EP1274860A1 - Use of genetic markers to diagnose familial dysautonomia - Google Patents

Use of genetic markers to diagnose familial dysautonomia

Info

Publication number
EP1274860A1
EP1274860A1 EP00916382A EP00916382A EP1274860A1 EP 1274860 A1 EP1274860 A1 EP 1274860A1 EP 00916382 A EP00916382 A EP 00916382A EP 00916382 A EP00916382 A EP 00916382A EP 1274860 A1 EP1274860 A1 EP 1274860A1
Authority
EP
European Patent Office
Prior art keywords
familial dysautonomia
nucleic acid
gene
markers
43b1gagt
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
EP00916382A
Other languages
German (de)
French (fr)
Other versions
EP1274860A4 (en
Inventor
Anat Blumenfeld
James F. Gusella
Susan Slaugenhaupt
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
General Hospital Corp
Original Assignee
General Hospital Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by General Hospital Corp filed Critical General Hospital Corp
Publication of EP1274860A1 publication Critical patent/EP1274860A1/en
Publication of EP1274860A4 publication Critical patent/EP1274860A4/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • This invention relates to genetic testing, and more specifically, to a method of diagnosing familial dysautonomia in an individual. BACKGROUND OF THE INVENTION

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

Familial Dysautonomia (FD), is an autosomal recessive disorder characterized by developmental arrest in the sensory and autonomic nervous systems and Ashkenazi Jewish ancestry. The familial dysautonomia disease gene (DYS) has previously been mapped to an 11cM segment of chromosome 9q31-33 flanked by D9s53 and D9S105. Using new polymorphic loci, the location of the gene is narrowed to less than 0.5 cM between the markers 43B1GAGT and 157A3. Two markers in this interval, 164D1 and D9S1677, show no recombination with the disease. Haplotype analysis confirmed this candidate region. The identification of these close flanking markers of the familial dysautonomia disease gene allows accurate genetic testing for both familial dysautonomia families and carriers.

Description

USE OF GENETIC MARKERS TO DIAGNOSE FAMILIAL DYSAUTONOMIA
FIELD OF THE INVENTION
This invention relates to genetic testing, and more specifically, to a method of diagnosing familial dysautonomia in an individual. BACKGROUND OF THE INVENTION
Familial dysautonomia (FD), or the Riley-Day syndrome, or hereditary sensory neuropathy type III, is a rare inherited neurological disease affecting the development and survival of sensory, sympathetic and some parasympathetic neurons (Axelrod et al., 1974; Axelrod, F.B. 1984; and Axelrod and Pearson 1984). It is the most common and the best known of a group of rare disorders, termed congenital sensory neuropathies, that are characterized by widespread sensory, and variable autonomic dysfunction. Patients with familial dysautonomia are affected from birth with a variety of symptoms including gastrointestinal dysfunction, vomiting crisis, recurrent pneumonias, altered sensitivity to pain and temperature, and cardiovascular instability (Axelrod et al. 1974; Axelrod 1996; Riley et al. 1949). There is progressive neuronal degeneration throughout life and despite recent advances in the management of FD, survival statistics indicate that the probability of reaching 30 years of age is only 50% (Axelrod and Abularrage 1982).
The disorder is inherited as an autosomal recessive with complete penetrance and is largely confined to individuals of Ashkenazi Jewish descent (Brunt, P.W., et al, 1970). In this population, the estimated carrier frequency is 1 in 30 with a disease incidence of 1 in 3600 births (Maayan, C, et al., 1987). The clear-cut pattern of transmission, apparent restriction to one etihnic population and lack of confounding phenocopies suggest that all cases of familial dysautonomia might have descended from a single mutation (Axelrod, F.B. 1984).
The diagnosis of FD is based on the following cardinal criteria: absense of fungiform papillae on the tongue, absence of axon flare after injection of intradermal histamine, decreased or absent deep tendon reflexes, absence of overflow emotional tears, and, because of its high prevelance, Ashkenazi Jewish descent (Axelrod 1984; Axelrod and Pearson 1984; Brunt and McKusick 1970). For many years, familial dysautonomia related research concentrated on biochemical, physiological and histological-pathological aspects of the disorder. Although those studies contributed to a better understanding of the nature of the disease, and indicated that a deficiency in a neuronal growth factor pathway might be the cause of familial dysautonomia, they did not result in identification of the familial dysautonomia gene and thus did not contribute to the development of genetic diagnostic test for familial dysautonomia.
Chromosomal localization of the gene causing familial dysautonomia can facilitate genetic counseling and prenatal diagnosis in affected families. Subsequent delineation of closely linked markers which show strong linkage disequilibrium with the disorder and ultimately, identification of the defective gene can allow screening of the entire at-risk population to identify carriers, and potentially reduce the incidence of new cases.
SUMMARY OF THE INVENTION
The present invention relates to a method of diagnosing familial dysautonomia in an individual. More specifically, the invention relates to a method of identifying the inheritance of an allele causing familial dysautonomia by linkage analysis using polymorphic markers of the familial dysautonomia disease gene. The familial dysautonomia disease gene is located between 43B1GAGT and 157A3 on the long arm of human chromosome 9 (q arm). Other markers encompassed by this region include 164D1 and D9S1677. The method provides accurate genetic testing for both familial dysautonomia families and disease carriers.
The invention also relates to nucleic acids and diagnostic kits useful for carrying out genetic testing of familial dysautonomia. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1 : Familial dysautonomia pedigrees showing the recombination events (A, centromeric cross; B, telomeric cross) that define the candidate interval.
The shaded bars represent the FD chromosome, unfilled bars are non-FD. The line shows the location of the recombination event.
Figure 2: Extended haplotype analysis of 435 FD chromosomes with 9 markers. The major haplotype is framed at the top. The other haplotypes, believed to be derived from ancestral recombination events, are depicted with the identical FD core markers framed.
DETAILED DESCRIPTION OF THE INVENTION
The present invention relates to genetic mapping of the familial dysautonomia disease gene. The familial dysautonomia disease gene (DYS) has previously been mapped to an 11 centiMorgan (cM) segment of chromosome 9q31-33 flanked by D9S53 waAD9S105 (Blumenfeld et al, U.S. Patents 5,387,506 and 5,998,133, hereby incorporated in their entirety by reference). One centiMorgan is roughly equivalent to 1,000 kb of DNA. The familial dysautonomia gene is located according to the invention in a gene segment comprising the following sequential polymorphisms: D9S172-D9S261-88B2GA-43B1GAGT-164D1-D9S1677-157A3-
D9S310-D9S309-D9S58-D9S160-D9S311-D9S105. The location of the familial dysautonomia gene is narrowed to less than 0.5 cM between the markers 43B1GAGT and 157A3. Two additional markers, 164D1 and D9S 1677, located between 43B1GAGT and 157A3, showed no recombination with the disease.
The present invention therefore relates to a method for identifying an individual carrying a gene associated with familial dysautonomia. The method comprises detecting the presence of a polymorphism located between D9S172 and D9S105, preferably between 43B1GAGT and 157A3 inclusive, and most preferably between 164D1 and D9S1677, on human chromosome 9. The presence of such polymorphisms is indicative of the presence of the familial dysautonomia gene in the individual.
The polymorphic markers of the invention can be detected by a variety of methods. The preferred detection means uses radioactive nucleotides in PCR .amplification of the polymorphism, or randomly labeled probes in hybridization reactions. Other detection methods such as the ligase chain reaction (LCR) can also be used. The polymorphism can be detectably labeled by a radioisotope or by chemical modification enabling direct detection of the polymorpliism. Fluorescent or colorimetric means can also be used. Detection of the polymorphism can be indirect, e.g. a radioactive complementary strand of DNA, resulting from incorporation of radioactive nucleotides in a polymerase chain reaction.
The invention also relates to nucleic acids useful for detecting the polymorphic markers of the invention. The nucleic acids, encoding sequences flanking the markers of the invention, can be used as primers for the polymerase chain reaction
(PCR). Amplication of DNA with these primers allows for the detection of the polymorphisms such as 88B2GA, 43B1GAGT, 164D1, D9S1677 and 157A3. Such primers may be about 15 to about 40 bases pairs in length, preferably about 17 to about
25 base pairs in length. In a preferred embodiment the primers used are 5 '-
GCCTGGGTGACAAGAGC-3' or 5'-CTCATTGTATCCTTACATGGTG-3' for the 88B2GA marker; 5 '-GATACACCATG-CATTTGC-3 ' or 5 '-GAAA-
TAGAACTGTTCCAAG-3' for the 43B1GAGT marker; 5'-CACCAGTATA-
CTCCAGC-3' or 5'-TTAGATAGAAGTTATATTGC-3' for the 164D1 marker; 5'-
CTGCTGTAATAGAAGGGAAAGG-3' or 5'-TCAACACCTAAGTCTAATCACC-
3 ' for the 157 A3 marker. It will be understood by one of skill in the art that variations in the 88B2GA, 43B1GAGT, 164D1, D9S1677 and 157A3 primers may be made providing they still result in nucleic acid sequences capable of amplifying the corresponding nucleic acid sequence. These primers may be used in the methods described herein for detecting the presence in a subject of the 43B1GAGT, 164D1, D9S 1677 and 157A3 polymorphisms.
Using the polymorphic markers of the invention, a genetic test for families with familial dysautonomia-affected member is provided for both prenatal diagnosis and carrier test in healthy siblings. Subsequent identification of the defective gene, could also allow screening of the entire at-risk population to identify carriers, and potentially reduce the incidence of new cases of familial dysautonomia.
The method lends itself readily to the formulation of kits which can be utilized in diagnosis. Such a kit would comprise a carrier being compartmentalized to receive in close confinement one or more containers wherein a first container may contain DNA containing coding sequences which may be used to identify a given polymorphism, e.g. an SSR. A second container may contain a different set of sequences coding for a second SSR, and so on. Other containers may contain reagents useful in the detection of the labelled probes, such as enzyme substrates. Still other containers may contain restriction enzymes, buffers, and the like.
The present invention will now be described by way of examples, which are meant to illustrate, but not limit, the scope of the invention.
EXAMPLE 1 Materials and Methods Familial Dysautonomia Families Patient samples were obtained from two major sources: the Dysautonomia
Diagnostic and Treatment Center at the New York University Medical Center, and the Israeli Center for Familial Dysautonomia at Hadassah University Hospital. All familial dysautonomia (FD) patients included in this study were diagnosed based on the standard criteria previously described (Axelrod 1984; Axelrod and Pearson 1984). Two hundred twelve (212) Ashkenazi FD families were studied, including 41 families with more than one affected member, (siblings, first cousins, and affected uncles/aunts), and two families with consanguinity and a single affected child. Altogether, 271 FD affected individuals (441 distinct FD chromosomes) were studied. Unaffected parents were studied in all 212 FD families, and in 102 of the families siblings, grandparents, and siblings of the parents were also studied (492 non-FD chromosomes from obligatory carriers). Control chromosomes were obtained from unaffected individuals marrying into the FD families (324 control chromosomes). Identification of New Markers
Seven new polymorphic markers were generated from cosmids in the FD critical region by hybridization with synthetic di-, tri-, terra-, and penta- oligonucleotides. Positive cosmids were shotgun subcloned and the positive subclones sequenced. Four of these markers, 157A3, D9S310, D9S309, andD9S311, are (GT)n repeats, 88B2GA is a (GA)n repeat, 43B1GAGT is a (GA)n (GT)n repeat, and 164D1 is a (AAAAC)n repeat (Table 1).
Table 1
Polymoφhic Markers in the FD Haplotype
Marker PCR Primers" or Reference Alleleb Allele Frequency0 Heterozygosity & CEPH standards
88B2GA GCCTGGGTGACAAGAGC 1(116) 0.38 0.72 CTCATTGTATCCTTACATGGTG 2(118) 0.17 3(120) 0.01 133101 1,4 4(122) 0.31 133102 1,1 5(124) 0.01 11(136) 0.12
43B1GAG GATACACCATGCATTTGC 3(80) 0.01 0.59 T GAAAATACAACTGTTCCAAG 4(82) 0.03
5(84) 0.09 1331015,8
6(86) 0.10 1331028,8
8(90) 0.61
9(92) 0.01
10(94) 0.15
164D1 CACCAGTATACTCCAGC 2(149) 0.01 0.61 TTAGATAGAAGTTATATTGC 3(154) 0.15
4(159) 0.35 1331014,5
5(164) 0.49 1331023,3
157A3 CTGCTGTAATAGAAGGGAAAGG 12(140) 0.03 0.29 TCAACACCTAAGTCTAATCACC 13(142) 0.84
14(144) 0.08 13310112,15
15(146) 0.02 13310213,14
16(148) 0.01
17(150) 0.02
D9S310 (Slaugenhaupt et al. 1994) 1 0.02 0.75
2 0.01
3 0.20 1331013,5
4 0.07 1331023,3
5 0.24
6 0.38
7 0.08
D9S309 (Slaugenhaupt et al. 1994) 1 0.01 0.78
2 0.02
3 0.02 1331019,11
4 0.07 1331029,10
5 0.03
6 0.08
7 0.08
8 0.06
9 0.37
10 0.24
11 0.01
15 0.01 Table 1
Polymorphic Markers in the FD Haplotype
Marker PCR Primers" or Reference llele" l lele Frequency0 Heterozygosity &
CEPH standards
D9S311 (Slaugenhaupt et al. 1994) -1 0.01 0.40
1 0.08
3 0.01 133101 6,9
4 0.01 133102 9,9
5 0.01
6 0.01
7 0.10
8 0.03
9 0.70
10 0.01
13 0.04
D9S172 (Weissenbach et al. 1992) 1 0.07 0.67
2 0.48
3 0.05 133101 2,4
4 0.24 1331022,2
5 0.10
6 0.02
7 0.03
8 0.01
D9S261 (Gyapay et al. 1994) 0 0.01 0.67
1 0.07
2 0.09 133101 8,8
3 0.01 133102 2,4
4 0.17
5 0.01
6 0.01
7 0.05
8 0.53
10 0.01
15 0.04
D9S1677 (Dib et al. 1996) 1 0.01 0.71
3 0.02
4 0.02 133101 9,9
5 0.02 133102 8,10
6 0.23
7 0.08
8 0.14
9 0.31
10 0.08
11 0.05
12 0.02
13 0.01
14 0.01
D9S58 (Kwia kowski et al. 1992) 1 0.01 0.98
2 0.01
3 0.02 133101 8,10
4 0.02 133102 7,19
5 0.03
6 0.02 Table 1
Polymoφhic Markers in the FD Haplotype
Marker PCR Primers3 or Reference He" A: llele Frequency0 Heterozygosity &
CEPH standards
7 0.02
8 0.06
9 0.08
10 0.04
11 0.05
12 0.05
13 0.11
14 0.11
15 0.07
16 0.06
17 0.01
18 0.05
19 0.03
20 0.10
23 0.01
24 0.01
26 0.03
D9S160 (Weissenbach et al. 1992) -1 0.01 0.72
0 0.01
2 0.03 133101 6,6
3 0.06 133102 6,7
4 0.10
5 0.06
6 0.34
7 0.38
D9S105 (Weber 1991) 1 0.02 0.83
2 0.07
3 0.14 133101 8,8
4 0.14 133102 4,8
5 0.08
6 0.06
7 0.11
8 0.31
9 0.05
10 0.01
11 0.01
"New polymorpliisms, PCR primers are listed 5' - 3' bAUeles sizes in base pairs for new markers
°Allele frequencies are based on 497 non-FD Ashkenazi Jewish chromosomes DNA Analysis
Genomic DNA was either prepared from lymphoblast cell lines (Anderson and Gusella 1984), using the SDS-proteinase K method, followed by phenol extraction, or directly from blood, using the Chelex-100 method (Walsh et al. 1991). PCR .analysis was carried out on genomic DNA using the published oligonucleotide primer pairs and annealing temperatures (Dib et al. 1996; Gyapay et al. 1994; Kwiatkowski et al. 1992; Weissenbach et al. 1992, The Genome Database) or according to Table 1. Typing of SSR polymoφhisms was performed as described in (Blumenfeld et al. 1993b). RESULTS
Order of markers in the DYS region
Previous studies have localized the FD gene close to D9S58, in an 11 cM region between D9S53 and D9S105. In the present study, thirteen SSR polymoφhisms from the DYS region were used, including both D9S58 and D9S105.
On the proximal side, the closer marker D9S172 (6 cM from D9S58) was substituted for the more distant marker D9S53 (8 cM from D9S58). The order of the ten additional markers (Table 1) with respect to the aforementioned three anchoring loci from centromere to telomere is: cen romeτe-D9S172-D9S261-88B2GA-43BlGAGT-l64Dl-D9Sl 677-151 A3-
D9S310-D9S309-D9S58-D9S160-D9S311-D9S105-le\o eτe.
This map order was determined sequentially from recombination events in reference pedigrees (Povey et al. 1997) and recombination events in our FD families. No crossovers were observed between 164D1 and D9S1677, but their relative order was established by isolation of a B AC clone containing D9S1677 and 157A3 but not 164DL
Fine localization of the FD Gene To refine the minimum FD candidate region, one hundred and two
(102) FD families (41 with multiple affecteds) were analyzed. On the proximal side, - li ¬
the recombination event depicted in Figure 1 A sets the closest centromeric flanking marker as 43B1GAGT. No additional crossovers were detected by 88B2GA or D9S261, although the more distant D9S172 (~6 cM away) detected 14 recombinations with DYS. On the distal side, the closest flanking marker is 157A3 based on the crossover shown in Figure IB. One additional crossover was found in each of the subsequent intervals: 151A3-D9S309, D9S309-D9S310, and D9S309-D9S58. No recombinants were observed between DYS and 164D1-E>PS26'77. Thus, the FD candidate region has been reduced to the interval 43B 1GAGT-164D1 -D9S1677- 157A3, winch we estimate from the analysis to span less than 0.5 cM.
A Major FD Haplotype
Haplotype analysis of FD was carried out in an attempt to further refine the candidate region and to estimate the number of independent mutations represented in the FD population. A major founder haplotype was observed for 435 of the 441 (98.6%) FD chromosomes examined, with a core of alleles '8-4-12' at 43B1GAGT- 164D1-E>PS26'77 (Table 2) and a consensus set of alleles for markers on either side that decays due to historical recombination events. The major founder haplotype in FD is recognizable across the interval D9S261 to D9S105, approximately 3 cM. The chromosomes supporting historical recombinations across the D9S261 to D9S58 interval are depicted in Figure 2. No events were detected to narrow the candidate region, although one ancestral recombination event with 157A3 was observed which confirms it as the closest telomeric flanking marker (Figure 2). The next distal flanking markers, D9S310 and D9S309, yielded evidence for 4 and 6 additional ancestral recombinations, respectively. On the centromeric side, 3 apparent ancestral recombinations were observed with 88B2GA, and 6 additional events were seen with D9S261.
D9S1677 forms part of the conserved haplotype, but displays some allelic variation due to 'slippage' events that create new alleles (Table 3). On most 'major haplotype' FD chromosomes, D9S1677 is represented by a '12' allele (83.5%), but on the remainder it is represented by '10' (0.5%), '11' (3%), '13' (3%), or '14' (10%o) even though adjacent markers remain unchanged. By contrast, the extreme
D9S1677 alleles '12', '13' and '14' are present on only 2.4%, 0.6% and 0.6%, respectively, of non-FD chromosomes. The instability of D9S1677 is further supported by our observation of two allele changes from '12' to '13' during parent-child transmissions in our FD families. Other FD Haplotypes
Six of 441 FD chromosomes revealed three different haplotypes across the candidate region (Table 2). All three of these other haplotypes were observed in compound heterozygotes with the major haplotype. Minor haplotypes 1, 2, and 3 were observed in two, three, and one unrelated families, respectively. The third rare haplotype was inherited from a woman who claimed not to be of Jewish extraction; she was of Irish-German/Sicilian origin. Other than the unusual family history, this child exhibited all of the diagnostic criteria for FD and had classical symptoms.
to o t_Λ o t
<-Λ <Λ
Table 2
Haplotypes Associated with FD
D9S172 D9S261 88B2GA lvxajor 2 4 8 4 12* 13 5 10 18 7 9 8 4351
Hap l 2 4 8 5 9 13 3 9 13 6 9 8 2
Hap 2 2 11 5 5 5 12 7 11 11 6 4 1 3
Hap 3 2 11 5 5 10 13 5 9 15 7 6 9 1
*10,ll,12,13,14 (see Table 3) aSee Figure 2 for details
Table 3
Allele variation observed at D9S1677
D9S261 8888BB22GGAA 4433BB11GGAAGGTT 164 4DD11 D D99SS11667777 1 15577AA33 D9S310 D9S309
4 8 4 4 1100 1133 5 10
4 8 4 4 1111 1133 5 10 6 9 x X X 8 4 4 1 122 1 133 X X x 4 4 8 4 4 1 133 1 133 5 10 6 9 6 9
4 14 13 5 10 6 9 6 9 6 6
See Figure 2 for details of x alleles
31 1
DTSCUSSION In an extensive study of FD families undertaken to refine the location of the FD gene in 9q31, eleven new polymoφhic markers were used. Within the 11 cM candidate region previously reported (Blumenfeld et al. 1993b), recombination events in FD families that define a FD gene candidate region of less than 0.5 cM, between the new markers 43B1GAGT and 157A3 were observed.
One major haplotype for the FD region was detected on more than 98% of FD * chromosomes. Indeed, all of the FD patients studied have at least one copy of the major haplotype. This dramatic linkage disequilibrium indicates that one major founder mutation is responsible for virtually all FD cases in the Ashkenazim. In several other recessive hereditary diseases a major founder mutation has been observed in Ashkenazi Jews, but in 0 none of them is a single founder mutation as preponderant as the haplotype found in FD. For example the major mutations found in Tay Sachs disease, Gaucher disease, and cystic fibrosis are observed on 78%, 76%, and 48% of disease chromosomes, respectively (Triggs- Raine et al. 1990; Beutler et al. 1993; Abeliovich et al. 1992).
Of our 271 FD patients, only 9 individuals from six families were compound 5 heterozygotes with one atypical haplotype. These three rare haplotypes may reflect independent FD mutations. In particular, the inheritance of haplotype 3 from a non- Ashkenazi parent suggests that at least one of the rare FD haplotypes may have been introduced from a non- Ashkenazi population. However, the possibility that haplotypes 1 and 2 represent mutations that have occurred more recently in the Ashkenazim cannot be ruled out. In addition, one of the minor haplotypes observed in two affected individuals (haplotype #1, Table 2), has the same alleles as the major haplotype for the centromeric markers D9S172 to 43B1GAGT. Compound heterozygotes for this haplotype appear to express a classic FD phenotype. Therefore, this haplotype could conceivably result from a historical recombination event with the major haplotype between 43B1GAGT and 164D1, rather than representing an independent mutation.
If haplotype 1 is a derivative of the major FD haplotype, this would position
DYS between 164D1 and the flanking marker 43B1GAGT. Haplotypes on non-FD
Ashkenazi chromosomes can also be inteφreted as providing tentative support for a location of the disease gene proximal to D9S1677. None of the 497 non-FD chromosomes tested has a haplotype that matches the consensus FD haplotype. However, careful examination of those non-FD haplotypes with alleles 11-14 at D9S1677 revealed 4 chromosomes that have o the haplotype (1 l,12)-13-6-9-13-7-9-X for the markers D9S1677-151A3-D9S310-D9S309- D9S58-D9S160-D9S311-D9S105, matching the distal portion of the haplotype observed on 40 out of 435 FD chromosomes (9%, Figure 2). Centromeric to D9S1677, all four non-FD chromosomes have the haplotype 11-5-5 instead of 4-8-4 for the markers 88B2GA- 43B1GAGT-164D1. It is intriguing to speculate that these non-FD chromosomes may ^ reflect a historical recombination event telomeric to 164D1 which would place the DYS gene proximal to D9S1677. Although we do not feel that our current data provide strong enough evidence for definitively refining the localization of DYS within the 43B1GAGT-164D1- D9S1677-157 A3 interval, these inteφretations of rare haplotype 1 and of the selected non- 0 FD chromosomes favor the centromeric portion of the candidate region.
The FD candidate region now extends from 43B1GAGT to 157A3, defined on each side by an actual recombination event observed in a parent-child transmission in one of our FD families. In other studies, haplotype analysis has assisted in pinpointing the location of a disease gene within a candidate interval previously defined by actual 5 recombinants. For example, in Ashkenazi Jewish dystonia, haplotype analysis reduced the interval containing the DYT1 gene from approximately 1.8 Mb to 150 kb (Ozelius et al.
1997). Similarly, in Huntington's disease, haplotype studies revealing ancestral crossovers progressively narrowed a 2 Mb candidate region to ~200 kb (Gusella and MacDonald 1993). 0 We observe significant linkage disequilibrium on FD chromosomes across a region of about 3 cM from D9S261 to D9S105. Despite the fact that we genotyped a very large number of FD chromosomes, the candidate region could not be narrowed further using ancestral recombination events. Only one additional historical recombination event was observed with 157A3, and none was seen with 43B1GAGT (Figure 2). Thus, the extent of linkage disequilibrium on FD chromosomes and the comparison of historical and actual recombination events in FD suggests that the major FD mutation probably occurred relatively recently in the Ashkenazi population, certainly within a few hundred years. The high incidence of FD in the Ashkenazim suggests that the mutation was likely present during a period of rapid population expansion from a small number of founders (Risch et al. 1995). The incidence of FD is 1 in 3700 live births among Ashkenazi Jews, and the calculated carrier frequency is 1 in 32 individuals (Maayan et al. 1987). 324 control chromosomes from spouses of FD carriers were genotyped and the major FD haplotype was observed on 1.54% (expected 1.56%). The fact that none of the FD associated haplotypes was observed in non-FD chromosomes, combined with the ability to identify the major FD haplotype in the general Ashkenazi Jewish population, indicates that accurate and sensitive genetic testing can be provided for FD families and spouses (Blumenfeld et al. 1995; Eng et al. 1995; Oddoux et al. 1995).
The definition of a precise candidate region for DYS has set the stage for the identification of the the FD defect through location cloning. FD belongs to a family of hereditary sensory neuropathies whose accurate diagnosis challenges clinicians. The observation of at least one non- Jewish FD chromosome in our data indicates that other non- Jewish patients might have escaped diagnosis as FD. Cloning of the DYS gene based on its chromosomal location will provide the means for direct comparison of both 'atypical' cases as well as other sensory neuropathies to FD, allowing a classification based on the primary genetic cause rather than subtle symptomatic differences.
References
Abeliovich D, Lavon IP, Lerer I, Cohen T, Springer C, Avital A, Cutting G (1992) Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenasi population. Am J Hum Genet 51:951-956
Anderson MA, Gusella JF (1984) Use of cyclosporin A in establishing Epstein-Barr virus- transfoimed human lymphoblastoid cell lines. In Vitro 20:856-8
Axelrod FB, Nachtigal R, Dancis J (1974) Familial dysautonomia: diagnosis, pathogenesis and management. Adv Pediatr 21 -.15-96 Axelrod FB (1984) Familial dysautonomia and other congenital and sensory autonomic neuropathies. In: Blake IB (ed) Cell and Molecular Biology of Neuronal Development. Plenum Press, New York, pp 331-340
Axelrod FB, Pearson J (1984) Congenital sensory neuropathies. Diagnostic distinction from familial dysautonomia. Am J Dis Child 138:947-54
Axelrod FB, Abularrage JJ (1982) Familial Dysautonomia. A prospective study of survival. J Pediatr 101:234-236
Axelrod FB (1995) Familial dysautonomia. In: Robertson D, Biaggioni I (eds) Disorders of the Autonomic Nervous System. Vol. 5. Harwood Academic Publishers, Luxembourg, pp 217-231
Axelrod FB (1996) Familial dysautonomia. In: Robertson D, Low PA, Polinsky RJ (eds) Primer on the Autonomic Nervous System. Academic Press, San Diego, pp 242-249
Beutler E, Nguyen NJ, Henneberger MW, Smolec JM, McPherson RA, West C, Gelbart T (1993) Gaucher Disease: gene frequencies in the Ashkenazi Jewish population. Am J Hum Genet 52:85-88
Blumenfeld A, Slaugenhaupt SA, Axelrod FB, Lucente DE, Maayan C, Liebert CB, Ozelius LJ, et al (1993a) Localization of the gene for familial dysautonomia on chromosome 9 and definition of DNA markers for genetic diagnosis. Nat Genet 4: 160-4
Blumenfeld A, Axelrod FB, Trofatter JA, Maayan C, Lucente DE, Slaugenhaupt SA, Liebert CB, et al (1993b) Exclusion of familial dysautonomia from more than 60% of the genome. J Med Genet 30:47-52
Blumenfeld A, Axelrod FB, Tamper V, Maayan C (1995) [Localization of the familial dysautonomia gene to chromosome 9q31-33 and the development of a genetic test for the disease]. Isr J Med Ass 128:97-100
Breakefield XO, Orloff G, Castiglione C, Coussens L, Axelrod FB, Ullrich A (1984) Structural gene for beta-nerve growth factor not defective in familial dysautonomia. Proc Natl Acad Sci U S A 81:4213-6
Breakefield XO, Ozelius L, Bothwell MA, Chao MV, Axelrod F, Kramer PL, Kidd KK, et al (1986) DNA polymoφhisms for the nerve growth factor receptor gene exclude its role in familial dysautonomia. Mol Biol Med 3:483-94 Brunt PW, McKusick VA (1970) Familial dysautonomia. A report of genetic and clinical studies, with a review of the literature. Medicine (Baltimore) 49:343-74
Dib C, Faure S, Fizames C, Samson D, Drouot N, Vignal A, Millasseau P, et al (1996) A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 380:152-4
Eng CM, Slaugenhaupt SA, Blumenfeld A, Axelrod FB, Gusella JF, Desnick RJ (1995) Prenatal diagnosis of familial dysautonomia by analysis of linked CA- repeat polymoφhisms on chromosome 9q31-q33. Am J Med Genet 59:349-55
Gusella JF, MacDonald ME (1993) Hunting for Huntington's disease. Mol Genet Med 3:139-58
Gyapay G, Morissette J, Vignal A, Dib C, Fizames C, Millasseau P, Marc S, et al (1994) The 1993-94 Genethon human genetic linkage map. Nat Genet 7:246-339
Harris DJ, Yang BI, Wolf B, Snodgrass PJ (1980) Dysautonomia in an infant with secondary hyperammonemia due to propionyl coenzyme A carboxylase deficiency. Pediatrics' 65(1):107-110
Klebanoff MA and Neff JM (1980) Familial dysautonomia associated with recurrent osteomyelitis in a non- Jewish girl. J Pediatr 96(1): 75-77
Kwiatkowski DJ, Henske EP, Weimer K, Ozelius L, Gusella JF, Haines J (1992) Construction of a GT polymoφhism map of human 9q. Genomics 12:229-40
Levine SL, Manniello RF, Farrell PM (1977) Familial dysautonomia: unusual presentation in an infant on non-Jewish ancestry. J Pediatr 90(1):79-81
Maayan C, Kaplan E, Shachar S, Peleg O, Godfrey S (1987) Incidence of familial dysautonomia in Israel 1977-1981. Clin Genet 32:106-8
Metha K (1978) Familial dysautonomia in a Hindu boy. Am J Dis Child 32:719
Orbeck H and Oftedal G (1977) Familial dysautonomia in a non- Jewish child. Acta Paediatr Scand 66(6):777-781
Ozelius LJ, Hewett J, Kramer P, Bressman SB, Shalish C, de Leon D, Rutter M, et al (1997) Fine localization of the torsion dystonia gene (DYT1) on human chromosome 9q34: YAC map and linkage disequilibrium. Genome Res 7:483-94
Oddoux C, Reich E, Axelrod F, Blumenfeld A, Maayan C, Slaugenhaupt S, Gusella J, et al (1995) Prenatal diagnostic testing for familial dysautonomia using linked genetic markers. Prenat Diagn 15:817-26
Pearson J, Pytel BA (1978a) Quantitative studies of sympathetic ganglia and spinal cord intermedio-lateral gray columns in familial dysautonomia. J Neurol Sci 39:47-59
Pearson J, Pytel B (1978b) Quantitative studies of ciliary and sphenopalatine ganglia in familial dysautonomia. J Neurol Sci 39:123-30 Pearson J, Pytel BA, Grover- Johnson N, Axelrod F, Dancis J (1978) Quantitative studies of dorsal root ganglia and neuropathologic observations on spinal cords in familial dysautonomia. J Neurol Sci 35:77-92 Povey S, Attwood J, Chadwick B, Frezal J, Haines JL, Knowles M, Kwiatkowski DJ, et al (1997) Report on the Fifth International Workshop on Chromosome 9 held at Eynsham, Oxfordshire, UK, September 4-6, 1996. Ami Hum Genet 61:183-206 o Riley CM, Day RL, Greely D, Langford WS (1949) Central autonomic dysfunction with defective lacrimation. Pediatrics 3:468-477
Risch N, de Leon D, Ozelius L, Kramer P, Almasy L, Singer B, Fahn S, et al (1995) Genetic analysis of idiopathic torsion dystonia in Ashkenazi Jews and their recent descent from a small founder population. Nat Genet 9:152-9
Schwartz JP, Breakefield XO (1980) Altered nerve growth factor in fibroblasts from patients with familial dysautonomia. Proc Natl Acad Sci U S A 77: 1154-8
Slaugenhaupt SA, Blumenfeld A, Liebert CB, Mull J, MacCormack K, LeBel A, O'Leary K, . et al. (1994) Physical map surrounding the familial dysautonomia gene. In: Pericak- Vance MA, Bale AE, Haines JL, Kwiatkowski DJ, Pilz A, Slaugenhaupt SA, White JA, et al. Report on the Fourth International Workshop on Chromosome 9. Ann Hum Genet 59:347- 365
Slaugenhaupt SA, Blumenfeld A, Liebert CB, Mull J, Lucente DE, Monahan M, Breakefield XO, et al. (1995) The human gene for neurotrophic tyrosine kinase receptor type 2 is located on chromosome 9 but is not the familial dysautonomia gene. Genomics 25:730-732.
Suzuki T, Higa S, Hayashi A, Nakagawa T, Fujii K (1976) A case of new dysautonomia-like disorder found in Japan. I. Clinical and metabolic studies. Eur Neurol 14(2): 146-160. Triggs-Raine BL, Feigenbaum ASJ, Natowicz M, Skomorowski MA, Schuster SM, Clarke JTR, Mahuran DJ, et al. (1990) Screening for carriers of Tay-Sachs disease among Ashkenazi Jews: a comparison of DNA-based and enzyme-based tests. New Eng J Med 323:6-12
Walsh PS, Metzger DA, Higuchi R (1991) Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10:506-13 Weissenbach J, Gyapay G, Dib C, Vignal A, Morissette J, Millasseau P, Vaysseix G, et al (1992) A second-generation linkage map of the human genome. Nature 359:794-801
Wrathall JR (1986) Reduced neuronotrophic activity of fibroblasts from individuals with dysautonomia in cultures of newborn mouse sensory ganglion cells. Brain Res 364:23-9

Claims

We claim:
o 1. A method for identifying an individual carrying a gene associated with familial dysautonomia, said method comprising: detecting the presence of a polymoφhism located between D9S172 and D9S105 inclusive on human chromosome 9, linked to the gene associated with familial dysautonomia, wherein the presence of the polymoφhism is indicative of the presence of the familial dysautonomia gene.
2. The method according to claim 1, wherein the polymoφhism is selected from the group consisting of D9S172, D9S261, 88B2GA, 43B1GAGT, 164D1,
D9S1677, 157A3, D9S310, D9S309, D9S58, D9S160, D9S311 and D9S105.
3. The method according to claim 2, wherein the polymoφhism is selected from the group consisting of 43B1GAGT, 164D1, D9S1677 and 157A3.
4. The method according to claim 3, wherein the polymoφhism is selected from the group consisting of 164D 1 and D9S 1677
5. An isolated nucleic acid sequence comprising the familial dysautonomia gene, said nucleic acid sequence consisting essentially of the sequence located on the long arm of chromosome 9 between 43B1GAGT and 157 A3.
6. The isolated nucleic acid sequence according to claim 5, wherein the sequence consists essentially of the sequence located on the long arm of chromosome '9 between 164D1 and D9S 1677.
7. A nucleic acid primer for detecting the 43B 1 GAGT marker, said primer having a nucleic acid sequence of 5'-GATACACCATGCATTTGC-3' or 5'- GAAATAGAACTGTTCC AAG-3 ' .
8. A nucleic acid primer for detecting the 164D1 marker, said primer having a nucleic acid sequence of 5'-CACCAGTATACTCCAGC-3' or 5'- TTAGATAGAAGTTATATTGC-3 ' .
9. A nucleic acid primer for detecting the 157 A3 marker, said primer having a nucleic acid sequence of 5'-CTGCTGTAATAGAAGGGAAAGG-3' or 5'- o TC AACACCTAAGTCTAATCACC-3 ' .
10. A nucleic acid primer for detecting the 88B2GA marker, said primer having a nucleic acid seqμence of 5 '-GCCTGGGTGACAAGAGC-3' or 5'-
CTC ATTGTATCCTTACATGGTG-3 ' .
11. A kit for diagnosing a carrier of the familial dysautonomia gene, said kit comprising at least one nucleic acid probe having a sequence that can identify a polymoφhism between D9S172 and D9S105 inclusive linked to the gene associated with familial dysautonomia.
12. The kit according to claim 11, wherein the nucleic acid probe has a sequence that can identify a polymoφhism between 43B1GAGT and 157A3 inclusive linked to the gene associated with familial dysautonomia.
13. The kit according to claim 12, wherein the nucleic acid probe has a sequence that can identify a polymoφhism between 164D 1 and D9S 1677 inclusive linked to the gene associated with familial dysautonomia.
EP00916382A 2000-03-15 2000-03-15 Use of genetic markers to diagnose familial dysautonomia Ceased EP1274860A4 (en)

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
PCT/US2000/006851 WO2001068917A1 (en) 2000-03-15 2000-03-15 Use of genetic markers to diagnose familial dysautonomia

Publications (2)

Publication Number Publication Date
EP1274860A1 true EP1274860A1 (en) 2003-01-15
EP1274860A4 EP1274860A4 (en) 2006-02-08

Family

ID=21741155

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00916382A Ceased EP1274860A4 (en) 2000-03-15 2000-03-15 Use of genetic markers to diagnose familial dysautonomia

Country Status (5)

Country Link
EP (1) EP1274860A4 (en)
AU (1) AU2000237492A1 (en)
CA (1) CA2403696A1 (en)
IL (1) IL151769A0 (en)
WO (1) WO2001068917A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7388093B2 (en) 2001-01-06 2008-06-17 The General Hospital Corporation Gene for identifying individuals with familial dysautonomia

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU4390293A (en) * 1992-05-29 1993-12-30 General Hospital Corporation, The Use of genetic markers to diagnose familial dysautonomia

Also Published As

Publication number Publication date
IL151769A0 (en) 2003-04-10
WO2001068917A1 (en) 2001-09-20
EP1274860A4 (en) 2006-02-08
CA2403696A1 (en) 2001-09-20
AU2000237492A1 (en) 2001-09-24

Similar Documents

Publication Publication Date Title
Lee et al. Direct molecular diagnosis of CYP21 mutations in congenital adrenal hyperplasia.
Robinson et al. Multiple interacting gene products may influence susceptibility to malignant hyperthermia
Bürger et al. Hereditary spastic paraplegia caused by mutations in the SPG4 gene
Eggerding et al. Uniparental isodisomy for paternal 7p and maternal 7q in a child with growth retardation
Balciuniene et al. A gene for autosomal dominant progressive cone dystrophy (CORD5) maps to chromosome 17p12–p13
Gelb et al. Paternal uniparental disomy for chromosome 1 revealed by molecular analysis of a patient with pycnodysostosis
Yamagishi et al. Mucopolysaccharidosis type I: identification of common mutations that cause Hurler and Scheie syndromes in Japanese populations
Talbot Jr et al. The tetranucleotide repeat polymorphism D21S1245 demonstrates hypermutability in germline and somatic cells
US5879884A (en) Diagnosis of depression by linkage of a polymorphic marker to a segment of chromosome 19P13 bordered by D19S247 and D19S394
Wijmenga et al. Genetic linkage map of facioscapulohumeral muscular dystrophy and five polymorphic loci on chromosome 4q35-qter
Nichols et al. Linkage of combined factors V and VIII deficiency to chromosome 18q by homozygosity mapping.
EP1366185B9 (en) Methods and compositions for perioperative genomic profiling
Matsuura et al. For novel gene mutations in five Japanese male patients with neonatal or late onset OTC deficiency: application of PCR-single-strand conformation polymorphisms for all exons and adjacent introns
Wang et al. Continuous linkage map of human chromosome 14 short tandem repeat polymorphisms
Hodaňová et al. Analysis of the β-glucocerebrosidase gene in Czech and Slovak Gaucher patients: mutation profile and description of six novel mutant alleles
US6262250B1 (en) Kits for detecting polymorphisms associated with familial dysautonomia
US6136532A (en) Methods for treating bipolar mood disorder associated with markers on chromosome 18q
Kondo et al. Delineation of the critical interval for the familial exudative vitreoretinopathy gene by linkage and haplotype analysis
Kondo et al. Diagnosis of autosomal dominant retinitis pigmentosa by linkage-based exclusion screening with multiple locus-specific microsatellite markers
WO2001068917A1 (en) Use of genetic markers to diagnose familial dysautonomia
AU2007200906A1 (en) Use of genetic markers to diagnose familial dysautonomia
EP1233075A2 (en) BDNF polymorphism and association with bipolar disorder
AU2011202743A1 (en) Use of genetic markers to diagnose familial dysautonomia
US6274352B1 (en) Methods for diagnosing and assessing a predisposition to bipolar affective disorder
Sadia et al. Development of T-ARMS-PCR to detect MYBPC3 gene variation in hypertrophic cardiomyopathy (HCM) patients

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20021008

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL PAYMENT 20021008;LT PAYMENT 20021008;LV PAYMENT 20021008;MK PAYMENT 20021008;RO PAYMENT 20021008;SI PAYMENT 20021008

A4 Supplementary search report drawn up and despatched

Effective date: 20051229

17Q First examination report despatched

Effective date: 20081002

REG Reference to a national code

Ref country code: DE

Ref legal event code: R003

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION HAS BEEN REFUSED

18R Application refused

Effective date: 20121023