EP1265635A1 - Pharmaceutical comprising an agent that blocks the cell cycle and an antibody - Google Patents
Pharmaceutical comprising an agent that blocks the cell cycle and an antibodyInfo
- Publication number
- EP1265635A1 EP1265635A1 EP01922610A EP01922610A EP1265635A1 EP 1265635 A1 EP1265635 A1 EP 1265635A1 EP 01922610 A EP01922610 A EP 01922610A EP 01922610 A EP01922610 A EP 01922610A EP 1265635 A1 EP1265635 A1 EP 1265635A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- cell
- agent
- cell surface
- antibody
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
- C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/77—Internalization into the cell
Definitions
- the present invention relates to pharmaceutical combinations, that is combinations of therapeutically active agents in the treatment of mammalian patients particularly those afflicted with a disease of cell cycle regulation such as cancer or a disease or disorder of metabolic dysfunction and methods of medical treatment comprising the same.
- the present invention more particularly concerns the combined use of an agent that is capable of affecting cell growth (i.e. number) by blocking (or retarding) progression of the cell cycle in G 2 and/or M (herein "G 2 M agents”) and another therapeutic agent.
- G 2 M agents an agent that is capable of affecting cell growth (i.e. number) by blocking (or retarding) progression of the cell cycle in G 2 and/or M
- G 2 M agents a therapeutic agent that is capable of affecting cell growth (i.e. number) by blocking (or retarding) progression of the cell cycle in G 2 and/or M
- G 2 M agents a therapeutic agent that is capable of affecting cell growth (i.e. number) by blocking (or retarding) progression of the cell cycle in G 2 and/or M
- the cell cycle refers to a sequence of events between one mitotic division and another in a cell.
- a quiescent resting phase (G 0 ) is followed by a growth phase (G ⁇ ), then by DNA synthesis phase (S).
- a second growth phase of cell enlargement (G ) and DNA replication (M phase) is followed by division of the cell into two progeny cells.
- DNA is stained with intercalating dyes (i.e. propidium iodide or 4',6'-diamidino-2- phenylindole (DAPI)) and using flow cytometry, the cellular amount of the DNA can be used to determine the cell cycle distribution. Interference with cellular machinery may inhibit progression through the cell cycle.
- intercalating dyes i.e. propidium iodide or 4',6'-diamidino-2- phenylindole (DAPI)
- chemotherapeutic agents may block progression in either G 2 and/or M.
- exposure to certain drugs e.g. chemotherapeutic agents will for example arrest individual cells in G 2 and/or M until eventually most, or all of the cells in a population cease progression through the cell cycle and arrest in G 2 and/or M.
- chemotherapeutic agents While a few cell surface structures such as proteins have been identified as produced solely at certain phases of the cell cycle, and therefore can serve as markers of cell cycle status, most others are produced across the cell cycle but at higher or lower levels at certain points.
- tumour antigen density across the cell cycle is typical for sacroma antigens pi 02 andp200 (Song S, Anticancer Research 16(3 A): 1171-5 (1996)), the leukaemia/lymphoma-associated antigen JD118 (Czuczman et al; Cancer immunology, immunotherapy 36(6):387-96 (1993)) and the gastric tumour antigen PCI (Wei et al, J. Oncology 9(3): 179-182 (1987)).
- a few tumour antigens have been reported to be cell-cycle independent, e.g. liver metastates 3H4 (Wulf et al, J
- a process by which the cell's plasma membrane including associated structures (e.g. proteins, glycoproteins) invaginate is endocytosis.
- endocytosis the membrane and associated structures are taken up within the cell and subject to further processing by cellular machinery.
- receptor endocytosis is required for agonist-induced mitogenic signalling of various tyrosine kinase growth receptors such as receptors for epidermal growth factor receptor (Vieira, AV, Lamaze, C, and Schmid, SL (1996) Nature 274, 2086-2089), nerve growth factor receptor (Riccio, A, Pierchala, BA, Ciarallo, CL, and Ginty DD (1997) Science 277, 1097- 1100), and insulin growth factor receptor 1 (Chow JC, Condorelli G, and Smith RJ (1998) J Biol.
- G protein-coupled receptors such as endothelial cell-derived G protein-coupled receptor (EDG-1) and chemo ine receptor CXCR1 (Barlic J, Khandaker, MH, Mahon, E, Andrews, J, DeVries, ME, Mitchell, GB, Rahimpour, R, Tan, CM, Ferguson, SSG, and Kelvin DJ (1999) J Biol. Chem. 274 (23), 16287-16294).
- EDG-1 endothelial cell-derived G protein-coupled receptor
- CXCR1 chemo ine receptor CXCR1
- Integrins link extracellular matrix proteins to cytoskeletal proteins and actin filaments on the cytoplasmic face and have been shown to regulate agonist-induced protein phosphorylation (Clark, EA, Shattil, SJ and Brugge, JS (1994) Trends Biochem. Sci. 19, 464).
- Classical markers of receptor-mediated endocytosis are macromolecules such as transferrin, low-density lipoprotein or asialoglycoprotein receptors. These macromolecules bound to specific receptors at the cell surface are internalised by the cell via endocytosis. Initially, macromolecules are internalised into early endosomes and once there, are either recycled to the plasma membrane or became concentrated with sorting endosomes before being routed towards lysosomes.
- Microtubule-dependent transport is an integral component of many of the membrane-trafficking events involved in endocytosis, secretion, transcytosis, and membrane organisation and maintenance (Cole, N.B. and Lippincott-Schwartz, J. (1995) "Organisation of organelles and membrane traffic by Microtubules" Curr. Opin. Cell Biol. 7, 55-64; Goodson, H.V., Valetti, C, and Kreis, T. E. (1997) “Motors and membrane traffic” Curr. Opin. Cell Biol. 9, 18-28.).
- the conventional therapeutic approaches to the treatment of cancer include surgery, radiotherapy and chemotherapy in various combinations; however, response rates for some types of cancer have not improved significantly in the last 20 years.
- the major limitation of chemotherapy and radiotherapy is the non-selective targeting of both normal and tumour cells that result in toxic side effects.
- various types of immunotherapy have been investigated.
- strategies based on monoclonal antibodies have been applied to a broad spectrum of malignancies.
- the utility of monoclonal antibodies is based upon their clonal antigen specificity, i.e. molecular recognition of specific epitopes which may comprise an antigen and to bind to these antigens with high affinity.
- Monoclonal antibodies can bind to antigens expressed uniquely or preferentially on the surface of malignant cells and hence can be used to specifically target and destroy tumour cells.
- Antibodies may be constructed as delivery vehicles for drugs or DNA or as conjugates with radionuclides. Binding of naked antibody to target cells may also activate innate antitumour immune functions such as antibody- dependent cell-mediated cytotoxicity (ADCC) and complement mediated cytotoxicity (CMC), either of which may result in lysis or phagocytosis of the targeted cell. Both ADCC and CMC are antibody-dose related immune functions and it is therefore desirable to get as much antibody bound to target cells as possible.
- ADCC antibody-dependent cell-mediated cytotoxicity
- CMC complement mediated cytotoxicity
- Both ADCC and CMC are antibody-dose related immune functions and it is therefore desirable to get as much antibody bound to target cells as possible.
- One way of achieving this objective is to increase the amount of antigen expressed on the cell surface which may effectively increase antibody functions such as, for example, ADCC of the target
- pancreatic tumor antigens Mukerjee, S., McKnight, M. E., Nasoff, M., and Glassy, M. C. "Co-expression of tumor antigens and their modulation by pleiotrophic modifiers enhance targeting of human monoclonals antibodies to pancreatic carcinoma” Human Antibodies 9, 9-22 (1999)) and epidermal growth factor receptor (Zuckier G. and Tritton T. R. "Adriamycin Causes Up Regulation of Epidermal Growth Factor Receptors in Actively Growing Cells" Experimental Cell Research 148, 155-161 (1983); Hanauske A.-R., Depenbrock, H., Shirvani, D., and Rastetter J. "Effects of Microtubule-disturbing
- the effect of interferons on at least one ganglioside antigen suggests that the mechanism of increased in surface density may be the result of increased gene expression.
- EGF epidermal growth factor
- doxorubicin increased EGF binding, though vinblastine and cisplatin caused a reduction in the binding affinity.
- Successful antibody combinations that target epidermal growth factor receptor include the G 2 M agents doxorubicin and cisplatin (Baselga, J., Norton, L., Masui, H., Pandiella, A., Coplan, K., Miller Jr., W., and Mendelsohn, J. "Antitumor Effects of Doxorubicin in Combination with Anti- epidermal Growth Factor Receptor Monoclonal Antibodies" J. Natl. Cancer Inst. 85 (16) 1327-1333 (1993); Fan, Z., Baselga, J., Masui, H., and Mendelsohn, J.
- Doxorubicin is the only agent where increased surface density may account for it's increased potency in combination with an anti- EGF receptor antibody, but proposed to occur due to receptor block by antibody causing cell signal deprivation.
- the mechanism of cisplatin' s increased potency is unclear and does not appear to be the result of effects on surface receptor density, but was proposed by Fan et al. to be cytoreduction and altered microenvironment (including tumor vascularity) interference with autocrine growth signals.
- these G /M- antibody combinations disclosed therein are disclaimed and do not form part of the present invention as defined by the appended claims.
- the present invention is based, at least in part, on the observation that the therapeutic effectiveness of many therapeutic agents such as antibodies or small molecule therapeutics whose therapeutic effectiveness is, at least partly, based on the presence of an internalising cell surface structure, for example an antigen on the target cell may be enhanced through the use of a G 2 /M agent.
- a cell treated with a G 2 /M agent nevertheless continues to synthesise and present cell surface structures on its cell surface, leading to an increased density of the structure on the cell surface. It is believed that treatment of the cell with a G 2 /M agent disrupts/perturbs/cripples (either temporarily or permanently) the internalisation mechanism of the cell. It is therefore believed that the increase in density of the cell surface structure is not as a result of increased gene expression er se but rather a combination of the continuance in protein synthesis and/or presentation by the cell and the effect on the internalisation mechanism.
- the subsequent therapeutic effectiveness of a therapeutic agent such as an antibody or small molecule which targets that structure (e.g. by binding to it or otherwise interacting with the structure) is enhanced by virtue of an increased density in the target structure on the cell surface.
- This enhanced effect may take the form of improved efficacy of the therapeutic agent (e.g. increased tumour cell killing or induction of apoptosis in the cell expressing the target cell surface structure) or by attaining similar efficacy but at a lower effective dose of the therapeutic agent, potentially decreasing side effects for the patient.
- This enhanced effect is typically a result of synergistic or additive interaction between the G 2 /M agent and the therapeutic agent.
- the present inventors therefore teach that the blocking or retarding of a cell, particularly a cancerous cell, in the G 2 /M phase of the cell cycle leads to an increase in density on the cell (i.e. plasma membrane) surface of a number of apparently unrelated antigens.
- a method of treating a mammalian patient, preferably human, in clinical need thereof comprises the step of simultaneously treating said patient with a G 2 /M agent and a therapeutic agent whose therapeutic effectiveness depends at least in part on the expression on the cell surface of the patient cell of a cell surface structure that internalises as the cell progresses through its cell cycle (e.g. by binding to or otherwise interacting with the cell surface structure).
- a method of treating a mammalian patient, preferably human, in clinical need thereof comprises the step of simultaneously treating said patient with a G 2 /M agent and a therapeutic agent wherein treatment with said G 2 M agent blocks or retards progression of the cell cycle in a target patient cell at G 2 and/or M thereby increasing the density of a cell surface structure in said target patient cell such as a protein or glycoprotein which structure is targeted by (e.g. specifically bound by) said therapeutic agent.
- a method of treating a mammalian patient, preferably human, afflicted with a disease or disorder of cell cycle regulation which method comprises the step of simultaneously treating said patient with a G /M agent and an agent whose therapeutic effectiveness depends at least partly, preferably mainly (even solely), on an internalising cell surface structure, particularly an internalising structure known or suspected to have a role in maintaining or progressing a cancerous state in said patient.
- a disease or disorder of cell cycle regulation e.g. cancer
- a combination of a G 2 /M agent and a therapeutic agent whose therapeutic effectiveness is based at least partly, preferably mainly, on the presence of an internalising cell surface structure.
- the term "simultaneously treating" need not necessarily imply simultaneously administrating (although it does not exclude this). Indeed in many instances, it will be preferable to administer the G 2 /M agent to the patient first, to block or retard cell cycle progression at G 2 and/or M to achieve the desired increase in cell surface structure density. This is then usually followed by exposing the same cells to the therapeutic agent that targets the cell surface structure thereby achieving enhanced therapeutic effectiveness of the therapeutic agent.
- the G 2 /M agent may be administered on the same day as the therapeutic agent either together or within hours of each other. However, the G 2 /M may also be administrated up to about two months beforehand, typically about one or two weeks beforehand and more typically less than a week beforehand, e.g.
- the G 2 M agent has a known posology for monotherapeutic use, this maybe substantially followed prior to or together with administration of the therapeutic agent.
- Administration of the therapeutic agent may include multiple dosing (either as an oral medication, infusion or bolus dose) within several weeks after administration of the G /M agent (which itself may include multiple dosing either as an oral medication, infusion or bolus dose) but variation of this to take into account the respective pharmacokinetics and efficacy profile of the G 2 /M agent and therapeutic agent may be required.
- Treatment regimen is, of course, also dependent on a number of other factors such as the weight, age, general health status of the patient, type and severity of disease or disorder to be treated, all these being within the purview of the attending physician.
- Genetic predisposition of the patient to respond to treatment by a particular combination of the present invention may also require consideration. This may be achieved in advance of treatment by detenmning whether response is associated with a genetic polymorphism such as a gene region polymorphism e.g. single nucleotide polymorphism (SNP).
- SNP single nucleotide polymorphism
- the polymorphism is typically detected by directly determining the presence of the polymorphism sequence in a polynucleotide (e.g. genomic DNA or mRNA) or protein of the patient.
- the presence of the polymorphism is determined in a method that comprises contacting a polynucleotide or protein of the patient with a specific binding agent for the polymorphism and determining whether the binding agent binds to a polymorphism in the polynucleotide or protein, the binding of the agent to the polymorphism indicating the likely response profile of the patient.
- the polymorphism maybe associated with metabolism (e.g. cytochrome P450 polymorphism) of any component of the combination.
- therapeutic effectiveness or “therapeutically effective” or the like need not necessarily imply that the therapeutic agent is sufficiently effective to cure the disease or disorder. It is sufficient that therapeutic agent can ameliorate the disease or disorder state at least to some extent or otherwise provide a clinical benefit.
- treatment regimens that may be employed according to various aspects of the present invention are discussed in more detail below. However, it will be apparent that it is not an essential prerequisite that the mammalian patient is treated with at least two agents.
- the general principle is that target cells within the patient are arrested in preferably G 2 and/or M (or at least their progression through G 2 and/or M is retarded) which together with a therapeutic agent of the present invention has an enhanced therapeutic effectiveness.
- Treatment regimens involving one or more therapeutic agents and one or more G 2 /M agents are envisaged. It will be apparent that the methods of the present invention may be used prophylatically where appropriate.
- cell surface structure refers to structures that are present (e.g. expressed) on the cell surface of a cell and are anchored to the plasma membrane. Such structures may be proteins or modified proteins (such as glycoproteins) and are internalised by the cell, typically by the process of endocytosis, as the cell progresses through its cell cycle.
- internalising cell surface structure refers to those cell surface structures that are internalised by the cell, typically by endocytosis, as the cell progresses through its cell cycle.
- the internalising cell surface structure is typically an antigen, transmembrane receptor (e.g.
- 7-transrnembrane receptor or other biological moiety which is synthesised and expressed by the cell and whose density at the cell surface may be increased by arresting the cell at G 2 and/or M (or at least retarding its progression therethrough).
- the term is not intended to extend to components of the plasma membrane itself, i.e. the lipid bilayer itself.
- the internalising cell surface structure may undergo various processing events prior to expression.
- a cell surface structure that is internalised may be determined through the use of an antibody specific for the suspected internalising cell surface structure
- a suspected G /M agent of the present invention may be identified by observing increased binding of an antibody-/reporter moiety complex when the cell is arrested in G 2 and/or M. The particular stage that a cell is at during the cell cycle can be determined by known techniques well known to those skilled in the art, see for example Crissman et al, supra.
- step (e) optionally synthesising and/or purifying said agent of step (d).
- J-n accordance with a further aspect, there is provided a method of treating a mammalian patient (afflicted with e.g. a disease of cell cycle regulation) in clinical need comprising the steps of;
- step (c) simultaneously treating said patient with a therapeutically effective amount of; said agent of step (b) and a therapeutic agent which specifically binds to an internalising cell surface structure, preferably said structure of step. (a).
- a method for the treatment of a mammalian patient afflicted with a disease or disorder such as cancer comprises the steps of;
- step (b) providing a therapeutic agent which specifically binds to or otherwise interacts with an internalising cell surface structure, preferably said structure of step (a) optionally by determining whether a candidate therapeutic agent binds to (e.g. specifically binds to) an internalising cell surface structure; (c) simultaneously treating said patient with a therapeutically effective amount of ; said G 2 /M agent of step (a) and said therapeutic agent of step (b).
- Internalising cell surface structures may comprise an extracellular, transmembrane and/or an intracellular portions.
- the internalising cell surface structure e.g. antigen
- Therapeutic agents of the present invention are those whose therapeutic effectiveness depends at least in part, preferably mainly, on the presence of an internalising structure on the cell surface. In many instances, this dependency will be as a result of the specific interaction (e.g. specific binding) of the therapeutic agent with the internalising cell surface structure. This binding may take place on the extracellular, transmembrane or intracellular portion of the cell surface structure.
- the agent binds intracellularly, the agent binds to an intracellular catalytic domain of a protein (which will normally be coupled to the internal face of the plasma membrane or otherwise associated therewith).
- a protein which will normally be coupled to the internal face of the plasma membrane or otherwise associated therewith.
- proteins include those with kinase activity such as tyrosine kinase or serine/threonine lcinase. Tyrosine kinase intracellular portions are a particularly attractive target for anti-cancer treatments.
- Binding may then be followed by; the elicitation of a biological response to the binding e.g. ADCC, the inhibition of the catalytic properties of a protein, steric hindrance of the protein (for example by changing or interfering with the tertiary conformation of the protein) or competitive binding to an important effector site of the protein.
- the internalising nature of the cell surface structure may therefore be utilised in the following general therapeutic approach.
- the increased cell surface structure density on the cell surface affords the opportunity of improving the delivery of a therapeutic agent into the target cell.
- the target cell is treated with a G 2 /M agent to increase the density of the cell surface structure followed by treatment with the therapeutic agent.
- the treatment with the G 2 /M agent is then stopped or reduced permitting the target cell, having the therapeutic agent bound to the internalising cell surface structure, to continue through its cell cycle and therefore internalise the therapeutic agent.
- Internalising cell surface structures include those having a known or suspected disease association for example with a known or suspected role (e.g. causative role) in the initiation, maintenance or progression of a particular disease or disorder. Also included are those cell surface structures whose presence on the cell surface is indicative of a particular disease or disorder state.
- the present invention is of particular use in diseases of cell cycle regulation of which the best known are those having the collective term "cancer".
- tumour cell surface structures e.g. antigen
- therapeutic agent e.g. antibody
- Internalising tumour cell surface structures include those having an established role in the initiation, progression or maintenance (or whose expression is indicative) of the cancerous state.
- These structures maybe mutated or otherwise altered forms of antigens expressed by normal cells, over expressed antigens or neoantigens, that is antigens expressed at an inappropriate point in the patients development.
- antigens are c-erB2 (HER-2/neu), c-erbB3 (HER-3,
- tumour antigens include: ⁇ integrin (J.Biological Chemistry 272(5): 2736-2743, 1997, Jan 31), ⁇ 2 integrins, e.g. Macl/LFAl, Vascular Endothelial Growth Factor receptor 1 and 2 (VEGFR-1 and 2, Dougher, M., et al, Blood (1999) 81(10): 2767-2773), EDG- 1 (Liu CH et al (1999) Mol.Biol.Cell, Apr:10(4) 1179-90), Insulin growth factor (IGF-1) receptor (J.Biol.Chem.1998 Nov 27; 273(48):31640-3) and Prostate Specific Membrane Antigen (PSMA, Liu et al, Cancer Research 58, 4055-4060, 1998).
- ⁇ integrin J.Biological Chemistry 272(5): 2736-2743, 1997, Jan 31
- ⁇ 2 integrins e.g. Macl/LFAl
- Other therapeutically useful target internalising antigens include those having known or suspected role in asthma and/or chronic obstructive pulmonary disorder (COPD). These therefore include: chemokine CCR3 (El-Shazly A., et al Biochem.Biophys. Research Comm. (1999), 264:163-170), VLA, CXCR1 Barlic j. et al, J.Biol.Chem. 23(4):16287-16294), ⁇ 2 integrin, P2Y 2 (Sromek, S.M. (1998) Molecular Pharmacology 54:485-494).
- the present invention also envisages improved treatments for diabetes mellitus by increasing cell surface density of the insulin receptor and in gene therapy where entry of the therapeutic genetic agent into the target cell is via a cell surface structure whose density can be increased by treatment with a G 2 /M agent.
- the therapeutic agent maybe an agonist, antagonist or mimetic of a particular cell function and may take the form of an antibody or other immunoglobulin (particularly when binding to the extracellular portion of the cell surface structure occurs), other protein or peptide species or otherwise a non-protein/non-peptide chemical entity (i.e. what is known in the art as a "small molecule").
- the therapeutic agent delivered into the cell following internalisation according to the present invention is advantaegously cytotoxic leading to cell death (either apoptosis or necrosis).
- the therapeutic agent is an antibody specific for the internalising cell surface structure, a number of possible outcomes may occur following binding to the internalising cell surface structure depending, at least in part, on the effector function of the antibody.
- the antibody has functional F c function this may lead to the activation of complement-mediated cytotoxicity (CMC) and/or antibody dependent cell-mediated cytotoxicity (ADCC), either of which may result in lysis or phagocytosis of the target cell.
- CMC complement-mediated cytotoxicity
- ADCC antibody dependent cell-mediated cytotoxicity
- the antibody is conjugated to a therapeutically useful substance such as a radionuclide, enzyme or toxin as is well known and practised within the field.
- the antibodies which specifically bind to an internalising cell surface structure e.g. antigen of the present invention preferably have the structure of a natural antibody or a fragment thereof.
- Antibodies typically comprise two heavy chains linked together by disulphide bonds and two light chains. Each light chain is linked to a respective heavy chain by disulphide bonds. Each heavy chain has at one end a variable domain followed by a number of constant domains. Each light chain has a variable domain at one end and a constant domain at its other end. The light chain variable domain is aligned with the variable domain of the heavy chain. The light chain constant domain is aligned with the first constant domain of the heavy chain. The constant domains in the light and heavy chains are not involved directly in binding the antibody to antigen.
- variable domains of each pair of light and heavy chains form the antigen binding site.
- the domains on the light and heavy chains have the same general structure and each domain comprises a framework of four regions, whose sequences are relatively conserved, connected by three complementarity determining regions (CDRs).
- CDRs complementarity determining regions
- the four framework regions largely adopt a beta-sheet conformation and the CDRs form loops connecting, and in some cases forming part of, the beta-sheet structure.
- the CDRs are held in close proximity by the framework regions and with the CDRs from the other domain, contribute to the formation of the antigen binding site, which in the case of the present invention is the formation of an internalising antigen binding site.
- CDRs and framework regions of antibodies may be determined by reference to Kabat et al ("Sequences of proteins of immuno logical interest" US Dept. of Health and
- the preparation of an antibody in which the CDRs are derived from a different species than the framework of the antibody's variable domains is disclosed in EP-A- 0239400.
- the CDR's may be derived from a rodent or primate monoclonal antibody.
- the framework of the variable domains and the constant domains of such altered antibodies are usually derived from a human antibody.
- Such a humanised antibody should not elicit as great an immune response when administered to a human compared to the immune response mounted by a human against a wholly foreign antibody such as one derived from a rodent.
- the antibody preferably has the structure of a natural antibody or a fragment thereof. Throughout the specification reference to antibody therefore comprises not only a complete antibody but also fragments such as a (Fab') 2 fragment, a Fab fragment, a light chain dimer or a heavy chain dimer.
- the antibody may be an IgG such as IgGi, IgG 2 , IgG 3 or IgG 4 ; or IgM, IgA, IgE or IgD or a modified variant thereof, including those that may be conjugated to other molecules such as radionuclides, enzymes etc.
- the constant region is selected according to the functionality required. Normally an IgGl will demonstrate lytic ability through binding to complement and will mediate ADCC (antibody dependent cell cytotoxicity).
- Antibodies according to the present invention also include bispecific antibodies.
- Antibodies of the present invention may be murine, chimaeric or humanised with the preferred antibody being humanised antibody.
- Step 1 Determining the nucleotide and predicted amino acid sequence of the antibody light and heavy chain variable domains
- an antibody To humanise an antibody only the amino acid sequence of the antibody's heavy and light chain variable domains needs to be known. The sequence of the constant domains is irrelevant because these do not contribute to the reshaping strategy.
- the simplest method of determining an antibody variable domain amino acid sequence is from cloned cDNA encoding the heavy and light variable domain.
- Step 2 Designing the humanised antibody
- variable domain framework residues have little or no direct contribution.
- the primary function of the framework regions is to hold the CDRs in their proper spatial orientation to recognise the antigen.
- substitution of rodent CDRs into a human variable domain framework is most likely to result in retention of their correct spatial orientation if the human variable domain framework is highly homologous to the rodent variable domain from which they originated.
- a human variable domain should preferably be chosen therefore that is highly homologous to the rodent variable domain(s).
- a suitable human antibody variable domain sequence can be selected as follows :
- CDR 3 of the heavy chain which is quite variable.
- Human heavy chains and Kappa and Lambda light chains are divided into subgroups; Heavy chain 3 subgroups, Kappa chain 4 subgroups, Lambda chain 6 subgroups.
- the CDR sizes within each subgroup are similar but vary between subgroups. It is usually possible to match a rodent antibody CDR to one of the human subgroups as a first approximation of homology.
- Antibodies bearing CDRs of similar length are then compared for amino acid sequence homology, especially within the CDRs, but also in the surrounding framework regions.
- the human variable domain which is most homologous is chosen as the framework for humanisation.
- Step 3 The actual humanising methodologies/techniques An antibody may be humanised by grafting the desired CDRs onto a human framework according to EP-A- 0239400.(see also P.T. Jones et al, Nature 321:522
- a DNA sequence encoding the desired reshaped antibody can therefore be made beginning with the human DNA whose CDRs it is wished to reshape.
- the rodent variable domain amino acid sequence containing the desired CDRs is compared to that of the chosen human antibody variable domain sequence.
- the residues in the human variable domain are marked that need to be changed to the corresponding residue in the rodent to make the human variable region incorporate the rodent CDRs.
- Oligonucleotides are synthesised that can be used to mutagenise the human variable domain framework to contain the desired residues. Those oligonucleotides can be of any convenient size. One is normally only limited in length by the capabilities of the particular synthesiser one has available. The method of oligonucleotide-directed in vitro mutagenesis is well known.
- PCR polymerase chain reaction
- the technique of WO92/07075 can be performed using a template comprising two human framework regions, AB and CD and between them, the CDR which is to be replaced by a donor CDR.
- Primers A and B are used to amplify the framework region AB, and primers C and D used to amplify the framework region CD.
- the primers B and C each also contain, at their 5' ends, an additional sequence corresponding to all or at least part of the donor CDR sequence.
- Primers B and C overlap by a length sufficient to permit annealing of their 5 ' ends to each other under conditions which allow a PCR to be performed.
- the amplified regions AB and CD may undergo gene splicing by overlap extension to produce the humanised product in a single reaction.
- Step 4 The transfection and expression of the reshaped antibody
- the mutagenised DNAs can be linked to an appropriate DNA encoding a light or heavy chain constant region, cloned into an expression vector, and transfected into host cells, preferably mammalian cells. These steps can be carried out in routine fashion.
- a reshaped antibody may therefore be prepared by a process comprising :
- the DNA sequence in step (a) encodes both the variable domain and the or each constant domain of the human antibody chain.
- the humanised antibody can be recovered and purified.
- the cell line which is transformed to produce the altered antibody may be Chinese Hamster Ovary (CHO) cell line or an immortalised mammalian cell line, which is advantageously of lymphoid origin, such as a myeloma, hybridoma, trioma or quadroma cell line.
- the cell line may also comprise a normal lymphoid cell, such as a B-cell, which has been immortalised by transformation with a virus, such as the Epstein-Barr virus.
- the immortalised cell line is a myeloma cell line or a derivative thereof.
- the expression system of choice is the glutamine synthetase expression system described in
- the cell line used to produce the humanised antibody is preferably a mammalian cell line
- any other suitable cell line such as a bacterial cell line or a yeast cell line
- K coli - derived bacterial strains could be used.
- the antibody obtained is checked for functionality. If functionality is lost, it is necessary to return to step (2) and alter the framework of the antibody.
- the whole antibodies, their dimers, individual light and heavy chains, or other immunoglobulin forms of the present invention can be purified according to standard procedures of the art, including ammonium sulfate precipitation, affinity columns, column chromatography, gel electrophoresis and the like (see generally Scopes, R, Protein Purification, Springer- Verlag, N.Y. (1982)).
- Substantially pure immunoglobulins of at least about 90 to 95% homogeneity are preferred and 98 to 99% or more homogeneity most preferred, for pharmaceutical uses.
- an antibody may then be used therapeutically.
- G 2 M agents of the present invention are capable of affecting cell growth by blocking (or retarding) progression of the cell cycle G 2 and/or M.
- G 2 /M agents which are capable of blocking (or retarding) cell cycle progression in G 2 and/or M are vinorelbine, cisplatin, mytomycin, paclitaxel, carboplatin, oxaliplatin and CPT-II
- the dose and regimen employed according to the present invention may be the same or substantially similar to an established dose and regimen for that G 2 /M agent.
- Vinorelbine tartrate is a semisynthetic vinca alkaloid with the chemical name 3',4'- didehydro -4'-deoxy-C'-norvincaleukoblastine [R-(R*,R*)-2,3- dihydroxybutanedioate (1 :2)(salt)].
- Vinorelbine tartrate is used in combination with other chemotherapy agents such as cisplatin or as a single agent in the treatment of various solid tumours particularly non-small cell lung, advanced breast, and hormone refractory prostate cancers.
- the brand name Navelbine® is used in North America and Europe. Navelbine® is administered intravenously as a single-agent or in combination therapy typically at doses of 20-30 mg/m ⁇ on a weekly basis.
- An oral formulation of vinorelbine is in clinical development.
- Cisplatin has the chemical name cis-diamminedichloroplatinum. Cisplatin is used in the treatment of metastatic testicular tumours as a combination therapy, as single and combination therapy in metastatic ovarian tumours, as well as a single agent in advanced bladder cancer. Cisplatin is manufactured by Bristol-Myers Squibb under the brand names of Platinol® and Platinol-AQ®. Cisplatin is also used in the following types of cancer, typically in combination therapy: non-small cell and small cell lung cancers, head and neck, endometrial, cervical, and non-Hodgkin's lymphoma. Cisplatin is typically administered intravenously in doses ranging from
- Carboplatin has the chemical name platinum, diammine [1,1-cyclobutane- dicarboxylato(2)-0,0']-(SP-4-2). Carboplatin is usually administered in combination with other cytotoxics such as paclitaxel and etoposide. It is used in the treatment of advanced ovarian cancer, non-small cell lung cancer as well as in many of the same types of cancer as cisplatin is used. The brand name of carboplatin manufactured by Bristol-Myers Squibb is Paraplatin®.
- Carboplatin is typically administered intravenously at 300 - 400 mg/m ⁇ , or to a target area under the drug concentration versus time curve (AUC) of 4-6 mg/ml-min using the patient's estimated glomerular filtration rate (GFR). Higher doses up to around 1600 mg/ni ⁇ divided over several, usually five, days may also be administered.
- AUC drug concentration versus time curve
- GFR estimated glomerular filtration rate
- Paclitaxel has the chemical name 5 ⁇ , 20 epoxy-l,2 ⁇ ,4,7 ⁇ ,10 ⁇ ,13 ⁇ -hexahydroxytax- 1 l-en-9-one 4,10-diacetate 2-benzoate 13-ester with (2R, 3S)-N-benzoyl-3- phenylisoserine.
- Paclitaxel is manufactured by Bristol-Myers Squibb as Taxol®. It is used to treat a variety of carcinomas including ovarian, breast, non-small cell lung, head and neck. Typical doses include 135-175 mg/m ⁇ as either a 3 or 24 hour intravenous infusion given every 3 or 4 weeks. Higher doses up to around 300 mg/m ⁇ have also been administered.
- the drug products provided by manufacturers typically contain a diluent such as sterile water, dextrose 5% in water or 0.9% sodium chloride in water with additional excipients such as Cremophor vehicle added to make for example, paclitaxel soluble.
- a diluent such as sterile water, dextrose 5% in water or 0.9% sodium chloride in water with additional excipients such as Cremophor vehicle added to make for example, paclitaxel soluble.
- anthracyclines e.g. doxorubicin and aclarubicin
- carmustine BC ⁇ U
- camptothecin camptothecin
- 9-nitro-camptothecin cyclophosphamide and its derivatives
- docetaxel etoposide
- Razoxane ICRF-187
- alkyllyso-phospholipids e.g.
- ilmofosine methotrexate, MST-16, taxanes, vinblastine, vincristine and teniposide (VM-26) (again see Martindale, The Extra Pharmacopoeia, 31st edition, edited by JEF Reynolds, London, Royal Pharmaceutical Society, 1996,) and flavonoids e.g. apigenin and genistein (see The Merck Index, 12th edition, Merck Research Laboratories, Merck and Co Inc, 1996).
- adozelesin (a class of pyrazole compounds) (Cancer Research 1992, October 15; 52 (2) : 5687 to 5692)), Bistratene A (Mutation Research 1996, March 1; 367 (3) : 169 to 175), cycloxazoline (Cancer Chemotherapy & Pharmacology 1994; 33(5) : 399 to 409), imidazoarcridinone, melephan (Experimental Cell Biology 1986; 54 (3) : 138 to 148 and International Journal of Cancer 1995, Jul 17; 62 (2) : 170 to 175 ), merbarone (Environmental & Molecular Mutagenesis 1997; 29 (1) : 16 to 27 and Cancer Research 1995, Apr 1; 55 (7) : 1509 to 1516 ) and oracin (FEBS Letters 1997, Jan 2; 400 (1) : 127 to 130) are also believed to block (or retard) cell cycle progression in G 2 and/or M.
- topo II inhibitors e.g. to potecan (abpi, 1998-1999)
- all vinca derivatives and all DNA damaging agents including radiation are also believed to arrest cells in G 2 and/or M.
- Further examples include RAF kinase inhibitors (see for example, Clinical Can.Res 4(5):1111-1116, May 1998 and our co- pending application WO 99/10325, the entire contents of which are incorporated herein by reference and to which the reader is specifically referred).
- 5FU has been reported to arrest cells in G 2 and/or M (Oncology Research 1994; 6(7):303-309) and it is therefore believed that 5FU and compounds similar to 5FU such as UFT, methotrexate, capecitabine and Gemcitabine will increase internalising antigen expression in some tissues.
- tomudex Raloxifen which is known to arrest cells in the S phase is believed to increase internalising antigen expression.
- G 2 /M agent is therefore not limited to cytotoxic therapy, but also encompasses cytostatic therapy and any other drugs capable of blocking (or retarding) cell cycle progression in G 2 and/or M. Combinations of drugs which together result in blocking or retarding cell progression at or through G 2 /M are contemplated.
- a G 2 /M agent includes combinations of one or more specific chemotherapeutic agents which arrest (or retard) internalising cell surface structure expressing cells (particularly tumour antigens) in G 2 and/or M.
- Examples of typical combinations are vinorelbine with cisplatin and paclitaxel with carboplatin; oxaliplatin with 5FU; cyclophosphamide with methotrexate and 5FU; cyclophosphamide with doxorubicin and 5FU.
- G 2 /M agent While it is possible for the G 2 /M agent to be administered alone it is preferable to present it as a pharmaceutical composition comprising an active ingredient, as defined above, together with an acceptable carrier therefor.
- an acceptable carrier therefor.
- Each carrier must be "acceptable” in the sense of being compatible with the other ingredients of the composition and not injurious to the recipient.
- Therapeutic protocols for administration of the G 2 /M agent and therapeutic agent (particularly where the therapeutic agent is an antibody or other immunoglobulin) include: administering the therapeutic agent once every one or two weeks, preferably once every three or four weeks or a combination thereof for as long as necessary.
- the G 2 /M agent is given according to the established regimen for that agent or a regimen which will allow exposure of internalising cell surface structure expressing cells to be blocked/arrested or retarded in G /M.
- Preferred dosing schedules vary with the therapeutic agent and disease state but include, for example, once weekly, once every three or four weeks, or daily for several (e.g. 3-5) days repeated every three or four weeks for as long as necessary.
- Dosing of the therapeutic agent may take place on the same day or different days as indicated for the G /M agent. Adjustment of the dosing schedule or strength of dose to prevent or decrease toxicity or side effects may take place with either the therapeutic agent or the G 2 /M agent.
- the preferred dosing schedule for co-administration of vinorelbine and cisplatin in combination with a therapeutic agent which binds the target internalising cell surface structure is administration of the agent at a dose supported by clinical studies e.g. 30mg/m 2 once a week for as long as necessary but typically for a period of 3 to 4 weeks, followed by a 30mg/m 2 dose every other week thereafter for as long as necessary.
- Vinorelbine is administered at a dose 25mg/m 2 on day 1,8,15 and 22.
- Cisplatin is given only once at a dose of 100mg/m 2 on day 1. Thereafter the vinorelbine /cisplatin regime is repeated every 28 days for as long as necessary.
- vinorelbine, cisplatin and the antibody are administered at the same time on day one over a period of about 2 to 3 hours.
- paclitaxel, carboplatin and the antibody are preferably administered together on day 1 over a period of about 2 to 3 hours.
- Other preferred dosage schedules which comprise the combination of the antibody with any of navelbine, cisplatin or taxol on their own would comprise similar dosages and administration schedules, using just one anticancer agent instead of two.
- Preferred combinations of a therapeutic agent and a G 2 /M agent are: The therapeutic agent in combination with any of the following chemotherapeutic agents: UFT, Capecitabine, CPT-II, Oxaliplatin, 5FU, 5FU continuous infusion, Paclitaxel, Docetaxel, Cyclophosphamide, Methotrexate, Doxorubicin, Navelbine (iv and oral), Epirubicin, Mitoxantrone, Raloxifen, Cisplatin, Mitomycin, Carboplatinum, Gemcitabine, Etoposide and Topotecan.
- chemotherapeutic agents UFT, Capecitabine, CPT-II, Oxaliplatin, 5FU, 5FU continuous infusion, Paclitaxel, Docetaxel, Cyclophosphamide, Methotrexate, Doxorubicin, Navelbine (iv and oral), Epirubicin, Mitoxantrone, Raloxifen, Cisplatin, Mitomycin, Carbo
- Particularly preferred combinations are the therapeutic agent with CPT-II, 5FU (continuous infusion), Oxaliplatin, Capecitibine, UFT and Tomudex (Raloxifen).
- the therapeutic agent in combination with: UFT (optionally with Leucovorin); Capecitabine; Oxaliplatin (optionally with 5FU); CPT-II, 5FU (optionally with Eniluracil or Levamisole or Leucovorin); 5FU protracted continuous infusion; and Mitomycin.
- Preferred combinations for the treatment of breast cancer are: the therapeutic agent in combination with Paclitaxel; Docetaxel; Cyclophosphamide (optionally with 5FU and either Methotrexate or Doxorubicin); Navelbine (iv and/or oral); Doxorubicine; Epirubicin; Mitoxantrone; and tomudex.
- Preferred combinations for the treatment of gastric cancer are: the therapeutic agent in combination with Cisplatin; 5FU; Mitomycin; and Carboplatinum.
- a preferred combination for the treatment of prostatic cancer is: the therapeutic agent in combination with Mitoxantrone.
- Preferred combinations for the treatment of non-small-cell lung cancer are: the therapeutic agent in combination with: Navelbine; Cisplatin; Carboplatin; Paclitaxel; Docetaxel; Gemcitabine; Topotecan; and Etoposide.
- compositions of the present invention include those suitable for oral, rectal, nasal, topical (including buccal and sublingual), vaginal, parenteral (including subcutaneous, intramuscular, intravenous and intradermal) or transdermal administration.
- the preparations may conveniently be presented in unit dosage form and may be prepared by any methods well known in the ait of pharmacy. Such methods include the step of bringing into association the active ingredient with the carrier which constitutes one or more accessory ingredients.
- the compositions are prepared by uniformly and intimately bringing into association the active ingredient with liquid carriers or finely divided solid carriers or both, and then if necessary shaping the product.
- the preparation may comprise the G 2 /M agent and therapeutic agent as separate compositions suitable of administration or combined into a single composition ready for administration.
- Preparations of the G /M agent suitable for oral administration may be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution or suspension in an aqueous or non-aqueous liquid; or as an oil-in-water liquid emulsion or a water- in-oil liquid emulsion.
- the active ingredient may also be presented as a bolus, electuary or paste.
- a tablet may be made by compression or moulding, optionally with one or more accessory ingredients.
- Compressed tablets may be prepared by compressing in a suitable machine the active ingredient in a free-flowing form such as a powder or granules, optionally mixed with a binder (e.g. povidone, gelatin, hydroxypropylmethyl cellulose), lubricants, inert diluent, preservative, disintegrant (eg. sodium starch glycollate, cross-linked povidone, cross-linked sodium carboxymethyl cellullose) surface-active or dispersing agent.
- Moulded tablets may be made by moulding in a suitable machine a mixture of the powdered compound moistened with an inert liquid diluent.
- the tablets may optionally be coated or scored and may be formulated so as to provide slow or controlled release of the active ingredient therein using, for example, hydroxypropylmethyl cellulose in varying proportions to provide the desired release profile. Tablets may optionally be provided with an enteric coating to provide release in parts of the gut other than the stomach.
- Preparations suitable for oral use as described above may also include buffering agents designed to neutralise stomach acidity.
- buffers may be chosen from a variety of organic or inorganic agents such as weak acids or bases admixed with their conjugated salts.
- Preparations suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured basis, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert basis such as gelatine and glycerin, or sucrose and acacia and mouthwashes comprising the active ingredient in a suitable carrier.
- Preparations for rectal administration may be presented as a suppository with suitable base comprising for example cocoa butter or a salicylate.
- suitable base comprising for example cocoa butter or a salicylate.
- Preparations suitable for vaginal administration may be presented as pessaries, tampons, creams, gels, pastes, foams or spray formulations containing in addition to the active ingredient such carriers as are known in the art to be appropriate.
- Preparations suitable for parenteral administration include aqueous and non-aqueous isotonic sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the compositions isotonic with the blood of the intended recipient; and aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, such as liposomes or other microparticulate systems which are designed to target the compounds to blood components or one or more organs.
- aqueous and non-aqueous isotonic sterile injection solutions which may contain anti-oxidants, buffers, bacteriostats and solutes which render the compositions isotonic with the blood of the intended recipient
- aqueous and non-aqueous sterile suspensions which may include suspending agents and thickening agents, such as liposomes or other microparticulate systems which are designed to target the compounds to blood components or one or more organs.
- the preparations may be presented in unit-dose or multi-dose sealed containers, for example, ampoules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of sterile liquid carrier, for example water for injections, immediately prior to use.
- sterile liquid carrier for example water for injections
- Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules and tablets of the kind previously described.
- Preparations suitable for transdermal administration may be presented as discrete patches adapted to remain in intimate contact with the epidermis of the recipient for a prolonged period of time.
- patches suitably contain the active ingredient as an optionally buffered, aqueous solution of, for example, 0.1-0.2M concentration with respect to said compound.
- the active ingredient may be delivered from the patch by iontophoresis as generally described in Pharmaceutical Research, 3 (6),318 (1986).
- compositions in question for example, those suitable for oral administration may include such further agents as sweeteners, thickeners and flavouring agents.
- a pharmaceutical preparation comprising a G 2 /M agent and an therapeutic agent preferably together with instructions for administrating the preparation to a mammalian patient, preferably human (i.e. instructions for carrying out a medical treatment, particularly a treatment for a disease of cell cycle regulation such as cancer or particular diseases or disorders that the preparation is useful for/approved for).
- Simultaneous treatment of the patient in accordance with the instructions may lead to a biological interaction within the patient between the G /M agent and the therapeutic agent which interaction has enhanced therapeutic effect (e.g. additive or synergistic effect).
- the interaction between the G 2 M agent and therapeutic agent can be determined as enhanced (e.g. additive, but preferably synergistic) by comparing the effectiveness of the simultaneous treatment of G 2 /M agent and the therapeutic agent on the one hand and the effectiveness of non-simultaneous treatment.
- additive and “synergistic” being terms of the art.
- a method of treating a mammalian patient afflicted with cancer which method comprises the step of simultaneously treating said patient with cytotoxic agent and a cytostatic agent, particularly one which blocks or retards cell cycle progression in G and/or M.
- a method of treating a mammalian patient, particularly human patient afflicted with a disease of cell cycle regulation e.g. cancer which method comprises the step of simultaneously treating said patient with a G /M agent and a therapeutic agent (e.g. antibody or small molecule) which is capable of specifically binding an internalising antigen presented on the cell surface of the diseased (i.e cancerous) cell.
- a disease of cell cycle regulation e.g. cancer
- a therapeutic agent e.g. antibody or small molecule
- a method of treating a mammalian patient afflicted with a disease of cell cycle regulation e.g. cancer which method comprises the step of simultaneously treating said patient e.g. human with a G 2 /M agent and a therapeutic agent, preferably a non-protein/non- peptide chemical agent, which therapeutic agent targets (e.g. binds to and/or inhibits the function of) one or more of the following: A tyrosine kinase e.g. erbB2 or VEGFr-2.
- a method of treating a mammalian patient e.g.
- human afflicted with a disease of cell cycle regulation such as cancer which method comprises the step of simultaneously treating said patient with an effective amount of a G 2 /M agent and an effective amount of a therapeutic agent which binds to an internalising antigen (either at the extracellular, transmembrane or intracellular portion of the internalising antigen) thereby bringing about a therapeutic effect on said patient.
- a method of treating a mammalian patient e.g. human afflicted with a disease of cell cycle regulation such as cancer comprises the step of simultaneously treating said patient with an effective amount of a G /M agent and an effective amount of a therapeutic agent which therapeutic agent binds to an internalising antigen (either at the extracellular, transmembrane or intracellular portion of the internalising antigen), said G 2 /M agent and therapeutic agent interacting within said patient, said interaction having a synergistic therapeutic effect on said patient.
- a G /M agent and a therapeutic agent whose therapeutic effectiveness depends on the expression of an internalising cell surface structure such as an antigen on a target diseased cell which internalisation is capable of being blocked or impeded by said G 2 /M agent.
- a combination of a G 2 /M agent and a therapeutic agent whose therapeutic effectiveness depends at least in part on the expression of an internalising cell surface structure such as an antigen whose density at the cell surface can be increased by treatment of the cell with the G 2 /M agent.
- kits-of-parts comprising a G 2 /M agent and a therapeutic agent whose therapeutic effectiveness depends, at least in part, on the presence of an internalising cell surface structure on a target cell.
- G 2 /M agent and therapeutic agent in combination (whether described as a combination or not) is not:
- Ep-CAM specific antibodies together with a G 2 /M agent.
- Monoclonal antibodies such as disclosed in WO 89/06692 (specifically Herceptin®, otherwise known as trastuzumab or rhuMab) together with Taxol, docetaxel or
- EGFr Epidermal growth factor receptor
- FIG. 6 Populations of PC-3 prostatic adenocarcmoma cells in culture were evaluated for distribution in G 0 /G 1 (solid line), S (dotted line), and G /M (dashed line) phases of cell cycle and characterized for Ep-CAM antigen expression at each phase. Ep-CAM is expressed at higher density and homogeneity in S and G /M phases.
- Populations of PC-3 prostatic adenocarcinoma cells were evaluated for distribution in G 0 /G l5 S and G /M phases of the cell cycle as well as Ep- CAM expression of the cell surface.
- Figure 6 demonstrates that Ep-CAM is expressed across the cell cycle, but at higher density and greater homogeneity in cells in S and in G 2 /M phases than G 0 /G ⁇ . This pattern of expression has been documented in a number of other human colon, prostate, and lung tumor cells in culture.
- FIG. 7 Cell Cycle Analysis and Quantitation of Antigen Expression. Populations of adenocarcinoma cells were evaluated for distribution in Go/G 1; S, and G 2 /M phases of the cell cycle as well as Ep-CAM presentation on the cell surface. Subconfment cells were exposed to Navelbine or Taxol for up to 24 hours, then washed and exposed to cisplatin or carboplatin, respectively, overnight. Cells were exposed to 5- fluorouracil (5-FU) for 24 hours, and to the interferons continuously for 2-5 days. Cells were washed and cultured for another 2 days prior to analysis for antigen presentation except for cells exposed to interferons.
- 5-FU 5- fluorouracil
- Cells were lightly trypsinized and mechanically detached from the culture flasks and resuspended in calcium- and magnesium-free phosphate-buffered saline containing bovine serum albumin and sodium azide. Exactly 2 x 10 5 cells were stained with FITC-323/A3 murine IgG antibody or FITC-murine IgG (control). Cells were fixed with cold paraformaldehyde, then permeabilized for DNA staining with Tween-20. Cellular DNA was stained with a propidium iodide buffer containing RNAse A.
- Listmode data were acquired using Lysis II software on a FACScan flow cytometer (Becton Dickinson Immunocytometry Systems) equipped with a 488 nm laser. Cell cycle analysis was done using CellFit software for SOBR modeling of the histograms (where possible, otherwise manual estimations were employed) on Cell-Fit. Ep-CAM antigen presentation was quantitated by comparison of the mean fluorescence intensity of fluorescein-conjugated 323/A3 bound to cultured cells with the fluorescence intensity of calibrated microbead standards and evaluated separately using histogram analysis in WinList (Verity Software House). Standard curves of calibration bead concentration versus fluorescence intensity were constructed in SoftMax Pro (Molecular Devices, Inc.), and fluorescence intensity of stained cells was used to calculate the number of antigen molecules per cell for the population.
- Adenocarcinoma cells (HT-29) were exposed to Navelbine or Taxol or combinations of drugs as indicated in Figure 7 and the cells were evaluated for cell surface Ep- CAM presentation in addition to cell cycle distribution.
- Cell cycle analysis demonstrated that only 6.3% of the media control cells were in S and G 2 /M phases combined, compared to 39.4% of the Navelbine followed by cisplatin (CDDP) combination and 82.6% of Taxol followed by carboplatin (CPBDA) combination. More importantly, both drug combinations caused significant increases in cell surface Ep-CAM expression.
- Antigen expression was not significantly increased in cells exposed to 5-FU, interferon-alpha, or interferon-gamma, which had only 7.9%, 12%, and 11.5%, respectively, of cells in S and G 2 /M phase. Thus, only the drugs that caused accumulation of cells in S or G /M phases were able to produce a significant increase in Ep-CAM antigen presentation. It has reported in the literature that interferons cause an increase in cell surface presentation of certain antigens by exerting their affect at the level of gene expression. Our results are consistent with the published results of others (Shimada, S., Ogawa, M. ' , Schlom, J. and Greiner J. W.
- Figure 8 The cell surface quantitation of Ep-CAM antigen and cell cycle distribution from various human colon (A, B), lung (C, D) adenocarcinoma cells in culture.
- Cells were exposed to Navelbine (NVL; 30 nM) plus cisplatin (CDDP; 5 ⁇ M), or Taxol (TAX; 80 nM) plus carboplatin (CBPDA; 100 ⁇ M) and compared to media alone.
- the area of each bar is divided to indicate the percentage of cells in G 0 /G ⁇ , S, and G 2 /M phases; the height of each bar indicates the average number of Ep-CAM molecules per cell within the total population.
- Ep-CAM density was dose-dependent and correlated with the effectiveness of cycle block (data not shown).
- the four normal cell lines did not achieve cycle block as effectively and did not show any increase in antigen presentation , which remained undetectable in 2 of the normal cell populations.
- Figure 9 Ep-CAM Antigen Expression and ADCC of Prostatic Adenocarcinoma in
- PC-3 adenocarcinoma target cells were exposed to either
- Spontaneous lysis wells received media (no effectors) and total lysis wells (CPM ⁇ otai) received Triton-X-100. Cultures were incubated for 6 hours at 37°C/5% CO 2 , then supernatants were harvested using Skatron filter frames (Skatron Instruments, Sterling VA). Radioactivity was counted in a gamma counter and the percentage specific release, corrected for spontaneous lysis, was calculated.
- PC-3 prostatic adenocarcinoma cells in culture exposed to Navelbine followed by cisplatin were better targets for human ADCC activity in vitro than control cells.
- PC-3 prostatic adenocarcinoma cells were pretreated with Navelbine alone or Navelbine followed by cisplatin and the in vitro lytic efficacy of the humanized antibody GW3622W94) was evaluated by ADCC. The results are shown in Figure 8b.
- HT-29 tumors Human colon adenocarcinoma (HT-29) tumors were initiated by subcutaneous implantation into female CD-I nude mice (Charles River). When the tumors reached 200-300 mg, animals were divided into groups of five. Navelbine was injected intravenously at a dosage of 28 mg/kg in vehicle (5% dextrose in distilled water) on days 1 and 5. This dose of Navelbine was close to the LDio for this mouse strain and caused minimal tumor regression. A control group was dosed with 5-fluorouracil (5-FU) intraperitoneally at 20 mg/kg on days 1 and 5. On day 6, antibody GW1209W95 was labeled with lutetium-177 and injected intravenously via the lateral tail vein.
- 5-fluorouracil 5-fluorouracil
- Each mouse received a 200 ⁇ L injection containing 2.09 ⁇ Ci 177 Lu-GW1209W95 (4.1 ⁇ g protein).
- Blood, spleen, liver, lung, kidney, femur, and tumor were harvested on days 1, 3 and 5 post- antibody-dose for direct gamma counting (Packard).
- FIG. 11 Internalization of Ep-CAM antigen on HT-29 colon adenocarcinoma cells in culture was signficantly inhibited by prefreatment with chemotherapeutic agents. Internalization of Lutetium-177-labeled GW1208W95 (anti-Ep-CAM) by Human Colon Adenocarcinoma Cells. Colon adenocarcinoma cells (HT-29) were plated in 6- well plates and cultured. Subconfluent cells were exposed to cytotoxic drugs for up to 24 hours. Cells were washed and cultured for another 2-5 days.
- the plates were put on ice (0°C) for minimum of 60 minutes and lutetium-177-labeled coupled to 6,6"- bis ⁇ N,N,N",N"-tetra(carboxymethyl)aminomethyl)-4'-(3-bromoacetamido-4- methoxyphenyl-2,2' :6,2"-terpyridine) at 0.5-1.0 mCi/mg was added at a final concentration of 6.7 nM.
- Cells were incubated at 0°C for 3.5 hr. Following incubation at 0°C, the cells were washed with 2.5 mL of ice-cold phosphate-buffered saline with human serum albumin (1%) (PBS-HSA).
- Ep-CAM does internalize (Kyriakos, R. J., Shih, L. B., Ong, G. L., Patel, K., Goldenberg, D. M. and Mattes, M. J. The Fate of Antibodies Bound to the Surface of Tumor Cells in Vitro" Cancer Research 52:835-842, 1992.). Since the agents evaluated in this study are microtubule targets, it seemed logical to evaluate the effect of these agents on the internalization of Ep-CAM.
- Colon adenocarcinoma cells in culture were pretreated with chemotherapeutic agents as described previously for the evaluation of cell cycle and cell surface antigen quantitation. Following treatment with either Navelbine (30 nM) alone or Navelbine followed by cisplatin (2.5 ⁇ M), cells were evaluated for antigen internalization using established literature protocols (Novak- Hofer, I., Amstutz, H. P., Morgenthaler J. and Schubiger, P. A. Internalization and Degradation of Monoclonal Antibody chCE7 by Human Neuroblastoma Cells. Int. J.
- adenocarcinoma cells were evaluated for distribution in G 0 /G ⁇ , S and G 2 /M phases of the cell cycle as well as for erbB2/neu presentation.
- Cells were dissociated from the culture plates using Versene (Gibco) and resuspended in calcium- and magnesium-free phosphate-buffered saline containing bovine serum albumin and sodium azide. Exactly 2 x 10 5 cells were stained with R-Phycoerythrin- conjugated-anti-HER-2/neu murine IgG (Cat. 340552, Becton Dickinson) in buffer containing 100 ⁇ g/mL mouse IgG (Cat. 15381, Sigma).
- Sample data were collected on a FACStar P US® flow cytometer (Becton Dickinson) equipped with a 488nm argon ion laser in position 1 and a 350nm argon ion laser in position 2.
- data was collected on signal pulses from linear forward scatter height and width, linear area and width of DAPI fluorescence for DNA, and logarithmic fluorescence height of the HER-2/neu antibody probe.
- the resulting listmode files were processed using Winlist 3D ® software (Verity Software House, Topsham, ME). Displays of cell population data was used to discriminate doublets and aggregates revealed by forward scatter width and DAPI fluorescence width versus DAPI fluorescence area.
- ABS ABS Cell
- Figure 1 shows that erbB2 is expressed across the cell cycle, but at higher density and greater homogeneity (data not shown) on cells in S and in G /M phases than in G 0 /G ⁇ .
- the examples include MCF-7 (breast), MDA-MB-468 (breast), H322 (lung) and A549 (lung) adenocarcinomas. This pattern of expression has been documented in all epithelial-derived tumors cells studied to date.
- Example 2 Increased presentation of erbB2 receptor on adenocarcinoma cells was associated with arrest of cell cycle progression and accumulation of cells in S and G 2 /M phases.
- Adenocarcinoma cells were exposed to various drugs or combinations of drags as indicated in Figure 2 A-D.
- Subconfluent cells were exposed to vinorelbine (Navelbine® (NVL), Glaxo Wellcome, Inc., RTP, NC) or paclitaxel (Taxol (TAX), Bristol-Myers Squibb, Princeton, NJ) for up to 24 hours, then washed and exposed to cisplatin (CDDP, Bristol Laboratories, Princeton NJ) or carboplatin (Paraplatin® (CBPDA), Bristol Oncology, Princeton, NJ). Cells were exposed to Gemzar (gemcitabine (GMZ), Lilly, Indianapolis, IN) for 24 hours.
- the high erbB2 expressing cell lines, BT-474 and NCI H322 were treated with the metalloprotease inhibitor BB-94 (10 ⁇ M) to prevent ectodomain shedding (Codony- Servat, J., Albanell, J., Lopez-Talvera, J. C, Arribas, J., and Baselga, J. "Cleavage of the HER-2 Ectodomain is a Pervanadate-activable Process That is Inhibited by the Tissue Inliibitor of Metalloproteases- 1 in Breast Cancer Cells" Cancer Research 59, 1196-1201 (1999)).
- the cell volume increases until mitosis occurs and thus, the relationship between cell cycle and cell size may translate to a greater surface area and possibly greater antigen expression, assuming equivalent surface density.
- Ectodomain is a Pervanadate-activable Process That is Inhibited by the Tissue Inhibitor of Metalloproteases- 1 in Breast Cancer Cells" Cancer Research 59, 1196-
- Adenocarcinoma cells were exposed to various drugs or combinations of drugs as indicated in Figure 3A and B.
- Subconfluent cells were exposed to vinorelbine (Navelbine® (NVL), Glaxo Wellcome, Inc., RTP, NC) or paclitaxel (Taxol (TAX), Bristol-Myers Squibb, Princeton, NJ) for up to 24 hours, then washed and exposed to cisplatin (CDDP, Bristol Laboratories, Princeton NJ) or carboplatin (Paraplatin® (CBPDA), Bristol Oncology, Princeton, NJ). Cells were exposed to interferons continuously for 2-5 days.
- Example 4 Increased erbB2 receptor presentation was not observed on normal cells exposed to cytotoxic agents in vitro.
- Example 5 Increases in erbB2 receptor presentation caused by Navelbine and Taxol are not a result of increased gene expression.
- Adenocarcinoma cells were exposed to various drags or combinations of drags as indicated in Figure 5.
- Subconfluent cells were exposed to vinorelbine (Navelbine® (NVL), Glaxo Wellcome, Inc., RTP, NC) or paclitaxel (Taxol (TAX), Bristol-Myers Squibb, Princeton, NJ) for up to 24 hours, then washed and exposed to cisplatin (CDDP, Bristol Laboratories, Princeton NJ) or carboplatin (Paraplatin® (CBPDA), Bristol Oncology, Princeton, NJ). Cells were exposed to Gemzar (gemcitabine (GMZ), Lilly, Indianapolis, IN) for 24 hours.
- Probe (5'CGCCGCTAGAGGTGAAATTCT 3'), 20nM reverse primer (5'CATTCTTGGCAAATGCTTTCG 3') and 50 nM of Probe (5' Joe-6-carboxy-4,5- dichloro-2,',7'-tefrachlorofluorescein-ACCGGCGCAAGACGGACCAGA-TAMRA-
- the probe is covalently bound to a
- RNA was transferred to a replicate 96-well plate containing a RT- PCR reaction cocktail, as outlined above.
- 300 nM of forward primer (5'GGATGTGCGGCTCGTACAC 3')
- 300 nM of reverse primer (5' GTAATTTTGACATGGTTGGGACTCT 3')
- 150 nM of probe (5' FAM(6- carboxyfluorescein)-ACTTGGCCGCTCGGAACGTGC-TAMRA 3') was added to the cocktail mixture.
- Real-time PCR analysis of the RNA for ErbB2 expression was carried out using the standard laboratory protocols as outlined previously (Strum, J.C., Carrick. K.M., Stuart, J.S.
- the amount of gene expression for each cell line was determined by comparing the gene expression of the treatment group to the control group.
- the ⁇ Ct value was determined by subtracting the Ct value of the treatment group from the Ct value of the control group.
- the fold equation (2 ⁇ Ct ) for each treatment group was determined and the significance difference reported to be 2 fold or greater.
- Cisplatin (CDDP), Gemzar (GMZ) and INF- ⁇ were toxic to SK-BR-3, MCF-7 and BT-474 breast adenocarcinoma cell lines ( Figure 5 A) based on the 18s values, resulting in low ratios. It appears that the increases in erbB2 receptor presentation that we have seen following exposure of cell lines to agents that block cell cycle arrest in G 2 /M are not due to increased expression of erbB2 receptor gene.
- Cells in culture that present a cell surface target(s) of interest are identified and exposed to various drugs or combinations of drags as indicated.
- Subconfluent cells were exposed to vinorelbine (Navelbine® (NVL), Glaxo Wellcome, Inc., RTP, NC) or paclitaxel (Taxol (TAX), Bristol-Myers Squibb, Princeton, NJ) for up to 24 hours, then washed and exposed to cisplatin (CDDP, Bristol Laboratories, Princeton NJ) or carboplatin (Paraplatin® (CBPDA), Bristol Oncology, Princeton, NJ). Cells were exposed to Gemzar (gemcitabine (GMZ), Lilly, Indianapolis, IN) for 24 hours.
- Cells were exposed to interferons continuously for 2-5 days. Agent concentration and duration of exposure are optimised for maximal cell cycle block in G 2 /M and minimal cell death.
- Cells were dissociated from the culture plates while maintaining the integrity of the cell surface target using Versene (Gibco), trypsin (Gibco), or collagenase (Gibco) and resuspended in calcium- and magnesium-free phosphate- buffered saline containing bovine serum albumin and sodium azide. Exactly 2 x 10 5 cells were stained with a fluorescent-conjugated antibody(ies) that binds with high affinity to the cell surface target(s) of interest in buffer containing 100 ⁇ g/mL mouse IgG (Cat. 15381, Sigma).
- Sample data were collected on a FACStar PLUS® flow cytometer (Becton Dickinson). For each cell analysed, data were collected on signal pulses from linear forward scatter height and width, linear area and width of DAPI fluorescence for DNA, and logarithmic fluorescence pulse height of the cell surface target(s) of interest antibody probe. The resulting listmode files were processed using Winlist 3D ® software (Verity Software House, Topsham, ME). Displays of cell population data were used to discriminate doublets and aggregates revealed by forward scatter width and DAPI fluorescence width versus DAPI fluorescence area. The remaining cells were analysed for surface antigen density and for cell cycle position by manual gating .
- Antigen presentation was quantified against bead standards calibrated by the vendor for murine IgG binding capacity (Quantum Simply Cellular Bead, Cat. QSC-100, Sigma); calibration beads were stained with R-phycoerythrin-conjugated anti-HER- 2/neu murine IgG. Plots of fluorescence intensity against bead IgG binding capacity were constructed, and molecules of IgG bound per cell was read from the fluorescence intensity of the stained cells.
- Example 7 A generalised protocol for determining biological Data
- Target cells were cultured in RPMI 1640 + 10% Fetal bovine serum, Sodium pyravate and L-Glutarnine at 37° in a 95/5% air/CO 2 atmosphere. Cells were harvested following trypsin digestion and brought to a density of 2xl0 6 cells / 200 ⁇ l in PBS.
- Tumors were initiated by injection of the cell suspension subcutaneously in the axillary region.
- Drags were administered by P.O. or I.V. routes.
- the G 2 /M agent was formulated in aqueous 0.5% hydroxypropyl methylcellulose, 0.1% Tween 80 and administered as a suspension twice daily for 21 days as indicated in the respective figures.
- Taxol® Bristol Myers Squibb Co. was purchased preformulated in
- Taxol was administered I.V., once a day, for 5 days (days 1-5) as indicated in the respective figures.
- Carboplatin (Sigma) was formulated in saline and was administered I.V., once a day, for two 5 day periods. These studies were performed under IACUC # 468.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Immunology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Engineering & Computer Science (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US19133600P | 2000-03-22 | 2000-03-22 | |
| US191336P | 2000-03-22 | ||
| PCT/US2001/009368 WO2001070268A1 (en) | 2000-03-22 | 2001-03-22 | Pharmaceutical comprising an agent that blocks the cell cycle and an antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| EP1265635A1 true EP1265635A1 (en) | 2002-12-18 |
Family
ID=22705070
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP01922610A Withdrawn EP1265635A1 (en) | 2000-03-22 | 2001-03-22 | Pharmaceutical comprising an agent that blocks the cell cycle and an antibody |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1265635A1 (en) |
| JP (1) | JP2003527441A (en) |
| AU (1) | AU2001249393A1 (en) |
| WO (1) | WO2001070268A1 (en) |
Families Citing this family (19)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2272768T3 (en) * | 2001-10-03 | 2007-05-01 | Celator Pharmaceuticals Inc | COMPOSITIONS FOR THE ADMINISTRATION OF COMBINATIONS OF PHARMACOS. |
| CA2383259A1 (en) | 2002-04-23 | 2003-10-23 | Celator Technologies Inc. | Synergistic compositions |
| US7850990B2 (en) | 2001-10-03 | 2010-12-14 | Celator Pharmaceuticals, Inc. | Compositions for delivery of drug combinations |
| US8623822B2 (en) | 2002-03-01 | 2014-01-07 | Bracco Suisse Sa | KDR and VEGF/KDR binding peptides and their use in diagnosis and therapy |
| US7261876B2 (en) | 2002-03-01 | 2007-08-28 | Bracco International Bv | Multivalent constructs for therapeutic and diagnostic applications |
| EP1587944A4 (en) | 2002-03-01 | 2007-03-21 | Dyax Corp | Kdr and vegf/kdr binding peptides and their use in diagnosis and therapy |
| US7794693B2 (en) | 2002-03-01 | 2010-09-14 | Bracco International B.V. | Targeting vector-phospholipid conjugates |
| US7211240B2 (en) | 2002-03-01 | 2007-05-01 | Bracco International B.V. | Multivalent constructs for therapeutic and diagnostic applications |
| NZ536475A (en) | 2002-05-24 | 2008-06-30 | Schering Corp | Neutralizing human anti-igfr antibody |
| AT413486B (en) | 2002-07-03 | 2006-03-15 | Igeneon Krebs Immuntherapie | USE OF AN ANTIBODY DIRECTED AGAINST LEWIS ANTIGENE |
| EP2284180B1 (en) | 2003-03-03 | 2015-09-09 | Dyax Corp. | Uses of peptides that specifically bind HGF receptor (cMET) |
| CA2536321A1 (en) | 2003-08-29 | 2005-03-10 | Pfizer Inc. | Thienopyridine-phenylacet amides and their derivatives useful as new anti-angiogenic agents |
| ATE514783T1 (en) | 2003-11-12 | 2011-07-15 | Schering Corp | PLASMID SYSTEM FOR EXPRESSING MULTIPLE GENES |
| PE20050928A1 (en) | 2003-11-21 | 2005-11-08 | Schering Corp | THERAPEUTIC COMBINATIONS OF ANTI-IGFR1 ANTIBODY |
| JP4503022B2 (en) | 2003-12-23 | 2010-07-14 | ファイザー・インク | New quinoline derivatives |
| DE602005025685D1 (en) | 2004-12-03 | 2011-02-10 | Schering Corp | BIOLOGICAL MARKERS FOR THE PRESELECTION OF PATIENTS FOR ANTI-IGF1R THERAPY |
| PL2161336T5 (en) * | 2005-05-09 | 2017-10-31 | Ono Pharmaceutical Co | Human monoclonal antibodies to programmed death 1(PD-1) and methods for treating cancer using anti-PD-1 antibodies alone or in combination with other immunotherapeutics |
| KR101832133B1 (en) * | 2011-10-20 | 2018-02-27 | 주식회사 차바이오텍 | Method for the Isolation and Proliferation of Primary Lung Cancer Cells |
| KR102043603B1 (en) * | 2012-10-12 | 2019-11-12 | 주식회사 차바이오텍 | Isolation of lung cancer cells and proliferation thereof using suspension culture method |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6884418B1 (en) * | 1989-08-04 | 2005-04-26 | Berlex Laboratories, Inc. | Use of ligand-mimicking agents and anti-neoplastic drugs in cancer therapy |
| ZA9811162B (en) * | 1997-12-12 | 2000-06-07 | Genentech Inc | Treatment with anti-ERBB2 antibodies. |
| AU5286999A (en) * | 1999-07-23 | 2001-02-13 | Glaxo Group Limited | Combination of an anti-ep-cam antibody with a chemotherapeutic agent |
-
2001
- 2001-03-22 EP EP01922610A patent/EP1265635A1/en not_active Withdrawn
- 2001-03-22 WO PCT/US2001/009368 patent/WO2001070268A1/en not_active Ceased
- 2001-03-22 AU AU2001249393A patent/AU2001249393A1/en not_active Abandoned
- 2001-03-22 JP JP2001568464A patent/JP2003527441A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| See references of WO0170268A1 * |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2001070268A1 (en) | 2001-09-27 |
| JP2003527441A (en) | 2003-09-16 |
| AU2001249393A1 (en) | 2001-10-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6894952B2 (en) | Combination of PD-1 antagonist and VEGFR inhibitor for cancer treatment | |
| WO2001070268A1 (en) | Pharmaceutical comprising an agent that blocks the cell cycle and an antibody | |
| JP7455806B2 (en) | Drug combination using quinoline derivatives and antibodies | |
| RU2765997C2 (en) | Combination of anti-pd-l1 antibody and dna-pk inhibitor for treating malignant neoplasm | |
| US20220324965A1 (en) | Combination therapy involving antibodies against claudin 18.2 and immune checkpoint inhibitors for treatment of cancer | |
| EP4074732A1 (en) | Fully human antibodies against ox40, method for preparing the same, and use thereof | |
| US20030138430A1 (en) | Pharmaceutical comprising an agent that blocks the cell cycle and an antibody | |
| CN105214086A (en) | Anti-VEGF antibodies combines the application being used for the treatment of breast carcinoma with chemotherapy | |
| JP6023699B2 (en) | Methods for enhancing antibody-dependent cellular cytotoxicity | |
| WO2020249018A1 (en) | Combined pharmaceutical composition for treating driver-gene-positive lung cancer | |
| KR20250052418A (en) | Anti-CCR8 antibodies and their uses | |
| US20240218066A1 (en) | Use of anti-pd-1 antibody in combination with first-line chemotherapy in treatment of advanced non-small cell lung cancer | |
| JP2003505432A (en) | Combination of anti-EP-CAM antibody and chemotherapeutic agent | |
| JP2016117718A (en) | Anti-angiogenesis therapy for treatment of previously treated breast cancer | |
| WO2020233602A1 (en) | Quinoline derivative used for combination treatment of small cell lung cancer | |
| CN112996504A (en) | Methods of treating cancer by inhibiting ubiquitin conjugating enzyme E2K (UBE2K) | |
| Zhang et al. | Combination therapy for adult T-cell leukemia–xenografted mice: flavopiridol and anti-CD25 monoclonal antibody | |
| WO2020233723A1 (en) | Quinoline derivatives for treatment of head and neck cancer | |
| CN119768423A (en) | Combination therapy | |
| EP2236139A1 (en) | Combination therapy of erlotinib with an anti-IGF-1R antibody, which does not inhibit binding of insulin to the insulin receptor | |
| HK40119929A (en) | Anti-ccr8 antibodies and uses thereof | |
| WO2020119792A1 (en) | Humanized antibodies against ox40, method for preparing the same, and use thereof | |
| KR20250004821A (en) | Combination of antibody-drug conjugates with EZH1 and/or EZH2 inhibitors | |
| HK40082317A (en) | Fully human antibodies against ox40, method for preparing the same, and use thereof | |
| HK40054961A (en) | Methods of treating cancer by inhibiting ubiquitin conjugating enzyme e2 k (ube2k) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20020923 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR |
|
| AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
| RIN1 | Information on inventor provided before grant (corrected) |
Inventor name: KNICK, VINCENT CLARKGLAXOSMITHKLINE Inventor name: STIMMEL, JULIE BETHGLAXOSMITHKLINE Inventor name: THURMOND, LINDA MARGARITEGLAXOSMITHKLINE |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20061001 |