EP1242634A2 - Identification of virus-binding polypeptides and nucleotide sequences - Google Patents

Identification of virus-binding polypeptides and nucleotide sequences

Info

Publication number
EP1242634A2
EP1242634A2 EP00952633A EP00952633A EP1242634A2 EP 1242634 A2 EP1242634 A2 EP 1242634A2 EP 00952633 A EP00952633 A EP 00952633A EP 00952633 A EP00952633 A EP 00952633A EP 1242634 A2 EP1242634 A2 EP 1242634A2
Authority
EP
European Patent Office
Prior art keywords
virus
seq
group
membrane
plant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00952633A
Other languages
German (de)
French (fr)
Inventor
Ricardo B. Demedeiros
Thomas L. German
Lada Rasochova
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Wisconsin Alumni Research Foundation
Original Assignee
Wisconsin Alumni Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Wisconsin Alumni Research Foundation filed Critical Wisconsin Alumni Research Foundation
Publication of EP1242634A2 publication Critical patent/EP1242634A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage

Definitions

  • viruses In animals, viruses generally enter host cells by the stepwise process of virus attachment, fusion and penetration. The attachment to the putative viral receptor, or virus-binding polypeptide, is the first event in this process. In the past and recent years, a diversity of cellular receptors have been identified for numerous animal viruses in the surface of their host cells.
  • receptors for the human immunodefficiency-1 retrovirus include, for example, the receptors for the human immunodefficiency-1 retrovirus (Dalgleish et al, "The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus," Nature, 312:763-767 (1984)); the hepatitis A herpesvirus (Kaplan et al., "Identification of a surfce glycoprotein on African green monkey kidney cells as a receptor for hepatitis A virus," EMBO J.. 15:4284-96 (1996)); the rabies rhabdovirus (Hanham et al., "Evidence from the anti-idiotypic network that the acetylcholine receptor is a rabies virus receptor," _ Virol..
  • Plant viruses are usually introduced into their plant host cells via the feeding of invertebrate vectors or via mechanical action using a process that involves the partial destruction of the plant's cell wall and perforation of its cellular membrane. Once introduced into the cell, the virus is then able to move from cell-to-cell using the filamentous structures between the cells, known as plasmodesmata.
  • TSWV tomato spotted wilt virus
  • Bunyaviridae the type member of the Tospovirus genus
  • thrips which have an extremely high reproductive capacity, mainly the western flower thrips, Frankliniella occidentalis Pergande.
  • the viral family Bunyaviridae has more than 300 members, making it one of the largest viral families.
  • the Bunyaviridae family includes five genera: Bunyavirus, Hantavirus, Nairovirus, Phlebovirus and Tospovirus, encompassing some of the most dangerous of the emergent group of pathogens.
  • Bunyaviridaes which are transmitted by rodents excreta aerosols
  • all other members of the Bunyaviridae are transmitted by arthropods (mosquitos, sand flies, ticks, and thrips).
  • Vertebrate hosts include humans, and other primates, mammals, birds, and ungulates.
  • Tospovirus The genus Tospovirus is the only known viral genus in the Bunyaviridae family that is made up of plant-infecting viruses. They have an extremely wide host range and infect hundreds of plant species, ultimately causing diseases in many economically important cereal, vegetable, ornamental and fruit crops throughout the world. Examples of important plant hosts include potato, tomato, pepper, peanut, tobacco, pea, lettuce, cotton, onion, watermelon, chrysanthemum, impatiens, begonia, dahlia and others. Diseases caused by tospoviruses are also extremely difficult to control.
  • virus vectors In addition to the tospoviruses, an enormous number of other plant viruses show a very specific relationship with virus vectors, mostly insects, wherein each virus or group of viruses is transmitted only by a specific vector.
  • the specificity of each virus to its vector may be determined at the molecular level by recognition of a receptor, or other recognition or binding factors which stabilize or protect the virus in the vector organism.
  • a number of different approaches have been used for identification and cloning of virus receptors, with the vast majority relying upon the capability of the virus or its viral attachment protein(s) to bind to host cells or to cell components.
  • putative receptors have been partially purified by affinity chromatography, and then used for the development of anti-receptor antibodies and/or microsequencing, followed by use for immuno (Baldwin et al., "Molecular cloning and expression of receptor peptides that block human cytomegalovirus/cell fusion,” Biochem. Biophvs. Res. Commun.. 219:668-673 (1996)) or hyrbridization screening (Holmes et al., "Characterization and expression of the receptor glycoprotein for mouse hepatitis virus," New aspects of positive-strand RNA viruses. 253-256 (Brinton and Heinz (eds.) ASM Press, Washington D.C.
  • virus receptor cloning strategies include the use of the yeast two-hybrid screening system (Matsumoto et al., "Hepatitis C virus core protein interacts with the cytoplasmic tail of lympho-toxin-beta receptor, " J.
  • the present invention is summarized in that a novel method is disclosed for identifying virus-binding polypeptides, and the nucleotide sequences encoding them. Also disclosed are nucleotide sequences encoding tospovirus-binding polypeptides from the western flower thrips, Frankliniella occidentalis Pergande ("WFT"), identified using the method of the present invention.
  • WFT Frankliniella occidentalis Pergande
  • the present invention includes a method for identifying virus-binding polypeptides comprising the steps of constructing a cDNA library from total mRNA isolated from a virus vector; inducing expression of the cDNA library to obtain fusion polypeptides; transferring the fusion polypeptides onto a membrane; exposing the membrane to at least one viral particle; and detecting those expression products which bind to the viral particle.
  • the cDNA library member associated with the bound fusion polypeptide may be sequenced to elucidate its nucleotide sequence.
  • the present invention also includes nucleotide sequences encoding tospovirus- binding polypeptides identified in the western flower thrips, Frankliniella occidentalis Pergande, in accordance with the present invention.
  • the present invention further includes a transgenic plant expressing a foreign protein encoded by a nucleotide sequence encoding a tospovirus-binding polypeptide identified in the western flower thrips, Frankliniella occidentalis Pergande, in accordance with the present invention.
  • virus-binding polypeptides and their nucleotide sequences, can be identified without requiring a cellular virus infection or binding system.
  • virus-binding polypeptides and their nucleotide sequences, can be identified without requiring partial or complete purification of the putative receptor.
  • virus-binding polypeptides and their nucleotide sequences, can be identified without requiring identification, cloning and expression of a functional viral attachment protein.
  • Fig. 1 is a graphical illustration of Tospovirus morphology and structure, genome organization, replication and expression strategies.
  • Fig. 2 is an illustration of the method for cloning virus-binding polypeptides.
  • Fig. 3 is a diagram illustrating the screening process.
  • Fig. 4 is a table summarizing the results from a sequence analysis.
  • Fig. 5 is a conceptual drawing representing the working hypothesis for receptor and co-receptor recognition by TSWV.
  • Fig. 6 is a conceptual drawing representing the blocking of virus-receptor recognition by the expression of a virus-binding polypeptide in transgenic plants.
  • Figure 7 is a conceptual drawing illustrating the mechanism of virus acquisition when vectors feed on infected plants.
  • the method uses a cDNA expression library made from the total mRNA of a virus vector organism and a freshly purified preparation of a plant-infecting virus.
  • the method is a variation of the far- Western technique in which protein-protein interactions can be detected similarly to the traditional antigen-antibody interactions detected in Western blotting.
  • the process does not require cellular infection, nor another viral binding system, nor the identification of the viral protein responsible for binding in the virus.
  • the purification of a putative viral receptor from the virus vector organism is also not required. Techniques such as the one described here are not normally used in studies of plant viruses, since plant viruses do not use receptors when infecting plant cells.
  • TS WV-binding polypeptides from the western flower thrip, Frankliniella occidentalis Pergande. It will be understood that the principles of the invention apply as well to other types of plant-infecting viruses that use animal vectors, such as rhabdoviruses and other types of tospoviruses, such as the impatiens necrotic spot virus. Likewise, it will be understood that the principles of the present invention apply as well to other types of virus vectors, such as insects (e.g., mosquitos, sand flies, flies, and thrips), rodents, birds and other arthropods.
  • insects e.g., mosquitos, sand flies, flies, and thrips
  • rodents e.g., birds and other arthropods.
  • virus-binding polypeptides begins by constructing a cDNA expression library from the total mRNA of a virus vector animal.
  • a virus vector is defined to include those animals capable of carrying and transmitting viruses.
  • virus vectors may include insects (e.g., mosquitos, sand flies, flies, and thrips), rodents, birds and other arthropods.
  • virus vectors may include insects capable of carrying and transmitting bunyaviruses, nairoviruses, phleboviruses, rhabdoviruses and tospoviruses, such as the western flower thrips, Frankliniella occidentalis Pergande ("WFT"), which is known to carry and transmit the tomato spotted wilt virus (“TSWV”).
  • WFT Frankliniella occidentalis Pergande
  • TSWV tomato spotted wilt virus
  • the cDNA library may be constructed using any one of the many molecular vector systems commonly known in the art.
  • the lambda-based cDNA synthesis kit (Stratagene) may be used for the cDNA library construction. Lambda- based cDNA expression libraries show several advantages when compared to other methods.
  • the cDNA library may be plated and cultured to begin the screening process.
  • the screening process involves the use of a preparation of a plant-infecting virus to screen the fusion polypeptides produced by the members of the cDNA library to detect which fusion polypeptides, if any, exhibit virus-binding activity.
  • the screening may be performed on any solid substrate suitable for protein detection, such as a nitrocellulose membrane, nylon membrane or pdf membrane.
  • the detection system used may include any one of the many labeling systems employed in screening expression libraries. Such systems include, for example, monoclonal or polyclonal antibody systems which are selective to viral proteins.
  • Fusion polypeptides are obtained by inducing expression of the plated cDNA library using an inducer which promotes transcription of the cDNA insert.
  • the inducer may be applied to the cDNA library independently or in association with the membrane to facilitate the transfer of the fusion polypeptides to the membrane.
  • the fusion polypeptides are transferred onto the membrane where they are exposed to a preparation of a plant-infecting virus.
  • the preparation will generally include a purified solution of a native virus of interest, but may also include a solution of purified viral particles (native viral proteins).
  • viral particles native viral proteins
  • the most external viral protein is likely to be the actual binding ligand (viral glycoproteins in enveloped viruses, or capsid proteins in non-enveloped viruses), with antibodies against these proteins used for detection.
  • purified viral particles instead of recombinant viral proteins, one can avoid potential problems with non-specific or abrogated binding caused by structural differences between the recombinant and the native viral protein, and additionally the viral protein cloning becomes an unnecessary process step.
  • the initial advantage of using the present method is that several complex process steps are rendered unnecessary in the cloning process of the virus-binding polypeptide.
  • the present invention does not require the induction of a cellular infection and/or a cellular binding system, or the identification, cloning and expression of a functional viral attachment protein, or the partial purification of a putative receptor.
  • virus receptor candidates can be selected and cloned in a very short period of time, and used in subsequent experiments for determination of their biological relevance as a virus receptor.
  • the present method does not eliminate the selection of polypeptides which are unrelated to the virus receptor, but bind to the virus with a similar or higher affinity, which can be as useful or even more useful than a virus' specific receptor in terms of the development of novel control strategies.
  • the present method may also be used for deciphering other virus-host interactions, including the detection and identification of cytoplasmic host factors involved in virus replication, transcription, and/or pathogenesis when other viral proteins are used in the screening (e.g., the viral polymerase or the movement of the protein and their specific antibodies).
  • virus-binding polypeptides may also lead to the discovery of control strategies via the development of inhibitors of virus entry, replication, transcription, movement and transmission. For example, direct expression in transgenic plants of DNA sequences encoding viral binding polypeptides is expected to result in virus tolerant and/or resistant plans.
  • Virus-binding polypeptides may also be used for identification of virus attachment proteins (receptor-binding) which, in turn, can be fused to specific toxins and then expressed in transgenic plants to accomplish the specific control of insect vectors.
  • the present method has been used to identify seven DNA sequence from the western flower thrips, Frankliniella occidentalis Pergande, which encode polypeptides that specifically bind to the tomato spotted wilt virus ("TSWV").
  • the seven DNA sequences are partial sequences, i.e. not the entire sequence of native thirps genes, but encode sufficient portions of the binding domains of the thrips genes to bind TSWV virions.
  • the sequences have been identified as pTRl 11 (SEQ ID NO:l), pTR211 (SEQ ID NO:2), pTR313 (SEQ ID NO:3), pTR411 (SEQ ID NO:4), pTR621 (SEQ ID NO:5), pTR711 (SEQ ID NO:6), and pTR821 (SEQ ID NO:7).
  • TSWV has three single- stranded RNA segments encapsulated by a lipidic envelope of host origin.
  • the virion contains four structural proteins including the L polymerase, the N nucleocapsid and two viral-encoded glycoproteins embedded in the envelope, Gl and G2, as all illustrated in Fig. 1.
  • the viral glycoproteins may serve as viral attachment proteins for several enveloped viruses, an expected property because of the proteins external position in the virus particle.
  • the Arginine-Glycine-Aspartate (RGD) motif has also been established as an integrin-receptor binding motif as it is typically found in glycoproteins of the extracellular matrix in both animal and plant cells, the RGD motif believed to be involved in adhesion of cells to the extracellular matrix.
  • RGD Arginine-Glycine-Aspartate
  • Gavrilovskaya et al. "3 integrins mediate the cellular entry of hantaviruses that cause respiratory failure," Proc. Natl. Acad. Sci. USA. 95:7074-7079 (1998).
  • Gavrilovskaya et al. observed that hantavirus entry is RGD-independent, in agreement with the observation that Hantaviruses do not have an RGD sequence in their glycoprotein ORF.
  • RGD motif is present in the 5' end of G2 in two tospoviruses, TSWV and Impatiens necrotic spot virus (INSV) and its role as a receptor- binding motif together with the role of ⁇ integrins as tospoviruses receptors are questions still not addressed.
  • Gavrilovskaya demonstrated that ⁇ 3 integrins specifically mediate the entry of two different hantaviruses in their respective host cells and, thus, proposed ⁇ -integrins as the hantavirus receptor.
  • TSWV binds to some transcriptional activator-like thrips polypeptides which, if confirmed in vivo, might represent TSWV co-receptors and a novel mechanism for virus entry.
  • Figure 5 illustrates a model for the proposed interactions between these factors.
  • Several potential novel virus control strategies based on the seven sequences presented here, as well on virus-binding sequences discovered in accordance with the method of the present invention, are plausible.
  • One approach is based on the use of transgenic plants engineered to express the virus-binding polypeptides. These plants are expected to inhibit transmission by interfering with virus particles assembly (virus assembly is necessary for virus acquisition by thrips).
  • the polypeptides will bind to the viral glycoproteins and block its interaction with virus RNAs.
  • these plants are expected to inhibit transmission by interfering with virus-receptor recognition.
  • virus-binding polypeptides will saturate receptor binding sites on the virus surface and prevent virus- receptor interaction in thrips vectors. This strategy is illustrated in Fig. 6.
  • virus-binding polypeptides The inhibition of virus transmission caused by virus-binding polypeptides is expected to be effective against all or most tospoviruses because TSWV glycoproteins share about 80% identity with others in the genus. This provides a significant advantage over transgenic plants expressing the N gene, as plants transfected with the N gene are resistant only against the isolate from which the N gene was extracted. Additionally non-binding mutant viruses that will eventually arise would not be transmitted.
  • Another envisioned approach is based on the use of vector specific biological pesticides. Virus-binding polypeptides exclusively found in vector species will be used for selection of specific ligands (TSWV glycoproteins). These specific ligands will be used in the construction of Bt toxin-fusion proteins that will be expressed in transgenic plants or sprayed on plants in the field. Such biopesticides will target tospovirus vectors while avoiding non-vector species.
  • Another potential approach is based on the identification of chemical compounds and peptides that block TSWV-thrips interaction. Identified virus-binding polypeptides will be used for screening chemical compounds and small peptide libraries. Compounds and/or peptides that disrupt virus binding could be expressed in transgenic plants to inhibit viral binding directly or could be used to design virus-vector interaction blocking agents.
  • VAP viral attachment protein
  • the method described here can be also be adapted to the cloning of polypeptides that bind any viral proteins (L and/or N for example).
  • Purified recombinant L and N proteins can be used in substitution to the whole virus particle in the overlay step and, instead of TSWV glycoproteins-bound polypeptides, polymerase- or capsid-bound polypeptides can be identified and cloned. Subsequently transgenic plants expressing these polypeptides can be obtained and are expected to be resistant to virus infection via interference with virus replication.
  • Monoclonal anti-Gl/G2 antibodies (Bandla and Sherwood, "Production of monoclonal antibodies to the glycoproteins of tomato spotted wilt virus using antigens eluted from ChromaPhor stained gels," Phytopathology. 85:1205 (1995)) were coupled to Sepharose C1-4B beads (Sigma) by addition of cyanogen-bromide as described by Ausubel et al., Short Protocols in Molecular Biology. (John Wiley and Sons, Inc., New York, 1995), producing an antibody-Sepharose complex (Ab-Seph).
  • TWWV was purified as described by Gonsalves and Trujillo, "Tomato spotted wilt virus in papaya and detection of the virus by ELISA," Plant Disease. 70:501-506 (1986), resuspended in 0.01 M NaSO 3 to 2 ⁇ g/ ⁇ l total protein and immediately incubated for 2 hours at 4°C with Ab-Seph (1 vol virus: lOvol Ab-Seph), resulting in the Ab-Seph-TSWV conjugate.
  • Thrips and mosquito (Anopheles gambiae Giles) extracts were homogenized in SDS lysis buffer (0.5% SDS, 0.05 M Tris-HCl, pH 8.0, ImM DTT, 2mM leupeptin and pepstatin, 20mM iodoacetamide, 1 mM PMSF) at 4 ⁇ g/ ⁇ l total protein, boiled 5 minutes, added to 1 vol of RIP A correction buffer (1.25% NP-40, 1.25% Na- deoxycholate, 0.0125M NaPO 4 , pH 7.2, 2mM EDTA, 0.2 mM Na-vanadate, 50 mM Na- fluoride, 100 U/ml aprotinin, 2mM leupeptin and pepstatin, 20 mM iodoacetamide, ImM PMSF) and incubated 1 to 4 hours at 4°C.
  • SDS lysis buffer 0.5% SDS, 0.05 M Tris-HCl, pH 8.0, ImM
  • the insect extracts were then incubated with the Ab-Seph/TSWV conjugate (1:1 vol., empirically determined) for an additional 3 hours at 4°C. After this further incubation period, the mixture was centrifuged for 1 min at 10,000 x g in washing buffer (1% Triton X-100, 1% bovine hemoglobin, pH 8.0, 0.14 NaCl, 0.025% NaN 3 , 1% sodium dowxycholate, 0.1% SDS, 1 mM DTT), the surpematant was discarded and the pellet was resuspended in washing buffer.
  • washing buffer 1% Triton X-100, 1% bovine hemoglobin, pH 8.0, 0.14 NaCl, 0.025% NaN 3 , 1% sodium dowxycholate, 0.1% SDS, 1 mM DTT
  • nitrocellulose membranes were incubated with purified TSWV diluted in fresh blocking solution at 10 ⁇ g/ml of total protein overnight at 4°C.
  • monoclonal anti-Gl antibody (1 : 100 in blocking solution) was used as primary antibody and anti-mouse IgG-horseradish peroxidase conjugate (Sigma) as the secondary antibody (1 :25,000).
  • the ECLTM enhancer chemiluminescent reagent (Amersham) was used as substrate for detection followed by exposure of the blot to X- ray film (Kodak and LabScientific).
  • thrips and mosquito whole extracts 120 ⁇ g of total protein were prepared in Laemmli buffer as described above. The thrips extracts were prepared suing larval stages since the previously detected 50 kDa candidate receptor protein is more abundant in larval than in adult extracts.
  • Membranes were sequentially incubated in stripping buffer (2% SDS, 100 mM BME, 62 mM Tris, pH 6.8) 50 °C for 30 minutes to remove TSWV virions and antibodies, according to the manufacturers instructions (Amersham), and re-probed only with anti-Gl and secondary antibodies, without previous incubation with purified TSWV.
  • stripping buffer 2% SDS, 100 mM BME, 62 mM Tris, pH 6.8
  • Anti-Gl and secondary antibodies without previous incubation with purified TSWV.
  • Four additional immunoprecipitation buffers containing nonionic detergents as Triton-XlOO and Nonidet-P40 were tested (data not shown), as well as buffering conditions.
  • anti-idiotypic antibodies raised against anti-Gl /G2 monoclonal antibodies (Bandla et al., supra) were coupled to Sepharose beads as described before.
  • the resulting anti-Ids-Seph complex was incubated with the insect extracts (1:1 vol) for 3 hours at 4°C, washed three times, resuspended in Laemmli buffer and boiled for 5 minutes.
  • the Western blotting assay was conducted as described above but without any virus overlay, while anti-idiotypic antibodies raised against anti-viral glycoproteins antibodies obtained previously were used as the primary antibodies.
  • Mosquitoes (Aedes triseriatus, A. albopictus and Anopheles gambiae) were used as negative controls.
  • the antibodies were cross-absorbed (an anti-IdGl+anti-IdG2 mixture) by incubation with whole mouse serum (Sigma) at 4 °C for 3 hours, and collecting the supernatent after 30 minutes of centrifugation at 14,000 x g in a microcentrifuge.
  • Chemiluminescence relative to background of the detected 50 kDA proteins was measured with Lumi-ImagerTM (Boehringer Mannheim) in Boehringer light units (BLU)(representing the chemiluminescent light released by the peroxidase-luminol reaction.)
  • the far- Western assay detected a 50 kDa thrips factor (protein) in the thrips extracts as previously reported by Bandla et al., supra, possibly representing the TSWV receptor or a receptor component.
  • a second factor at about 65 kDa was also detected, although less evident, possibly representing a second receptor or receptor component.
  • Both thrips proteins were also detected in the Western blotting assay when anti-idiotypic antibodies (anti-Ids) were utilized as the primary antibody. Such anti-Ids are considered to mimic the original ligand structure and are frequently used for receptor recognition in several different systems (Gaulton & Greene, 1986).
  • Poly(A) + RNA (mRNA) was purified by affinity chromatography using biotin-oligo(dT)-streptavidin beads (PolyATractTM, Promega, Madison, WI) in three rounds of purification.
  • Northern hybridization analysis of total and mRNA samples was performed after formaldehyde- 1% agarose gel electrophoresis using an actin universal DNA probe (pActin-1 clone, provided by the S. Carroll's laboratory, Dept. Genetics, UW-Madison) labeled with [ ⁇ - 32 P]-dATP to monitor the synthesis reaction.
  • Rnase H, DNA polymerase I, and dNTPs were then added to the first-strand synthesis reaciton product (a DNA/mRNA hybrid) to obtain the second- strand cDNA by 'nick translation'.
  • 100 ⁇ g of total RNA and 5 ⁇ g of poly(A) + RNA were obtained from the 100 mg of F. occidentalis larval tissue.
  • Ribosomal RNA bands were visualized on a 1% denaturing agarose gel by ethidium bromide staining. Analysis of the results showed the 18S rRNA a and b fragments at the 1.8 kb position, as expected.
  • a Drosophila melanogaster actin probe hybridized to an 800 bp RNA species, as expected, before and after mRNA isolation.
  • ⁇ -ZAP cDNA synthesis kit (Stratagene, San Diego, CA) was used according to the manufacturer's instructions with some modifications.
  • Poly(A) + RNA was added to oligo(dT) linker-primer (5* GAGAGAGAGAGAGAGAACTAGTCTCGAGT TTTTTTTTTTTTTTTTT 3'), which contains an. ⁇ 7j ⁇ l site (underlined) for sense- oriented insertion in the UniZAP XR ⁇ vector, with respect to the lacL promoter, a GAGA sequence to protect the restriction site, and a 18-base poly(dT) sequence that binds to the 3' poly(A) region fo the mRNA templates, MMLV reverse transcriptase, 5- methyl dCTP (to protect the cDNA from subsequent digestion reaction), and dNTPs to obtains the first-strand cDNA using [ ⁇ "32 P]-dATP to monitor the reaction.
  • RNA extracted with aurin tricarboxylate resulted in a wider range of cDNA when compared to RNA extracted with TRITM reagent.
  • cDNA fragments that were size-fractionated (0.5-10kb) and used in the ligation reaction to the ⁇ -ZAP XP vector (Stratagene).
  • Primary library titer was determined by plaque assay as 2 x 10 5 pfu and 6 x 10 9 pfu/ml after amplification.
  • cDNA fragments ranging from 0.5 to 10 kb were recovered by silica-gel columns (QIAquickTM, Qiagen, St. Clarita, CA). After gel recovery, cDNA inserts were ligated in the Uni-ZAP XR ⁇ vector containing XhoX and EcoRX cohesive ends for directional cloning into the pBluescript plasmid sequence, under the control of the lacZ promoter (Stratagene), using T4 DNA ligase according to the manufacturer's instructions.
  • the Gigapack II extract (Stratagene) was used for in vitro packaging of the recombinant phages (Kretz et al., " Gigapack ® III high efficiency lambda packaging extract with single-tube convenience," Strategies Mol. Biol., 7:44-45 (1991)), resulting in infectious recombinant ⁇ phase particles.
  • the primary library was produced by infecting E. coli XL 1 -blue (Bullock et al., "XL 1 -blue: A high efficient plasmid transforming recA Escherichia coli strain with ⁇ - galactosidase selection," BioTechniques. 5:376-379 (1987)) with the above recombinant phages. Titer was determined by a plaque assay to reveal a titer of 2 x 10 5 pfu.
  • the TSWV Hawaiian strain was maintained by thrips inoculation in Datura stramonium (provided by D. Ullman's laboratory, Dept. Entomology, UC-Davis). Virus purification was performed as described above.
  • a colony of F. occidentalis was established from eggs provided by D. Ullman's laboratory and maintained in a growth chamber at 26 °C and a photoperiod of 16 hours of light and 8 hours of dark. The colony was raised in plastic containers and maintained on green bean pods that were replenished about 2-3 days. Larvae were collected with soft brush at about 5-6 days after oviposition, representing a mixture of first and second instar larvae.
  • plaques identified as positive in the first round of screening were removed with Pasteur pipettes (wider ends, about 0.8 cm radius) and incubated for 2 hours in 2% chloroform SM buffer (Stratagene ⁇ -ZAP kit). Resuspended phages were titered by plaque assay and 2 x 10 4 pfu from each positive clone were plated in 50 mm plates and the screening process (steps 1-6) was repeated.
  • fusion proteins Overexpression of fusion proteins was performed as described by Huang and Jong, "Expression and preparation of fusion proteins from recombinant ⁇ gtl 1 phages," cDNA Library Protocols. 241-246 (Cowell and Austin (eds.) Humana Press, New Jersey (1997)) with some modifications.
  • the selected recombinant phages were used to infect E. coli XL-1 blue (2 x 10 4 pfu/plate). Phages and cells were incubated for 3.5 hours at 42°C, added to 10 ml of LB medium (Sambrook et al., supra) containing 1-10 mM IPTG, and incubated for an additional 3-6 hours at 37 °C.
  • Thrips polypeptides-TSWV interactions were detected with anti-TSWV Gl monoclonal antibodies as the primary antibody and anti-mouse IgG-HR peroxidase conjugate as the secondary antibody. Positive signals were detected by adding ECLTM enhanced chemiluminescent reagent (Amersham) followed by film (LabScientific) exposure for 2 min to 1 hour.
  • thrips clones (pTRl 11, pTR211, pTR313, pTR411, pTR621, PTR711, and pTR821) were overexpressed in E. coli XL-1 blue and fusion proteins were purified by virtue of their ⁇ -galactosidase affinity. Binding of TSWV to a 50 kDa protein present in thrips total protein extracts was detected, as reported previously by Bandla et al., supra, as a control. TSWV binding to four different polypeptides (pTR411, pTR711, pTR821, and pTR621) selected from the thrips cDNA library was also detected. A stronger signal was observed with pTR621 which may represent higher TSWV affinity and/or higher concentration of the TR621 polypeptide in the E. coli lysate.
  • Plasmid DNA derived from the 7 positive pfus (pTRl 11, pTR211, pTR313, pTR411, pTR621, pTR711, and pTR821) were in vivo excised and purified. Thrips inserts were then sequenced with T3 and T7 primers, and analyzed using the UWGCG package (Devereux et al., Nucleic Acid Res.. 12:387 (1984)), the BLAST and FASTA programs and the DNAStarTM software (DNAStar Inc.).
  • ⁇ -integrins the characteristic binding motif of ⁇ - integrins (the ⁇ chain integrin domains signatures) which comprises about 20 residues [Cx(G, N, Q)x ⁇ l,3 ⁇ GxCxCx2CxC] and three additional GC-rich region motifs localized in a region of approximately 200 nucleotides (ferredoxin, a defensin and a EGF-like protein domains), detected by the MOTIFS program of the UW-Genetics Comuter Group package (Devereux et al., supra). These same domains, and only them, were also found in other ⁇ integrin sequences, such as a Drosophila ⁇ integrin.
  • all seven of the positively selected TSWV-binding polypeptides have an ORF in-frame with the lacZ gene in which they were cloned, and would code for polypeptides of about 25 to 30 kDa. They also have potential glycosylation signals; and polyadenylation and stop signals in the correct positions.
  • pTR411 shares homology with cytochrome C sequences (95% identity at the amino acid level); pTR911 shares homology with a defensin protein (95% identity at the amino acid level); pTRl 11 shares homology with several transcription factors, mainly the homeodomain protein (57% identity at the amino acid level); and pTR313 shares homology with the bluebottle fly Calliphora vicina arylphorin receptor (50% identity at the amino acid level).
  • pTR411 shares homology with cytochrome C sequences (95% identity at the amino acid level)
  • pTR911 shares homology with a defensin protein (95% identity at the amino acid level)
  • pTRl 11 shares homology with several transcription factors, mainly the homeodomain protein (57% identity at the amino acid level)
  • pTR313 shares homology with the bluebottle fly Calliphora vicina arylphorin receptor (50% identity at the amino acid level).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Biochemistry (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Virology (AREA)
  • Biotechnology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The present invention provides a novel method for identifying virus-binding polypeptides (putative viral receptors) and the nucleotide sequences encoding them. The method uses a cDNA expression library made from the total mRNA of an animal virus vector and a freshly purified preparation of a plant-infecting virus. Also disclosed are polypeptides identified from the western flower thrips which bind to the tomato spotted wilt virus.

Description

IDENTIFICATION OF VIRUS-BINDING POLYPEPTIDES AND NUCLEOTIDE SEQUENCES
CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority from U.S. provisional patent application serial number 60/147,606, filed August 6, 1999.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
OR DEVELOPMENT Under investigation.
BACKGROUND OF THE INVENTION In animals, viruses generally enter host cells by the stepwise process of virus attachment, fusion and penetration. The attachment to the putative viral receptor, or virus-binding polypeptide, is the first event in this process. In the past and recent years, a diversity of cellular receptors have been identified for numerous animal viruses in the surface of their host cells. These receptors include, for example, the receptors for the human immunodefficiency-1 retrovirus (Dalgleish et al, "The CD4 (T4) antigen is an essential component of the receptor for the AIDS retrovirus," Nature, 312:763-767 (1984)); the hepatitis A herpesvirus (Kaplan et al., "Identification of a surfce glycoprotein on African green monkey kidney cells as a receptor for hepatitis A virus," EMBO J.. 15:4284-96 (1996)); the rabies rhabdovirus (Hanham et al., "Evidence from the anti-idiotypic network that the acetylcholine receptor is a rabies virus receptor," _ Virol.. 67:530-542 (1993)); and the human adenovirus type 2 (Wickham et al., "Integrins αvβ3 and 0^5 promote adenovirus internalization but not attachment," Cell, 73:309-313 (1993)). As a result of these discoveries, a better understanding of host range, tissue tropism, and virus entry mechanisms has evolved, opening the door for the development of novel therapeutic strategies for animal and human viral diseases. Unlike animal viruses, plant viruses generally do not utilize viral receptors for entry into plant cells or for cell-to-cell movement. Plant viruses are usually introduced into their plant host cells via the feeding of invertebrate vectors or via mechanical action using a process that involves the partial destruction of the plant's cell wall and perforation of its cellular membrane. Once introduced into the cell, the virus is then able to move from cell-to-cell using the filamentous structures between the cells, known as plasmodesmata.
Some plant viruses, however, also infect and replicate in natural insect vectors just as animal viruses infect and replicate in their animal hosts. As with animal viruses, these plant viruses are thought to enter the cells of their animal vectors via the recognition of virus-binding proteins, or putative viral receptors. For example, the tomato spotted wilt virus (TSWV, Bunyaviridae), the type member of the Tospovirus genus, replicates in and is transmitted in nature by several species of thrips which have an extremely high reproductive capacity, mainly the western flower thrips, Frankliniella occidentalis Pergande.
The viral family Bunyaviridae has more than 300 members, making it one of the largest viral families. First established in 1980, the Bunyaviridae family includes five genera: Bunyavirus, Hantavirus, Nairovirus, Phlebovirus and Tospovirus, encompassing some of the most dangerous of the emergent group of pathogens. With the exception of the hantaviruses, which are transmitted by rodents excreta aerosols, all other members of the Bunyaviridae are transmitted by arthropods (mosquitos, sand flies, ticks, and thrips). Vertebrate hosts include humans, and other primates, mammals, birds, and ungulates.
The genus Tospovirus is the only known viral genus in the Bunyaviridae family that is made up of plant-infecting viruses. They have an extremely wide host range and infect hundreds of plant species, ultimately causing diseases in many economically important cereal, vegetable, ornamental and fruit crops throughout the world. Examples of important plant hosts include potato, tomato, pepper, peanut, tobacco, pea, lettuce, cotton, onion, watermelon, chrysanthemum, impatiens, begonia, dahlia and others. Diseases caused by tospoviruses are also extremely difficult to control. The rarity of genetic resistance in commercial varieties, the severity of the diseases, the large and overlapping host ranges of both the viruses and their vectors, and the development of insecticide resistance by thrips vectors are the most important reasons for increasing economic losses caused by the tospoviruses. Devastating effects in entire fields are common throughout the world and concerns about the spread of the virus have often resulted in the increased use of chemical pesticides, thus increasing both the existence of potentially harmful chemical pollution and human health risks.
In addition to the tospoviruses, an enormous number of other plant viruses show a very specific relationship with virus vectors, mostly insects, wherein each virus or group of viruses is transmitted only by a specific vector. The specificity of each virus to its vector may be determined at the molecular level by recognition of a receptor, or other recognition or binding factors which stabilize or protect the virus in the vector organism. A number of different approaches have been used for identification and cloning of virus receptors, with the vast majority relying upon the capability of the virus or its viral attachment protein(s) to bind to host cells or to cell components. For example, putative receptors have been partially purified by affinity chromatography, and then used for the development of anti-receptor antibodies and/or microsequencing, followed by use for immuno (Baldwin et al., "Molecular cloning and expression of receptor peptides that block human cytomegalovirus/cell fusion," Biochem. Biophvs. Res. Commun.. 219:668-673 (1996)) or hyrbridization screening (Holmes et al., "Characterization and expression of the receptor glycoprotein for mouse hepatitis virus," New aspects of positive-strand RNA viruses. 253-256 (Brinton and Heinz (eds.) ASM Press, Washington D.C. 1990); Cao et al., "Identification of alpha-dystroglycan as a receptor for lymphocytic choriomeningitis virus and Lassa fever virus," Science. 282:2079-81 (1998)). Alternatively, cell lines resistant to virus attachment and/or entry have been transformed with libraries derived from susceptible cell lines. Subsequently, screening is performed by either virus binding assay, virus infection, or by virus- encoded reporter gene expression (Feng et al., "HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor," Science. 272:872-877 (1996); Montgomery et al., "Herpes simplex virus-1 entry into cells mediated by a novel member of the TNF/NGF receptor family," CeU, 87:427-436 (1996); Golovkina et al., "A novel membrane protein is a mouse mammary tumor virus receptor," J. Virol.. 72:3066-71 (1998)). The most common approach, however, involves the identification of antibodies with the ability to block virus infection in neutralization experiments. Additional examples of virus receptor cloning strategies include the use of the yeast two-hybrid screening system (Matsumoto et al., "Hepatitis C virus core protein interacts with the cytoplasmic tail of lympho-toxin-beta receptor, " J. Virol.. 71 : 1301 - 1309 ( 1997)) and the phage display library system (Ban et al., "Isolation and characterization of a 2.3- kilobase-pair cDNA fragment encoding the binding domain of the bovine leukemia virus cell receptor," J. Virol.. 67:1050-57 (1993); Krikbaev et al., "Mutant CD4 molecules with improved binding to HIV envelope protein gpl20 selected by phage display," Virology. 234:196-202 (1997)).
All of these approaches generally require one or more of the following prerequisites: (1) a cellular virus infection or virus binding system, (2) partial or complete purification of the putative receptor, and/or (3) identification, cloning and expression of a functional viral attachment protein. Although these requisites are normally available and relatively easy to obtain in animal virus systems, they are not commonly accessible for plant viruses or are enormously difficult to obtain because of their intrinsic characteristics. Accordingly, relatively few plant viral receptors have been identified.
BRIEF SUMMARY OF THE INVENTION The present invention is summarized in that a novel method is disclosed for identifying virus-binding polypeptides, and the nucleotide sequences encoding them. Also disclosed are nucleotide sequences encoding tospovirus-binding polypeptides from the western flower thrips, Frankliniella occidentalis Pergande ("WFT"), identified using the method of the present invention.
The present invention includes a method for identifying virus-binding polypeptides comprising the steps of constructing a cDNA library from total mRNA isolated from a virus vector; inducing expression of the cDNA library to obtain fusion polypeptides; transferring the fusion polypeptides onto a membrane; exposing the membrane to at least one viral particle; and detecting those expression products which bind to the viral particle. In addition, the cDNA library member associated with the bound fusion polypeptide may be sequenced to elucidate its nucleotide sequence. The present invention also includes nucleotide sequences encoding tospovirus- binding polypeptides identified in the western flower thrips, Frankliniella occidentalis Pergande, in accordance with the present invention.
The present invention further includes a transgenic plant expressing a foreign protein encoded by a nucleotide sequence encoding a tospovirus-binding polypeptide identified in the western flower thrips, Frankliniella occidentalis Pergande, in accordance with the present invention.
It is an object of the present invention to provide a simplified method for identifying virus-binding polypeptides in organisms. It is also an object of the present invention to provide nucleotide sequences which encode virus-binding polypeptides that may be used in strategies intended to control viral infection and transmission.
It is one advantage of the present invention that virus-binding polypeptides, and their nucleotide sequences, can be identified without requiring a cellular virus infection or binding system.
It is another advantage of the present invention that virus-binding polypeptides, and their nucleotide sequences, can be identified without requiring partial or complete purification of the putative receptor.
It is yet another advantage of the present invention that virus-binding polypeptides, and their nucleotide sequences, can be identified without requiring identification, cloning and expression of a functional viral attachment protein.
Other objects, advantages and features of the present invention will become apparent from the following specification.
BRIEF DESCRIPTION OF THE DRAWINGS AND FIGURES. Fig. 1 is a graphical illustration of Tospovirus morphology and structure, genome organization, replication and expression strategies.
Fig. 2 is an illustration of the method for cloning virus-binding polypeptides. Fig. 3 is a diagram illustrating the screening process. Fig. 4 is a table summarizing the results from a sequence analysis. Fig. 5 is a conceptual drawing representing the working hypothesis for receptor and co-receptor recognition by TSWV.
Fig. 6 is a conceptual drawing representing the blocking of virus-receptor recognition by the expression of a virus-binding polypeptide in transgenic plants.
Figure 7 is a conceptual drawing illustrating the mechanism of virus acquisition when vectors feed on infected plants.
DETAILED DESCRIPTION OF THE INVENTION Describe here is an alternative and rapid method for the identification and cloning of virus-binding polypeptides, and the nucleotide sequences encoding such polypeptides, the polypeptides binding to plant-infecting viruses. The method uses a cDNA expression library made from the total mRNA of a virus vector organism and a freshly purified preparation of a plant-infecting virus. The method is a variation of the far- Western technique in which protein-protein interactions can be detected similarly to the traditional antigen-antibody interactions detected in Western blotting. The process does not require cellular infection, nor another viral binding system, nor the identification of the viral protein responsible for binding in the virus. The purification of a putative viral receptor from the virus vector organism is also not required. Techniques such as the one described here are not normally used in studies of plant viruses, since plant viruses do not use receptors when infecting plant cells.
In the Examples below, the invention will be described in detail in connection with the identification of TS WV-binding polypeptides from the western flower thrip, Frankliniella occidentalis Pergande. It will be understood that the principles of the invention apply as well to other types of plant-infecting viruses that use animal vectors, such as rhabdoviruses and other types of tospoviruses, such as the impatiens necrotic spot virus. Likewise, it will be understood that the principles of the present invention apply as well to other types of virus vectors, such as insects (e.g., mosquitos, sand flies, flies, and thrips), rodents, birds and other arthropods.
In general, the identification of virus-binding polypeptides in accordance with the present invention begins by constructing a cDNA expression library from the total mRNA of a virus vector animal. As used herein, a "virus vector" is defined to include those animals capable of carrying and transmitting viruses. For example, virus vectors may include insects (e.g., mosquitos, sand flies, flies, and thrips), rodents, birds and other arthropods. In particular, virus vectors may include insects capable of carrying and transmitting bunyaviruses, nairoviruses, phleboviruses, rhabdoviruses and tospoviruses, such as the western flower thrips, Frankliniella occidentalis Pergande ("WFT"), which is known to carry and transmit the tomato spotted wilt virus ("TSWV"). The cDNA library may be constructed using any one of the many molecular vector systems commonly known in the art. For example, the lambda-based cDNA synthesis kit (Stratagene) may be used for the cDNA library construction. Lambda- based cDNA expression libraries show several advantages when compared to other methods. In vitro packaged λ phages are more efficient than plasmid DNA for E. coli transformation. Lambda libraries are also easier to amplify, plate, screen, and store more than plasmid libraries. Moreover, lambda expression libraries possess a higher size limitation for the introduced inserts when compared to other phage display libraries. Once constructed, the cDNA library may be plated and cultured to begin the screening process. In general, the screening process involves the use of a preparation of a plant-infecting virus to screen the fusion polypeptides produced by the members of the cDNA library to detect which fusion polypeptides, if any, exhibit virus-binding activity. The screening may be performed on any solid substrate suitable for protein detection, such as a nitrocellulose membrane, nylon membrane or pdf membrane. The detection system used may include any one of the many labeling systems employed in screening expression libraries. Such systems include, for example, monoclonal or polyclonal antibody systems which are selective to viral proteins.
Fusion polypeptides are obtained by inducing expression of the plated cDNA library using an inducer which promotes transcription of the cDNA insert. The inducer may be applied to the cDNA library independently or in association with the membrane to facilitate the transfer of the fusion polypeptides to the membrane.
To perform the actual screening, the fusion polypeptides are transferred onto the membrane where they are exposed to a preparation of a plant-infecting virus. The preparation will generally include a purified solution of a native virus of interest, but may also include a solution of purified viral particles (native viral proteins). When viral particles are used, the most external viral protein is likely to be the actual binding ligand (viral glycoproteins in enveloped viruses, or capsid proteins in non-enveloped viruses), with antibodies against these proteins used for detection. By using such purified viral particles, instead of recombinant viral proteins, one can avoid potential problems with non-specific or abrogated binding caused by structural differences between the recombinant and the native viral protein, and additionally the viral protein cloning becomes an unnecessary process step.
The initial advantage of using the present method is that several complex process steps are rendered unnecessary in the cloning process of the virus-binding polypeptide. For example, the present invention does not require the induction of a cellular infection and/or a cellular binding system, or the identification, cloning and expression of a functional viral attachment protein, or the partial purification of a putative receptor.
In addition, by using the method of the present invention, several virus receptor candidates can be selected and cloned in a very short period of time, and used in subsequent experiments for determination of their biological relevance as a virus receptor. Moreover, the present method does not eliminate the selection of polypeptides which are unrelated to the virus receptor, but bind to the virus with a similar or higher affinity, which can be as useful or even more useful than a virus' specific receptor in terms of the development of novel control strategies.
The present method may also be used for deciphering other virus-host interactions, including the detection and identification of cytoplasmic host factors involved in virus replication, transcription, and/or pathogenesis when other viral proteins are used in the screening (e.g., the viral polymerase or the movement of the protein and their specific antibodies).
The identification of virus-binding polypeptides may also lead to the discovery of control strategies via the development of inhibitors of virus entry, replication, transcription, movement and transmission. For example, direct expression in transgenic plants of DNA sequences encoding viral binding polypeptides is expected to result in virus tolerant and/or resistant plans. Virus-binding polypeptides may also be used for identification of virus attachment proteins (receptor-binding) which, in turn, can be fused to specific toxins and then expressed in transgenic plants to accomplish the specific control of insect vectors. For example, the present method has been used to identify seven DNA sequence from the western flower thrips, Frankliniella occidentalis Pergande, which encode polypeptides that specifically bind to the tomato spotted wilt virus ("TSWV"). The seven DNA sequences are partial sequences, i.e. not the entire sequence of native thirps genes, but encode sufficient portions of the binding domains of the thrips genes to bind TSWV virions. The sequences have been identified as pTRl 11 (SEQ ID NO:l), pTR211 (SEQ ID NO:2), pTR313 (SEQ ID NO:3), pTR411 (SEQ ID NO:4), pTR621 (SEQ ID NO:5), pTR711 (SEQ ID NO:6), and pTR821 (SEQ ID NO:7).
As a typical member of the Bunyaviridae family, TSWV has three single- stranded RNA segments encapsulated by a lipidic envelope of host origin. The virion contains four structural proteins including the L polymerase, the N nucleocapsid and two viral-encoded glycoproteins embedded in the envelope, Gl and G2, as all illustrated in Fig. 1.
Recent studies have reported that the viral glycoproteins may serve as viral attachment proteins for several enveloped viruses, an expected property because of the proteins external position in the virus particle. The Arginine-Glycine-Aspartate (RGD) motif has also been established as an integrin-receptor binding motif as it is typically found in glycoproteins of the extracellular matrix in both animal and plant cells, the RGD motif believed to be involved in adhesion of cells to the extracellular matrix. Recently Gavrilovskaya et al. found that β integrins are the cellular receptors for Hantaviruses, the very important human pathogens which are also members of the Bunyaviridae family. Gavrilovskaya et al., "3 integrins mediate the cellular entry of hantaviruses that cause respiratory failure," Proc. Natl. Acad. Sci. USA. 95:7074-7079 (1998). Gavrilovskaya et al. observed that hantavirus entry is RGD-independent, in agreement with the observation that Hantaviruses do not have an RGD sequence in their glycoprotein ORF. Nonetheless, an RGD motif is present in the 5' end of G2 in two tospoviruses, TSWV and Impatiens necrotic spot virus (INSV) and its role as a receptor- binding motif together with the role of β integrins as tospoviruses receptors are questions still not addressed. As mentioned above, Gavrilovskaya demonstrated that β3 integrins specifically mediate the entry of two different hantaviruses in their respective host cells and, thus, proposed β-integrins as the hantavirus receptor. Our sequence analysis indicates that we have cloned at least parts of one or several thrips integrins or integrin-like proteins using the virus-binding selection process of the present invention and a purified TSWV prepartion. Accordingly, this indicates that Tospoviruses may also use β integrins as cellular receptors, which is plausible in evolutionary terms. This hypothesis is substantiated by other data and observations. The Arg-Gly-Asp (RGD) motif has been extensively characterized as the β integrin binding domain and it is present in the G2 sequence of TSWV and INSV. In addition it has been previously demonstrated that TSWV is acquired just by larval stages and that the TSWV receptor is localized in larval midguts.
Our results also show that TSWV binds to some transcriptional activator-like thrips polypeptides which, if confirmed in vivo, might represent TSWV co-receptors and a novel mechanism for virus entry. Figure 5 illustrates a model for the proposed interactions between these factors. Several potential novel virus control strategies based on the seven sequences presented here, as well on virus-binding sequences discovered in accordance with the method of the present invention, are plausible. One approach is based on the use of transgenic plants engineered to express the virus-binding polypeptides. These plants are expected to inhibit transmission by interfering with virus particles assembly (virus assembly is necessary for virus acquisition by thrips). In particular, the polypeptides will bind to the viral glycoproteins and block its interaction with virus RNAs. Alternatively, or concomitantly, these plants are expected to inhibit transmission by interfering with virus-receptor recognition. More specifically, virus-binding polypeptides will saturate receptor binding sites on the virus surface and prevent virus- receptor interaction in thrips vectors. This strategy is illustrated in Fig. 6.
The inhibition of virus transmission caused by virus-binding polypeptides is expected to be effective against all or most tospoviruses because TSWV glycoproteins share about 80% identity with others in the genus. This provides a significant advantage over transgenic plants expressing the N gene, as plants transfected with the N gene are resistant only against the isolate from which the N gene was extracted. Additionally non-binding mutant viruses that will eventually arise would not be transmitted. Another envisioned approach is based on the use of vector specific biological pesticides. Virus-binding polypeptides exclusively found in vector species will be used for selection of specific ligands (TSWV glycoproteins). These specific ligands will be used in the construction of Bt toxin-fusion proteins that will be expressed in transgenic plants or sprayed on plants in the field. Such biopesticides will target tospovirus vectors while avoiding non-vector species.
Another potential approach is based on the identification of chemical compounds and peptides that block TSWV-thrips interaction. Identified virus-binding polypeptides will be used for screening chemical compounds and small peptide libraries. Compounds and/or peptides that disrupt virus binding could be expressed in transgenic plants to inhibit viral binding directly or could be used to design virus-vector interaction blocking agents.
Yet another potential strategy could be based on the use of transgenic plants expressing the viral attachment protein (VAP) or a specific VAP domain. The cloning and identification of the TSWV thrips receptor and TSWV-binding thrips polypeptides will lead to the VAP identification, when expressed in a transgenic plant the VAP will flood the thrips receptor and block transmission.
The method described here can be also be adapted to the cloning of polypeptides that bind any viral proteins (L and/or N for example). Purified recombinant L and N proteins can be used in substitution to the whole virus particle in the overlay step and, instead of TSWV glycoproteins-bound polypeptides, polymerase- or capsid-bound polypeptides can be identified and cloned. Subsequently transgenic plants expressing these polypeptides can be obtained and are expected to be resistant to virus infection via interference with virus replication.
EXAMPLES
Detection of specific TSWV-bound thrips factors using far- Western assays.
Experiments were performed to confirm the existence of specific virus-binding factors in thrips vectors already been reported (Bandla et al., "Interaction of tomato spotted wilt tospovirus (TSWV) glycoproteins with a thrips midgut protein, a potential cellular receptor for TSWV, Phytopathology. 88:98-104 (1998)). As expected, specific TSWV-bound thrips factors were detected only in F. occidentalis using far- Western and Western blotting assays performed as described.
Monoclonal anti-Gl/G2 antibodies (Bandla and Sherwood, "Production of monoclonal antibodies to the glycoproteins of tomato spotted wilt virus using antigens eluted from ChromaPhor stained gels," Phytopathology. 85:1205 (1995)) were coupled to Sepharose C1-4B beads (Sigma) by addition of cyanogen-bromide as described by Ausubel et al., Short Protocols in Molecular Biology. (John Wiley and Sons, Inc., New York, 1995), producing an antibody-Sepharose complex (Ab-Seph). TWWV was purified as described by Gonsalves and Trujillo, "Tomato spotted wilt virus in papaya and detection of the virus by ELISA," Plant Disease. 70:501-506 (1986), resuspended in 0.01 M NaSO3 to 2 μg/μl total protein and immediately incubated for 2 hours at 4°C with Ab-Seph (1 vol virus: lOvol Ab-Seph), resulting in the Ab-Seph-TSWV conjugate. Thrips and mosquito (Anopheles gambiae Giles) extracts were homogenized in SDS lysis buffer (0.5% SDS, 0.05 M Tris-HCl, pH 8.0, ImM DTT, 2mM leupeptin and pepstatin, 20mM iodoacetamide, 1 mM PMSF) at 4 μg/μl total protein, boiled 5 minutes, added to 1 vol of RIP A correction buffer (1.25% NP-40, 1.25% Na- deoxycholate, 0.0125M NaPO4, pH 7.2, 2mM EDTA, 0.2 mM Na-vanadate, 50 mM Na- fluoride, 100 U/ml aprotinin, 2mM leupeptin and pepstatin, 20 mM iodoacetamide, ImM PMSF) and incubated 1 to 4 hours at 4°C.
The insect extracts were then incubated with the Ab-Seph/TSWV conjugate (1:1 vol., empirically determined) for an additional 3 hours at 4°C. After this further incubation period, the mixture was centrifuged for 1 min at 10,000 x g in washing buffer (1% Triton X-100, 1% bovine hemoglobin, pH 8.0, 0.14 NaCl, 0.025% NaN3, 1% sodium dowxycholate, 0.1% SDS, 1 mM DTT), the surpematant was discarded and the pellet was resuspended in washing buffer.
The washing step was repeated three times and the final pellet was resuspended in 10 vols of Laemmli buffer (60mM Tris pH 6.8, 0.1% bromophenol blue, 2.5% BME, 5% SDS), boiled 5 min, and submitted to 7.5% SDS-PAGE. To detect thrips proteins immunoprecipitated by the Ab-Seph-TSWV conjugate, a far- Western assay was performed as described by Bandla et al., supra, with some modifications as will be described. After overnight electroblotting (1 V/cm) and incubation in a blocking solution [5% non-fat dry milk, 0.5% Tween-20, and TBE buffer] for 2 hours, nitrocellulose membranes were incubated with purified TSWV diluted in fresh blocking solution at 10 μg/ml of total protein overnight at 4°C. For visualization, monoclonal anti-Gl antibody (1 : 100 in blocking solution) was used as primary antibody and anti-mouse IgG-horseradish peroxidase conjugate (Sigma) as the secondary antibody (1 :25,000). The ECL™ enhancer chemiluminescent reagent (Amersham) was used as substrate for detection followed by exposure of the blot to X- ray film (Kodak and LabScientific). As positive and negative controls, thrips and mosquito whole extracts (120 μg of total protein) were prepared in Laemmli buffer as described above. The thrips extracts were prepared suing larval stages since the previously detected 50 kDa candidate receptor protein is more abundant in larval than in adult extracts.
Membranes were sequentially incubated in stripping buffer (2% SDS, 100 mM BME, 62 mM Tris, pH 6.8) 50 °C for 30 minutes to remove TSWV virions and antibodies, according to the manufacturers instructions (Amersham), and re-probed only with anti-Gl and secondary antibodies, without previous incubation with purified TSWV. Four additional immunoprecipitation buffers containing nonionic detergents as Triton-XlOO and Nonidet-P40 (described in Ausebel et al, supra) were tested (data not shown), as well as buffering conditions.
Next, anti-idiotypic antibodies (anti-Ids) raised against anti-Gl /G2 monoclonal antibodies (Bandla et al., supra) were coupled to Sepharose beads as described before. The resulting anti-Ids-Seph complex was incubated with the insect extracts (1:1 vol) for 3 hours at 4°C, washed three times, resuspended in Laemmli buffer and boiled for 5 minutes.
The Western blotting assay was conducted as described above but without any virus overlay, while anti-idiotypic antibodies raised against anti-viral glycoproteins antibodies obtained previously were used as the primary antibodies. Mosquitoes (Aedes triseriatus, A. albopictus and Anopheles gambiae) were used as negative controls. To decrease the background cross-reaction observed by Blanda et al., supra, when using the anti-Ids, the antibodies were cross-absorbed (an anti-IdGl+anti-IdG2 mixture) by incubation with whole mouse serum (Sigma) at 4 °C for 3 hours, and collecting the supernatent after 30 minutes of centrifugation at 14,000 x g in a microcentrifuge. Chemiluminescence relative to background of the detected 50 kDA proteins was measured with Lumi-Imager™ (Boehringer Mannheim) in Boehringer light units (BLU)(representing the chemiluminescent light released by the peroxidase-luminol reaction.)
The far- Western assay detected a 50 kDa thrips factor (protein) in the thrips extracts as previously reported by Bandla et al., supra, possibly representing the TSWV receptor or a receptor component. A second factor at about 65 kDa was also detected, although less evident, possibly representing a second receptor or receptor component. Both thrips proteins were also detected in the Western blotting assay when anti-idiotypic antibodies (anti-Ids) were utilized as the primary antibody. Such anti-Ids are considered to mimic the original ligand structure and are frequently used for receptor recognition in several different systems (Gaulton & Greene, 1986).
Construction of cDNA Library
Total RNA and mRNA purification and analysis
Total RNA was extracted from 100 mg of 2nd instar F. occidentalis larvae and adults and Drosophila melanogaster using TRI™ reagent (Sigma, St. Louis, MO) and aurin tricarboxylate (as RNase inhibitor) as described by Dinesh-Kumar and Miller, "Control of start codon choice on a plant viral RNA encoding overlapping genes," Plant Cell. 5:679-692 (1993). Poly(A)+RNA (mRNA) was purified by affinity chromatography using biotin-oligo(dT)-streptavidin beads (PolyATract™, Promega, Madison, WI) in three rounds of purification. Northern hybridization analysis of total and mRNA samples was performed after formaldehyde- 1% agarose gel electrophoresis using an actin universal DNA probe (pActin-1 clone, provided by the S. Carroll's laboratory, Dept. Genetics, UW-Madison) labeled with [α-32P]-dATP to monitor the synthesis reaction. Rnase H, DNA polymerase I, and dNTPs were then added to the first-strand synthesis reaciton product (a DNA/mRNA hybrid) to obtain the second- strand cDNA by 'nick translation'. 100 μg of total RNA and 5 μg of poly(A)+RNA were obtained from the 100 mg of F. occidentalis larval tissue. Final poly(A)+RNA samples had an OD260/ 8o = 1.8. Ribosomal RNA bands were visualized on a 1% denaturing agarose gel by ethidium bromide staining. Analysis of the results showed the 18S rRNA a and b fragments at the 1.8 kb position, as expected. In addition, a Drosophila melanogaster actin probe hybridized to an 800 bp RNA species, as expected, before and after mRNA isolation. These results indicate that the RNA samples utilized were of appropriate quality.
cDNA first- and second-strand synthesis
The λ-ZAP cDNA synthesis kit (Stratagene, San Diego, CA) was used according to the manufacturer's instructions with some modifications. Poly(A)+RNA was added to oligo(dT) linker-primer (5* GAGAGAGAGAGAGAGAGAGAACTAGTCTCGAGT TTTTTTTTTTTTTTTTT 3'), which contains an.λ7jøl site (underlined) for sense- oriented insertion in the UniZAP XR λ vector, with respect to the lacL promoter, a GAGA sequence to protect the restriction site, and a 18-base poly(dT) sequence that binds to the 3' poly(A) region fo the mRNA templates, MMLV reverse transcriptase, 5- methyl dCTP (to protect the cDNA from subsequent digestion reaction), and dNTPs to obtains the first-strand cDNA using [α"32P]-dATP to monitor the reaction. Rnase H, DNA polyerase I ("nick-translation"), and dNTPs were then added to the first-strand synthesis reaction product (a cDNA/mRNA hybrid) to obtain the second-strand cDNA by 'nick translation'. The results visualized on a gel showed a smear of cDNA products extending from 0.1 kb to about 12 kb in a 1% alkaline agarose gel, indicating successful synthesis of a wide range of cDNA. RNA extracted with aurin tricarboxylate resulted in a wider range of cDNA when compared to RNA extracted with TRI™ reagent. Also visualized was a range of cDNA fragments that were size-fractionated (0.5-10kb) and used in the ligation reaction to the λ-ZAP XP vector (Stratagene). Primary library titer was determined by plaque assay as 2 x 105 pfu and 6 x 109 pfu/ml after amplification.
Obtaining recombinant λ phage
Total F. occidentalis cDNA samples were blunted at the ends with Pfu DNA polymerase. EcoRl adapters (a 9- and 13-mer oligonucleotides, complementary to each other with an EcoRI cohesive end) were added by T4 DNA ligase and the reaction product was digested with_Λ72oI. Since the EcoRX adapters were ligated to both ends and the cDNA was not methylated at the linker-primer region, the XhόX. digestion reaction released XhoX. and EcoRX cohesive ends. To avoid cloning of sequences mostly derived from tRNA and small rRNA, size fractionation was carried out by electrophoretic separation of cDNA products on a 1% low melting agarose gel. After 2 hours at 20mA, cDNA fragments ranging from 0.5 to 10 kb were recovered by silica-gel columns (QIAquick™, Qiagen, St. Clarita, CA). After gel recovery, cDNA inserts were ligated in the Uni-ZAP XR λ vector containing XhoX and EcoRX cohesive ends for directional cloning into the pBluescript plasmid sequence, under the control of the lacZ promoter (Stratagene), using T4 DNA ligase according to the manufacturer's instructions. The Gigapack II extract (Stratagene) was used for in vitro packaging of the recombinant phages (Kretz et al., " Gigapack® III high efficiency lambda packaging extract with single-tube convenience," Strategies Mol. Biol., 7:44-45 (1991)), resulting in infectious recombinant λ phase particles.
Titration and amplification
The primary library was produced by infecting E. coli XL 1 -blue (Bullock et al., "XL 1 -blue: A high efficient plasmid transforming recA Escherichia coli strain with β- galactosidase selection," BioTechniques. 5:376-379 (1987)) with the above recombinant phages. Titer was determined by a plaque assay to reveal a titer of 2 x 105 pfu.
Because primary libraries are generally unstable and normally insufficient for repeated rounds of screening, amplification was performed by re-infection in E. coli XL 1 -blue following the manufacturer instructions (Stratagene' s λ-ZAP cDNA synthesis kit). A titer of 6 x 109 pfu/ml was obtained. One ml of the amplified library was stored at 4°C for immediate use in the subsequent screening steps and the remaining 20 ml was stored at - 80 °C with 7% DMSO.
Average size of the thrips inserts
Thirty-one different recombinant plasmid vectors (in a pBluescript background) were isolated at random from the thrips cDNA library and excised in vivo using co- infection with fl helper phage (Short and Sorge, "In vivo excision properties of bacteriophage λZAP expression vectors," Meth. EnzvmoL. 216:485-508 (1992)), according to the manufacturer's instructions (Stratagene), and purified via alkalyne lysis (Sambrook et al., Molecular Cloning: A Laboratory Manuel. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989)). After in vivo excision, the derived plasmids were digested with XhoX /EcoRX restriction enzymes, followed by visualization on 1% agarose gel with ethidium bromide using UV transilluminator (NucleoTech NucleoVision), to determine the average size of the thrips cDNA inserts. The thirty-one cDNA fragments were visible on 1% agarose gel, with the XhoXIEcoRX inserts present in a 0.5 to 1.7 kb range. Figure 2 shows a diagram illustrating the process of the library construction.
Virus maintenance and insect colony
The TSWV Hawaiian strain was maintained by thrips inoculation in Datura stramonium (provided by D. Ullman's laboratory, Dept. Entomology, UC-Davis). Virus purification was performed as described above. A colony of F. occidentalis was established from eggs provided by D. Ullman's laboratory and maintained in a growth chamber at 26 °C and a photoperiod of 16 hours of light and 8 hours of dark. The colony was raised in plastic containers and maintained on green bean pods that were replenished about 2-3 days. Larvae were collected with soft brush at about 5-6 days after oviposition, representing a mixture of first and second instar larvae.
Screening for TSWV-Binding Polypeptides
Screening for TSWV-binding polypeptides was performed in three rounds as described below: First Screening Round:
1) 5 x 104 plaque forming units (pfu) were plated in 150 mm plates and incubated for 3.5 hours at 42°C. Plates were then overlaid with IPTG-impregnated nitrocellulose membranes and incubated at 37°C for 8 hours. Ten (10) plates were used since 5 x 105 was the estimated number of clones to be screened in order to have a 99% probability of finding one gene derived from a low-abundant mRNA (Sibson and Starkey, "Increasing the average of abundance of low-abundance cDNAs by ordered subdivision of cDNA populations," cDNA Library Protocols. 13-32 (Cowell and Austin (eds.) Humana Press, New Jersey (1997)). 2) Nitrocellulose membranes were removed and incubated with a 5% dry fat milk, 0.05% Tween-20 Tris-buffered saline solution (TTBS, Sambrook et al., supra) for 30 min (blocking); plates were stored at 4°C until results were available.
3) Membranes were then incubated at 4 °C overnight with freshly purified TSWV diluted in the 5% milk TTBS solution (final concentration of TSWV = 10 μg total protein/ml of TTBS, spectophotometrically determined).
4) Membranes were washed three times at 5 minutes each in Tris-buffered saline solution (TBS, Sambrook et al., supra) and further incubated for 3 hours at room temperature with anti-Gl monoclonal antibody (MAb).
5) Membranes were washed again and incubated with anti-mouse IgG-HR peroxidase conjugate (Sigma, 1 :25 000 dilution) or anti-mouse IgG-alkaline phosphatase conjugate (Sigma 1 :25 000). Positive signals were detected by adding ECL™ enhanced chemiluminescent reagent as described by the manufacturer (Amersham, Piscataway, NJ) followed by film exposure (LabScientific, Livingston, NJ) or by adding BCIP-NBT alkaline phosphatase substrate (Sigma). Controls:
6) Anύ-Manduca sexta whole hemo-lymph polyclonal antibody (provided by the W. Goodman's laboratory, Dept. Entomology, UW-Madison) was used as a positive control at a dilution of 1 : 10 000. Negative controls included: (a) direct usage of anti-Gl Mab (at 1:100 dilution), without previous incubation with TSWV; and (b) screening of wild type λ-infected plates and TSWV and anti-Gl MAb. All controls were treated as described below for detection. Second Screening Round:
7) The plaques identified as positive in the first round of screening were removed with Pasteur pipettes (wider ends, about 0.8 cm radius) and incubated for 2 hours in 2% chloroform SM buffer (Stratagene λ-ZAP kit). Resuspended phages were titered by plaque assay and 2 x 104 pfu from each positive clone were plated in 50 mm plates and the screening process (steps 1-6) was repeated. Third Screening Round:
8) After the 2nd round, at least 3 positive plaques/plate were isolated, resuspended in SM buffer, titered, and plated again in 50 mm plates. A third round of screening was performed as described above (steps 1-6) in order to insure that a homogenous population of positive clones had been selected and isolated. Selected recombinant plasmid vectors were then excised in vivo and transformed in E. coli DH5α.
In the first round 10 positive signals corresponding to TSWV-bound pfu were identified from a total of 5 x 105 pfu plated. In the second and third rounds 7 out of 10 selected pfu were confirmed as positives. No signals were detected on wt λ-infected plates (negative control) used in the first and third rounds when probed with anti-Gl monoclonal antibody without previous incubation of membranes with purified TSWV (data not shown). Selected pfus were purified and submitted to Eco AIXhόX digestion to confirm homogeneity of the selected phage population. Digestion analysis showed that the positively selected recombinant phages isolated from the same plate after three rounds of screening had the same insert size (data not shown). Meanwhile, randomly selected recombinant phages isolated from negatively selected plates showed inserts of various sizes (data not shown). Overall, this indicated that three rounds of screening was sufficient for isolation of the selected phages.
Overexpression of fusion proteins and far- Western assays
Overexpression of fusion proteins was performed as described by Huang and Jong, "Expression and preparation of fusion proteins from recombinant λgtl 1 phages," cDNA Library Protocols. 241-246 (Cowell and Austin (eds.) Humana Press, New Jersey (1997)) with some modifications. The selected recombinant phages were used to infect E. coli XL-1 blue (2 x 104 pfu/plate). Phages and cells were incubated for 3.5 hours at 42°C, added to 10 ml of LB medium (Sambrook et al., supra) containing 1-10 mM IPTG, and incubated for an additional 3-6 hours at 37 °C. Bacterial lysates were recovered and stored at - 80° C overnight. Next, three volumes of saturated ammonium sulfate were added and total protein was collected by 30 min of centrifugation at 14,000 x g in a refrigerated microcentrifuge (Eppendorff). The supernatant was discarded and pellets recovered in Tris-HCl buffer, pH 7.5. β-galactisidase fusion proteins were purified via affinity chromatography using APTG-agarose (Boehringer Mannheim, Indianapolis, IN) and detected via Western blotting with anti-β-galactosidase monoclonal antibody (Boehringer Mannheim). Fusion protein concentrations' were spectophotometrically determined and adjusted to 1 μg/μl-
Far- Western assays were also carried out as described above. (Bandla et al., supra; Medeiros et al., "Immunoprecipitation of a 50 kDa protein; a candidate receptor component for tomato spotted wilt tospovirus (Bunyaviridae) in its main vector, Frankliniella occidentalis, Virus Res.. 67:109-118 (2000)). Briefly, samples were submitted to 7% SDS-PAGE, transferred to nitrocellulose membranes, and probed with purified TSWV (10 μg total protein/ml of buffer). Thrips polypeptides-TSWV interactions were detected with anti-TSWV Gl monoclonal antibodies as the primary antibody and anti-mouse IgG-HR peroxidase conjugate as the secondary antibody. Positive signals were detected by adding ECL™ enhanced chemiluminescent reagent (Amersham) followed by film (LabScientific) exposure for 2 min to 1 hour.
Positively selected thrips clones (pTRl 11, pTR211, pTR313, pTR411, pTR621, PTR711, and pTR821) were overexpressed in E. coli XL-1 blue and fusion proteins were purified by virtue of their β-galactosidase affinity. Binding of TSWV to a 50 kDa protein present in thrips total protein extracts was detected, as reported previously by Bandla et al., supra, as a control. TSWV binding to four different polypeptides (pTR411, pTR711, pTR821, and pTR621) selected from the thrips cDNA library was also detected. A stronger signal was observed with pTR621 which may represent higher TSWV affinity and/or higher concentration of the TR621 polypeptide in the E. coli lysate.
Other selected clones (pTRl 11 , pTR211 , and pTR313) also resulted in positive signals in additional far- Western assays (data not shown). No TSWV-binding was detected when Aedes triseriatus (a bunyavirus vector) total protein extract or empty pBluescript plasmid vector (pBS) were used. Overall, these results confirmed the specific TSWV-binding capability of the selected thrips polypeptids.
Sequence Analysis
Plasmid DNA derived from the 7 positive pfus (pTRl 11, pTR211, pTR313, pTR411, pTR621, pTR711, and pTR821) were in vivo excised and purified. Thrips inserts were then sequenced with T3 and T7 primers, and analyzed using the UWGCG package (Devereux et al., Nucleic Acid Res.. 12:387 (1984)), the BLAST and FASTA programs and the DNAStar™ software (DNAStar Inc.).
As shown in the table of Fig. 4, sequence analysis revealed that all seven of the positively selected TSWV-binding polypeptides share the four conserved motifs commonly found in β-integrins. These motifs are the characteristic binding motif of β- integrins (the β chain integrin domains signatures) which comprises about 20 residues [Cx(G, N, Q)x{l,3} GxCxCx2CxC] and three additional GC-rich region motifs localized in a region of approximately 200 nucleotides (ferredoxin, a defensin and a EGF-like protein domains), detected by the MOTIFS program of the UW-Genetics Comuter Group package (Devereux et al., supra). These same domains, and only them, were also found in other β integrin sequences, such as a Drosophila β integrin.
In addition, all seven of the positively selected TSWV-binding polypeptides have an ORF in-frame with the lacZ gene in which they were cloned, and would code for polypeptides of about 25 to 30 kDa. They also have potential glycosylation signals; and polyadenylation and stop signals in the correct positions.
Three out of the seven selected clones (pTR621, pTR711 and pTR821) share 90 to 97% homology at the nucleotide level with exactly the same 3' end, although they came from different original plates, which indicates that they originated from the same gene. The prevalence of this gene probably indicates a high abundance in the WFT cDNA library as has been observed in cDNA libraries from D. melanogaster, and/or strong affinity for virus binding. Clone pTR211 showed about 20% homology to clones pTR621, pTR711, and pTR821, while the remaining clones (pTRl 11, pTR411 and pTR313) shared no homology amongst themselves or with the four clones mentioned above. All clones share some homology with proteins detected in the database. BLAST and FASTA searches revealed that pTR621, pTR711, and pTR821 share homology (70% identity at the amino acid level) with cuticle proteins previously cloned from Anopheles spp. and other insects; pTR411 shares homology with cytochrome C sequences (95% identity at the amino acid level); pTR911 shares homology with a defensin protein (95% identity at the amino acid level); pTRl 11 shares homology with several transcription factors, mainly the homeodomain protein (57% identity at the amino acid level); and pTR313 shares homology with the bluebottle fly Calliphora vicina arylphorin receptor (50% identity at the amino acid level). However, none of the selected clones presented an entire open reading frame, therefore the significance of these similarities cannot yet be addressed.

Claims

CLAIMS We claim:
1. A method for identifying nucleotide sequences encoding virus-binding polypeptides which bind to a plant-infecting virus comprising the steps of constructing a cDNA library from total mRNA isolated from an animal virus vector; inducing expression of the cDNA library to obtain fusion polypeptides; transferring the fusion polypeptides onto a membrane; exposing the membrane to a preparation of a plant-infecting virus; detecting those fusion polypeptides which bind to the virus; and sequencing the cDNA library member associated with the fusion polypeptide.
2. The method of claim 1 wherein the virus vector is an insect.
3. The method of claim 2 wherein the virus vector belongs to the insect order Thysanoptera.
4. The method of claim 3 wherein the virus vector is Frankliniella occidentalis
Pergande.
5. The method of claim 1 wherein the membrane is selected from the group consisting of a nitrocellulose membrane, a nylon membrane and a pdf membrane.
6. The method of claim 1 wherein the preparation comprises of a purified solution of a native virus.
7. The method of claim 6 wherein the native virus is selected from the group consisting of rhabdoviruses and tospoviruses.
8. The method of claim 7 wherein the native virus is a tospovirus.
9. The method of claim 8 wherein the native virus is selected from the group consisting of a tomato spotted wilt virus and an impatiens necrotic spot virus.
10. The method of claim 1 wherein the preparation comprises at least one viral particle.
11. The method of claim 10 wherein the viral particle is from a virus selected from the group consisting of rhabdoviruses and tospoviruses.
12. The method of claim 11 wherein the viral particle is from a tospovirus.
13. The method of claim 12 wherein the viral particle is from a virus selected from the group consisting of a tomato spotted wilt virus and an impatiens necrotic spot virus.
14. A method for identifying virus-binding polypeptides which bind to a plant virus comprising the steps of: constructing a cDNA library from total mRNA isolated from an animal virus vector; inducing expression of the cDNA library to obtain fusion polypeptides; transferring the fusion polypeptides onto a membrane; exposing the membrane to a preparation of a plant-infecting virus; and detecting those fusion polypeptides which bind to the virus.
15. The method of claim 14 wherein the virus vector is an insect.
16. The method of claim 15 wherein the virus vector belongs to the insect order
Thysanoptera.
X 1. The method of claim 16 wherein the virus vector is Frankliniella occidentalis Pergande.
18. The method of claim 14 wherein the membrane is selected from the group consisting of a nitrocellulose membrane, a nylon membrane and a pdf membrane.
19. The method of claim 14 wherein the preparation comprises a purified solution of a native virus.
20. The method of claim 19 wherein the native virus is selected from the group consisting of rhabdoviruses and tospoviruses.
21. The method of claim 20 wherein the native virus is a tospovirus.
22. The method of claim 21 wherein the native virus is selected from the group consisting of a tomato spotted wilt virus and an impatiens necrotic spot virus.
23. The method of claim 14 wherein the preparation comprises of at least one viral particle.
24. The method of claim 23 wherein the viral particle is from a virus selected from the group consisting of rhabdoviruses and tospoviruses.
25. The method of claim 24 wherein the viral particle is from a tospovirus.
26. The method of claim 25 wherein the viral particle is from a virus selected from the group consisting of a tomato spotted wilt virus and an impatiens necrotic spot virus.
27. An isolated nucleotide sequence comprising DNA selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7.
28. A transgenic plant expressing a foreign protein, the foreign protein comprising a virus-binding polypeptide as is encoded by a nucleotide sequence selected from the group consisting of SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4, SEQ ID NO. 5, SEQ ID NO. 6, and SEQ ID NO. 7.
29. A seed of the transgenic plant of claim 28.
30. A plant grown from the seed of claim 29.
31. A polypeptide encoded by the nucleotide sequence of claim 28.
EP00952633A 1999-08-06 2000-08-07 Identification of virus-binding polypeptides and nucleotide sequences Withdrawn EP1242634A2 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US14760699P 1999-08-06 1999-08-06
US147606P 1999-08-06
PCT/US2000/021614 WO2001011090A2 (en) 1999-08-06 2000-08-07 Identification of virus-binding polypeptides and nucleotide sequences

Publications (1)

Publication Number Publication Date
EP1242634A2 true EP1242634A2 (en) 2002-09-25

Family

ID=22522214

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00952633A Withdrawn EP1242634A2 (en) 1999-08-06 2000-08-07 Identification of virus-binding polypeptides and nucleotide sequences

Country Status (7)

Country Link
EP (1) EP1242634A2 (en)
AU (1) AU6529500A (en)
CA (1) CA2382646A1 (en)
IL (1) IL147574A0 (en)
MX (1) MXPA02000917A (en)
NZ (1) NZ516487A (en)
WO (1) WO2001011090A2 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106970080A (en) * 2017-05-22 2017-07-21 贵州省亚热带作物研究所 A kind of fast and convenient mango thrips monitoring method

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5877012A (en) * 1993-03-25 1999-03-02 Novartis Finance Corporation Class of proteins for the control of plant pests

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0111090A3 *

Also Published As

Publication number Publication date
WO2001011090A3 (en) 2002-07-18
AU6529500A (en) 2001-03-05
WO2001011090A9 (en) 2002-11-07
MXPA02000917A (en) 2003-03-27
NZ516487A (en) 2004-04-30
IL147574A0 (en) 2002-08-14
WO2001011090A2 (en) 2001-02-15
CA2382646A1 (en) 2001-02-15

Similar Documents

Publication Publication Date Title
Ghosh et al. Transmission of a new polerovirus infecting pepper by the whitefly Bemisia tabaci
Yadani et al. The carboxy-terminal acidic domain of Rift Valley Fever virus NSs protein is essential for the formation of filamentous structures but not for the nuclear localization of the protein
Taning et al. Engineered flock house virus for targeted gene suppression through RNAi in fruit flies (Drosophila melanogaster) in vitro and in vivo
Medeiros et al. The plant virus Tomato Spotted Wilt Tospovirus activates the immune system of its main insect vector, Frankliniella occidentalis
Rowley et al. Genetic variation and virulence of nucleopolyhedroviruses isolated worldwide from the heliothine pests Helicoverpa armigera, Helicoverpa zea, and Heliothis virescens
Guo et al. Roles of cellular NSF protein in entry and nuclear egress of budded virions of Autographa californica multiple nucleopolyhedrovirus
Dai et al. Autographa californica multiple nucleopolyhedrovirus exon0 (orf141), which encodes a RING finger protein, is required for efficient production of budded virus
Tatineni et al. High Plains wheat mosaic virus: An enigmatic disease of wheat and corn causing the High Plains disease
Ohkawa et al. Nuclear F-actin is required for AcMNPV nucleocapsid morphogenesis
Tatineni et al. Differential synergistic interactions among four different wheat-infecting viruses
Wetzel et al. The Beta vulgaris‐derived resistance gene Rz2 confers broad‐spectrum resistance against soilborne sugar beet‐infecting viruses from different families by recognizing triple gene block protein 1
Haas-Stapleton et al. Spodoptera frugiperda resistance to oral infection by Autographa californica multiple nucleopolyhedrovirus linked to aberrant occlusion-derived virus binding in the midgut
Ghosh et al. A C2H2 zinc finger transcription factor of the whitefly Bemisia tabaci interacts with the capsid proteins of begomoviruses and inhibits virus retention
Bao et al. Direct interactions between bidensovirus B m DNV‐Z proteins and midgut proteins from the virus target B ombyx mori
Kang et al. Interaction of Bombyx mori nucleopolyhedrovirus BRO-A and host cell protein laminin
Tatineni et al. 6K1, NIa-VPg, NIa-pro, and CP of wheat streak mosaic virus are collective determinants of wheat streak mosaic disease in wheat
Gilmer Molecular biology and replication of beet necrotic yellow vein virus
WO2001011090A2 (en) Identification of virus-binding polypeptides and nucleotide sequences
WO2013032999A2 (en) Polydnavirus delivery constructs
Dorrington Advances in Tetravirus research: new insight into the infectious virus lifecycle and an expanding host range
Goszczynski Divergent molecular variants of Grapevine virus B (GVB) from corky bark (CB)-affected and CB-negative LN33 hybrid grapevines
Medeiros et al. Simplified, rapid method for cloning of virus-binding polypeptides (putative receptors) via the far-Western screening of a cDNA expression library using purified virus particles
Sun et al. The mRNA surveillance factor Pelo restricts rice virus propagation in insect vectors and host plants
Alaoui-Ismaili et al. Identification and characterization of a filament-associated protein encoded by Amsacta moorei entomopoxvirus
JPH10262669A (en) Transgenic virus

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020222

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20031008

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060301