
- a zinc finger- nucleotide binding polypeptide variant comprising at least three zinc finger modules that bind to a target cellular nucleotide sequence and modulate the transcriptional function of the cellular nucleotide sequence, wherein the amino acid sequence of each zinc finger module that binds a target cellular nucleotide comprises two cysteines and two histidines whereby both cysteines are amino proximal to both histidines and wherein each of three modules of said variant has at least one amino acid sequence modification.
- the present invention is directed to a genetically modified plant cell, which cell comprises an expression system for a zinc finger protein, said zinc finger protein is capable of binding, preferably specifically binding, to a target nucleotide sequence, or a complementary strand thereof, within a target gene whose expression is to be modulated by said zinc finger protein.
- the present invention is directed to a zinc finger protein that is ZFPml , ZFPm2, ZFPm3, ZFPm4, or ZFPA ⁇ 3, preferably in combination with positive and negative regulating domains, or a fusion protein comprises a zinc finger of 2C7 and an effector domain of SID (2C7-SID fusion protein).
- the present invention is directed to an isolated nucleic acid fragment comprising a sequence of nucleotides encoding ZFPml, ZFPm2, ZFPm3, ZFPm4, ZFPA ⁇ 3 or a 2C7-SID fusion protein. Plasmids and cells containing the nucleic acid fragments and methods for producing ZFPml, ZFPm2, ZFPm3, ZFPm4, ZFPAp3 proteins or 2C7-SLD fusion proteins using the plasmids and cells are also provided.
- the present invention is directed to an antibody that specifically binds to the above-described zinc finger protein.
- the present invention is directed to a zinc finger protein comprising a zinc finger nucleic acid binding domain and an effector domain, wherein said effector domain comprises an active domain of a restriction enzyme, an active domain of a nucleic acid modifying protein, e.g., a nucleic acid methylase, a label or a modification.
- a nucleic acid modifying protein e.g., a nucleic acid methylase, a label or a modification.
- the present invention is directed to an assay method for determining a suitable position in a gene for regulation of expression in plant cells, which method comprises: a) providing a target gene which contains a nucleotide sequence encoding a reporter protein within the coding region of said target gene and a target nucleotide sequence at a predetermined location within said target gene; b) contacting said target gene with a regulatory factor comprising a zinc finger protein specific for said target nucleotide sequence; and c) assessing the level of expression of said reporter gene in the presence and absence of said contacting; wherein a change in the level of expression of said reporter gene in the presence as opposed to the absence of said contacting identifies said position of said target nucleotide sequence as a position suitable for controlling expression of said target gene in plant cells.
- the zinc finger protein used in the present assay methods is not any zinc finger protein that is disclosed in U.S. Patent No. 6,140,466 or WO 98/54311, e.g., a zinc finger-nucleotide binding polypeptide variant comprising at least three zinc finger modules that bind to a target cellular nucleotide sequence and modulate the transcriptional function of the cellular nucleotide sequence, wherein the amino acid sequence of each zinc finger module that binds a target cellular nucleotide comprises two cysteines and two histidines whereby both cysteines are amino proximal to both histidines and wherein each of three modules of said variant has at least one amino acid sequence modification.
- Fig. 1 A Constructs for analyzing activation of reporter gene in maize HE89 (FI 9556) cells.
- Fig. 1 B Activation of reporter gene in maize HE89 (F19556) cells.
- Maize Ubiquitin promoter was used to drive the expression of 2C7-VP64 fusion protein (activator).
- Reporter I p5'C7F
- Reporter II activation is between 40 to 70 fold.
- Fig. 2 Reporter plasmids for evaluating different binding site positions.
- pAluc Full length CsVMV
- p5'C7A Full length CsVMV with 6x2c7 binding sites at the 5' end
- ⁇ 3'C7A Full length CsVMV with 6x2c7 binding sites at the 3' end of the 5'UTR
- pC7 ⁇ E CsVMV with 6x2c7 binding sites replacing -112 to -63
- p5'C7C CsVMV (-
- ⁇ 5'C7D CsVMV (-178 to +72) with 6x2c7 binding sites at the 5' end
- p5'C7F CsVMV (-112 to +72) with 6x2c7 binding sites at the 5' end
- pc7rbTATA Minimal promoter with a TATA box with 6x2c7 binding sites at the 5' end
- prbTATA Minimal promoter with a TATA box with no ZFP binding sites.
- Fig. 3 Zinc finger protem-effector fusion constructs for evaluation of the position effect of ZFP binding site in tobacco cells.
- 2C7-SID 6 finger ZFP fused to the Sin3 interaction domain (SID);
- 2C7-SKD 6 finger ZFP fused to the super krab domain (S D);
- 2C7-VP64 6 finger ZFP fused to 4 repeats of the minimal VP16 activation domain (VP64);
- C7-VP64 3 finger ZFP fused to 4 repeats of the minimal VP16 activation domain (VP64);
- C7-GFP 3 finger ZFP fused to the Green Fluorescent Protein (GFP);
- GFP Free GFP.
- Fig. 4 A Effects of zinc finger protein binding site on reporter gene expression levels and activation and activation of reporter gene with 3-( blue) or 6-zinc (cross hatch) finger proteins. A) Effects of different binding site positions on activation by a 3-finger effector
- Fig. 4 B Activation of a minimal TATA containing reporter.
- Fig. 5 Repression of reporters with 3- or 6-finger zinc finger fusion proteins.
- Fig. 6 DNA recognition helix sequences of ZFPml, ZFPm2, ZFPm3,
- Fig. 7 ELISA analysis of ZFPml DNA-binding specificity.
- Six-finger protein ZFPml was purified through affinity column from as MBP fusion protein from E. coli. Specificity of binding was analyzed by measuring the binding activity in total lysates to immobilized biotinylated hairpin oligonucleotides containing the indicated 18-bp targets. Assay were performed in duplicate. Binding site tested: A ⁇ 3, ml2, m34, 8 other non-target oligos (a-h) and no oligo control
- Fig. 8 ELISA analysis ofZFPm2 DNA-binding specificity.
- Six-finger protein ZFPm2 was purified through affinity column from as MBP fusion protein from E. coli. Specificity of binding was analyzed by measuring the binding activity in total lysates to immobilized biotinylated hairpin oligonucleotides containing the indicated 18-bp targets. Assay were performed in duplicate. Binding site tested: Ap3, ml2, m34, 8 other non-target oligos (a-h) and no oligo control
- Fig. 9 ELISA analysis of ZFPm3 DNA-binding specificity.
- Six-finger protein ZFPm3 was purified through affinity column from as MBP fusion protein from E. coli. Specificity of binding was analyzed by measuring the binding activity in total lysates to immobilized biotinylated hairpin oligonucleotides containing the indicated 18-bp targets. Assay were performed in duplicate. Binding site tested: Ap3, ml2, m34, 8 other non-target oligos (a-h) and no oligo control
- FIG. 10 ELISA analysis of ZFPm4 DNA-binding specificity.
- Six-finger protein ZFPm4 was purified through affinity column from as MBP fusion protein from E. coli. Specificity of binding was analyzed by measuring the binding activity in total lysates to immobilized biotinylated hairpin oligonucleotides containing the indicated 18-bp targets. Assay were performed in duplicate. Binding site tested: Ap3, ml2, m34, 8 other non-target oligos (a-h) and no oligo control
- Fig. 11 ELISA analysis of ZFPmAp3 DNA-binding specificity.
- Six-finger protein ZFPAp3 was purified through affinity column from as MBP fusion protein from E. coli. Specificity of binding was analyzed by measuring the binding activity in total lysates to immobilized biotinylated hairpin oligonucleotides containing the indicated 18-bp targets. Assay were performed in duplicate. Binding site tested:
- Fig. 12 Gel Shift analysis of ZFPml DNA-binding affinity.
- Six-finger protein ZFPml was purified through affinity column from as MBP fusion protein from E. coli.
- Affinity of binding was determined from a gel shift analysis of the binding of labeled ml 2 oligo to decreasing concentrations of the purified ZFPml protein.
- B. The affinity of ZFPml was calculated to be approximately 2nM from the concentration where one half of the labeled oligo is bound to the ZFPml protein.
- Fig. 13 Gel Shift analysis of ZFPm2 DNA-binding affinity.
- Six-finger protein ZFPm2 was purified through affinity column from as MBP fusion protein from E. coli.
- Affinity of binding was determined from a gel shift analysis of the binding of labeled ml 2 oligo- to decreasing concentrations of the purified ZFPm2 protein.
- the affinity of ZFPm2 was calculated to be approximately 7.5nM from the concentration where one half of the labeled oligo is bound to the ZFPm2 protein.
- Fig. 14 Gel Shift analysis of ZFPm3 DNA-binding affinity.
- Six-finger protein ZFPm3 was purified through affinity column from as MBP fusion protein from E. coli. Affinity of binding was determined from a gel shift analysis of the binding of labeled m34 oligo to decreasing concentrations of the purified ZFPm3 protein. The affinity of ZFPm3 was calculated to be approximately 0.18nM from the concentration where one half of the labeled oligo is bound to the ZFPm3 protein.
- Fig. 15 Gel Shift analysis of ZFPm4 DNA-binding affinity. Six-finger protein ZFPm4 was purified through affinity column from as MBP fusion protein from E. coli.
- Affinity of binding was determined from a gel shift analysis of the binding of labeled m34 oligo to decreasing concentrations of the purified ZFPm4 protein.
- the affinity of ZFPm4 was calculated to be approximately 0.25nM from the concentration where one half of the labeled oligo is bound to the
- ZFPm4 protein ZFPm4 protein.
- Fig. 16 Gel Shift analysis of ZFPAp3 DNA-binding affinity.
- Six-finger protein ZFPAp3 was purified through affinity column from as MBP fusion protein from E. coli. Affinity of binding was determined from a gel shift analysis of the binding of labeled Ap3 oligo to decreasing concentrations of the purified ZFPAp3 protein. The affinity of ZFPAp3 was calculated to be approximately 2.3nM from the concentration where one half of the labeled oligo is bound to the ZFPA ⁇ 3 protein.
- Fig. 17 In vivo characterization of newly synthesized zinc finger protein
- ZFPml , ZFPm2, ZFPm3, and ZFPm4 in plant reporter system.
- the four activation fusion constructs are: ZmUbi::ZFPml-VP64//nos, ZmUbi::ZFPm2-VP64//nos, ZmUbi::ZFPm3-VP64//nos, and ZmUbi::ZFPm4-VP64//nos.
- the reporter constructs are similar to reporter I in Fig. 1 except the 2C7 binding site was replaced by MIPS gene specific ZFP binding site ml2 for ZFPml and ZFPm2 and by the second MIPS gene specific ZFP binding site m34 for ZFPm3 and ZFPm4.
- Fig. 18 ZFP-Effector fusion constructs for Arabidopsis transformation.
- ZFP-Effector constructs for Arabidopsis transformation A. Transient transformation vectors: pND3011 and pND3012 are transcriptional repressors. pND3014 andpND3013 are transcriptional activators. pNDOOOl is control vector. B. Stable transformation vectors for Agrobacteria mediated plant transformation method. Fig. 19 Transient activation of endogenous AP3 gene in Arabidopsis leaf cells. RT-PCR was used to detect AP3 expression in Arabidopsis leaf protoplasts transformed with a GFP (pNDOOOl, control), m4- VP64 (pND3013, non-specific activation control), and Ap3-VP64
- Fig. 20 Endogenous gene AP3 specifically repressed by the expression of ZFPAp3-repressor fusion protein in transgenic plant ND0052-2e.
- A PCR identification of transgene ZFPAp3 in transgenic event ND0052-2e and wt plant.
- B RT-PCR evaluation of endogenous gene AP3 expression level in transgenic event ND0052-2e and wild- type (wt) plant.
- the expression of AP3 gene is significantly repressed by the expression of ZFP Ap3 -repressor (ZFPAp3-SLD) fusion protein (Quantitative PCR shows a 46 fold of repression).
- ZFPAp3-SLD ZFP Ap3 -repressor
- Fig. 21 Quantitative analysis of endogenous gene AP3 gene expression level in transgenic ZFPAp3 plants. The expression level of AP3 gene in transgenic plant is normalized to the wild type plant
- Repression event ND0052-2e shows a 46- fold of activation and ND0052-257 shows a 5-fold of repression.
- Activation event ND0052-1 a shows a 2-fold of activation.
- Each sample was performed on triplicate assays.
- Fig. 22 ZFP-Effector fusion constructs for maize transformation.
- Fig. 23 Transient activation of endogenous MIPS gene in maize cells.
- Quantitative PCR was used to detect ML? S expression in maize cells transformed with a GFP (control), ml-VP64 (pND3015), m2-VP64
- Fig. 24 Nucleotide sequences of various nucleic acids and oligonucleotides disclosed in the present application.
- a or “an” means “at least one” or “one or more.”
- ZFP zinc finger protein, (zinc finger polypeptide, or ZFP)” refers to a polypeptide having nucleic acid, e.g., DNA, binding domains that are stabilized by zinc.
- the individual DNA binding domains are typically referred to as “fingers,” such that a zinc finger protein or polypeptide has at least one finger, more typically two fingers, more preferably three fingers, or even more preferably four or five fingers, to at least six or more fingers.
- Each finger binds from two to four base pairs of DNA, typically three or four base pairs of DNA.
- a ZFP binds to a nucleic acid sequence called a target nucleic acid sequence.
- Each finger usually comprises an approximately 30 amino acids, zinc-chelating, DNA-binding subdomain.
- An exemplary motif of one class, the Cys2-His2 class (C2H2 motif) is -CYS-(X)2-4-
- a zinc finger protein can have at least two DNA-binding domains, one of which is a zinc finger polypeptide, linked to the other domain via a flexible linker.
- the two domains can be identical or different. Both domains can be zinc finger proteins, either identical or different zinc finger proteins.
- one domain can be a non-zinc finger DNA-binding protein, such as one from a transcription factor.
- frame (or backbone) derived from a naturally occurring zinc finger protein means that the protein or peptide sequence within the naturally occurring zinc fmger protein that is involved in non-sequence specific binding with a target nucleotide sequence is not substantially changed from its natural sequence.
- framework (or backbone) derived from the naturally occurring zinc fmger protein maintains at least 50%, and preferably, 60%, 70%, 80%, 90%, 95%,
- the nucleic acid encoding such framework (or backbone) derived from the naturally occurring zinc finger protein can be hybridizable with the nucleic acid encoding the naturally occurring zinc finger protein, either entirely or within the non-sequence specific binding region, under low, medium or high stringency condition.
- the nucleic acid encoding such framework (or backbone) derived from the naturally occurring zinc finger protein is hybridizable with the nucleic acid encoding the naturally occurring zinc finger protein, either entirely or within the non-sequence specific binding region, under high stringency condition.
- gene refers to a nucleic acid molecule or portion thereof which comprises a coding sequence, optionally containing introns, and control regions which regulate the expression of the coding sequence and the transcription of untranslated portions of the transcript.
- the term “gene” includes, besides coding sequence, regulatory sequence such as the promoter, enhancer, 5' untranslated regions, 3' untranslated region, termination signals, poly adenylation region and the like. Regulatory sequence of a gene may be located proximal to, within, or distal to the coding region.
- target gene refers to a gene whose expression is to be modulated by a zinc finger protein in plant cells.
- plant refers to any of various photosynthetic, eucaryotic multi-cellular organisms of the kingdom Plantae, characteristically producing embryos, containing chloroplasts, having cellulose cell walls and lacking locomotion.
- plant includes any plant or part of a plant at any stage of development, including seeds, suspension cultures, embryos, meristematic regions, callus tissue, leaves, roots, shoots, gametophytes, sporophytes, pollen, microspores, and progeny thereof. Also included are cuttings, and cell or tissue cultures.
- plant tissue includes, but is not limited to, whole plants, plant cells, plant organs, e.g., leafs, stems, roots, meristems, plant seeds, protoplasts, callus, cell cultures, and any groups of plant cells organized into structural and/or functional units.
- modulate the expression of a target gene in plant cells refers to increasing (activation) or decreasing (repression) the expression of the target gene in plant cells with a zinc finger protein, alone or in combination with other transcription and/or translational regulatory factors, or nucleic acids encoding such zinc finger protein, in plant cells.
- providing plant cells with a zinc fmger protein refers to the provisional to the plant cells, whether in culture or in whole plant, functional zinc finger protein that is capable of modulating a target gene in the plant cells.
- the functional zinc finger protein can be provided, i.e., delivered, to the plant cells by any means.
- the zinc finger protein can be delivered directly into the plant cells.
- nucleic acids, e.g., DNA or mRNA, encoding such zinc finger protein can be delivered into the plant cells and the plant cells are maintained under the conditions that functional zinc finger protein can be produeed within the plant cells.
- a "target nucleotide sequence” refers to a portion of double- stranded polynucleotide acid, e.g., RNA, DNA, PNA (peptide nucleic acid) or combinations thereof, to which it is advantageous to bind a protein.
- a "target nucleotide sequence” is all or part of a transcriptional control element for a gene for which a desired phenotypic result can be attained by altering the degree of its expression.
- a transcriptional control element includes positive and negative control elements such as a promoter, an enhancer, other response elements, e.g., steroid response element, heat shock response element, metal response element, a repressor binding site, operator, and or a silencer.
- the transcriptional control element can be viral, eukaryotic, or prokaryotic.
- a "target nucleotide sequence" also includes a downstream or an upstream sequence which can bind a protein and thereby modulate, typically prevent transcription.
- binding affinity of a zinc finger protein to a specified target nucleic acid sequence is statistically higher than the binding affinity of the same zinc fmger protein to a generally comparable, but non-target nucleic acid sequence, e.g., a GNN sequence without matching code sequence for the particular zinc finger protein.
- the binding affinity of a zinc finger protein to a specified target nucleic acid sequence is at least 1.5 fold, and preferably 2 fold or 5 fold, of the binding affinity of the same zinc finger protein to a non-target nucleic acid sequence.
- It also refers to binding of a zinc-finger-protein-nucleic-acid-binding domain to a specified nucleic acid target sequence to a detectably greater degree, e.g. , at least 1.5-fold over background, than its binding to non-target nucleic acid sequences and to the substantial exclusion of non-target nucleic acids.
- the zinc finger protein's Kd to each nucleotide sequence can be compared to assess the binding specificity of the zinc finger protein to a particular target nucleotide sequence.
- a "target nucleotide sequence within a target gene” refers to a functional relationship between the target nucleotide sequence and the target gene in that binding of a zinc-finger-protein to the target nucleotide sequence will modulate the expression of the target gene.
- the target nucleotide sequence can be physically located anywhere inside the boundaries of the target gene, e.g., 5' ends, coding region, 3' ends, upstream and downstream regions outside of cDNA encoded region, or inside enhancer or other regulatory region, and can be proximal or distal to the target gene.
- culturing plant cells refers to the cultivation or growth of the plant cells. Such cultivation or growth can be in vitro, e.g. , in culture medium, or in vivo, e.g. , in planta.
- endogenous refers to nucleic acid or protein sequence naturally associated with a target gene or a host cell into which it is introduced.
- exogenous refers to nucleic acid or protein sequence not naturally associated with a target gene or a host cell into which it is introduced, including non-naturally occurring multiple copies of a naturally occurring nucleic acid, e.g., DNA sequence, or naturally occurring nucleic acid sequence located in a non-naturally occurring genome location.
- effector refers to constructs or their encoded products which are able to regulate gene expression either by activation or repression or which exert other effects on a target nucleic acid.
- the effector protein may include a zinc finger binding region only, but more commonly also includes a “functional domain” such as a "regulatory domain.”
- regulatory domain refers to the portion of the effector protein or effector which enhances or represses gene expression.
- compound refers to any substance that is metabolized in plant cells and its metabolism can be modulated by a zinc-finger-protein in plant cells.
- transgenic plant refers to a plant which comprises within its genome an exogenous polynucleotide.
- the exogenous polynucleotide is stably integrated within the genome such that the polynucleotide is passed on to successive generations.
- the exogenous polynucleotide may be integrated into the genome alone or as part of a recombinant expression cassette.
- Transgenic is used herein to include any cell, cell line, callus, tissue, plant part or plant, the genotype of which has been altered by the presence of exogenous nucleic acid including those transgenics initially so altered as well as those created by sexual crosses or asexual propagation from the initial transgenic.
- transgenic does not encompass the alteration of the genome (chromosomal or extra-chromosomal) by conventional plant breeding methods or by naturally occurring events such as random cross-fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.
- essential gene refers to a gene encoding a protein that is essential to the growth or survival of the plant, e.g., a biosynthetic enzyme, receptor, signal transduction protein, structural gene product, or transport protein.
- expression cassette refers to a DNA sequence capable of directing expression of a particular nucleotide sequence in an appropriate host cell, comprising a promoter operably linked to the nucleotide sequence of interest which is operably linked to termination signals. It also typically comprises sequences required for proper translation of the nucleotide sequence.
- the coding region usually codes for a protein of interest but may also code for a functional RNA of interest, for example antisense RNA or a nontranslated RNA, in the sense or antisense direction.
- the expression cassette comprising the nucleotide sequence of interest maybe chimeric, meaning that at least one of its components is heterologous with respect to at least one of its other components.
- the zinc finger-effector fusions of the present invention are chimeric.
- the expression cassette may also be one which is naturally occurring but has been obtained in a recombinant form useful for heterologous expression. Typically, however, the expression cassette is heterologous with respect to the host, i.e., the particular DNA sequence of the expression cassette does not occur naturally in the host cell and must have been introduced into the host cell or an ancestor of the host cell by a transformation event.
- the expression of the nucleotide sequence in the expression cassette may be under the control of a constitutive promoter or of an inducible promoter which initiates transcription only when the host cell is exposed to some particular external stimulus.
- the promoter can also be specific to a particular tissue or organ or stage of development.
- additional elements i.e., ribosome binding sites, may be required.
- minimal promoter refers to a promoter element, particularly a TATA element, that is inactive or that has greatly reduced promoter activity in the absence of upstream activation. In the presence of a suitable transcription factor, the minimal promoter functions to permit transcription.
- significant increase refer to an increase in gene expression, enzymatic or other biological activity, specificity or affinity, or effector or phenotypic activity, that is larger than the margin of error inherent in the measurement technique, preferably an increase by about 2-fold or greater of the activity without the ZFP or ligand inducer, more preferably an increase by about 5-fold or greater, and most preferably an increase by about 10-fold or greater.
- repressor protein refer to a protein that binds to operator of
- repression refers to inhibition of transcription or translation by binding of repressor protein to specific site on DNA or mRNA.
- repression includes a significant change in transcription or translation level of at least 1.5 fold, more preferably at least two fold, and even more preferably at least five fold.
- activator protein refers to a protein that binds to operator of DNA or to RNA to enhance transcription or translation, respectively.
- activation refers to enhancement of transcription or translation by binding of activator protein to specific site on DNA or mRNA.
- activation includes a significant change in transcription or translation level of at least 1.5 fold, more preferably at least two fold, and even more preferably at least five fold.
- conservatively modified variant refer to amino acid and nucleic acid sequences containing individual substitutions, deletions or additions that alter, add or delete a single amino acid or nucleotide or a small percentage of amino acids or nucleotides in the sequence, where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants and alleles of the invention.
- the following groups each contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Serine (S), Threonine (T); 3) Aspartic acid (D), Glutamic acid (E); 4) Asparagine (N), Gmtamine (Q); 5) Cysteine (C), Methionine (M); 6) Arginine (R), Lysine (K), Histidine (H); 7) Isoleucine (1), Leucine (L), Valine (V); and 8) Phenylalanine (F), Tyrosine (Y), Tryptophan (W). (see, e.g., Creighton, Proteins (1984) for a discussion of amino acid properties).
- a combination refers to any association between two or among more items.
- a composition refers to any mixture. It may be a solution, a suspension, liquid, powder, paste, aqueous, non-aqueous or any combination thereof.
- derivative or analog of a molecule refers to a portion derived from or a modified version of the molecule.
- operably linked, operatively linked or operationally associated refers to the functional relationship of DNA with regulatory and effector sequences of nucleotides, such as promoters, enhancers, transcriptional and translational stop sites, and other signal sequences.
- operative linkage of DNA to a promoter refers to the physical and functional relationship between the DNA and the promoter such that the transcription of such DNA is initiated from the promoter by an RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
- RNA polymerase that specifically recognizes, binds to and transcribes the DNA.
- a promoter region or promoter element refers to a segment of
- the promoter region includes specific sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. This portion of the promoter region is referred to as the promoter.
- the promoter region includes sequences that modulate this recognition, binding and transcription initiation activity of RNA polymerase. These sequences may be cis acting or may be responsive to trans acting factors. Promoters, depending upon the nature of the regulation, may be constitutive or regulated.
- stringency of hybridization in determining percentage mismatch is as follows: (1) high stringency: 0.1 x SSPE, 0.1% SDS, 65°C; (2) medium stringency: 0.2 x SSPE, 0.1% SDS, 50°C; and (3) low stringency: 1.0 x SSPE, 0.1% SDS, 50°C.
- Equivalent stringencies maybe achieved using alternative buffers, salts and temperatures.
- substantially identical or homologous or similar varies with the context as understood by those skilled in the relevant art and generally means at least 70%, preferably means at least 80%, more preferably at least 90%, and most preferably at least 95% identity.
- substantially identical to a product means sufficiently similar so that the property of interest is sufficiently unchanged so that the substantially identical product can be used in place of the product.
- substantially pure means sufficiently homogeneous to appear free of readily detectable impurities as determined by standard methods of analysis, such as thin layer chromatography (TLC), gel electrophoresis and high performance liquid chromatography (HPLC), used by those of skill in the art to assess such purity, or sufficiently pure such that further purification would not detectably alter the physical and chemical properties, such as enzymatic and biological activities, of the substance.
- TLC thin layer chromatography
- HPLC high performance liquid chromatography
- vector or plasmid refers to discrete elements that are used to introduce heterologous DNA into cells for either expression or replication thereof. Selection and use of such vehicles are well known within the skill of the artisan.
- An expression vector includes vectors capable of expressing DNAs that are operatively linked with regulatory sequences, such as promoter regions, that are capable of effecting expression of such DNA fragments.
- an expression vector refers to a recombinant DNA or RNA construct, such as a plasmid, a phage, recombinant virus or other vector that, upon introduction into an appropriate host cell, results in expression of the cloned DNA.
- macromolecule refers to a molecule that, without attaching to another molecule, is capable of generating an antibody that specifically binds to the macromolecule.
- small molecule refers to a molecule that, without forming homo-aggregates or without attaching to a macromolecule or adjuvant, is incapable of generating an antibody that specifically binds to the small molecule.
- the small molecule has a molecular weight that is about or less than 10,000 daltons. More preferably, the small molecule has a molecular weight that is about or less than 5,000 dalton.
- vitamin refers to a trace organic substance required in certain biological species. Most vitamins function as components of certain coenzymes.
- lipid refers to water-insoluble, oily or greasy organic substances that are extractable from cells and tissues by nonpolar solvents, such as chloroform or ether.
- a "receptor” refers to a molecule that has an affinity for a given ligand. Receptors may be naturally-occurring or synthetic molecules. Receptors may also be referred to in the art as anti-ligands. As used herein, the receptor and anti-ligand are interchangeable. Receptors can be used in their unaltered state or as aggregates with other species. Receptors may be attached, covalently or noncovalently, or in physical contact with, to a binding member, either directly or indirectly via a specific binding substance or linker.
- receptors include, but are not limited to: antibodies, cell membrane receptors surface receptors and internalizing receptors, monoclonal antibodies and antisera reactive with specific antigenic determinants such as on viruses, cells, or other materials, drugs, polynucleotides, nucleic acids, peptides, cofactors, lectins, sugars, polysaccharides, cells, cellular membranes, and organelles.
- nutrient or storage protein refers to a protein that is used by the cell as the nutrient source or storage form for such nutrient.
- Non-limiting examples of nutrient or storage proteins include gliadin, ovalbumin, casein, and ferritin.
- contractile or motile protein refers to a protein that endows cells and organisms with the ability to contract, to change shape, or to move about.
- contractile or motile proteins include actin, myosin, tubulin and dynein.
- structural protein refers to a protein that serves as supporting filaments, cables, or sheets to give biological structures strength or protection.
- structural proteins include keratin, fibroin, collagen, elastin and proteoglycans.
- defense protein refers to a protein that defends organisms against invasion by other species or protect them from injury.
- Non-limiting examples of defense proteins include antibodies, fibrinogen, thrombin, botulinus toxin, diphtheria toxin, snake venoms and ricin.
- regulatory protein refers to a protein that helps regulate cellular or physiological activity.
- Non-limiting examples of regulatory proteins include insulin, growth hormones, corticotropin and repressors.
- the present invention is directed to a method to modulate the expression of a target gene in plant cells, which method comprises providing plant cells with a zinc finger protein, said zinc finger protein being capable of binding or specifically binding to a target nucleotide sequence, or a complementary strand thereof, within a target gene, and allowing said zinc finger protein binding to said target nucleotide sequence, whereby the expression of said target gene in said plant cells is modulated.
- the present invention can be used over a broad range of plant types, preferably the class of higher plants amenable to transformation techniques, particularly monocots and dicots. Particularly preferred are monocots such as the species of the Family Gramineae including Sorghum bicolor and Zea mays.
- the present method can also be used in species from the following genera: Cucurbita, Rosa, Vitis, Juglans, Fragaria, Lotus, Medicago, Onobrychis, Trifolium, Trigonella, Vigna, Citrus, Linum, Geranium, Manihot, Daucus, Arabidopsis, Brassica, Raphanus, Sinapis, Atropa, Capsicum, Datura, Hyoscyamus, Lycopersicon, Nicotiana, Solanum, Petunia, Digitalis, Majorana, Ciahorium, Helianthus, Lactuca, Bromus, Asparagus, Antirrhinum, Heterocalhs, Nemesis, Pelargonium, Panieum, Pennisetum, Ranunculus, Senecio, Salpiglossis, Cucumis, Browaalia, Glycine, Pisum, Phaseolus, Lolium, Oryza, Avena, Hordeum, Secale, and Tritic
- Preferred plant cells include those from corn (Zea mays), canola (Brassica napus, Brassica rapa ssp.), particularly those Brassica species useful as sources of seed oil, alfalfa (Medicago sativa), rice (Oryza sativa), rye (Secale cereale), sorghum (Sorghum bicolor, Sorghum vulgare), millet (e.g., pearl millet (Pennisetum glaucum), proso millet (Panieum miliaceum), foxtail millet (Setaria italic ⁇ ), finger millet (Eleusine coracana), sunflower (Helianthus annuus), safflower (Carthamus tinctorius), wheat (Triticum aestivum), duckweed (Lemna) soybean (Glycine max), tobacco (Nicotiana tabacum), potato (Solanum tuberosum), peanut (Arachis hypogaea), cotton (Goss
- Preferred vegetables include tomatoes (Lycopersicon esculentum), lettuce (e.g., Lactuca sativa), green beans (Phaseolus vulgaris), lima beans (Phaseolus limensis), peas (Lathyrus spp.), and members of the genus Cucumis such as cucumber (C. sativus), cantaloupe (C cantalupensis), and musk melon (C. melo).
- Preferred ornamentals include azalea (Rhododendron spp.), hydrangea
- Conifers that may be employed in practicing the present method include, for example, pines such as loblolly pine (Pinus taeda), slash pine (Pinus elliotii), ponderosapine (Pinus ponderosa), lodgepole pine (Pinus contorta), and Monterey pine (Pinus radiata); Douglas-fir (Pseudotsuga menziesii); Western hemlock (Isuga canadensis); Sitka spruce (Picea glauca); redwood (Sequoia sempervirens); true firs such as silver fir (Abies amabilis) and balsam fir (Abies balsamea); and cedars such as Western red cedar (Thuja plicata) and Alaska yellow-cedar (Chamaecyparis nootkatensis).
- pines such as loblolly pine (Pinus taeda), slash pine (
- Leguminous plants include beans and peas.
- Beans include guar, locust bean, fenugreek, soybean, garden bean, cowpea, mungbean, lima bean, fava bean, lentils, chickpea, etc.
- Legumes include, but are not limited to, Arachis, e.g., peanuts, Vicia, e.g., crown vetch, hairy vetch, adzuki bean, mung bean, and chickpea, Lupinus, e.g., lupine, trifolium, Phaseolus, e.g., common bean and lima bean, Pisum, e.g., field bean, Melilotus, e.g., clover, Medicago, e.g., alfalfa, Lotus, e.g., trefoil, lens, e.g., lentil, and false indigo.
- Preferred forage and turf grass for use in the methods of the invention include alfalfa, orchard grass, tall fescue, perennial ryegrass, creeping bent grass, and redtop.
- plants that can be modulated by the present method are crop plants and model plant, e.g., corn, rice, alfalfa, sunflower, canola, soybean, cotton, peanut, sorghum, wheat, tobacco, lemna, etc. Most preferably, gene expression in corn, rice, lemna, and soybean plants are modulated by the present method.
- Zinc fmger proteins used in the present method Zinc fmger proteins used in the present method
- any zinc finger proteins can be used in the present method.
- zinc finger proteins disclosed or designed and predicted according to the procedures in WO 98/54311 can be used.
- WO 98/54311 discloses technology which allows the design of zinc fmger protein domains which bind specific nucleotide sequences which are unique to a target gene. It has been calculated that a sequence comprising 18 nucleotides is sufficient to specify an unique location in the genome of higher organisms. Typically, therefore, the zinc fmger protein domains are hexadactyl, i.e., contain 6 zinc fingers, each with its specifically designed alpha helix for interaction with a particular triplet. However, in some instances, a shorter or longer nucleotide target sequence may be desirable.
- the zinc finger domains in the proteins may contain from 2-12 fingers, preferably, 3-8 fingers, more preferably 5-7 fingers, and most preferably 6 fingers.
- a multi-finger protein binds to a polynucleotide duplex, e.g. , DNA,
- RNA, PNA or any hybrids thereof its fingers typically line up along the polynucleotide duplex with a periodicity of about one finger per 3 bases of nucleotide sequence.
- the binding sites of individual zinc fingers (or subsites) typically span three to four bases, and subsites of adjacent fingers usually overlap by one base.
- a three-finger zinc finger protein XYZ binds to the 10 base pair site abcdefghij (where these letters indicate one of the duplex DNA) with the subsite of finger X being ghij, finger Y being defg and finger Z being abed.
- zinc fingers Y and Z would have the same polypeptide sequence as found in the original zinc finger discussed above (perhaps a wild type zinc fingers which bind defg and abed, respectively).
- Finger X would have a mutated polypeptide sequence.
- finger X would have mutations at one or more of the base-contacting positions, i. e. , fmger X would have the same polypeptide sequence as a wild type zinc finger except that at least one of the four amino residues at the primary positions would differ.
- fingers X and Z have the same sequence as the wild type zinc fingers which bind ghij and abed, respectively, while fmger Y would have residues at one or more base-coating positions which differ from those in a wild type finger.
- the present method can employ multi-fingered proteins in which more than one finger differs from a wild type zinc finger.
- the present method can also employ multi-fingered protein in which the amino acid sequence in all the fingers have been changed, including those designed by combinatorial chemistry or other protein design and binding assays.
- a zinc finger protein it is also possible to design or select a zinc finger protein to bind to a targeted polynucleotide in which more than four bases have been altered. In this case, more than one finger of the binding protein must be altered.
- a three-finger binding protein could be designed in which fingers X and Z differ from the corresponding fingers in a wild type zinc finger, while fmger Y will have the same polypeptide sequence as the corresponding finger in the wild type fingers which binds to the subsite defg. Binding proteins having more than three fingers can also be designed for base sequences of longer length.
- a four finger-protein will optimally bind to a 13 base sequence, while a five-finger protein will optimally bind to a 16 base sequence.
- a multi-finger protein can also be designed in which some of the fingers are not involved in binding to the selected DNA. Slight variations are also possible in the spacing of the fingers and framework. While the present method can employ any valid recognition code, the zing finger protein nucleic acid binding domain/nucleoside binding partner pairs disclosed in United States Patent No. 5,789,538, WO 96/06166, and WO 00/23464 can also be used.
- Methods for designing and identifying a zinc finger protein with desired nucleic acid binding characteristics also include those described in WO98/53060, which reports a method for preparing a nucleic acid binding protein of the Cys2-His2 zinc finger class capable of binding to a nucleic acid quadruplet in a target nucleic acid sequence.
- Zinc finger proteins useful in the present method can comprise at least one zinc finger polypeptide linked via a linker, preferably a flexible linker, to at least a second DNA binding domain, which optionally is a second zinc finger polypeptide.
- the zinc finger protein may contain more than two DNA-binding domains, as well as one or more regulator domains.
- the zinc fmger polypeptides used in the present method can be engineered to recognize a selected target site in the gene of choice.
- a backbone from any suitable C2H2-ZFP such as SPA, SPIC, or ZIF268, is used as the scaffold for the engineered zinc finger polypeptides (see, e.g., Jacobs, EMBO J. (1992) 11 :4507 ; and Desjarlais & Berg, Proc. Natl. Acad. Sci. USA (1993) 90:2256-2260).
- a number of methods can then be used to design and select a zinc finger polypeptide with high affinity for its target.
- a zinc finger polypeptide can be designed or selected to bind to any suitable target site in the target gene, with high affinity.
- nucleic acids encoding zinc finger polypeptides e.g., phage display, random mutagenesis, combinatorial libraries, computer/rational design, affinity selection,
- Zinc finger proteins useful in the method can be made by any recombinant DNA technology method for gene construction. For example, PCR based construction can be used. Ligation of desired fragments can also be performed, using linkers or appropriately complementary restriction sites. One can also synthesize entire finger domain or parts thereof by any protein synthesis method. Preferred for cost and flexibility is the use of PCR primers that encode a fmger sequence or part thereof with known base pair specificity, and that can be reused or recombined to create new combinations of fingers and ZFP sequences.
- the amino acid linker should be flexible, a beta turn structure is preferred, to allow each three finger domain to independently bind to its target sequence and avoid steric hindrance of each other's binding.
- Linkers can be designed and empirically tested.
- the ZFP can be designed to bind to non-contiguous target sequences.
- a target sequence for a six-finger ZFP can be a nine base pair sequence (recognized by three fingers) with intervening bases (that do not contact the zinc finger nucleic acid binding domain) between a second nine base pair sequence (recognized by a second set of three fingers).
- the number of intervening bases can vary, such that one can compensate for this intervening distance with an appropriately designed amino acid linker between the two three-finger parts of ZFP.
- a range of intervening nucleic acid bases in a target binding site is preferably 20 or less bases, more preferably 10 or less, and even more preferably 6 or less bases. It is of course recognized that the linker must maintain the reading frame between the linked parts of ZFP protein.
- a minimum length of a linker is the length that would allow the two zinc finger domains to be connected without providing steric hindrance to the domains or the linker.
- a linker that provides more than the minimum length is a "flexible linker.” Determining the length of minimum linkers and flexible linkers can be performed using physical or computer models of DNA-binding proteins bound to their respective target sites as are known in the art.
- the six-finger zinc finger peptides can use a conventional "TGEKP" linker to connect two three-finger zinc finger peptides or to add additional fingers to a three- finger protein.
- Other zinc finger peptide linkers both natural and synthetic, are also suitable.
- a useful zinc fmger framework is that of ZIF268 (see WO00/23464 and references cited therein.), however, others are suitable.
- Examples of known zinc finger nucleotide binding polypeptides that can be truncated, expanded, and/or mutagenized in order to change the function of a nucleotide sequence containing a zinc fmger nucleotide binding motif includes TFIIIA and zif268.
- Other zinc fmger nucleotide binding proteins are known to those of skill in the art.
- the murine CYS2- HiS2 zinc finger protein Zif268 is structurally well characterized of the zinc finger proteins (Pavletich andPabo, Science (1991) 252:809-817; Elrod-Erickson et al, Structure (London) (1996) 4:1171-1180; and Swirnoff et al, Mol. Cell. Biol. (1995) 15:2275-2287).
- DNA recognition in each of the three zinc finger domains of this protein is mediated by residues in the N-terminus of the alpha-helix contacting primarily three nucleotides on a single strand of the DNA.
- the operator binding site for this three fmger protein is 5'-GCGTGGGCG-'3. Structural studies of Zif268 and other related zinc finger-DNA complexes (Elrod-Erickson et al, Structure (London) (1998) 6:451-464; Kim and Berg, Nature Structural Biology (1996) 3:940-945;
- zinc fmger domains appear to specify overlappmg 4 bp sites rather than individual 3 bp sites.
- residues in addition to those found at helix positions -1, 3, and 6 are involved in contacting DNA (Elrod-Erickson et al, Structure (1996) 4:1171-1180).
- an aspartate in helix position 2 of the middle finger plays several roles in recognition and makes a variety of contacts.
- the carboxylate of the aspartate side chain hydrogen bonds with arginine at position -1, stabilizing its interaction with the 3'- guanine of its target site. This aspartate may also participate in water-mediated contacts with the guanine's complementary cytosine.
- this carboxylate is observed to make a direct contact to the N4 of the cytosine base on the opposite strand of the 5'-guanine base of the fmger 1 binding site. It is this interaction which is the chemical basis for target site overlap.
- any suitable host can be used, e.g., bacterial cells, insect cells, yeast cells, mammalian cells, and the like.
- expression of the zinc fmger protein fused to a maltose binding protein (MBP-zinc finger protein) in bacterial strain JM 109 allows for purification through an amylose column (NEB).
- High expression levels of the zinc fmger protein can be obtained by induction with IPTG since the MBP-zinc finger protein fusion in the pMal-c2 expression plasmid is under the control of the IPTG inducible tac promoter (NEB).
- Bacteria containing the MBP-zinc finger protein fusion plasmids are inoculated in to 2xYT medium containing 10-LM ZnC12, 0.02% glucose, plus 50 ptg/ml ampicillin and shaken at 37°C. At mid-exponential growth
- IP TG is added to 0.3 mM and the cultures are allowed to shake. After 3 hours the bacteria are harvested by centrifugation, disrupted by sonication, and then insoluble material is removed by centrifugation.
- the MBP-zinc fmger proteins are captured on an arnylose-bound resin, washed extensively with buffer containing 20 mM Tris-HCl (pH 7-5), 200 mM NaCl, 5 mM DTT and 50 ⁇ tM ZnC12, then eluted with maltose in essentially the same buffer (purification is based on a standard protocol from NEB). Purified proteins are quantitated and stored for biochemical analysis.
- Kd The biochemical properties of the purified proteins, e.g., Kd, can be characterized by any suitable assay.
- Kd is characterized via electrophoretic mobility shift assays ("EMSA") (Buratowski & Chodosh, in Current
- Kd is meant the dissociation constant for the compound, i.e., the concentration of a compound (e.g., a zinc finger protein) that gives half maximal binding of the compound to its target (i.e., half of the compound molecules are bound to the target) under given conditions (i.e., when [target] « Kd), as measured using a given assay system.
- a compound e.g., a zinc finger protein
- Any assay system can be used, as long as it gives an accurate measurement of the actual Kd of the zinc finger protein.
- the Kd for the zinc finger proteins of the invention is measured using an electrophoretic mobility shift assay as described herein.
- the 2C7 derivative of the Spl zinc finger was reported to have a specificity of 0.46 nM and the e2c zinc finger was reported to have an affinity of 0.5 nM.
- zinc fingers used in the invention typically have affinity 0.1 to 1.0 nanomolar range, more typically 0.18 to 0.75 nanomolar, and to picomoloar range and even to femtomolar range.
- naturally occurring zinc fingers have Kd in the nanomolar range.
- Zinc fmger proteins useful in the invention may even have an affinity for the target site that is in the femtamolar range, e.g., 100 femtamoles, 10 femtamoles, or less, in some cases as low as one femtamole.
- the zinc finger protein used in the present methods comprises a framework (or backbone) derived from a naturally occurring zinc fmger protein.
- Framework (or backbone) derived from any naturally occurring zinc fmger protein can be used.
- the zinc finger protein comprises a framework (or backbone) derived from a zinc fmger protein comprising a C2H2 motif can be used.
- the protein or peptide sequence within the ⁇ sheet of the C2H2 motif is not substantially changed, or not changed, from its natural sequence.
- the zinc finger protein used in the present methods comprises a framework (or backbone) derived from a zinc fmger protein that is naturally functional in plant cells.
- the zinc finger protein used in the present methods can comprise a C3H zinc finger (Terol et al., Gene, 260(l-2):45-53 (2000)), a QALGGH motif (Takatsuji, Plant. Mol. Biol, 39(6): 1073-8 (1999)), a RTNG-H2 zinc fmger motif (Jensen et al., FEBS Lett., 436(2 :283-7 (1998)), a 9 amino acid C2H2 motif (Chou et al., Proc. Natl. Acad. Sci.
- the zinc finger protein used in the present methods comprises a framework (or backbone) derived from a zinc fmger protein that is known in the art as of January 19, 2001.
- the zinc finger protein used in the present methods can comprise a framework (or backbone) derived from the zinc finger protein disclosed in the following U.S. patents and PCT patent publications: U.S. Patent No. 6,160,091, 6,140,466, 6,140,081, 5,831,008, 5,811,304 and 5,789,538 and WO 00/42219, WO 00/41566, WO 00/27878, WO 00/23464, WO 00/20622, WO 00/20556, WO 99/62952, WO 99/48909, WO 99/46293, WO 99/45132, WO 99/42474, WO 99/21991, WO 98/54311, WO 98/53061, WO 98/45326, WO 96/11267, WO
- the zinc finger protein used in the present methods can also comprise a framework (or backbone) derived from the zinc fmger protein disclosed in the following references: 1) Cousins RJ, Lanningham-Foster L., "Regulation of cysteine- rich intestinal protein, a zinc finger protein, by mediators of the immune response.” J
- Urrutia R. "Exploring the role of homeobox and zinc finger proteins in pancreatic cell proliferation, differentiation, and apoptosis.”
- Mizuno K Higuchi O., "LIM domains: double zinc finger motifs involved in protein-protein interactions” Tanpakushitsu KakusanKoso. 1997 Oct;42(l 3) -.2061-71; 15: LossonR., "KRAB zinc f ger proteins and nuclear receptors: a possible cross-talk.” Biol Chem.
- the zinc fmger protein is preferably fused to an effector domain (or regulatory domain or functional domain), i.e., a protein domain which activates or represses gene expression, e.g., an activator domain of a regulatory protein or an active domain of a nucleic acid modifying protein.
- an effector domain or regulatory domain or functional domain
- a protein domain which activates or represses gene expression e.g., an activator domain of a regulatory protein or an active domain of a nucleic acid modifying protein.
- effector domain or effector
- regulatory domain or regulatory domain
- functional domain may refer to the materials on either the nucleic acid or protein level as will be clear from the context.
- the effector domain can have an activity such as transcriptional modulation activity, DNA modifying activity, protein modifying activity and the like when " tethered to a DNA binding domain, i.e., a zinc finger protein.
- regulatory domains include proteins or effector domains of proteins such as transcription factors and co-factors, e.g., KRAB, MAD, ERD, SID, nuclear factor kappa B subunit p65, early growth response factor 1, and nuclear hormone receptors, VP16 and VP64, endonucleases, integrases, recombinases, methyltransferases, histone acetyltransferases, histone deacetylases, mutases, restriction enzymes, etc.
- transcription factors and co-factors e.g., KRAB, MAD, ERD, SID, nuclear factor kappa B subunit p65, early growth response factor 1, and nuclear hormone receptors, VP16 and VP64, endonucleases, integrases, recombinases, methyltransferases, histone acetyltransferases, histone deacetylases, mutases, restriction enzymes, etc.
- Activators and repressors include co-activators and co-repressors (see, e.g., Utley et al, Nature (1998) 394:498-502; and WO 00/03026).
- Effector domains can include DNA-binding domains from a protein that is not a zinc finger protein, such as a restriction enzyme, a nuclear hormone receptor, a homeodomain protein such as engrailed or antenopedia, a bacterial helix-turn-helix motif protein such as lambda repressor and tet repressor, Gal4, TATA binding protein, helix-loop-helix motif proteins such as myc and myo D, leucine zipper type proteins such as fos and jun, and beta sheet motif proteins such as met, arc, and mnt repressors.
- Particularly preferred activator is the CI activator domain of maize (Goff et al, Genes Dev. (1991) 5(2):298-309)
- the zinc finger protein having an effector domain is one that is responsive to a ligand.
- the effector domain can effect such a response.
- ligand inducible binding domain-effector fusions Use of ligand inducible binding domain-effector fusions is generally known as a gene switch. Therefore, the ZFP domains discussed here can be used as part of the ligand- binding domain in gene switches.
- Example of such ligand-responsive domains include hormone receptor ligand binding domains, e.g., estrogen receptor domain, ecydysone receptor system, glucocorticosteroid (Parker, Curr. Opin. Cell Biol. (1993)
- Preferred inducers are small, inorganic, biodegradable, molecules.
- the zinc finger protein can be covalently or non-covalently associated with one or more regulatory domains. Alternatively, two or more regulatory domains, whether identical or different ones, can be linked together.
- the regulatory domains can be covalently linked to the zinc finger protein nucleic acid binding domain, e.g., via an amino acid linker, as part of a fusion protein.
- the zinc finger proteins can also be associated with a regulatory domain via a non-covalent dimerization domain, e.g., a leucine zipper, a STAT protein N terminal domain, or an FK506 binding protein (see, e.g., O'Shea, Science (1991) 254:539; Barahmand-Pour et al, Curr. Top.
- the regulatory domain can be associated with the zinc finger protein domain at any suitable position, including the C- or N-terminus of the zinc finger protein.
- Common regulatory domains for addition to the zinc fmger protein made using the methods of the invention include, e.g., DNA-binding domains from transcription factors, effector domains from transcription factors (activators, repressors, co-activators, co-repressors), silencers, nuclear hormone receptors, and chromatin associated proteins and their modifiers, e.g. , methylases, kinases, acetylases and deacetylases.
- Transcription factor polypeptides from which one can obtain a regulatory domain include those that are involved in regulated and basal transcription. Such polypeptides include transcription factors, their effector domains, coactivators, silencers, nuclear hormone receptors (see, e.g., Goodrich et al, Cell (1996) 84:825-
- TATA box binding protein (T13P) and its associated TAF polypeptides are described in Goodrich & Tjian, Curr. Opin. Cell Biol (1994) 6:403-409 and Hurley, Curr. Opin. Struct. Biol. (1996) 6:69-75.
- the STAT family of transcription factors are reviewed in, for example, Barahmand-Pour et al, Curr. Top. Microbiol. Immunol (1996) 211:121-128. Transcription factors involved in disease are reviewed in Aso et al, J Clin. Invest.
- the KRAB repression domain from the human KOX- 1 protein is used as a transcriptional repressor (Thiesen et al, New Biologist (1990) 2:363-374; Margolin et al, Proc. Natl Acad. Sci. USA (1994) 91:4509-4513; Pengue et al, Nucl. Acids Res. (1994) 22:2908-2914; and Wixzgall et al, Proc. Natl. Acad.
- KAP-1 a KRAB co- repressor
- KRAB a KRAB co-repressor
- KRAB a KRAB co-repressor
- KRAB a KRAB co-repressor
- KRAB a KRAB co-repressor
- KRAB a KRAB co-repressor
- KAP- 1 can be used alone with a zinc finger protein.
- MAD a preferred transcription factors and transcription factor domains that act as transcriptional repressors.
- MAD see, e.g., Sommer et al, JBiol Chem. (1998) 273:6632-
- EGR- 1 early growth response gene product- 1
- EGR- 1 head growth response gene product- 1
- EGD ets2 repressor factor repressor domain
- SID MAD smSLN3 interaction domain
- the HSV VP 16 activation domain is used as a transcriptional activator (see, e.g., Hagmann et al, J Virol (1997) 71:5952- 5962).
- Other preferred transcription factors that could supply activation domains include the VP64 activation domain (Selpel et al, EMBOJ (1996) 11:4961-4968); nuclear hormone receptors (see, e.g., Torchia et al, Curr. Opin. Cell. Biol. (1998) 10:373-
- Oncogenes are described in, for example, Cooper, Oncogenes, 2nd ed., The Jones and Bartlett Series in Biology, Boston, MA, Jones and Bartlett Publishers, 1995. The ets transcription factors are reviewed in Waslylk et al, Eur. J Biochem. (1993) 211 :7-l 8. Myc oncogenes are reviewed in, for example, Ryan et al, Biochem. J. (1996) 314:713-721.
- the Jun and fos transcription factors are described in, for example, The Fos and Jun Families of Transcription Factors, Angel & Herrlich, eds. (1994).
- the max oncogene is reviewed in Hurlin et al, Cold Spring Harb. Symp. Quant. Biol. 59:109-116.
- the myb gene family is reviewed in Kanei- Ishii et al, Curr. Top. Microbiol. Immunol. (1996) 211:89-98.
- the mos family is reviewed in Yew et al, Curr. Opin. Genet. Dev. (1993) 3:19-25.
- histone acetyltransferase is used as a transcriptional activator (.see, e.g., Jin & Scotto, Mol. Cell. Biol. (1998) 18:4377-4384; Wolffle, Science (1996) 272:371-372; Taunton et al, Science (1996) 272:408-411; and Hassig et al, Proc. Natl. Acad. Sci. USA (1998) 95:3519-3524).
- histone deacetylase is used as a transcriptional repressor (see, e.g., Jin & Scotto, Mol. Cell. Biol.
- Table 1 Exemplary plant effectors.
- Target genes and target nucleotide sequences Expression of any target genes in plant can be modulated by the present method.
- the expression of the APETALA3 (AP3) gene of Arabidopsis can be modulated.
- the APETALA3 (AP3) gene of Arabidopsis is a member of the ADS domain proteins that are required to specify the flower organ types and are involved in regulation of floral development. The success illustrated below in targeting this gene for endogenous gene regulation is important for several reasons.
- Arabidopsis is a well-studied model organism in which genetic studies are easily and rapidly performed and is considered a typical case.
- Second, AP3 has been well studied in its role during flower development to specify floral organ identity (see, Yanofsky, Annu. Rev. Plant Physiol. Plant Mol Biol (1995) 46:167-188; and Irish,
- the expression of the maize MIPS gene can be modulated.
- the maize MIPS protein catalyzes the conversion of glucose-6-phosphate to oinositol 1 -phosphate which is an early step in the synthesis of phytic acid.
- Low phytic acid content in feed for many species of animals is considered to have a great advantage from environmental and nutritional standpoints since phytic acid metabolism in plant plays a role in the regulation of phosphate and mineral concentration. Controlling the expression of the MIPS gene would therefore provide a means to assure plants with low phytic acid content and act as a dominant trait.
- the present invention permits such control, as well as control of genetic expression generally in plants.
- the target nucleotide sequence is any location within the target gene whose expression is to be regulated which provides a suitable location for controlling expression.
- the target nucleotide sequence maybe within the coding region or upstream or downstream thereof.
- upstream from ATG translation start codon is preferred, most preferably upstream of TATTA box but not exceeding 1000 bp from the start of transcription.
- upstream from the ATG translation start codon is also preferred, but preferably downstream from TATTA box.
- the targeted nucleotide sequence can also be a short portion of duplex nucleic acid, e.g., RNA, DNA, PNA or any hybrids thereof, having from about 8 to about 40 base pairs and having a defined sequence for which there is some desirable purpose in determining its presence or absence within a larger polynucleotide. For example, it may be desirable to determine whether a particular promoter or control region is found within the genome of a particular organism.
- a labeled protein e.g., bound with a radioactive or fluorescent label, containing zinc fingers which binds to a polynucleotide having this particular sequence can be used to determine whether the genetic material of the organism contains this particular sequence.
- the target sequence may reside endogenously in the target gene, e.g., MIPS in maize and AP3 in Arabidopsis as shown in the Example Section below, or may be inserted into the gene, e.g., heterologous, as is illustrated below for luciferase in tobacco, for example, using techniques such as homologous recombination.
- the regulatory factors employed in the methods of the invention can target the endogenous nucleotide sequence.
- the target gene lacks an appropriate unique nucleotide sequence or contains such a sequence only in a position where binding to a regulatory factor would be ineffective in controlling expression, it may be necessary to provide a "heterologous" targeted nucleotide sequence.
- heterologous targeted nucleotide sequence is meant either a sequence completely foreign to the gene to be targeted or a sequence which resides in the gene itself, but in a different position from that wherein it is inserted as a target. Thus, it is possible to completely control the nature and position of the targeted nucleotide sequence.
- the target sequence may be any given sequence of interest for which a complementary zinc finger protein is designed.
- Target genes include both structural and regulatory genes. When the target gene is a regulatory gene, the expression of the gene that is regulated by the target regulatory gene can also be regulated by the zinc finger protein, albeit indirectly. Therefore, expression of single genes or gene families can be controlled by the present methods.
- the target gene may, as is the case for the MIPS gene and AP3 gene, be endogenous to the plant cells or plant wherein expression is regulated or may be a transgene which has been inserted into the cells or plants in order to provide a production system for a desired protein or which has been added to the genetic compliment in order to modulate the metabolism of the plant or plant cells, for example as illustrated below for the C7 binding site inserted into tobacco genome.
- the assay system exemplified in Example 1 can be used in selecting desirable ZFP, effector or target nucleotide sequence.
- the assay system used in the Example 1 generally contains two constructs.
- One construct contains a reporter gene, e.g., P-glucuronidase (GUS), chloramphenicol acetyl transferase (CAT), or green fluorescent protein (GFP), operably linked to a promoter having a ZFP target nucleotide sequence so that the expression of the reporter gene is amenable to regulation by the ZFP.
- the other construct contains ZFP gene, and optionally fused to an effector domain.
- the ZFP Upon introduction into and expression within plant or plant cells, whether transiently or stably, the ZFP, and optionally the ZFP- effector fusion protein, will regulate the expression of the reporter gene, provided that the ZFP and the target nucleotide sequence have matching "code" sequence, e.g., the pairs listed in Table 2.
- "code" sequence e.g., the pairs listed in Table 2.
- the assay system can be used to screen or select for new ZFP, effector or target nucleotide sequence with desirable specificity or binding affinity.
- a system is started with a ZFP, optionally with an effector and a target nucleotide sequence that are compatible and substitute the ZFP with a new amino acid sequence
- New effector and target nucleotide sequence can be identified using similar procedure.
- the assay can be conducted quantitatively to identify ZFP, effector or target nucleotide sequence with particular specificity and binding affinity.
- ZFPs can tolerate changes in the fmger region, one can start with a preferred pairs of ZFP and target nucleotide sequence, e.g., the pairs listed in Table 2, and mutagenize the finger region of the ZFP to identify those variants that can still function as a ZFP, but with different specificity to binding affinity. It is often necessary to select ZFP finger sequence by testing against actual DNA sequence, since the juxtaposition of triplets may affect optimal ZFP finger sequence. In addition, particular positions in the finger region, e.g., -1, 3, 6, should be the focused in the mutagenesis analysis because these positions are thought to be critical for the binding between a ZFP and its target nucleotide sequence. Accordingly, ZFPs with different level of specificities and binding affinities can be obtained and these ZFPs can be used in fine-tuned control of a target gene expression in plant.
- a preferred pairs of ZFP and target nucleotide sequence e.g., the pairs listed in Table 2
- the zinc fmger protein can be provided to the plant cells via any suitable methods known in the art.
- the zinc fmger protein can be exogenously added to the plant cells and the plant cells are maintained under conditions such that the zinc finger protein binds to the target nucleotide sequence and regulates the expression of the target gene in the plant cells.
- a nucleotide sequence encoding the zinc finger protein can be expressed in the plant cells and the plant cells are maintained under conditions such that the expressed zinc fmger protein binds to the target nucleotide sequence and regulates the expression of the target gene in the plant cells.
- the zinc finger gene can be expressed in plant with any suitable plant expression vectors.
- Typical vectors useful for expression of genes in higher plants are well known in the art and include vectors derived from the tumor-inducing (Ti) plasmid of Agrobacterium tumefaciens described by Rogers et al, Meth. in Enzymol. (1987) 153:253-277. These vectors are plant integrating vectors in that upon transformation, the vectors integrate a portion of vector DNA into the genome of the host plant.
- Exemplary A. tumefaciens vectors useful herein are plasmids pKYLX6 and pKYLX7 of Schardl et al, Gene (1987) 61:1-11 and Berger et al, Proc. Natl Acad. Sci.
- plasmid pBI 101.2 that is available from Clontech Laboratories, Inc. (Palo Alto, CA).
- the zinc finger protein can be expressed as a fusion protein such as maltose binding protein ("MBP"), glutathione S transferase (GST), hexahistidine, c-myc, and the FLAG epitope, for ease of purification, monitoring expression, or monitoring cellular and subcellular localization.
- MBP maltose binding protein
- GST glutathione S transferase
- hexahistidine hexahistidine
- c-myc hexahistidine
- FLAG epitope FLAG epitope
- nucleic acid sequences of the present invention may be expressed in both monocotyledonous and dicotyledonous plant species, sequences can be modified to account for the specific codon preferences and GC content preferences of monocotyledons or dicotyledons as these preferences have been shown to differ (Murray et al, Nucl. Acids Res. (1989) 17: 477-498).
- the maize preferred codon for a particular amino acid may be derived from known gene sequences from maize. Maize codon usage for 28 genes from maize plants are listed in Table 4 of Murray et al, supra.
- the transgene may include a reporter protein such as luciferase, which can be helpful in providing an assay system for determining the position in a target gene in which the targeted nucleotide sequence should reside.
- a reporter protein such as luciferase
- the invention also includes an assay system for determination of a suitable region for targeting by regulatory factors, wherein said assay method comprises providing a chimeric gene comprising a nucleotide sequence encoding a reporter protein optionally fused to coding regions of said gene; said nucleotide sequence operably linked to control sequences endogenous to said gene.
- the chimeric gene is then provided a targeted nucleotide sequence at various locations within the endogenous portions and the effect on production of the reporter protein of contact with the appropriate zinc fmger containing regulatory protein is determined.
- the expression system for the effector protein with control sequences that are tissue specific so that the desired gene regulation can occur selectively in the desired portion of the plant.
- tissue specific tissue specific
- effector proteins for regulation of expression would be designed for selective - expression in flowering portions of the plant.
- ZFPs can be used to create functional "gene knockouts" and "gain of function" mutations in a host cell or plant by repression or activation of the target gene expression.
- Repression or activation maybe of a structural gene, e.g., one encoding a protein having for example enzymatic activity, or of a regulatory gene, e.g. , one encoding a protein that in turn regulates expression of a structural gene.
- Expression of a negative regulatory protein can cause a functional gene knockout of one or more genes, under its control.
- a zinc finger having a negative regulatory domain can repress a positive regulatory protein to knockout or prevent expression of one or more genes under control of the positive regulatory protein.
- the present invention further provides recombinant expression cassettes comprising a ZFP-encoding nucleic acid.
- a nucleic acid sequence coding for the desired polynucleotide of the present invention can be used to construct a recombinant expression cassette which can be introduced into the desired host cell.
- a recombinant expression cassette will typically comprise a polynucleotide encoding creation zinc fmger proteins, e.g., ZFPml, ZFPm2, ZFPm3, ZFPm4 and ZFPAp3, operably linked to transcriptional initiation regulatory sequences which will direct the transcription of the polynucleotide in the intended host cell, such as tissues of a transformed plant.
- plant expression vectors may include (1) a cloned plant gene under the transcriptional control of 5' and 3' regulatory sequences and (2) a dominant selectable marker.
- Such plant expression vectors may also contain, if desired, a promoter regulatory region (e.g., one conferring inducible or constitutive, environmentally- or developmentally-regulated, or cell- or tissue-specific/selective expression), a transcription initiation start site, a ribosome binding site, an RNA processing signal, a transcription termination site, and/or a polyadenylation signal.
- a plant promoter fragment can be employed which will direct expression of a polynucleotide of the present invention in all tissues of a regenerated plant.
- Such promoters are referred to herein as "constitutive" promoters and are active under most environmental conditions and states of development or cell differentiation. Examples of constitutive promoters include the rice actin 1 promoter (U.S. Patent No.
- CaMV cauliflower mosaic virus
- P- or 2'- promoter derived from T-DNA of Agrobacterium tumefaciens
- the ubiquitin I promoter the Smas promoter
- the cinnamyl alcohol dehydrogenase promoter U.S. Patent No. 5,683,439
- the Nos promoter the pEmu promoter
- the rubisco promoter the GRP 1 - 8 promoter
- other transcription initiation regions from various plant genes known to those of skilled artisans.
- the plant promoter can direct expression of a polynucleotide of the present invention in a specific tissue or may be otherwise under more precise environmental or developmental control.
- Such promoters are referred to here as
- inducible promoters Environmental conditions that may effect transcription by inducible promoters include pathogen attack, anaerobic conditions, or the presence of light.
- inducible promoters are the Adhl promoter which is inducible by hypoxia or cold stress, the Hsp70 promoter which is inducible by heat stress, and the PPDK promoter which is inducible by light.
- promoters under developmental control include promoters that initiate transcription only, or preferentially, in certain tissues, such as leaves, roots, fruit, seeds, or flowers.
- An exemplary promoter is the anther specific promoter 5126 (U.S. Patent Nos. 5,689,049 and 5,689,051). The operation of a promoter may also vary depending on its location in the genome. Thus, an inducible promoter may become fully or partially constitutive in certain locations.
- heterologous and non-heterologous (i.e., endogenous) promoters can be employed to direct expression of the nucleic acids of the present invention. These promoters can also be used, for example, in recombinant expression cassettes to drive expression of antisense nucleic acids to reduce, increase, or alter concentration and/or composition of the proteins of the present invention in a desired tissue.
- the nucleic acid construct will comprise a promoter functional in a plant cell, such as in Zea mays, operably linked to a polynucleotide of the present invention.
- isolated nucleic acids which serve as promoter or enhancer elements can be introduced in the appropriate position (generally upstream) of a non- heterologous form of a polynucleotide of the present invention so as to up or down regulate expression of a polynucleotide of the present invention.
- endogenous promoters can be altered in vivo by mutation, deletion, and/or substitution (see, Kmiec, U.S. Patent No. 5,565,350; WO 93/22443), or isolated promoters can be introduced into a plant cell in the proper orientation and distance from a gene of the present invention so as to control the expression of the gene.
- Gene expression can be modulated under conditions suitable for plant growth so as to alter the total concentration and/or alter the composition of the polypeptides of the present invention in plant cell.
- the selection of the promoter used in expression cassettes will determine the spatial and temporal expression pattern of the transgene in the transgenic plant, i.e., the ZFP gene is only expressed in the desired tissue or at a certain time in plant development or growth.
- Selected promoters will express transgenes in specific cell types (such as leaf epidermal cells, mesophyll cells, root cortex cells) or in specific tissues or organs (roots, leaves or flowers, for example) and the selection will reflect the desired location of accumulation of the gene product.
- the selected promoter may drive expression of the gene under various inducing conditions.
- the zinc finger encoding gene can be under control of and activated by a promoter responsive to the presence of a pathogen or to plant stress, e.g., cold stress, salt stress, etc., so that the induced ZFP can modulate a gene that counteracts the pathogen, stress, etc.
- Promoters vary in their strength, i.e., ability to promote transcription. Depending upon the host cell system utilized, any one of a number of suitable promoters can be used, including the gene's native promoter.
- promoters will be useful in the invention, particularly to control the expression of the ZFP and ZFP-effector fusions, the choice of which will depend in part upon the desired level of protein expression and desired tissue-specific, temporal specific, or environmental cue-specific control, if any in a plant cell.
- Constitutive and tissue specific promoters are of particular interest.
- Such constitutive promoters include, for example, the core promoter of the Rsyn7, the core CaMV 35S promoter (Odell et al, Nature (1985) 313:810-812), CaMV 19S (Gmunder and Kohli, Mol Gen Genet 1989 Dec; 220(1):95-101), rice actin (Wang et al., Mol. Cell.
- Ubiquitin is a gene product known to accumulate in many cell types and its promoter has been cloned from several species for use in transgenic plants (e.g. sunflower - Binet et al, Plant Science (1991) 79:87-94; maize - Christensen et al,
- a vector that comprises the maize ubiquitin promoter and first intron and its high activity in cell suspensions of numerous monocotyledons when introduced via microprojectile bombardment.
- the Arabidopsis ubiquitin promoter is also ideal for use with the nucleotide sequences of the present invention.
- the ubiquitin promoter is suitable for gene expression in transgenic plants, both monocotyledons and dicotyledons.
- Suitable vectors are derivatives of pAHC25 or any of the transformation vectors described in this application, modified by the introduction of the appropriate ubiquitin promoter and/or intron sequences.
- pCGN1761 contains the "double" CaMV 35S promoter and the tml transcriptional terminator with a unique EcoRI site between the promoter and the terminator and has a pUC-type backbone.
- a derivative of pCGN1761 is constructed which has a modified polylinker which includes Notl and Xhol sites in addition to the existing EcoRI site. This derivative is designated pCGN1761ENX.
- pCGNl 761ENX is useful for the cloning of cDNA sequences or coding sequences (including microbial ORF sequences) within its polylinker for the purpose of their expression under the control of the 35S promoter in transgenic plants.
- the entire 35S promoter-coding sequence- tml terminator cassette of such a construction can be excised by Hindlll, Sphl, Sail, and Xbal sites 5' to the promoter and Xbal, BamHI and Bgll sites 3' to the terminator for transfer to transformation vectors such as those described below.
- the double 35S promoter fragment can be removed by 5' excision with Hindlll, Sphl, Sail, Xbal, or Pstl, and 3' excision with any of the polylinker restriction sites (EcoRI, Notl or Xhol) for replacement with another promoter.
- modifications around the cloning sites can be made by the introduction of sequences that may enhance translation. This is particularly useful when overexpression is desired.
- pCGN1761ENX may be modified by optimization of the translational initiation site as described in Example 37 of U.S. Patent No. 5,639,949, incorporated herein by reference.
- actin promoter is a good choice for a constitutive promoter.
- the promoter from the rice Actl gene has been cloned and characterized (McElroy et al, Plant Cell (1990) 2:163-171).
- a 1.3 kb fragment of the promoter was found to contain all the regulatory elements required for expression in rice protoplasts.
- numerous expression vectors based on the Actl promoter have been constructed specifically for use in monocotyledons (McElroy et al, Mol Gen. Genet. (1991) 231:150-160).
- promoter-containing fragments is removed from the McElroy constructions and used to replace the double 35S promoter in pCGN1761ENX, which is then available for the insertion of specific gene sequences.
- the fusion genes thus constructed can then be transferred to appropriate transformation vectors.
- the rice Actl promoter with its first intron has also been found to direct high expression in cultured barley cells (Chibbar et al, Plant Cell Rep. (1993) 12:506-509).
- Tissue-specific promoters can be utilized to target enhanced expression within a particular plant tissue (See generally, copending U.S. Provisional Patent Application entitled "Promoters for Regulation of Plant Gene Expression, Attorney Docket No. 1360.002PRV (Schwegman, Lundberg, Woessner & Kluth), filed June 23, 2000, the content of which is herein incorporated by reference in its entirety.
- tissue specific promoters which have been described include the lectin (Vodkin, Prog. Clinc. Biol. Res., 138:87-98 (1983); and Lindstrom et al., £>ev. Genet, 11:160-167
- Tissue-specific promoters disclosed in the following references may also be used: Yamamoto et al, Plant J ' (1997) 12(2):255-265; Kawamata et al, Plant Cell Physiol. (1997) 38(7):792-803; Hansen et al, Mol Gen Genet. (1997) 254(3):337); Russell et al, Transgenic Res. (1997) 6(2):15 7-168; Rinehart et al, Plant Physiol. (1996) 112(3):1331; Y an Camn et al, Plant Physiol. (1996) 112(2):525-535;
- a maize gene encoding phosphoenol carboxylase has been described by Hudspeth & Grula (Plant Molec Biol 12: 579-589 (1989)).
- the promoter for this gene can be used to drive the expression of any gene in a leaf-specific manner in transgenic plants.
- Other leaf- specific promoters are known in the art, and include those described in, for example, Yamamoto et al, Plant J. (1997) 12(2):255-265; Kwon et al, Plant Physiol. (1994) 105:357-367; Yamamoto et al, Plant Cell Physiol. (1994) 35(5):773-778; Gotor et al, Plant J. (1993) 3:509-518; Orozco et al, Plant Mol. Biol. (1993) 23(6):1129-
- a suitable root promoter is the promoter of the maize metallothionein-like (MTL) gene described by de Framond (FEBS (1991) 290:103-106) and also in U.S. Patent No. 5,466,785, incorporated herein by reference.
- This "MTL" promoter is transferred to a suitable vector such as pCGN1761ENX for the insertion of a selected gene and subsequent transfer of the entire promoter-gene-terminator cassette to a transformation vector of interest.
- suitable vector such as pCGN1761ENX
- Other examples of root-specific promoters which have been described include the RB7 promoter from Nicotiana tabacum (U.S. Patent Nos. 5,459,252 and 5,750,386).
- WO 93/07278 describes the isolation of the maize calcium-dependent protein kinase (CDPK) gene which is expressed in pollen cells.
- CDPK calcium-dependent protein kinase
- the gene sequence and promoter extend up to 1400 bp from the start of transcription.
- this promoter or parts thereof can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a nucleic acid sequence of the invention in a pollen-specific manner.
- Inducible promoters and other types of regulated promoters can also be used.
- PR-1 promoters, ethanol-inducible promoters, glucocorticoid-inducible promoters, wound-inducible promoters, promoters for pith-preferred expression and promoters for receptor mediated transactivation in the presence of a chemical ligand can be used.
- the double 35S promoter in pCGN1761ENX may be replaced with any other promoter of choice that will result in suitably high expression levels.
- one of the chemically regulatable promoters described in U.S. Patent No. 5,614,395, such as the tobacco PR-la promoter may replace the double 35S promoter.
- the Arabidopsis PR-1 promoter described in Lebel et ah, Plant J. (1998) 16:223-233 maybe used.
- the promoter of choice is preferably excised from its source by restriction enzymes, but can alternatively be PCR-amplified using primers that carry appropriate terminal restriction sites.
- the chemically/pathogen regulatable tobacco PR- la promoter is cleaved from plasmid pCIB1004 (for construction, see example 21 of EP 0 332 104, which is hereby incorporated by reference) and transferred to plasmid pCGN1761ENX (U.S. Patent
- pCIB1004 is cleaved with Ncol and the resultant 3' overhang of the linearized fragment is rendered blunt by treatment with T4 DNA polymerase. The fragment is then cleaved with Hindlll and the resultant PR- la promoter-containing fragment is gel purified and cloned into pCGN1761ENX from which the double 35S promoter has been removed. This is done by cleavage with Xhol and blunting with
- T4 polymerase followed by cleavage with Hindlll and isolation of the larger vector- terminator containing fragment into which the pCIB1004 promoter fragment is cloned.
- This generates a pCGN1761ENX derivative with the PR- la promoter and the tml terminator and an intervening polylinker with unique EcoRI and Notl sites.
- the selected coding sequence can be inserted into this vector, and the fusion products (i.e. promoter-gene-terminator) can subsequently be transferred to any selected transformation vector, including those described infra.
- Various chemical regulators may be employed to induce expression of the selected coding sequence in the plants transformed according to the present invention, including the benzothiadiazole, isonicotinic acid, and salicylic acid compounds disclosed in U.S. Patent Nos.
- a promoter inducible by certain alcohols or ketones, such as ethanol, may also be used to confer inducible expression of a coding sequence of the present invention.
- a promoter is for example the alcA gene promoter from Aspergillus nidulans (Caddick et al, (1998) Nat. Biotechnol 16:177-180).
- the alcA gene encodes alcohol dehydrogenase I, the expression of which is regulated by the AlcR transcription factors in presence of the chemical inducer.
- the CAT coding sequences in plasmid ⁇ alcA:CAT comprising a ale A gene promoter sequence fused to a minimal 35S promoter (Caddick et al, Nat. Biotechnol (1998) 16:177-180) are replaced by a coding sequence of the present invention to form an expression cassette having the coding sequence under the control of the alcA gene promoter.
- This is carried out using methods well known in the art. Induction of expression of a nucleic acid sequence of the present invention using systems based on steroid hormones is also contemplated.
- a glucocorticoid-mediated induction system is used (Aoyama and Chua, The Plant Journal (1997) 11:605-612) and gene expression is induced by application of a glucocorticoid, for example a synthetic glucocorticoid, preferably dexamethasone, preferably at a concentration ranging from O.lmM to lmM, more preferably from lOmM to lOOmM.
- the luciferase gene sequences are replaced by a nucleic acid sequence of the invention to form an expression cassette having a nucleic acid sequence of the invention under the control of six copies of the GAL4 upstream activating sequences fused to the 35S minimal promoter. This is carried out using methods well known in the art.
- the trans-acting factor comprises the GAL4 DNA-binding domain (Keegan et al, Science (1986)
- fusion protein fused to the transactivating domain of the herpes viral protein VP 16 (Triezenberg et al, Genes Devel (1988) 2:718-729) fused to the hormone-binding domain of the rat glucocorticoid receptor (Picard et al, (1988) Cell 54:1073-1080).
- the expression of the fusion protein is controlled by any promoter suitable for expression in plants known in the art or described here.
- This expression cassette is also comprised in the plant comprising a nucleic acid sequence of the invention fused to the 6xGAL4/minimal promoter.
- tissue- or organ-specificity of the fusion protein is achieved leading to inducible tissue- or organ-specificity of the insecticidal toxin. Wound-inducible promoters may also be suitable for gene expression.
- WO 93/07278 which is herein incorporated by reference, describes the isolation of the maize trp A gene, which is preferentially expressed in pith cells.
- the gene sequence and promoter extending up to -1726 bp from the start of transcription are presented.
- this promoter, or parts thereof can be transferred to a vector such as pCGN1761 where it can replace the 35S promoter and be used to drive the expression of a foreign gene in a pith-preferred manner.
- fragments containing the pith-preferred promoter or parts thereof can be transferred to any vector and modified for utility in transgenic plants.
- 5,880,333 describes a system whereby class II hormone receptors such as Ecdysone Receptor (EcR) and Ultraspiracle (USP), which function together as a heterodimer, regulate the expression of a target polypeptide in a plant cell in the presence of an appropriate chemical ligand, e.g., tebufenozide.
- EcR Ecdysone Receptor
- USP Ultraspiracle
- inducible PR1 promoter particularly preferred are the inducible PR1 promoter, maize ubiquitin promoter, and rice actin promoter.
- any combination of constitutive or inducible and non-tissue specific or tissue specific may be used to control ZFP expression.
- the desired control may be temporal, developmental or environmentally controlled using the appropriate promoter.
- Environmentally controlled promoters are those that respond to assault by pathogen, pathogen toxin, or other external compound
- temporal or developmental promoter is a fruit ripening-dependent promoter.
- the present invention provides compositions, and methods for making, heterologous promoters and/or enhancers operably linked to a ZFP and ZFP-effector fusion encoding polynucleotide of the present invention.
- a typical step in promoter isolation is identification of gene products that are expressed with some degree of specificity in the target tissue.
- methodologies include: differential hybridization to cDNA libraries; subtractive hybridization; differential display; differential 2-D protein gel electrophoresis; DNA probe arrays; and isolation of proteins known to be expressed with some specificity in the target tissue.
- Such methods are well known to those of skill in the art.
- Commercially available products for identifying promoters are known in the art such as Clontech's (Palo Alto, CA) Universal GenomeWalker Kit.
- the amino acid sequence for at least a portion of the identified protein it is helpful to obtain the amino acid sequence for at least a portion of the identified protein, and then to use the protein sequence as the basis for preparing a nucleic acid that can be used as a probe to identify either genomic DNA directly, or preferably, to identify a cDNA clone from a library prepared from the target tissue. Once such a cDNA clone has been identified, that sequence can be used to identify the sequence at the 5' end of the transcript of the indicated gene. For differential hybridization, subtractive hybridization and differential display, the nucleic acid sequence identified as enriched in the target tissue is used to identify the sequence at the 5 1 end of the transcript of the indicated gene.
- any of these sequences identified as being from the gene transcript can be used to screen a genomic library prepared from the target organism.
- Methods for identifying and confirming the transcriptional start site are well known in the art.
- a number of genes are identified that are expressed under the desired circumstances, in the desired tissue, or at the desired stage. Further analysis will reveal expression of each particular gene in one or more other tissues of the plant.
- promoter sequence elements include the TATA box consensus sequence (TAT AAT), which is usually an NT-rich stretch of 5-10 bp located approximately 20 to 40 base pairs upstrearn of the transcription start site. Identification of the TATA box is well known in the art. For example, one way to predict the location of this element is to identify the transcription start site using standard R ⁇ A-mapping techniques such as primer extension, S I analysis, and/or R ⁇ ase protection.
- TATA box consensus sequence TATA box consensus sequence
- a structure-function analysis can be performed involving mutagenesis of the putative region and quantification of the mutation's effect on expression of a linked downstreamreporter gene. See, e.g., The Maize Handbook, Chapter 114, Freeling and Walbot, Eds., Springer, New York (1994).
- a promoter element i.e., the CAAT box
- a series of adenines surrounding the trinucleotide G (or T) N G (Messing et al, in Genetic Engineering in Plants, Kosage, Meredith and Hollaender, Eds., pp.
- a region of suitable size is selected from the genomic DNA that is 5' to the transcriptional start, or the translational start site, and such sequences are then linked to a coding sequence. If the transcriptional start site is used as the point of fusion, any of a number of possible 5' untranslated regions can be used in between the transcriptional start site and the partial coding sequence. If the translational start site at the 3' end of the specific promoter is used, then it is linked directly to the methionine start codon of a coding sequence.
- polypeptide expression it is generally desirable to include a polyadenylation region at the 3 '-end of a polynucleotide coding region.
- the polyadenylation region can be derived from the natural gene, from a variety of other plant genes, or from T-DNA.
- the 3' end sequence to be added can be derived from, for example, the nopaline synthase or octopine synthase genes, or alternatively from another plant gene, or less preferably from any other eukaryotic gene.
- An intron sequence can be added to the 5' untranslated region or the coding sequence of the partial coding sequence to increase the amount of the mature message that accumulates in the cytosol.
- Inclusion of a spliceable intron in the transcription unit in both plant and animal expression constructs has been shown to increase gene expression at both the mRNA and protein levels up to 1,000-fold (Buchman and Berg, Mol. Cell Biol (1988) 8:4395-4405; and Callis et al, Genes Dev. (1987) 1:1183- 1200).
- Such intron enhancement of gene expression is typically greatest when placed near the 5' end of the transcription unit.
- Use of maize introns Adhl-S intron 1, 2, and 6, the Bronze-I intron are known in the art (See generally, The Maize Handbook, Chapter 116, Freeling and Walbot, Eds, Springer, New York (1994))
- Plant transformation protocols as well as protocols for introducing nucleotide sequences into plants may vary depending on the type of plant or plant cell, i.e., monocot or dicot, targeted for transformation. Suitable methods of introducing nucleotide sequences into plant cells and subsequent insertion into the plant genome include microinjection (Crossway et al, Biotechniques (1986) 4:320-334), electroporation (Riggs et al, Proc. Natl. Acad Sci. USA (1986) 83:5602-5606), Agrobacterium-mediated transformation (Townsend et al, U.S. Patent No.
- the zinc fmger protein with optional effector domain can be targeted to a specific organelle within the plant cell.
- Targeting can be achieved with providing the ZFP an appropriate targeting peptide sequence, such as a secretory signal peptide (for secretion or cell wall or membrane targeting, a plastid transit peptide, a chloroplast transit peptide, a mitochondrial target peptide, a vacuole targeting peptide, or a nuclear targeting peptide, and the like (Reiss et al, Mol Gen. Genet. (1987)
- Plastids are a class of plant organelles derived from proplastids and include chloroplasts, leucoplasts, aravloplasts, and chromoplasts.
- the plastids are major sites of biosynthesis in plants. In addition to photosynthesis in the chloroplast, plastids are also sites of lipid biosynthesis, nitrate reduction to ammonium, and starch storage.
- plastids contain their own circular genome, most of the proteins localized to the plastids are encoded by the nuclear genome and are imported into the organelle from the cytoplasm. As described in the Example Section below, a nuclear localization peptide (see
- the modified plant may be grown into plants in accordance with conventional ways (See, e.g., McCormick et ah, Plant Cell. Reports (1986) 81-84). These plants may then be grown, and either pollinated with the same transformed strain or different strains, and the resulting hybrid having the desired phenotypic characteristic identified. Two or more generations may be grown to ensure that the subject phenotypic characteristic is stably maintained and inherited and then seeds harvested to ensure the desired phenotype or other property has been achieved.
- the method of the invention is particularly appealing to the plant breeder because it has the effect of providing a dominant trait, which minimizes the level of crossbreeding necessary to develop a phenotypically desirable species which is also commercially valuable.
- modification of the plant genome by conventional methods creates heterozygotes where the modified gene is phenotypically recessive.
- Crossbreeding is required to obtain homozygous forms where the recessive characteristic is found in the phenotype. This crossbreeding is laborious and time consuming. The need for such crossbreeding is eliminated in the case of the present invention which provides an immediate phenotypic effect.
- the present method can be used to modulate the expression of said encoded target protein.
- Expression of any target protein can be modulated by the present method in plant cells.
- the protein whose expression being modulated can be endogenous or exogenous to the plant cell.
- the modulation can be activation or inhibition.
- the protein whose expression being modulated is an antibody.
- the protein whose expression being modulated participates in a metabolic pathway or controls a metabolic pathway, e.g., an anabolic or a catabolic pathway.
- the present method can be used for modulating metabolic pathways of any desirable molecules such as vitamins, taste molecules, e.g., bad taste molecules, anti-oxidants, sugars and flavanoids.
- the metabolic pathway being modulated can be endogenous or exogenous to the plant cell.
- target gene encodes a structural protein, e.g., an enzyme or a co- factor in a metabolic pathway, or a regulatory protein.
- the metabolic pathway being modulated enhances an input or output trait in a plant or seed.
- Enzyme activity means herein the ability of an enzyme to catalyze the conversion of a substrate into a product.
- a substrate for the enzyme comprises the natural substrate of the enzyme but also comprises analogues of the natural substrate, which can also be converted, by the enzyme into a product or into an analogue of a product.
- the activity of the enzyme is measured for example by determining the amount of product in the reaction after a certain period of time, or by determining the amount of substrate remaining in the reaction mixture after a certain period of time.
- the activity of the enzyme is also measured by determining the amount of an unused co-factor of the reaction remaining in the reaction mixture after a certain period of time or by determining the amount of used co-factor in the reaction mixture after a certain period of time.
- the activity of the enzyme is also measured by determining the amount of a donor of free energy or energy-rich molecule (e.g., ATP, phosphoenolpyruvate, acetyl phosphate or phosphocreatine) remaining in the reaction mixture after a certain period of time or by determining the amount of a used donor of free energy or energy-rich molecule (e.g., ADP, pyruvate, acetate or creatine) in the reaction mixture after a certain period of time.
- a donor of free energy or energy-rich molecule e.g., ATP, phosphoenolpyruvate, acetyl phosphate or phosphocreatine
- Co-factor is a natural reactant, such as an organic molecule or a metal ion, required in an enzyme-catalyzed reaction.
- a co-factor can be regenerated and reused.
- Exemplary co-factors include NAD(P), riboflavin (including FAD and FMN), folate, molybdopterin, thiamin, biotin, lipoic acid, pantothenic acid and coenzyme A, S- adenosylmethionine, pyridoxal phosphate, ubiquitinone, menaquinone.
- the present invention is directed to a genetically modified plant cell, which cell comprises an expression system for a zinc finger protein, said zinc finger protein is capable of binding, and preferably specifically binding, to a target nucleotide sequence, or a complementary strand thereof, within a target gene whose expression is to be modulated by said zinc finger protein.
- the genetically modified plant cell can comprise any desirable target nucleotide sequence and target gene.
- the target nucleotide sequence can be endogenous or exogenous to the targeted gene.
- the target gene can be endogenous or exogenous to the plant cells.
- the genetically - modified plant cell can exist in culture or can be contained in an intact plant.
- the zinc finger protein can be used to control the expression of any target genes.
- the zinc fmger protein controls its own expression by binding to a target sequence withi the zinc finger protein gene.
- the zinc finger protein controls its own expression by binding to a first target sequence within the zinc finger protein gene and controls the expression of the target gene by binding to a second target sequence within the target gene.
- the first target sequence within the zinc fmger protein gene is different from the second target sequence within the target gene.
- the expression of the zinc fmger protein gene can be further controlled by second promoter, e.g., an inducible promoter.
- the zinc fmger protein contained in the genetically modified plant cell can contain any number of zinc fmger sequence.
- the zinc finger protein comprises at least two zinc fmger sequences, e.g., from about 2 to about 6 zinc fmger sequences or from about 3 to about 6 zinc finger sequences..
- Any plant cell can be genetically modified to comprise an expression system for a zinc finger protein, so that the expression of a target gene is modulated by said zinc fmger protein.
- exemplary plants include tobacco, tomato, potato, banana, soybean, pepper, wheat, rye, rice, spinach, carrot, maize and com.
- a method to modulate expression in a plant cell comprises culturing the genetically modified plant cell(s).
- such genetically modified plant cell(s) is cultured in planta.
- a transgenic plant cell is provided, which plant cell is transformed with a nucleic acid comprising a functional geminiviral replicase gene operably linked to a fruit ripening-dependent promoter.
- a genetically modified plant cell is provided, which cell comprises a heterologous zinc finger protein that specifically binds to a target nucleotide sequence in said plant cell wherein said heterologous zinc fmger protein is constitutively or inducibly expressed.
- a genetically modified plant tissue is also provided herein, which tissue comprises the above-described genetically modified plant cell(s).
- a genetically modified plant seed e.g., a tobacco, tomato, potato, banana, soybean, pepper, wheat, rye, rice, spinach, carrot, maize and corn seed, is further- provide herein, which seed comprises the above-described genetically modified plant cell(s).
- a transgenic plant seed is further provide herein, which seed is transformed with a nucleic acid comprising a functional geminiviral replicase gene operably linked to a fruit ripening-dependent promoter.
- the genetically modified plant cell, tissue, seed and whole plant does not contain a zinc finger protein that is disclosed in U.S. Patent No. 6,140,466 or WO 98/54311, e.g., a zinc finger-nucleotide binding polypeptide variant comprising at least three zinc fmger modules that bind to a target cellular nucleotide sequence and modulate the transcriptional function of the cellular nucleotide sequence, wherein the amino acid sequence of each zinc finger module that binds a target cellular nucleotide comprises two cysteines and two histidines whereby both cysteines are amino proximal to both histidines and wherein each of three modules of said variant has at least one amino acid sequence modification.
- a zinc finger-nucleotide binding polypeptide variant comprising at least three zinc fmger modules that bind to a target cellular nucleotide sequence and modulate the transcriptional function of the cellular nucleotide sequence, wherein the amino acid sequence of
- the present invention is directed to an isolated nucleic acid fragment, comprising a sequence of nucleotides encoding ZFPml (SEQ ID NO: 1
- the isolated nucleic acid fragment can be DNA or RNA.
- An isolated nucleic acid fragment, which is hybridizable to the nucleic acid fragment encoding ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 under low, medium and high stringency condition is also provided.
- the isolated nucleic acid fragment hybridizes to the nucleic acid fragment encoding ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 under high stringency condition.
- Plasmids comprising the nucleic acid fragment encoding ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 and cells comprising such plasmids are further provided. Any suitable cells can be used and preferably, bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells are used.
- the nucleic acid fragment encoding ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 can be prepared by any methods known in the art, e.g. , recombinant production, chemical synthesis or a combination thereof (See generally, Current Protocols in Molecular Biology (1998) ⁇ 20, John Wiley & Sons, Inc; Knoire, Design and Targeted Reactions of Oligonucleotide Derivative, CRC Press, 1994; and Staut (Ed.), Nucleic Acid Chemstry: Improved and New Synthetic Procedures, Methods and Techniques, John Wiley & Sons, Inc., 1978).
- a method for producing a ZFPml , ZFPm2, ZFPm3 , ZFPm4 or ZFP Ap3 protein comprises growing the cells harboring plasmids containing the nucleic acid fragment encoding ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 under conditions whereby these zinc finger proteins are expressed by the cell; and recovering the expressed zinc fmger protein.
- ZFPAp3 typically consists of at least 25 (continuous) nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, or 200 nucleotides, or a full-length coding sequence. In another embodiment, the nucleic acids are smaller than 35, 200, or 500 nucleotides in length. Nucleic acids can be single or double stranded.
- nucleic acids that hybridize to or are complementary to the foregoing sequences are also provided.
- nucleic acids which comprise a sequence complementary to (specifically are the inverse complement of) at least 10, 25, 50, 100, or 200 nucleotides or the entire coding region of a ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 coding sequence.
- nucleic acids encoding ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 provided herein include those with nucleotide sequences encoding substantially the same amino acid sequences as found in Figures 6, and those encoding amino acid sequences with functionally equivalent amino acids.
- the present invention is directed to a zinc finger protein that is ZFPml (SEQ ID NO:38), ZFPm2 (SEQ ID NO:39), ZFPm3 (SEQ LD NO:40), ZFPm4 (SEQ ID NO:41) or ZFPAp3 (SEQ ID NO:42), preferably in combination with positive and negative regulating domains.
- ZFPml, ZFPm2, ZFPm3, and ZFPm4 zinc fingers are specific for the MIPS gene, meaning they can specifically and strongly bind to nucleotide sequence within the MIPS gene.
- ZFPAp3 is designed to bind to AP3 in Arabidopsis.
- the positive regulatory domain VP64 (Beerli et ah; Proc. Natl. Acad. Sci. USA (1998) 95:14628-14633) is fused to the C-terminal of each zinc finger domain.
- the negative regulatory domains SID (mSin3 interaction domain) (Ayer et ah, Mol. Cell. Biol. (1996) 16:5772-5781) or SKD (a modified
- Kruppel-associated box (Margolin et ah, Proc. Natl. Acad. Sci. USA (1994) 91:4509- 4513) are fused to the N-terminal of each zinc finger domain.
- the present invention is directed to a zinc fmger protein comprising a zinc finger nucleic acid binding domain and an effector domain, wherein said effector domain comprises an active domain of a restriction enzyme, an active domain of a nucleic acid modifying protein, e.g., a nucleic acid methylase, a label or a modification.
- a nucleic acid modifying protein e.g., a nucleic acid methylase, a label or a modification.
- the zinc finger proteins can be made by any methods known in the art.
- the zinc fmger proteins can be produced by chemical synthesis (see e.g., Fmoc Solid Phase Peptide Synthesis: A Practical Approach, Chan and White (Ed.), Oxford
- the zinc fmger proteins are produced by recombinant production.
- Functional fragments, analogs or derivatives of the ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 polypeptides are also provided.
- fragments, analogs or derivatives can be recognized an antibody raised against a ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 polypeptide.
- such fragments, analogs or derivatives comprise an amino acid sequence that has at least 60% identity, more preferably at least 90% identity to the ZFPml (SEQ ID NO:38), ZFPm2 (SEQ ID NO:39), ZFPm3 (SEQ LD NO:40), ZFPm4 (SEQ ID NO:41) or ZFPAp3 (SEQ ID NO:42) polypeptide (See Figure 6).
- Antibodies whether polyclonal or monoclonal antibodies, can be raised against the zinc finger proteins by any methods known in the art (see e.g., Antibody Production: Essential Techniques, Delves, Wiley, John & Sons, Inc., 1997; Basic Methods in Antibody Production and Characterization, Howard and Bethell, CRC Press, Inc., 1999; and Monoclonal Antibody Production Techniques and Applications: Hybridoma Techniques, Schook, Marcel Dekker, 1987). These antibodies can be used to assess the expression level and localization of ZFP protein in cells, e.g., plant cells.
- various host animals can be immunized by injection with the ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPA ⁇ 3 proteins, or a derivative of the foregoing, such as a cross-linked zinc finger protein.
- host animals include but are not limited to rabbits, mice, rats, and the like.
- adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, and potentially useful human adjuvants such as bacille Calmette-Guerin (BCG) and corynebacterium parvum.
- BCG Bacille Calmette-Guerin
- any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used.
- Such techniques include but are not restricted to the hybridoma technique originally developed by Kohler and Milstein (Nature 256:495-497 (1975)), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today 4:72 (1983)), and the EBV hybridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal
- monoclonal antibodies can be produced in germ-free animals (WO89/12690).
- Human antibodies may be used and can be obtained by using human hybridomas (Cote et al, Proc. Natl. Acad. Sci. USA 80:2026-2030 (1983)) or by transforming human B cells with EBV virus in vitro (Cole et al, in Monoclonal
- ZFPA ⁇ 3 protein-specific single chain antibodies An additional embodiment utilizes the techniques described for the construction of Fab expression libraries (Huse et al., Science 246:1275-1281 (1989)) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 proteins, or domains, derivatives, or analogs thereof.
- Non-human antibodies can be "humanized” by known methods (see, e.g., U.S. Patent No. 5,225,539).
- Antibody fragments that contain the idiotypes of ZFPml, ZFPm2, ZFPm3, ZFPm4 or ZFPAp3 proteins can be generated by techniques known in the art in accordance with the methods of the present invention.
- such fragments include but are not limited to: the F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragment, the Fab fragments that can be generated by treating the antibody molecular with papain and a reducing agent, and Fv fragments.
- screening for the desired antibody can be accomplished by techniques known in the art in accordance with the methods of the present invention, e.g., ELISA (enzyme-linked immunosorbent assay).
- ELISA enzyme-linked immunosorbent assay
- the present invention is directed to an isolated nucleic acid fragment, comprising a sequence of nucleotides encoding a fusion protein comprises a zinc finger domain, e.g., 2C7 and an effector domain of SID (mSin3A Interaction Domain).
- a fusion protein comprising the 2C7 and the SID domains is termed as a 2C7-SID fusion protein.
- the isolated nucleic acid fragment can be DNA or RNA.
- An isolated nucleic acid fragment, which is hybridizable to the nucleic acid fragment encoding the 2C7-SID fusion protein under low, medium and high stringency condition is also provided.
- the isolated nucleic acid fragment hybridizes to the nucleic acid fragment encoding the 2C7-SID fusion protein under high stringency condition.
- the isolated nucleic acid fragment has the nucleotide sequence set forth in SEQ ID NO:5 or SEQ ID NO:66. Plasmids comprising the nucleic acid fragment encoding the 2C7-SID fusion protein and cells comprising such plasmids are further provided. Any suitable cells can be used and preferably, bacterial cells, yeast cells, fungal cells, plant cells, insect cells and animal cells are used.
- the nucleic acid fragment encoding the 2C7-SID fusion protein can be prepared by any methods known in the art, e.g., recombinant production, chemical synthesis or a combination thereof (See generally, Current Protocols in Molecular Biology (1998) ⁇ 20, John Wiley & Sons, Inc; Knorre, Design and Targeted Reactions of Oligonucleotide Derivative, CRC Press, 1994; and Staut (Ed.), Nucleic Acid Chemstry: Improved and New Synthetic Procedures, Methods and Techniques, John
- a method for producing a 2C7- SID fusion protein comprises growing the cells harboring plasmids containing the nucleic acid fragment encoding the 2C7-SID fusion protein under conditions whereby these zinc finger proteins are expressed by the cell; and recovering the expressed 2C7-SID fusion protein.
- the isolated nucleic acids encoding the 2C7-SID fusion protein typically consists of at least 25 (continuous) nucleotides, 50 nucleotides, 100 nucleotides, 150 nucleotides, or 200 nucleotides, or a full-length coding sequence. In another embodiment, the nucleic acids are smaller than 35, 200, or 500 nucleotides in length. Nucleic acids can be single or double stranded.
- nucleic acids that hybridize to or are complementary to the foregoing sequences are also provided.
- nucleic acids which comprise a sequence complementary to (specifically are the inverse complement of) at least 10, 25, 50, 100, or 200 nucleotides or the entire coding region of the 2C7-SID fusion protein coding sequence.
- the nucleic acids encoding the 2C7-SID fusion protein provided herein include those with nucleotide sequences encoding substantially the same amino acid sequences as found in Figures 6 and 24, and those encoding amino acid sequences with functionally equivalent amino acids. Any suitable SID domains can be used. Preferably, the SID domain is derived from a SID domain of the MAD 1 protein.
- the present invention is directed to a ZFP-SID, e.g., 2C7-SID, fusion protein comprising a zinc finger of 2C7 and an effector domain of
- SID The negative regulatory domains SID (mSin3 interaction domain) (Ayer et al, Mol. Cell. Biol. (1996) 16:5772-5781) or SKD (a modified Kruppel-associated box) (Margolin et al, Proc. Natl. Acad. Sci. USA (1994) 91 :4509-4513) can be fused to the C- or N-terminal of the 2C7 zinc finger domain.
- the SID domain is fused to the N-terminal of the 2C7 zinc fmger domain.
- the 2C7-SID fusion protein comprises a nuclear localization signal.
- the 2C7-SID fusion protein can be made by any methods known in the art. It can be produced by chemical synthesis (see e.g., Fmoc Solid Phase Peptide Synthesis: A Practical Approach, Chan and White (Ed.), Oxford University Press, 2000; Peptide Synthesis Protocols, Vol. 35, Pennington and Dunn (Ed.), Humana Press, 1995; and
- the 2C7-SID fusion proteins are produced by recombinant production.
- fragments, analogs or derivatives of the 2C7-SID fusion proteins or polypeptides are also provided.
- fragments, analogs or derivatives can be recognized an antibody raised against a 2C7-SID fusion protein or polypeptide.
- fragments, analogs or derivatives comprise an amino acid sequence that has at least 60% identity, more preferably at least 90% identity to the
- 2C7-SID fusion protein encoded by the nucleotide sequence set forth in SEQ ID NO:5 or SEQ ED NO:66.
- ZFP-SID fusion protein An antibody that specifically binds to a ZFP-SID, e.g., 2C7-SID, fusion proteins is also provided.
- Antibodies, whether polyclonal or monoclonal antibodies, can be raised against the 2C7-SID fusion proteins by any methods known in the art (see e.g., Antibody Production: Essential Techniques, Delves, Wiley, John & Sons, Inc., 1997; Basic Methods in Antibody Production and Characterization, Howard and
- These antibodies can be used to assess the expression level and localization of ZFP protein in cells, e.g., plant cells.
- various host animals can be immunized by injection with the 2C7-SID fusion proteins, or a derivative of the foregoing, such as a cross-linked fusion protein.
- Such host animals include but are not limited to rabbits, mice, rats, and the like.
- adjuvants can be used to increase the immunological response, depending on the host species, and include but are not limited to Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, dinitrophenol, and potentially useful human adjuvants such as bacille Calmette- Guerin (BCG) and corynebacterium parvum.
- BCG Bacille Calmette- Guerin
- any technique that provides for the production of antibody molecules by continuous cell lines in culture may be used.
- Such techniques include but are not restricted to the hybridoma technique originally developed by Kohler and Milstein (Nature 256:495-497 (1975)), the trioma technique, the human B-cell hybridoma technique (Kozbor et al., Immunology Today 4:72 (1983)), and the EBV hybridoma technique to produce human monoclonal antibodies (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985)).
- monoclonal antibodies can be produced in germ-free animals (WO89/12690).
- Human antibodies may be used and can be obtained by using human hybridomas (Cote et al., Proc. Natl. Acad. Sci. USA 80:2026-2030 (1983)) or by transforming human B cells with EBV virus in vitro (Cole et al., in Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, Inc., pp. 77-96 (1985)).
- Techniques developed for the production of "chimeric antibodies” (Morrison et al., Proc. Natl. Acad. Sci.
- An additional embodiment utilizes the techniques described for the construction of Fab expression libraries (Huse et al., Science 246:1275-1281 (1989)) to allow rapid and easy identification of monoclonal Fab fragments with the desired specificity for 2C7-SID fusion proteins, or domains, derivatives, or analogs thereof.
- Non-human antibodies can be "humanized” by known methods (see, e.g., U.S. Patent No. 5,225,539).
- Antibody fragments that contain the idiotypes of 2C7-SID fusion proteins can be generated by techniques known in the art in accordance with the methods of the present invention.
- such fragments include but are not limited to: the
- F(ab')2 fragment which can be produced by pepsin digestion of the antibody molecule; the Fab' fragments that can be generated by reducing the disulfide bridges of the F(ab')2 fragment, the Fab fragments that can be generated by treating the antibody molecular with papain and a reducing agent, and Fv fragments.
- screening for the desired antibody can be accomplished by techniques known in the art in accordance with the methods of the present invention, e.g., ELISA (enzyme-linked immunosorbent assay).
- ELISA enzyme-linked immunosorbent assay
- the homeotic gene APETALA3 of Arabidopsis thaliana encodes a ADS box and is expressed in petals and stamens Cell 68, 683-687
- Verdaguer, B. (1996) Isolation and expression in transgenic tobacco and rice plants, of the Casseva Vein Mosaic Virus (CsVMV) promoter Plant Mol. Biol. 31, 1129-1139 Verdaguer, B. (1998) Functional organization of the Casseva Vein Mosaic Virus (CsVMV) promoter Plant Mol Biol. 37, 1055-1067
- the invention is illustrated by materials and methods for controlling genetic expression in plants, e.g., the luciferase transgene, Arabidopsis AP3 gen ⁇ j and the maize MIPS gene.
- "Providing” herein means maintaining a plant cell, either in planta or ex planta, either in a plant or in cell or tissue culture, under conditions in which expression and production of a desired zinc fmger protein is produced in the plant cell.
- the regulatory factor, or "effector protein” will at least comprise a zinc finger component which binds specifically to a nucleotide sequence contained within the target gene such that the binding of the zinc finger protein modulates expression of the target gene (See generally Kim and Pabo, Proc. Natl. Acad. Sci.
- the zinc fmger protein can be fused to an additional amino acid sequence which provides regulation,, although as stated above, in some instances, binding of the zinc finger portion alone has an effect on expression. This is especially the case when the binding target is in the TATTA box region where transcription is initiated.
- Example 1 ZFP-effector fusion protein function on luciferase reporter gene in maize cells
- ZFP Zinc Finger Protein
- the claimed method comprises providing plant cells, either in culture or in intact plants, with a functional ZFP, or an expression system for production of a suitable ZFP.
- culturing is meant maintaining a plant cell, either in planta or ex planta, either in a plant or in cell or tissue culture, under conditions in which expression and production of a desired zinc finger protein is produced in the plant cell.
- Luciferase reporter plasmids were constructed from the Cassava Vein Mosaic Virus promoter (CsVMV) (SEQ ID NO:l) (Calvert et al, J. Gen. Virol (1995) 76:1271-1278; Verdaguer et ⁇ /., Pt ⁇ t Mol. Biol. (1996) 31:1129-1139, Verdaguer et al, Plant Mol. Biol. (1998) 37:1055-1067).
- CsVMV Cassava Vein Mosaic Virus promoter
- (6X2C7) (SEQ ID NO:2) was inserted at the upstream of reporter.
- Reporter I (p5'C7F) is a deleted and thus inactive version of promoter CsVMV which contains nucleotide sequence -112 bp to +72 bp of the full length CsVMV promoter with 6X 2C7 binding site is inserted at the 5' end.
- Reporter II (pc7rbTATA) contains a minimal promoter (SEQ LD NO:3) with 6X2C7 binding site inserted at the 5 ' end.
- Reporter I contains a longer promoter sequence and is stronger than the promoter in reporter I (Fig. 1).
- Maize ubiquitin promoter ZmUbi (Cornejo et al, Plant Mol Biol (1993) 23(3):567-81) was used to express the ZFP-effector fusion proteins.
- the activation construct (pND3008) (SEQ ID NO:4) consists of several functional domains: zinc finger protein domain 2C7, nuclear localization signal, the transcriptional activation domain VP64 which is fused to the relative C-terminal of ZFP2C7 and HA epitope tag sequence (Fig. 1).
- the function of HA tag is for the detection of zinc finger protein expression through Western procedures.
- the repression construct (pND3.018) (SEQ ID NO:5) consists of repression domain SID, nuclear localization signal, ZFP2C7 domain, and HA epitope tag sequence.
- the repression domain SID is fused to the relative N-terminal of ZFP2C7 domain.
- Maize protoplasts were prepared from maize cell line HE89 (F19556) and transformed using standard procedure (Chourey and Zurawski, Theor. Appl. Genet. 59:341-344 (1981)). For each transformation reaction, lug of luciferase reporter constructs and lOug activator were co-transformed into one million purified protoplasts. The transformed protoplasts were incubated at 28°C in dark for 24 - 48 hrs. Collect cells by centrifugation at 500g for 5min. Aspirate off media. Resuspend in 80ul 1.2x Passive Lysis Buffer (Promega). Freeze at -80°C for >10min. Thaw completely at room temp. Vortex and spin at 3500RPM for 5min at 4°C. Collect supernatant. Assay 20ul extract for luciferase with the Luciferase Assay Kit
- the luciferase activity of the target reporter is normalized to the protein contents of each sample to generate the specific activity. This will correct for any variations in transformation efficiency and cell extractions.
- Plasmid pAluc contains a full-length CsVMV promoter (same as in pND3008, see SEQ ID NO:l) driving the expression of luciferase gene.
- Plasmid p5 'C7 A contains the same full-length CsVMV promoter with 6X2C7 inserted at the
- Plasmid p3'C7A is almost identical to p5'C7A except the 6X2C7 was inserted at the 3' end using Xba I site.
- Plasmid pC7 ⁇ E contains the deleted CsVMV promoter with 6X2C7 binding site replacing nucleotide sequence - 112 to -63 of CsVMV.
- Plasmid p5'C7C contains a partial deleted CsVMV (-222 to +72) with 6X2C7 inserted at the 5' end.
- Plasmid p5'C7D contains a partial deleted
- Plasmid p5'C7F and pc7rbTATA are the same in example 1 A. Plasmid prbTATA is identical to pc7rbTATA except no 6X2C7 binding site.
- the promoter activity in each construct is further decreased than the previous version as the promoter sequence gets shorter. For example, the activity of p5'C7A is higher than p5'C7C, p5'C7D is higher than p5'C7F, and their activities are all higher than the minimal promoter construct ⁇ c7rbTATA.
- TMV Tobacco mosaic virus
- Plasmid p2C7-SID consists of TMV promoter and SID-2C7 repression domain (same as in pND3018).
- Plasmid p2C7-VP64 consists of TMV promoter and 2C7- VP64 activation domain (same as in pND3008).
- Plasmid pC7-VP64 is similar to p2C7-VP64 except the 6 fmger zinc fmger protein 2C7 (in pND3008 and pND3018) is replaced by 3 fmger protein C7 (SEQ ID NO:6).
- Plasmid pC7-GFP consists TMV promoter and GFP fragment (Ref). It was used as background control. Arabidopsis ubiquitin promoter UBQ3 was also used to express the ZFP fusion proteins(constructs did not show here and the results are similar).
- TMV viral RNA was made from the effector constructs with the T7 Megascript Kit (Ambion). Collect log phase tobacco BY-2 cells in conical tubes. Wash with 0.4M mannitol. Digest cell walls by adding 20 ml Enzyme Solution (1% Cellulase Onezuka RS (Karlan Research USA #2019), 0.1% Pectolyase Y-23 (Karlan Research USA #8006), 0.4M mannitol, pH 5.8). Incubate in deep petri dish (NUNC 4031) at 22-28°C in dark with continuous or occasional swirling for 2hrs. Wash 2x with 0.4M mannitol. Collect by centrifugation at 300g for 2min.
- the luciferase activity of the target reporter is normalized to the RL activity of the control reporter by division. This will correct for any variations in transformation efficiency and cell extract concentration.
- the normalized activity of an effector is presented as the normalized activity of reporter plus effector relative to the activity of the target reporter without effector expression.
- Reporter I p5'C7F
- Reporter II pc7rbTATA
- ⁇ C7 ⁇ E ⁇ C7 ⁇ E
- the 2C7-SID effector produces almost 5-fold repression of all the reporters (Fig. 5).
- the 2C7-SKD shows no specific repression of any of the reporters.
- the e2c-SJX> repressor does not cause much repression of the reporters (Fig. 5).
- ZFP fusions to the SID repressor domain provide effective, specific repression of their target genes.
- the repression domain SKD and the e2c zinc finger protein are not functional in plant cells.
- GCT STSGELV SEQ LD NO:51
- GGA SQSSHLVR SEQ ID O:52
- GGC SDPGHLVR (SEQ ID NO:54)
- GGT STSGHLVR (SEQ LD NO:56)
- GTA SQSSSLVR (SEQ ID NO:57)
- AP3 For the AP3 gene, only one target site was identified as a possible ZFP binding site using the cunent code. This site (5 '-tac ttc ttc aac tec atc-3') was located from -112 to -95 relative to the start of translation, about 70 base pairs upstream of the start of transcription. ZFPAp3 was selected to bind the compliment of this sequence (5'-GAT GGA GTT GAA GAA GTA-3') (SEQ ID NO:7). Of course, with a complete code falls in place in combo with present leadings, any sequence can be targeted.
- ZFPml binds the compliment of this sequence from -68 to -85 (5'- TGA GAG GAG GAA GGA GGC-3') (SEQ ID NO:9) and ZFPm2 binds from -65 to -82 (5'- GAG TGA GAG GAG GAA GGA-3') (SEQ ID NO:10) of the compliment.
- ZFP binding sites Another location for ZFP binding sites was within the translated region of the gene from 294 to 317 (5'-GCC AAC TAC TAC GGC TCC CTC ACC-3') (SEQ ID NO:l 1) after the translational start site. Two ZFPs were selected to bind the compliment of this site. ZFPm3 binds from 311 to 294 (5'- GGA GCC GTA GTA GTT GGC-3') (SEQ ID NO:12) and ZFPm4 binds from 317 to 300 (5'- GGT GAG GGA GCC GTA GTA-3') (SEQ ID NO: 13). All four of these zinc finger proteins of the six-finger (hectadactyl) type were constructed. The activity of these different zinc fingers when fused to transcriptional regulatory domains should provide us with more information about the optimal binding position. This information will aid in selecting binding sites for new target genes.
- polydactyl zinc finger proteins with novel DNA specificity can be constructed by modifying the recognition helices of existing zinc finger proteins.
- a human zinc fmger protein SplC has been selected to serve as a framework in the present example. It has been demonstrated that the Sp 1 C protein can provide a good framework for zinc fmger domain modification (Beerli et ah, Proc. Natl. Acad. Sci. USA (1998) 95:14628-14633).
- New zinc fmger proteins were constructed in two steps. First, three-finger ZFPs are constructed by PCR from overlapping oligonucleotides. These three-finger ZFPs are then fused together to create a six-finger (polydactyl) zinc finger protein to bind a specific 18bp sequence. PCR construction of three-finger proteins was carried out in two sequential PCR reactions. In PCRl, the F2-b (finger 2-backward) and F2-f (fmger 2- forward) primers were used as a template for PCR extension reaction with the Fl-fl (fmger 1- first forward) and F3-bl (finger 3- first backward) primers.
- lug Fl-fl, lug F3-bl, O.lug F2-f, O.lug F2- b 8ul 2.5mM dNTP mix, lOul lOx Taq Buffer with 15mM MgC12 (Perkin Elmer), 0.5ul 5u/ul AmpliTaq Gold (Perkin Elmer).
- PCR2 lul of the PCR extension product from PCRl is used as a template for PCR with Fl-f2 (finger 1 second forward) and f3-b2
- this vector provided lPTG-inducible expression of the zinc finger fused to the Maltose Binding Protein (MBP).
- MBP Maltose Binding Protein
- the MBP fusion allows easy purification and detection of the zinc finger protein.
- the second half of zinc finger protein domain (also containing three fingers) was synthesized using PCR extension reaction.
- GAC GAG ATT GTC AGA CCG AGA gaa aga ctt gcc aca ttc tgg aca ttt gta tgg c), F3-b2 (gag gag gag gag gag ctg gcc ggc ctg gcc act agt ttt ttt ace ggt gtg agt acg ttg gtg CCG GAC GAG ATT GTC AGA CCG).
- This protein has the framework of the SplC zinc finger protein (lower case sequences) with the DNA recognition helices replaced with the appropriate sequences (upper case sequences) to generate a zinc finger with a new binding specificity (5'-
- This protein also has a SplC framework with altered recognition helices to bind (5'- GAG GAA GGA-3').
- the first set of three fmger protein (ZFPa) was fused to C- terminal to the second set of three finger protein (ZFPb) by ligating the ZFPa SpeliXmal 0.3kb fragment and ZFPb XhoI-BsrFI 0.3kb fragment into the pMal-C2 vector digested with Xhol and Spel.
- the resulting six-finger zinc finger protein should specifically bind the target 18 bp sequence 5 '-GAG TGA GAG GAG GAA GGA-3' (SEQ ID NO:65).
- the five constructs that carried the ZFP genes were named as pMAL-ml, pMAL-m2, ⁇ MAL-m3, pMAL-m4, and ⁇ MAL-Ap3.
- the coding regions are the 500 bp fragment from Sfi digestion of each pMal plasmid and are named ZFPml (SEQ ID NO: 14), ZFPm2 (SEQ ID NO:15), ZFPm3 (SEQ LD
- ZFPm4 SEQ ID NO: 17
- ZFPAp3 SEQ ID NO:18
- ZFPml Expression and Purification of ZFPAp3.
- ZFPml Expression and Purification of ZFPAp3.
- Zinc Finger Protein fusions were prepared as follows, primarily to obtain material for use in raising anti-ZFP antibodies and to assess binding affinity and specificity in vitro.
- E. coli (XLl-Blue and (K12TB1) containing the zinc fmger expression plasmid was first collected for each construct. Grow 3ml culture of bacteria overnight in SB (lOg/1 MOPS, 30g/l Bacto Peptone, 20g/l Yeast extract) + 50ug/ml Carbenicillin + 1% Glucose at 37°C.
- the supernatant is then ready for ELISA assay.
- Biolab's pMAL protein fusion purification Kit One hundred ml of E. coli (K12TB1) that carried construct pMAL-ml , pMAL-m2, pMAL-m3, pMAL-m4, and pMAL-Ap3 separately was grown at 30°C for overnight under the selection of Carbenicillin (same condition as above). Cells were collected through centrifugation and lysed through brief sonication on ice. The ZFPml -MBP fusion protein was purified from this total lysate using New England Biolab's Kit (#800). The purified samples were quantitated and loaded on SDS-PAGE to estimate the quality. All five proteins were shown as single band on SDS-PAGE gel.
- Antibody I was made against the ZFPml antigen.
- Antibody II was made against an equal mixture of the ZFPm3 and ZFPm4 antigens. Both antibodies were tittered using
- Zinc finger protein can be characterized by any methods known in the art.
- the zinc finger protein can be characterized by in vitro assay such as ELISA and in vivo assay such as gel shifting assay.
- ELISA assay can be used to characterized biding specificity of a particular zinc finger protein for a variety of target nucleotide sequences.
- Gel shifting assay can be sued to characterize binding affinity, i.e., obtaining binding constant, of a particular zinc finger protein for a particular target nucleotide sequence.
- crude extracts of the three-finger and six-finger proteins were used for ELISA assay to evaluate the newly synthesized zinc finger protein's DNA binding specificity. The assay was also repeated with the purified six-finger proteins.
- Hairpin oligonucleotides with a 5' biotin conjugate were synthesized.
- the oligo ml2 (5'-Biotin-GGa gcc tec ttc etc etc tea etc GGG TTTT CCC gag tga gag gag gaa gga ggc tCC-3') (SEQ ID NO:19) has the target sites for ZFPml and ZFPm2.
- Oligo m34 (5'-Biotin-GGa gcc aac tac tac ggc tec etc ace GGG TTTT CCC ggt gag gga gcc gta gtt ggc tCC-3') (SEQ LD NO:20) has the target sites for ZFPm3 and ZFPm4.
- the oligo A ⁇ 3 has the target site for the ZFPAp3 protein (5'-Biotin-GGt tac ttc ttc aac tec ate GGG TTTT CCC gat gga gtt gaa gaa gta aCC-3') (SEQ ID NO:21) .
- the individual three-finger ZFPs were evaluated on ELISA with the ml2, m34, and
- Ap3 target oligos In every case, the three-finger proteins bound their target oligo with significantly higher affinity than the non-target oligos.
- the eight non-target oligos are: NRI-1 (SEQ LD NO:22), NRI-2 (SEQ ID NO:23), hHD-I (SEQ ID NO:24), hHD-II (SEQ ID NO:25), c5cl-g (SEQ ID NO:26), c5p3-g (SEQ ID NO:27), B3c2 (SEQ ID NO:28), and e2c-g (SEQ ID NO:29).
- ZFPml, ZFPn ⁇ , ZFPm3, ZFPm4, and ZFPAp3 were tested more extensively by ELISA with the ml2, m34, Ap3, and the above eight non-target oligos.
- the six- finger proteins bound their targets better than any of the non-target oligos.
- ZFPml, ZFPm4 and ZFPAp3 showed even higher specificity than ZFPm2 and ZFPm3 (Fig. 7-
- Ml 2 site is a sequence that contains overlapping ml and m2 binding sites.
- m34 contains overlapping m3 and m4 sequences.
- the non-target oligoes are: Oligo m34 (SEQ ID NO:20), Oligo Ap3 (SEQ ID NO:21), NRI-1 (SEQ ID NO:22), NRI-2 (SEQ ID NO:23), hHD-I (SEQ LD NO:24), hHD-II (SEQ ID NO:25), c5cl-g (SEQ TD NO:26), c5p3-g (SEQ ID NO:27), B3c2 (SEQ JD NO:28), and e2c-g (SEQ ID NO:29).
- the non-target oligoes are Oligo ml 2 (SEQ JD NO: 19), oligo Ap3 (SEQ ID NO:
- the non-target oligoes are Oligo ml2, oligo m34 (SEQ LD NO:20), and the eight other oligoes.
- the affinity reading for target oligo was further normalized to the no oligo control which has the least affinity.
- Table 3 showed the relative affinity of each zinc finger protein to the listed 11 oligo sequences. This relative affinity represents the fold of specificity of each protein to its target (specific or non-specific). The higher number of the fold of specificity means the more specific of this protein to that particular oligo.
- the fold of specificity to its own target oligo are 18, 23, 13, 16, and 27, respectively, the highest number among all 11 oligoes tested.
- the result indicates that the six-finger protein, as well as the three-finger proteins, bound their target oligo with significantly higher affinity than the non-target oligoes in every case.
- binding affinity and specificity can be further obtained by random mutagenesis, as by PCR mutagenesis to introduce mutations in the ZFP -to improve ZFP specificity or affinity.
- the affinity of the purified six-finger proteins was measured using gel shift assay.
- the target oligos used in the ELISA assays were radioactively labeled using [ ⁇ 32P]-ddATP and terminal transferase.
- Ten serial dilutions of 1 :3 with the purified protein (starting with ⁇ lmg/ml) in binding buffer (lpM labeled oligo, 10% Glycerol, 0.8% BSA, 0. lug/ul salmon sperm DNA in Zn Buffer A) were performed.
- the ZFP was allowed to bind at room temperature for lhr.
- the samples were then run on 5- 6% non-denaturing PAGE gel in TBE. The gel was dried and exposed with Phosphoimager.
- the affinity (Kd) of the ZFP was calculated from this gel.
- the Kd value is the concentration of the protein at which half of the labeled oligo is shifted to a higher molecular weight on the gel by binding to the ZFP.
- the 2C7 derivative of the Spl zinc fmger has a specificity of 0.46 nM and the e2c zinc fmger constructed earlier (Beerli et ah, Proc. Natl. Acad. Sci. USA (1998) 95:14628-14633) has an affinity of 0.5 nM.
- ZFPml, ZFPm2, ZFPm3, and ZFPm4 were cloned into plasmid reporter I system. Two steps are involved: First step is to modify the reporter construct by replacing 2C7 binding site with MIPS gene specific binding site ml2 and m34. The second step is to modify the activators (activation constructs) by replacing the 2C7 fragment with each of these four new zinc finger proteins.
- the ZFPml -VP64 activation construct is co-transformed with ml2-luciferase reporter construct. The luciferase reading from this activation transformation is compared to the BG luciferase activity (no activator).
- the ZFPm2, ZFPm3, and ZFPm4 are evaluated using the similar steps.
- the ZFPAp3 domain was fused to the N terminal of the VP64 activation domain and then cloned into plant expression vector under the control of the UBQ3 promoter (Fig. 18).
- RNA with Qiagen Plant RNeasy kit Extract RNA with Qiagen Plant RNeasy kit.
- the amount of activator expression can also be determined.
- AP3-specific effector expression can be detected by RTPCR as described above using a generic zinc finger forward primer, NZlib5' (GGCCCAGGCGGCCCTCGAGC) (SEQ ID NO:31) and an Ap3-specific reverse primer Ap3f4-R, (CTAACCAAGGAGCCACTGGTG) (SEQ LD NO:32).
- the m4-specific effector expression can be detected using NZlib5' and a m4-specific reverse primer, m4f3-R (CCTCGCAAGATCACGACAATC) (SEQ ID NO:33).
- ZFP Ap3 -activator fusion protein Effects of expressing ZFP Ap3 -activator fusion protein on the transcriptional level of endogenous gene AP3
- the AP3 gene is expressed exclusively in the developing flower, so no expression was expected in the leaf-derived protoplasts.
- Three constructs, AP3 activation ( ⁇ ND3014), m4 activation (pND3013) and GFP control (pNDOOOl) were transformed into Arabidopsis leaf cells (protoplasts) respectively.
- the ZFPm4- specific constructs was used as a control in this experiment to show that the gene specific transcription factors generated with this technology affect only their target gene since the ZFPm4-specific activator (ZFPm4-VP64) should have no effect on the endogenous AP3 gene.
- the result show that only in the cells that are transformed with AP3 activation constructs there are AP3 transcripts detected (Fig. 19).
- the ZFP domain is able to direct the activation domain (VP64) to the specific endogenous
- Example 8 Stable repression and stable activation of AP3 gene expression in transgenic
- UBQ3::SID-ZFPAp3//nos with hygromycin as selection marker was created and named as pND0051.
- expression cassette of UBQ3::ZFPAp3-VP64//nos was cloned into this Agrobacteria transformation vector as well and named as pND0052 (Fig.18).
- pND0052 Fig.18.
- RNA samples were prepared from average of two flower heads using RNAwiz method (Example 7, Section B).
- TaqMan PCR reaction was done using 250ng total RNA and TaqMan One-step RT-PCR Master mix reagent.
- ND0052-2e ND0052-257
- ND0051-la ND0052-2e
- Plant ND0052-2e contains very high expression level of ZFPAp3-SID transgene (Fig. 20A).
- the transcriptional level of endogenous AP3 gene has been significantly down regulated (Fig. 20B).
- Quantitative analysis shows a nearly 50 fold of repression was achieved in this plant (Fig. 21).
- the phenotype of this flower is similar to the flowers from previously characterized mutant ap3 (Jack et al, Cell (1992) 68:683-687, Jack et al, Cell (1994) 76:703-716) and sap (Byzova et al, Gene and Development (1999) 13:1002-1014) but is definitely not identical.
- This plant is sterile. Comparing with the mo ⁇ hology of this flower with the wild type flower, it appears that the unproportional development of stamen and stigma is the cause of sterility. More detailed analysis can be carried out in this area.
- the second event is named as ND0052-257. This is a sterile plant too. The flower is very similar to flower from ND0052-2e. However, there seems missing one petal in the two flowers that we have dissected.
- the third event is named as ND0051-2d. Same as the previous two, it is a sterile plant. There is no silique formation in this plant. The plant died during flowering stage. Wild type flowers have four organ types (sepal, petal, stamen, ca ⁇ el) arranged in concentric whorls.
- the AP3 gene is involved in the determination of organ identity. Misexpression of the AP3 gene results in homeotic mutations where whorl- specific organ identity will be altered.
- UBQ3 is a constitutive promoter and the expression pattern and strength is very different from the native AP3 promoter.
- AP3 gene is one of the many genes that are involved in floral organ determination (Weigel, Annu. Rev. Genetics (1995) 29:19-39; and Pineiro and Coupland, Plant Physiol (1998) 117:108). It is very likely that there are other genes, especially the down stream genes, that play a role in this very complex process as well.
- Arabidopsis AP3 promoter region (1.9kb) was isolated by PCR according to Irish and Yamamoto (Plant Cell 7 (10), 1635-1644 (1995)). This fragment was used to replace the UBQ3 fragment in the pND0052 construct. The final construct was named as pND3045 (AraAP3 promoter: :ZFPAp3-VP64//nos). pND3045 was transformed into Arabidopsis as described in previous section. About 400 plants were generated through selection media. There are several plants that have shown sterile phenotype already. Molecular analysis on these events can be performed as previously described.
- the Ap3-VP64 6-finger construct appears to work effectively and specifically to activate and repress AP3 expression in Arabidopsis protoplasts or even the whole plant. This is a good system to test the activity of zinc finger protein with less than 6 fingers, such as 3-finger effector constructs.
- the 6-finger ZFPAp3 protein was constructed from two 3-finger proteins (See Example 3).
- ZPFAp3a is a 3-finger protein with fingers 4-6 of ZFPAp3.
- ZFPAp3b has fingers 1 to 3 of ZFPAp3.
- the Ap3-VP64 expression plasmid is digested with Sfil to remove the 6-finger Ap3 coding region.
- the 300bp Sfil fragment of the AP3 3-finger proteins is ligated in this digested vector to generate Ap3a-VP64 and Ap3b-VP64 constructs.
- the activation of AP3 expression in protoplasts is tested with these constructs using the method described in Example 7 and 8.
- 3-finger protein is less specific than the 6-finger protein. But, this may not be the case for all the targets (genes). If some of these 3-finger effectors are able to specifically and effectively activate AP3 expression, this will indicate that 6 finger proteins are not required for all targets. This will also demonstrate the versatility of this technology with respect to the number of zinc fingers required.
- MIPS is an endogenous maize enzyme. Its gene expression level can be monitored at three levels after transforming the maize cells with ZFPmips-activator or ZFPmips-repressor. The first level is on the transcriptional level. Quantitative PCR can be used to analyze the abundant of MIPS transcripts. The second level is on the protein expression level. We have generated MIPS specific antibody and can analyze the amount of MIPS protein expressed on Western blot. The third level is on the function level of MIPS enzyme. The activity of MIPS enzyme can be monitored by the concentration of its product, phytic acid through HPLC (Talamond et ah, J. of
- ZFPmips ZFPmips-effector cassette
- a maize type II cell line HE89 was used to evaluate the ZFPmips-effector fusion constructs function (Fig.22).
- Protoplasts from HE89 suspension cells were isolated and transformed using standard procedures (Chourey and Zurawski, 1981).
- the activation constructs pND3015, pND3023, pND3024, and pND3016 were transformed into freshly prepared protoplasts.
- the transcription level of MIPS gene was detected through quantitative PCR.
- pND3016 ZFPm4-VP64 activation constructs
- at least 2-fold of activation is detected (Fig. 23).
- We found that the phytic acid concentration is increased from 304 pg/ml to 569 pg/ml (detection was carried out with HPLC).
- zinc finger protein approach can be used in both up-regulation (as example of AP3 in Arabidopsis, MIPS in maize) and down- regulation (as example of AP3 in Arabidopsis) of endogenous gene expression in plant.
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Botany (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
Abstract
Description
Claims
Applications Claiming Priority (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US620897 | 1990-12-03 | ||
| US17746800P | 2000-01-21 | 2000-01-21 | |
| US177468P | 2000-01-21 | ||
| US62089700A | 2000-07-21 | 2000-07-21 | |
| PCT/US2001/001817 WO2001052620A2 (en) | 2000-01-21 | 2001-01-19 | Methods and compositions to modulate expression in plants |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1276869A2 true EP1276869A2 (en) | 2003-01-22 |
Family
ID=26873328
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01942508A Withdrawn EP1276869A2 (en) | 2000-01-21 | 2001-01-19 | Methods and compositions to modulate expression in plants |
Country Status (5)
| Country | Link |
|---|---|
| EP (1) | EP1276869A2 (en) |
| AR (1) | AR048989A1 (en) |
| AU (1) | AU2964101A (en) |
| CA (1) | CA2396898A1 (en) |
| WO (1) | WO2001052620A2 (en) |
Families Citing this family (95)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7285416B2 (en) | 2000-01-24 | 2007-10-23 | Gendaq Limited | Regulated gene expression in plants |
| US7262055B2 (en) | 1998-08-25 | 2007-08-28 | Gendaq Limited | Regulated gene expression in plants |
| US7329728B1 (en) | 1999-10-25 | 2008-02-12 | The Scripps Research Institute | Ligand activated transcriptional regulator proteins |
| ATE353361T1 (en) * | 2000-04-28 | 2007-02-15 | Sangamo Biosciences Inc | TARGETED MODIFICATION OF THE CHROMATE STRUCTURE |
| CA2516042A1 (en) | 2003-02-17 | 2004-09-02 | Metanomics Gmbh | Preparation of transgenic plants comprising a nucleic acid molecule encoding an l450 polypeptide-exhibiting faster growth and/or increased yield |
| WO2005014828A2 (en) | 2003-08-01 | 2005-02-17 | Basf Plant Science Gmbh | Process for the production of fine chemicals in plants |
| EP1641930B1 (en) | 2003-04-15 | 2011-06-29 | BASF Plant Science GmbH | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
| EP1765857A2 (en) | 2004-07-02 | 2007-03-28 | Metanomics GmbH | Process for the production of fine chemicals |
| AU2005268943B2 (en) | 2004-07-31 | 2011-04-14 | Metanomics Gmbh | Preparation of organisms with faster growth and/or higher yield |
| CN103289961A (en) | 2004-09-24 | 2013-09-11 | 巴斯福植物科学有限公司 | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
| AU2005286427B2 (en) | 2004-09-24 | 2011-09-15 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance to environmental stress |
| CA2585798A1 (en) | 2004-12-17 | 2006-06-17 | Metanomics Gmbh | Process for the control of production of fine chemicals |
| EP2573188A2 (en) | 2005-03-02 | 2013-03-27 | Metanomics GmbH | Process for the production of fine chemicals |
| WO2006092449A2 (en) | 2005-03-02 | 2006-09-08 | Metanomics Gmbh | Process for the production of fine chemicals |
| WO2007020198A2 (en) | 2005-08-12 | 2007-02-22 | Basf Plant Science Gmbh | Nucleic acid sequences encoding proteins associated with abiotic stress response and plant cells and plants with increased tolerance to environmental stress |
| WO2007058833A2 (en) | 2005-11-10 | 2007-05-24 | Pioneer Hi-Bred International, Inc. | Dof (dna binding with one finger) sequences and methods of use |
| GB0526449D0 (en) | 2005-12-23 | 2006-02-08 | Medical Res Council | Polypeptide targeting |
| MX2008012252A (en) | 2006-03-24 | 2009-01-14 | Basf Plant Science Gmbh | Proteins associated with abiotic stress response and homologs. |
| CA2644273A1 (en) | 2006-04-05 | 2008-03-27 | Metanomics Gmbh | Process for the production of a fine chemical |
| BRPI0710455A2 (en) | 2006-04-19 | 2011-08-16 | Pioneer Hi Bred Int | isolated polypeptide, isolated polynucleotide and methods for increasing the level of a polypeptide in a plant, modulating the level of a polypeptide in a plant and modifying plant growth |
| WO2007137114A2 (en) | 2006-05-17 | 2007-11-29 | Pioneer Hi-Bred International, Inc. | Artificial plant minichromosomes |
| MX2008015090A (en) | 2006-05-31 | 2008-12-15 | Metanomics Gmbh | Manipulation of the nitrogen metabolism using ammonium transporter or glucose 6-phosphate deshydrogenases or farnesyl phosphate synthetase (fpp). |
| DK2069389T3 (en) | 2006-08-04 | 2015-01-12 | Bp Corp North America Inc | Glucanases, nucleic acids encoding them, and processes for their preparation and use |
| HUE029140T2 (en) | 2006-09-21 | 2017-02-28 | Basf Enzymes Llc | Phytases, nucleic acids encoding them, and processes for their preparation and use |
| US8344205B2 (en) | 2006-10-13 | 2013-01-01 | Basf Plant Science Gmbh | Plants with increased yield |
| US20100124583A1 (en) | 2008-04-30 | 2010-05-20 | Xyleco, Inc. | Processing biomass |
| ES2586210T3 (en) | 2006-12-14 | 2016-10-13 | Sangamo Biosciences, Inc. | Optimized non-canon zinc finger proteins |
| BRPI0719449A2 (en) | 2006-12-21 | 2017-06-20 | Syngenta Participations Ag | isolated, synthetic or recombinant nucleic acid molecule, isolated polypeptide, plant or part of plant, cloning vehicle comprising a nucleic acid, expression cassette comprising a nucleic acid molecule and method for hydrolyzing a polysaccharide, oligosaccharide or starch |
| CA2675926A1 (en) | 2007-02-16 | 2008-08-21 | Basf Plant Science Gmbh | Nucleic acid sequences for regulation of embryo-specific expression in monocotyledonous plants |
| US7642436B2 (en) | 2007-04-13 | 2010-01-05 | Ball Horticultural Company | Petunia mutant allele |
| AR067318A1 (en) | 2007-05-22 | 2009-10-07 | Basf Plant Science Gmbh | PLANTS WITH HIGHER TOLERANCE AND / OR INCREASED RESISTANCE TO ENVIRONMENTAL STRESS AND HIGHER BIOMASS PRODUCTION |
| US20100162432A1 (en) | 2007-05-22 | 2010-06-24 | Basf Plant Science Gmbh | Plant cells and plants with increased tolerance and/or resistance to environmental stress and increased biomass production-ko |
| CN101679493A (en) | 2007-05-25 | 2010-03-24 | 克罗普迪塞恩股份有限公司 | In plant, strengthen by the output of regulating corn ALFIN |
| EP2164863A4 (en) | 2007-06-15 | 2010-07-28 | Univ Arkansas | METHODS OF DISPENSING MOLECULE TO CELLS USING RICIN SUBUNIT AND ASSOCIATED COMPOSITIONS |
| AU2008300579B2 (en) | 2007-09-18 | 2014-11-13 | Basf Plant Science Gmbh | Plants with increased yield |
| EP2594646A3 (en) | 2007-09-21 | 2013-11-06 | BASF Plant Science GmbH | Plant with increased yield |
| BRPI0820653B1 (en) | 2007-12-03 | 2023-05-16 | Syngenta Participations Ag | THERMAL TOLERANT AND ENZYMATICALLY RESPECTFUL PHYTASE ISOLATED, POLYNUCLEOTIDE, EXPRESSION CASSETTE, VECTOR, MICROBIAL HOST CELL, METHOD FOR PREPARING SAID PHYTASE, PREPARATION AND ANIMAL FEED |
| AU2008337398B2 (en) | 2007-12-19 | 2014-04-03 | Basf Plant Science Gmbh | Plants with increased yield and/or increased tolerance to environmental stress (IY-BM) |
| US20100293665A1 (en) | 2007-12-21 | 2010-11-18 | Basf Plant Science Gmbh | Plants With Increased Yield (KO NUE) |
| US20110010800A1 (en) | 2008-02-27 | 2011-01-13 | Basf Plant Science Gmbh | Plants with increased yield |
| BR122018010009B1 (en) | 2008-04-30 | 2021-05-04 | Xyleco, Inc | METHODS OF PREPARING A MATERIAL |
| US8829282B2 (en) | 2008-05-14 | 2014-09-09 | Monsanto Technology, Llc | Plants and seeds of spring canola variety SCV425044 |
| US7964774B2 (en) | 2008-05-14 | 2011-06-21 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV384196 |
| US7935870B2 (en) | 2008-05-14 | 2011-05-03 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV354718 |
| US7947877B2 (en) | 2008-05-14 | 2011-05-24 | Monosanto Technology LLC | Plants and seeds of spring canola variety SCV328921 |
| EP2352822A2 (en) | 2008-08-19 | 2011-08-10 | BASF Plant Science GmbH | Plants with increased yield by increasing or generating one or more activities in a plant or a part thereof |
| BRPI0919153A2 (en) | 2008-09-23 | 2019-05-07 | Basf Plant Science Gmbh | method for producing a high yielding plant, nucleic acid molecule, nucleic acid construct, vector, process for producing a polypeptide, polypeptide, antibody, plant cell nucleus, plant cell, plant tissue, propagating material, pollen , progeny, material collected, or a plant, or part of a plant, a transgenic plant, process for identifying a compound, method for producing an agricultural composition, composition, use of nucleic acid, and method for identifying a plant with an increased yield, and to increase the yield of a plant population |
| MX2011004270A (en) | 2008-10-23 | 2011-07-13 | Basf Plant Science Gmbh | PLANTS WITH INCREASED PERFORMANCE (NUE). |
| CN104745624A (en) | 2008-10-23 | 2015-07-01 | 巴斯夫植物科学有限公司 | A method for producing a transgenic cell with increased gamma-aminobutyric acid (gaba) content |
| WO2010083328A2 (en) | 2009-01-14 | 2010-07-22 | The Salk Institute For Biological Studies | Methods for screening and compounds that protect against amyloid diseases |
| EP2419514A4 (en) | 2009-04-17 | 2012-10-24 | Basf Plant Science Co Gmbh | Plant promoter operable in endosperm and uses thereof |
| US8779239B2 (en) | 2009-05-04 | 2014-07-15 | Pioneeri Hi-Bred International, Inc. | Yield enhancement in plants by modulation of AP2 transcription factor |
| CN106011159A (en) | 2009-05-21 | 2016-10-12 | 巴斯夫酶有限责任公司 | Phytases, nucleic acids encoding them and methods for making and using them |
| US8071848B2 (en) | 2009-06-17 | 2011-12-06 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV218328 |
| US8440891B2 (en) | 2009-09-22 | 2013-05-14 | Board of Trustees of the University of Akransas, N.A. | Rice cultivar CL 142-AR |
| US8440892B2 (en) | 2009-10-15 | 2013-05-14 | Board Of Trustees Of The University Of Arkansas, N.A. | Rice cultivar CL 181-AR |
| WO2011082318A2 (en) | 2009-12-30 | 2011-07-07 | Pioneer Hi-Bred International, Inc. | Methods and compositions for the introduction and regulated expression of genes in plants |
| US8704041B2 (en) | 2009-12-30 | 2014-04-22 | Pioneer Hi Bred International Inc | Methods and compositions for targeted polynucleotide modification |
| US8143488B2 (en) | 2010-02-26 | 2012-03-27 | Monsanto Technoloy LLC | Plants and seeds of spring canola variety SCV470336 |
| US8148611B2 (en) | 2010-02-26 | 2012-04-03 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV453784 |
| US8138394B2 (en) | 2010-02-26 | 2012-03-20 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV431158 |
| US8581048B2 (en) | 2010-03-09 | 2013-11-12 | Monsanto Technology, Llc | Plants and seeds of spring canola variety SCV119103 |
| US8153865B2 (en) | 2010-03-11 | 2012-04-10 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV152154 |
| MX2012012672A (en) | 2010-05-06 | 2012-12-17 | Du Pont | Maize acc synthase 3 gene and protein and uses thereof. |
| BR112013008347A2 (en) | 2010-10-06 | 2016-06-14 | Bp Corp North America Inc | cbh variant polypeptides i |
| US8513487B2 (en) | 2011-04-07 | 2013-08-20 | Zenon LISIECZKO | Plants and seeds of spring canola variety ND-662c |
| US8513494B2 (en) | 2011-04-08 | 2013-08-20 | Chunren Wu | Plants and seeds of spring canola variety SCV695971 |
| US8507761B2 (en) | 2011-05-05 | 2013-08-13 | Teresa Huskowska | Plants and seeds of spring canola variety SCV372145 |
| US8513495B2 (en) | 2011-05-10 | 2013-08-20 | Dale Burns | Plants and seeds of spring canola variety SCV291489 |
| US8785729B2 (en) | 2011-08-09 | 2014-07-22 | Nunhems, B.V. | Lettuce variety redglace |
| US8754293B2 (en) | 2011-09-09 | 2014-06-17 | Nunhems B.V. | Lettuce variety intred |
| MA36970A1 (en) * | 2011-10-11 | 2016-03-31 | Aliophtha Ag | Regulating the expression of a receptor via the administration of artificial transcription factors |
| WO2013096810A1 (en) | 2011-12-21 | 2013-06-27 | The Curators Of The University Of Missouri | Soybean variety s05-11482 |
| WO2013096818A1 (en) | 2011-12-21 | 2013-06-27 | The Curators Of The University Of Missouri | Soybean variety s05-11268 |
| US9644213B2 (en) | 2012-03-09 | 2017-05-09 | Board Of Trustees Of Michigan State University | Method of enhancing plant drought tolerance by expression of NDR1 |
| US8835720B2 (en) | 2012-04-26 | 2014-09-16 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV967592 |
| US8859857B2 (en) | 2012-04-26 | 2014-10-14 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV259778 |
| US8802935B2 (en) | 2012-04-26 | 2014-08-12 | Monsanto Technology Llc | Plants and seeds of spring canola variety SCV942568 |
| US8878009B2 (en) | 2012-04-26 | 2014-11-04 | Monsanto Technology, LLP | Plants and seeds of spring canola variety SCV318181 |
| EP3166965B1 (en) | 2014-07-10 | 2020-09-09 | Benson Hill, Inc. | Compositions and methods for increasing plant growth and yield |
| WO2017070458A2 (en) | 2015-10-23 | 2017-04-27 | Donald Danforth Plant Science Center | Genes encoding c4 transporter proteins for use in increasing crop plant yield |
| ES2881392T3 (en) | 2015-10-30 | 2021-11-29 | Pioneer Hi Bred Int | Methods and compositions for rapid plant transformation |
| WO2017078836A1 (en) | 2015-11-06 | 2017-05-11 | Pioneer Hi-Bred International, Inc. | Methods and compositions of improved plant transformation |
| ES3036459T3 (en) | 2018-03-12 | 2025-09-19 | Pioneer Hi Bred Int | Methods for plant transformation |
| BR112020026640A2 (en) | 2018-06-28 | 2021-04-06 | Pioneer Hi-Bred International, Inc. | METHODS FOR SELECTING TRANSFORMED PLANTS |
| CN108949786B (en) * | 2018-06-29 | 2021-07-23 | 山东农业大学 | Application of Arabidopsis thaliana E3 ubiquitin ligase encoding gene ATL27 in regulating plant salt tolerance |
| AU2019369415A1 (en) | 2018-10-31 | 2021-03-25 | Pioneer Hi-Bred International, Inc. | Compositions and methods for Ochrobactrum-mediated plant transformation |
| CN109912704B (en) * | 2019-03-22 | 2022-03-18 | 济南大学 | Maize Zinc Finger Binding Protein Interacting Factor Gene Actin and Its Recombinant Expression Vector and Application |
| CN111205356B (en) * | 2020-01-15 | 2023-03-21 | 湖北大学 | Gene for regulating and controlling plant florescence and encoding protein and application thereof |
| US20240262874A1 (en) * | 2021-05-28 | 2024-08-08 | The Coca-Cola Company | Novel brazzein production system and methods |
| CN114561387B (en) * | 2022-02-28 | 2023-08-15 | 北京大学现代农业研究院 | Peanut promoter and application thereof |
| WO2024064743A2 (en) * | 2022-09-21 | 2024-03-28 | University Of Florida Research Foundation, Incorporated | Nuclease-free genome editing using zinc finger dna binding domains |
| CN118086326B (en) * | 2024-02-27 | 2024-09-20 | 西北农林科技大学 | Application of wheat zinc finger protein TaC3H112-6B gene in regulating plant flowering and resisting drought and salt stress |
| CN118389586A (en) * | 2024-06-27 | 2024-07-26 | 中国农业大学 | Application of MYBR81 protein and its gene in regulating plant seed yield |
| EP4725303A1 (en) | 2024-10-11 | 2026-04-15 | Agrokray Limited Liability Company | Spelt, method of producing spelt plants, grain produced from spelt plant and food product produced therefrom |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6140466A (en) * | 1994-01-18 | 2000-10-31 | The Scripps Research Institute | Zinc finger protein derivatives and methods therefor |
| US6534261B1 (en) * | 1999-01-12 | 2003-03-18 | Sangamo Biosciences, Inc. | Regulation of endogenous gene expression in cells using zinc finger proteins |
| AU778150B2 (en) * | 1999-05-28 | 2004-11-18 | Gendaq Limited | Molecular switches |
-
2001
- 2001-01-19 AU AU29641/01A patent/AU2964101A/en not_active Abandoned
- 2001-01-19 EP EP01942508A patent/EP1276869A2/en not_active Withdrawn
- 2001-01-19 CA CA002396898A patent/CA2396898A1/en not_active Abandoned
- 2001-01-19 WO PCT/US2001/001817 patent/WO2001052620A2/en not_active Ceased
- 2001-01-22 AR ARP010100266A patent/AR048989A1/en active IP Right Grant
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0152620A3 * |
Also Published As
| Publication number | Publication date |
|---|---|
| AR048989A1 (en) | 2006-06-21 |
| WO2001052620A2 (en) | 2001-07-26 |
| CA2396898A1 (en) | 2001-07-26 |
| AU2964101A (en) | 2001-07-31 |
| WO2001052620A3 (en) | 2002-02-07 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7378510B2 (en) | Synthetic zinc finger protein encoding sequences and methods of producing the same | |
| WO2001052620A2 (en) | Methods and compositions to modulate expression in plants | |
| EP2722392B1 (en) | Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis | |
| AU2003303589B2 (en) | Cell proliferation-related polypeptides and uses therefor | |
| WO2002008286A2 (en) | Zinc finger domain recognition code and uses thereof | |
| US20090265813A1 (en) | Stress tolerance in plants | |
| JP6208692B2 (en) | Plant transactivation interaction motifs and uses thereof | |
| WO2005122751A1 (en) | Nucleic acid molecules and their use in plant male sterility | |
| AU762816B2 (en) | Cyclin-dependent kinase inhibitors as plant growth regulators | |
| AU2006203634B2 (en) | Methods and compositions to modulate expression in plants | |
| US7553667B2 (en) | Regulation of gene expression using chromatin remodelling factors | |
| US7582807B2 (en) | Regulation of gene expression using chromatin remodelling factors | |
| CA2329684C (en) | Cyclin-dependent kinase inhibitors as plant growth regulators | |
| US20040091990A1 (en) | Compositions and methods for regulation of plant gamma-tocopherol methyltransferase | |
| Zhai et al. | Transcriptional Mechanism of Jasmonate Receptor COI1-Mediated Delay of Flowering Time in ArabidopsisOPEN | |
| AU2017200511A1 (en) | Engineered zinc finger proteins targeting plant genes involved in fatty acid biosynthesis | |
| AU2006200381A1 (en) | Regulation of Gene Expression Using Chromatin Remodelling Factors |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20020820 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Free format text: AL PAYMENT 20020820;LT PAYMENT 20020820;LV PAYMENT 20020820;MK PAYMENT 20020820;RO PAYMENT 20020820;SI PAYMENT 20020820 |
|
| RAP1 | Party data changed (applicant data changed or rights of an application transferred) |
Owner name: SYNGENTA PARTICIPATIONS AG Owner name: THE SCRIPPS RESEARCH INSTITUTE |
|
| 17Q | First examination report despatched |
Effective date: 20060728 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20110510 |