EP1229795A2 - Human chemokine beta-13 - Google Patents

Human chemokine beta-13

Info

Publication number
EP1229795A2
EP1229795A2 EP00978340A EP00978340A EP1229795A2 EP 1229795 A2 EP1229795 A2 EP 1229795A2 EP 00978340 A EP00978340 A EP 00978340A EP 00978340 A EP00978340 A EP 00978340A EP 1229795 A2 EP1229795 A2 EP 1229795A2
Authority
EP
European Patent Office
Prior art keywords
ckβ
polypeptide
amino acid
seq
polynucleotide
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00978340A
Other languages
German (de)
French (fr)
Other versions
EP1229795A4 (en
Inventor
Stephen Ullrich
George Seibel
Haodong Li
Francis W. Luscinskas
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Brigham and Womens Hospital Inc
Human Genome Sciences Inc
SmithKline Beecham Corp
Original Assignee
Brigham and Womens Hospital Inc
Human Genome Sciences Inc
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Brigham and Womens Hospital Inc, Human Genome Sciences Inc, SmithKline Beecham Corp filed Critical Brigham and Womens Hospital Inc
Publication of EP1229795A2 publication Critical patent/EP1229795A2/en
Publication of EP1229795A4 publication Critical patent/EP1229795A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/521Chemokines
    • C07K14/523Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1, LDCF-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to a novel human gene encoding a polypeptide which is a member of the chemokine family. More specifically, isolated nucleic acid molecules are provided encoding a human polypeptide named Human Chemokine Beta-13, hereinafter referred to as "CK ⁇ -13.” Polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. Also provided are diagnostic methods for detecting disorders related to the immune system, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of CK ⁇ -13 activity.
  • Chemokines also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75% homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C-X-C" subfamily. In the beta subfamily, the two cysteines are in an adjacent position and are, therefore, referred to as the "C-C” subfamily. Thus far, at least nine different members of this family have been identified in humans.
  • the intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils, and fibroblasts. Many chemokines have proinflammatory activity and are involved in multiple types during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enchanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvment in inflammation, certain chemokines have been shown to exhibit other activities.
  • macrophage inflammatory protein- 1 is able to suppress hematopoietic stem cell proliferation
  • platelet factor-4 is a potent inhibitor of endothelial cell growth
  • interleukin-8 IL-8 promotes proliferation of keratinocytes
  • GRO is an autocrine growth factor for melanoma cells.
  • chemokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.
  • C-C Members of the "C-C” branch exert their effects on the following cells: eosinophils which destroy parasites to lessen parasitic infection and cause chronic inflammation in the airways of the respiratory system; monocytes and macrophages which suppress tumor formation in vertebrates; T lymphocytes which attract T cells and basophils which release histamine which plays a role in allergic inflammation.
  • polypeptide of the present invention has the conserved cysteine "C-C" region, and has amino acid sequence homology to other known chemokines.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of the CK ⁇ -13 polypeptide having the complete amino acid sequence shown in SEQ ID NO: 2 or the complete amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number 97113 on April 28, 1995.
  • the polypeptide of the present invention has amino acid sequence homology to known chemokines, including the conserved cysteine pattern characteristic of the beta subfamily of chemokines beginning with the first cysteine from the amino terminus in SEQ ED NO:2.
  • the encoded polypeptide has two observed leader sequences of 24 and 28 amino acids; and the amino acid sequence of the observed mature CK ⁇ -13 proteins are also shown in Figure 1 (SEQ ID NO:2), as amino acid residues 25-93 and 29-93.
  • one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding the CK ⁇ -13 polypeptide having the complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the observed mature CK ⁇ -13 polypeptide having the amino acid sequence at positions 25-93 in SEQ ID NO:2; (c) a nucleotide sequence encoding the observed mature CK ⁇ -13 polypeptide having the amino acid sequence at positions 29-93 in SEQ ID NO:2; (d) a nucleotide sequence encoding the CK ⁇ -13 polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
  • An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a CK ⁇ -13 polypeptide having an amino acid sequence described in (a), (b), (c), (d) or (e), above.
  • Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a CK ⁇ -13 polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.
  • the invention provides an isolated antibody that binds specifically to a CK ⁇ -13 polypeptide having an amino acid sequence described in (a), (b), (c), (d) or (e) above.
  • the invention further provides methods for isolating antibodies that bind specifically to a CK ⁇ -13 polypeptide having an amino acid sequence as described herein. Such antibodies are useful diagnostically or therapeutically as described below.
  • the invention also provides for pharmaceutical compositions comprising CK ⁇ -13 polypeptides, particularly human CK ⁇ -13 polypeptides, which may be employed, for instance, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasistic infections, psoriasis, to regulate hematopoiesis, to stimulate growth factor activity, to treat fibrotic disorders, to inhibit angiogenesis and to promote wound healing.
  • CK ⁇ -13 may also be employed to treat sepsis and is useful for immune enhancement or suppression, myeloprotection, and acute and chronic inflammatory control.
  • compositions comprising a CK ⁇ -13 polynucleotide or a CK ⁇ -13 polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism.
  • the compositions comprise a CK ⁇ -13 polynucleotide for expression of a CK ⁇ -13 polypeptide in a host organism for treatment of disease.
  • Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity of a CK ⁇ -13.
  • a screening assay for agonists and antagonists involves determining the effect a candidate compound has on CK ⁇ -13 binding to a CK ⁇ -13 receptor.
  • the method involves contacting the CK ⁇ -13 receptor with a CK ⁇ -13 polypeptide and a candidate compound and determining whether CK ⁇ -13 polypeptide binding to the CK ⁇ -13 is increased or decreased due to the presence of the candidate compound.
  • an increase in binding of CK ⁇ -13 over the standard binding indicates that the candidate compound is an agonist of CK ⁇ -13 binding activity and a decrease in CK ⁇ -13 binding compared to the standard indicates that the compound is an antagonist of CK ⁇ -13 binding activity.
  • CK ⁇ -13 is expressed not only in monocytes but also in activated dendritic cells.
  • tissues e.g., cancerous and wounded tissues
  • bodily fluids e.g., serum, plasma, urine, synovial fluid or spinal fluid
  • the invention provides a diagnostic method useful during diagnosis of such a disorder, which involves: (a) assaying CK ⁇ -13 gene expression level in cells or body fluid of an individual; (b) comparing the CK ⁇ -13 gene expression level with a standard CK ⁇ -13 gene expression level, whereby an increase or decrease in the assayed CK ⁇ -13 gene expression level compared to the standard expression level is indicative of disorder in the immune.
  • An additional aspect of the invention is related to a method for treating an individual in need of an increased level of CK ⁇ -13 activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated CK ⁇ -13 polypeptide of the invention or an agonist thereof.
  • a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of CK ⁇ -13 activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of an CK ⁇ -13 antagonist.
  • Preferred antagonists for use in the present invention are CK ⁇ - 13 -specific antibodies.
  • Figure 1 shows the nucleotide sequence (SEQ ID NO: l) and deduced amino acid sequence (SEQ ID NO:2) of CK ⁇ -13.
  • Figure 2 shows the regions of identity between the amino acid sequences of the CK ⁇ - 13 protein and translation product of the human mRNA for monocyte chemotactic protein-l (MTP-l ⁇ ) (lower line) (SEQ ID NO:3), determined by the computer program Bestfit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) using the default parameters.
  • MTP-l ⁇ monocyte chemotactic protein-l
  • Figure 3 shows an analysis of the CK ⁇ - 13 amino acid sequence.
  • Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings.
  • the positive peaks indicate locations of the highly antigenic regions of the CK ⁇ - 13 protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained.
  • the domains defined by these graphs are contemplated by the present invention.
  • Figure 5 shows the effect of CK ⁇ - 13 on VLA4-VCAM-1 interactions of
  • CD4+ T cell subsets under flow The top panel shows the increased accumulation of naive T cells with increasing levels of CK ⁇ - 13 compared to accumulation in media alone.
  • the bottom panel shows a decreased memory T cell accumulation under identical conditions.
  • Figure 6 shows the effect of CK ⁇ - 13 co-immobilized with VCAM-1 on T cell subsets.
  • Figure 7 shows the effect of CK ⁇ - 13 on CD4+ T cell subset accumulation on (A) VCAM- 1 -transduced or (B) TNF- ⁇ activated HUVEC monolayers under flow.
  • Figure 8 shows the effect of mAb to the CK ⁇ - 13 receptor, CCR4, on T cell subset interactions with VCAM-1.
  • the present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a CK ⁇ - 13 polypeptide having the amino acid sequence shown in SEQ ID NO: 2, which was determined by sequencing a cloned cDNA.
  • the nucleotide sequence shown in Figure 1 (SEQ ID NO: l) was obtained by sequencing the HMSDB49 clone, which was deposited on April 28, 1995 at the American Type Culture Collection, located at 10801 University Boulevard, Manassas, VA 201 10- 2209, USA, and given accession number ATCC 97113.
  • the deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA).
  • isolated refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state.
  • an isolated polynucleotide or nucleic acid could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.
  • isolated does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
  • a CK ⁇ - 13 "polynucleotide” refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: l or the cDNA contained within the clone deposited with the ATCC.
  • the CK ⁇ - 13 polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence.
  • a CK ⁇ -13 "polypeptide” refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
  • polypeptide of the present invention has amino acid sequence homology to known chemokines, including the conserved cysteine pattern characteristic of the beta subfamily of chemokines beginning with the first cysteine from the amino terminus in SEQ ID NO:2.
  • nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City, CA), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art.
  • a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion.
  • nucleotide sequence of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U).
  • nucleic acid molecule of the present invention encoding a CK ⁇ - 13 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material.
  • nucleic acid molecule described in Figure 1 was discovered in a cDNA library derived from human monocytes.
  • SEQ ID NO: l contains an open reading frame encoding a protein of 93 amino acid residues, with an initiation codon at nucleotide positions 1-3 of the nucleotide sequence in Figure 1 (SEQ ID NO: l).
  • the amino acid sequence of the CK ⁇ - 13 protein shown in SEQ ID NO:2 is about 33% identical to and 53% similar to human mRNA for MIP- 1 ⁇ ( Figure 2) .
  • the actual complete CK ⁇ - 13 polypeptide encoded by the deposited cDNA which comprises about 93 amino acids, may be somewhat longer or shorter. More generally, the actual open reading frame may be anywhere in the range of ⁇ 20 amino acids, more likely in the range of ⁇ 10 amino acids, of that predicted from the first methionine codon from the N-terminus shown in Figure 1 (SEQ ID NO: 1).
  • the present invention provides nucleic acid molecules encoding a mature form of the CK ⁇ - 13 protein.
  • proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the complete polypeptide to produce a secreted "mature" form of the protein.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein.
  • the present invention provides a nucleotide sequence encoding the mature CK ⁇ - 13 polypeptide having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. 971 13.
  • the mature CK ⁇ - 13 polypeptide having the amino acid sequence encoded by the cDNA clone in ATCC Deposit No.
  • 97113 is meant the mature form(s) of the CK ⁇ - 13 protein produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host.
  • a mammalian cell e.g., COS cells, as described below
  • the deposited cDNA has been expressed in a baculovirus vector in insect cells as described herein below, and amino acid sequencing of the amino terminus of the two secreted species indicated that the mature CK ⁇ - 13 proteins comprise amino acids 25 to 93 and 29 to 93 of SEQ ID NO:2.
  • the leader sequences of the CK ⁇ - 13 protein in the amino acid sequence of SEQ ID NO:2 are 24 and 28 amino acids, respectively.
  • nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically.
  • the DNA may be double-stranded or single-stranded.
  • Single- stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
  • isolated nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment
  • isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution.
  • isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention.
  • Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically.
  • Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) with an initiation codon at positions 1-3 of the nucleotide sequence shown in Figure 1 (SEQ ID NO: l).
  • DNA molecules comprising the coding sequence for the observed mature CK ⁇ - 13 protein.
  • isolated nucleic acid molecules of the invention include DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the CK ⁇ - 13 protein.
  • the genetic code and species-specific codon preferences are well known in the art. Thus, it would be routine for one skilled in the art to generate the degenerate variants described above, for instance, to optimize codon expression for a particular host (e.g., change codons in the human mRNA to those preferred by a bacterial host such as E. coli).
  • the invention provides isolated nucleic acid molecules encoding the CK ⁇ - 13 polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97113 on
  • this nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited cDNA clone.
  • the invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (S ⁇ Q ID NO: l) or the nucleotide sequence of the CK ⁇ - 13 cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences.
  • isolated molecules particularly DNA molecules, are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the CK ⁇ - 13 gene in human tissue, for instance, by Northern blot analysis.
  • the present invention is further directed to nucleic acid molecules encoding portions of the nucleotide sequences described herein as well as to fragments of the isolated nucleic acid molecules described herein.
  • the invention provides a polynucleotide comprising nucleotides 1 to 279 of S ⁇ Q ID NO:2.
  • fragments of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figure 1 is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein.
  • larger fragments 50-300 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figure 1 (S ⁇ Q ⁇ D NO: l).
  • nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the CK ⁇ - 13 polypeptide as identified in Figure 3 and described in more detail below.
  • the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit No. 97113.
  • stringent hybridization conditions is intended overnight incubation at 42° C in a solution comprising: 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0. lx SSC at about 65° C.
  • a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 (e.g., 50) nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
  • a portion of a polynucleotide of "at least 20 nt in length,” for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO: l)).
  • a polynucleotide which hybridizes only to a poly A sequence such as the 3' terminal poly(A) tract of the CK ⁇ - 13 cDNA shown in Figure 1 (SEQ ID NO: l)), or to a complementary stretch of T (or U) residues, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
  • nucleic acid molecules of the present invention which encode a CK ⁇ - 13 polypeptide may include, but are not limited to those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding the about 20-35 amino acid leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; and/or the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences.
  • nucleic acids of the invention are the above protein sequences together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; and an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • additional, non-coding sequences including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA
  • additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
  • the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • the "HA” tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37: 767 (1984).
  • other such fusion proteins include the CK ⁇ - 13 fused to Fc at the N- or C-terminus.
  • polynucleotide fragment refers to a short polynucleotide having a nucleic acid sequence which: is a portion of that contained in a deposited clone, or encodes the polypeptide encoded by the cDNA in a deposited clone; is a portion of that shown in SEQ ID NO: 1 or the complementary strand thereto, or is a portion of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2.
  • the nucleotide fragments of the invention are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length.
  • a fragment "at least 20 nt in length,” for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in a deposited clone or the nucleotide sequence shown in SEQ ID NO: l.
  • “about” includes the particularly recited value, a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. These nucleotide fragments have uses that include, but are not limited to, as diagnostic probes and primers as discussed herein.
  • fragments e.g., 50, 150, 500, 600, 2000 nucleotides are preferred.
  • polynucleotide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, a sequence from about nucleotide number, 1-48, 48-72, 48-84, 72-105, 84-105, 106- 144, 145-192, 193-228, 229-279, and 280 to the end of SEQ ID NO: l, or the complementary strand thereto, or the cDNA contained in the deposited clone.
  • “about” includes the particularly recited ranges, and ranges larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini.
  • these fragments encode a polypeptide which has biological activity.
  • these polynucleotides can be used as probes or primers as discussed herein.
  • Polynucleotides which hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides.
  • the present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the CK ⁇ - 13 protein. Variants may occur naturally, such as a natural allelic variant. By an "allelic variant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
  • variants include those produced by nucleotide substitutions, deletions or additions.
  • the substitutions, deletions or additions may involve one or more nucleotides.
  • the variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the CK ⁇ - 13 protein or portions thereof. Also especially preferred in this regard are conservative substitutions.
  • nucleic acid molecules encoding the mature protein having the amino acid sequence described above or the mature CK ⁇ - 13 amino acid sequence encoded by the deposited cDNA clone.
  • inventions include an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to a polynucleotide selected from the group consisting of: (a) a nucleotide sequence encoding the CK ⁇ - 13 polypeptide having the complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the observed mature CK ⁇ - 13 polypeptide having the amino acid sequence at positions 25 to 93 of SEQ ED NO:2; (c) a nucleotide sequence encoding the observed mature CK ⁇ - 13 polypeptide having the amino acid sequence at positions 29 to 93 of SEQ ED NO:2; (d) a nucleotide sequence encoding the CK ⁇ - 13 polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
  • nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e) or (f), above.
  • This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
  • An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a CK ⁇ -13 polypeptide having an amino acid sequence in (a), (b), (c), (d) or (e), above.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of CK ⁇ - 13 polypeptides or peptides by recombinant techniques.
  • nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the CK ⁇ - 13 polypeptide.
  • nucleic acid having a nucleotide sequence at least 95% ⁇ identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • the query sequence may be an entire sequence shown of SEQ ED NO:l, the ORF (open reading frame), or any fragment specified as described herein.
  • nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the present invention can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.)
  • a sequence alignment the query and subject sequences are both DNA sequences.
  • An RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
  • the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end.
  • the 10 unpaired bases represent 10%) of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
  • a 90 base subject sequence is compared with a 100 base query sequence.
  • deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • the present application is directed to nucleic acid molecules at least 90%, 95%o, 96%), 97%, 98%) or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO: l) or to the nucleic acid sequence of the deposited cDNA, irrespective of whether they encode a polypeptide having CK ⁇ - 13 activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having CK ⁇ - 13 activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer.
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having CK ⁇ -13 activity include, inter alia, (1) isolating the CK ⁇ - 13 gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the CK ⁇ - 13 gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and Northern Blot analysis for detecting CK ⁇ - 13 mRNA expression in specific tissues.
  • FISH in situ hybridization
  • nucleic acid molecules having sequences at least 90%, 95%, 96%), 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ED NO:l) or to the nucleic acid sequence of the deposited cDNA which do, in fact, encode a polypeptide having CK ⁇ -13 protein activity.
  • a polypeptide having CK ⁇ - 13 activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the mature protein of the invention, as measured in a particular biological assay.
  • the CK ⁇ -13 protein of the present invention modulates the leukocyte-endothelial cell interactions of T cell subsets.
  • CK ⁇ - 13 polynucleotides or polypeptides Treatment of CD4+ T cells with CK ⁇ - 13 polynucleotides or polypeptides, strongly modulates the VLA-4 integrin interaction with its endothelial cell ligand VCAM-1.
  • CK ⁇ - 13 polynucleotides or polypeptides of the invention may be used to modulate leukocyte-endothelial cell interactions either positively or negatively, and regulate leukocyte trafficking in the peripheral vasculature.
  • CK ⁇ - 13 polynucleotides or polypeptides may be used to negatively regulate memory T cell adhesive interactions on VCAM-1.
  • CK ⁇ - 13 polynucleotides or polypeptides may be used to negatively regulate memory T cell recruitment to inflammatory sites where VCAM-1 is abundantly expressed on chronic activated vascular epithelium.
  • CK ⁇ - 13 polynucleotides or polypeptides may be used to positively regulate naive T cell adhesive interations on VCAM-1 (See, e.g., Example 6).
  • CK ⁇ - 13 protein of the present invention is chemotactic for activated T-lymphocytes in the assay described in Example 5.
  • CK ⁇ - 13 protein is chemotactic in a dose-dependent manner for activated T-lymphocytes in the above- described assay.
  • "a polypeptide having CK ⁇ - 13 protein activity” includes polypeptides that also exhibit any of the same activities in the above-described assays in a dose-dependent manner.
  • a polypeptide having CK ⁇ - 13 protein activity will exhibit substantially similar dose-dependence in a given activity as compared to the CK ⁇ -13 protein (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity relative to the reference CK ⁇ - 13 protein).
  • CK ⁇ - 13 Like other CC chemokines, CK ⁇ - 13 exhibits activity on leukocytes with a strong activity on T-lymphocytes which have been activiated by cross-linking of the CD3 receptor in the presence of IL-2. For this reason CK ⁇ -13 is active in directing the proliferation, differentiation and migration of these cell types. Such activity is useful for immune enhancement or suppression, myeloprotection, stem cell mobilization, acute and chronic inflammatory control and treatment of leukemia. However, unlike other known CC chemokines CK ⁇ - 13 has been shown to be expressed only in an activated monocyte and dendritic cell cDNA library. These two cell types combined make up the majority of the anitigen presenting cells (APCs).
  • APCs anitigen presenting cells
  • Dendritic cells (DCs) and monocytes are professional APCs which are critical for the proper response of the host and are responsible for primary antigen-specific immune reactions. APCs play a crucial role in the presentation of antigens to both T- lymphocytes and B-lymphocytes to initiate the immune response, including for example, antigen trapping and processing, viral trapping, filtering and processing. APCs are normally found in the lymph node, spleen, thymus, skin and circulate throughout the body. When found in the skin, DCs are refered to as Langerhans cells. Follicular dendritic cells reside in the germinal centers of the lymph node.
  • CK ⁇ - 13 is produced by these cells, CK ⁇ - 13 is active in modulating the activities of both monocytes and dendritic cells as well as the cells with which these APCs interact. In addition, CK ⁇ - 13 has effects on the local resident cells in which APCs normally reside such as the skin, thymus, spleen, and lymph node. CK ⁇ - 13 regulates the proliferation and maturation of DCs and is monitored in a proliferation differentiation assay such as those reviewed by Peters et al. (1996) Immun. Today 17:273 and described by Young et al. (1995) J. Exp. Med. 182: 11 1 1; Caux et al.
  • CK ⁇ -13 also influences the effector function of DCs and monocytes. That is, CK ⁇ - 13 enhaces the capacity of DCs and monocytes to take up virus, bacteria or other foreign substances, process them and present them to the lymphocytes responsible for immune responses. CK ⁇ - 13 also modulates the interaction of DCs and monocytes with T-lymphocytes and B-lymphocytes.
  • CK ⁇ - 13 provides a costimulation signal during antigen presentation which directs the responding cell to survive, proliferate, differentiate, secrete additional cytokines or soluble mediators, or selectively removes the responding cell by inducing apoptosis or other mechanisms of cell death Since DCs and monocytes have been shown to facilitate the transfer of HIV to CD4+ T-lymphocytes CK ⁇ - 13 also influences this ability and prevents infection of lymphocytes by HIV or other viruses mediated through monocytes or DCs This is also true for the intital infection of monocytes and DCs by such viruses Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figure 1 (SEQ ID NO 1) will encode a polypeptide "having CK ⁇ - 13
  • the present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of CK ⁇ - 13 polypeptides or fragments thereof by recombinant techniques
  • the vector may be, for example, a phage, plasmid, viral or retroviral vector Retroviral vectors may be replication competent or replication defective In the latter case, viral propagation generally will occur only in complementing host cells
  • the polynucleotides may be joined to a vector containing a selectable marker for propagation in a host.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the S V40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293 and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • vectors preferred for use in bacteria include pQ ⁇ 70, pQE60 and ⁇ QE-9, available from QIAGEN, Inc., supra, pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHl ⁇ a, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • the polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art.
  • a preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to stabilize and purify proteins.
  • EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262).
  • Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations.
  • human proteins such as hJL-5
  • Fc portions for the purpose of high-throughput screening assays to identify antagonists of hEL-5. See, D. Bennett et ai, J. Molecular Recognition 5:52-58 (1995) and K. Johanson et al, J. Biol. Chem. 270:9459-9471 (1995).
  • the CK ⁇ - 13 protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • Polypeptides of the present invention include: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
  • the invention further provides an isolated CK ⁇ - 13 polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID NO:2, or a peptide or polypeptide comprising a portion of the above polypeptides.
  • polypeptides of the present invention include polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide sequence shown in SEQ ID NO:2, the polypeptide sequence encoded by the cDNA contained in a deposited clone, and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein).
  • polypeptide having an amino acid sequence at least, for example, 95%
  • amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • whether any particular polypeptide is at least 80%,
  • 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences of SEQ ID NO: 2 or to the amino acid sequence encoded by the cDNA contained in a deposited clone can be determined conventionally using known computer programs.
  • a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245(1990)).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention.
  • a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity.
  • the deletion occurs at the N- terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%).
  • a 90 residue subject sequence is compared with a 100 residue query sequence.
  • deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • CK ⁇ - 13 polypeptides protein engineering may be employed.
  • Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins including single or multiple amino acid substitutions, deletions, additions or fusion proteins.
  • modified polypeptides can show, e.g., enhanced activity or increased stability.
  • they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions.
  • polypeptide fragment refers to an amino acid sequence which is a portion of that contained in SEQ ED NO: 2 or encoded by the cDNA contained in the deposited clone.
  • Protein (polypeptide) fragments may be "free-standing,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
  • Representative examples of polypeptide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-24, 1-28, 25-35, 28-35, 36-48, 49-64, 65-76, and 77 to the end of the coding region.
  • polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids in length.
  • “about” includes the particularly recited ranges or values, and ranges or values larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
  • Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • deletions of N-terminal amino acids up to the Cys at position 36 of SEQ ID NO: 2 may retain some biological activity such as receptor binding or modulation of T cell activities, for chemokines.
  • Polypeptides having further N-terminal deletions including the Cys-36 residue in SEQ ED NO:2 would not be expected to retain such biological activities because it is known that this residue in a chemokine-related polypeptide is required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction.
  • deletion of one or more amino acids from the N-terminus of a protein results in modification of loss of one or more biological functions of the protein
  • other functional activities e.g., biological activities, ability to multimerize, ability to bind CK ⁇ - 13 ligand, ability to modulate T cell activity
  • the ability of shortened CK ⁇ - 13 muteins to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptides generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the N-terminus.
  • Preferred polypeptide fragments include the secreted protein as well as the mature form. Further preferred polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids,
  • polypeptide fragments include the secreted CK ⁇ - 13 protein as well as the mature form. Further preferred polypeptide fragments include the secreted CK ⁇ - 13 protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids, ranging from 1-60, can be deleted from the amino terminus of either the secreted CK ⁇ - 13 polypeptide or the mature form. Similarly, any number of amino acids, ranging from 1-30, can be deleted from the carboxy terminus of the secreted CK ⁇ - 13 protein or mature form. Furthermore, any combination of the above amino and carboxy terminus deletions are preferred. Similarly, polynucleotides encoding these polypeptide fragments are also preferred.
  • N-terminal deletions of the CK ⁇ -13 polypeptide can be described by the general formula m ! -93, where m 1 is an integer from 2 to 88, where m 1 corresponds to the position of the amino acid residue identified in SEQ ID NO:2.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of A-2 to Q-93; R-3 to Q-93; L-4 to Q-93; Q-5 to Q-93; T-6 to Q-93; A-7 to Q-93; L-8 to Q-93; L-9 to Q-93; V-10 to Q-93; V-l 1 to Q-93; L-12 to Q-93; V-13 to Q-93; L-14 to Q-93; L-15 to Q-93; A-16 to Q-93; V-17 to Q-93; A-18 to Q-93; L-19 to Q-93; Q-20 to Q-93; A-21 to Q-93; T-22 to Q-93; E-23 to Q-93; A-24 to Q-93; G-25 to Q-93; P-26 to Q-93; Y-27 to Q-93; G-28 to Q-93; A-29 to Q-93; N-30 to Q-93; M- 31 to Q
  • the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of the CK ⁇ -13 shown in SEQ ID NO:2, up to the Cys-36 residue, and polynucleotides encoding such polypeptides.
  • the present invention provides polypeptides comprising the amino acid sequence of residues m 2 -93 of SEQ ID NO:2, where m 2 is an integer in the range of 1-35 where Cys-36 is the position of the first residue from the N-terminus of the complete CK ⁇ -13 polypeptide (shown in SEQ ID NO:2) believed to be required for receptor binding activity of the CK ⁇ - 13 protein.
  • the invention provides polypeptides having the amino acid sequence of residues 1-93, 2-93, 3-93, 4-93, 5-93, 6-93, 7-93, 8-93, 9-93, 10-93, 11- 93, 12-93, 13-93, 14-93, 15-93, 16-93, 17-93, 18-93, 19-93, 20-93, 21-93, 22-93, 23-93, 24-93, 25-93, 26-93, 27-93, 28-93, 29-93, 30-93, 31-93, 32-93, 33-93, 34- 93, and/or 35-93 of SEQ ED NO:2. Polynucleotides encoding these polypeptides also are provided.
  • deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein
  • other functional activities e.g., biological activities, ability to multimerize, ability to bind CK ⁇ - 13 ligand, ability to modulate T cell activity
  • the ability of the shortened CK ⁇ - 13 mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus.
  • C-terminal deletion muteins are known. For instance, interferon gamma shows up to ten times higher activities by deleting 8-10 amino acid residues from the carboxy terminus of the protein (Dobeli et al, J. Biotechnology 7:199-216 (1988).
  • deletions of C-terminal amino acids up to the Cys at position 76 of SEQ ID NO:2 may retain some biological activity such as receptor binding or modulation of target cell activities, for chemokines.
  • Polypeptides having further C-terminal deletions including Cys-76 of SEQ ED NO: 2 would not be expected to retain such biological activities because it is known that this residue in a chemokine-related polypeptide is required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction.
  • the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the CK ⁇ - 13 polypeptide shown in Figure 1 (SEQ ID NO: 2), as described by the general formula 1-n 1 , where n 1 is an integer from 7 to 92, where n 1 corresponds to the position of amino acid residue identified in SEQ ID NO:2.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of M-l to S-92; M-l to L-91; M-l to K-90; M-l to S-89; M-l to L-88; M-l to 1-87; M-l to M-86; M-l to K-85; M-l to V-84; M-l to W-83; M-l to P-82; M-l toV-81; M-l to R-80; M-l to P-79; M-l to D-78; M-l to A-77; M-lto C-76; M-l to 1-75; M-l to E-74; M-l to K-73; M-l to D-72; M-lto R-71; M-l to F-70; M-l to T-69; M-l to L-68; M-l to L-67; M-lto V-66; M-
  • the present invention further provides polypeptides having one or more residues from the carboxy terminus of the amino acid sequence of the CK ⁇ - 13 shown in SEQ ID NO 2, up to the Cys-76 of SEQ ID NO 2, and polynucleotides encoding such polypeptides
  • the present invention provides polypeptides having the amino acid sequence of residues 1-n 2 of the amino acid sequence in SEQ ID NO 2, where n 2 is any integer in the range of 77 to 93 where 76 is the position of the C- terminal Cys residue of the complete CK ⁇ - 13 polypeptide (shown in SEQ ID NO 2) believed to be required for receptor binding or modulation of target cell activities of the CK ⁇ - 13 protein
  • the invention provides polynucleotides encoding polypeptides having the amino acid sequence of residues m 2 -n 2 , where m 2 is an integer 1-35 and n 2 is an integer 77-93 of SEQ ID NO 2 Polynucleotides encoding these polypeptides
  • any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted CK ⁇ - 13 polypeptide
  • the invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues n ⁇ -n 1 of SEQ ID NO 2, where m 1 and n 1 are integers as described above Polynucleotides encoding these polypeptides are also encompassed by the invention
  • preferred N- and C- terminal deletions comprise amino acid sequences A-29 to Q-93; G-28 to Q-93; and/or G-25 to Q-93 of SEQ ID NO:2.
  • polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the mature CK ⁇ -13 polypeptide shown in Figure 1 (SEQ ID NO:2), as described by the general formula 25-n 3 , where n 3 is an integer from 31 to 92, where n 3 corresponds to the position of amino acid residue identified in SEQ ED NO:2.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of G- 25 to S-92; G-25 to L-91; G-25 to K-90; G-25 to S-89; G-25 to L-88; G-25 to 1-87; G-25 to M-86; G-25 to K-85; G-25 to V-84; G-25 to W-83; G-25 to P-82; G-25 toV-81; G-25 to R-80; G-25 to P-79; G-25 to D-78; G-25 to A-77; G-25 to C-76; G-25 to 1-75; G-25 to E-74; G-25 to K-73; G-25 to D-72; G-25 to R-71; G-25 to F- 70; G-25 to T-69; G-25 to L-68; G-25 to L-67; G-25 to V-66; G-25 to V-65; G-25 to G-64; G-25 to P-63; G-25 to R-62;
  • a signal sequence may be added to these C-terminal constructs.
  • the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the mature CK ⁇ -13 polypeptide shown in Figure 1 (SEQ ID NO:2), as described by the general formula 29-n 4 , where n 4 is an integer from 35 to 92, where n 4 corresponds to the position of amino acid residue identified in SEQ ID NO:2.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of G- 29 to S-92; G-29 to L-91; G-29 to K-90; G-29 to S-89; G-29 to L-88; G-29 to 1-87; G-29 to M-86; G-29 to K-85; G-29 to V-84; G-29 to W-83; G-29 to P-82; G-29 toV-81; G-29 to R-80; G-29 to P-79; G-29 to D-78; G-29 to A-77; G-29 to C-76; G-29 to 1-75; G-29 to E-74; G-29 to K-73; G-29 to D-72; G-29 to R-71 ; G-29 to F- 70; G-29 to T-69; G-29 to L-68; G-29 to L-67; G-29 to V-66; G
  • nucleotide sequence encoding a polypeptide consisting of a portion of the complete CK ⁇ - 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, where this portion excludes any integer of amino acid residues from 1 to about 83 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, or any integer of amino acid residues from 1 to about 83 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113.
  • Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided. Also included are a nucleotide sequence encoding a polypeptide consisting of a portion of the complete CK ⁇ - 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, where this portion excludes from 1 to about 35 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, or from 1 to about 17 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 971 13.
  • Additional preferred polypeptide fragments comprise, or alternatively consist of, the amino acid sequence of residues: M-l to L-15; A-2 to A- 16; R-3 to V-17; L-4 to A-18; Q-5 to L-19; T-6 to Q-20; A-7 to A-21; L-8 to T-22; L-9 to E-23; V-10 to A-24; V-l l to G-25; L-12 to P-26; V-13 to Y-27; L-14 to G-28; L-15 to A-29; A- 16 to N-30; V-17 to M-31; A-18 to E-32; L-19 to D-33; Q-20 to S-34; A-21 to V-35; T-22 to C-36; E-23 to C-37; A-24 to R-38; G-25 to D-39; P-26 toY-40; Y-27 to V- 41; G-28 to R-42; A-29 to H-43; N-30 to R
  • polypeptide fragments may retain the biological activity of the CK ⁇ - 13 polypeptides of the invention and may be useful to generate antibodies, as described further below.
  • Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
  • the present application is also directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the CK ⁇ - 13 polypeptide sequence set forth herein as m'-n 1 , m 2 -n 2 , m 3 -n 3 , and/or m 4 -n 4 .
  • the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific CK ⁇ - 13 N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • the polynucleotide fragments of the invention encode a polypeptide which demonstrates a CK ⁇ - 13 functional activity.
  • a polypeptide demonstrating a CK ⁇ - 13 "functional activity" is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) CK ⁇ - 13 protein.
  • Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a CK ⁇ - 13 polypeptide for binding) to an anti CK ⁇ - 13 antibody], immunogenicity (ability to generate antibody which binds to a CK ⁇ - 13 polypeptide), ability to form multimers with CK ⁇ - 13 polypeptides of the invention, and ability to bind to a receptor or ligand for a CK ⁇ - 13 polypeptide.
  • CK ⁇ - 13 polypeptides and fragments, variants derivatives, and analogs thereof, can be assayed by various methods.
  • various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
  • competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting. See generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59:94-123.
  • physiological correlates of CK ⁇ - 13 binding to its substrates can be assayed.
  • assays described herein may routinely be applied to measure the ability of CK ⁇ - 13 polypeptides and fragments, variants derivatives and analogs thereof to elicit CK ⁇ - 13 related biological activity (either in vitro or in vivo).
  • Other methods will be known to the skilled artisan and are within the scope of the invention.
  • fragments of the invention are fragments characterized by structural or functional attributes of CK ⁇ - 13
  • Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions”), coil and coil-forming regions ("coil- regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) of complete (i.e., full-length) CK ⁇ -13 (SEQ ID NO:2).
  • Certain preferred regions are those set out in Figure 3 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in Figure 1 (SEQ ID NO:2), such preferred regions include; Garnier-Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson- Wolf high antigenic index regions, as predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • the polynucleotides of the invention encode functional attributes of CK ⁇ -13.
  • Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of CK ⁇ -13.
  • the data presented in columns VIII, IX, XIII, and XIV of Table I can be used to determine regions of CK ⁇ - 13 which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, IX, XIII, and/or IV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
  • the above-mentioned preferred regions set out in Figure 3 and in Table I include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1.
  • such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf regions of high antigenic index.
  • Table 1
  • Glu 74 A A 0 81 -1 24 0 60 0 50 lie 75 A T 1 30 -1 24 * 1 28 0 50
  • Trp 83 A B -0 26 0 24 * -0 02 0 41
  • the invention further includes variations of the CK ⁇ - 13 polypeptide which show substantial CK ⁇ - 13 polypeptide activity or which include regions of CK ⁇ - 13 protein such as the protein portions discussed below.
  • Such mutants include deletions, insertions, inversions, repeats, and type substitutions selected according to general rules known in the art so as have little effect on activity. For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein the authors indicate that there are two main approaches for studying the tolerance of an amino acid sequence to change.
  • the first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.
  • the second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244: 1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity. As the authors state, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein.
  • amino acid residues For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
  • Amino acids in the CK ⁇ - 13 protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro or in vitro proliferative activity.
  • Replacement of amino acids can also change the selectivity of the binding of a ligand to cell surface receptors.
  • Ostade et al, Nature 361:266-26$ (1993) describes certain mutations resulting in selective binding of TNF- ⁇ to only one of the two known types of TNF receptors.
  • Sites that are critical for ligand- receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol 224:899-904 (1992) and de Vos et al Science 255:306-312 (1992)).
  • site directed changes at the amino acid level of CK ⁇ - 13 can be made by replacing a particular amino acid with a conservative amino acid.
  • Preferred conservative mutations include: Ml replaced with A, G, I, L, S, T, or V; A2 replaced with G, I, L, S, T, M, or V; R3 replaced with H, or K; L4 replaced with A, G, I, S, T, M, or V; Q5 replaced with N; T6 replaced with A, G, I, L, S, M, or V; A7 replaced with G, I, L, S, T, M, or V; L8 replaced with A, G, I, S, T, M, or V; L9 replaced with A, G, I, S, T, M, or V; VI 0 replaced with A, G, I, L, S, T, or M; VI 1 replaced with A, G, 1, L, S, T, or M; L12 replaced with A, G, I, S, T, M, or V; VI 3 replaced with A, G, I
  • the resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art.
  • the resulting constructs have one CK ⁇ - 13 activity or function increased and/or decreased, while the remaining CK ⁇ - 13 activities or functions are maintained. More preferably, the resulting constructs have more than one CK ⁇ - 13 activity or function increased and/or decreased, while the remaining CK ⁇ - 13 activities or functions are maintained.
  • variants of CK ⁇ - 13 include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification.
  • Such variant polypeptides are deemed to be within the scope of those skilled in the art from the teachings herein.
  • CK ⁇ - 13 polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity.
  • preferred non-conservative substitutions of CK ⁇ -13 include: Ml replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A2 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R3 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L4 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q5 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T6 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A7 replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; L8 replaced with D
  • the invention further provides an isolated CK ⁇ - 13 polypeptide having the amino acid sequence in SEQ ED NO:2 wherein H43 is replaced with Y and/or S89 is replaced with N.
  • These replacements may occur singularly or together in the full length, mature, or proprotein form of CK ⁇ - 13 protein; as well as the N- and C- terminal deletion mutants having the general formula m'-n 1 , m 2 -n 2 , m 3 -n 3 , and/or m 4 - n 4 listed above; and/or further variants, and polypeptide fragments of the invention, including but not limited to, predicted epitope fragments.
  • These polypeptides are expected to retain the biological function of a CK ⁇ - 13 polypeptide.
  • the resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art.
  • the resulting constructs have one CK ⁇ - 13 activity or function increased and/or decreased, while the remaining CK ⁇ - 13 activities or functions are maintained. More preferably, the resulting constructs have more than one CK ⁇ - 13 activity or function increased and/or decreased, while the remaining CK ⁇ - 13 activities or functions are maintained.
  • more than one amino acid can be replaced with the substituted amino acids as described above (either conservative or nonconservative).
  • the substituted amino acids can occur in the full length, mature, or proprotein form of CK ⁇ - 13 protein, as well as the N- and C- terminal deletion mutants, having the general formula m'-n 1 and/or m 2 -n 2 , listed above.
  • a further embodiment of the invention relates to a polypeptide which comprises the amino acid sequence of a CK ⁇ - 13 polypeptide having an amino acid sequence which contains at least one amino acid substitution, but not more than 50 amino acid substitutions, even more preferably, not more than 40 amino acid substitutions, still more preferably, not more than 30 amino acid substitutions, and still even more preferably, not more than 20 amino acid substitutions.
  • a polypeptide in order of ever-increasing preference, it is highly preferable for a polypeptide to have an amino acid sequence which comprises the amino acid sequence of a CK ⁇ - 13 polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions.
  • the number of additions, substitutions, and/or deletions in the amino acid sequence of Figure 1 or fragments thereof is 1-5, 5-10, 5-25, 5-50, 10-50 or 50-150, conservative amino acid substitutions are preferable.
  • polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified
  • a recombinantly produced version of the CK ⁇ - 13 polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene 67 31-40 (1988)
  • Polypeptides of the invention also can be purified from natural or recombinant sources using anti-CK ⁇ - 13 antibodies of the invention in methods which are well known in the art of protein purification
  • polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art
  • polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting CK ⁇ - 13 protein expression as described below or as agonists and antagonists capable of enhancing or inhibiting CK ⁇ - 13 protein function Further, such polypeptides can be used in the yeast two-hybrid system to "capture" CK ⁇ -13 protein binding proteins which are also candidate agonists and antagonists according to the present invention The yeast two hybrid system is described in Fields and Song, Nature 340 245-246 (1989)
  • the present invention is also directed to polypeptide fragments comprising, or alternatively consisting of, an epitope of the polypeptide sequence shown in SEQ ID NO 2, or the polypeptide sequence encoded by the cDNA contained in a deposited clone
  • Polynucleotides encoding these epitopes are also encompassed by the invention, as is the nucleotide sequences of the complementary strand of the polynucleotides encoding these epitopes
  • epitopes refer to polypeptide fragments having antigenic activity and/or immunogenic activity in an animal, especially in a human
  • a preferred embodiment of the present invention relates to a polypeptide fragment comprising an epitope, as well as the polynucleotide encoding this fragment.
  • a region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope.”
  • an "immunogenic epitope” is defined as a part of a protein that elicits an antibody response. (See, for instance, Geysen et al.,Proc. Natl. Acad. Sci. USA 81 :3998- 4002 (1983).)
  • antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, and most preferably between about 15 to about 30 amino acids.
  • Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length.
  • Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies, that specifically bind the epitope.
  • Non-limiting examples of antigenic polypeptides or peptides that can be used to generate CK ⁇ - 13 -specific antibodies include: a polypeptide comprising amino acid residues from about Thr-22 to about Gly-28; Asn-30 to about Leu-47; Thr-56 to about Val-65; and Phe-70 to about Trp-83. These polypeptide fragments have been determined to bear antigenic epitopes of the CK ⁇ - 13 protein by the analysis of the Jameson- Wolf antigenic index, as shown in Figure 3 and Table 1, above.
  • immunogenic epitopes can be used, for example, to induce antibodies according to methods well known in the art. (See, for instance, Sutcliffe et al., supra; Wilson et al, supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910- 914; and Bittle et al, J. Gen. Virol. 66:2347-2354 (1985).)
  • a preferred immunogenic epitope includes the secreted protein.
  • the immunogenic epitopes may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier.
  • immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting.)
  • Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe et al, supra; Wilson et al., supra, and Bittle et al, J. Gen. Virol., 66:2347-2354 (1985).
  • animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
  • KLH keyhole limpet hemacyanin
  • peptides containing cysteine residues may be coupled to a carrier using a linker such as -maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde.
  • Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 ⁇ gs of peptide or carrier protein and Freund's adjuvant. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
  • the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
  • polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to heterologous polypeptide sequences.
  • the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, any combination thereof including both entire domains and portions thereof) resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • CHI constant domain of immunoglobulins
  • CH2, CH3 any combination thereof including both entire domains and portions thereof
  • polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to heterologous polypeptide sequences.
  • the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, any combination thereof including both entire domains and portions thereof) resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • CHI constant domain of immunoglobulins
  • CH2, CH3 any combination thereof including both entire domains and portions thereof
  • DNA shuffling may be employed to modulate the activities of polypeptides corresponding to SEQ ID NO: 2 thereby effectively generating agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P.A., et al, Curr. Opinion Biotechnol.
  • alteration of polynucleotides corresponding to SEQ ID NO: l and corresponding polypeptides may be achieved by DNA shuffling.
  • DNA shuffling involves the assembly of two or more DNA segments into a desired molecule corresponding to SEQ ID NO: l polynucleotides of the invention by homologous, or site-specific, recombination.
  • polynucleotides corresponding to SEQ ID NO: l and corresponding polypeptides may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of coding polynucleotide corresponding to SEQ ID NO:l, or the polypeptide encoded thereby may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • the present invention further relates to antibodies and T-cell antigen receptors (TCR) which specifically bind the polypeptides of the present invention.
  • the antibodies of the present invention include IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY.
  • antibody is meant to include whole antibodies, including single-chain whole antibodies, and antigen-binding fragments thereof.
  • the antibodies are human antigen binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a V L or V H domain.
  • the antibodies may be from any animal origin including birds and mammals.
  • the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse, or chicken.
  • Antigen-binding antibody fragments may comprise the variable region(s) alone or in combination with the entire or partial of the following: hinge region, CHI, CH2, and CH3 domains. Also included in the invention are any combinations of variable region(s) and hinge region, CHI, CH2, and CH3 domains.
  • the present invention further includes monoclonal, polyclonal, chimeric, humanized, and human monoclonal and human polyclonal antibodies which specifically bind the polypeptides of the present invention.
  • the present invention further includes antibodies which are anti-idiotypic to the antibodies of the present invention.
  • the antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for heterologous compositions, such as a heterologous polypeptide or solid support material. See, e.g., WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol.
  • Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which are recognized or specifically bound by the antibody.
  • the epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or listed in the Tables and Figures.
  • Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.
  • Antibodies of the present invention may also be described or specified in terms of their cross-reactivity.
  • Antibodies that do not bind any other analog, ortholog, or homolog of the polypeptides of the present invention are included.
  • Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50%) identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention.
  • Further included in the present invention are antibodies which only bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described herein).
  • Antibodies of the present invention may also be described or specified in terms of their binding affinity.
  • Preferred binding affinities include those with a dissociation constant or Kd less than 5X10 "6 M, 10 "6 M, 5X10 “7 M, 10 “7 M, 5X10 " *M, 10 "8 M, 5X10 "9 M, 10 "9 M, 5X10- 10 M, 10 "10 M, 5X10 "n M, 10 " ⁇ M, 5X10 "12 M, 10 "12 M, 5X10 "13 M, 10 "13 M, 5X10 "14 M, 10 "14 M, 5X10 "15 M, and 10 "15 M.
  • Antibodies of the present invention have uses that include, but are not limited to, methods known in the art to purify, detect, and target the polypeptides of the present invention including both in vitro and in vivo diagnostic and therapeutic methods.
  • the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference in the entirety).
  • the antibodies of the present invention may be used either alone or in combination with other compositions.
  • the antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions
  • antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, or toxins See, e g , WO 92/08495, WO 91/14438, WO 89/12624, US Patent 5,314,995, and EP 0 396 387
  • the antibodies of the present invention may be prepared by any suitable method known in the art
  • a polypeptide of the present invention or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies
  • the term "monoclonal antibody” is not a limited to antibodies produced through hybridoma technology
  • the term "monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced
  • Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technology
  • Fab and F(ab')2 fragments may be produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments)
  • antibodies of the present invention can be produced through the application of recombinant DNA and phage display technology or through synthetic chemistry using methods known in the art
  • the antibodies of the present invention can be prepared using various phage display methods known in the art In phage display methods, functional antibody domains are displayed on the surface of a phage particle which carries polynucleotide sequences encoding them Phage with a desired binding property are selected from a repertoire or combinatorial antibody library (e.g. human or murine) by selecting directly with antigen, typically antigen bound or captured to a solid surface or bead.
  • a repertoire or combinatorial antibody library e.g. human or murine
  • Phage used in these methods are typically filamentous phage including fd and Ml 3 with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.
  • Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al, J. Immunol. Methods 182:41-50 (1995); Ames et al, J. Immunol. Methods 184:177- 186 (1995); Kettleborough et al., Eur. J. Immunol.
  • the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host including mammalian cells, insect cells, plant cells, yeast, and bacteria.
  • Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in WO 92/22324; Mullinax et al, BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al, Science 240: 1041-1043 (1988) (said references incorporated by reference in their entireties).
  • Antibodies can be humanized using a variety of techniques including CDR-grafting (EP 0 239 400; WO 91/09967; US Patent 5,530,101; and 5,585,089), veneering or resurfacing (EP 0 592 106; EP 0 519 596; Padlan E.A., Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska.
  • antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide of the present invention may be specific for antigens other than polypeptides of the present invention.
  • antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors.
  • Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al.
  • the present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions.
  • the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof.
  • the antibody portion fused to a polypeptide of the present invention may comprise the hinge region, CHI domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof.
  • the polypeptides of the present invention may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art.
  • the polypeptides may also be fused or conjugated to the above antibody portions to form multimers.
  • Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fc portions.
  • Higher multimeric forms can be made by fusing the polypeptides to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of the present invention to antibody portions are known in the art.
  • the present invention includes antibodies which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully. Included are both receptor- specific antibodies and ligand-specific antibodies. Included are receptor-specific antibodies which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art. Also included are receptor-specific antibodies which both prevent ligand binding and receptor activation. Likewise, included are neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor. Further included are antibodies which activate the receptor.
  • antibodies may act as agonists for either all or less than all of the biological activities affected by ligand-mediated receptor activation.
  • the antibodies may be specified as agonists or antagonists for biological activities comprising specific activities disclosed herein.
  • the above antibody agonists can be made using methods known in the art. See e.g., WO 96/40281; US Patent 5,81 1,097; Deng et al., Blood 92(6)1981-1988 (1998); Chen, et al, Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4)1786-1794 (1998); Zhu et al, Cancer Res.
  • antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)).
  • antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to ligand can be used to generate anti-idiotypes that "mimic" the polypeptide mutimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and/or its ligand.
  • anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand.
  • anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligands/receptors, and thereby block its biological activity.
  • the invention further relates to a diagnostic kit for use in screening serum containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides.
  • a diagnostic kit for use in screening serum containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides.
  • a kit may include a substantially isolated polypeptide antigen comprising an epitope which is specifically immunoreactive with at least one anti- polypeptide antigen antibody.
  • Such a kit also includes means for detecting the binding of said antibody to the antigen.
  • the kit may include a recombinantly produced or chemically synthesized polypeptide antigen.
  • the polypeptide antigen of the kit may also be attached to a solid support.
  • the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached.
  • a kit may also include a non-attached reporter-labelled anti-human antibody.
  • binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labelled antibody.
  • the invention further includes a method of detecting proliferative and/or cancerous disorders and conditions in a test subject.
  • This detection method includes reacting serum from a test subject (e.g., one in which proliferative and/or cancerous cells or tissues may be present) with a substantially isolated polypeptide and/or polynucleotide antigen, and examining the antigen for the presence of bound antibody.
  • the method includes a polypeptide antigen attached to a solid support, and the serum is reacted with the support. Subsequently, the support is reacted with a reporter labelled anti-human antibody. The solid support is then examined for the presence of reporter-labelled antibody.
  • the invention includes a proliferative condition vaccine composition.
  • the composition includes a substantially isolated polypeptide and/or polynucleotide antigen, where the antigen includes an epitope which is specifically immunoreactive with at least antibody specific for the epitope.
  • the peptide and/or polynucleotide antigen may be produced according to methods known in the art, including recombinant expression or chemical synthesis.
  • the peptide antigen is preferably present in a pharmacologically effective dose in a pharmaceutically acceptable carrier.
  • the invention includes a monoclonal antibody that is specifically immunoreactive with polypeptide and/or polynucleotide epitopes.
  • the invention includes a substantially isolated preparation of polyclonal antibodies specifically immunoreactive with polynucleotides and/or polypeptides of the present invention.
  • polyclonal antibodies are prepared by affinity chromatography, in addition to, other methods known in the art.
  • the invention includes a method for producing antibodies to polypeptide and/or polynucleotide antigens.
  • the method includes administering to a test subject a substantially isolated polypeptide and/or polynucleotide antigen, where the antigen includes an epitope which is specifically immunoreactive with at least one anti- polypeptide and/or polynucleotide antibody.
  • the antigen is administered in an amount sufficient to produce an immune response in the subject.
  • the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention.
  • the diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody.
  • the antibody is attached to a solid support.
  • the antibody may be a monoclonal antibody.
  • the detecting means of the kit may include a second, labelled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labelled, competing antigen.
  • test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention.
  • the reagent After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labelled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-antigen antibody on the solid support.
  • the reagent is again washed to remove unbound labelled antibody, and the amount of reporter associated with the reagent is determined.
  • the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric or colorimetric substrate (Sigma, St. Louis, MO).
  • the solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free a ine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
  • the kit generally includes a support with surface-bound recombinant antigens, and a reporter-labelled anti-human antibody for detecting surface-bound anti-antigen antibody.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may be useful in treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
  • Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
  • the etiology of these immune deficiencies or disorders may be genetic, somatic, such as cancer or some autoimmune disorders, acquired (e.g., by chemotherapy or toxins), or infectious.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, can be used as a marker or detector of a particular immune system disease or disorder.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may be useful in treating or detecting deficiencies or disorders of hematopoietic cells.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat those disorders associated with a decrease in certain (or many) types hematopoietic cells.
  • immunologic deficiency syndromes include, but are not limited to: blood protein disorders (e.g.
  • agammaglobulinemia agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV- BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott- Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
  • DIDs severe combined immunodeficiency
  • CK ⁇ -13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity (clot formation).
  • hemostatic the stopping of bleeding
  • thrombolytic activity clot formation
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13 could be used to treat blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet disorders (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes.
  • blood coagulation disorders e.g., afibrinogenemia, factor deficiencies
  • blood platelet disorders e.g. thrombocytopenia
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment of heart attacks (infarction), strokes, or scarring.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may also be useful in treating or detecting autoimmune disorders.
  • Many autoimmune disorders result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destruction of the host tissue. Therefore, the administration of CK ⁇ -13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -13, that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune disorders.
  • autoimmune disorders examples include, but are not limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
  • allergic reactions and conditions such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated by CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -13.
  • these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may also be used to treat and/or prevent organ rejection or graft-versus-host disease (GVHD).
  • Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response.
  • an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues.
  • the administration of CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -13, that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells may be an effective therapy in preventing organ rejection or GVHD.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 15, may also be used to modulate inflammation.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 15, may inhibit the proliferation and differentiation of cells involved in an inflammatory response.
  • These molecules can be used to treat inflammatory conditions, both chronic and acute conditions, including chronic prostatitis, granulomatous prostatitis and malacoplakia, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
  • cytokines e.g., TNF or IL-1.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -
  • infectious agents can be used to treat or detect infectious agents.
  • infectious diseases may be treated.
  • the immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -13 may recruite naive T cells to a site of new infection.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -13 may also directly inhibit the infectious agent, without necessarily eliciting an immune response.
  • viruses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention.
  • viruses include, but are not limited to Examples of viruses, include, but are not limited to the following DNA and RNA viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus (e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A, Influenza B, and parainfluen
  • Viruses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, respiratory syncytial virus, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
  • arthritis bronchiollitis
  • respiratory syncytial virus e.g., respiratory syncytial virus,
  • polynucleotides or polypeptides, or agonists or antagonists of the invention can be used to treat or detect any of these symptoms or diseases.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B).
  • hepatitis e.g., hepatitis B
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients nonresponsive to one or more other commercially available hepatitis vaccines.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat AIDS.
  • Actinomycetales e.g., Corynebacterium, Mycobacterium,
  • Enterobacteriaceae Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella typhi, and Salmonella paratyphi), Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal), Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, Shigella spp.
  • Enterobacteriaceae Klebsiella, Salmonella (e.g.,
  • bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B), Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually
  • Polynucleotides or polypeptides, agonists or antagonists of the invention can be used to treat or detect any of these symptoms or diseases.
  • Ppolynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, Diptheria, botulism, and/or meningitis type B .
  • parasitic agents causing disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, the following families or class: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium ovale).
  • polynucleotides or polypeptides, or agonists or antagonists of the invention can be used to treat or detect any of these symptoms or diseases.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat malaria.
  • treatment using a polypeptide or polynucleotide and/or agonist or antagonist of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy).
  • the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
  • CK ⁇ - 13 is expressed inactivated monocytes and ex vivo expanded dendritic cells.
  • substantially altered (increased or decreased) levels of CK ⁇ -13 gene expression can be detected in immune system tissue or other cells or bodily fluids (e.g., sera, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" CK ⁇ - 13 gene expression level, that is, the CK ⁇ - 13 expression level in immune system tissues or bodily fluids from an individual not having the immune system disorder.
  • the invention provides a diagnostic method useful during diagnosis of a immune system disorder, which involves measuring the expression level of the gene encoding the CK ⁇ - 13 protein in immune system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard CK ⁇ - 13 gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of an immune system disorder.
  • tissue in mammals with cancer of the immune system express significantly altered (i.e., either enhanced or decreased) levels of the CK ⁇ - 13 protein and mRNA encoding the CK ⁇ - 13 protein when compared to a corresponding "standard" level.
  • altered levels of the CK ⁇ - 13 protein can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal fluid) from mammals with such a cancer when compared to sera from mammals of the same species not having the cancer.
  • the invention provides a diagnostic method useful during diagnosis of an immune system disorder, including cancers of this system which involves measuring the expression level of the gene encoding the CK ⁇ - 13 protein in immune system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard CK ⁇ - 13 gene expression level, whereby a significant increase or decrease in the gene expression level compared to the standard is indicative of an immune system disorder.
  • a diagnosis of a disorder in the immune system including diagnosis of a tumor has already been made according to conventional methods
  • the present invention is useful as a prognostic indicator, whereby patients exhibiting a significantly altered CK ⁇ - 13 gene expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.
  • saying the expression level of the gene encoding the CK ⁇ - 13 protein is intended qualitatively or quantitatively measuring or estimating the level of the CK ⁇ - 13 protein or the level of the mRNA encoding the CK ⁇ - 13 protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the CK ⁇ -13 protein level or mRNA level in a second biological sample).
  • the CK ⁇ -13 protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard CK ⁇ - 13 protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder of the immune system.
  • a standard CK ⁇ - 13 protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains CK ⁇ - 13 protein or mRNA.
  • biological samples include body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain free CK ⁇ - 13 protein, immune system tissue, and other tissue sources found to express complete or mature CK ⁇ - 13 or a CK ⁇ - 13 receptor. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
  • the present invention is useful for diagnosis or treatment of various immune system-related disorders, including disregulation of immune cell function in mammals, preferably humans.
  • Such disorders include tumors, cancers, interstitial lung disease (such as Langerhans cell granulomatosis) and any disregulation of immune cell function including but not limited to, leukemias, lymphomas, autoimmune diseases, arthritis, immune suppression, histamine and IgE-mediated allergic reactions, sepsis, prostaglandin-independant fever, bone marrow failure, wound healing, silicosis, sarcoidosis, acute and chronic infection, cell mediated immunity, humoral immunity, inflammatory bowel disease, mylosuppression and hyper-eosinophil syndrome and the like.
  • interstitial lung disease such as Langerhans cell granulomatosis
  • any disregulation of immune cell function including but not limited to, leukemias, lymphomas, autoimmune diseases, arthritis, immune suppression, histamine and IgE-mediated allergic reactions, sepsis, prostaglandin
  • Total cellular RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 752.156-159 (1987). Levels of mRNA encoding the CK ⁇ - 13 protein are then assayed using any appropriate method. These include Northern blot analysis, SI nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR). Assaying CK ⁇ - 13 protein levels in a biological sample can occur using antibody-based techniques.
  • any suitable technique such as the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 752.156-159 (1987).
  • Levels of mRNA encoding the CK ⁇ - 13 protein are then assayed
  • CK ⁇ - 13 protein expression in tissues can be studied with classical immunohistological methods (Jalkanen, M., et al, J. Cell Biol. 707:976-985 (1985); jalkanen, M., et al, J. Cell . Biol. 705:3087-3096 (1987)).
  • Other antibody-based methods useful for detecting CK ⁇ - 13 protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Suitable antibody assay labels include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine ( 125 I, 121 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( l l2 In), and technetium ( 99m Tc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as, glucose oxidase, and radioisotopes, such as iodine ( 125 I, 121 I), carbon ( 14 C), sulfur ( 35 S), tritium ( 3 H), indium ( l l2 In), and technetium ( 99m Tc)
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • CK ⁇ - 13 protein can also be detected in vivo by imaging.
  • Antibody labels or markers for in vivo imaging of CK ⁇ - 13 protein include those detectable by X-radiography, NMR or ESR.
  • suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
  • Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma.
  • a CK ⁇ - 13 protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (for example, 131 I, 112 In, 99m Tc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) into the mammal to be examined for immune system disorder.
  • a radioisotope for example, 131 I, 112 In, 99m Tc
  • a radio-opaque substance for example, parenterally, subcutaneously or intraperitoneally
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99m Tc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain CK ⁇ - 13 protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)).
  • CK ⁇ -13 polynucleotides and polypeptides are useful for diagnosis of conditions involving abnormally high or low expression of CK ⁇ - 13 activities.
  • CK ⁇ - 13 is expressed as well as the activities modulated by CK ⁇ - 13
  • a substantially altered (increased or decreased) level of expression of CK ⁇ - 13 in an individual compared to the standard or "normal” level produces pathological conditions related to the bodily system(s) in which CK ⁇ - 13 is expressed and/or is active.
  • the mature form(s) of the protein may be released in soluble form from the cells which express the CK ⁇ - 13 by proteolytic cleavage. Therefore, when mature CK ⁇ - 13 is added from an exogenous source to cells, tissues or the body of an individual, the protein will exert its physiological activities on its target cells of that individual. Therefore, it will be appreciated that conditions caused by a decrease in the standard or normal level of CK ⁇ - 13 activity in an individual, particularly disorders of the immune system, can be treated by administration of CK ⁇ - 13 polypeptide (in the form of mature protein.
  • the invention also provides a method of treatment of an individual in need of an increased level of CK ⁇ - 13 activity comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated CK ⁇ - 13 polypeptide of the invention, particularly a mature form of the CK ⁇ - 13 effective to increase the CK ⁇ - 13 activity level in such an individual.
  • the polypeptides of the present invention may be emplyed to inhibit bone marrow stem cell colony formation as an adjunct protective treatment during cancer chemotherapy.
  • the CK ⁇ - 13 polypeptide may inhibit the proliferation and differentiation of hematopoietic cells such as bone marrow stem cells.
  • the inhibitor effect on the population of committed progenitor cells, (for example, granulocytes, and macrophages/monocytes) may be employed therapeutically to inhibit proliferation of leukemic cells.
  • polypeptides of the present invention may also be employed to inhibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper-proliferation, since Langerhans cells in skin have been found to produce chemokines.
  • CK ⁇ - 13 may be employed as an anti-neovascularizing agent to treat solid tumors; e.g., Karposi sarcoma by stimulating the invasion and activation of host defense cells; e.g., cytotoxic T cells and macrophages and by inhibiting the angiogenesis of tumors.
  • host defense cells e.g., cytotoxic T cells and macrophages
  • CK ⁇ - 13 may be employed as an anti-neovascularizing agent to treat solid tumors; e.g., Karposi sarcoma by stimulating the invasion and activation of host defense cells; e.g., cytotoxic T cells and macrophages and by inhibiting the angiogenesis of tumors.
  • host defense cells e.g., cytotoxic T cells and macrophages
  • CK ⁇ - 13 polypeptides may be employed to enhance host defenses against resistant chronic and acute infections, for example, mycobacterial infections via the attraction and activation of microbicidal leukocytes.
  • CK ⁇ - 13 may also be employed to inhibit T-cell proliferation by the inhibition of IL-2 biosynthesis for the treatment of T-cell mediated auto-immune diseases and lymphocytic leukemias.
  • CK ⁇ - 13 may also be employed to stimulate wound healing and prevent scarring during healing, both via the recruitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF - mediated fibrosis. In this same manner, CK ⁇ - 13 may also be employed to treat other fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary fibrosis.
  • CK ⁇ - 13 also increases the presence of eosinophils which have the distinctive function of killing the larvae of parasites that invade tissues, as in schistosomiasis, trichinosis and ascariasis. CK ⁇ - 13 also increases the presence of and activates
  • NK cells Natural Killer (NK) cells which will be useful for treating a variety of diseases in which the presence of NK cells are beneficial well known to those of skill in the art.
  • CK ⁇ - 13 may also be employed to treat sepsis and is useful for immune enhancement or suppression, myeloprotection, and acute and chronic inflammatory control.
  • They may also be employed to regulate hematopoiesis, by regulating activation and differentiation of various hematopoietic progenitor cells, for example, to release mature leukocytes from the bone marrow following chemotherapy.
  • polypeptides of the present invention may also be used to target unwanted cells, such as in the treatment of cancer, for apoptosis.
  • the polypeptide may also be used to mobilize bone marrow stem cells to peripheral blood, which allows easy isolation of stem cells.
  • the isolation of stem cells may be employed for bone marrow colonization after high dose chemotherapy.
  • CK ⁇ -13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may have chemotaxis activity.
  • a chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hyperproliferation.
  • the mobilized cells can then fight off and/or heal the particular trauma or abnormality.
  • CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hyperproliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat wounds. It is also contemplated that CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ - 13, may inhibit chemotactic activity. These molecules could also be used to treat disorders. Thus, CK ⁇ - 13 polynucleotides or polypeptides, or agonists or antagonists of CK ⁇ -13, could be used as an inhibitor of chemotaxis.
  • CK ⁇ - 13 polypeptides may be used to screen for molecules that bind to CK ⁇ - 13 or for molecules to which CK ⁇ - 13 binds.
  • the binding of CK ⁇ - 13 and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the CK ⁇ -13 or the molecule bound.
  • Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors, such as CCR4), or small molecules.
  • the molecule is closely related to the natural ligand of CK ⁇ - 13, e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural or functional mimetic.
  • the molecule can be closely related to the natural receptor to which CK ⁇ - 13 binds, or at least, a fragment of the receptor capable of being bound by CK ⁇ - 13 (e.g., active site).
  • the molecule can be rationally designed using known techniques.
  • the screening for these molecules involves producing appropriate cells which express CK ⁇ - 13, either as a secreted protein or on the cell membrane.
  • Preferred cells include cells from mammals, yeast, Drosophila, or E. coli.
  • Cells expressing CK ⁇ - 13 (or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either CK ⁇ - 13 or the molecule.
  • the assay may simply test binding of a candidate compound to CK ⁇ - 13, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to CK ⁇ -13.
  • the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures.
  • the assay may also simply comprise the steps of mixing a candidate compound with a solution containing CK ⁇ - 13, measuring CK ⁇ - 13 /molecule activity or binding, and comparing the CK ⁇ - 13 /molecule activity or binding to a standard.
  • an ELISA assay can measure CK ⁇ - 13 level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody.
  • the antibody can measure CK ⁇ - 13 level or activity by either binding, directly or indirectly, to CK ⁇ - 13 or by competing with CK ⁇ - 13 for a substrate.
  • the receptor to which CK ⁇ - 13 binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)).
  • expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the polypeptides, for example, NTH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides.
  • Transfected cells which are grown on glass slides are exposed to the polypeptide of the present invention, after they have been labelled.
  • the polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site- specific protein kinase.
  • the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
  • DNA shuffling may be employed to modulate the activities of CK ⁇ - 13 thereby effectively generating agonists and antagonists of CK ⁇ -13. See generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P. A., et al, Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, S. Trends Biotechnol. 16(2): 76- 82 (1998); Hansson, L.
  • alteration of CK ⁇ - 13 polynucleotides and corresponding polypeptides may be achieved by DNA shuffling.
  • DNA shuffling involves the assembly of two or more DNA segments into a desired CK ⁇ - 13 molecule by homologous, or site-specific, recombination.
  • CK ⁇ - 13 polynucleotides and corresponding polypeptides may be alterred by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of CK ⁇ - 13 may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • the heterologous molecules are CK ⁇ - 13 family members.
  • the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-1), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dp ⁇ ), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF- betal, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).
  • PDGF platelet-derived growth factor
  • IGF-1 insulin-like growth factor
  • TGF transforming growth factor
  • EGF epidermal growth factor
  • FGF fibroblast growth factor
  • TGF-beta TGF-
  • Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the CK ⁇ - 13 polypeptide.
  • the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
  • this invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention.
  • An example of such an assay comprises combining a mammalian fibroblast cell, a the polypeptide of the present invention, the compound to be screened and - [H] thymidine under cell culture conditions where the fibroblast cell would normally proliferate.
  • a control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of - [H] thymidine in each case.
  • the amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the incorporation of - [H] thymidine. Both agonist and antagonist compounds may be identified by this procedure.
  • a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound. The ability of the compound to enhance or block this interaction could then be measured.
  • the response of a known second messenger system following interaction of a compound to be screened and the CK ⁇ - 13 receptor is measured and the ability of the compound to bind to the receptor and elicit a second messenger response is measured to determine if the compound is a potential agonist or antagonist.
  • Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis. All of these above assays can be used as diagnostic or prognostic markers. The molecules discovered using these assays can be used to treat disease or to bring about a particular result in a patient (e.g., blood vessel growth) by activating or inhibiting the polypeptide/molecule. Moreover, the assays can discover agents which may inhibit or enhance the production of the polypeptides of the invention from suitably manipulated cells or tissues.
  • the invention includes a method of identifying compounds which bind to CK ⁇ - 13 comprising the steps of: (a) incubating a candidate binding compound with CK ⁇ -13; and (b) determining if binding has occurred. Moreover, the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with CK ⁇ - 13, (b) assaying a biological activity , and (b) determining if a biological activity of CK ⁇ - 13 has been altered.
  • the invention provides a method of delivering compositions to targeted cells expressing a receptor for a polypeptide of the invention, or cells expressing a cell bound form of a polypeptide of the invention.
  • polypeptides or antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
  • the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (including antibodies) that are associated with heterologous polypeptides or nucleic acids.
  • the invention provides a method for delivering a therapeutic protein into the targeted cell.
  • the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.
  • a single stranded nucleic acid e.g., antisense or ribozymes
  • double stranded nucleic acid e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed
  • the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention (e.g., polypeptides of the invention or antibodies of the invention) in association with toxins or cytotoxic prodrugs.
  • toxins is meant compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death.
  • Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin.
  • radioisotopes known in the art
  • compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseu
  • cytotoxic prodrug is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound.
  • Cytotoxic prodrugs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin.
  • polypeptides of the present invention or the polynucleotides encoding these polypeptides, to screen for molecules which modify the activities of the polypeptides of the present invention.
  • a method would include contacting the polypeptide of the present invention with a selected compound(s) suspected of having antagonist or agonist activity, and assaying the activity of these polypeptides following binding.
  • This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of drug screening techniques.
  • the polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly.
  • One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays.
  • One may measure, for example, the formulation of complexes between the agent being tested and a polypeptide of the present invention.
  • the present invention provides methods of screening for drugs or any other agents which affect activities mediated by the polypeptides of the present invention. These methods comprise contacting such an agent with a polypeptide of the present invention or a fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art.
  • the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the present invention.
  • Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the present invention, and is described in great detail in European Patent Application 84/03564, published on September 13, 1984, which is incorporated herein by reference herein. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with polypeptides of the present invention and washed. Bound polypeptides are then detected by methods well known in the art. Purified polypeptides are coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.
  • This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding polypeptides of the present invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.
  • the CK ⁇ - 13 polypeptide composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with CK ⁇ - 13 polypeptide alone), the site of delivery of the CK ⁇ - 13 polypeptide composition, the method of administration, the scheduling of administration, and other factors known to practitioners.
  • the "effective amount" of CK ⁇ - 13 polypeptide for purposes herein is thus determined by such considerations.
  • the total pharmaceutically effective amount of CK ⁇ - 13 polypeptide administered parenterally per dose will be in the range of about 1 ⁇ g/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone.
  • the CK ⁇ - 13 polypeptide is typically administered at a dose rate of about 1 ⁇ g/kg/hour to about 50 ⁇ g/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed.
  • compositions containing the CK ⁇ - 13 of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • pharmaceutically acceptable carrier is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the CK ⁇ - 13 polypeptide is also suitably administered by sustained-release systems.
  • sustained-release compositions include semi- permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules.
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al, Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (R. Langer et al, J. Bio ed. Mater. Res.
  • Sustained-release CK ⁇ -13 polypeptide compositions also include liposomally entrapped CK ⁇ - 13 polypeptide. Liposomes containing CK ⁇ -13 polypeptide are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal CK ⁇ - 13 polypeptide therapy.
  • the CK ⁇ - 13 polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
  • the formulations are prepared by contacting the CK ⁇ - 13 polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.
  • buffers such as phosphate, cit
  • the CK ⁇ - 13 polypeptide is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of CK ⁇ - 13 polypeptide salts.
  • CK ⁇ - 13 polypeptide to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes).
  • Therapeutic CK ⁇ -13 polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • CK ⁇ - 13 polypeptide ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous CK ⁇ - 13 polypeptide solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized CK ⁇ - 13 polypeptide using bacteriostatic Water-for- Injection.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds. Agonists and Antagonists - Assays and Molecules
  • antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ID NO1, or the complementary strand thereof, and/or to nucleotide sequences contained in the deposited clone CK ⁇ - 13.
  • antisense sequence is generated internally, by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
  • Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation.
  • Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 10-1573 (1979); Cooney et al., Science 241 :456 (1988); and Dervan et al., Science 2511300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • c-myc and c-myb antisense RNA constructs to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines was previously described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments were performed in vitro by incubating cells with the oligoribonucleotide. A similar procedure for in vivo use is described in WO 91/15580.
  • a pair of oligonucleotides for a given antisense RNA is produced as follows: A sequence complimentary to the first 15 bases of the open reading frame is flanked by an EcoRl site on the 5 end and a Hindlll site on the 3 end. Next, the pair of oligonucleotides is heated at 90°C for one minute and then annealed in 2X ligation buffer (20mM TRIS HC1 pH 7.5, lOmM MgCl2, lOMM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the EcoRl/Hind III site of the retroviral vector PMV7 (WO 91/15580).
  • 2X ligation buffer 20mM TRIS HC1 pH 7.5, lOmM MgCl2, lOMM dithiothreitol (DTT) and 0.2 mM ATP
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the CK ⁇ - 13 antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence.
  • a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention.
  • RNA antisense nucleic acid
  • Such a vector would contain a sequence encoding the CK ⁇ - 13 antisense nucleic acid.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells.
  • Expression of the sequence encoding CK ⁇ - 13, or fragments thereof can be by any promoter known in the art to act in vertebrate, preferably human cells.
  • Such promoters can be inducible or constitutive.
  • Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al, Cell 22:787-797 (1980), the herpes thymidine promoter (Wagner et al, Proc. Natl. Acad. Sci. U.S.A. 781441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
  • the antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a CK ⁇ - 13 gene.
  • absolute complementarity although preferred, is not required.
  • a sequence "complementary to at least a portion of an RNA,” referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded CK ⁇ - 13 antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid.
  • the larger the hybridizing nucleic acid the more base mismatches with a CK ⁇ - 13 RNA it may contain and still form a stable duplex (or triplex as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
  • sequences complementary to the 3' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
  • oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of CK ⁇ - 13 shown in Figures 1A-B could be used in an antisense approach to inhibit translation of endogenous CK ⁇ - 13 mRNA.
  • Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'- or coding region of CK ⁇ -13 mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length.
  • the oligonucleotide is at least 10_ nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
  • the polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double- stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. WO88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published April 25, 1988), hybridization-triggered cleavage agents.
  • peptides e.g., for targeting host cell receptors in vivo
  • agents facilitating transport across the cell membrane see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization- triggered cleavage agent, etc.
  • the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1-methylinosine,
  • 5'-methoxycarboxymethyluracil 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
  • the antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense oligonucleotide is an a-anomeric oligonucleotide.
  • An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gautier et al, 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al, 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBS Lett. 215:327-330).
  • Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209)
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al, 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc. While antisense nucleotides complementary to the CK ⁇ - 13 coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
  • Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 2471222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy CK ⁇ - 13 mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'.
  • hammerhead ribozymes The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988).
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the CK ⁇ -13 mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
  • the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express CK ⁇ - 13 in vivo.
  • DNA constructs encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA.
  • a preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous CK ⁇ - 13 messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • Antagonist/agonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor formation or growth.
  • the antagonist/agonist may also be employed to prevent hyper-vascular diseases, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the present invention may also be desirous in cases such as restenosis after balloon angioplasty.
  • the antagonist/agonist may also be employed to prevent the growth of scar tissue during wound healing.
  • the antagonist/agonist may also be employed to treat the diseases described herein.
  • the invention provides a method of treating disorders or diseases, including but not limited to the disorders or diseases listed throughout this application, associated with overexpression of a polynucleotide of the present invention by administering to a patient (a) an antisense molecule directed to the polynucleotide of the present invention, and/or (b) a ribozyme directed to the polynucleotide of the present invention
  • the invention also provides a method of screening compounds to identify those which enhance or block the action of CK ⁇ - 13 on cells, such as its interaction with CK ⁇ - 13 -binding molecules such as receptor molecules
  • An agonist is a compound which increases the natural biological functions of CK ⁇ - 13 or which functions in a manner similar to CK ⁇ - 13, while antagonists decrease or eliminate such functions
  • a cellular compartment such as a membrane or a preparation thereof, may be prepared from a cell that expresses a molecule that binds CK ⁇ - 13, such as a molecule of a signaling or regulatory pathway modulated by CK ⁇ -13
  • the preparation is incubated with labeled CK ⁇ - 13 in the absence or the presence of a candidate molecule which may be a CK ⁇ - 13 agonist or antagonist
  • the ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand Molecules which bind gratuitously, i e , without inducing
  • an assay for CK ⁇ - 13 antagonists is a competitive assay that combines CK ⁇ - 13 and a potential antagonist with membrane-bound CK ⁇ - 13 receptor molecules or recombinant CK ⁇ - 13 receptor molecules under appropriate conditions for a competitive inhibition assay.
  • CK ⁇ - 13 can be labeled, such as by radioactivity, such that the number of CK ⁇ - 13 molecules bound to a receptor molecule can be determined accurately to assess the effectiveness of the potential antagonist.
  • Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity.
  • Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing CK ⁇ - 13 -induced activities, thereby preventing the action of CK ⁇ - 13 by excluding CK ⁇ - 13 from binding.
  • Antisense molecules can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression.” CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Zee et al, Nucleic Acids Research 6: 3073 (1979); Cooney et al, Science 241: 456 (1988); and Dervan et al, Science 251: 1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of CK ⁇ -13.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into CK ⁇ - 13 polypeptide.
  • the oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of CK ⁇ - 13 protein.
  • the agonists and antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described above.
  • the antagonists may be employed for instance to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and some T-cell subsets, e.g., activated and CD8 cytotoxic T cells and natural killer cells, in certain auto-immune and chronic inflammatory and infective diseases.
  • auto-immune diseases include multiple sclerosis, and insulin- dependent diabetes.
  • the antagonists may also be employed to treat infectious diseases including silicosis, sarcoidosis, idiopathic pulmonary fibrosis by preventing the recruitment and activation of mononuclear phagocytes. They may also be employed to treat idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and migration. Endotoxic shock may also be treated by the antagonists by preventing the migration of macrophages and their production of the human chemokine polypeptides of the present invention.
  • the antagonists may also be employed for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.
  • the antagonists may also be employed to treat histamine-mediated allergic reactions and immunological disorders including late phase allergic reactions, chronic urticaria, and atopic dermatitis by inhibiting chemokine-induced mast cell and basophil degranulation and release of histamine.
  • IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema may also be treated.
  • the antagonists may also be employed to treat chronic and acute inflammation by preventing the attraction of monocytes to a wound area. They may also be employed to regulate normal pulmonary macrophage populations, since chronic and acute inflammatory pulmonary diseases are associated with sequestration of mononuclear phagocytes in the lung.
  • Antagonists may also be employed to treat rheumatoid arthritis by preventing the attraction of monocytes into synovial fluid in the joints of patients.
  • Monocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathies.
  • the antagonists may be employed to interfere with the deleterious cascades attributed primarily to IL-1 and TNF, which prevents the biosynthesis of other inflammatory cytokines. In this way, the antagonists may be employed to prevent inflammation.
  • the antagonists may also be employed to inhibit prostaglandin- independent fever induced by chemokines.
  • the antagonists may also be employed to treat cases of bone marrow failure, for example, aplastic anemia and myelodysplastic syndrome.
  • the antagonists may also be employed to treat asthma and allergy by preventing eosinophil accumulation in the lung.
  • the antagonists may also be employed to treat subepithelial basement membrane fibrosis which is a prominent feature of the asthmatic lung.
  • Antibodies against CK ⁇ - 13 may be employed to bind to and inhibit CK ⁇ - 13 activity to treat, for example, ARDS, by preventing infiltration of neutrophils into the lung after injury. Any of the above antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described herein.
  • the nucleic acid molecules of the present invention are also valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome.
  • Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • the cDNA herein disclosed is used to clone genomic DNA of a CK ⁇ -13 protein gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 ' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with probes from the cDNA as short as 50 or 60 bp. For a review of this technique, see Verma et al, Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York (1988).
  • FISH Fluorescence in situ hybridization
  • the bacterial expression vector pQE60 was used for bacterial expression in this example (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311).
  • pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site (“RBS”), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo- tri-acetic acid (“Ni-NTA”) affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites.
  • a DNA fragment encoding a polypeptide may be inserted in such as way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide.
  • the polypeptide coding sequence is inserted such that translation of the six His codons is prevented and, therefore, the polypeptide is produced with no 6 X His tag.
  • the DNA sequence encoding the desired portion of the CK ⁇ - 13 protein comprising the mature form beginning with Gly-25 of the CK ⁇ - 13 amino acid sequence was amplified from the deposited cDNA clone using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the CK ⁇ - 13 protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector were added to the 5' and 3' sequences, respectively.
  • the 5' primer has the sequence 5' AAACCATGGGTCCGTACGGTGCAAACATGGAAGACAGCG 3' (SEQ ID NO:4) containing the underlined Ncol restriction site (bold). Particular nucleotides in the "wobble" position in certain codons in both primers have been altered based on E. coli preference.
  • the point in the protein coding sequence where the 5' primer begins may be varied to amplify a desired portion of the complete protein shorter or longer than the mature form.
  • the 3' primer has the sequence 5'
  • AAAAAGCTTCTGACCCTTCCCTGGAAGGTA 3' (SEQ ID NO: 5) containing the underlined Hindlll restriction site.
  • the amplified CK ⁇ -13 DNA fragments and the vector pQE60 were digested with Ncol and Hindlll and the digested DNAs were then ligated together. Insertion of the CK ⁇ -13 DNA into the restricted pQE60 vector places the CK ⁇ -13 protein coding region including its associated stop codon downstream from the IPTG- inducible promoter and in-frame with an initiating AUG. The associated stop codon prevents translation of the six histidine codons downstream of the insertion point.
  • the ligation mixture was transformed into competent E. coli cells using standard procedures such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). E.
  • coli strain M15/rep4 containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance (“Kanr"), is used in carrying out the illustrative example described herein.
  • This strain which is only one of many that are suitable for expressing CK ⁇ - 13 protein, is available commercially from QIAGEN, Inc., supra. Transformants were identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA was isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • Clones containing the desired constructs were 'grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 ⁇ g/ml) and kanamycin (25 ⁇ g/ml).
  • the O/N culture was used to inoculate a large culture, at a dilution of approximately 1 :25 to 1 :250.
  • the cells were grown to an optical density at 600 nm ("OD600”) of between 0.4 and 0.6. isopropyl-b-D-thiogalactopyranoside (“IPTG”) was then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor. Cells subsequently were incubated further for 3 to 4 hours.
  • CK ⁇ - 13 polypeptide cells then were harvested by centrifugation. To purify the CK ⁇ - 13 polypeptide, the cells were then stirred for 3-4 hours at 4° C in 6M guanidine-HCl, pH 8. The cell debris was removed by centrifugation, and the supernatant containing the CK ⁇ - 13 was dialyzed against 50 mM Na-acetate buffer pH 6, supplemented with 200 mM NaCl. Alternatively, the protein can be successfully refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM Tris/HCl pH 7.4, containing protease inhibitors. After renaturation the protein can be purified by ion exchange, hydrophobic interaction and size exclusion chromatography. Alternatively, an affinity chromatography step such as an antibody column can be used to obtain pure CK ⁇ - 13 protein. The purified protein is stored at 4° C or frozen at -80° C.
  • the cell culture Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10°C and the cells are harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech). On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM ⁇ DTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.
  • the cells ware then lysed by passing the solution through a microfluidizer
  • the resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 xg centrifugation for 15 min., the pellet is discarded and the CK ⁇ -13 polypeptide-containing supernatant is incubated at 4°C overnight to allow further GuHCl extraction. Following high speed centrifugation (30,000 xg) to remove insoluble particles, the GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4 5, 150 mM NaCl,
  • a previously prepared tangential filtration unit equipped with 0 16 ⁇ m membrane filter with appropriate surface area equilibrated with 40 mM sodium acetate, pH 6 0 is employed
  • the filtered sample is loaded onto a cation exchange resin (e g , Poros HS-50, Perseptive Biosystems)
  • the column is washed with 40 mM sodium acetate, pH 6 0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCl in the same buffer, in a stepwise manner
  • the absorbance at 280 mm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS- PAGE Fractions containing the CK ⁇ - 13 polypeptide are then pooled and mixed with
  • CK ⁇ - 13 polypeptide exhibits greater than 95% purity after the above refolding and purification steps No major contaminant bands are observed from Commassie blue stained 16% SDS-PAGE gel when 5 ⁇ g of purified protein is loaded
  • the purified protein is also tested for endotoxin/LPS contamination, and typically the LPS content is less than 0 1 ng/ml according to LAL assays
  • Example 2 Cloning and Expression of CK ⁇ -13 protein in a Baculovirus Expression System
  • the plasmid shuttle vector pA2 was used to insert the cloned
  • This expression vector contains the strong polyhedrin promoter of the Autographa calif ornica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and Asp718.
  • AcMNPV Autographa calif ornica nuclear polyhedrosis virus
  • the polyadenylation site of the simian virus 40 (“SV40") is used for efficient polyadenylation.
  • the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene.
  • the inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate a viable virus that express the cloned polynucleotide.
  • baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in- frame AUG as required.
  • Such vectors are described, for instance, in Luckow et al, Virology 170:31-39 (1989).
  • the 5' primer has the sequence 5' AAAGGATCCGCCACCATGGCTCGCCTACAGACT 3' (SEQ ID NO:6) containing a BamHI restriction enzyme site (bold), and an efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987).
  • the 3' primer has the sequence
  • the amplified fragment was isolated from a 1% agarose gel using a commercially available kit ("Geneclean,” BIO 101 Inc., La Jolla, Ca ). The fragment then was digested with BamHI and Asp718 and again is purified on a 1% agarose gel.
  • the plasmid was digested with the restriction enzymes BamHI and Asp718 and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art.
  • the DNA was then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca ).
  • E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Statagene Cloning Systems, La Jolla, CA) cells were transformed with the ligation mixture and spread on culture plates. Bacteria were identified that contain the plasmid with the human CK ⁇ - 13 gene by digesting DNA from individual colonies using BamHI and Asp718 and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment was confirmed by DNA sequencing. This plasmid is designated herein pA2CK ⁇ -13.
  • plasmid pA2CK ⁇ -13 Five ⁇ g of the plasmid pA2CK ⁇ -13 was co-transfected with 1.0 ⁇ g of a commercially available linearized baculovirus DNA ("BaculoGoldTM baculovirus DNA", Pharmingen, San Diego, CA), using the lipofection method described by Feigner et al., Pr ⁇ c. Natl. Acad. Sci. USA 84: 7413-7417 (1987).
  • BaculoGoldTM virus DNA and 5 ⁇ g of the plasmid pA2CK ⁇ -13 were mixed in a sterile well of a microtiter plate containing 50 ⁇ l of serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD).
  • plaque assay After four days the supernatant was collected and a plaque assay was performed, as described by Summers and Smith, supra. An agarose gel with "Blue Gal” (Life Technologies Inc., Gaithersburg) was used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay” of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation, blue stained plaques were picked with the tip of a micropipettor (e.g., Eppendorf).
  • a micropipettor e.g., Eppendorf
  • the agar containing the recombinant viruses was then resuspended in a microcentrifuge tube containing 200 ⁇ l of Grace's medium and the suspension containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4° C.
  • the recombinant virus is called V-CK ⁇ -13.
  • Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS.
  • the cells were infected with the recombinant baculovirus V- CK ⁇ - 13 at a multiplicity of infection ("MOI") of about 2. 6 hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 ⁇ Ci of 35 S-methionine and 5 ⁇ Ci 35 S-cysteine (available from Amersham) were added. The cells were further incubated for 16 hours and then harvested by centrifugation.
  • MOI multiplicity of infection
  • the proteins in the supernatant as well as the intracellular proteins were analyzed by SDS-PAGE followed by autoradiography (if radiolabeled). Microsequencing of the amino acid sequence of the amino terminus of purified proteins was used to determine the amino terminal sequence of the mature of the CK ⁇ - 13 protein, and thus the leader and mature forms, as described above.
  • plasmid CK ⁇ -13HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site.
  • a DNA fragment encoding the entire CK ⁇ - 13 precursor and an HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter.
  • the HA tag corresponds to an epitope derived from the influenza hemaglutinin protein as previously described (I.
  • the plasmid construction strategy is described as follows: The DNA sequence encoding CK ⁇ -13, ATCC # 97113, is constructed by PCR using two primers: The 5' primer
  • 5' AAAAAGCTTAACATAGGCTCGCCTACAGACT 3' contains a Hindlll site followed by 18 nucleotides of CK ⁇ - 13 coding sequence starting from the minus 3 position relative to the initiation codon; the 3' primer 5'CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTATTGGCTCAGC TTATTGAGAAT 3' (SEQ ID NO:9) contains complementary sequence to an Xbal site, translation stop codon, HA tag and the last 21 nucleotides of the CK ⁇ - 13 coding sequence (not including the stop codon).
  • the PCR product contains a Hindlll site, CK ⁇ - 13 coding sequence followed by an HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site.
  • the PCR amplified DNA fragment and the vector, pcDNA3/Amp are digested with Hindlll and Xbal restriction enzyme and ligated.
  • the ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment.
  • COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1989)).
  • the expression of the CK ⁇ -13 HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)).
  • Cells are labelled for 8 hours with 35-S-Cysteine two days post transfection.
  • Fibroblasts are obtained from a subject by skin biopsy.
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask.
  • the flask is turned upside down, closed tight and left at room temp, over night. After 24 hours at room temp., the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media, e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37 degrees C for approximately one week. At this time fresh media is added and subsequently changed every several days.
  • fresh media e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin
  • pMV-7 Kerschmeier, P.T. et al. DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus is digested with EcoRI and Hindlll and subsequently treated with calf intestinal alkaline phosphatase.
  • the linear vector is fractionated on agarose gel and purified, using glass beads.
  • the cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond tolhe 5' and 3' end sequences respectively.
  • the 5' primer containing an EcoRI site and the 3' primer further includes a Hindlll site.
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is used to transform bacteria HB101 , which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10%) calf serum (CS), penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
  • Fresh media is added to the transduced producer cells, and subsequently the media is harvested from a 10cm plate of confluent producer cells.
  • the spent media containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titier is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
  • the engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.
  • the fibroblasts now produce the protein product.
  • Example 5 Chemotactic Effect of CK ⁇ -13 on Activated T-lymphocytes
  • Peripheral blood mononuclear cells were purified from donor leukopacks (Red Cross) by centrifugation on lymphocyte separation medium (LSM; density 1.077 g/ml; Organon Teknika Corp.) and harvesting the interface band.
  • LSM lymphocyte separation medium
  • T- lymphocytes purified from the PBMCs using T-cell enrichment columns (R&D Systems).
  • EL-2 10 U/ml
  • Cells used for the assay were washed 3X with HBSS/01% BSA and resuspended at 2 x 10 6 /ml for labeling.
  • Calcein-AM (Molecular Probes) was added to a final concentration of 1 mM and the cells incubated at 37°C for 30 minutes. Following this incubation the cells were washed 3X with HBSS/01% BSA. Labeled cells were resuspended as 4-8 x lOVml and 25ml (1-2 x 105 cells) added to the top of a polycarbonate filter (3-5 mm pore size; PVP free; NeuroProbe, Inc.) which separates the cell suspension from the chemotactic agent in the plate below. Cells are allowed to migrate for 45 - 90 minutes and then the number of migrated cells (both attached to the filter as well as in the bottom plate) are quantitated using a Cytofluor II fluorescence plate reader (PerSeptive Biosystems).
  • Activated T-lymphocytes from three different donors were used for chemotaxis assays as described above.
  • the data for MCP-1 (open circles) and CkBeta-13 (closed triangles) are presented as the chemotactic index (the ratio between the number of cells migrated in the presence of chemokines and the number of cells migrated in the presence of buffer control) in Figure 4.
  • Example 6 CKBeta-13 Modulates the VLA-4-VCAM-1 Adhesion Pathway in CD4+ Memory and Na ⁇ ve T cells Under Flow Conditions.
  • T cell interactions with immobilized VCAM-1 on coverslips with or without CK ⁇ - 13 under defined laminar flow were studied using a parallel plate flow chamber.
  • Purified T cell subsets were resuspended in RPMI containing 10% FCS at 25 x 10 6 /ml and incubated for 5 minutes at 37°C.
  • CK ⁇ - 13 caused a dose-dependent increase in cell accumulation across a range of estimated shear stresses.
  • This concentration range for CK ⁇ - 13 is chemotactic for both T cell subsets (data not shown).
  • Example 7 CK ⁇ -13 Co-Immobilized with VCAM-1 the VLA-4-VCAM-1 Adhesion Pathway in CD4+ Memory and Na ⁇ ve T cells Under Flow Conditions.
  • Soluble human VCAM-1 IgG fusion protein, expressed by a recombinant baculovirus was absorbed at saturating concentrations to 25 mm glass coverslips using goat F(ab') 2 anti-human Fc antibody.
  • CK ⁇ - 13 was adsorbed to VCAM-1 coated coverslips by incubating a 20 ul aliquot of 100 ng/ml CK ⁇ - 13 for 10 minutes followed by extensive washing with DPBS just prior to use in the flow assay.
  • T cell subsets were incubated with perfusion buffer alone or buffer containing CK ⁇ - 13 (100 ng/ml) for 5 minutes and perfused across coverslips containing VCAM-1 or VCAM-1 co-immobilized with CK ⁇ -13 (100 ng/ml). T cell accumulation at each shear was determined as in Example 6. Either protocol led to a significant drop in memory T cell accumulation and conversely, an increase in naive T cell accumulation (Figure 6). No cell adhesion to CK ⁇ - 13 immobilized alone (without VCAM-1) was observed. These data suggest that independent of the mode of presentation, CK ⁇ - 13 exerted specific, but opposing effects, on T cell subset VLA-4 dependent adhesion to VCAM-1 under flow.
  • Example 8 CK ⁇ -13 modulates CD4+ T cell subset accumulation on VCAM-1 -transduced or TNF- activated HUVEC monolayers underflow.
  • HUVEC were induced to selectively express VCAM-1 by transfection of HUVEC with a VCAM-1 adenovirus.
  • CD4+ na ⁇ ve or memory T cells either untreated or treated with CK ⁇ - 13 (100 ng/ml, 5 min prior to perfusion), were perfused across VCAM-1 -expressing HUVEC monolayers. Accumulation of lymphocytes was measured over a range of shear stresses and is shown in Figure 7A.
  • CK ⁇ - 13 reduces memory T cell adhesion to 4 hr TNF- ⁇ activated HUVEC monolayers.
  • HUVEC were treated for 4 hr with culture media alone or media containing 25 ng/ml of recombinant human TNF- ⁇ and inserted into the flow plate apparatus.
  • Example 9 mAb to CCR4 totally blocks CK ⁇ -13 effects on T cells interactions with VCAM-1.
  • T cell subsets were incubated with the mAb 1G1, specific for the CK ⁇ - 13 cell receptor, CCR4; or mAb specific for an unrelated receptor CCR2 (each at 20 ug/ml, 20 min at 37°C) and then CK ⁇ -13 (100 ng/ml) was added 5 min prior to perfusion across VCAM-1 at 1 dynes/cm 2 .
  • Na ⁇ ve cells, which do not express CCR4 were included as a control.
  • CK ⁇ - 13 signals through the CCR4 in memory T cells to down regulate VLA-4 interactions with VCAM-1 as shown in Figure 8.
  • Example 10 Construction of N-Terminal and/or C-Terminal Deletion Mutants of CK ⁇ -13.
  • oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NO1. The 5' and 3' positions of the primers are determined based on the desired CK ⁇ - 13 polynucleotide fragment.
  • CK ⁇ - 13 polypeptide fragments are those encoding the N-terminal and C-terminal deletion mutants disclosed above in the "Polynucleotide and Polypeptide Fragments" section of the Specification.
  • Additional nucleotides containing restriction sites to facilitate cloning of the CK ⁇ -13 polynucleotide fragment in a desired vector may also be added to the 5' and 3' primer sequences.
  • the CK ⁇ - 13 polynucleotide fragment is amplified from genomic DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art.
  • the CK ⁇ - 13 polypeptide fragments encoded by the CK ⁇ - 13 polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide.
  • the polynucleotide encoding the CK ⁇ -13 polypeptide fragment A-29 to Q-93 is amplified and cloned as follows: A 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence encoding the N-terminal portion of the polypeptide fragment beginning with A-29. A complementary 3' primer is generated comprising a restriction enzyme site followed by a stop codon in frame with the polynucleotide sequence encoding C-terminal portion of the CK ⁇ - 13 polypeptide fragment ending with Q-93.
  • the amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers.
  • the digested polynucleotides are then ligated together.
  • the CK ⁇ - 13 polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the CK ⁇ - 13 polypeptide fragment coding region downstream from the promoter.
  • the ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
  • Tissue distribution of mRNA expression of CK ⁇ - 13 is determined using protocols for Northern blot analysis, described by, among others, Sambrook et al.
  • a CK ⁇ - 13 polynucleotide may be amplified as described in Example 1 and labeled with P 32 using the rediprimeTM DNA labeling system (Amersham Life Science), according to manufacturer's instructions to generate a CK ⁇ - 13 specific probe.
  • the probe is purified using CHROMA SPIN- 100TM column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT1200- 1. The purified labeled probe is then used to examine various human tissues for mRNA expression.
  • MTN Multiple Tissue Northern
  • H human tissues
  • IM human immune system tissues
  • An oligonucleotide primer set is designed according to the sequence at the 5' end of SEQ ID NO1. This primer preferably spans about 100 nucleotides. This primer set is then used in a polymerase chain reaction under the following set of conditions : 30 seconds, 95 degree C; 1 minute, 56 degree C; 1 minute, 70 degree C. This cycle is repeated 32 times followed by one 5 minute cycle at 70 degree C. Human, mouse, and hamster DNA is used as template in addition to a somatic cell hybrid panel containing individual chromosomes or chromosome fragments (Bios, Inc). The reactions is analyzed on either 8% polyacrylamide gels or 3.5 % agarose gels. Chromosome mapping is determined by the presence of an approximately 100 bp PCR fragment in the particular somatic cell hybrid.
  • Example 13 Protein Fusions ofCK ⁇ -13.
  • CK ⁇ - 13 polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of CK ⁇ - 13 polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Example 1; see also EP A 394,827; Traunecker, et al., Nature 331 :84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo.
  • Nuclear localization signals fused to CK ⁇ -13 polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein compared to the non-fused protein. All of the types of fusion proteins described above can be made by modifying the following protocol, which outlines the fusion of a polypeptide to an IgG molecule, or the protocol described in Example 1.
  • the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5' and 3' ends of the sequence described below. These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.
  • the human Fc portion can be ligated into the BamHI cloning site. Note that the 3' BamHI site should be destroyed.
  • the vector containing the human Fc portion is re-restricted with BamHI, linearizing the vector, and CK ⁇ -13 polynucleotide, isolated by the PCR protocol described in Example 1, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.
  • pC4 does not need a second signal peptide.
  • the vector can be modified to include a heterologous signal sequence. (See, e.g., WO 96/34891.)
  • Human IgG Fc region GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCAC
  • the antibodies of the present invention can be prepared by a variety of methods. (See, Current Protocols, Chapter 2.) As one example of such methods, cells expressing CK ⁇ - 13 is administered to an animal to induce the production of sera containing polyclonal antibodies. In a preferred method, a preparation of CK ⁇ - 13 protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
  • the antibodies of the present invention are monoclonal antibodies (or protein binding fragments thereof).
  • Such monoclonal antibodies can be prepared using hybridoma technology. (K ⁇ hler et al, Nature 256:495 (1975); K ⁇ hler et al., Eur. J. Immunol. 6:511 (1976); K ⁇ hler et al, Eur. J. Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp.
  • such procedures involve immunizing an animal (preferably a mouse) with CK ⁇ - 13 polypeptide or, more preferably, with a secreted CK ⁇ - 13 polypeptide-expressing cell.
  • Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56 degree C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ug/ml of streptomycin.
  • the splenocytes of such mice are extracted and fused with a suitable myeloma cell line.
  • a suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC.
  • SP2O parent myeloma cell line
  • the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981).)
  • the hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the CK ⁇ - 13 polypeptide.
  • additional antibodies capable of binding to CK ⁇ - 13 polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies.
  • Such a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody.
  • protein specific antibodies are used to immunize an animal, preferably a mouse.
  • the splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the CK ⁇ - 13 protein-specific antibody can be blocked by CK ⁇ -13.
  • Such antibodies comprise anti-idiotypic antibodies to the CK ⁇ - 13 protein-specific antibody and can be used to immunize an animal to induce formation of further CK ⁇ - 13 protein-specific antibodies.
  • Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • secreted CK ⁇ - 13 protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
  • chimeric monoclonal antibodies For in vivo use of antibodies in humans, it may be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. (See, for review, Morrison, Science 2291202 (1985); Oi et al, BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No.
  • V-genes isolated from human PBLs are constructed into a large library of antibody fragments which contain reactivities against CK ⁇ - 13 to which the donor may or may not have been exposed (see e.g., U.S. Patent 5,885,793 incorporated herein in its entirety by reference).
  • a library of scFvs is constructed from the RNA of human PBLs as described in WO92/01047.
  • To rescue phage displaying antibody fragments approximately 10 9 E. coli harbouring the phagemid are used to inoculate 50 ml of 2xTY containing 1% glucose and 100 ug/ml of ampicillin (2xTY-AMP- GLU) and grown to an O.D. of 0.8 with shaking.
  • M13 delta gene III is prepared as follows: Ml 3 delta gene III helper phage does not encode gene III protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious Ml 3 delta gene III particles are made by growing the helper phage in cells harbouring a pUC19 derivative supplying the wild type gene III protein during phage morphogenesis. The culture is incubated for 1 hour at 37 degree C without shaking and then for a further hour at 37 degree C with shaking.
  • Cells are spun down (IEC-Centra 8, 4000 revs/min for 10 min), resuspended in 300 ml 2xTY broth containing 100 ug ampicillin/ml and 25 ug kanamycin/ml (2xTY- AMP-KAN) and grown overnight, shaking at 37° C. Phage particles are purified and concentrated from the culture medium by two PEG- precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 um filter (Minisart NML; Sartorius) to give a final concentration of approximately 10 13 transducing units/ml (ampicillin-resistant clones).
  • Immuno tubes (Nunc) are coated overnight in PBS with 4 ml of either 100 ug/ml or 10 ug/ml of a polypeptide of the present invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37 degree C and then washed 3 times in PBS. Approximately 10 13 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS.
  • Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TGI by incubating eluted phage with bacteria for 30 minutes at 37 degree C. The E. coli are then plated on TYE plates containing 1% glucose and 100 ug/ml ampicillin. The resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection.
  • Binders Eluted phage from the 3rd and 4th rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al, 1991) from single colonies for assay.
  • ELISAs are performed with microtitre plates coated with either 10 pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR fingerprinting (see e.g., WO92/01047) and then by sequencing.
  • Example 15 Production Of CK ⁇ - 13 Protein For High-Throughput Screening Assays The following protocol produces a supernatant containing CK ⁇ - 13 polypeptide to be tested. This supernatant can then be used in the Screening Assays described in Examples 17-21.
  • dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution (lmg/ml in PBS) 1 :20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a working solution of 50ug/ml.
  • PBS w/o calcium or magnesium 17-516F Biowhittaker
  • one plate of vector DNA lacking an insert should be transfected with each set of transfections
  • the transfection should be performed by tag-teaming the following tasks By tag-teaming, hands on time is cut in half, and the cells do not spend too much time on PBS First, person A aspirates off the media from four 24-well plates of cells, and then person B rinses each well with 5- lml PBS Person A then aspirates off PBS rinse, and person B, using al2-channel pipetter with tips on every other channel, adds the 200ul of DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even wells, to each row on the 24-well plates Incubate at 37 degree
  • the activity when activity is obtained in any of the assays described below using a supernatant, the activity originates from either the CK ⁇ - 13 polypeptide directly (e.g., as a secreted protein) or by CK ⁇ - 13 inducing expression of other proteins, which are then secreted into the supernatant.
  • the invention further provides a method of identifying the protein in the supernatant characterized by an activity in a particular assay.
  • Jaks-STATs pathway One signal transduction pathway involved in the differentiation and proliferation of cells is called the Jaks-STATs pathway. Activated proteins in the Jaks-STATs pathway
  • Jaks-STATs pathway bind to gamma activation site "GAS” elements or interferon- sensitive responsive element ("ISRE"), located in the promoter of many genes. The binding of a protein to these elements alter the expression of the associated gene.
  • GAS gamma activation site
  • ISRE interferon- sensitive responsive element
  • GAS and ISRE elements are recognized by a class of transcription factors called Signal Transducers and Activators of Transcription, or "STATs.”
  • STATs Signal Transducers and Activators of Transcription
  • Statl and Stat3 are present in many cell types, as is Stat2 (as response to IFN-alpha is widespread).
  • Stat4 is more restricted and is not in many cell types though it has been found in T helper class I, cells after treatment with IL-12.
  • Stat5 was originally called mammary growth factor, but has been found at higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines.
  • the STATs are activated to translocate from the cytoplasm to the nucleus upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase ("Jaks") family.
  • Jaks represent a distinct family of soluble tyrosine kinases and include Tyk2, Jakl, Jak2, and Jak3. These kinases display significant sequence similarity and are generally catalytically inactive in resting cells.
  • the Jaks are activated by a wide range of receptors summarized in the Table below. (Adapted from review by Schidler and Darnell, Ann. Rev. Biochem.
  • a cytokine receptor family capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, EL-4, EL-6, EL-7, EL-9, IL-11, IL-12, EL-15, Epo, PRL, GH, G-CSF, GM-CSF, LEF, CNTF, and thrombopoietin; and (b) Class 2 includes EFN-a, IFN-g, and EL- 10.
  • the Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and one tryptophan) and a WSXWS motif (a membrane proximal region encoding Trp-Ser-Xxx-Trp-Ser (SEQ ID NO: 5)).
  • Jaks are activated, which in turn activate STATs, which then translocate and bind to GAS elements. This entire process is encompassed in the Jaks-STATs signal transduction pathway.
  • activation of the Jaks-STATs pathway can be used to indicate proteins involved in the proliferation and differentiation of cells.
  • growth factors and cytokines are known to activate the Jaks-STATs pathway. (See Table below.)
  • activators of the Jaks-STATs pathway can be identified.
  • IL-2 lymphocytes + - + 1,3,5 GAS
  • IL-7 (lymphocytes) + - + 5 GAS IL-9 (lymphocytes) + - + 5 GAS IL-13 (lymphocyte) + ? ? 6 GAS IL-15 + ? + 5 GAS
  • a PCR based strategy is employed to generate a GAS-SV40 promoter sequence.
  • the 5' primer contains four tandem copies of the GAS binding site found in the IRFl promoter and previously demonstrated to bind STATs upon induction with a range of cytokines (Rothman et al., Immunity 1 :457-468 (1994).), although other GAS or ISRE elements can be used instead.
  • the 5' primer also contains 18bp of sequence complementary to the SV40 early promoter sequence and is flanked with an Xhol site.
  • the sequence of the 5' primer is: 5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATT TCCCCGAAATGATTTCCCCGAAATATCTGCCATCTCAATTAG:3' (SEQ ID NO:11)
  • the downstream primer is complementary to the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO12)
  • PCR amplification is performed using the SV40 promoter template present in the B -gal: promoter plasmid obtained from Clontech.
  • the resulting PCR fragment is digested with Xhol/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward and reverse primers confirms that the insert contains the following sequence:
  • a GAS:SEAP2 reporter construct is next engineered.
  • the reporter molecule is a secreted alkaline phosphatase, or "SEAP.”
  • SEAP secreted alkaline phosphatase
  • any reporter molecule can be instead of SEAP, in this or in any of the other Examples.
  • Well known reporter molecules that can be used instead of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline phosphatase, beta-galactosidase, green fluorescent protein (GFP), or any protein detectable by an antibody.
  • CAT chloramphenicol acetyltransferase
  • luciferase luciferase
  • alkaline phosphatase beta-galactosidase
  • GFP green fluorescent protein
  • the GAS-SEAP cassette is removed from the GAS-SEAP vector using Sail and Notl, and inserted into a backbone vector containing the neomycin resistance gene, such as pGFP-1 (Clontech), using these restriction sites in the multiple cloning site, to create the GAS-SEAP/Neo vector.
  • pGFP-1 pGFP-1
  • HELA epidermal
  • HUVEC endothelial
  • Reh B-cell
  • Saos-2 osteoblast
  • HUVAC aortic
  • Cardiomyocyte a cell line
  • Example 17 High-Throughput Screening Assay for T-cell Activity.
  • T-cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 16.
  • factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway.
  • the T-cell used in this assay is Jurkat T-cells (ATCC Accession No. TEB- 152), although Molt-3 cells (ATCC Accession No. CRL-1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.
  • Jurkat T-cells are lymphoblastic CD4+ Thl helper cells.
  • approximately 2 million Jurkat cells are transfected with the GAS- SEAP/neo vector using DMRIE-C (Life Technologies)(transfection procedure described below).
  • the transfected cells are seeded to a density of approximately 20,000 cells per well and transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are expanded and then tested for their response to increasing concentrations of interferon gamma. The dose response of a selected clone is demonstrated.
  • the following protocol will yield sufficient cells for 75 wells containing 200 ul of cells. Thus, it is either scaled up, or performed in multiple to generate sufficient cells for multiple 96 well plates.
  • Jurkat cells are maintained in RPMI + 10% serum with l%Pen-Strep.
  • OPTI-MEM Life Technologies
  • the cells On the day of treatment with the supernatant, the cells should be washed and resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml. The exact number of cells required will depend on the number of supernatants being screened. For one 96 well plate, approximately 10 million cells (for 10 plates, 100 million cells) are required.
  • the 96 well dishes containing Jurkat cells treated with supernatants are placed in an incubator for 48 hrs (note: this time is variable between 48-72 hrs).
  • 35 ul samples from each well are then transferred to an opaque 96 well plate using a 12 channel pipette.
  • the opaque plates should be covered (using sellophene covers) and stored at -20 degree C until SEAP assays are performed according to Example 18.
  • the plates containing the remaining treated cells are placed at 4 degree C and serve as a source of material for repeating the assay on a specific well if desired.
  • 100 Unit/ml interferon gamma can be used which is known to activate Jurkat T cells. Over 30 fold induction is typically observed in the positive control wells.
  • the following protocol is used to assess myeloid activity of CK ⁇ - 13 by determining whether CK ⁇ - 13 proliferates and/or differentiates myeloid cells.
  • Myeloid cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 16. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway.
  • the myeloid cell used in this assay is U937, a pre-monocyte cell line, although TF-1, HL60, or KG1 can be used.
  • a DEAE-Dextran method (Kharbanda et. al, 1994, Cell Growth & Differentiation, 5:259-265) is used.
  • the U937 cells are usually grown in RPMI 1640 medium containing 10%) heat-inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100 mg/ml streptomycin.
  • FBS heat-inactivated fetal bovine serum
  • the GAS-SEAP/U937 stable cells are obtained by growing the cells in 400 ug/ml G418.
  • the G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 400 ug/ml G418 for couple of passages.
  • EGR1 (early growth response gene 1), is induced in various tissues and cell types upon activation.
  • the promoter of EGR 1 is responsible for such induction.
  • EGR1 promoter linked to reporter molecules activation of cells can be assessed by
  • PC 12 cells rat phenochromocytoma cells
  • TPA tetradecanoyl phorbol acetate
  • NGF nerve growth factor
  • EGF epidermal growth factor
  • the EGR1 gene expression is activated during this treatment.
  • PC 12 cells by stably transfecting PC 12 cells with a construct containing an EGR promoter linked to
  • SEAP reporter activation of PC12 cells by CK ⁇ -13 can be assessed.
  • the EGR SEAP reporter construct can be assembled by the following protocol.
  • the EGR-1 promoter sequence (-633 to +l)(Sakamoto K et al., Oncogene 6:867-871 (1991)) can be PCR amplified from human genomic DNA using the following primers:
  • EGR1 amplified product can then be inserted into this vector.
  • PC 12 cells are routinely grown in RPMI- 1640 medium (Bio Whittaker) containing 10% horse serum (JRH BIOSCIENCES, Cat. # 12449-78P), 5% heat- inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100 ug/ml streptomycin on a precoated 10 cm tissue culture dish.
  • FBS heat- inactivated fetal bovine serum
  • EGR-SEAP/PC12 stable cells are obtained by growing the cells in 300 ug/ml G418.
  • the G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 300 ug/ml
  • a 10 cm plate with cells around 70 to 80% confluent is screened by removing the old medium. Wash the cells once with PBS (Phosphate buffered saline). Then starve the cells in low serum medium (RPMI- 1640 containing 1% horse serum and 0.5% FBS with antibiotics) overnight.
  • PBS Phosphate buffered saline
  • Example 20 High-Throughput Screening Assay for T-cell Activity
  • NF-kappaB Nuclear Factor kappaB
  • NF-kappaB is a transcription factor activated by a wide variety of agents including the inflammatory cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression of certain viral gene products.
  • NF-kappaB regulates the expression of genes involved in immune cell activation, control of apoptosis (NF-kappaB appears to shield cells from apoptosis), B and T- cell development, anti-viral and antimicrobial responses, and multiple stress responses.
  • NF-kappaB is retained in the cytoplasm with I- kappaB (Inhibitor kappaB).
  • I-kappaB is phosphorylated and degraded, causing NF-kappaB to shuttle to the nucleus, thereby activating transcription of target genes.
  • Target genes activated by NF-kappaB include IL-2, EL- 6, GM-CSF, ICAM-1 and class 1 MHC. Due to its central role and ability to respond to a range of stimuli, reporter constructs utilizing the NF-kappaB promoter element are used to screen the supernatants produced in Example 15. Activators or inhibitors of NF-kappaB would be useful in treating diseases. For example, inhibitors of NF-kappaB could be used to treat those diseases related to the acute or chronic activation of NF-kappaB, such as rheumatoid arthritis.
  • the upstream primer contains four tandem copies of the NF-kappaB binding site (GGGGACTTTCCC) (SEQ ID NO: 16), 18 bp of sequence complementary to the 5' end of the SV40 early promoter sequence, and is flanked with an Xhol site:
  • the downstream primer is complementary to the 3' end of the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO12)
  • PCR amplification is performed using the SV40 promoter template present in the pB -gal: promoter plasmid obtained from Clontech.
  • the resulting PCR fragment is digested with Xhol and Hind III and subcloned into BLSK2- (Stratagene).
  • the NF-kappaB/SV40/SEAP cassette is removed from the above NF-kappaB/SEAP vector using restriction enzymes Sail and Notl, and inserted into a vector containing neomycin resistance.
  • the NF-kappaB/SV40/SEAP cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after restricting pGFP-1 with Sail and Notl.
  • NF-kappaB/SV40/SEAP/Neo vector Once NF-kappaB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells are created and maintained according to the protocol described in Example 17.
  • Example 17 the method for assaying supernatants with these stable Jurkat T-cells is also described in Example 17.
  • exogenous TNF alpha 0.1,1, 10 ng
  • H9, HlO, and HI 1 wells H9, HlO, and HI 1, with a 5-10 fold activation typically observed.
  • SEAP activity is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the following general procedure
  • the Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction Buffers used below
  • Example 22 High-Throughput Screening Assay Identifying Changes in Small Molecule Concentration and Membrane Permeability Binding of a ligand to a receptor is known to alter intracellular levels of small molecules, such as calcium, potassium, sodium, and pH, as well as alter membrane potential. These alterations can be measured in an assay to identify supernatants which bind to receptors of a particular cell. Although the following protocol describes an assay for calcium, this protocol can easily be modified to detect changes in potassium, sodium, pH, membrane potential, or any other small molecule which is detectable by a fluorescent probe.
  • small molecules such as calcium, potassium, sodium, and pH
  • the following assay uses Fluorometric Imaging Plate Reader ("FLIPR”) to measure changes in fluorescent molecules (Molecular Probes) that bind small molecules.
  • FLIPR Fluorometric Imaging Plate Reader
  • any fluorescent molecule detecting a small molecule can be used instead of the calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.; catalog no. F- 14202), used here.
  • adherent cells For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star black 96-well plate with clear bottom. The plate is incubated in a CO 2 incubator for 20 hours. The adherent cells are washed two times in Biotek washer with 200 ul of HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after the final wash. A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To load the cells with fluo-4, 50 ul of 12 ug/ml fluo-4 is added to each well. The plate is incubated at 37 degrees C in a CO 2 incubator for 60 min. The plate is washed four times in the Biotek washer with HBSS leaving 100 ul of buffer.
  • the cells are spun down from culture media.
  • Cells are re-suspended to 2-5x10 6 cells/ml with HBSS in a 50-ml conical tube.
  • 4 ul of 1 mg/ml fluo-4 solution in 10% pluronic acid DMSO is added to each ml of cell suspension.
  • the tube is then placed in a 37 degrees C water bath for 30-60 min.
  • the cells are washed twice with HBSS, resuspended to lxl 0 6 cells/ml, and dispensed into a microplate, 100 ul/well.
  • the plate is centrifuged at 1000 rpm for 5 min.
  • each well contains a fluorescent molecule, such as fluo-4.
  • the supernatant is added to the well, and a change in fluorescence is detected.
  • the FLIPR is set for the following parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4 second; (3) Camera F/stop is F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6) Sample addition is 50 ul. Increased emission at 530 nm indicates an extracellular signaling event caused by the a molecule, either CK ⁇ - 13 or a molecule induced by CK ⁇ - 13, which has resulted in an increase in the intracellular Ca++ concentration.
  • the Protein Tyrosine Kinases represent a diverse group of transmembrane and cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group are receptors for a range of mitogenic and metabolic growth factors including the PDGF, FGF, EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large family of RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include mainly secreted small proteins, but also membrane-bound and extracellular matrix proteins.
  • cytoplasmic tyrosine kinases include receptor associated tyrosine kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor linked and cytosolic protein tyrosine kinases, such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
  • src-family e.g., src, yes, lck, lyn, fyn
  • non-receptor linked and cytosolic protein tyrosine kinases such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
  • the following protocol is designed to identify such molecules capable of activating the tyrosine kinase signal transduction pathways.
  • Seed target cells e.g., primary keratinocytes
  • Loprodyne Silent Screen Plates purchased from Nalge Nunc (Naperville, EL). The plates are sterilized with two 30 minute rinses with 100% ethanol, rinsed with water and dried overnight. Some plates are coated for 2 hr with 100 ml of cell culture grade type I collagen (50 mg/ml), gelatin (2%) or polylysine (50 mg/ml), all of which can be purchased from Sigma Chemicals (St. Louis, MO) or 10% Matrigel purchased from Becton Dickinson (Bedford, MA), or calf serum, rinsed with PBS and stored at 4 degree C.
  • Cell growth on these plates is assayed by seeding 5,000 cells/well in growth medium and indirect quantitation of cell number through use of alamarBlue as described by the manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hr.
  • Falcon plate covers #3071 from Becton Dickinson (Bedford, MA) are used to cover the Loprodyne Silent Screen Plates.
  • Falcon Microtest III cell culture plates can also be used in some proliferation experiments.
  • A431 cells are seeded onto the nylon membranes of Loprodyne plates (20,000/200ml/well) and cultured overnight in complete medium. Cells are quiesced by incubation in serum-free basal medium for 24 hr.
  • the medium was removed and 100 ml of extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-l 00, 0.1% SDS, 2 mM Na3VO4, 2 mM Na4P2O7 and a cocktail of protease inhibitors (# 1836170) obtained from Boeheringer Mannheim (Indianapolis, IN) is added to each well and the plate is shaken on a rotating shaker for 5 minutes at 4oC. The plate is then placed in a vacuum transfer manifold and the extract filtered through the 0.45 mm membrane bottoms of each well using house vacuum.
  • extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-l 00, 0.1% SDS, 2 mM Na3VO4, 2 mM Na4P2O7 and a cocktail of protease inhibitors (# 1836170) obtained from Boeheringer Mannheim (Indianapolis, IN) is
  • Extracts are collected in a 96-well catch/assay plate in the bottom of the vacuum manifold and immediately placed on ice. To obtain extracts clarified by centrifugation, the content of each well, after detergent solubilization for 5 minutes, is removed and centrifuged for 15 minutes at 4 degree C at 16,000 x g.
  • the filtered extracts for levels of tyrosine kinase activity.
  • a biotinylated peptide Biotinylated peptides that can be used for this purpose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a range of tyrosine kinases and are available from Boehringer Mannheim.
  • the tyrosine kinase reaction is set up by adding the following components in order. First, add lOul of 5uM Biotinylated Peptide, then lOul ATP/Mg2+ (5mM ATP/50mM MgC12), then lOul of 5x Assay Buffer (40mM imidazole hydrochloride, pH7.3, 40 mM beta-glycerophosphate, ImM EGTA, lOOmM MgC12, 5 mM MnC12, 0.5 mg/ml BSA), then 5ul of Sodium Vanadate (ImM), and then 5ul of water. Mix the components gently and preincubate the reaction mix at 30 degree C for 2 min. Initial the reaction by adding lOul of the control enzyme or the filtered supernatant.
  • 5x Assay Buffer 40mM imidazole hydrochloride, pH7.3, 40 mM beta-glycerophosphate, ImM EGTA, lOO
  • the tyrosine kinase assay reaction is then terminated by adding 10 ul of 120mm EDTA and place the reactions on ice.
  • Tyrosine kinase activity is determined by transferring 50 ul aliquot of reaction mixture to a microtiter plate (MTP) module and incubating at 37 degree C for 20 min. This allows the streptavadin coated 96 well plate to associate with the biotinylated peptide. Wash the MTP module with 300ul/well of PBS four times. Next add 75 ul of anti-phospotyrosine antibody conjugated to horse radish peroxidase(anti-P-Tyr-POD(0.5u/ml)) to each well and incubate at 37 degree C for one hour. Wash the well as above.
  • an assay which detects activation (phosphorylation) of major intracellular signal transduction intermediates can also be used.
  • one particular assay can detect tyrosine phosphorylation of the Erk-1 and Erk-2 kinases.
  • phosphorylation of other molecules such as Raf, JNK, p38 MAP, Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK, Tec, and Janus, as well as any other phosphoserine, phosphotyrosine, or phosphothreonine molecule, can be detected by substituting these molecules for Erk-1 or Erk-2 in the following assay.
  • assay plates are made by coating the wells of a 96-well ELISA plate with 0.1ml of protein G (lug/ml) for 2 hr at room temp, (RT). The plates are then rinsed with PBS and blocked with 3% BS A/PBS for 1 hr at RT. The protein G plates are then treated with 2 commercial monoclonal antibodies (lOOng/well) against Erk-land Erk-2 (1 hr at RT) (Santa Cruz Biotechnology). (To detect other molecules, this step can easily be modified by substituting a monoclonal antibody detecting any of the above described molecules.) After 3-5 rinses with PBS, the plates are stored at 4 degree C until use.
  • A431 cells are seeded at 20,000/well in a 96-well Loprodyne filterplate and cultured overnight in growth medium. The cells are then starved for 48 hr in basal medium (DMEM) and then treated with EGF (6ng/well) or 50 ul of the supernatants obtained in Example 15 for 5-20 minutes. The cells are then solubilized and extracts filtered directly into the assay plate.
  • DMEM basal medium
  • EGF 6ng/well
  • 50 ul of the supernatants obtained in Example 15 for 5-20 minutes.
  • the cells are then solubilized and extracts filtered directly into the assay plate.
  • RNA isolated from entire families or individual patients presenting with a phenotype of interest is be isolated.
  • cDNA is then generated from these RNA samples using protocols known in the art. (See, Sambrook.)
  • the cDNA is then used as a template for PCR, employing primers surrounding regions of interest in SEQ ID NO1.
  • Suggested PCR conditions consist of 35 cycles at 95 degree C for 30 seconds; 60-120 seconds at 52-58 degree C; and 60-120 seconds at 70 degree C, using buffer solutions described in Sidransky, D., et al., Science 252:706 (1991).
  • PCR products are then sequenced using primers labeled at their 5' end with
  • T4 polynucleotide kinase employing SequiTherm Polymerase. (Epicentre Technologies).
  • the intron-exon borders of selected exons of CK ⁇ - 13 is also determined and genomic PCR products analyzed to confirm the results.
  • PCR products harboring suspected mutations in CK ⁇ - 13 is then cloned and sequenced to validate the results of the direct sequencing.
  • PCR products of CK ⁇ - 13 are cloned into T-tailed vectors as described in Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19: 1156 (1991) and sequenced with T7 polymerase (United States Biochemical). Affected individuals are identified by mutations in CK ⁇ - 13 not present in unaffected individuals.
  • Genomic rearrangements are also observed as a method of determining alterations in a gene corresponding to CK ⁇ -13.
  • Genomic clones isolated according to Example 2 are nick-translated with digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and FISH performed as described in Johnson, Cg. et al., Methods Cell Biol. 35:73-99 (1991).
  • Hybridization with the labeled probe is carried out using a vast excess of human cot-1 DNA for specific hybridization to the CK ⁇ - 13 genomic locus.
  • Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium iodide, producing a combination of C- and R-bands. Aligned images for precise mapping are obtained using a triple-band filter set (Chroma Technology, Brattleboro, VT) in combination with a cooled charge-coupled device camera (Photometries, Arlington, AZ) and variable excitation wavelength filters. (Johnson, Cv. et al, Genet. Anal. Tech.
  • Example 26 Method of Detecting Abnormal Levels of CK ⁇ -13 in a
  • CK ⁇ - 13 polypeptides can be detected in a biological sample, and if an increased or decreased level of CK ⁇ - 13 is detected, this polypeptide is a marker for a particular phenotype. Methods of detection are numerous, and thus, it is understood that one skilled in the art can modify the following assay to fit their particular needs.
  • antibody-sandwich ELISAs are used to detect CK ⁇ - 13 in a sample, preferably a biological sample.
  • Wells of a microtiter plate are coated with specific antibodies to CK ⁇ -13, at a final concentration of 0.2 to 10 ug/ml.
  • the antibodies are either monoclonal or polyclonal and are produced by the method described in Example 11. The wells are blocked so that non-specific binding of CK ⁇ - 13 to the well is reduced.
  • the coated wells are then incubated for > 2 hours at RT with a sample containing CK ⁇ -13.
  • serial dilutions of the sample should be used to validate results.
  • the plates are then washed three times with deionized or distilled water to remove unbounded CK ⁇ -13.
  • the invention also provides methods of treatment and/or prevention of diseases or disorders (such as, for example, any one or more of the diseases or disorders disclosed herein) by administration to a subject of an effective amount of a Therapeutic.
  • a Therapeutic is meant a polynucleotides or polypeptides of the invention (including fragments and variants), agonists or antagonists thereof, and/or antibodies thereto, in combination with a pharmaceutically acceptable carrier type (e g , a sterile carrier)
  • a pharmaceutically acceptable carrier type e g , a sterile carrier
  • the Therapeutic will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the Therapeutic alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to practitioners
  • the "effective amount" for purposes herein is thus determined by such considerations As a general proposition, the total pharmaceutically effective amount of the
  • Therapeutic administered parenterally per dose will be in the range of about lug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion More preferably, this dose is at least 0 01 mg/kg/day, and most preferably for humans between about 0 01 and 1 mg/kg/day for the hormone If given continuously, the Therapeutic is typically administered at a dose rate of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump An intravenous bag solution may also be employed The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect
  • Therapeutics can be are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray
  • “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion
  • Therapeutics of the invention are also suitably administered by sustained- release systems Suitable examples of sustained-release Therapeutics are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray.
  • “Pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type.
  • parenteral refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • Therapeutics of the invention are also suitably administered by sustained- release systems.
  • sustained-release Therapeutics include suitable polymeric materials (such as, for example, semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt).
  • Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al, Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res. 15167-277 (1981), and Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
  • Sustained-release Therapeutics also include liposomally entrapped
  • Liposomes containing the Therapeutic are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad.
  • the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal Therapeutic.
  • the Therapeutics of the invention are delivered by way of a pump (see Langer, supra, Sefton, CRC Crit. Ref Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl.
  • the Therapeutic is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • a pharmaceutically acceptable carrier i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the Therapeutic.
  • the formulations are prepared by contacting the Therapeutic uniformly and intimately with liquid carriers or finely divided solid carriers or both.
  • the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient.
  • carrier vehicles include water, saline,
  • Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
  • the carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability.
  • additives such as substances that enhance isotonicity and chemical stability.
  • Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbi
  • the Therapeutic is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of polypeptide salts.
  • Any pharmaceutical used for therapeutic administration can be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Therapeutics generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • a sterile access port for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
  • Therapeutics ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution.
  • a lyophilized formulation 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous Therapeutic solution, and the resulting mixture is lyophilized.
  • the infusion solution is prepared by reconstituting the lyophilized Therapeutic using bacteriostatic Water-for- Injection.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the Therapeutics of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • the Therapeutics may be employed in conjunction with other therapeutic compounds.
  • the Therapeutics of the invention may be administered alone or in combination with adjuvants.
  • adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.), BCG, and MPL.
  • Therapeutics of the invention are administered in combination with alum.
  • Therapeutics of the invention are administered in combination with QS-21.
  • compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology.
  • Vaccines that may be administered with the Therapeutics of the invention include, but are not limited to, vaccines directed toward protection against MMR (measles, mumps, rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially.
  • MMR measles, mumps, rubella
  • polio varicella
  • tetanus/diptheria hepatitis A
  • hepatitis B haemophilus influenzae B
  • cholera yellow fever
  • Japanese encephalitis polio
  • Administration "in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.
  • the Therapeutics of the invention may be administered alone or in combination with other therapeutic agents.
  • Therapeutic agents that may be administered in combination with the Therapeutics of the invention include but not limited to, other members of the TNF family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatories, conventional immunotherapeutic agents, cytokines and/or growth factors.
  • Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially.
  • Administration "in combination” further includes the separate administration of one of the compounds or agents given first, followed by the second.
  • the Therapeutics of the invention are administered in combination with members of the TNF family.
  • TNF, TNF-related or TNF-like molecules that may be administered with the Therapeutics of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I (International Publication No.
  • WO 98/41629 TRANK
  • TR9 International Publication No. WO 98/56892
  • TR10 International Publication No. WO 98/54202
  • 312C2 International Publication No. WO 98/06842
  • TR12 and soluble forms CD 154, CD70, and CD 153.
  • Therapeutics of the invention are administered in combination with antiretro viral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors.
  • Nucleoside reverse transcriptase inhibitors that may be administered in combination with the Therapeutics of the invention include, but are not limited to, RETRO V1RTM (zidovudine/AZT), VTDEXTM (didanosine/ddl), HIVIDTM (zalcitabine/ddC), ZERITTM (stavudine/d4T), EPIVIRTM (lamivudine/3TC), and COMBIVIRTM (zidovudine/lamivudine).
  • Non-nucleoside reverse transcriptase inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, VIRAMUNETM (nevirapine), RESCRIPTORTM (delavirdine), and SUSTIVATM (efavirenz).
  • Protease inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, CR1XIVANTM (indinavir), NORVIRTM (ritonavir), INVIRASETM (saquinavir), and VIRACEPTTM (nelfinavir).
  • antiretroviral agents nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors may be used in any combination with Therapeutics of the invention to treat AIDS and/or to prevent or treat HIV infection.
  • Therapeutics of the invention may be administered in combination with anti-opportunistic infection agents.
  • Anti-opportunistic agents that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLETM, DAPSONETM, PENTAMIDINETM, ATOVAQUONETM, ISONIAZIDTM,
  • RIFAMPINTM PYRAZINAMIDETM, ETHAMBUTOLTM, RIFABUTINTM, CLARITHROMYCINTM, AZITHROMYCINTM, GANCICLOVIRTM, FOSCARNETTM, CIDOFOVIRTM, FLUCONAZOLETM, ITRACONAZOLETM, KETOCONAZOLETM, ACYCLOVIRTM, FAMCICOLVD ⁇ TM, PYRIMETHAMINETM, LEUCOVORINTM, NEUPOGENTM (filgrastim/G-CSF), and LEUKINETM (sargramostim/GM-CSF).
  • Therapeutics of the invention are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLETM, DAPSONETM, PENTAMIDINETM, and/or ATOVAQUONETM to prophylactically treat or prevent an opportunistic Pneumocystis carinii pneumonia infection.
  • Therapeutics of the invention are used in any combination with ISONIAZIDTM, RIFAMPINTM, PYRAZINAMIDETM, and/or ETHAMBUTOLTM to prophylactically treat or prevent an opportunistic Mycobacterium avium complex infection.
  • Therapeutics of the invention are used in any combination with RIFABUTINTM, CLARITHROMYCINTM, and/or AZITHROMYCINTM to prophylactically treat or prevent an opportunistic Mycobacterium tuberculosis infection.
  • Therapeutics of the invention are used in any combination with GANCICLOVIRTM, FOSCARNETTM, and/or CIDOFOVIRTM to prophylactically treat or prevent an opportunistic cytomegalovirus infection.
  • Therapeutics of the invention are used in any combination with FLUCONAZOLETM, ITRACONAZOLETM, and/or KETOCONAZOLETM to prophylactically treat or prevent an opportunistic fungal infection.
  • Therapeutics of the invention are used in any combination with ACYCLOVIRTM and/or FAMCICOLVIRTM to prophylactically treat or prevent an opportunistic herpes simplex virus type I and/or type II infection.
  • Therapeutics of the invention are used in any combination with PYRIMETHAMINETM and/or LEUCOVORINTM to prophylactically treat or prevent an opportunistic Toxoplasma gondii infection.
  • Therapeutics of the invention are used in any combination with LEUCOVORINTM and/or NEUPOGENTM to prophylactically treat or prevent an opportunistic bacterial infection.
  • the Therapeutics of the invention are administered in combination with an antiviral agent.
  • Antiviral agents that may be administered with the Therapeutics of the invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantidine.
  • the Therapeutics of the invention are administered in combination with an antibiotic agent.
  • Antibiotic agents that may be administered with the Therapeutics of the invention include, but are not limited to, amoxicillin, beta- lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim- sulfamthoxazole, and vancomycin.
  • immunosuppressive agents that may be administered in combination with the Therapeutics of the invention include, but are not limited to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells.
  • Therapeutics of the invention are administered in combination with immunosuppressants.
  • Immunosuppressants preparations that may be administered with the Therapeutics of the invention include, but are not limited to, ORTHOCLONETM (OKT3), SANDIMMUNETM/NEORALTM/SANGDYATM
  • immunosuppressants may be used to prevent rejection of organ or bone marrow transplantation.
  • Therapeutics of the invention are administered alone or in combination with one or more intravenous immune globulin preparations.
  • Intravenous immune globulin preparations that may be administered with the Therapeutics of the invention include, but not limited to, GAMMARTM, IVEEGAMTM, SANDOGLOBULINTM, GAMMAGARD S/DTM, and GAMIMUNETM.
  • Therapeutics of the invention are administered in combination with intravenous immune globulin preparations in transplantation therapy (e.g., bone marrow transplant).
  • the Therapeutics of the invention are administered alone or in combination with an anti-inflammatory agent.
  • Anti- inflammatory agents that may be administered with the Therapeutics of the invention include, but are not limited to, glucocorticoids and the nonsteroidal anti- inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e- acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol, parany
  • compositions of the invention are administered in combination with a chemotherapeutic agent.
  • Chemo therapeutic agents that may be administered with the Therapeutics of the invention include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine sulfate); hormones (e.
  • Therapeutics of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) or any combination of the components of CHOP.
  • CHOP cyclophosphamide, doxorubicin, vincristine, and prednisone
  • Therapeutics of the invention are administered in combination with Rituximab.
  • Therapeutics of the invention are administered with Rituxmab and CHOP, or Rituxmab and any combination of the components of CHOP.
  • the Therapeutics of the invention are administered in combination with cytokines.
  • Cytokines that may be administered with the Therapeutics of the invention include, but are not limited to, IL2, EL3, EL4, EL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF- alpha.
  • Therapeutics of the invention may be administered with any interleukin, including, but not limited to, IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, EL- 19, IL-20, and EL-21.
  • interleukin including, but not limited to, IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, EL- 19, IL-20, and EL-21.
  • the Therapeutics of the invention are administered in combination with angiogenic proteins.
  • Angiogenic proteins that may be administered with the Therapeutics of the invention include, but are not limited to, Glioma Derived Growth Factor (GDGF), as disclosed in European Patent Number EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110; Platelet Derived Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317; Placental Growth Factor (P1GF), as disclosed in International Publication Number WO 92/06194; Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et al., Gorwth Factors, 4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in International Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A (VEGF- A), as disclosed in European Patent Number EP-506477; Vascular
  • the Therapeutics of the invention are administered in combination with hematopoietic growth factors.
  • Hematopoietic growth factors that may be administered with the Therapeutics of the invention include, but are not limited to, LEUKINETM (SARGRAMOSTIMTM) and NEUPOGENTM (FILGRASTIMTM).
  • the Therapeutics of tlie invention are administered in combination with Fibroblast Growth Factors.
  • Fibroblast Growth Factors that may be administered with the Therapeutics of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-1 1, FGF-12, FGF-13, FGF-14, and FGF-15.
  • the Therapeutics of the invention are administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.
  • Example 28 Method of Treating Decreased Levels of CK ⁇ -13
  • the present invention relates to a method for treating an individual in need of an increased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an agonist of the invention (including polypeptides of the invention).
  • a composition comprising a therapeutically effective amount of an agonist of the invention (including polypeptides of the invention).
  • conditions caused by a decrease in the standard or normal expression level of CK ⁇ - 13 in an individual can be treated by administering CK ⁇ -13, preferably in the secreted form.
  • the invention also provides a method of treatment of an individual in need of an increased level of CK ⁇ - 13 polypeptide comprising administering to such an individual a Therapeutic comprising an amount of CK ⁇ - 13 to increase the activity level of CK ⁇ - 13 in such an individual.
  • a patient with decreased levels of CK ⁇ - 13 polypeptide receives a daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days.
  • the polypeptide is in the secreted form.
  • the exact details of the dosing scheme, based on administration and formulation, are provided in Example 27.
  • Example 29 Method of Treating Increased Levels of CK ⁇ -13
  • the present invention also relates to a method of treating an individual in need of a decreased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an antagonist of the invention (including polypeptides and antibodies of the invention)
  • antisense technology is used to inhibit production of CK ⁇ - 13
  • This technology is one example of a method of decreasing levels of CK ⁇ - 13 polypeptide, preferably a secreted form, due to a variety of etiologies, such as cancer
  • a patient diagnosed with abnormally increased levels of CK ⁇ - 13 is administered intravenously antisense polynucleotides at 0 5, 1 0, 1 5, 2 0 and 3 0 mg/kg day for 21 days This treatment is repeated after a 7-day rest period if the treatment was well tolerated
  • the formulation of the antisense polynucleotide is provided in Example 27
  • Example 30 Method of Treatment Using Gene Therapy - Ex Vivo
  • fibroblasts which are capable of expressing CK ⁇ - 13 polypeptides, onto a patient
  • fibroblasts are obtained from a subject by skin biopsy
  • the resulting tissue is placed in tissue-culture medium and separated into small pieces Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask
  • the flask is turned upside down, closed tight and left at room temperature over night After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e g , Ham's F12 media, with 10%) FBS, penicillin and streptomycin) is added
  • fresh media e g , Ham's F12 media, with 10%
  • FBS penicillin and streptomycin
  • the cDNA encoding CK ⁇ - 13 can be amplified using PCR primers which correspond to the 5' and 3' end sequences respectively as set forth in Example 1.
  • the 5' primer contains an EcoRI site and the 3' primer includes a Hindlll site.
  • Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the ligation mixture is then used to transform bacteria HB101, which are then plated onto agar containing kanamycin for the purpose of confirming that the vector contains properly inserted CK ⁇ -13.
  • the amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin.
  • DMEM Dulbecco's Modified Eagles Medium
  • CS calf serum
  • penicillin and streptomycin The MSV vector containing the CK ⁇ - 13 gene is then added to the media and the packaging cells transduced with the vector.
  • the packaging cells now produce infectious viral particles containing the CK ⁇ -13 gene(the packaging cells are now referred to as producer cells).
  • Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells.
  • the spent media containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells.
  • Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his. Once the fibroblasts have been efficiently infected, the fibroblasts are analyzed to determine whether CK ⁇ - 13 protein is produced.
  • Example 31 Gene Therapy Using Endogenous CK ⁇ -13 Gene
  • Another method of gene therapy involves operably associating the endogenous CK ⁇ - 13 sequence with a promoter via homologous recombination as described, for example, in U.S. Patent No. 5,641,670, issued June 24, 1997; International Publication No. WO 96/29411, published September 26, 1996; International Publication No. WO 94/12650, published August 4, 1994; Roller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989).
  • This method involves the activation of a gene which is present in the target cells, but which is not expressed in the cells, or is expressed at a lower level than desired.
  • Polynucleotide constructs are made which contain a promoter and targeting sequences, which are homologous to the 5' non-coding sequence of endogenous CK ⁇ - 13, flanking the promoter.
  • the targeting sequence will be sufficiently near the 5' end of CK ⁇ - 13 so the promoter will be operably linked to the endogenous sequence upon homologous recombination.
  • the promoter and the targeting sequences can be amplified using PCR.
  • the amplified promoter contains distinct restriction enzyme sites on the 5' and 3' ends.
  • the 3' end of the first targeting sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5' end of the second targeting sequence contains the same restriction site as the 3' end of the amplified promoter.
  • the amplified promoter and the amplified targeting sequences are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase.
  • the digested promoter and digested targeting sequences are added together in the presence of T4 DNA ligase.
  • the resulting mixture is maintained under conditions appropriate for ligation of the two fragments.
  • the construct is size fractionated on an agarose gel then purified by phenol extraction and ethanol precipitation.
  • the polynucleotide constructs are administered as naked polynucleotides via electroporation.
  • the polynucleotide constructs may also be administered with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, precipitating agents, etc. Such methods of delivery are known in the art.
  • Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in DMEM + 10% fetal calf serum. Exponentially growing or early stationary phase fibroblasts are trypsinized and rinsed from the plastic surface with nutrient medium. An aliquot of the cell suspension is removed for counting, and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is resuspended in 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KC1, 0.7 mM Na 2 HPO 4 , 6 mM dextrose).
  • electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KC1, 0.7 mM Na 2 HPO 4 , 6 mM dextrose).
  • the cells are recentrifuged, the supernatant aspirated, and the cells resuspended in electroporation buffer containing 1 mg/ml acetylated bovine serum albumin.
  • the final cell suspension contains approximately 3X10 6 cells/ml. Electroporation should be performed immediately following resuspension.
  • Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting to the CK ⁇ - 13 locus, plasmid pUC18 (MB1 Fermentas, Amherst, NY) is digested with Hindlll. The CMV promoter is amplified by PCR with an Xbal site on the 5' end and a BamHI site on the 3 'end.
  • Two CK ⁇ - 13 non-coding sequences are amplified via PCR: one CK ⁇ - 13 non-coding sequence CK ⁇ -13 fragment 1) is amplified with a Hindlll site at the 5' end and an Xba site at the 3 'end; the other CK ⁇ - 13 non-coding sequence CK ⁇ - 13 fragment 2) is amplified with a BamHI site at the 5'end and a Hindlll site at the 3 'end.
  • the CMV promoter and CK ⁇ - 13 fragments (1 and 2) are digested with the appropriate enzymes (CMV promoter - Xbal and BamHI; CK ⁇ - 13 fragment 1 - Xbal; CK ⁇ - 13 fragment 2 - BamHI) and ligated together.
  • the resulting ligation product is digested with
  • Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap
  • the final DNA concentration is generally at least 120 ⁇ g/ml.
  • 0.5 ml of the cell suspension (containing approximately 1.5.X10 6 cells) is then added to the cuvette, and the cell suspension and DNA solutions are gently mixed. Electroporation is performed with a Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage are set at 960 ⁇ F and 250-300 V, respectively. As voltage increases, cell survival decreases, but the percentage of surviving cells that stably incorporate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 mSec should be observed.
  • Electroporated cells are maintained at room temperature for approximately 5 min, and the contents of the cuvette are then gently removed with a sterile transfer pipette. The cells are added directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf serum) in a 10 cm dish and incubated at 37 degree C. The following day, the media is aspirated and replaced with 10 ml of fresh media and incubated for a further 16-24 hours.
  • DMEM prewarmed nutrient media
  • the engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.
  • the fibroblasts now produce the protein product.
  • the fibroblasts can then be introduced into a patient as described above.
  • Example 32 Method of Treatment Using Gene Therapy - In Vivo
  • the gene therapy method relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) CK ⁇ - 13 sequences into an animal to increase or decrease the expression of the CK ⁇ - 13 polypeptide.
  • the CK ⁇ - 13 polynucleotide may be operatively linked to a promoter or any other genetic elements necessary for the expression of the CK ⁇ - 13 polypeptide by the target tissue.
  • Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90/1 1092, WO98/1 1779; U.S. Patent NO.
  • the CK ⁇ - 13 polynucleotide constructs may be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and the like).
  • the CK ⁇ - 13 polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.
  • naked polynucleotide DNA or RNA refers to sequences that are free from any delivery vehicle that acts to assist, promote, or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like.
  • the CK ⁇ - 13 polynucleotides may also be delivered in liposome formulations (such as those taught in Feigner P.L. et al. (1995) Ann. NY Acad. Sci. 772126-139 and Abdallah B. et al. (1995) Biol. Cell 85(1)1-7) which can be prepared by methods well known to those skilled in the art.
  • the CK ⁇ - 13 polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication. Any strong promoter known to those skilled in the art can be used for driving the expression of DNA. Unlike other gene therapies techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
  • the CK ⁇ - 13 polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue.
  • Interstitial space of the tissues comprises the intercellular fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone.
  • the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.
  • an effective dosage amount of DNA or RNA will be in the range of from about 0.05 g/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection. The appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues.
  • CK ⁇ -13 polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in the procedure.
  • the dose response effects of injected CK ⁇ - 13 polynucleotide in muscle in vivo is determined as follows. Suitable CK ⁇ - 13 template DNA for production of mRNA coding for CK ⁇ - 13 polypeptide is prepared in accordance with a standard recombinant DNA methodology.
  • the template DNA which may be either circular or linear, is either used as naked DNA or complexed with liposomes.
  • the quadriceps muscles of mice are then injected with various amounts of the template DNA.
  • mice Five to six week old female and male Balb/C mice are anesthetized by intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made on the anterior thigh, and the quadriceps muscle is directly visualized. The CK ⁇ - 13 template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute, approximately 0.5 cm from the distal insertion site of the muscle into the knee and about 0.2 cm deep. A suture is placed over the injection site for future localization, and the skin is closed with stainless steel clips.
  • muscle extracts are prepared by excising the entire quadriceps. Every fifth 15 um cross-section of the individual quadriceps muscles is histochemically stained for CK ⁇ - 13 protein expression.
  • a time course for CK ⁇ - 13 protein expression may be done in a similar fashion except that quadriceps from different mice are harvested at different times.
  • Persistence of CK ⁇ - 13 DNA in muscle following injection may be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. The results of the above experimentation in mice can be use to extrapolate proper dosages and other treatment parameters in humans and other animals using CK ⁇ - 13 naked DNA.
  • Example 33 CK ⁇ -13 Transgenic Animals.
  • the CK ⁇ - 13 polypeptides can also be expressed in transgenic animals.
  • Animals of any species including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate transgenic animals.
  • techniques described herein or otherwise known in the art are used to express polypeptides of the invention in humans, as part of a gene therapy protocol
  • transgene i e , polynucleotides of the invention
  • transgene i e , polynucleotides of the invention
  • Such techniques include, but are not limited to, pronuclear microinjection (Paterson et al , Appl Microbiol Biotechnol 40 691-698 (1994), Carver et al , Biotechnology (NY) 11 1263-1270 (1993), Wright et al , Biotechnology (NY) 9 830-834 (1991), and Hoppe et al , U S Pat No 4,873,191 (1989)), retrovirus mediated gene transfer into germ lines (Van der Putten et al , Proc Natl Acad Sci , USA 82 6148-6152 (1985)), blastocysts or embryos, gene targeting in embryonic stem cells (Thompson et al , Cell 56 313-321 (1989)), electroporation of cells or embryos (Lo, 1983, Mol Cell Biol 3 1803
  • transgenic clones containing polynucleotides of the invention for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells induced to quiescence (Campell et al , Nature 380 64-66 (1996), Wilmut et al , Nature 385 810- 813 (1997))
  • the present invention provides for transgenic animals that carry the transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i e , mosaic animals or chimeric
  • the transgene may be integrated as a single transgene or as multiple copies such as in concatamers, e g , head-to-head tandems or head-to-tail tandems
  • the transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)).
  • the regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. When it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred.
  • vectors containing some nucleotide sequences homologous to the endogenous gene are designed for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous gene.
  • the transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenous gene in only that cell type, by following, for example, the teaching of Gu et al. (Gu et al., Science 265103-106 (1994)).
  • the regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art.
  • the contents of each of the documents recited in this paragraph is herein incorporated by reference in its entirety.
  • any of the CK ⁇ - 13 polypeptides disclosed throughout this application can be used to generate transgenic animals.
  • the DNA encoding the full length CK ⁇ - 13 protein (nucleotides 1-279 of SEQ ID NO1) can be inserted into a vector containing a promoter, such as the actin promoter, which will ubiquitously express the inserted fragment.
  • DNA encoding the full length CK ⁇ - 13 protein can be inserted into a vector using the following primers: A 5' primer containing a BamHI restriction site shown in bold: GCAGCAGGATCCGCCATCATGGCTCGCCTACAGACTGCACTCCTGG (SEQ ID NO: 19) and a 3' primer, containing a Xba restriction site shown in bold: GCAGCATCTAGATCATTGGCTCAGCTTATTGAGAATCATCTTCACCC (SEQ ID NO: 20).
  • other fragments of CK ⁇ -13 can also be inserted into a vector to create transgenics having ubiquitous expression.
  • polynucleotides of the invention can be inserted in a vector which controls tissue specific expression through a tissue specific promoter.
  • a construct having a transferrin promoter would express the CK ⁇ - 13 polypeptide in the liver of transgenic animals. Therefore, DNA encoding the full length CK ⁇ -13 protein (nucleotides 1-279 of SEQ ID NO1) can be inserted into a vector for tissue specific expression using the following primers: A 5' primer containing a BamHI restriction site shown in bold:
  • GCAGCAGGATCCGCCATCATGGCTCGCCTACAGACTGCACTCCTGG (SEQ ID NO: 21) and a 3' primer, containing a Xba restriction site shown in bold: GCAGCATCTAGATCATTGGCTCAGCTTATTGAGAATCATCTTCACCC (SEQ ID NO: 22).
  • the expression of the recombinant gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-expressing tissue may also be evaluated immunocytochemically or immunohistochemically using antibodies specific for the transgene product.
  • founder animals may be bred, inbred, outbred, or crossbred to produce colonies of the particular animal.
  • breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic animals to produce animals homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; and breeding to place the transgene on a distinct background that is appropriate for an experimental model of interest.
  • Transgenic animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of
  • CK ⁇ - 13 polypeptides studying conditions and/or disorders associated with aberrant
  • CK ⁇ - 13 expression and in screening for compounds effective in ameliorating such conditions and/or disorders.
  • Endogenous CK ⁇ - 13 gene expression can also be reduced by inactivating or "knocking out" the CK ⁇ - 13 gene and/or its promoter using targeted homologous recombination.
  • endogenous CK ⁇ - 13 gene expression can also be reduced by inactivating or "knocking out" the CK ⁇ - 13 gene and/or its promoter using targeted homologous recombination.
  • a mutant, non-functional polynucleotide of the invention flanked by DNA homologous to the endogenous polynucleotide sequence (either the coding regions or regulatory regions of the gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express polypeptides of the invention in vivo.
  • techniques known in the art are used to generate knockouts in cells that contain, but do not express the gene of interest. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the targeted gene.
  • cells that are genetically engineered to express the polypeptides of the invention, or alternatively, that are genetically engineered not to express the polypeptides of the invention are administered to a patient in vivo.
  • Such cells may be obtained from the patient (i.e., animal, including human) or an MHC compatible donor and can include, but are not limited to fibroblasts, bone marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle cells, endothelial cells etc.
  • the cells are genetically engineered in vitro using recombinant DNA techniques to introduce the coding sequence of polypeptides of the invention into the cells, or alternatively, to disrupt the coding sequence and/or endogenous regulatory sequence associated with the polypeptides of the invention, e.g.. by transduction (using viral vectors, and preferably vectors that integrate the transgene into the cell genome) or transfection procedures, including, but not limited to, the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc.
  • transduction using viral vectors, and preferably vectors that integrate the transgene into the cell genome
  • transfection procedures including, but not limited to, the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc.
  • the coding sequence of the polypeptides of the invention can be placed under the control of a strong constitutive or inducible promoter or promoter/enhancer to achieve expression, and preferably secretion, of the CK ⁇ - 13 polypeptides.
  • the engineered cells which express and preferably secrete the polypeptides of the invention can be introduced into the patient systemically, e.g., in the circulation, or intraperitoneally.
  • the cells can be incorporated into a matrix and implanted in the body, e.g., genetically engineered fibroblasts can be implanted as part of a skin graft; genetically engineered endothelial cells can be implanted as part of a lymphatic or vascular graft.
  • genetically engineered fibroblasts can be implanted as part of a skin graft
  • genetically engineered endothelial cells can be implanted as part of a lymphatic or vascular graft.
  • the cells to be administered are non-autologous or non-MHC compatible cells, they can be administered using well known techniques which prevent the development of a host immune response against the introduced cells.
  • the cells may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system.
  • Knock-out animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of CK ⁇ -
  • Example 35 Assays Detecting Stimulation or Inhibition of B cell Proliferation and Differentiation
  • TNF- superfamily One of the best studied classes of B-cell co-stimulatory proteins is the TNF- superfamily. Within this family CD40, CD27, and CD30 along with their respective ligands CD 154, CD70, and CD 153 have been found to regulate a variety of immune responses. Assays which allow for the detection and/or observation of the proliferation and differentiation of these B-cell populations and their precursors are valuable tools in determining the effects various proteins may have on these B-cell populations in terms of proliferation and differentiation. Listed below are two assays designed to allow for the detection of the differentiation, proliferation, or inhibition of B-cell populations and their precursors.
  • CK ⁇ - 13 protein is assessed for its ability to induce activation, proliferation, differentiation or inhibition and/or death in B-cell populations and their precursors.
  • the activity of CK ⁇ - 13 protein on purified human tonsillar B cells is assessed in a standard B-lymphocyte co- stimulation assay in which purified tonsillar B cells are cultured in the presence of either formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized anti- human IgM antibody as the priming agent.
  • SAC formalin-fixed Staphylococcus aureus Cowan I
  • Second signals such as EL-2 and EL- 15 synergize with SAC and IgM crosslinking to elicit B cell proliferation as measured by tritiated-thymidine incorporation.
  • Novel synergizing agents can be readily identified using this assay.
  • the assay involves isolating human tonsillar B cells by magnetic bead (MACS) depletion of CD3 -positive cells. The resulting cell population is greater than 95% B cells as assessed by expression of CD45R(B220).
  • Various dilutions of each sample are placed into individual wells of a 96-well plate to which are added 10 5 B-cells suspended in culture medium (RPMI 1640 containing 10% FBS, 5 X 10 "5 M 2ME, lOOU/ml penicillin, lOug/ml streptomycin, and 10 "5 dilution of SAC) in a total volume of 150ul.
  • Proliferation or inhibition is quantitated by a 20h pulse (luCi/well) with 3H-thymidine (6.7 Ci/mM) beginning 72h post factor addition.
  • the positive and negative controls are IL2 and medium respectively.
  • mice are injected (i.p.) twice per day with buffer only, or 2 mg/Kg of CK ⁇ -13 protein, or truncated forms thereof. Mice receive this treatment for 4 consecutive days, at which time they are sacrificed and various tissues and serum collected for analyses.
  • Comparison of H&E sections from normal and CK ⁇ - 13 protein-treated spleens identify the results of the activity of CK ⁇ - 13 protein on spleen cells, such as the diffusion of peri-arterial lymphatic sheaths, and/or significant increases in the nucleated cellularity of the red pulp regions, which may indicate the activation of the differentiation and proliferation of B-cell populations
  • Immunohistochemical studies using a B cell marker, anti-CD45R(B220) are used to determine whether any physiological changes to splenic cells, such as splenic disorganization, are due to increased B-cell representation within loosely defined B- cell zones that infiltrate established T-cell regions
  • Flow cytometric analyses of the spleens from CK ⁇ - 13 protein-treated mice is used to indicate whether CK ⁇ - 13 protein specifically increases the proportion of ThB+, CD45R(B220)dull B cells over that which is observed in control mice
  • a CD3 -induced proliferation assay is performed on PBMCs and is measured by the uptake of 3 H-thymidine
  • the assay is performed as follows
  • Ninety-six well plates are coated with 100 ⁇ l/well of mAb to CD3 (HIT3a, Pharmingen) or isotype- matched control mAb (B33 1) overnight at 4°C (1 ⁇ g/ml in 05M bicarbonate buffer, pH 9 5), then washed three times with PBS PBMC are isolated by F/H gradient centrifugation from human peripheral blood and added to quadruplicate wells (5 x 10 4 /well) of mAb coated plates in RPMI containing 10% FCS and P/S in the presence of varying concentrations of CK ⁇ - 13 protein (total volume 200 ⁇ l) Relevant protein buffer and medium alone are controls After 48 hr culture at 37°C, plates are spun for 2 min at 1000 rpm and 100 ⁇ l of supernatant is removed and stored -20°C
  • Example 37 Effect of CK ⁇ -13 on the Expression of MHC Class II, Costimulatory and Adhesion Molecules and Cell Differentiation of Monocytes and Monocyte-Derived Human Dendritic Cells
  • Dendritic cells Eire generated by the expansion of proliferating precursors found in the peripheral blood: adherent PBMC or elutriated monocytic fractions are cultured for 7-10 days with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells have the characteristic phenotype of immature cells (expression of CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activating factors, such as TNF- ⁇ , causes a rapid change in surface phenotype (increased expression of MHC class I and II, costimulatory and adhesion molecules, downregulation of FC ⁇ RII, upregulation of CD83). These changes correlate with increased antigen-presenting capacity and with functional maturation of the dendritic cells.
  • FACS analysis of surface antigens is performed as follows. Cells are treated 1-3 days with increasing concentrations of CK ⁇ - 13 or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1 :20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4°C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACS can (Becton Dickinson). Effect on the production of cytokines. Cytokines generated by dendritic cells, in particular IL-12, are important in the initiation of T-cell dependent immune responses.
  • EL- 12 strongly influences the development of Thl helper T-cell immune response, and induces cytotoxic T and NK cell function.
  • An ELISA is used to measure the EL- 12 release as follows. Dendritic cells (10 6 /ml) are treated with increasing concentrations of CK ⁇ -13 for 24 hours. LPS (100 ng/ml) is added to the cell culture as positive control. Supernatants from the cell cultures are then collected and analyzed for EL-12 content using commercial ELISA kit (e. g, R & D Systems (Minneapolis, MN)). The standard protocols provided with the kits are used.
  • MHC Class II Effect on the expression of MHC Class II, costimulatory and adhesion molecules.
  • Three major families of cell surface antigens can be identified on monocytes: adhesion molecules, molecules involved in antigen presentation, and Fc receptor. Modulation of the expression of MHC class II antigens and other costimulatory molecules, such as B7 and ICAM-1, may result in changes in the antigen presenting capacity of monocytes and ability to induce T cell activation. Increase expression of Fc receptors may correlate with improved monocyte cytotoxic activity, cytokine release and phagocytosis.
  • FACS analysis is used to examine the surface antigens as follows.
  • Monocytes are treated 1-5 days with increasing concentrations of CK ⁇ -13 or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1 :20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4°C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).
  • Monocyte activation and/or increased survival are examples of monocyte activation and/or increased survival. Assays for molecules that activate (or alternatively, inactivate) monocytes and/or increase monocyte survival
  • CK ⁇ -13, agonists, or antagonists of CK ⁇ - 13 can be screened using the three assays described below.
  • Peripheral blood mononuclear cells PBMC are purified from single donor leukopacks (American Red Cross, Baltimore, MD) by centrifugation through a Histopaque gradient (Sigma). Monocytes are isolated from PBMC by counterflow centrifugal elutriation.
  • Monocyte Survival Assay Human peripheral blood monocytes progressively lose viability when cultured in absence of serum or other stimuli. Their death results from internally regulated process (apoptosis). Addition to the culture of activating factors, such as TNF-alpha dramatically improves cell survival and prevents DNA fragmentation. Propidium iodide (PI) staining is used to measure apoptosis as follows. Monocytes are cultured for 48 hours in polypropylene tubes in serum-free medium (positive control), in the presence of 100 ng/ml TNF-alpha (negative control), and in the presence of varying concentrations of the compound to be tested.
  • PI Propidium iodide
  • Cells are suspended at a concentration of 2 x 10 6 /ml in PBS containing PI at a final concentration of 5 ⁇ g/ml, and then incubaed at room temperature for 5 minutes before FACScan analysis. PI uptake has been demonstrated to correlate with DNA fragmentation in this experimental paradigm.
  • cytokine release An important function of monocytes/macrophages is their regulatory activity on other cellular populations of the immune system through the release of cytokines after stimulation.
  • An ELISA to measure cytokine release is performed as follows. Human monocytes are incubated at a density of 5xl0 5 cells/ml with increasing concentrations of CK ⁇ - 13 and under the same conditions, but in the absence of CK ⁇ -13. For IL-12 production, the cells are primed overnight with IFN (100 U/ml) in presence of CK ⁇ -13. LPS (10 ng/ml) is then added. Conditioned media are collected after 24h and kept frozen until use. Measurement of TNF-alpha, EL- 10, MCP-1 and EL-8 is then performed using a commercially available ELISA kit (e.g, R & D Systems (Minneapolis, MN)) and applying the standard protocols provided with the kit.
  • a commercially available ELISA kit e.g, R & D Systems (Minneapolis
  • Oxidative burst Purified monocytes are plated in 96-w plate at 2-lxl 0 5 cell/well. Increasing concentrations of CK ⁇ - 13 are added to the wells in a total volume of 0.2 ml culture medium (RPMI 1640 + 10% FCS, glutamine and antibiotics). After 3 days incubation, the plates are centrifuged and the medium is removed from the wells. To the macrophage monolayers, 0.2 ml per well of phenol red solution (140 mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the stimulant (200 nM PMA).
  • phenol red solution 140 mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U/ml of HRPO
  • the plates are incubated at 37°C for 2 hours and the reaction is stopped by adding 20 ⁇ l IN NaOH per well.
  • the absorbance is read at 610 nm.
  • a standard curve of a H 2 O 2 solution of known molarity is performed for each experiment. The studies described in this example tested activity in CK ⁇ - 13 protein.
  • Example 38 CK ⁇ -13 Biological Effects Astrocyte and Neuronal Assays.
  • Recombinant CK ⁇ -13 expressed in Escherichia coli and purified as described above, can be tested for activity in promoting the survival, neurite outgrowth, or phenotypic differentiation of cortical neuronal cells and for inducing the proliferation of glial fibrillary acidic protein immunopositive cells, astrocytes.
  • the selection of cortical cells for the bioassay is based on the prevalent expression of FGF-1 and FGF-2 in cortical structures and on the previously reported enhancement of cortical neuronal survival resulting from FGF-2 treatment.
  • a thymidine incorporation assay for example, can be used to elucidate CK ⁇ -13's activity on these cells.
  • FGF-2 basic FGF
  • studies describing the biological effects of FGF-2 (basic FGF) on cortical or hippocampal neurons in vitro have demonstrated increases in both neuron survival and neurite outgrowth (Walicke, P. et al., "Fibroblast growth factor promotes survival of dissociated hippocampal neurons and enhances neurite extension.” Proc. Natl Acad. Sci. USA 53:3012-3016. (1986), assay herein incorporated by reference in its entirety).
  • reports from experiments done on PC- 12 cells suggest that these two responses are not necessarily synonymous and may depend on not only which FGF is being tested but also on which receptor(s) are expressed on the target cells.
  • the ability of CK ⁇ - 13 to induce neurite outgrowth can be compared to the response achieved with FGF-2 using, for example, a thymidine incorporation assay.
  • Human lung fibroblasts are obtained from Clonetics (San Diego, CA) and maintained in growth media from Clonetics.
  • Dermal microvascular endothelial cells are obtained from Cell Applications (San Diego, CA).
  • the human lung fibroblasts and dermal microvascular endothelial cells can be cultured at 5,000 cells/well in a 96-well plate for one day in growth medium. The cells are then incubated for one day in 0.1 % BSA basal medium. After replacing the medium with fresh 0.1 % BSA medium, the cells are incubated with the test proteins for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each well to a final concentration of 10%. The cells are incubated for 4 hr.
  • Cell viability is measured by reading in a CytoFluor fluorescence reader.
  • the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1 % BSA basal medium, the cells are incubated with FGF-2 or CK ⁇ - 13 with or without IL-l ⁇ for 24 hours. The supernatants are collected and assayed for PGE 2 by EIA kit (Cayman, Ann Arbor, MI).
  • EIA kit Cayman, Ann Arbor, MI
  • the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day.
  • the cells After a medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or CK ⁇ - 13 with or without EL-l ⁇ for 24 hours. The supernatants are collected and assayed for EL-6 by ELISA kit (Endogen, Cambridge, MA).
  • Human lung fibroblasts are cultured with FGF-2 or CK ⁇ - 13 for 3 days in basal medium before the addition of Alamar Blue to assess effects on growth of the fibroblasts.
  • FGF-2 should show a stimulation at 10 - 2500 ng/ml which can be used to compare stimulation with CK ⁇ -13.
  • the loss of motor function in Parkinson's disease is attributed to a deficiency of striatal dopamine resulting from the degeneration of the nigrostriatal dopaminergic projection neurons.
  • An animal model for Parkinson's that has been extensively characterized involves the systemic administration of l-methyl-4 phenyl 1,2,3,6- tetrahydropyridine (MPTP).
  • MPTP is taken-up by astrocytes and catabolized by monoamine oxidase B to 1 -methyl-4-phenyl pyridine (MPP + ) and released. Subsequently, MPP + is actively accumulated in dopaminergic neurons by the high-affinity reuptake transporter for dopamine.
  • MPP + is then concentrated in mitochondria by the electrochemical gradient and selectively inhibits nicotidamide adenine disphosphate: ubiquinone oxidoreductionase (complex I), thereby interfering with electron transport and eventually generating oxygen radicals.
  • FGF-2 basic FGF
  • FGF-2 has trophic activity towards nigral dopaminergic neurons
  • Dr. Unsicker's group has demonstrated that administering FGF-2 in gel foam implants in the striatum results in the near complete protection of nigral dopaminergic neurons from the toxicity associated with MPTP exposure (Otto and Unsicker, J. Neuroscience, 1990).
  • CK ⁇ - 13 can be evaluated to determine whether it has an action similar to that of FGF-2 in enhancing dopaminergic neuronal survival in vitro and it can also be tested in vivo for protection of dopaminergic neurons in the striatum from the damage associated with MPTP treatment.
  • the potential effect of CK ⁇ - 13 is first examined in vitro in a dopaminergic neuronal cell culture paradigm. The cultures are prepared by dissecting the midbrain floor plate from gestation day 14 Wistar rat embryos. The tissue is dissociated with trypsin and seeded at a density of 200,000 cells/cm 2 on polyorthinine-laminin coated glass coverslips.
  • the cells are maintained in Dulbecco's Modified Eagle's medium and F12 medium containing hormonal supplements (Nl).
  • the cultures are fixed with paraformaldehyde after 8 days in vitro and are processed for tyrosine hydroxylase, a specific marker for dopminergic neurons, immunohistochemical staining.
  • Dissociated cell cultures are prepared from embryonic rats. The culture medium is changed every third day and the factors are also added at that time. Since the dopaminergic neurons are isolated from animals at gestation day 14, a developmental time which is past the stage when the dopaminergic precursor cells are proliferating, an increase in the number of tyrosine hydroxylase immunopositive neurons would represent an increase in the number of dopaminergic neurons surviving in vitro. Therefore, if CK ⁇ - 13 acts to prolong the survival of dopaminergic neurons, it would suggest that CK ⁇ - 13 may be involved in Parkinson's Disease.
  • Endothelial cell migration assays are performed using a 48 well microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD; Falk, W., et al, J. Immunological Methods 1980;33:239-247).
  • Polyvinylpyrrolidone-free polycarbonate filters with a pore size of 8 um are coated with 0.1%) gelatin for at least 6 hours at room temperature and dried under sterile air.
  • Test substances are diluted to appropriate concentrations in Ml 99 supplemented with 0.25%) bovine serum albumin (BSA), and 25 ul of the final dilution is placed in the lower chamber of the modified Boyden apparatus.
  • BSA bovine serum albumin
  • Subconfluent, early passage (2-6) HUVEC or BMEC cultures are washed and trypsinized for the minimum time required to achieve cell detachment.
  • 2.5 x 10 5 cells suspended in 50 ul Ml 99 containing 1% FBS are seeded in the upper compartment.
  • the apparatus is then incubated for 5 hours at 37°C in a humidified chamber with 5% CO2 to allow cell migration.
  • the filter is removed and the upper side of the filter with the non-migrated cells is scraped with a rubber policeman.
  • the filters are fixed with methanol and stained with a Giemsa solution (Diff-Quick, Baxter, McGraw Park, IL). Migration is quantified by counting cells of three random high-power fields (40x) in each well, and all groups are performed in quadruplicate.
  • the studies described in this example tested activity in CK ⁇ -13 protein.
  • Nitric oxide released by the vascular endothelium is believed to be a mediator of vascular endothelium relaxation.
  • CK ⁇ - 13 activity can be assayed by determining nitric oxide production by endothelial cells in response to CK ⁇ -13.
  • Nitric oxide is measured in 96-well plates of confluent microvascular endothelial cells after 24 hours starvation and a subsequent 4 hr exposure to various levels of a positive control (such as VEGF-1) and CK ⁇ -13. Nitric oxide in the medium is determined by use of the Griess reagent to measure total nitrite after reduction of nitric oxide-derived nitrate by nitrate reductase. The effect of CK ⁇ - 13 on nitric oxide release is examined on HUVEC. Briefly, NO release from cultured HUVEC monolayer is measured with a
  • NO-specific polarographic electrode connected to a NO meter (Iso-NO, World Precision Instruments Inc.) (1049). Calibration of the NO elements is performed according to the following equation:
  • the standard calibration curve is obtained by adding graded concentrations of KNO 2 (0, 5, 10, 25, 50, 100, 250, and 500 nmol/L) into the calibration solution containing KI and H 2 SO 4 .
  • the specificity of the Iso-NO electrode to NO is previously determined by measurement of NO from authentic NO gas (1050). The culture medium is removed and HUVECs are washed twice with Dulbecco's phosphate buffered saline.
  • the cells are then bathed in 5 ml of filtered Krebs- Henseleit solution in 6-well plates, and the cell plates are kept on a slide warmer (Lab Line Instruments Inc.) To maintain the temperature at 37°C.
  • the NO sensor probe is inserted vertically into the wells, keeping the tip of the electrode 2 mm under the surface of the solution, before addition of the different conditions.
  • S-nitroso acetyl penicillamin (SNAP) is used as a positive control.
  • the amount of released NO is expressed as picomoles per lxl 0 6 endothelial cells. All values reported are means of four to six measurements in each group (number of cell culture wells). See, Leak et al. Biochem. and Biophys. Res. Comm. 277:96-105 (1995). The studies described in this example tested activity in CK ⁇ - 13 protein.
  • This animal model shows the effect of CK ⁇ - 13 on neovascularization.
  • the experimental protocol includes: a) Making a 1-1.5 mm long incision from the center of cornea into the stromal layer. b) Inserting a spatula below the lip of the incision facing the outer corner of the eye. c) Making a pocket (its base is 1-1.5 mm form the edge of the eye). d) Positioning a pellet, containing 50ng- 5ug of CK ⁇ -13, within the pocket. e) CK ⁇ - 13 treatment can also be applied topically to the corneal wounds in a dosage range of 20mg - 500mg (daily treatment for five days).
  • the full thickness wound healing model in the db+/db+ mouse is a well characterized, clinically relevant and reproducible model of impaired wound healing.
  • Healing of the diabetic wound is dependent on formation of granulation tissue and re-epithelialization rather than contraction (Gartner, M.H. et al, J. Surg. Res. 52:389 (1992); Greenhalgh, D.G. et al, Am. J. Pathol. 7361235 (1990)).
  • the diabetic animals have many of the characteristic features observed in Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison to their normal heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single autosomal recessive mutation on chromosome 4 (db+) (Coleman et al. Proc. Natl Acad. Sci. USA 77:283-293 (1982)). Animals show polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+) have elevated blood glucose, increased or normal insulin levels, and suppressed cell-mediated immunity (Mandel et al, J. Immunol.
  • mice Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-diabetic (db+/+m) heterozygous littermates are used in this study (Jackson Laboratories). The animals are purchased at 6 weeks of age and are 8 weeks old at the beginning of the study. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. The experiments are conducted according to the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.
  • Wounding protocol is performed according to previously reported methods (Tsuboi, R. and Rifkin, D.B., J. Exp. Med. 772:245-251 (1990)). Briefly, on the day of wounding, animals are anesthetized with an intraperitoneal injection of Avertin (0.01 mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized water. The dorsal region of the animal is shaved and the skin washed with 70% ethanol solution and iodine. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is then created using a Keyes tissue punch.
  • wounds are left open for the duration of the experiment.
  • Application of the treatment is given topically for 5 consecutive days commencing on the day of wounding.
  • wounds are gently cleansed with sterile saline and gauze sponges.
  • Wounds are visually examined and photographed at a fixed distance at the day of surgery and at two day intervals thereafter. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.
  • CK ⁇ -13 is administered using at a range different doses of CK ⁇ -13, from
  • Vehicle control groups received 50mL of vehicle solution.
  • Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested for histology and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.
  • Wound closure is analyzed by measuring the area in the vertical and horizontal axis and obtaining the total square area of the wound. Contraction is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64mm 2 , the corresponding size of the dermal punch. Calculations are made using the following formula:
  • Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned perpendicular to the wound surface (5mm) and cut using a Reichert- Jung microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross- sections of bisected wounds. Histologic examination of the wounds are used to assess whether the healing process and the morphologic appearance of the repaired skin is altered by treatment with CK ⁇ -13. This assessment included verification of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, re- epithelialization and epidermal maturity (Greenhalgh, D.G. et al, Am. J. Pathol. 136:1235 (1990)). A calibrated lens micrometer is used by a blinded observer.
  • Tissue sections are also stained immunohistochemically with a polyclonal rabbit anti-human keratin antibody using ABC Elite detection system. Human skin is used as a positive tissue control while non-immune IgG is used as a negative control.
  • Keratinocyte growth is determined by evaluating the extent of reepithelialization of the wound using a calibrated lens micrometer.
  • PCNA Proliferating cell nuclear antigen/cyclin
  • Human colon cancer can serve as a positive tissue control and human brain tissue can be used as a negative tissue control.
  • Each specimen includes a section with omission of the primary antibody and substitution with non-immune mouse IgG. Ranking of these sections is based on the extent of proliferation on a scale of 0-8, the lower side of the scale reflecting slight proliferation to the higher side reflecting intense proliferation.
  • the wounding protocol is followed according to section A, above.
  • animals are anesthetized with an intramuscular injection of ketamine (50 mg/kg) and xylazine (5 mg/kg).
  • the dorsal region of the animal is shaved and the skin washed with 70% ethanol and iodine solutions.
  • the surgical area is dried with sterile gauze prior to wounding.
  • An 8 mm full-thickness wound is created using a Keyes tissue punch.
  • the wounds are left open for the duration of the experiment.
  • Applications of the testing materials are given topically once a day for 7 consecutive days commencing on the day of wounding and subsequent to methylprednisolone administration.
  • wounds Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges. Wounds are visually examined and photographed at a fixed distance at the day of wounding and at the end of treatment. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.
  • CK ⁇ - 13 is administered using at a range different doses of CK ⁇ - 13, from 4mg to 500mg per wound per day for 8 days in vehicle.
  • Vehicle control groups received 50mL of vehicle solution. Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested for histology. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.
  • Wound closure is analyzed by measuring the area in the vertical and ' horizontal axis and obtaining the total area of the wound. Closure is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64mm 2 , the corresponding size of the dermal punch. Calculations are made using the following formula:
  • Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned perpendicular to the wound surface (5mm) and cut using an Olympus microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross- sections of bisected wounds. Histologic examination of the wounds allows assessment of whether the healing process and the morphologic appearance of the repaired skin is improved by treatment with CK ⁇ -13. A calibrated lens micrometer is used by a blinded observer to determine the distance of the wound gap.
  • lymphedema The purpose of this experimental approach is to create an appropriate and consistent lymphedema model for testing the therapeutic effects of CK ⁇ - 13 in lymphangiogenesis and re-establishment of the lymphatic circulatory system in the rat hind limb. Effectiveness is measured by swelling volume of the affected limb, quantification of the amount of lymphatic vasculature, total blood plasma protein, and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more importantly, the chronic progress of the edema is followed for up to 3-4 weeks.
  • a mid-leg inguinal incision is made circumferentially allowing the femoral vessels to be located. Forceps and hemostats are used to dissect and separate the skin flaps. After locating the femoral vessels, the lymphatic vessel that runs along side and underneath the vessel(s) is located. The main lymphatic vessels in this area are then electrically coagulated or suture ligated. Using a microscope, muscles in back of the leg (near the semitendinosis and adductors) are bluntly dissected. The popliteal lymph node is then located. The 2 proximal and 2 distal lymphatic vessels and distal blood supply of the popliteal node are then and ligated by suturing. The popliteal lymph node, and any accompanying adipose tissue, is then removed by cutting connective tissues.
  • the skin flaps are sealed by using liquid skin (Vetbond) (AJ Buck).
  • Vetbond liquid skin
  • the separated skin edges are sealed to the underlying muscle tissue while leaving a gap of -0.5 cm around the leg.
  • Skin also may be anchored by suturing to underlying muscle when necessary.
  • Recovering animals are checked daily through the optimal edematous peak, which typically occurred by day 5-7. The plateau edematous peak are then observed.
  • the circumference and volumes of 2 designated places on each paw before operation and daily for 7 days are measured.
  • the effect plasma proteins on lymphedema is determined and whether protein analysis is a useful testing perimeter is also investigated.
  • the weights of both control and edematous limbs are evaluated at 2 places. Analysis is performed in a blind manner.
  • Circumference Measurements Under brief gas anesthetic to prevent limb movement, a cloth tape is used to measure limb circumference. Measurements are done at the ankle bone and dorsal paw by 2 different people then those 2 readings are averaged. Readings are taken from both control and edematous limbs.
  • Blood-plasma protein measurements Blood is drawn, spun, and serum separated prior to surgery and then at conclusion for total protein and Ca2+ comparison.
  • Limb Weight Comparison After drawing blood, the animal is prepared for tissue collection. The limbs are amputated using a quillitine, then both experimental and control legs are cut at the ligature and weighed. A second weighing is done as the tibio-cacaneal joint is disarticulated and the foot is weighed. Histological Preparations: The transverse muscle located behind the knee
  • CAMs cell surface adhesion molecules
  • the adhesion process in both normal and pathological settings, follows a multi-step cascade that involves intercellular adhesion molecule- 1 (ICAM-1), vascular cell adhesion molecule- 1 (VCAM-1), and endothelial leukocyte adhesion molecule- 1 (E-selectin) expression on endothelial cells (EC).
  • ICM-1 intercellular adhesion molecule- 1
  • VCAM-1 vascular cell adhesion molecule- 1
  • E-selectin endothelial leukocyte adhesion molecule- 1
  • the expression of these molecules and others on the vascular endothelium determines the efficiency with which leukocytes may adhere to the local vasculature and extravasate into the local tissue during the development of an inflammatory response.
  • the local concentration of cytokines and growth factor participate in the modulation of the expression of these CAMs.
  • Tumor necrosis factor alpha (TNF-a), a potent proinflammatory cytokine, is a stimulator of all three CAMs on endothelial cells and may be involved in a wide variety of inflammatory responses, often resulting in a pathological outcome.
  • a modified ELISA assay which uses ECs as a solid phase absorbent is employed to measure the amount of CAM expression on TNF-a treated ECs when co-stimulated with a member of the FGF family of proteins.
  • human umbilical vein endothelial cell (HUVEC) cultures are obtained from pooled cord harvests and maintained in growth medium (EGM-2; Clonetics, San Diego, CA) supplemented with 10% FCS and 1% penicillin/streptomycin in a 37 degree C humidified incubator containing 5% CO2.
  • HUVECs are seeded in 96-well plates at concentrations of 1 x 104 cells/well in EGM medium at 37 degree C for 18-24 hrs or until confluent.
  • the monolayers are subsequently washed 3 times with a serum-free solution of RPMI- 1640 supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin, and treated with a given cytokine and/or growth factor(s) for 24 h at 37 degree C. Following incubation, the cells are then evaluated for CAM expression.
  • Human Umbilical Vein Endothelial cells are grown in a standard 96 well plate to confluence. Growth medium is removed from the cells and replaced with 90 ul of 199 Medium (10% FBS). Samples for testing and positive or negative controls are added to the plate in triplicate (in 10 ul volumes). Plates are incubated at 37 degree C for either 5 h (selectin and integrin expression) or 24 h (integrin expression only). Plates are aspirated to remove medium and 100 ⁇ l of 0.1 % paraformaldehyde-PBS(with Ca++ and Mg++) is added to each well. Plates are held at 4°C for 30 min.
  • Fixative is then removed from the wells and wells are washed IX with PBS(+Ca,Mg)+0.5% BSA and drained. Do not allow the wells to dry. Add 10 ⁇ l of diluted primary antibody to the test and control wells. Anti-ICAM-1-Biotin, Anti- VCAM-1-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 ⁇ g/ml (1 : 10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at 37°C for 30 min. in a humidified environment. Wells are washed X3 with PBS(+Ca,Mg)+0.5% BSA.
  • Standard wells in triplicate are prepared from the working dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer: 1 :5,000 (10°) > 10 " 0 5 > 10 "1 > 10 "1'5 . 5 ⁇ l of each dilution is added to triplicate wells and the resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100 ⁇ l of pNNP reagent must then be added to each of the standard wells. The plate must be incubated at 37°C for 4h. A volume of 50 ⁇ l of 3M NaOH is added to all wells. The results are quantified on a plate reader at 405 nm.
  • the background subtraction option is used on blank wells filled with glycine buffer only.
  • the template is set up to indicate the concentration of AP-conjugate in each standard well [ 5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. Results are indicated as amount of bound AP-conjugate in each sample.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Genetics & Genomics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • Zoology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

The present invention relates to a novel CKβ-13 protein which is a member of the chemokine family. In particular, isolated nucleic acid molecules are provided encoding the human CKβ-13 protein. CKβ-13 polypeptides are also provided as are vectors, host cells and recombinant methods for producing the same. The invention further relates to screening methods for identifying agonists and antagonists of CKβ-13 activity. Also provided are diagnostic methods for detecting immune system-related disorders and therapeutic methods for treating immune system-related disorders.

Description

Human Chemokine Beta-13
Field of the Invention The present invention relates to a novel human gene encoding a polypeptide which is a member of the chemokine family. More specifically, isolated nucleic acid molecules are provided encoding a human polypeptide named Human Chemokine Beta-13, hereinafter referred to as "CKβ-13." Polypeptides are also provided, as are vectors, host cells and recombinant methods for producing the same. Also provided are diagnostic methods for detecting disorders related to the immune system, and therapeutic methods for treating such disorders. The invention further relates to screening methods for identifying agonists and antagonists of CKβ-13 activity.
Background of the Invention
Chemokines, also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-10 kd in size. In general, chemokines exhibit 20% to 75% homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C-X-C" subfamily. In the beta subfamily, the two cysteines are in an adjacent position and are, therefore, referred to as the "C-C" subfamily. Thus far, at least nine different members of this family have been identified in humans.
The intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils, and fibroblasts. Many chemokines have proinflammatory activity and are involved in multiple types during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enchanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvment in inflammation, certain chemokines have been shown to exhibit other activities. For example, macrophage inflammatory protein- 1 (MUM) is able to suppress hematopoietic stem cell proliferation, platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell growth, interleukin-8 (IL-8) promotes proliferation of keratinocytes, and GRO is an autocrine growth factor for melanoma cells. In light of the diverse biological activities, it is not surprising that chemokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.
Members of the "C-C" branch exert their effects on the following cells: eosinophils which destroy parasites to lessen parasitic infection and cause chronic inflammation in the airways of the respiratory system; monocytes and macrophages which suppress tumor formation in vertebrates; T lymphocytes which attract T cells and basophils which release histamine which plays a role in allergic inflammation.
While members of the C-C branch act predominately on mononuclear cells and members of the C-X-C branch act predominantly on neutorphils a distinct chemoattractant property cannot be assigned to a chemokine based on this guideline. Some chemokines from one family show characteristics of the other.
The polypeptide of the present invention has the conserved cysteine "C-C" region, and has amino acid sequence homology to other known chemokines.
Summary of the Invention
The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding at least a portion of the CKβ-13 polypeptide having the complete amino acid sequence shown in SEQ ID NO: 2 or the complete amino acid sequence encoded by the cDNA clone deposited in a bacterial host as ATCC Deposit Number 97113 on April 28, 1995. The nucleotide sequence determined by sequencing the deposited CKβ-13 clone, which is shown in Figure 1 (SEQ ID NO: l), contains an open reading frame encoding a complete polypeptide of 93 amino acid residues, including an initiation codon encoding an N-terminal methionine at nucleotide positions 1-3 .
The polypeptide of the present invention has amino acid sequence homology to known chemokines, including the conserved cysteine pattern characteristic of the beta subfamily of chemokines beginning with the first cysteine from the amino terminus in SEQ ED NO:2. The encoded polypeptide has two observed leader sequences of 24 and 28 amino acids; and the amino acid sequence of the observed mature CKβ-13 proteins are also shown in Figure 1 (SEQ ID NO:2), as amino acid residues 25-93 and 29-93.
Thus, one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding the CKβ-13 polypeptide having the complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the observed mature CKβ-13 polypeptide having the amino acid sequence at positions 25-93 in SEQ ID NO:2; (c) a nucleotide sequence encoding the observed mature CKβ-13 polypeptide having the amino acid sequence at positions 29-93 in SEQ ID NO:2; (d) a nucleotide sequence encoding the CKβ-13 polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113; (e) a nucleotide sequence encoding a mature CKβ-13 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113; and (f) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d) or (e) above.
An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which comprises the amino acid sequence of an epitope-bearing portion of a CKβ-13 polypeptide having an amino acid sequence described in (a), (b), (c), (d) or (e), above. Peptides or polypeptides having the amino acid sequence of an epitope-bearing portion of a CKβ-13 polypeptide of the invention include portions of such polypeptides with at least six or seven, preferably at least nine, and more preferably at least about 30 amino acids to about 50 amino acids, although epitope-bearing polypeptides of any length up to and including the entire amino acid sequence of a polypeptide of the invention described above also are included in the invention.
In another embodiment, the invention provides an isolated antibody that binds specifically to a CKβ-13 polypeptide having an amino acid sequence described in (a), (b), (c), (d) or (e) above. The invention further provides methods for isolating antibodies that bind specifically to a CKβ-13 polypeptide having an amino acid sequence as described herein. Such antibodies are useful diagnostically or therapeutically as described below.
The invention also provides for pharmaceutical compositions comprising CKβ-13 polypeptides, particularly human CKβ-13 polypeptides, which may be employed, for instance, to treat solid tumors, chronic infections, leukemia, T-cell mediated auto-immune diseases, parasistic infections, psoriasis, to regulate hematopoiesis, to stimulate growth factor activity, to treat fibrotic disorders, to inhibit angiogenesis and to promote wound healing. CKβ-13 may also be employed to treat sepsis and is useful for immune enhancement or suppression, myeloprotection, and acute and chronic inflammatory control.
Methods of treating individuals in need CKβ-13 polypeptides are also provided.
The invention further provides compositions comprising a CKβ-13 polynucleotide or a CKβ-13 polypeptide for administration to cells in vitro, to cells ex vivo and to cells in vivo, or to a multicellular organism. In certain particularly preferred embodiments of this aspect of the invention, the compositions comprise a CKβ-13 polynucleotide for expression of a CKβ-13 polypeptide in a host organism for treatment of disease. Particularly preferred in this regard is expression in a human patient for treatment of a dysfunction associated with aberrant endogenous activity of a CKβ-13.
In another aspect, a screening assay for agonists and antagonists is provided which involves determining the effect a candidate compound has on CKβ-13 binding to a CKβ-13 receptor. In particular, the method involves contacting the CKβ-13 receptor with a CKβ-13 polypeptide and a candidate compound and determining whether CKβ-13 polypeptide binding to the CKβ-13 is increased or decreased due to the presence of the candidate compound. In this assay, an increase in binding of CKβ-13 over the standard binding indicates that the candidate compound is an agonist of CKβ-13 binding activity and a decrease in CKβ-13 binding compared to the standard indicates that the compound is an antagonist of CKβ-13 binding activity.
It has been discovered that CKβ-13 is expressed not only in monocytes but also in activated dendritic cells. For a number of disorders of these tissues or cells, particularly of the immune system, significantly higher or lower levels of CKβ-13 gene expression may be detected in certain tissues (e.g., cancerous and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" CKβ-13 gene expression level, i.e., the CKβ-13 expression level in healthy tissue from an individual not having the immune system disorder. Thus, the invention provides a diagnostic method useful during diagnosis of such a disorder, which involves: (a) assaying CKβ-13 gene expression level in cells or body fluid of an individual; (b) comparing the CKβ-13 gene expression level with a standard CKβ-13 gene expression level, whereby an increase or decrease in the assayed CKβ-13 gene expression level compared to the standard expression level is indicative of disorder in the immune.
An additional aspect of the invention is related to a method for treating an individual in need of an increased level of CKβ-13 activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated CKβ-13 polypeptide of the invention or an agonist thereof.
A still further aspect of the invention is related to a method for treating an individual in need of a decreased level of CKβ-13 activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of an CKβ-13 antagonist. Preferred antagonists for use in the present invention are CKβ- 13 -specific antibodies.
Brief Description of the Figures Figure 1 shows the nucleotide sequence (SEQ ID NO: l) and deduced amino acid sequence (SEQ ID NO:2) of CKβ-13.
Figure 2 shows the regions of identity between the amino acid sequences of the CKβ- 13 protein and translation product of the human mRNA for monocyte chemotactic protein-l (MTP-lα) (lower line) (SEQ ID NO:3), determined by the computer program Bestfit (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, 575 Science Drive, Madison, WI 53711) using the default parameters.
Figure 3 shows an analysis of the CKβ- 13 amino acid sequence. Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings. In the "Antigenic Index or Jameson-Wolf graph, the positive peaks indicate locations of the highly antigenic regions of the CKβ- 13 protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained. The domains defined by these graphs are contemplated by the present invention.
The data presented in Figure 3 are also represented in tabular form in Table I. The columns are labeled with the headings "Res", "Position", and Roman Numerals I-XIV. The column headings refer to the following features of the amino acid sequence presented in Figure 3, and Table I: "Res": amino acid residue of SEQ ED NO:2 and Figure 1; "Position": position of the corresponding residue within SEQ ID NO:2 and Figure 1; 1: Alpha, Regions - Garnier-Robson; II: Alpha, Regions - Chou-Fasman; III: Beta, Regions - Garnier-Robson; IV: Beta, Regions - Chou-Fasman; V: Turn, Regions - Garnier-Robson; VI: Turn, Regions - Chou-Fasman; VII: Coil, Regions - Garnier-Robson; VIII: Hydrophilicity Plot - Kyte-Doolittle; IX: Hydrophobicity Plot - Hopp-Woods; X: Alpha, Amphipathic Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg; XII: Flexible Regions - Karplus-Schulz; XIII: Antigenic Index - Jameson-Wolf; and XIV: Surface Probability Plot - Emini. Figure 4 shows the chemotactic activity of CKβ- 13 on activated T- lymphocytes taken from 3 donors.
Figure 5 shows the effect of CKβ- 13 on VLA4-VCAM-1 interactions of
CD4+ T cell subsets under flow. The top panel shows the increased accumulation of naive T cells with increasing levels of CKβ- 13 compared to accumulation in media alone. The bottom panel shows a decreased memory T cell accumulation under identical conditions.
Figure 6 shows the effect of CKβ- 13 co-immobilized with VCAM-1 on T cell subsets.
Figure 7 shows the effect of CKβ- 13 on CD4+ T cell subset accumulation on (A) VCAM- 1 -transduced or (B) TNF-α activated HUVEC monolayers under flow.
Figure 8 shows the effect of mAb to the CKβ- 13 receptor, CCR4, on T cell subset interactions with VCAM-1.
Detailed Description
The present invention provides isolated nucleic acid molecules comprising a polynucleotide encoding a CKβ- 13 polypeptide having the amino acid sequence shown in SEQ ID NO: 2, which was determined by sequencing a cloned cDNA. The nucleotide sequence shown in Figure 1 (SEQ ID NO: l) was obtained by sequencing the HMSDB49 clone, which was deposited on April 28, 1995 at the American Type Culture Collection, located at 10801 University Boulevard, Manassas, VA 201 10- 2209, USA, and given accession number ATCC 97113. The deposited clone is contained in the pBluescript SK(-) plasmid (Stratagene, La Jolla, CA).
In the present invention, "isolated" refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide or nucleic acid could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide. The term "isolated" does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
As used herein, a CKβ- 13 "polynucleotide" refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: l or the cDNA contained within the clone deposited with the ATCC. For example, the CKβ- 13 polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence. Moreover, as used herein, a CKβ-13 "polypeptide" refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
The polypeptide of the present invention has amino acid sequence homology to known chemokines, including the conserved cysteine pattern characteristic of the beta subfamily of chemokines beginning with the first cysteine from the amino terminus in SEQ ID NO:2. Nucleic Acid Molecules
Unless otherwise indicated, all nucleotide sequences determined by sequencing a DNA molecule herein were determined using an automated DNA sequencer (such as the Model 373 from Applied Biosystems, Inc., Foster City, CA), and all amino acid sequences of polypeptides encoded by DNA molecules determined herein were predicted by translation of a DNA sequence determined as above. Therefore, as is known in the art for any DNA sequence determined by this automated approach, any nucleotide sequence determined herein may contain some errors. Nucleotide sequences determined by automation are typically at least about 90% identical, more typically at least about 95% to at least about 99.9% identical to the actual nucleotide sequence of the sequenced DNA molecule. The actual sequence can be more precisely determined by other approaches including manual DNA sequencing methods well known in the art. As is also known in the art, a single insertion or deletion in a determined nucleotide sequence compared to the actual sequence will cause a frame shift in translation of the nucleotide sequence such that the predicted amino acid sequence encoded by a determined nucleotide sequence will be completely different from the amino acid sequence actually encoded by the sequenced DNA molecule, beginning at the point of such an insertion or deletion. By "nucleotide sequence" of a nucleic acid molecule or polynucleotide is intended, for a DNA molecule or polynucleotide, a sequence of deoxyribonucleotides, and for an RNA molecule or polynucleotide, the corresponding sequence of ribonucleotides (A, G, C and U), where each thymidine deoxyribonucleotide (T) in the specified deoxyribonucleotide sequence is replaced by the ribonucleotide uridine (U).
Using the information provided herein, such as the nucleotide sequence in Figure 1 (SEQ ID NO: l), a nucleic acid molecule of the present invention encoding a CKβ- 13 polypeptide may be obtained using standard cloning and screening procedures, such as those for cloning cDNAs using mRNA as starting material. Illustrative of the invention, the nucleic acid molecule described in Figure 1 (SEQ ID NO: 1) was discovered in a cDNA library derived from human monocytes.
Additional clones of the same gene were also identified in cDNA libraries from activated dendritic cells. The determined nucleotide sequence of the CKβ- 13 cDNA of Figure 1 (SEQ
ID NO: l) contains an open reading frame encoding a protein of 93 amino acid residues, with an initiation codon at nucleotide positions 1-3 of the nucleotide sequence in Figure 1 (SEQ ID NO: l). The amino acid sequence of the CKβ- 13 protein shown in SEQ ID NO:2 is about 33% identical to and 53% similar to human mRNA for MIP- 1 α (Figure 2) .
As one of ordinary skill would appreciate, due to the possibilities of sequencing errors discussed above, the actual complete CKβ- 13 polypeptide encoded by the deposited cDNA, which comprises about 93 amino acids, may be somewhat longer or shorter. More generally, the actual open reading frame may be anywhere in the range of ±20 amino acids, more likely in the range of ±10 amino acids, of that predicted from the first methionine codon from the N-terminus shown in Figure 1 (SEQ ID NO: 1).
Leader and Mature Sequences The amino acid sequence of the complete CKβ- 13 protein is shown in SEQ
ID NO:2 and includes leader sequences and mature protein(s), as described below. More in particular, the present invention provides nucleic acid molecules encoding a mature form of the CKβ- 13 protein. Thus, according to the signal hypothesis, once export of the growing protein chain across the rough endoplasmic reticulum has been initiated, proteins secreted by mammalian cells have a signal or secretory leader sequence which is cleaved from the complete polypeptide to produce a secreted "mature" form of the protein. Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein. Further, it has long been known that the cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide. Therefore, the present invention provides a nucleotide sequence encoding the mature CKβ- 13 polypeptide having the amino acid sequence encoded by the cDNA clone contained in the host identified as ATCC Deposit No. 971 13. By the "mature CKβ- 13 polypeptide having the amino acid sequence encoded by the cDNA clone in ATCC Deposit No. 97113" is meant the mature form(s) of the CKβ- 13 protein produced by expression in a mammalian cell (e.g., COS cells, as described below) of the complete open reading frame encoded by the human DNA sequence of the clone contained in the vector in the deposited host.
In the present case, the deposited cDNA has been expressed in a baculovirus vector in insect cells as described herein below, and amino acid sequencing of the amino terminus of the two secreted species indicated that the mature CKβ- 13 proteins comprise amino acids 25 to 93 and 29 to 93 of SEQ ID NO:2. Thus, the leader sequences of the CKβ- 13 protein in the amino acid sequence of SEQ ID NO:2 are 24 and 28 amino acids, respectively.
In addition, methods for predicting whether a protein has a secretory leader as well as the cleavage point for that leader sequence are available. For instance, the method of McGeoch (Virus Res. 3:271-286 (1985)) uses the information from a short N-terminal charged region and a subsequent uncharged region of the complete (uncleaved) protein. The method of von Heinje (Nucleic Acids Res. 74:4683-4690 (1986)) uses the information from the residues surrounding the cleavage site, typically residues -13 to +2 where +1 indicates the amino terminus of the mature protein. The accuracy of predicting the cleavage points of known mammalian secretory proteins for each of these methods is in the range of 75-80% (von Heinje, supra). However, the two methods do not always produce the same predicted cleavage point(s) for a given protein.
As one of ordinary skill would appreciate from the above discussions, due to the possibilities of sequencing errors as well as the variability of cleavage sites in different known proteins, the two mature CKβ-13 polypeptide species encoded by the deposited cDNA are expected to consist of about 65 and 69 amino acids, but may consist of any number of amino acids in the range of about 58-73 amino acids; and the actual leader sequences of this protein are expected to be 24 and 28 amino acids, but may consist of any number of amino acids in the range of 20-35 amino acids. As indicated, nucleic acid molecules of the present invention may be in the form of RNA, such as mRNA, or in the form of DNA, including, for instance, cDNA and genomic DNA obtained by cloning or produced synthetically. The DNA may be double-stranded or single-stranded. Single- stranded DNA or RNA may be the coding strand, also known as the sense strand, or it may be the non-coding strand, also referred to as the anti-sense strand.
By "isolated" nucleic acid molecule(s) is intended a nucleic acid molecule, DNA or RNA, which has been removed from its native environment For example, recombinant DNA molecules contained in a vector are considered isolated for the purposes of the present invention. Further examples of isolated DNA molecules include recombinant DNA molecules maintained in heterologous host cells or purified (partially or substantially) DNA molecules in solution. Isolated RNA molecules include in vivo or in vitro RNA transcripts of the DNA molecules of the present invention. Isolated nucleic acid molecules according to the present invention further include such molecules produced synthetically. Isolated nucleic acid molecules of the present invention include DNA molecules comprising an open reading frame (ORF) with an initiation codon at positions 1-3 of the nucleotide sequence shown in Figure 1 (SEQ ID NO: l).
Also included are DNA molecules comprising the coding sequence for the observed mature CKβ- 13 protein. In addition, isolated nucleic acid molecules of the invention include DNA molecules which comprise a sequence substantially different from those described above but which, due to the degeneracy of the genetic code, still encode the CKβ- 13 protein. Of course, the genetic code and species-specific codon preferences are well known in the art. Thus, it would be routine for one skilled in the art to generate the degenerate variants described above, for instance, to optimize codon expression for a particular host (e.g., change codons in the human mRNA to those preferred by a bacterial host such as E. coli).
In another aspect, the invention provides isolated nucleic acid molecules encoding the CKβ- 13 polypeptide having an amino acid sequence encoded by the cDNA clone contained in the plasmid deposited as ATCC Deposit No. 97113 on
April 28, 1995. Preferably, this nucleic acid molecule will encode the mature polypeptide encoded by the above-described deposited cDNA clone.
The invention further provides an isolated nucleic acid molecule having the nucleotide sequence shown in Figure 1 (SΕQ ID NO: l) or the nucleotide sequence of the CKβ- 13 cDNA contained in the above-described deposited clone, or a nucleic acid molecule having a sequence complementary to one of the above sequences. Such isolated molecules, particularly DNA molecules, are useful as probes for gene mapping, by in situ hybridization with chromosomes, and for detecting expression of the CKβ- 13 gene in human tissue, for instance, by Northern blot analysis. The present invention is further directed to nucleic acid molecules encoding portions of the nucleotide sequences described herein as well as to fragments of the isolated nucleic acid molecules described herein. In particular, the invention provides a polynucleotide comprising nucleotides 1 to 279 of SΕQ ID NO:2.
More generally, by a fragment of an isolated nucleic acid molecule having the nucleotide sequence of the deposited cDNA or the nucleotide sequence shown in Figure 1 (SΕQ ID NO: l) is intended fragments at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt in length which are useful as diagnostic probes and primers as discussed herein. Of course, larger fragments 50-300 nt in length are also useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequence of the deposited cDNA or as shown in Figure 1 (SΕQ ΕD NO: l). By a fragment at least 20 nt in length, for example, is intended fragments which include 20 or more contiguous bases from the nucleotide sequence of the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SΕQ ID NO: l). Preferred nucleic acid fragments of the present invention include nucleic acid molecules encoding epitope-bearing portions of the CKβ- 13 polypeptide as identified in Figure 3 and described in more detail below.
In another aspect, the invention provides an isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a portion of the polynucleotide in a nucleic acid molecule of the invention described above, for instance, the cDNA clone contained in ATCC Deposit No. 97113. By "stringent hybridization conditions" is intended overnight incubation at 42° C in a solution comprising: 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in 0. lx SSC at about 65° C.
By a polynucleotide which hybridizes to a "portion" of a polynucleotide is intended a polynucleotide (either DNA or RNA) hybridizing to at least about 15 nucleotides (nt), and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably about 30-70 (e.g., 50) nt of the reference polynucleotide. These are useful as diagnostic probes and primers as discussed above and in more detail below.
By a portion of a polynucleotide of "at least 20 nt in length," for example, is intended 20 or more contiguous nucleotides from the nucleotide sequence of the reference polynucleotide (e.g., the deposited cDNA or the nucleotide sequence as shown in Figure 1 (SEQ ID NO: l)). Of course, a polynucleotide which hybridizes only to a poly A sequence (such as the 3' terminal poly(A) tract of the CKβ- 13 cDNA shown in Figure 1 (SEQ ID NO: l)), or to a complementary stretch of T (or U) residues, would not be included in a polynucleotide of the invention used to hybridize to a portion of a nucleic acid of the invention, since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone).
As indicated, nucleic acid molecules of the present invention which encode a CKβ- 13 polypeptide may include, but are not limited to those encoding the amino acid sequence of the mature polypeptide, by itself; the coding sequence for the mature polypeptide and additional sequences, such as those encoding the about 20-35 amino acid leader or secretory sequence, such as a pre-, or pro- or prepro- protein sequence; and/or the coding sequence of the mature polypeptide, with or without the aforementioned additional coding sequences. Also encoded by nucleic acids of the invention are the above protein sequences together with additional, non-coding sequences, including for example, but not limited to introns and non-coding 5' and 3' sequences, such as the transcribed, non-translated sequences that play a role in transcription, mRNA processing, including splicing and polyadenylation signals, for example - ribosome binding and stability of mRNA; and an additional coding sequence which codes for additional amino acids, such as those which provide additional functionalities.
Thus, the sequence encoding the polypeptide may be fused to a marker sequence, such as a sequence encoding a peptide which facilitates purification of the fused polypeptide. In certain preferred embodiments of this aspect of the invention, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et ai, Proc. Natl. Acad. Sci. USA 86: 821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. The "HA" tag is another peptide useful for purification which corresponds to an epitope derived from the influenza hemagglutinin protein, which has been described by Wilson et al, Cell 37: 767 (1984). As discussed below, other such fusion proteins include the CKβ- 13 fused to Fc at the N- or C-terminus.
Variant and Mutant Polynucleotides
The present invention is also directed to polynucleotide fragments of the polynucleotides of the invention. In the present invention, a "polynucleotide fragment" refers to a short polynucleotide having a nucleic acid sequence which: is a portion of that contained in a deposited clone, or encodes the polypeptide encoded by the cDNA in a deposited clone; is a portion of that shown in SEQ ID NO: 1 or the complementary strand thereto, or is a portion of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:2. The nucleotide fragments of the invention are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length. A fragment "at least 20 nt in length," for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in a deposited clone or the nucleotide sequence shown in SEQ ID NO: l. In this context "about" includes the particularly recited value, a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. These nucleotide fragments have uses that include, but are not limited to, as diagnostic probes and primers as discussed herein.
Of course, larger fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred.
Moreover, representative examples of polynucleotide fragments of the invention, include, for example, fragments comprising, or alternatively consisting of, a sequence from about nucleotide number, 1-48, 48-72, 48-84, 72-105, 84-105, 106- 144, 145-192, 193-228, 229-279, and 280 to the end of SEQ ID NO: l, or the complementary strand thereto, or the cDNA contained in the deposited clone. In this context "about" includes the particularly recited ranges, and ranges larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. Preferably, these fragments encode a polypeptide which has biological activity. More preferably, these polynucleotides can be used as probes or primers as discussed herein. Polynucleotides which hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides. The present invention further relates to variants of the nucleic acid molecules of the present invention, which encode portions, analogs or derivatives of the CKβ- 13 protein. Variants may occur naturally, such as a natural allelic variant. By an "allelic variant" is intended one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985). Non-naturally occurring variants may be produced using art-known mutagenesis techniques.
Such variants include those produced by nucleotide substitutions, deletions or additions. The substitutions, deletions or additions may involve one or more nucleotides. The variants may be altered in coding regions, non-coding regions, or both. Alterations in the coding regions may produce conservative or non-conservative amino acid substitutions, deletions or additions. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the CKβ- 13 protein or portions thereof. Also especially preferred in this regard are conservative substitutions.
Most highly preferred are nucleic acid molecules encoding the mature protein having the amino acid sequence described above or the mature CKβ- 13 amino acid sequence encoded by the deposited cDNA clone.
Further embodiments include an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical to a polynucleotide selected from the group consisting of: (a) a nucleotide sequence encoding the CKβ- 13 polypeptide having the complete amino acid sequence in SEQ ID NO:2; (b) a nucleotide sequence encoding the observed mature CKβ- 13 polypeptide having the amino acid sequence at positions 25 to 93 of SEQ ED NO:2; (c) a nucleotide sequence encoding the observed mature CKβ- 13 polypeptide having the amino acid sequence at positions 29 to 93 of SEQ ED NO:2; (d) a nucleotide sequence encoding the CKβ- 13 polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113; (e) a nucleotide sequence encoding a mature CKβ- 13 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113; and (f) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d) or (e) above.
Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% identical, and more preferably at least 95%, 96%, 97%, 98% or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e) or (f), above. This polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues. An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a CKβ-13 polypeptide having an amino acid sequence in (a), (b), (c), (d) or (e), above. The present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells and for using them for production of CKβ- 13 polypeptides or peptides by recombinant techniques. By a nucleic acid having a nucleotide sequence at least, for example, 95%
"identical" to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the CKβ- 13 polypeptide. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95%ι identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence shown of SEQ ED NO:l, the ORF (open reading frame), or any fragment specified as described herein.
As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the present invention can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.) In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identiy are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the lenght of the subject nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence because of 5' or 3' deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5' and 3' truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5' or 3' ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases represent 10%) of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
The present application is directed to nucleic acid molecules at least 90%, 95%o, 96%), 97%, 98%) or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ID NO: l) or to the nucleic acid sequence of the deposited cDNA, irrespective of whether they encode a polypeptide having CKβ- 13 activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having CKβ- 13 activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having CKβ-13 activity include, inter alia, (1) isolating the CKβ- 13 gene or allelic variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the CKβ- 13 gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon Press, New York (1988); and Northern Blot analysis for detecting CKβ- 13 mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least 90%, 95%, 96%), 97%, 98% or 99% identical to the nucleic acid sequence shown in Figure 1 (SEQ ED NO:l) or to the nucleic acid sequence of the deposited cDNA which do, in fact, encode a polypeptide having CKβ-13 protein activity. By "a polypeptide having CKβ- 13 activity" is intended polypeptides exhibiting activity similar, but not necessarily identical, to an activity of the mature protein of the invention, as measured in a particular biological assay. For example, the CKβ-13 protein of the present invention modulates the leukocyte-endothelial cell interactions of T cell subsets.
Treatment of CD4+ T cells with CKβ- 13 polynucleotides or polypeptides, strongly modulates the VLA-4 integrin interaction with its endothelial cell ligand VCAM-1. Thus, CKβ- 13 polynucleotides or polypeptides of the invention may be used to modulate leukocyte-endothelial cell interactions either positively or negatively, and regulate leukocyte trafficking in the peripheral vasculature. CKβ- 13 polynucleotides or polypeptides may be used to negatively regulate memory T cell adhesive interactions on VCAM-1. Thus, CKβ- 13 polynucleotides or polypeptides may be used to negatively regulate memory T cell recruitment to inflammatory sites where VCAM-1 is abundantly expressed on chronic activated vascular epithelium. Alternatively, CKβ- 13 polynucleotides or polypeptides may be used to positively regulate naive T cell adhesive interations on VCAM-1 (See, e.g., Example 6).
Additionally, the CKβ- 13 protein of the present invention is chemotactic for activated T-lymphocytes in the assay described in Example 5. CKβ- 13 protein is chemotactic in a dose-dependent manner for activated T-lymphocytes in the above- described assay. Thus, "a polypeptide having CKβ- 13 protein activity" includes polypeptides that also exhibit any of the same activities in the above-described assays in a dose-dependent manner. Although the degree of dose-dependent activity need not be identical to that of the CKβ- 13 protein, preferably, "a polypeptide having CKβ- 13 protein activity" will exhibit substantially similar dose-dependence in a given activity as compared to the CKβ-13 protein (i.e., the candidate polypeptide will exhibit greater activity or not more than about 25-fold less and, preferably, not more than about tenfold less activity relative to the reference CKβ- 13 protein).
Like other CC chemokines, CKβ- 13 exhibits activity on leukocytes with a strong activity on T-lymphocytes which have been activiated by cross-linking of the CD3 receptor in the presence of IL-2. For this reason CKβ-13 is active in directing the proliferation, differentiation and migration of these cell types. Such activity is useful for immune enhancement or suppression, myeloprotection, stem cell mobilization, acute and chronic inflammatory control and treatment of leukemia. However, unlike other known CC chemokines CKβ- 13 has been shown to be expressed only in an activated monocyte and dendritic cell cDNA library. These two cell types combined make up the majority of the anitigen presenting cells (APCs). Dendritic cells (DCs) and monocytes are professional APCs which are critical for the proper response of the host and are responsible for primary antigen-specific immune reactions. APCs play a crucial role in the presentation of antigens to both T- lymphocytes and B-lymphocytes to initiate the immune response, including for example, antigen trapping and processing, viral trapping, filtering and processing. APCs are normally found in the lymph node, spleen, thymus, skin and circulate throughout the body. When found in the skin, DCs are refered to as Langerhans cells. Follicular dendritic cells reside in the germinal centers of the lymph node. Because CKβ- 13 is produced by these cells, CKβ- 13 is active in modulating the activities of both monocytes and dendritic cells as well as the cells with which these APCs interact. In addition, CKβ- 13 has effects on the local resident cells in which APCs normally reside such as the skin, thymus, spleen, and lymph node. CKβ- 13 regulates the proliferation and maturation of DCs and is monitored in a proliferation differentiation assay such as those reviewed by Peters et al. (1996) Immun. Today 17:273 and described by Young et al. (1995) J. Exp. Med. 182: 11 1 1; Caux et al. (1992) Nαtwre 360:258; and Santigo-Schwarz et al. (1995) Adv. Exp. Med. Biol. 378:7. Representative cell lines could also be employed in such assays. CKβ-13 also influences the effector function of DCs and monocytes. That is, CKβ- 13 enhaces the capacity of DCs and monocytes to take up virus, bacteria or other foreign substances, process them and present them to the lymphocytes responsible for immune responses. CKβ- 13 also modulates the interaction of DCs and monocytes with T-lymphocytes and B-lymphocytes. For instance, CKβ- 13 provides a costimulation signal during antigen presentation which directs the responding cell to survive, proliferate, differentiate, secrete additional cytokines or soluble mediators, or selectively removes the responding cell by inducing apoptosis or other mechanisms of cell death Since DCs and monocytes have been shown to facilitate the transfer of HIV to CD4+ T-lymphocytes CKβ- 13 also influences this ability and prevents infection of lymphocytes by HIV or other viruses mediated through monocytes or DCs This is also true for the intital infection of monocytes and DCs by such viruses Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA or the nucleic acid sequence shown in Figure 1 (SEQ ID NO 1) will encode a polypeptide "having CKβ- 13 protein activity " In fact, since degenerate variants of these nucleotide sequences all encode the same polypeptide, this will be clear to the skilled artisan even without performing the above described comparison assay It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having CKβ- 13 protein activity This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e g , replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below
Vectors and Host Cells
The present invention also relates to vectors which include the isolated DNA molecules of the present invention, host cells which are genetically engineered with the recombinant vectors, and the production of CKβ- 13 polypeptides or fragments thereof by recombinant techniques The vector may be, for example, a phage, plasmid, viral or retroviral vector Retroviral vectors may be replication competent or replication defective In the latter case, viral propagation generally will occur only in complementing host cells The polynucleotides may be joined to a vector containing a selectable marker for propagation in a host. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
The DNA insert should be operatively linked to an appropriate promoter, such as the phage lambda PL promoter, the E. coli lac, trp, phoA and tac promoters, the S V40 early and late promoters and promoters of retroviral LTRs, to name a few. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constructs will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated. As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria. Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293 and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
Among vectors preferred for use in bacteria include pQΕ70, pQE60 and ρQE-9, available from QIAGEN, Inc., supra, pBS vectors, Phagescript vectors, Bluescript vectors, pNH8A, pNHlόa, pNH18A, pNH46A, available from Stratagene; and ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 available from Pharmacia. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Other suitable vectors will be readily apparent to the skilled artisan. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al, Basic Methods In Molecular Biology (1986).
The polypeptide may be expressed in a modified form, such as a fusion protein, and may include not only secretion signals, but also additional heterologous functional regions. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of the polypeptide to improve stability and persistence in the host cell, during purification, or during subsequent handling and storage. Also, peptide moieties may be added to the polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the polypeptide. The addition of peptide moieties to polypeptides to engender secretion or excretion, to improve stability and to facilitate purification, among others, are familiar and routine techniques in the art. A preferred fusion protein comprises a heterologous region from immunoglobulin that is useful to stabilize and purify proteins. For example, EP-A-O 464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is thoroughly advantageous for use in therapy and diagnosis and thus results, for example, in improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified in the advantageous manner described. This is the case when Fc portion proves to be a hindrance to use in therapy and diagnosis, for example when the fusion protein is to be used as antigen for immunizations. In drug discovery, for example, human proteins, such as hJL-5, have been fused with Fc portions for the purpose of high-throughput screening assays to identify antagonists of hEL-5. See, D. Bennett et ai, J. Molecular Recognition 5:52-58 (1995) and K. Johanson et al, J. Biol. Chem. 270:9459-9471 (1995). The CKβ- 13 protein can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification. Polypeptides of the present invention include: products purified from natural sources, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; and products produced by recombinant techniques from a prokaryotic or eukaryotic host, including, for example, bacterial, yeast, higher plant, insect and mammalian cells. Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. In addition, polypeptides of the invention may also include an initial modified methionine residue, in some cases as a result of host-mediated processes.
Polypeptides and Fragments
The invention further provides an isolated CKβ- 13 polypeptide having the amino acid sequence encoded by the deposited cDNA, or the amino acid sequence in SEQ ID NO:2, or a peptide or polypeptide comprising a portion of the above polypeptides.
Further polypeptides of the present invention include polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide sequence shown in SEQ ID NO:2, the polypeptide sequence encoded by the cDNA contained in a deposited clone, and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein).
By a polypeptide having an amino acid sequence at least, for example, 95%
"identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence. As a practical matter, whether any particular polypeptide is at least 80%,
85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences of SEQ ID NO: 2 or to the amino acid sequence encoded by the cDNA contained in a deposited clone can be determined conventionally using known computer programs. A preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245(1990)). In a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter. If the subject sequence is shorter than the query sequence due to N- or C- terminal deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C-terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence.
For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N- terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%). In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are to made for the purposes of the present invention. Variant and Mutant Polypeptides
To improve or alter the characteristics of CKβ- 13 polypeptides, protein engineering may be employed. Recombinant DNA technology known to those skilled in the art can be used to create novel mutant proteins or "muteins including single or multiple amino acid substitutions, deletions, additions or fusion proteins. Such modified polypeptides can show, e.g., enhanced activity or increased stability. In addition, they may be purified in higher yields and show better solubility than the corresponding natural polypeptide, at least under certain purification and storage conditions.
In the present invention, a "polypeptide fragment" refers to an amino acid sequence which is a portion of that contained in SEQ ED NO: 2 or encoded by the cDNA contained in the deposited clone. Protein (polypeptide) fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-24, 1-28, 25-35, 28-35, 36-48, 49-64, 65-76, and 77 to the end of the coding region. Moreover, polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids in length. In this context "about" includes the particularly recited ranges or values, and ranges or values larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes.
Polynucleotides encoding these polypeptides are also encompassed by the invention.
For instance, for many proteins, including the extracellular domain of a membrane associated protein or the mature form(s) of a secreted protein, it is known in the art that one or more amino acids may be deleted from the N-terminus or C- terminus without substantial loss of biological function. For instance, Ron et al., J. Biol Chem., 2(55:2984-2988 (1993) reported modified KGF proteins that had heparin binding activity even if 3, 8, or 27 amino-terminal amino acid residues were missing. In the present case, since the protein of the invention is a member of the chemokine polypeptide family, deletions of N-terminal amino acids up to the Cys at position 36 of SEQ ID NO: 2 may retain some biological activity such as receptor binding or modulation of T cell activities, for chemokines. Polypeptides having further N-terminal deletions including the Cys-36 residue in SEQ ED NO:2 would not be expected to retain such biological activities because it is known that this residue in a chemokine-related polypeptide is required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction.
Even if deletion of one or more amino acids from the N-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind CKβ- 13 ligand, ability to modulate T cell activity) may still be retained. For example, the ability of shortened CKβ- 13 muteins to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptides generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that an CKβ- 13 mutein with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six CKβ- 13 amino acid residues may often evoke an immune response.
Preferred polypeptide fragments include the secreted protein as well as the mature form. Further preferred polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids,
Accordingly, polypeptide fragments include the secreted CKβ- 13 protein as well as the mature form. Further preferred polypeptide fragments include the secreted CKβ- 13 protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, any number of amino acids, ranging from 1-60, can be deleted from the amino terminus of either the secreted CKβ- 13 polypeptide or the mature form. Similarly, any number of amino acids, ranging from 1-30, can be deleted from the carboxy terminus of the secreted CKβ- 13 protein or mature form. Furthermore, any combination of the above amino and carboxy terminus deletions are preferred. Similarly, polynucleotides encoding these polypeptide fragments are also preferred.
Particularly, N-terminal deletions of the CKβ-13 polypeptide can be described by the general formula m!-93, where m1 is an integer from 2 to 88, where m1 corresponds to the position of the amino acid residue identified in SEQ ID NO:2. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of A-2 to Q-93; R-3 to Q-93; L-4 to Q-93; Q-5 to Q-93; T-6 to Q-93; A-7 to Q-93; L-8 to Q-93; L-9 to Q-93; V-10 to Q-93; V-l 1 to Q-93; L-12 to Q-93; V-13 to Q-93; L-14 to Q-93; L-15 to Q-93; A-16 to Q-93; V-17 to Q-93; A-18 to Q-93; L-19 to Q-93; Q-20 to Q-93; A-21 to Q-93; T-22 to Q-93; E-23 to Q-93; A-24 to Q-93; G-25 to Q-93; P-26 to Q-93; Y-27 to Q-93; G-28 to Q-93; A-29 to Q-93; N-30 to Q-93; M- 31 to Q-93; E-32 to Q-93; D-33 to Q-93; S-34 to Q-93; V-35 to Q-93; C-36 to Q- 93; C-37 to Q-93; R-38 to Q-93; D-39 to Q-93; Y-40 to Q-93; V-41 to Q-93; R-42 to Q-93; H-43 to Q-93; R-44 to Q-93; L-45 to Q-93; P-46 to Q-93; L-47 to Q-93; R-48 to Q-93; V-49 to Q-93; V-50 to Q-93; K-51 to Q-93; H-52 to Q-93; F-53 to Q-93; Y-54 to Q-93; W-55 to Q-93; T-56 to Q-93; S-57 to Q-93; D-58 to Q-93; S- 59 to Q-93; C-60 to Q-93; P-61 to Q-93; R-62 to Q-93; P-63 to Q-93; G-64 to Q- 93; V-65 to Q-93; V-66 to Q-93; L-67 to Q-93; L-68 to Q-93; T-69 to Q-93; F-70 to Q-93; R-71 to Q-93; D-72 to Q-93; K-73 to Q-93; E-74 to Q-93; 1-75 to Q-93; C-76 to Q-93; A-77 to Q-93; D-78 to Q-93; P-79 to Q-93; R-80 to Q-93; V-81 to Q-93; P-82 to Q-93; W-83 to Q-93; V-84 to Q-93; K-85 to Q-93; M-86 to Q-93; I- 87 to Q-93; and/or L-88 to Q-93 of SEQ ID NO:2. Polypeptides encoded by these polynucleotides are also encompassed by the invention.
Accordingly, the present invention further provides polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence of the CKβ-13 shown in SEQ ID NO:2, up to the Cys-36 residue, and polynucleotides encoding such polypeptides. In particular, the present invention provides polypeptides comprising the amino acid sequence of residues m2-93 of SEQ ID NO:2, where m2 is an integer in the range of 1-35 where Cys-36 is the position of the first residue from the N-terminus of the complete CKβ-13 polypeptide (shown in SEQ ID NO:2) believed to be required for receptor binding activity of the CKβ- 13 protein.
More in particular, the invention provides polypeptides having the amino acid sequence of residues 1-93, 2-93, 3-93, 4-93, 5-93, 6-93, 7-93, 8-93, 9-93, 10-93, 11- 93, 12-93, 13-93, 14-93, 15-93, 16-93, 17-93, 18-93, 19-93, 20-93, 21-93, 22-93, 23-93, 24-93, 25-93, 26-93, 27-93, 28-93, 29-93, 30-93, 31-93, 32-93, 33-93, 34- 93, and/or 35-93 of SEQ ED NO:2. Polynucleotides encoding these polypeptides also are provided.
Also as mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind CKβ- 13 ligand, ability to modulate T cell activity) may still be retained. For example the ability of the shortened CKβ- 13 mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that an CKβ- 13 mutein with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six CKβ- 13 amino acid residues may often evoke an immune response.
Similarly, many examples of biologically functional C-terminal deletion muteins are known. For instance, interferon gamma shows up to ten times higher activities by deleting 8-10 amino acid residues from the carboxy terminus of the protein (Dobeli et al, J. Biotechnology 7:199-216 (1988). In the present case, since the protein of the invention is a member of the chemokine polypeptide family, deletions of C-terminal amino acids up to the Cys at position 76 of SEQ ID NO:2 may retain some biological activity such as receptor binding or modulation of target cell activities, for chemokines. Polypeptides having further C-terminal deletions including Cys-76 of SEQ ED NO: 2 would not be expected to retain such biological activities because it is known that this residue in a chemokine-related polypeptide is required for forming a disulfide bridge to provide structural stability which is needed for receptor binding and signal transduction.
However, even if deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein, other biological activities may still be retained. Thus, the ability of the shortened protein to induce and/or bind to antibodies which recognize the complete or mature form of the protein generally will be retained when less than the majority of the residues of the complete or mature protein are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete protein retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art.
Accordingly, the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the CKβ- 13 polypeptide shown in Figure 1 (SEQ ID NO: 2), as described by the general formula 1-n1, where n1 is an integer from 7 to 92, where n1 corresponds to the position of amino acid residue identified in SEQ ID NO:2. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of M-l to S-92; M-l to L-91; M-l to K-90; M-l to S-89; M-l to L-88; M-l to 1-87; M-l to M-86; M-l to K-85; M-l to V-84; M-l to W-83; M-l to P-82; M-l toV-81; M-l to R-80; M-l to P-79; M-l to D-78; M-l to A-77; M-lto C-76; M-l to 1-75; M-l to E-74; M-l to K-73; M-l to D-72; M-lto R-71; M-l to F-70; M-l to T-69; M-l to L-68; M-l to L-67; M-lto V-66; M-l to V-65; M-l to G-64; M-l to P-63; M-l to R-62; M-l to P-61; M-l to C-60; M-l to S-59; M-l to D-58; M-l to S-57; M-l to T-56; M-l to W-55, M-l to Y-54, M-l to F-53, M-l to H-52, M-l to K-51, M-l to V-50, M-l to V-49, M-l to R-48, M-lto L-47, M-l to P-46, M-l to L-45, M-l to R-44, M-l to H-43, M-l to R-42, M-l to V-41, M-l to Y-40, M-l to D-39, M-l to R-38, M-l to C-37, M-l to C-36, M-l to V-35, M-l to S-34, M-lto D-33, M-l to E-32, M-l to M-31, M-l to N-30, M-l to A-29, M-l to G-28, M-l to Y-27, M-l to P-26, M-l to G-25, M-l to A-24, M-l to E-23, M-l to T-22, M-l to A-21, M-l to Q-20, M-l to L-19, M-l to A-18, M-l to V-17, M-l to A-16, M-l to L-15, M-l to L-14, M-l to V-13, M-1 to L-12, M-l to V-11, M-1 to V-10, M-l to L-9, M-l to L-8, and/or M- 1 to A-7 of SEQ ID NO 2 Polypeptides encoded by these polynucleotides are also encompassed by the invention
Further, the present invention further provides polypeptides having one or more residues from the carboxy terminus of the amino acid sequence of the CKβ- 13 shown in SEQ ID NO 2, up to the Cys-76 of SEQ ID NO 2, and polynucleotides encoding such polypeptides In particular, the present invention provides polypeptides having the amino acid sequence of residues 1-n2 of the amino acid sequence in SEQ ID NO 2, where n2 is any integer in the range of 77 to 93 where 76 is the position of the C- terminal Cys residue of the complete CKβ- 13 polypeptide (shown in SEQ ID NO 2) believed to be required for receptor binding or modulation of target cell activities of the CKβ- 13 protein More in particular, the invention provides polynucleotides encoding polypeptides having the amino acid sequence of residues m2-n2, where m2 is an integer 1-35 and n2 is an integer 77-93 of SEQ ID NO 2 Polynucleotides encoding these polypeptides also are provided
In addition, any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted CKβ- 13 polypeptide The invention also provides polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini, which may be described generally as having residues n^-n1 of SEQ ID NO 2, where m1 and n1 are integers as described above Polynucleotides encoding these polypeptides are also encompassed by the invention In particular, preferred N- and C- terminal deletions comprise amino acid sequences A-29 to Q-93; G-28 to Q-93; and/or G-25 to Q-93 of SEQ ID NO:2. Polynucleotides encoding these polypeptides are also encompassed by the invention. Accordingly, the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the mature CKβ-13 polypeptide shown in Figure 1 (SEQ ID NO:2), as described by the general formula 25-n3, where n3 is an integer from 31 to 92, where n3 corresponds to the position of amino acid residue identified in SEQ ED NO:2. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of G- 25 to S-92; G-25 to L-91; G-25 to K-90; G-25 to S-89; G-25 to L-88; G-25 to 1-87; G-25 to M-86; G-25 to K-85; G-25 to V-84; G-25 to W-83; G-25 to P-82; G-25 toV-81; G-25 to R-80; G-25 to P-79; G-25 to D-78; G-25 to A-77; G-25 to C-76; G-25 to 1-75; G-25 to E-74; G-25 to K-73; G-25 to D-72; G-25 to R-71; G-25 to F- 70; G-25 to T-69; G-25 to L-68; G-25 to L-67; G-25 to V-66; G-25 to V-65; G-25 to G-64; G-25 to P-63; G-25 to R-62; G-25 to P-61; G-25 to C-60; G-25 to S-59; G-25 to D-58; G-25 to S-57; G-25 to T-56; G-25 to W-55; G-25 to Y-54; G-25 to F-53; G-25 to H-52; G-25 to K-51; G-25 to V-50; G-25 to V-49; G-25 to R-48; G- 25 to L-47; G-25 to P-46; G-25 to L-45; G-25 to R-44; G-25 to H-43; G-25 to R- 42; G-25 to V-41; G-25 to Y-40; G-25 to D-39; G-25 to R-38; G-25 to C-37; G-25 to C-36; G-25 to V-35; G-25 to S-34; G-25 to D-33; G-25 to E-32; and/or G-25 to M-31 of SEQ ID NO:2. Polypeptides encoded by these polynucleotides are also encompassed by the invention.
Moreover, a signal sequence may be added to these C-terminal constructs. For example, amino acids 1-24 of SEQ ID NO:2, amino acids 2-24 of SEQ ED NO:2, amino acids 3-24 of SEQ ED NO: 2, amino acids 4-24 of SEQ ID NO: 2, amino acids 5-24 of SEQ ID NO:2, amino acids 6-24 of SEQ ID NO:2, amino acids 7-24 of SEQ ID NO:2, amino acids 8-24 of SEQ ID NO:2, amino acids 9-24 of SEQ ID NO:2, amino acids 10-24 of SEQ ID NO: 2, amino acids 11-24 of SEQ ED NO: 2, amino acids 12-24 of SEQ ID NO:2, amino acids 13-24 of SEQ ID NO:2, amino acids 14- 24 of SEQ ID NO:2, amino acids 15-24 of SEQ ID NO:2, amino acids 16-24 of SEQ ID NO:2, amino acids 17-24 of SEQ ID NO:2, amino acids 18-24 of SEQ ID NO:2, amino acids 19-24 of SEQ ID NO:2, amino acids 20-24 of SEQ ID NO:2, amino acids 21-24 of SEQ ID NO:2, amino acids 22-24 of SEQ ID NO:2, or amino acids 23-24 of SEQ ID NO:2, can be added to the N-terminus of each C-terminal constructs listed above.
Accordingly, the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the mature CKβ-13 polypeptide shown in Figure 1 (SEQ ID NO:2), as described by the general formula 29-n4, where n4 is an integer from 35 to 92, where n4 corresponds to the position of amino acid residue identified in SEQ ID NO:2. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of G- 29 to S-92; G-29 to L-91; G-29 to K-90; G-29 to S-89; G-29 to L-88; G-29 to 1-87; G-29 to M-86; G-29 to K-85; G-29 to V-84; G-29 to W-83; G-29 to P-82; G-29 toV-81; G-29 to R-80; G-29 to P-79; G-29 to D-78; G-29 to A-77; G-29 to C-76; G-29 to 1-75; G-29 to E-74; G-29 to K-73; G-29 to D-72; G-29 to R-71 ; G-29 to F- 70; G-29 to T-69; G-29 to L-68; G-29 to L-67; G-29 to V-66; G-29 to V-65; G-29 to G-64; G-29 to P-63; G-29 to R-62; G-29 to P-61; G-29 to C-60; G-29 to S-59; G-29 to D-58; G-29 to S-57; G-29 to T-56; G-29 to W-55; G-29 to Y-54; G-29 to F-53; G-29 to H-52; G-29 to K-51; G-29 to V-50; G-29 to V-49; G-29 to R-48; G- 29 to L-47; G-29 to P-46; G-29 to L-45; G-29 to R-44; G-29 to H-43; G-29 to R- 42; G-29 to V-41; G-29 to Y-40; G-29 to D-39; G-29 to R-38; G-29 to C-37; G-29 to C-36; and/or G-29 to V-35 of SEQ ID NO:2. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Alternatively, amino acids 1-28 of SEQ ID NO:2, amino acids 2-28 of SEQ ID NO:2, amino acids 3-28 of SEQ ED NO:2, amino acids 4-28 of SEQ ID NO:2, amino acids 5-28 of SEQ ID NO:2, amino acids 6-28 of SEQ ID NO:2, amino acids 7-28 of SEQ ID NO:2, amino acids 8-28 of SEQ ID NO:2, amino acids 9-28 of SEQ ID NO:2, amino acids 10-28 of SEQ ID NO:2, amino acids 11-28 of SEQ ID NO:2, amino acids 12-28 of SEQ ID NO:2, amino acids 13-28 of SEQ ID NO:2, amino acids 14-28 of SEQ ID NO:2, amino acids 15-28 of SEQ ID NO:2, amino acids 16- 28 of SEQ ID NO:2, amino acids 17-28 of SEQ ID NO:2, amino acids 18-28 of SEQ ID NO:2, amino acids 19-28 of SEQ ID NO:2, amino acids 20-28 of SEQ ID NO:2, amino acids 21-28 of SEQ ID NO:2, amino acids 22-28 of SEQ ID NO:2, amino acids 23-28 of SEQ ID NO:2, amino acids 24-28 of SEQ ID NO:2, amino acids 25- 28 of SEQ ID NO:2, amino acids 26-28 of SEQ ID NO:2, or amino acids 27-28 of SEQ ID NO:2, can be added to the N-terminus of each C-terminal constructs listed above. Also included are a nucleotide sequence encoding a polypeptide consisting of a portion of the complete CKβ- 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, where this portion excludes any integer of amino acid residues from 1 to about 83 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, or any integer of amino acid residues from 1 to about 83 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113. Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided. Also included are a nucleotide sequence encoding a polypeptide consisting of a portion of the complete CKβ- 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, where this portion excludes from 1 to about 35 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113, or from 1 to about 17 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 971 13. Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided. Additional preferred polypeptide fragments comprise, or alternatively consist of, the amino acid sequence of residues: M-l to L-15; A-2 to A- 16; R-3 to V-17; L-4 to A-18; Q-5 to L-19; T-6 to Q-20; A-7 to A-21; L-8 to T-22; L-9 to E-23; V-10 to A-24; V-l l to G-25; L-12 to P-26; V-13 to Y-27; L-14 to G-28; L-15 to A-29; A- 16 to N-30; V-17 to M-31; A-18 to E-32; L-19 to D-33; Q-20 to S-34; A-21 to V-35; T-22 to C-36; E-23 to C-37; A-24 to R-38; G-25 to D-39; P-26 toY-40; Y-27 to V- 41; G-28 to R-42; A-29 to H-43; N-30 to R-44; M-31 to L-45; E-32 to P-46; D-33 to L-47; S-34 to R-48; V-35 toV-49; C-36 to V-50; C-37 to K-51; R-38 to H-52; D- 39 to F-53; Y-40 to Y-54; V-41 to W-55; R-42 to T-56; H-43 to S-57; R-44 to D- 58; L-45 to S-59; P-46 to C-60; L-47 to P-61; R-48 to R-62;V-49 to P-63; V-50 to G-64; K-51 to V-65; H-52 to V-66; F-53 to L-67; Y-54 to L-68; W-55 to T-69; T- 56 to F-70; S-57 to R-71; D-58 to D-72; S-59 to K-73; C-60 to E-74; P-61 to 1-75; R-62 to C-76; P-63 to A-77; G-64 to D-78; V-65 to P-79; V-66 to R-80; L-67 to V- 81; L-68 to P-82; T-69 to W-83; F-70 to V-84; R-71 to K-85; D-72 to M-86; K-73 to 1-87; E-74 to L-88; 1-75 to S-89; C-76 to K-90; A-77 to L-91 ; D-78 to S-92; and/or P-79 to Q-93 of SEQ ID NO:2. These polypeptide fragments may retain the biological activity of the CKβ- 13 polypeptides of the invention and may be useful to generate antibodies, as described further below. Polynucleotides encoding these polypeptide fragments are also encompassed by the invention. The present application is also directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to the CKβ- 13 polypeptide sequence set forth herein as m'-n1, m2-n2, m3-n3, and/or m4-n4. In preferred embodiments, the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific CKβ- 13 N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Preferably, the polynucleotide fragments of the invention encode a polypeptide which demonstrates a CKβ- 13 functional activity. By a polypeptide demonstrating a CKβ- 13 "functional activity" is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) CKβ- 13 protein. Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a CKβ- 13 polypeptide for binding) to an anti CKβ- 13 antibody], immunogenicity (ability to generate antibody which binds to a CKβ- 13 polypeptide), ability to form multimers with CKβ- 13 polypeptides of the invention, and ability to bind to a receptor or ligand for a CKβ- 13 polypeptide.
The functional activity of CKβ- 13 polypeptides, and fragments, variants derivatives, and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to bind or compete with full-length CKβ- 13 polypeptide for binding to anti-CKβ-13 antibody, various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. In another embodiment, where a CKβ- 13 ligand is identified, or the ability of a polypeptide fragment, variant or derivative of the invention to multimerize is being evaluated, binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting. See generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59:94-123. In another embodiment, physiological correlates of CKβ- 13 binding to its substrates (signal transduction) can be assayed.
In addition, assays described herein (see Examples) and otherwise known in the art may routinely be applied to measure the ability of CKβ- 13 polypeptides and fragments, variants derivatives and analogs thereof to elicit CKβ- 13 related biological activity (either in vitro or in vivo). Other methods will be known to the skilled artisan and are within the scope of the invention.
Among the especially preferred fragments of the invention are fragments characterized by structural or functional attributes of CKβ- 13 Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil- regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) of complete (i.e., full-length) CKβ-13 (SEQ ID NO:2). Certain preferred regions are those set out in Figure 3 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in Figure 1 (SEQ ID NO:2), such preferred regions include; Garnier-Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson- Wolf high antigenic index regions, as predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also encompassed by the invention.
In additional embodiments, the polynucleotides of the invention encode functional attributes of CKβ-13. Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of CKβ-13. The data representing the structural or functional attributes of CKβ- 13 set forth in Figure 1 and/or Table I, as described above, was generated using the various modules and algorithms of the DNA* STAR set on default parameters. In a preferred embodiment, the data presented in columns VIII, IX, XIII, and XIV of Table I can be used to determine regions of CKβ- 13 which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, IX, XIII, and/or IV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response. Certain preferred regions in these regards are set out in Figure 3, but may, as shown in Table I, be represented or identified by using tabular representations of the data presented in Figure 3. The DNA* STAR computer algorithm used to generate Figure 3 (set on the original default parameters) was used to present the data in Figure 3 in a tabular format (See Table I). The tabular format of the data in Figure 3 may be used to easily determine specific boundaries of a preferred region.
The above-mentioned preferred regions set out in Figure 3 and in Table I include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1. As set out in Figure 3 and in Table I, such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf regions of high antigenic index. Table 1
Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV
Met 1 A A 0 06 0 09 * * -0 30 0 60
Ala 2 A A 0 13 0 06 * -0 30 0 82
Arg 3 A A -0 07 0 11 * * -0 30 0 93
Leu 4 A A -0 49 0 19 * * -0 30 0 94
Gin 5 A A -0 91 0 26 * -0 30 0 77
Thr 6 A A -1 17 0 44 * * -0 60 0 32
Ala 7 A A -1 43 1 09 * * -0 60 0 29
Leu 8 A A -2 36 1 04 * * -0 60 0 13
Leu 9 A A -2 40 1 33 -0 60 0 07
Val 10 A A -3 21 1 49 -0 60 0 05 Val 11 A A -3 71 1 67 -0 60 0 05
Leu 12 A A -3 71 1 67 -0 60 0 05
Val 13 A A -3 76 1 49 -0 60 0 07
Leu 14 A A -3 53 1 49 -0 60 0 07
Leu 15 A A -3 49 1 34 -0 60 0 09
Ala 16 A A -2 63 1 34 -0 60 0 10 Val 17 A A -2 41 1 10 -0 60 0 20 Ala 18 A A -1 87 0 91 -0 60 0 25
Leu 19 A A -1 06 0 71 -0 60 0 36
Gin 20 A A -0 83 0 21 -0 30 0 84
Ala 21 A A -0 59 0 07 -0 30 0 84
Thr 22 A A 0 06 -0 00 F 0 60 1 00
Glu 23 A A 0 40 -0 26 F 0 45 0 89
Ala 24 A C 0 87 0 10 F 0 20 1 39
Gly 25 T C 0 28 0 03 * F 0 45 0 95
Pro 26 T C 0 87 0 04 * F 0 45 0 56
Tyr 27 T C 0 58 0 44 F 0 15 0 88
Gly 28 T C 0 58 0 56 0 00 0 88
Ala 29 A 1 17 0 13 -0 10 0 99
Asn 30 A 1 21 -0 30 * 0 65 1 05
Met 31 A 0 57 -0 67 0 95 1 43
Glu 32 A 0 14 -0 46 F 0 80 1 05
Asp 33 A B -0 18 -0 39 * 0 30 0 35
Ser 34 A B 0 52 -0 21 * 0 30 0 19
Val 35 A B 0 52 -0 83 0 60 0 21
Cys 36 A B 0 88 -0 83 0 91 0 21
Cys 37 A T 0 02 -0 07 * * 1 32 0 25
Arg 38 A T 0 13 0 19 * * 1 03 0 25
Asp 39 T T 0 40 -0 46 * 2 34 0 92
Tyr 40 T T 1 37 -0 53 * 3 10 2 32
Val 41 B T 1 22 -1 10 * 2 39 2 32
Arg 42 B T 1 68 -0 41 * * 1 78 1 15
His 43 B T 0 76 0 01 * * 0 87 1 13
Arg 44 B T 0 87 -0 06 * 1 16 1 26 Table I (continued)
Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV
Leu 45 B 0 26 -0 70 * * 0 95 1 26
Pro 46 A B 0 26 -0 06 * * 0 30 0 69
Leu 47 A B 0 19 0 09 * * -0 30 0 26
Arg 48 A B 0 19 0 09 * * -0 30 0 63
Val 49 A B -0 62 -0 10 * * 0 30 0 56
Val 50 B B -0 06 0 26 * * -0 30 0 58
Lys 51 B B -0 13 0 33 * -0 30 0 47
His 52 B B 0 37 1 24 * -0 60 0 66
Phe 53 B T -0 04 1 09 * -0 05 1 28
Tyr 54 B T 0 81 0 83 * -0 20 0 86
Tφ 55 B T 1 37 0 83 * -0 05 1 06
Thr 56 T T 0 66 0 71 * F 0 50 1 63
Ser 57 T T 0 48 0 50 * * F 0 66 0 56
Asp 58 T T 1 29 0 17 * * F 1 27 0 82
Ser 59 T T 1 32 -0 74 * F 2 63 1 12
Cys 60 T 1 27 -0 80 * F 2 74 1 29
Pro 61 T T 0 72 -0 76 F 3 10 0 76
Arg 62 T 0 17 -0 11 * F 2 29 0 42
Pro 63 T T -0 64 0 14 * F 1 58 0 59
Gly 64 B T -1 16 0 26 * F 0 87 0 31
Val 65 B B -0 80 0 51 * -0 29 0 13
Val 66 B B -1 29 1 00 * -0 60 0 12
Leu 67 B B -1 29 1 36 * -0 60 0 1 1
Leu 68 B B -1 08 0 93 * -0 60 0 28
Thr 69 A B -0 69 0 29 * -0 30 0 64
Phe 70 A B 0 17 -0 36 0 45 1 55
Arg 71 A B 0 13 -1 04 * F 0 90 3 25
Asp 72 A B 0 28 -1 04 F 0 90 1 58
Lys 73 A A 0 50 -0 96 * F 0 75 0 98
Glu 74 A A 0 81 -1 24 0 60 0 50 lie 75 A T 1 30 -1 24 * 1 28 0 50
Cys 76 A T 1 30 -0 81 * 1 56 0 39
Ala 77 A T 0 44 -0 81 * * 1 84 0 44
Asp 78 T 0 19 -0 17 * * F 2 17 0 47
Pro 79 T T -0 10 -0 43 * F 2 80 1 34
Arg 80 A T -0 07 -0 09 * F 2 12 1 40
Val 81 A T 0 64 0 06 * 0 94 0 62
Pro 82 A B 0 63 0 06 * 0 26 0 80
Trp 83 A B -0 26 0 24 * -0 02 0 41
Val 84 A B -0 86 0 93 -0 60 0 38
Lys 85 A B -1 27 0 97 -0 60 0 20
Met 86 A B -0 37 0 93 * -0 60 0 26 lie 87 A B -0 97 0 01 * -0 30 0 70
Leu 88 A B -0 98 0 06 * -0 30 0 29 Table 1 (continued)
Res Position I II III IV V VI VII VIII IX X XI XII XIII XIV
Ser 89 A A -0.12 0.44 * -0.60 0.39
Lys 90 A A -0.56 0.23 * F -0.15 0.97
Leu 91 A A -0.34 -0.03 * F 0.60 1.50
Ser 92 A A 0.16 -0.29 * 0.45 1.43
Gin 93 A A 0.58 -0.24 * 0.30 0.92
Other Mutants
In addition to terminal deletion forms of the protein discussed above, it also will be recognized by one of ordinary skill in the art that some amino acid sequences of the CKβ- 13 polypeptide can be varied without significant effect of the structure or function of the protein. If such differences in sequence are contemplated, it should be remembered that there will be critical areas on the protein which determine activity.
Thus, the invention further includes variations of the CKβ- 13 polypeptide which show substantial CKβ- 13 polypeptide activity or which include regions of CKβ- 13 protein such as the protein portions discussed below. Such mutants include deletions, insertions, inversions, repeats, and type substitutions selected according to general rules known in the art so as have little effect on activity. For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie, J. U. et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein the authors indicate that there are two main approaches for studying the tolerance of an amino acid sequence to change.
The first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.
The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244: 1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity. As the authors state, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein. For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and He; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
Amino acids in the CKβ- 13 protein of the present invention that are essential for function can be identified by methods known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-1085 (1989)). The latter procedure introduces single alanine mutations at every residue in the molecule. The resulting mutant molecules are then tested for biological activity such as receptor binding or in vitro or in vitro proliferative activity.
Of special interest are substitutions of charged amino acids with other charged or neutral amino acids which may produce proteins with highly desirable improved characteristics, such as less aggregation. Aggregation may not only reduce activity but also be problematic when preparing pharmaceutical formulations, because aggregates can be immunogenic (Pinckard et al, Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al, Diabetes 36: 838-845 (1987); Cleland et al, Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993).
Replacement of amino acids can also change the selectivity of the binding of a ligand to cell surface receptors. For example, Ostade et al, Nature 361:266-26$ (1993) describes certain mutations resulting in selective binding of TNF-α to only one of the two known types of TNF receptors. Sites that are critical for ligand- receptor binding can also be determined by structural analysis such as crystallization, nuclear magnetic resonance or photoaffinity labeling (Smith et al, J. Mol. Biol 224:899-904 (1992) and de Vos et al Science 255:306-312 (1992)).
For example, site directed changes at the amino acid level of CKβ- 13 can be made by replacing a particular amino acid with a conservative amino acid. Preferred conservative mutations include: Ml replaced with A, G, I, L, S, T, or V; A2 replaced with G, I, L, S, T, M, or V; R3 replaced with H, or K; L4 replaced with A, G, I, S, T, M, or V; Q5 replaced with N; T6 replaced with A, G, I, L, S, M, or V; A7 replaced with G, I, L, S, T, M, or V; L8 replaced with A, G, I, S, T, M, or V; L9 replaced with A, G, I, S, T, M, or V; VI 0 replaced with A, G, I, L, S, T, or M; VI 1 replaced with A, G, 1, L, S, T, or M; L12 replaced with A, G, I, S, T, M, or V; VI 3 replaced with A, G, I, L, S, T, or M; L14 replaced with A, G, I, S, T, M, or V; LI 5 replaced with A, G, I, S, T, M, or V; A16 replaced with G, I, L, S, T, M, or V; VI 7 replaced with A, G, I, L, S, T, or M; A18 replaced with G, I, L, S, T, M, or V; LI 9 replaced with A, G, I, S, T, M, or V; Q20 replaced with N; A21 replaced with G, I, L, S, T, M, or V; T22 replaced with A, G, I, L, S, M, or V; E23 replaced with D; A24 replaced with G, I, L, S, T, M, or V; G25 replaced with A, I, L, S, T, M, or V; Y27 replaced with F, or W; G28 replaced with A, I, L, S, T, M, or V; A29 replaced with G, I, L, S, T, M, or V; N30 replaced with Q; M31 replaced with A, G, I, L, S, T, or V; E32 replaced with D; D33 replaced with E; S34 replaced with A, G, I, L, T, M, or V; V35 replaced with A, G, I, L, S, T, or M; R38 replaced with H, or K; D39 replaced with E; Y40 replaced with F, or W; V41 replaced with A, G, I, L, S, T, or M; R42 replaced with H, or K; H43 replaced with K, or R; R44 replaced with H, or K; L45 replaced with A, G, I, S, T, M, or V; L47 replaced with A, G, I, S, T, M, or V; R48 replaced with H, or K; V49 replaced with A, G, I, L, S, T, or M; V50 replaced with A, G, I, L, S, T, or M; K51 replaced with H, or R; H52 replaced with K, or R; F53 replaced with W, or Y; Y54 replaced with F, or W; W55 replaced with F, or Y; T56 replaced with A, G, I, L, S, M, or V; S57 replaced with A, G, I, L, T, M, or V; D58 replaced with E; S59 replaced with A, G, I, L, T, M, or V; R62 replaced with H, or K; G64 replaced with A, I, L, S, T, M, or V; V65 replaced with A, G, I, L, S, T, or M; V66 replaced with A, G, I, L, S, T, or M; L67 replaced with A, G, I, S, T, M, or V; L68 replaced with A, G, I, S, T, M, or V; T69 replaced with A, G, I, L, S, M, or V; F70 replaced with W, or Y; R71 replaced with H, or K; D72 replaced with E; K73 replaced with H, or R; E74 replaced with D; 175 replaced with A, G, L, S, T, M,or V; A77 replaced with G, I, L, S, T, M, or V; D78 replaced with E; R80 replaced with H, or K; V81 replaced with A, G, I, L, S, T, or M; W83 replaced with F, or Y; V84 replaced with A, G, I, L, S, T, or M; K85 replaced with H, or R; M86 replaced with A, G, I, L, S, T, or V; 187 replaced with A, G, L, S, T, M, or V; L88 replaced with A, G, I, S, T, M, or V; S89 replaced with A, G, I, L, T, M, or V; K90 replaced with H, or R; L91 replaced with A, G, I, S, T, M, or V; S92 replaced with A, G, I, L, T, M, or V; and/or Q93 replaced with N in SEQ ID NO:2.
The resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art. Preferably, the resulting constructs have one CKβ- 13 activity or function increased and/or decreased, while the remaining CKβ- 13 activities or functions are maintained. More preferably, the resulting constructs have more than one CKβ- 13 activity or function increased and/or decreased, while the remaining CKβ- 13 activities or functions are maintained.
Besides conservative amino acid substitution, variants of CKβ- 13 include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification. Such variant polypeptides are deemed to be within the scope of those skilled in the art from the teachings herein.
For example, CKβ- 13 polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity. (Pinckard et al, Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993).)
For example, preferred non-conservative substitutions of CKβ-13 include: Ml replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A2 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R3 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L4 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q5 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; T6 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A7 replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; L8 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L9 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; VI 0 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; VI 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L12 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; VI 3 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L14 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; LI 5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A16 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; VI 7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A18 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L19 replaced with D, E, H, K, R, N, Q,
F, W, Y, P, or C; Q20 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; A21 replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; T22 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E23 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A24 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G25 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P26 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Y27 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; G28 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A29 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N30 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; M31 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; E32 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D33 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S34 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V35 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C36 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C37 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; R38 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D39 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; Y40 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V41 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R42 replaced with D, E, A, G, I, L, S,T, M, V, N, Q, F, W, Y, P, or C; H43 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; R44 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L45 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P46 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; L47 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R48 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V49 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V50 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K51 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H52 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; F53 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; Y54 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; W55 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S57 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D58 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S59 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C60 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; P61 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; R62 replaced with D, E, A, G, 1, L, S, T, M, V, N, Q, F, W, Y, P, or C; P63 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; G64 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V65 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V66 replaced with D, E, H, K, R, N, Q, F,W, Y, P, or C; L67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L68 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T69 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F70 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; R71 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; D72 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K73 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E74 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; 175 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C76 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; A77 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D78 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; P79 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; R80 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V81 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P82 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; W83 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V84 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K85 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; M86 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 187 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L88 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S89 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K90 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L91 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S92 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; and/or Q93 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C.
The invention further provides an isolated CKβ- 13 polypeptide having the amino acid sequence in SEQ ED NO:2 wherein H43 is replaced with Y and/or S89 is replaced with N. These replacements may occur singularly or together in the full length, mature, or proprotein form of CKβ- 13 protein; as well as the N- and C- terminal deletion mutants having the general formula m'-n1, m2-n2, m3-n3, and/or m4- n4 listed above; and/or further variants, and polypeptide fragments of the invention, including but not limited to, predicted epitope fragments. These polypeptides are expected to retain the biological function of a CKβ- 13 polypeptide.
The resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art. Preferably, the resulting constructs have one CKβ- 13 activity or function increased and/or decreased, while the remaining CKβ- 13 activities or functions are maintained. More preferably, the resulting constructs have more than one CKβ- 13 activity or function increased and/or decreased, while the remaining CKβ- 13 activities or functions are maintained.
Additionally, more than one amino acid (e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10) can be replaced with the substituted amino acids as described above (either conservative or nonconservative). The substituted amino acids can occur in the full length, mature, or proprotein form of CKβ- 13 protein, as well as the N- and C- terminal deletion mutants, having the general formula m'-n1 and/or m2-n2, listed above.
A further embodiment of the invention relates to a polypeptide which comprises the amino acid sequence of a CKβ- 13 polypeptide having an amino acid sequence which contains at least one amino acid substitution, but not more than 50 amino acid substitutions, even more preferably, not more than 40 amino acid substitutions, still more preferably, not more than 30 amino acid substitutions, and still even more preferably, not more than 20 amino acid substitutions. Of course, in order of ever-increasing preference, it is highly preferable for a polypeptide to have an amino acid sequence which comprises the amino acid sequence of a CKβ- 13 polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 amino acid substitutions. In specific embodiments, the number of additions, substitutions, and/or deletions in the amino acid sequence of Figure 1 or fragments thereof (e.g., the mature form and/or other fragments described herein), is 1-5, 5-10, 5-25, 5-50, 10-50 or 50-150, conservative amino acid substitutions are preferable. The polypeptides of the present invention are preferably provided in an isolated form, and preferably are substantially purified A recombinantly produced version of the CKβ- 13 polypeptide can be substantially purified by the one-step method described in Smith and Johnson, Gene 67 31-40 (1988) Polypeptides of the invention also can be purified from natural or recombinant sources using anti-CKβ- 13 antibodies of the invention in methods which are well known in the art of protein purification
The polypeptide of the present invention could be used as a molecular weight marker on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art
As described in detail below, the polypeptides of the present invention can also be used to raise polyclonal and monoclonal antibodies, which are useful in assays for detecting CKβ- 13 protein expression as described below or as agonists and antagonists capable of enhancing or inhibiting CKβ- 13 protein function Further, such polypeptides can be used in the yeast two-hybrid system to "capture" CKβ-13 protein binding proteins which are also candidate agonists and antagonists according to the present invention The yeast two hybrid system is described in Fields and Song, Nature 340 245-246 (1989)
Epitope-Bearing Portions
The present invention is also directed to polypeptide fragments comprising, or alternatively consisting of, an epitope of the polypeptide sequence shown in SEQ ID NO 2, or the polypeptide sequence encoded by the cDNA contained in a deposited clone Polynucleotides encoding these epitopes (such as, for example, the sequence disclosed in SEQ ID NO 1) are also encompassed by the invention, as is the nucleotide sequences of the complementary strand of the polynucleotides encoding these epitopes And polynucleotides which hybridize to the complementary strand under stringent hybridization conditions or lower stringency conditions
In the present invention, "epitopes" refer to polypeptide fragments having antigenic activity and/or immunogenic activity in an animal, especially in a human A preferred embodiment of the present invention relates to a polypeptide fragment comprising an epitope, as well as the polynucleotide encoding this fragment. A region of a protein molecule to which an antibody can bind is defined as an "antigenic epitope." In contrast, an "immunogenic epitope" is defined as a part of a protein that elicits an antibody response. (See, for instance, Geysen et al.,Proc. Natl. Acad. Sci. USA 81 :3998- 4002 (1983).)
Fragments which function as epitopes may be produced by any conventional means. (See, e.g., Houghten, R. A., Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985) further described in U.S. Patent No. 4,631,211.) In the present invention, antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, and most preferably between about 15 to about 30 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length. Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies, that specifically bind the epitope. (See, for instance, Wilson et al., Cell 37:767-778 (1984); Sutcliffe et al, Science 219:660-666 (1983).) Non-limiting examples of antigenic polypeptides or peptides that can be used to generate CKβ- 13 -specific antibodies include: a polypeptide comprising amino acid residues from about Thr-22 to about Gly-28; Asn-30 to about Leu-47; Thr-56 to about Val-65; and Phe-70 to about Trp-83. These polypeptide fragments have been determined to bear antigenic epitopes of the CKβ- 13 protein by the analysis of the Jameson- Wolf antigenic index, as shown in Figure 3 and Table 1, above. Similarly, immunogenic epitopes can be used, for example, to induce antibodies according to methods well known in the art. (See, for instance, Sutcliffe et al., supra; Wilson et al, supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910- 914; and Bittle et al, J. Gen. Virol. 66:2347-2354 (1985).) A preferred immunogenic epitope includes the secreted protein. The immunogenic epitopes may be presented together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse) or, if it is long enough (at least about 25 amino acids), without a carrier. However, immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting.)
Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe et al, supra; Wilson et al., supra, and Bittle et al, J. Gen. Virol., 66:2347-2354 (1985). If in vivo immunization is used, animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides containing cysteine residues may be coupled to a carrier using a linker such as -maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde. Animals such as rabbits, rats and mice are immunized with either free or carrier-coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 μgs of peptide or carrier protein and Freund's adjuvant. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface. The titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
As one of skill in the art will appreciate, and discussed above, the polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to heterologous polypeptide sequences. For example, the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, any combination thereof including both entire domains and portions thereof) resulting in chimeric polypeptides. These fusion proteins facilitate purification, and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See, e.g., EPA 0,394,827; Traunecker et al., Nature, 331 :84-86 (1988). Fusion proteins that have a disulfide-linked dimeric structure due to the IgG portion can also be more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag to aid in detection and purification of the expressed polypeptide.
Fusion Proteins As one of skill in the art will appreciate, and discussed above, the polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to heterologous polypeptide sequences. For example, the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, any combination thereof including both entire domains and portions thereof) resulting in chimeric polypeptides. These fusion proteins facilitate purification, and show an increased half-life in vivo. This has been shown, e.g., for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See, e.g., EPA 0,394,827; Traunecker et al, Nature, 331 :84-86 (1988). Fusion proteins that have a disulfide-linked dimeric structure due to the IgG portion can also be more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag to aid in detection and purification of the expressed polypeptide.
Additional fusion proteins of the invention may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to modulate the activities of polypeptides corresponding to SEQ ID NO: 2 thereby effectively generating agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P.A., et al, Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, S., Trends Biotechnol. 16(2):76-82 (1998); Hansson, L.O., et al., J. Mol. Biol. 287:265- 76 (1999); and Lorenzo, M. M. and Blasco, R., Biotechniques 24(2): 308- 13 (1998) (each of these patents and publications are hereby incorporated by reference). In one embodiment, alteration of polynucleotides corresponding to SEQ ID NO: l and corresponding polypeptides may be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments into a desired molecule corresponding to SEQ ID NO: l polynucleotides of the invention by homologous, or site-specific, recombination. In another embodiment, polynucleotides corresponding to SEQ ID NO: l and corresponding polypeptides may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of coding polynucleotide corresponding to SEQ ID NO:l, or the polypeptide encoded thereby may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
Antibodies
The present invention further relates to antibodies and T-cell antigen receptors (TCR) which specifically bind the polypeptides of the present invention. The antibodies of the present invention include IgG (including IgGl, IgG2, IgG3, and IgG4), IgA (including IgAl and IgA2), IgD, IgE, or IgM, and IgY. As used herein, the term "antibody" (Ab) is meant to include whole antibodies, including single-chain whole antibodies, and antigen-binding fragments thereof. Most preferably the antibodies are human antigen binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single-chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. The antibodies may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine, rabbit, goat, guinea pig, camel, horse, or chicken.
Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entire or partial of the following: hinge region, CHI, CH2, and CH3 domains. Also included in the invention are any combinations of variable region(s) and hinge region, CHI, CH2, and CH3 domains. The present invention further includes monoclonal, polyclonal, chimeric, humanized, and human monoclonal and human polyclonal antibodies which specifically bind the polypeptides of the present invention. The present invention further includes antibodies which are anti-idiotypic to the antibodies of the present invention.
The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for heterologous compositions, such as a heterologous polypeptide or solid support material. See, e.g., WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); US Patents 5,573,920, 4,474,893, 5,601,819, 4,714,681, 4,925,648; Kostelny et al., J. Immunol. 148: 1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which are recognized or specifically bound by the antibody. The epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or listed in the Tables and Figures. Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same. Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of the polypeptides of the present invention are included. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50%) identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. Further included in the present invention are antibodies which only bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described herein). Antibodies of the present invention may also be described or specified in terms of their binding affinity. Preferred binding affinities include those with a dissociation constant or Kd less than 5X10"6M, 10"6M, 5X10"7M, 10"7M, 5X10"*M, 10"8M, 5X10"9M, 10"9M, 5X10-10M, 10"10M, 5X10"nM, 10M, 5X10"12M, 10"12M, 5X10"13M, 10"13M, 5X10"14M, 10"14M, 5X10"15M, and 10"15M. Antibodies of the present invention have uses that include, but are not limited to, methods known in the art to purify, detect, and target the polypeptides of the present invention including both in vitro and in vivo diagnostic and therapeutic methods. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., ANTIBODIES: A LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incorporated by reference in the entirety).
The antibodies of the present invention may be used either alone or in combination with other compositions. The antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions For example, antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, or toxins See, e g , WO 92/08495, WO 91/14438, WO 89/12624, US Patent 5,314,995, and EP 0 396 387
The antibodies of the present invention may be prepared by any suitable method known in the art For example, a polypeptide of the present invention or an antigenic fragment thereof can be administered to an animal in order to induce the production of sera containing polyclonal antibodies The term "monoclonal antibody" is not a limited to antibodies produced through hybridoma technology The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technology
Hybridoma techniques include those known in the art and taught in Harlow et al , ANTIBODIES A LABORATORY MANUAL, (Cold Spring Harbor Laboratory Press, 2nd ed 1988), Hammerling, et al , in MONOCLONAL ANTIBODIES AND T-CELL HYBRIDOMAS 563-681 (Elsevier, N Y , 1981) (said references incorporated by reference in their entireties) Fab and F(ab')2 fragments may be produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments)
Alternatively, antibodies of the present invention can be produced through the application of recombinant DNA and phage display technology or through synthetic chemistry using methods known in the art For example, the antibodies of the present invention can be prepared using various phage display methods known in the art In phage display methods, functional antibody domains are displayed on the surface of a phage particle which carries polynucleotide sequences encoding them Phage with a desired binding property are selected from a repertoire or combinatorial antibody library (e.g. human or murine) by selecting directly with antigen, typically antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and Ml 3 with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al, J. Immunol. Methods 182:41-50 (1995); Ames et al, J. Immunol. Methods 184:177- 186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT/GB91/01 134; WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and US Patents 5,698,426, 5,223,409, 5,403,484, 5,580,717, 5,427,908, 5,750,753, 5,821,047, 5,571,698, 5,427,908, 5,516,637, 5,780,225, 5,658,727 and 5,733,743 (said references incorporated by reference in their entireties). As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host including mammalian cells, insect cells, plant cells, yeast, and bacteria. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in WO 92/22324; Mullinax et al, BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al, Science 240: 1041-1043 (1988) (said references incorporated by reference in their entireties).
Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Patents 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203:46-88 (1991); Shu, L. et al., PNAS 90:7995- 7999 (1993); and Skerra et al, Science 240:1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized, or human antibodies. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies et al, (1989) J. Immunol. Methods 125: 191-202; and US Patent 5,807,715. Antibodies can be humanized using a variety of techniques including CDR-grafting (EP 0 239 400; WO 91/09967; US Patent 5,530,101; and 5,585,089), veneering or resurfacing (EP 0 592 106; EP 0 519 596; Padlan E.A., Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91 :969-973 (1994)), and chain shuffling (US Patent 5,565,332). Human antibodies can be made by a variety of methods known in the art including phage display methods described above. See also, US Patents 4,444,887, 4,716,111, 5,545,806, and 5,814,318; and WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741 (said references incorporated by reference in their entireties).
Further included in the present invention are antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide of the present invention. The antibodies may be specific for antigens other than polypeptides of the present invention. For example, antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors. Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al. supra and WO 93/21232; EP 0 439 095; Naramura et al., Immunol. Lett. 39:91-99 (1994); US Patent 5,474,981; Gillies et al, PNAS 89:1428-1432 (1992); Fell et al, J. Immunol. 146:2446-2452(1991) (said references incorporated by reference in their entireties).
The present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions. For example, the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof. The antibody portion fused to a polypeptide of the present invention may comprise the hinge region, CHI domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof. The polypeptides of the present invention may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art. The polypeptides may also be fused or conjugated to the above antibody portions to form multimers. For example, Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fc portions. Higher multimeric forms can be made by fusing the polypeptides to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of the present invention to antibody portions are known in the art. See e.g., US Patents 5,336,603, 5,622,929, 5,359,046, 5,349,053, 5,447,851, 5,112,946; EP 0 307 434, EP 0 367 166; WO 96/04388, WO 91/06570; Ashkenazi et al, PNAS 88: 10535-10539 (1991); Zheng et al, J. Immunol. 154:5590-5600 (1995); and Vil et al., PNAS 89: 11337- 1 1341(1992) (said references incorporated by reference in their entireties). The invention further relates to antibodies which act as agonists or antagonists of the polypeptides of the present invention. For example, the present invention includes antibodies which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully. Included are both receptor- specific antibodies and ligand-specific antibodies. Included are receptor-specific antibodies which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art. Also included are receptor-specific antibodies which both prevent ligand binding and receptor activation. Likewise, included are neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor. Further included are antibodies which activate the receptor. These antibodies may act as agonists for either all or less than all of the biological activities affected by ligand-mediated receptor activation. The antibodies may be specified as agonists or antagonists for biological activities comprising specific activities disclosed herein. The above antibody agonists can be made using methods known in the art. See e.g., WO 96/40281; US Patent 5,81 1,097; Deng et al., Blood 92(6)1981-1988 (1998); Chen, et al, Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4)1786-1794 (1998); Zhu et al, Cancer Res. 58(15):3209-3214 (1998); Yoon, et al., J. Immunol. 160(7):3170-3179 (1998); Prat et al., J. Cell. Sci. l l l(Pt2):237- 247 (1998); Pitard et al., J. Immunol. Methods 205(2)177-190 (1997); Liautard et al., Cytokinde 9(4):233-241 (1997); Carlson et al., J. Biol. Chem. 272(17)11295- 11301 (1997); Taryman et al, Neuron 14(4):755-762 (1995); Muller et al, Structure 6(9)1153-1167 (1998); Bartunek et al, Cytokine 8(1)14-20 (1996) (said references incorporated by reference in their entireties).
As discussed above, antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437-444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)). For example, antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to ligand can be used to generate anti-idiotypes that "mimic" the polypeptide mutimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and/or its ligand. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand. For example, such anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligands/receptors, and thereby block its biological activity.
The invention further relates to a diagnostic kit for use in screening serum containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides. Such a kit may include a substantially isolated polypeptide antigen comprising an epitope which is specifically immunoreactive with at least one anti- polypeptide antigen antibody. Such a kit also includes means for detecting the binding of said antibody to the antigen. In specific embodiments, the kit may include a recombinantly produced or chemically synthesized polypeptide antigen. The polypeptide antigen of the kit may also be attached to a solid support.
In a more specific embodiment the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached. Such a kit may also include a non-attached reporter-labelled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labelled antibody.
The invention further includes a method of detecting proliferative and/or cancerous disorders and conditions in a test subject. This detection method includes reacting serum from a test subject (e.g., one in which proliferative and/or cancerous cells or tissues may be present) with a substantially isolated polypeptide and/or polynucleotide antigen, and examining the antigen for the presence of bound antibody. In a specific embodiment, the method includes a polypeptide antigen attached to a solid support, and the serum is reacted with the support. Subsequently, the support is reacted with a reporter labelled anti-human antibody. The solid support is then examined for the presence of reporter-labelled antibody.
Additionally, the invention includes a proliferative condition vaccine composition. The composition includes a substantially isolated polypeptide and/or polynucleotide antigen, where the antigen includes an epitope which is specifically immunoreactive with at least antibody specific for the epitope. The peptide and/or polynucleotide antigen may be produced according to methods known in the art, including recombinant expression or chemical synthesis. The peptide antigen is preferably present in a pharmacologically effective dose in a pharmaceutically acceptable carrier. Further, the invention includes a monoclonal antibody that is specifically immunoreactive with polypeptide and/or polynucleotide epitopes. The invention includes a substantially isolated preparation of polyclonal antibodies specifically immunoreactive with polynucleotides and/or polypeptides of the present invention. In a more specific embodiment, such polyclonal antibodies are prepared by affinity chromatography, in addition to, other methods known in the art. In another emodiment, the invention includes a method for producing antibodies to polypeptide and/or polynucleotide antigens. The method includes administering to a test subject a substantially isolated polypeptide and/or polynucleotide antigen, where the antigen includes an epitope which is specifically immunoreactive with at least one anti- polypeptide and/or polynucleotide antibody. The antigen is administered in an amount sufficient to produce an immune response in the subject.
In an additional embodiment, the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention. The diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody. In one embodiment, the antibody is attached to a solid support. In a specific embodiment, the antibody may be a monoclonal antibody. The detecting means of the kit may include a second, labelled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labelled, competing antigen.
In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention. After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labelled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-antigen antibody on the solid support. The reagent is again washed to remove unbound labelled antibody, and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96-well plate or filter material. These attachment methods generally include non-specific adsorption of the protein to the support or covalent attachment of the protein, typically through a free a ine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s). Thus, the invention provieds an assay system or kit for carrying out this diagnostic method. The kit generally includes a support with surface-bound recombinant antigens, and a reporter-labelled anti-human antibody for detecting surface-bound anti-antigen antibody.
Immune System-Related Disorders
Immune Activity
CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may be useful in treating deficiencies or disorders of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells. Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells. The etiology of these immune deficiencies or disorders may be genetic, somatic, such as cancer or some autoimmune disorders, acquired (e.g., by chemotherapy or toxins), or infectious. Moreover, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, can be used as a marker or detector of a particular immune system disease or disorder.
CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may be useful in treating or detecting deficiencies or disorders of hematopoietic cells. CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat those disorders associated with a decrease in certain (or many) types hematopoietic cells. Examples of immunologic deficiency syndromes include, but are not limited to: blood protein disorders (e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HIV infection, HTLV- BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott- Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
Moreover, CKβ-13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity (clot formation). For example, by increasing hemostatic or thrombolytic activity, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, could be used to treat blood coagulation disorders (e.g., afibrinogenemia, factor deficiencies), blood platelet disorders (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes. Alternatively, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment of heart attacks (infarction), strokes, or scarring.
CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may also be useful in treating or detecting autoimmune disorders. Many autoimmune disorders result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destruction of the host tissue. Therefore, the administration of CKβ-13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-13, that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune disorders.
Examples of autoimmune disorders that can be treated or detected include, but are not limited to: Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Purpura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
Similarly, allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated by CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-13. Moreover, these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may also be used to treat and/or prevent organ rejection or graft-versus-host disease (GVHD). Organ rejection occurs by host immune cell destruction of the transplanted tissue through an immune response. Similarly, an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues. The administration of CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-13, that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD. Similarly, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 15, may also be used to modulate inflammation. For example, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 15, may inhibit the proliferation and differentiation of cells involved in an inflammatory response. These molecules can be used to treat inflammatory conditions, both chronic and acute conditions, including chronic prostatitis, granulomatous prostatitis and malacoplakia, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
Infectious Disease CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-
13, can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases may be treated. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. For example, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-13, may recruite naive T cells to a site of new infection. Alternatively, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-13, may also directly inhibit the infectious agent, without necessarily eliciting an immune response. Viruses are one example of an infectious agent that can cause disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention. Examples of viruses, include, but are not limited to Examples of viruses, include, but are not limited to the following DNA and RNA viruses and viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Birnaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Herpesviridae (such as, Cytomegalovirus, Herpes Simplex, Herpes Zoster), Mononegavirus (e.g., Paramyxoviridae, Morbillivirus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A, Influenza B, and parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae, Picornaviridae, Poxviridae (such as Smallpox or Vaccinia), Reoviridae (e.g., Rotavirus), Retroviridae (HTLV-I, HTLV-1I, Lentivirus), and Togaviridae (e.g., Rubivirus). Viruses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, respiratory syncytial virus, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia. polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat or detect any of these symptoms or diseases. In specific embodiments, polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B). In an additional specific embodiment polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients nonresponsive to one or more other commercially available hepatitis vaccines. In a further specific embodiment polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat AIDS.
Similarly, bacterial or fungal agents that can cause disease or symptoms and that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, include, but not limited to, the following Gram-Negative and Gram-positive bacteria and bacterial families and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium, Norcardia), Cryptococcus neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia (e.g., Borrelia burgdorferi, Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses, E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E. coli), Enter obacteriaceae (Klebsiella, Salmonella (e.g., Salmonella typhi, and Salmonella paratyphi), Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal), Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and Streptococcal (e.g., Streptococcus pneumoniae and Group B Streptococcus). These bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B), Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract infections, wound infections. Polynucleotides or polypeptides, agonists or antagonists of the invention, can be used to treat or detect any of these symptoms or diseases. In specific embodiments, Ppolynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, Diptheria, botulism, and/or meningitis type B .
Moreover, parasitic agents causing disease or symptoms that can be treated or detected by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, the following families or class: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium malariae and Plasmodium ovale). These parasites can cause a variety of diseases or symptoms, including, but not limited to: Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g., AIDS related), malaria, pregnancy complications, and toxoplasmosis. polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat or detect any of these symptoms or diseases. In specific embodiments, polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat malaria. Preferably, treatment using a polypeptide or polynucleotide and/or agonist or antagonist of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy). Moreover, the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
Diagnosis The present inventors have discovered that CKβ- 13 is expressed inactivated monocytes and ex vivo expanded dendritic cells. For a number of immune system- related disorders, substantially altered (increased or decreased) levels of CKβ-13 gene expression can be detected in immune system tissue or other cells or bodily fluids (e.g., sera, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" CKβ- 13 gene expression level, that is, the CKβ- 13 expression level in immune system tissues or bodily fluids from an individual not having the immune system disorder. Thus, the invention provides a diagnostic method useful during diagnosis of a immune system disorder, which involves measuring the expression level of the gene encoding the CKβ- 13 protein in immune system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard CKβ- 13 gene expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of an immune system disorder.
In particular, it is believed that certain tissues in mammals with cancer of the immune system express significantly altered (i.e., either enhanced or decreased) levels of the CKβ- 13 protein and mRNA encoding the CKβ- 13 protein when compared to a corresponding "standard" level. Further, it is believed that altered levels of the CKβ- 13 protein can be detected in certain body fluids (e.g., sera, plasma, urine, and spinal fluid) from mammals with such a cancer when compared to sera from mammals of the same species not having the cancer.
Thus, the invention provides a diagnostic method useful during diagnosis of an immune system disorder, including cancers of this system which involves measuring the expression level of the gene encoding the CKβ- 13 protein in immune system tissue or other cells or body fluid from an individual and comparing the measured gene expression level with a standard CKβ- 13 gene expression level, whereby a significant increase or decrease in the gene expression level compared to the standard is indicative of an immune system disorder. Where a diagnosis of a disorder in the immune system, including diagnosis of a tumor has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting a significantly altered CKβ- 13 gene expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level. By "assaying the expression level of the gene encoding the CKβ- 13 protein" is intended qualitatively or quantitatively measuring or estimating the level of the CKβ- 13 protein or the level of the mRNA encoding the CKβ- 13 protein in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the CKβ-13 protein level or mRNA level in a second biological sample). Preferably, the CKβ-13 protein level or mRNA level in the first biological sample is measured or estimated and compared to a standard CKβ- 13 protein level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder of the immune system. As will be appreciated in the art, once a standard CKβ- 13 protein level or mRNA level is known, it can be used repeatedly as a standard for comparison.
By "biological sample" is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains CKβ- 13 protein or mRNA. As indicated, biological samples include body fluids (such as sera, plasma, urine, synovial fluid and spinal fluid) which contain free CKβ- 13 protein, immune system tissue, and other tissue sources found to express complete or mature CKβ- 13 or a CKβ- 13 receptor. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
The present invention is useful for diagnosis or treatment of various immune system-related disorders, including disregulation of immune cell function in mammals, preferably humans. Such disorders include tumors, cancers, interstitial lung disease (such as Langerhans cell granulomatosis) and any disregulation of immune cell function including but not limited to, leukemias, lymphomas, autoimmune diseases, arthritis, immune suppression, histamine and IgE-mediated allergic reactions, sepsis, prostaglandin-independant fever, bone marrow failure, wound healing, silicosis, sarcoidosis, acute and chronic infection, cell mediated immunity, humoral immunity, inflammatory bowel disease, mylosuppression and hyper-eosinophil syndrome and the like.
Total cellular RNA can be isolated from a biological sample using any suitable technique such as the single-step guanidinium-thiocyanate-phenol-chloroform method described in Chomczynski and Sacchi, Anal. Biochem. 752.156-159 (1987). Levels of mRNA encoding the CKβ- 13 protein are then assayed using any appropriate method. These include Northern blot analysis, SI nuclease mapping, the polymerase chain reaction (PCR), reverse transcription in combination with the polymerase chain reaction (RT-PCR), and reverse transcription in combination with the ligase chain reaction (RT-LCR). Assaying CKβ- 13 protein levels in a biological sample can occur using antibody-based techniques. For example CKβ- 13 protein expression in tissues can be studied with classical immunohistological methods (Jalkanen, M., et al, J. Cell Biol. 707:976-985 (1985); jalkanen, M., et al, J. Cell . Biol. 705:3087-3096 (1987)). Other antibody-based methods useful for detecting CKβ- 13 protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine (125I, 121I), carbon (14C), sulfur (35S), tritium (3H), indium (l l2In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
In addition to assaying CKβ- 13 protein levels in a biological sample obtained from an individual, CKβ- 13 protein can also be detected in vivo by imaging. Antibody labels or markers for in vivo imaging of CKβ- 13 protein include those detectable by X-radiography, NMR or ESR. For X-radiography, suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incorporated into the antibody by labeling of nutrients for the relevant hybridoma.
A CKβ- 13 protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (for example, 131I, 112In, 99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously or intraperitoneally) into the mammal to be examined for immune system disorder. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain CKβ- 13 protein. In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments" (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982)). Treatment
As noted above, CKβ-13 polynucleotides and polypeptides are useful for diagnosis of conditions involving abnormally high or low expression of CKβ- 13 activities. Given the cells and tissues where CKβ- 13 is expressed as well as the activities modulated by CKβ- 13, it is readily apparent that a substantially altered (increased or decreased) level of expression of CKβ- 13 in an individual compared to the standard or "normal" level produces pathological conditions related to the bodily system(s) in which CKβ- 13 is expressed and/or is active.
It will also be appreciated by one of ordinary skill that, since the CKβ- 13 protein of the invention is a member of the chemokine beta family the mature form(s) of the protein may be released in soluble form from the cells which express the CKβ- 13 by proteolytic cleavage. Therefore, when mature CKβ- 13 is added from an exogenous source to cells, tissues or the body of an individual, the protein will exert its physiological activities on its target cells of that individual. Therefore, it will be appreciated that conditions caused by a decrease in the standard or normal level of CKβ- 13 activity in an individual, particularly disorders of the immune system, can be treated by administration of CKβ- 13 polypeptide (in the form of mature protein. Thus, the invention also provides a method of treatment of an individual in need of an increased level of CKβ- 13 activity comprising administering to such an individual a pharmaceutical composition comprising an amount of an isolated CKβ- 13 polypeptide of the invention, particularly a mature form of the CKβ- 13 effective to increase the CKβ- 13 activity level in such an individual.
The polypeptides of the present invention may be emplyed to inhibit bone marrow stem cell colony formation as an adjunct protective treatment during cancer chemotherapy. The CKβ- 13 polypeptide may inhibit the proliferation and differentiation of hematopoietic cells such as bone marrow stem cells. The inhibitor effect on the population of committed progenitor cells, (for example, granulocytes, and macrophages/monocytes) may be employed therapeutically to inhibit proliferation of leukemic cells.
The polypeptides of the present invention may also be employed to inhibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper-proliferation, since Langerhans cells in skin have been found to produce chemokines.
CKβ- 13 may be employed as an anti-neovascularizing agent to treat solid tumors; e.g., Karposi sarcoma by stimulating the invasion and activation of host defense cells; e.g., cytotoxic T cells and macrophages and by inhibiting the angiogenesis of tumors. Those of skill in the art will recognize other non-cancer indications where blood vessel proliferation is not wanted.
CKβ- 13 polypeptides may be employed to enhance host defenses against resistant chronic and acute infections, for example, mycobacterial infections via the attraction and activation of microbicidal leukocytes. CKβ- 13 may also be employed to inhibit T-cell proliferation by the inhibition of IL-2 biosynthesis for the treatment of T-cell mediated auto-immune diseases and lymphocytic leukemias.
CKβ- 13 may also be employed to stimulate wound healing and prevent scarring during healing, both via the recruitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF - mediated fibrosis. In this same manner, CKβ- 13 may also be employed to treat other fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary fibrosis.
CKβ- 13 also increases the presence of eosinophils which have the distinctive function of killing the larvae of parasites that invade tissues, as in schistosomiasis, trichinosis and ascariasis. CKβ- 13 also increases the presence of and activates
Natural Killer (NK) cells which will be useful for treating a variety of diseases in which the presence of NK cells are beneficial well known to those of skill in the art.
It may also be employed to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells, for example, to release mature leukocytes from the bone marrow following chemotherapy, i.e., in stem cell mobilization.
CKβ- 13 may also be employed to treat sepsis and is useful for immune enhancement or suppression, myeloprotection, and acute and chronic inflammatory control.
They may also be employed to regulate hematopoiesis, by regulating activation and differentiation of various hematopoietic progenitor cells, for example, to release mature leukocytes from the bone marrow following chemotherapy.
The polypeptides of the present invention may also be used to target unwanted cells, such as in the treatment of cancer, for apoptosis.
The polypeptide may also be used to mobilize bone marrow stem cells to peripheral blood, which allows easy isolation of stem cells. The isolation of stem cells may be employed for bone marrow colonization after high dose chemotherapy.
Chemotaxis
CKβ-13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may have chemotaxis activity. A chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and/or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hyperproliferation. The mobilized cells can then fight off and/or heal the particular trauma or abnormality.
CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat inflammation, infection, hyperproliferative disorders, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat wounds and other trauma to tissues by attracting immune cells to the injured location. Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat wounds. It is also contemplated that CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ- 13, may inhibit chemotactic activity. These molecules could also be used to treat disorders. Thus, CKβ- 13 polynucleotides or polypeptides, or agonists or antagonists of CKβ-13, could be used as an inhibitor of chemotaxis.
Binding Activity
CKβ- 13 polypeptides may be used to screen for molecules that bind to CKβ- 13 or for molecules to which CKβ- 13 binds. The binding of CKβ- 13 and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the CKβ-13 or the molecule bound. Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors, such as CCR4), or small molecules.
Preferably, the molecule is closely related to the natural ligand of CKβ- 13, e.g., a fragment of the ligand, or a natural substrate, a ligand, a structural or functional mimetic. (See, Coligan et al, Current Protocols in Immunology 1(2): Chapter 5 (1991).) Similarly, the molecule can be closely related to the natural receptor to which CKβ- 13 binds, or at least, a fragment of the receptor capable of being bound by CKβ- 13 (e.g., active site). In either case, the molecule can be rationally designed using known techniques. Preferably, the screening for these molecules involves producing appropriate cells which express CKβ- 13, either as a secreted protein or on the cell membrane. Preferred cells include cells from mammals, yeast, Drosophila, or E. coli. Cells expressing CKβ- 13 (or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either CKβ- 13 or the molecule.
The assay may simply test binding of a candidate compound to CKβ- 13, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to CKβ-13.
Alternatively, the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures. The assay may also simply comprise the steps of mixing a candidate compound with a solution containing CKβ- 13, measuring CKβ- 13 /molecule activity or binding, and comparing the CKβ- 13 /molecule activity or binding to a standard.
Preferably, an ELISA assay can measure CKβ- 13 level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody. The antibody can measure CKβ- 13 level or activity by either binding, directly or indirectly, to CKβ- 13 or by competing with CKβ- 13 for a substrate.
Additionally, the receptor to which CKβ- 13 binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). For example, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the polypeptides, for example, NTH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells which are grown on glass slides are exposed to the polypeptide of the present invention, after they have been labelled. The polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site- specific protein kinase.
Following fixation and incubation, the slides are subjected to auto- radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transfected using an iterative sub-pooling and re-screening process, eventually yielding a single clones that encodes the putative receptor.
As an alternative approach for receptor identification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
Moreover, the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and/or codon-shuffling (collectively referred to as "DNA shuffling") may be employed to modulate the activities of CKβ- 13 thereby effectively generating agonists and antagonists of CKβ-13. See generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458, and Patten, P. A., et al, Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, S. Trends Biotechnol. 16(2): 76- 82 (1998); Hansson, L. O., et al, J. Mol. Biol. 287:265-76 (1999); and Lorenzo, M. M. and Blasco, R. Biotechniques 24(2):308-13 (1998) (each of these patents and publications are hereby incorporated by reference). In one embodiment, alteration of CKβ- 13 polynucleotides and corresponding polypeptides may be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments into a desired CKβ- 13 molecule by homologous, or site-specific, recombination. In another embodiment, CKβ- 13 polynucleotides and corresponding polypeptides may be alterred by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of CKβ- 13 may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. In preferred embodiments, the heterologous molecules are CKβ- 13 family members. In further preferred embodiments, the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-1), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone morphogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dpρ), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF- betal, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).
Other preferred fragments are biologically active CKβ- 13 fragments.
Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the CKβ- 13 polypeptide. The biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
Additionally, this invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention. An example of such an assay comprises combining a mammalian fibroblast cell, a the polypeptide of the present invention, the compound to be screened and - [H] thymidine under cell culture conditions where the fibroblast cell would normally proliferate. A control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of - [H] thymidine in each case. The amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the incorporation of - [H] thymidine. Both agonist and antagonist compounds may be identified by this procedure. In another method, a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound. The ability of the compound to enhance or block this interaction could then be measured. Alternatively, the response of a known second messenger system following interaction of a compound to be screened and the CKβ- 13 receptor is measured and the ability of the compound to bind to the receptor and elicit a second messenger response is measured to determine if the compound is a potential agonist or antagonist. Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis. All of these above assays can be used as diagnostic or prognostic markers. The molecules discovered using these assays can be used to treat disease or to bring about a particular result in a patient (e.g., blood vessel growth) by activating or inhibiting the polypeptide/molecule. Moreover, the assays can discover agents which may inhibit or enhance the production of the polypeptides of the invention from suitably manipulated cells or tissues. Therefore, the invention includes a method of identifying compounds which bind to CKβ- 13 comprising the steps of: (a) incubating a candidate binding compound with CKβ-13; and (b) determining if binding has occurred. Moreover, the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with CKβ- 13, (b) assaying a biological activity , and (b) determining if a biological activity of CKβ- 13 has been altered.
Also, one could identify molecules bind CKβ- 13 experimentally by using the beta-pleated sheet regions disclosed in Figure 3, and Table 1. Accordingly, specific embodiments of the invention are directed to polynucleotides encoding polypeptides which comprise, or alternatively consist of, the amino acid sequence of each beta pleated sheet regions disclosed in Figure 3, and Table 1. Additional embodiments of the invention are directed to polynucleotides encoding CKβ- 13 polypeptides which comprise, or alternatively consist of, any combination or all of the beta pleated sheet regions disclosed in Figure 3, and Table 1. Additional preferred embodiments of the invention are directed to polypeptides which comprise, or alternatively consist of, the CKβ- 13 amino acid sequence of each of the beta pleated sheet regions disclosed in Figure 3, and Table 1. Additional embodiments of the invention are directed to CKβ- 13 polypeptides which comprise, or alternatively consist of, any combination or all of the beta pleated sheet regions disclosed in Figure 3, and Table 1. Targeted Delivery
In another embodiment, the invention provides a method of delivering compositions to targeted cells expressing a receptor for a polypeptide of the invention, or cells expressing a cell bound form of a polypeptide of the invention. As discussed herein, polypeptides or antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions. In one embodiment, the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (including antibodies) that are associated with heterologous polypeptides or nucleic acids. In one example, the invention provides a method for delivering a therapeutic protein into the targeted cell. In another example, the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.
In another embodiment, the invention provides a method for the specific destruction of cells (e.g., the destruction of tumor cells) by administering polypeptides of the invention (e.g., polypeptides of the invention or antibodies of the invention) in association with toxins or cytotoxic prodrugs. By "toxin" is meant compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death. Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin.
Drug Screening
Further contemplated is the use of the polypeptides of the present invention, or the polynucleotides encoding these polypeptides, to screen for molecules which modify the activities of the polypeptides of the present invention. Such a method would include contacting the polypeptide of the present invention with a selected compound(s) suspected of having antagonist or agonist activity, and assaying the activity of these polypeptides following binding.
This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of drug screening techniques. The polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly. One method of drug screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Drugs are screened against such transformed cells in competitive binding assays. One may measure, for example, the formulation of complexes between the agent being tested and a polypeptide of the present invention.
Thus, the present invention provides methods of screening for drugs or any other agents which affect activities mediated by the polypeptides of the present invention. These methods comprise contacting such an agent with a polypeptide of the present invention or a fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art. In such a competitive binding assay, the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the present invention.
Another technique for drug screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the present invention, and is described in great detail in European Patent Application 84/03564, published on September 13, 1984, which is incorporated herein by reference herein. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with polypeptides of the present invention and washed. Bound polypeptides are then detected by methods well known in the art. Purified polypeptides are coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.
This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding polypeptides of the present invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.
Formulations
The CKβ- 13 polypeptide composition will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with CKβ- 13 polypeptide alone), the site of delivery of the CKβ- 13 polypeptide composition, the method of administration, the scheduling of administration, and other factors known to practitioners. The "effective amount" of CKβ- 13 polypeptide for purposes herein is thus determined by such considerations.
As a general proposition, the total pharmaceutically effective amount of CKβ- 13 polypeptide administered parenterally per dose will be in the range of about 1 μg/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the CKβ- 13 polypeptide is typically administered at a dose rate of about 1 μg/kg/hour to about 50 μg/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect. Pharmaceutical compositions containing the CKβ- 13 of the invention may be administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray. By "pharmaceutically acceptable carrier" is meant a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
The CKβ- 13 polypeptide is also suitably administered by sustained-release systems. Suitable examples of sustained-release compositions include semi- permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules. Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman, U. et al, Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (R. Langer et al, J. Bio ed. Mater. Res. 15 A 67 -277 (1981), and R. Langer, Chem. Tech. 72:98-105 (1982)), ethylene vinyl acetate (R. Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988). Sustained-release CKβ-13 polypeptide compositions also include liposomally entrapped CKβ- 13 polypeptide. Liposomes containing CKβ-13 polypeptide are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci. (USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641 ; Japanese Pat. Appl. 83-1 18008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal CKβ- 13 polypeptide therapy.
For parenteral administration, in one embodiment, the CKβ- 13 polypeptide is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to polypeptides.
Generally, the formulations are prepared by contacting the CKβ- 13 polypeptide uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes. The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG.
The CKβ- 13 polypeptide is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of CKβ- 13 polypeptide salts.
CKβ- 13 polypeptide to be used for therapeutic administration must be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Therapeutic CKβ-13 polypeptide compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
CKβ- 13 polypeptide ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous CKβ- 13 polypeptide solution, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized CKβ- 13 polypeptide using bacteriostatic Water-for- Injection. The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds. Agonists and Antagonists - Assays and Molecules
In specific embodiments, antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ID NO1, or the complementary strand thereof, and/or to nucleotide sequences contained in the deposited clone CKβ- 13. In one embodiment, antisense sequence is generated internally, by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation. Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 6:3073 (1979); Cooney et al., Science 241 :456 (1988); and Dervan et al., Science 2511300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
For example, the use of c-myc and c-myb antisense RNA constructs to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines was previously described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments were performed in vitro by incubating cells with the oligoribonucleotide. A similar procedure for in vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides for a given antisense RNA is produced as follows: A sequence complimentary to the first 15 bases of the open reading frame is flanked by an EcoRl site on the 5 end and a Hindlll site on the 3 end. Next, the pair of oligonucleotides is heated at 90°C for one minute and then annealed in 2X ligation buffer (20mM TRIS HC1 pH 7.5, lOmM MgCl2, lOMM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the EcoRl/Hind III site of the retroviral vector PMV7 (WO 91/15580).
For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
In one embodiment, the CKβ- 13 antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof, is transcribed, producing an antisense nucleic acid (RNA) of the invention. Such a vector would contain a sequence encoding the CKβ- 13 antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding CKβ- 13, or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells. Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Bernoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma virus (Yamamoto et al, Cell 22:787-797 (1980), the herpes thymidine promoter (Wagner et al, Proc. Natl. Acad. Sci. U.S.A. 781441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
The antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a CKβ- 13 gene. However, absolute complementarity, although preferred, is not required. A sequence "complementary to at least a portion of an RNA," referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded CKβ- 13 antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the larger the hybridizing nucleic acid, the more base mismatches with a CKβ- 13 RNA it may contain and still form a stable duplex (or triplex as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
Oligonucleotides that are complementary to the 5' end of the message, e.g., the 5' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335. Thus, oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of CKβ- 13 shown in Figures 1A-B could be used in an antisense approach to inhibit translation of endogenous CKβ- 13 mRNA. Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'- or coding region of CKβ-13 mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10_ nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides. The polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double- stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al, 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. WO88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization- triggered cleavage agent, etc.
The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine, 5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1 -methylguanine, 1-methylinosine,
2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5 -methyl aminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta-D-mannosylqueosine,
5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino-3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose. In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof. In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gautier et al, 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0-methylribonucleotide (Inoue et al, 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al, 1987, FEBS Lett. 215:327-330).
Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al, 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc. While antisense nucleotides complementary to the CKβ- 13 coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 2471222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy CKβ- 13 mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG-3'. The construction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of CKβ- 13 (Figures 1A-B). Preferably, the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the CKβ-13 mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of non-functional mRNA transcripts.
As in the antisense approach, the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express CKβ- 13 in vivo. DNA constructs encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA. A preferred method of delivery involves using a DNA construct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous CKβ- 13 messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
Antagonist/agonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor formation or growth.
The antagonist/agonist may also be employed to prevent hyper-vascular diseases, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the present invention may also be desirous in cases such as restenosis after balloon angioplasty.
The antagonist/agonist may also be employed to prevent the growth of scar tissue during wound healing.
The antagonist/agonist may also be employed to treat the diseases described herein.
Thus, the invention provides a method of treating disorders or diseases, including but not limited to the disorders or diseases listed throughout this application, associated with overexpression of a polynucleotide of the present invention by administering to a patient (a) an antisense molecule directed to the polynucleotide of the present invention, and/or (b) a ribozyme directed to the polynucleotide of the present invention
The invention also provides a method of screening compounds to identify those which enhance or block the action of CKβ- 13 on cells, such as its interaction with CKβ- 13 -binding molecules such as receptor molecules An agonist is a compound which increases the natural biological functions of CKβ- 13 or which functions in a manner similar to CKβ- 13, while antagonists decrease or eliminate such functions In the assay of the invention for agonists or antagonists, a cellular compartment, such as a membrane or a preparation thereof, may be prepared from a cell that expresses a molecule that binds CKβ- 13, such as a molecule of a signaling or regulatory pathway modulated by CKβ-13 The preparation is incubated with labeled CKβ- 13 in the absence or the presence of a candidate molecule which may be a CKβ- 13 agonist or antagonist The ability of the candidate molecule to bind the binding molecule is reflected in decreased binding of the labeled ligand Molecules which bind gratuitously, i e , without inducing the effects of CKβ- 13 on binding the CKβ- 13 binding molecule, are most likely to be good antagonists Molecules that bind well and elicit effects that are the same as or closely related to CKβ- 13 are agonists CKβ-13-like effects of potential agonists and antagonists may by measured, for instance, by determining activity of a second messenger system following interaction of the candidate molecule with a cell or appropriate cell preparation, and comparing the effect with that of CKβ- 13 or molecules that elicit the same effects as CKβ- 13 Second messenger systems that may be useful in this regard include but are not limited to AMP guanylate cyclase, ion channel or phosphoinositide hydrolysis second messenger systems
Another example of an assay for CKβ- 13 antagonists is a competitive assay that combines CKβ- 13 and a potential antagonist with membrane-bound CKβ- 13 receptor molecules or recombinant CKβ- 13 receptor molecules under appropriate conditions for a competitive inhibition assay. CKβ- 13 can be labeled, such as by radioactivity, such that the number of CKβ- 13 molecules bound to a receptor molecule can be determined accurately to assess the effectiveness of the potential antagonist. Potential antagonists include small organic molecules, peptides, polypeptides and antibodies that bind to a polypeptide of the invention and thereby inhibit or extinguish its activity. Potential antagonists also may be small organic molecules, a peptide, a polypeptide such as a closely related protein or antibody that binds the same sites on a binding molecule, such as a receptor molecule, without inducing CKβ- 13 -induced activities, thereby preventing the action of CKβ- 13 by excluding CKβ- 13 from binding.
Other potential antagonists include antisense molecules. Antisense technology can be used to control gene expression through antisense DNA or RNA or through triple-helix formation. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression." CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Zee et al, Nucleic Acids Research 6: 3073 (1979); Cooney et al, Science 241: 456 (1988); and Dervan et al, Science 251: 1360 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA. For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of CKβ-13. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into CKβ- 13 polypeptide. The oligonucleotides described above can also be delivered to cells such that the antisense RNA or DNA may be expressed in vivo to inhibit production of CKβ- 13 protein.
The agonists and antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described above. The antagonists may be employed for instance to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and some T-cell subsets, e.g., activated and CD8 cytotoxic T cells and natural killer cells, in certain auto-immune and chronic inflammatory and infective diseases. Examples of auto-immune diseases include multiple sclerosis, and insulin- dependent diabetes.
The antagonists may also be employed to treat infectious diseases including silicosis, sarcoidosis, idiopathic pulmonary fibrosis by preventing the recruitment and activation of mononuclear phagocytes. They may also be employed to treat idiopathic hyper-eosinophilic syndrome by preventing eosinophil production and migration. Endotoxic shock may also be treated by the antagonists by preventing the migration of macrophages and their production of the human chemokine polypeptides of the present invention.
The antagonists may also be employed for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.
The antagonists may also be employed to treat histamine-mediated allergic reactions and immunological disorders including late phase allergic reactions, chronic urticaria, and atopic dermatitis by inhibiting chemokine-induced mast cell and basophil degranulation and release of histamine. IgE-mediated allergic reactions such as allergic asthma, rhinitis, and eczema may also be treated.
The antagonists may also be employed to treat chronic and acute inflammation by preventing the attraction of monocytes to a wound area. They may also be employed to regulate normal pulmonary macrophage populations, since chronic and acute inflammatory pulmonary diseases are associated with sequestration of mononuclear phagocytes in the lung.
Antagonists may also be employed to treat rheumatoid arthritis by preventing the attraction of monocytes into synovial fluid in the joints of patients. Monocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathies. The antagonists may be employed to interfere with the deleterious cascades attributed primarily to IL-1 and TNF, which prevents the biosynthesis of other inflammatory cytokines. In this way, the antagonists may be employed to prevent inflammation. The antagonists may also be employed to inhibit prostaglandin- independent fever induced by chemokines.
The antagonists may also be employed to treat cases of bone marrow failure, for example, aplastic anemia and myelodysplastic syndrome.
The antagonists may also be employed to treat asthma and allergy by preventing eosinophil accumulation in the lung. The antagonists may also be employed to treat subepithelial basement membrane fibrosis which is a prominent feature of the asthmatic lung.
Antibodies against CKβ- 13 may be employed to bind to and inhibit CKβ- 13 activity to treat, for example, ARDS, by preventing infiltration of neutrophils into the lung after injury. Any of the above antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as described herein.
Chromosome Assays
The nucleic acid molecules of the present invention are also valuable for chromosome identification. The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymorphisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
In certain preferred embodiments in this regard, the cDNA herein disclosed is used to clone genomic DNA of a CKβ-13 protein gene. This can be accomplished using a variety of well known techniques and libraries, which generally are available commercially. The genomic DNA then is used for in situ chromosome mapping using well known techniques for this purpose.
In addition, in some cases, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA. Computer analysis of the 3 ' untranslated region of the gene is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Fluorescence in situ hybridization ("FISH") of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with probes from the cDNA as short as 50 or 60 bp. For a review of this technique, see Verma et al, Human Chromosomes: A Manual Of Basic Techniques, Pergamon Press, New York (1988).
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance In Man, available on-line through Johns Hopkins University, Welch Medical Library. The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease. Having generally described the invention, the same will be more readily understood by reference to the following examples, which are provided by way of illustration and are not intended as limiting. Examples
Example 1: Expression and Purification ofCKβ-13 in E. coli
The bacterial expression vector pQE60 was used for bacterial expression in this example (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311). pQE60 encodes ampicillin antibiotic resistance ("Ampr") and contains a bacterial origin of replication ("ori"), an IPTG inducible promoter, a ribosome binding site ("RBS"), six codons encoding histidine residues that allow affinity purification using nickel-nitrilo- tri-acetic acid ("Ni-NTA") affinity resin sold by QIAGEN, Inc., supra, and suitable single restriction enzyme cleavage sites. These elements are arranged such that a DNA fragment encoding a polypeptide may be inserted in such as way as to produce that polypeptide with the six His residues (i.e., a "6 X His tag") covalently linked to the carboxyl terminus of that polypeptide. However, in this example, the polypeptide coding sequence is inserted such that translation of the six His codons is prevented and, therefore, the polypeptide is produced with no 6 X His tag.
The DNA sequence encoding the desired portion of the CKβ- 13 protein comprising the mature form beginning with Gly-25 of the CKβ- 13 amino acid sequence was amplified from the deposited cDNA clone using PCR oligonucleotide primers which anneal to the amino terminal sequences of the desired portion of the CKβ- 13 protein and to sequences in the deposited construct 3' to the cDNA coding sequence. Additional nucleotides containing restriction sites to facilitate cloning in the pQE60 vector were added to the 5' and 3' sequences, respectively.
For cloning the mature form of the CKβ- 13 protein beginning with Gly-25, the 5' primer has the sequence 5' AAACCATGGGTCCGTACGGTGCAAACATGGAAGACAGCG 3' (SEQ ID NO:4) containing the underlined Ncol restriction site (bold). Particular nucleotides in the "wobble" position in certain codons in both primers have been altered based on E. coli preference. One of ordinary skill in the art would appreciate, of course, that the point in the protein coding sequence where the 5' primer begins may be varied to amplify a desired portion of the complete protein shorter or longer than the mature form. The 3' primer has the sequence 5'
AAAAAGCTTCTGACCCTTCCCTGGAAGGTA 3' (SEQ ID NO: 5) containing the underlined Hindlll restriction site.
The amplified CKβ-13 DNA fragments and the vector pQE60 were digested with Ncol and Hindlll and the digested DNAs were then ligated together. Insertion of the CKβ-13 DNA into the restricted pQE60 vector places the CKβ-13 protein coding region including its associated stop codon downstream from the IPTG- inducible promoter and in-frame with an initiating AUG. The associated stop codon prevents translation of the six histidine codons downstream of the insertion point. The ligation mixture was transformed into competent E. coli cells using standard procedures such as those described in Sambrook et al., Molecular Cloning: a Laboratory Manual, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989). E. coli strain M15/rep4, containing multiple copies of the plasmid pREP4, which expresses the lac repressor and confers kanamycin resistance ("Kanr"), is used in carrying out the illustrative example described herein. This strain, which is only one of many that are suitable for expressing CKβ- 13 protein, is available commercially from QIAGEN, Inc., supra. Transformants were identified by their ability to grow on LB plates in the presence of ampicillin and kanamycin. Plasmid DNA was isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
Clones containing the desired constructs were 'grown overnight ("O/N") in liquid culture in LB media supplemented with both ampicillin (100 μg/ml) and kanamycin (25 μg/ml). The O/N culture was used to inoculate a large culture, at a dilution of approximately 1 :25 to 1 :250. The cells were grown to an optical density at 600 nm ("OD600") of between 0.4 and 0.6. isopropyl-b-D-thiogalactopyranoside ("IPTG") was then added to a final concentration of 1 mM to induce transcription from the lac repressor sensitive promoter, by inactivating the lad repressor. Cells subsequently were incubated further for 3 to 4 hours. Cells then were harvested by centrifugation. To purify the CKβ- 13 polypeptide, the cells were then stirred for 3-4 hours at 4° C in 6M guanidine-HCl, pH 8. The cell debris was removed by centrifugation, and the supernatant containing the CKβ- 13 was dialyzed against 50 mM Na-acetate buffer pH 6, supplemented with 200 mM NaCl. Alternatively, the protein can be successfully refolded by dialyzing it against 500 mM NaCl, 20% glycerol, 25 mM Tris/HCl pH 7.4, containing protease inhibitors. After renaturation the protein can be purified by ion exchange, hydrophobic interaction and size exclusion chromatography. Alternatively, an affinity chromatography step such as an antibody column can be used to obtain pure CKβ- 13 protein. The purified protein is stored at 4° C or frozen at -80° C.
The following alternative method may be used to purify CKβ- 13 expressed in E coli when it is present in the form of inclusion bodies. Unless otherwise specified, all of the following steps are conducted at 4-10°C.
Upon completion of the production phase of the E. coli fermentation, the cell culture is cooled to 4-10°C and the cells are harvested by continuous centrifugation at 15,000 rpm (Heraeus Sepatech). On the basis of the expected yield of protein per unit weight of cell paste and the amount of purified protein required, an appropriate amount of cell paste, by weight, is suspended in a buffer solution containing 100 mM Tris, 50 mM ΕDTA, pH 7.4. The cells are dispersed to a homogeneous suspension using a high shear mixer.
The cells ware then lysed by passing the solution through a microfluidizer
(Microfuidics, Corp. or APV Gaulin, Inc.) twice at 4000-6000 psi. The homogenate is then mixed with NaCl solution to a final concentration of 0.5 M NaCl, followed by centrifugation at 7000 xg for 15 min. The resultant pellet is washed again using 0.5M NaCl, 100 mM Tris, 50 mM ΕDTA, pH 7.4.
The resulting washed inclusion bodies are solubilized with 1.5 M guanidine hydrochloride (GuHCl) for 2-4 hours. After 7000 xg centrifugation for 15 min., the pellet is discarded and the CKβ -13 polypeptide-containing supernatant is incubated at 4°C overnight to allow further GuHCl extraction. Following high speed centrifugation (30,000 xg) to remove insoluble particles, the GuHCl solubilized protein is refolded by quickly mixing the GuHCl extract with 20 volumes of buffer containing 50 mM sodium, pH 4 5, 150 mM NaCl,
2 mM EDTA by vigorous stirring The refolded diluted protein solution is kept at 4°C without mixing for 12 hours prior to further purification steps
To clarify the refolded CKβ- 13 polypeptide solution, a previously prepared tangential filtration unit equipped with 0 16 μm membrane filter with appropriate surface area (e g , Filtron), equilibrated with 40 mM sodium acetate, pH 6 0 is employed The filtered sample is loaded onto a cation exchange resin (e g , Poros HS-50, Perseptive Biosystems) The column is washed with 40 mM sodium acetate, pH 6 0 and eluted with 250 mM, 500 mM, 1000 mM, and 1500 mM NaCl in the same buffer, in a stepwise manner The absorbance at 280 mm of the effluent is continuously monitored. Fractions are collected and further analyzed by SDS- PAGE Fractions containing the CKβ- 13 polypeptide are then pooled and mixed with
4 volumes of water The diluted sample is then loaded onto a previously prepared set of tandem columns of strong anion (Poros HQ-50, Perseptive Biosystems) and weak anion (Poros CM-20, Perseptive Biosystems) exchange resins The columns are equilibrated with 40 mM sodium acetate, pH 6 0 Both columns are washed with 40 mM sodium acetate, pH 6 0, 200 mM NaCl The CM-20 column is then eluted using a 10 column volume linear gradient ranging from 0 2 M NaCl, 50 mM sodium acetate, pH 6 0 to 1 0 M NaCl, 50 mM sodium acetate, pH 6 5 Fractions are collected under constant A280 monitoring of the effluent Fractions containing the CKβ- 13 polypeptide (determined, for instance, by 16% SDS-PAGE) are then pooled
The resultant CKβ- 13 polypeptide exhibits greater than 95% purity after the above refolding and purification steps No major contaminant bands are observed from Commassie blue stained 16% SDS-PAGE gel when 5 μg of purified protein is loaded The purified protein is also tested for endotoxin/LPS contamination, and typically the LPS content is less than 0 1 ng/ml according to LAL assays Example 2: Cloning and Expression of CKβ-13 protein in a Baculovirus Expression System
In this example, the plasmid shuttle vector pA2 was used to insert the cloned
DNA encoding complete protein, including its naturally associated secretory signal (leader) sequence, into a baculovirus to express the mature CKβ- 13 protein, using standard methods as described in Summers et al, A Manual of Methods for Baculovirus Vectors and Insect Cell Culture Procedures, Texas Agricultural Experimental Station Bulletin No. 1555 (1987). This expression vector contains the strong polyhedrin promoter of the Autographa calif ornica nuclear polyhedrosis virus (AcMNPV) followed by convenient restriction sites such as BamHI, Xba I and Asp718. The polyadenylation site of the simian virus 40 ("SV40") is used for efficient polyadenylation. For easy selection of recombinant virus, the plasmid contains the beta-galactosidase gene from E. coli under control of a weak Drosophila promoter in the same orientation, followed by the polyadenylation signal of the polyhedrin gene. The inserted genes are flanked on both sides by viral sequences for cell-mediated homologous recombination with wild-type viral DNA to generate a viable virus that express the cloned polynucleotide. Many other baculovirus vectors could be used in place of the vector above, such as pAc373, pVL941 and pAcIMl, as one skilled in the art would readily appreciate, as long as the construct provides appropriately located signals for transcription, translation, secretion and the like, including a signal peptide and an in- frame AUG as required. Such vectors are described, for instance, in Luckow et al, Virology 170:31-39 (1989).
The cDNA sequence encoding the full length CKβ- 13 protein in the deposited clone, including the AUG initiation codon and the naturally associated leader sequence shown in SEQ ID NO: 2, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene. The 5' primer has the sequence 5' AAAGGATCCGCCACCATGGCTCGCCTACAGACT 3' (SEQ ID NO:6) containing a BamHI restriction enzyme site (bold), and an efficient signal for initiation of translation in eukaryotic cells, as described by Kozak, M., J. Mol. Biol. 196:947-950 (1987). The 3' primer has the sequence
5' AAAGGTACCTCATTGGCTCAGCTTATT 3' (SEQ ID NO:7) containing an Asp718 restriction enzyme site (bold).
The amplified fragment was isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca ). The fragment then was digested with BamHI and Asp718 and again is purified on a 1% agarose gel. The plasmid was digested with the restriction enzymes BamHI and Asp718 and optionally, can be dephosphorylated using calf intestinal phosphatase, using routine procedures known in the art. The DNA was then isolated from a 1% agarose gel using a commercially available kit ("Geneclean" BIO 101 Inc., La Jolla, Ca ).
The fragment and dephosphorylated plasmid were ligated together with T4 DNA ligase. E. coli HB101 or other suitable E. coli hosts such as XL-1 Blue (Statagene Cloning Systems, La Jolla, CA) cells were transformed with the ligation mixture and spread on culture plates. Bacteria were identified that contain the plasmid with the human CKβ- 13 gene by digesting DNA from individual colonies using BamHI and Asp718 and then analyzing the digestion product by gel electrophoresis. The sequence of the cloned fragment was confirmed by DNA sequencing. This plasmid is designated herein pA2CKβ-13.
Five μg of the plasmid pA2CKβ-13 was co-transfected with 1.0 μg of a commercially available linearized baculovirus DNA ("BaculoGold™ baculovirus DNA", Pharmingen, San Diego, CA), using the lipofection method described by Feigner et al., Prυc. Natl. Acad. Sci. USA 84: 7413-7417 (1987). One μg of BaculoGold™ virus DNA and 5 μg of the plasmid pA2CKβ-13 were mixed in a sterile well of a microtiter plate containing 50 μl of serum-free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards, 10 μl Lipofectin plus 90 μl Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added drop-wise to Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1 ml Grace's medium without serum. The plate was then incubated for 5 hours at 27° C. The transfection solution was then removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf serum was added. Cultivation was then continued at 27° C for four days.
After four days the supernatant was collected and a plaque assay was performed, as described by Summers and Smith, supra. An agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used to allow easy identification and isolation of gal-expressing clones, which produce blue-stained plaques. (A detailed description of a "plaque assay" of this type can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10). After appropriate incubation, blue stained plaques were picked with the tip of a micropipettor (e.g., Eppendorf). The agar containing the recombinant viruses was then resuspended in a microcentrifuge tube containing 200 μl of Grace's medium and the suspension containing the recombinant baculovirus was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4° C. The recombinant virus is called V-CKβ-13.
To verify the expression of the CKβ- 13 gene Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated FBS. The cells were infected with the recombinant baculovirus V- CKβ- 13 at a multiplicity of infection ("MOI") of about 2. 6 hours later the medium is removed and is replaced with SF900 II medium minus methionine and cysteine (available from Life Technologies Inc., Rockville, MD). After 42 hours, 5 μCi of 35S-methionine and 5 μCi 35S-cysteine (available from Amersham) were added. The cells were further incubated for 16 hours and then harvested by centrifugation. The proteins in the supernatant as well as the intracellular proteins were analyzed by SDS-PAGE followed by autoradiography (if radiolabeled). Microsequencing of the amino acid sequence of the amino terminus of purified proteins was used to determine the amino terminal sequence of the mature of the CKβ- 13 protein, and thus the leader and mature forms, as described above.
Example 3: Expression of Recombinant CKβ-13 in COS Cells
The expression of plasmid CKβ-13HA is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire CKβ- 13 precursor and an HA tag fused in frame to its 3' end is cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag corresponds to an epitope derived from the influenza hemaglutinin protein as previously described (I. Wilson et al., 1984, Cell 37, 767). The fusion of an HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope. The plasmid construction strategy is described as follows: The DNA sequence encoding CKβ-13, ATCC # 97113, is constructed by PCR using two primers: The 5' primer
5' AAAAAGCTTAACATAGGCTCGCCTACAGACT 3' (SEQ ID NO: 8) contains a Hindlll site followed by 18 nucleotides of CKβ- 13 coding sequence starting from the minus 3 position relative to the initiation codon; the 3' primer 5'CGCTCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTATTGGCTCAGC TTATTGAGAAT 3' (SEQ ID NO:9) contains complementary sequence to an Xbal site, translation stop codon, HA tag and the last 21 nucleotides of the CKβ- 13 coding sequence (not including the stop codon). Therefore, the PCR product contains a Hindlll site, CKβ- 13 coding sequence followed by an HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNA3/Amp, are digested with Hindlll and Xbal restriction enzyme and ligated. The ligation mixture is transformed into E. coli strain SURE (Stratagene Cloning Systems, La Jolla, CA) the transformed culture is plated on ampicillin media plates and resistant colonies are selected. Plasmid DNA is isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant CKβ-13 polypeptide, COS cells are transfected with the expression vector by DEAE-DEXTRAN method (J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1989)). The expression of the CKβ-13 HA protein is detected by radiolabelling and immunoprecipitation method (E. Harlow et al., Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells are labelled for 8 hours with 35-S-Cysteine two days post transfection. Culture media are then collected and cells are lysed with detergent (REP A buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50mM Tris, pH 7.5) (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media are precipitated with an HA specific monoclonal antibody. Proteins precipitated are analyzed by SDS-PAGE.
Example 4: Expression via Gene Therapy
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temp, over night. After 24 hours at room temp., the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media, e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin, is added. This is then incubated at 37 degrees C for approximately one week. At this time fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks. pMV-7 (Kirschmeier, P.T. et al. DNA, 7:219-25 (1988) flanked by the long terminal repeats of the Moloney murine sarcoma virus is digested with EcoRI and Hindlll and subsequently treated with calf intestinal alkaline phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding a polypeptide of the present invention is amplified using PCR primers which correspond tolhe 5' and 3' end sequences respectively. The 5' primer containing an EcoRI site and the 3' primer further includes a Hindlll site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is used to transform bacteria HB101 , which are then plated onto agar-containing kanamycin for the purpose of confirming that the vector had the gene of interest properly inserted.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10%) calf serum (CS), penicillin and streptomycin. The MSV vector containing the gene is then added to the media and the packaging cells are transduced with the vector. The packaging cells now produce infectious viral particles containing the gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently the media is harvested from a 10cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titier is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product. Example 5: Chemotactic Effect of CKβ-13 on Activated T-lymphocytes
Peripheral blood mononuclear cells were purified from donor leukopacks (Red Cross) by centrifugation on lymphocyte separation medium (LSM; density 1.077 g/ml; Organon Teknika Corp.) and harvesting the interface band. T- lymphocytes purified from the PBMCs using T-cell enrichment columns (R&D Systems). For activation of the T-lymphocytes, cells were stimulated by crosslinking through the CD3 receptor in the presence of EL-2 (10 U/ml) for 16 hours prior to the chemotaxis assay. Cells used for the assay were washed 3X with HBSS/01% BSA and resuspended at 2 x 106/ml for labeling. Calcein-AM (Molecular Probes) was added to a final concentration of 1 mM and the cells incubated at 37°C for 30 minutes. Following this incubation the cells were washed 3X with HBSS/01% BSA. Labeled cells were resuspended as 4-8 x lOVml and 25ml (1-2 x 105 cells) added to the top of a polycarbonate filter (3-5 mm pore size; PVP free; NeuroProbe, Inc.) which separates the cell suspension from the chemotactic agent in the plate below. Cells are allowed to migrate for 45 - 90 minutes and then the number of migrated cells (both attached to the filter as well as in the bottom plate) are quantitated using a Cytofluor II fluorescence plate reader (PerSeptive Biosystems).
Activated T-lymphocytes from three different donors were used for chemotaxis assays as described above. The data for MCP-1 (open circles) and CkBeta-13 (closed triangles) are presented as the chemotactic index (the ratio between the number of cells migrated in the presence of chemokines and the number of cells migrated in the presence of buffer control) in Figure 4.
Example 6: CKBeta-13 Modulates the VLA-4-VCAM-1 Adhesion Pathway in CD4+ Memory and Naϊve T cells Under Flow Conditions.
In this assay a well characterized in vitro flow model is used to examine the ability of CKβ- 13 to modulate the VLA-4 - VCAM-1 adhesion pathway in CD4+ naive and memory T cells adhesion. (See, e.g., Luscinskas et al. J Cell Biol. 1251417 (1994) and Luscinskas et al. J. Exp. Med. 1811179 (1995); both references in their entirety are hereby incorporated herein by reference.)
T cell interactions with immobilized VCAM-1 on coverslips with or without CKβ- 13 under defined laminar flow were studied using a parallel plate flow chamber. Purified T cell subsets were resuspended in RPMI containing 10% FCS at 25 x 106/ml and incubated for 5 minutes at 37°C. Cells were treated with medium alone, or media containing CKβ- 13 at various concentrations for a further 5 minutes at 37°C, diluted to 5 x lOVml in prewar ed (37°C) DPBS containing 0.1% (v/v) HAS and perfused across coverslips at 2.0 dynes/cm2 (1 ml/min) for 3 min and then at decreasing levels of shear stress in increments of 3 minutes. The entire assay was videotaped. The number of rolling and firmly adhered cells were determined at each shear stess offline. T cell accumulation and instantaneous rate of attachment, ka, were measured in four randomly chosen fields. Accumulated cells included T cells that were either rolling on or firmly adhered to VCAM-1 coated coverslips. As shown in Figure 5 top panel, pretreatment of naϊve CD4+ T cells with
CKβ- 13 caused a dose-dependent increase in cell accumulation across a range of estimated shear stresses. In contrast, as shown in Figure 5 bottom panel, under identical conditions CKβ- 13 decreased memory T cell accumulation with a range of inhibition between 42-72% (N=4) at 1 dynes/cm 2. This concentration range for CKβ- 13 is chemotactic for both T cell subsets (data not shown).
Example 7: CKβ-13 Co-Immobilized with VCAM-1 the VLA-4-VCAM-1 Adhesion Pathway in CD4+ Memory and Naϊve T cells Under Flow Conditions.
Soluble human VCAM-1 IgG fusion protein, expressed by a recombinant baculovirus was absorbed at saturating concentrations to 25 mm glass coverslips using goat F(ab')2 anti-human Fc antibody. CKβ- 13 was adsorbed to VCAM-1 coated coverslips by incubating a 20 ul aliquot of 100 ng/ml CKβ- 13 for 10 minutes followed by extensive washing with DPBS just prior to use in the flow assay. Purified T cell subsets were incubated with perfusion buffer alone or buffer containing CKβ- 13 (100 ng/ml) for 5 minutes and perfused across coverslips containing VCAM-1 or VCAM-1 co-immobilized with CKβ-13 (100 ng/ml). T cell accumulation at each shear was determined as in Example 6. Either protocol led to a significant drop in memory T cell accumulation and conversely, an increase in naive T cell accumulation (Figure 6). No cell adhesion to CKβ- 13 immobilized alone (without VCAM-1) was observed. These data suggest that independent of the mode of presentation, CKβ- 13 exerted specific, but opposing effects, on T cell subset VLA-4 dependent adhesion to VCAM-1 under flow.
Example 8: CKβ-13 modulates CD4+ T cell subset accumulation on VCAM-1 -transduced or TNF- activated HUVEC monolayers underflow.
HUVEC were induced to selectively express VCAM-1 by transfection of HUVEC with a VCAM-1 adenovirus. CD4+ naϊve or memory T cells, either untreated or treated with CKβ- 13 (100 ng/ml, 5 min prior to perfusion), were perfused across VCAM-1 -expressing HUVEC monolayers. Accumulation of lymphocytes was measured over a range of shear stresses and is shown in Figure 7A.
CKβ- 13 reduces memory T cell adhesion to 4 hr TNF-α activated HUVEC monolayers. HUVEC were treated for 4 hr with culture media alone or media containing 25 ng/ml of recombinant human TNF-α and inserted into the flow plate apparatus. Memory T cells were treated for 5 min with media or media containing 100 ng/ml CKβ-13 and then perfused across HUVEC monolayers at 1.2 dynes/cm2. Flow was sequentially reduced every 3 min to the indicated level of estimated shear stress. Memory T cell accumulation at each shear stress was determined as in Example 6. Data shown in Figure 7B are from n=3 separate experiments. These data suggest that CKβ- 13 preferentially effects the VLA-4- VCAM-1 pathway of T cell- endothelial cell adhesion. Example 9: mAb to CCR4 totally blocks CKβ-13 effects on T cells interactions with VCAM-1.
T cell subsets were incubated with the mAb 1G1, specific for the CKβ- 13 cell receptor, CCR4; or mAb specific for an unrelated receptor CCR2 (each at 20 ug/ml, 20 min at 37°C) and then CKβ-13 (100 ng/ml) was added 5 min prior to perfusion across VCAM-1 at 1 dynes/cm2. Naϊve cells, which do not express CCR4 were included as a control. T cell accumulation was assessed as in Example 6. Data are n=2 for naive and n=3 for memory T cells. CKβ- 13 signals through the CCR4 in memory T cells to down regulate VLA-4 interactions with VCAM-1 as shown in Figure 8.
Example 10: Construction of N-Terminal and/or C-Terminal Deletion Mutants of CKβ-13.
The following general approach may be used to clone a N-terminal or C- terminal deletion CKβ- 13 deletion mutant. Generally, two oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NO1. The 5' and 3' positions of the primers are determined based on the desired CKβ- 13 polynucleotide fragment. An initiation and stop codon are added to the 5' and 3' primers respectively, if necessary, to express the CKβ- 13 polypeptide fragment encoded by the polynucleotide fragment Preferred CKβ- 13 polynucleotide fragments are those encoding the N-terminal and C-terminal deletion mutants disclosed above in the "Polynucleotide and Polypeptide Fragments" section of the Specification.
Additional nucleotides containing restriction sites to facilitate cloning of the CKβ-13 polynucleotide fragment in a desired vector may also be added to the 5' and 3' primer sequences. The CKβ- 13 polynucleotide fragment is amplified from genomic DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art. The CKβ- 13 polypeptide fragments encoded by the CKβ- 13 polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide. As a means of exemplifying but not limiting the present invention, the polynucleotide encoding the CKβ-13 polypeptide fragment A-29 to Q-93 is amplified and cloned as follows: A 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence encoding the N-terminal portion of the polypeptide fragment beginning with A-29. A complementary 3' primer is generated comprising a restriction enzyme site followed by a stop codon in frame with the polynucleotide sequence encoding C-terminal portion of the CKβ- 13 polypeptide fragment ending with Q-93.
The amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers. The digested polynucleotides are then ligated together. The CKβ- 13 polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the CKβ- 13 polypeptide fragment coding region downstream from the promoter. The ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
Example 11: Tissue Distribution ofCKβ-13 Polypeptides
Tissue distribution of mRNA expression of CKβ- 13 is determined using protocols for Northern blot analysis, described by, among others, Sambrook et al. For example, a CKβ- 13 polynucleotide may be amplified as described in Example 1 and labeled with P32 using the rediprime™ DNA labeling system (Amersham Life Science), according to manufacturer's instructions to generate a CKβ- 13 specific probe. After labeling, the probe is purified using CHROMA SPIN- 100™ column (Clontech Laboratories, Inc.), according to manufacturer's protocol number PT1200- 1. The purified labeled probe is then used to examine various human tissues for mRNA expression.
Multiple Tissue Northern (MTN) blots containing various human tissues (H) or human immune system tissues (IM) (Clontech) are examined with the labeled probe using ExpressHyb™ hybridization solution (Clontech) according to manufacturer's protocol number PT 1190-1. Following hybridization and washing, the blots are mounted and exposed to film at -70 degree C overnight, and the films developed according to standard procedures.
Example 12: Chromosomal Mapping ofCKβ-13.
An oligonucleotide primer set is designed according to the sequence at the 5' end of SEQ ID NO1. This primer preferably spans about 100 nucleotides. This primer set is then used in a polymerase chain reaction under the following set of conditions : 30 seconds, 95 degree C; 1 minute, 56 degree C; 1 minute, 70 degree C. This cycle is repeated 32 times followed by one 5 minute cycle at 70 degree C. Human, mouse, and hamster DNA is used as template in addition to a somatic cell hybrid panel containing individual chromosomes or chromosome fragments (Bios, Inc). The reactions is analyzed on either 8% polyacrylamide gels or 3.5 % agarose gels. Chromosome mapping is determined by the presence of an approximately 100 bp PCR fragment in the particular somatic cell hybrid.
Example 13: Protein Fusions ofCKβ-13. CKβ- 13 polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of CKβ- 13 polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Example 1; see also EP A 394,827; Traunecker, et al., Nature 331 :84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo. Nuclear localization signals fused to CKβ-13 polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein compared to the non-fused protein. All of the types of fusion proteins described above can be made by modifying the following protocol, which outlines the fusion of a polypeptide to an IgG molecule, or the protocol described in Example 1.
Briefly, the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5' and 3' ends of the sequence described below. These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.
For example, if pC4 (Accession No. 209646) is used, the human Fc portion can be ligated into the BamHI cloning site. Note that the 3' BamHI site should be destroyed. Next, the vector containing the human Fc portion is re-restricted with BamHI, linearizing the vector, and CKβ-13 polynucleotide, isolated by the PCR protocol described in Example 1, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.
If the naturally occurring signal sequence is used to produce the secreted protein, pC4 does not need a second signal peptide. Alternatively, if the naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence. (See, e.g., WO 96/34891.)
Human IgG Fc region: GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCAC
CGTGCCCAGCACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCC CCAAAACCCAAGGACACCCTCATGATCTCCCGGACTCCTGAGGTCACATG CGTGGTGGTGGACGTAAGCCACGAAGACCCTGAGGTCAAGTTCAACTGG TACGTGGACGGCGTGGAGGTGCATAATGCCAAGACAAAGCCGCGGGAGG AGC AGT AC AAC AGC ACGT ACCGTGTGGTC AGCGTCCTC ACCGTCCTGC AC CAGGACTGGCTGAATGGCAAGGAGTACAAGTGCAAGGTCTCCAACAAAG CCCTCCCAACCCCCATCGAGAAAACCATCTCCAAAGCCAAAGGGCAGCCC CGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGATGAGCTGACCA AGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCCAAGCGAC ATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACAAGA CCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAG CTCACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCT CCGTGATGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCC CTGTCTCCGGGTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT (SEQ ID NO: 10)
Example 14: Production of an Antibody
a) Hybridoma Technology
The antibodies of the present invention can be prepared by a variety of methods. (See, Current Protocols, Chapter 2.) As one example of such methods, cells expressing CKβ- 13 is administered to an animal to induce the production of sera containing polyclonal antibodies. In a preferred method, a preparation of CKβ- 13 protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
In the most preferred method, the antibodies of the present invention are monoclonal antibodies (or protein binding fragments thereof). Such monoclonal antibodies can be prepared using hybridoma technology. (Kόhler et al, Nature 256:495 (1975); Kόhler et al., Eur. J. Immunol. 6:511 (1976); Kόhler et al, Eur. J. Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981).) In general, such procedures involve immunizing an animal (preferably a mouse) with CKβ- 13 polypeptide or, more preferably, with a secreted CKβ- 13 polypeptide-expressing cell. Such cells may be cultured in any suitable tissue culture medium; however, it is preferable to culture cells in Earle's modified Eagle's medium supplemented with 10% fetal bovine serum (inactivated at about 56 degree C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 ug/ml of streptomycin.
The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981).) The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding the CKβ- 13 polypeptide.
Alternatively, additional antibodies capable of binding to CKβ- 13 polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody. In accordance with this method, protein specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the CKβ- 13 protein-specific antibody can be blocked by CKβ-13. Such antibodies comprise anti-idiotypic antibodies to the CKβ- 13 protein-specific antibody and can be used to immunize an animal to induce formation of further CKβ- 13 protein-specific antibodies. It will be appreciated that Fab and F(ab')2 and other fragments of the antibodies of the present invention may be used according to the methods disclosed herein. Such fragments are typically produced by proteolytic cleavage, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). Alternatively, secreted CKβ- 13 protein-binding fragments can be produced through the application of recombinant DNA technology or through synthetic chemistry.
For in vivo use of antibodies in humans, it may be preferable to use "humanized" chimeric monoclonal antibodies. Such antibodies can be produced using genetic constructs derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. (See, for review, Morrison, Science 2291202 (1985); Oi et al, BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al, WO 8702671; Boulianne et al, Nature 312:643 (1984); Neuberger et al, Nature 314:268 (1985).)
b) Isolation of antibody fragments directed against CKβ-13 from a library of scFvs.
Naturally occuring V-genes isolated from human PBLs are constructed into a large library of antibody fragments which contain reactivities against CKβ- 13 to which the donor may or may not have been exposed (see e.g., U.S. Patent 5,885,793 incorporated herein in its entirety by reference). Rescue of the Library. A library of scFvs is constructed from the RNA of human PBLs as described in WO92/01047. To rescue phage displaying antibody fragments, approximately 109 E. coli harbouring the phagemid are used to inoculate 50 ml of 2xTY containing 1% glucose and 100 ug/ml of ampicillin (2xTY-AMP- GLU) and grown to an O.D. of 0.8 with shaking. Five ml of this culture is used to innoculate 50 ml of 2xTY-AMP-GLU, 2 x 108 TU of delta gene 3 helper (Ml 3 delta gene III, see WO92/01047) are added and the culture incubated at 37 degree C for 45 minutes without shaking and then at 37 degree C for 45 minutes with shaking. The culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet resuspended in 2 liters of of 2xTY containing 100 ug/ml ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are prepared as described in WO92/01047. M13 delta gene III is prepared as follows: Ml 3 delta gene III helper phage does not encode gene III protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious Ml 3 delta gene III particles are made by growing the helper phage in cells harbouring a pUC19 derivative supplying the wild type gene III protein during phage morphogenesis. The culture is incubated for 1 hour at 37 degree C without shaking and then for a further hour at 37 degree C with shaking. Cells are spun down (IEC-Centra 8, 4000 revs/min for 10 min), resuspended in 300 ml 2xTY broth containing 100 ug ampicillin/ml and 25 ug kanamycin/ml (2xTY- AMP-KAN) and grown overnight, shaking at 37° C. Phage particles are purified and concentrated from the culture medium by two PEG- precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 um filter (Minisart NML; Sartorius) to give a final concentration of approximately 1013 transducing units/ml (ampicillin-resistant clones).
Panning of the Library. Immuno tubes (Nunc) are coated overnight in PBS with 4 ml of either 100 ug/ml or 10 ug/ml of a polypeptide of the present invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37 degree C and then washed 3 times in PBS. Approximately 1013 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TGI by incubating eluted phage with bacteria for 30 minutes at 37 degree C. The E. coli are then plated on TYE plates containing 1% glucose and 100 ug/ml ampicillin. The resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection. This process is then repeated for a total of 4 rounds of affinity purification with tube-washing increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS for rounds 3 and 4. Characterization of Binders. Eluted phage from the 3rd and 4th rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al, 1991) from single colonies for assay. ELISAs are performed with microtitre plates coated with either 10 pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR fingerprinting (see e.g., WO92/01047) and then by sequencing.
Example 15: Production Of CKβ- 13 Protein For High-Throughput Screening Assays The following protocol produces a supernatant containing CKβ- 13 polypeptide to be tested. This supernatant can then be used in the Screening Assays described in Examples 17-21.
First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution (lmg/ml in PBS) 1 :20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a working solution of 50ug/ml. Add 200 ul of this solution to each well (24 well plates) and incubate at RT for 20 minutes. Be sure to distribute the solution over each well (note: a 12-channel pipetter may be used with tips on every other channel). Aspirate off the Poly-D-Lysine solution and rinse with 1ml PBS (Phosphate Buffered Saline). The PBS should remain in the well until just prior to plating the cells and plates may be poly-lysine coated in advance for up to two weeks.
Plate 293T cells (do not carry cells past P+20) at 2 x 105 cells/well in 5ml DMEM(Dulbecco's Modified Eagle Medium)(with 4.5 G/L glucose and L-glutamine (12-604F Biowhittaker))/ 10% heat inactivated FBS(14-503F Biowhittaker)/lx Penstrep(17-602E Biowhittaker). Let the cells grow overnight. The next day, mix together in a sterile solution basin: 300 ul Lipofectamine
(18324-012 Gibco/BRL) and 5ml Optimem I (31985070 Gibco/BRL)/96-well plate. With a small volume multi-channel pipetter, aliquot approximately 2ug of an expression vector containing a polynucleotide insert, produced by the methods described in Examples 1-3, into an appropriately labeled 96-well round bottom plate. With a multi-channel pipetter, add 50ul of the Lipofectamine/Optimem I mixture to each well Pipette up and down gently to mix Incubate at RT 15-45 minutes After about 20 minutes, use a multi-channel pipetter to add 150ul Optimem I to each well As a control, one plate of vector DNA lacking an insert should be transfected with each set of transfections Preferably, the transfection should be performed by tag-teaming the following tasks By tag-teaming, hands on time is cut in half, and the cells do not spend too much time on PBS First, person A aspirates off the media from four 24-well plates of cells, and then person B rinses each well with 5- lml PBS Person A then aspirates off PBS rinse, and person B, using al2-channel pipetter with tips on every other channel, adds the 200ul of DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even wells, to each row on the 24-well plates Incubate at 37 degree C for 6 hours
While cells are incubating, prepare appropriate media, either 1%BSA in DMEM with lx penstrep, or HGS CHO-5 media (116 6 mg/L of CaC12 (anhyd), 0 00130 mg/L CuSO4-5H2O, 0 050 mg/L of Fe(NO3)3-9H2O, 0 417 mg/L of FeSO4-7H2O, 311 80 mg/L of Kcl, 28 64 mg/L of MgC12, 48 84 mg/L of MgSO4, 6995 50 mg/L of NaCl, 2400 0 mg/L of NaHCO3, 62 50 mg/L of NaH2PO4-H20, 71 02 mg/L of Na2HPO4, 4320 mg/L of ZnSO4-7H2O, 002 mg/L of Arachidonic Acid , 1 022 mg/L of Cholesterol, 070 mg/L of DL-alpha-Tocopherol-Acetate, 0 0520 mg/L of Linoleic Acid, 0 010 mg/L of Linolenic Acid, 0 010 mg/L of Myristic Acid, 0 010 mg/L of Oleic Acid, 0 010 mg/L of Palmitπc Acid, 0 010 mg/L of Palmitic Acid, 100 mg/L of Pluronic F-68, 0 010 mg/L of Stearic Acid, 2 20 mg/L of Tween 80, 4551 mg/L of D-Glucose, 130 85 mg/ml of L- Alanine, 147 50 mg/ml of L-Arginine-HCL, 7 50 mg/ml of L-Asparagine-H20, 6 65 mg/ml of L-Aspartic Acid, 29 56 mg/ml of L-Cystine-2HCL-H20, 31 29 mg/ml of L-Cystine-2HCL, 7 35 mg/ml of L-Glutamic Acid, 365 0 mg/ml of L-Glutamine, 18 75 mg/ml of Glycine, 52 48 mg/ml of L-Histidine-HCL-H20, 106 97 mg/ml of L-Isoleucine, 111 45 mg/ml of L- Leucine, 163 75 mg/ml of L-Lysine HCL, 32 34 mg/ml of L-Methionine, 68 48 mg/ml of L-Phenylalainine, 40 0 mg/ml of L-Proline, 26 25 mg/ml of L-Serine, 101 05 mg/ml of L-Threonine, 19 22 mg/ml of L-Tryptophan, 91 79 mg/ml of L- Tryrosine-2Na-2H20; and 99.65 mg/ml of L-Valine; 0.0035 mg/L of Biotin; 3.24 mg/L of D-Ca Pantothenate; 11.78 mg/L of Choline Chloride; 4.65 mg/L of Folic Acid; 15.60 mg/L of i-Inositol; 3.02 mg/L of Niacinamide; 3.00 mg/L of Pyridoxal HCL; 0.031 mg/L of Pyridoxine HCL; 0.319 mg/L of Riboflavin; 3.17 mg/L of Thiamine HCL; 0.365 mg/L of Thymidine; 0.680 mg L of Vitamin B12; 25 mM of HEPES Buffer; 2.39 mg/L of Na Hypoxanthine; 0.105 mg/L of Lipoic Acid; 0.081 mg/L of Sodium Putrescine-2HCL; 55.0 mg/L of Sodium Pyruvate; 0.0067 mg/L of Sodium Selenite; 20uM of Ethanolamine; 0.122 mg/L of Ferric Citrate; 41.70 mg/L of Methyl-B-Cyclodextrin complexed with Linoleic Acid; 33.33 mg/L of Methyl-B- Cyclodextrin complexed with Oleic Acid; 10 mg/L of Methyl-B-Cyclodextrin complexed with Retinal Acetate. Adjust osmolarity to 327 mOsm) with 2mm glutamine and lx penstrep. (BSA (81-068-3 Bayer) lOOgm dissolved in 1L DMEM for a 10%) BSA stock solution). Filter the media and collect 50 ul for endotoxin assay in 15ml polystyrene conical. The transfection reaction is terminated, preferably by tag-teaming, at the end of the incubation period. Person A aspirates off the transfection media, while person B adds 1.5ml appropriate media to each well. Incubate at 37 degree C for 45 or 72 hours depending on the media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
On day four, using a 300ul multichannel pipetter, aliquot 600ul in one 1ml deep well plate and the remaining supernatant into a 2ml deep well. The supernatants from each well can then be used in the assays described in Examples 17-24.
It is specifically understood that when activity is obtained in any of the assays described below using a supernatant, the activity originates from either the CKβ- 13 polypeptide directly (e.g., as a secreted protein) or by CKβ- 13 inducing expression of other proteins, which are then secreted into the supernatant. Thus, the invention further provides a method of identifying the protein in the supernatant characterized by an activity in a particular assay. Example 16: Construction of GAS Reporter Construct
One signal transduction pathway involved in the differentiation and proliferation of cells is called the Jaks-STATs pathway. Activated proteins in the
Jaks-STATs pathway bind to gamma activation site "GAS" elements or interferon- sensitive responsive element ("ISRE"), located in the promoter of many genes. The binding of a protein to these elements alter the expression of the associated gene.
GAS and ISRE elements are recognized by a class of transcription factors called Signal Transducers and Activators of Transcription, or "STATs." There are six members of the STATs family. Statl and Stat3 are present in many cell types, as is Stat2 (as response to IFN-alpha is widespread). Stat4 is more restricted and is not in many cell types though it has been found in T helper class I, cells after treatment with IL-12. Stat5 was originally called mammary growth factor, but has been found at higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines. The STATs are activated to translocate from the cytoplasm to the nucleus upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase ("Jaks") family. Jaks represent a distinct family of soluble tyrosine kinases and include Tyk2, Jakl, Jak2, and Jak3. These kinases display significant sequence similarity and are generally catalytically inactive in resting cells. The Jaks are activated by a wide range of receptors summarized in the Table below. (Adapted from review by Schidler and Darnell, Ann. Rev. Biochem. 64:621- 51 (1995).) A cytokine receptor family, capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, EL-4, EL-6, EL-7, EL-9, IL-11, IL-12, EL-15, Epo, PRL, GH, G-CSF, GM-CSF, LEF, CNTF, and thrombopoietin; and (b) Class 2 includes EFN-a, IFN-g, and EL- 10. The Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and one tryptophan) and a WSXWS motif (a membrane proximal region encoding Trp-Ser-Xxx-Trp-Ser (SEQ ID NO: 5)). Thus, on binding of a ligand to a receptor, Jaks are activated, which in turn activate STATs, which then translocate and bind to GAS elements. This entire process is encompassed in the Jaks-STATs signal transduction pathway.
Therefore, activation of the Jaks-STATs pathway, reflected by the binding of the GAS or the ISRE element, can be used to indicate proteins involved in the proliferation and differentiation of cells. For example, growth factors and cytokines are known to activate the Jaks-STATs pathway. (See Table below.) Thus, by using GAS elements linked to reporter molecules, activators of the Jaks-STATs pathway can be identified.
JAKs
STATS
GAS (elements)
Ligand tvk2 Jakl Jak2 Jak3 or ISRE
IFN familv
IFN-α/B + + - 1Λ3 ISRE
IFN-γ + + 1 GAS (IRFl>Lys6>IFP)
11-10 + 1,3
e l30 familv
IL-6 (Pleiotrohic) + + + ? 1,3 GAS (IRFl>Lys6>IFP)
11-11 (Pleiotrohic) ? + ? ? 1,3
OnM (Pleiotrohic) ? + + ? 1,3
LIF(Pleiotrohic) ? + + ? 1,3
CNTF(Pleiotrohic) -/+ + + ? 1,3
G-CSF(Pleiotrohic) ? + ? ? 1,3
IL-12(Pleiotrohic) + - + + 1,3 g-C family
IL-2 (lymphocytes) + - + 1,3,5 GAS
IL-4 (lymph/myeloid) + - + 6 GAS (IRF1=IFP
>Ly6)(IgH)
IL-7 (lymphocytes) + - + 5 GAS IL-9 (lymphocytes) + - + 5 GAS IL-13 (lymphocyte) + ? ? 6 GAS IL-15 + ? + 5 GAS
gp!40 familv IL-3 (myeloid) + GAS
(IRFl>IFP»Ly6)
IL-5 (myeloid) + GAS GM-CSF (myeloid) + GAS
Growth hormone familv GH ? + 5
PRL ? +/- + 1,3,5
EPO ? + 5 GAS(B-CAS> IRFl=IFP»Ly6)
Receptor Tyrosine Kinases
EGF ? + + 1,3 GAS (IRF1)
PDGF ? + + 1,3
CSF-1 ? + + 1,3 GAS (not ΙRFl)
To construct a synthetic GAS containing promoter element, which is used in the Biological Assays described in Examples 17-18, a PCR based strategy is employed to generate a GAS-SV40 promoter sequence. The 5' primer contains four tandem copies of the GAS binding site found in the IRFl promoter and previously demonstrated to bind STATs upon induction with a range of cytokines (Rothman et al., Immunity 1 :457-468 (1994).), although other GAS or ISRE elements can be used instead. The 5' primer also contains 18bp of sequence complementary to the SV40 early promoter sequence and is flanked with an Xhol site. The sequence of the 5' primer is: 5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATT TCCCCGAAATGATTTCCCCGAAATATCTGCCATCTCAATTAG:3' (SEQ ID NO:11)
The downstream primer is complementary to the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO12)
PCR amplification is performed using the SV40 promoter template present in the B -gal: promoter plasmid obtained from Clontech. The resulting PCR fragment is digested with Xhol/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward and reverse primers confirms that the insert contains the following sequence:
5 ' : CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCC CGAAATGATTTCCCCGAAATATCTGCCATCTCAATTAGTCAGCAACCATA GTCCCGCCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGC CCATTCTCCGCCCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGA GGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTG GAGGCCTAGGCTTTTGCAAAAAGCTT:3 ' (SEQ ID NO: 13)
With this GAS promoter element linked to the SV40 promoter, a GAS:SEAP2 reporter construct is next engineered. Here, the reporter molecule is a secreted alkaline phosphatase, or "SEAP." Clearly, however, any reporter molecule can be instead of SEAP, in this or in any of the other Examples. Well known reporter molecules that can be used instead of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline phosphatase, beta-galactosidase, green fluorescent protein (GFP), or any protein detectable by an antibody.
The above sequence confirmed synthetic GAS-SV40 promoter element is subcloned into the p SEAP -Promoter vector obtained from Clontech using Hindlll and Xhol, effectively replacing the SV40 promoter with the amplified GAS:SV40 promoter element, to create the GAS-SEAP vector. However, this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems. Thus, in order to generate mammalian stable cell lines expressing the GAS-
SEAP reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector using Sail and Notl, and inserted into a backbone vector containing the neomycin resistance gene, such as pGFP-1 (Clontech), using these restriction sites in the multiple cloning site, to create the GAS-SEAP/Neo vector. Once this vector is transfected into mammalian cells, this vector can then be used as a reporter molecule for GAS binding as described in Examples 17-18.
Other constructs can be made using the above description and replacing GAS with a different promoter sequence. For example, construction of reporter molecules containing NFK-B and EGR promoter sequences are described in Examples 20 and 19. However, many other promoters can be substituted using the protocols described in these Examples. For instance, SRE, EL-2, NFAT, or Osteocalcin promoters can be substituted, alone or in combination (e.g., GAS/NF-kappaB/EGR, GAS/NF-kappaB, I1-2/NFAT, or NF-kappaB/GAS). Similarly, other cell lines can be used to test reporter construct activity, such as HELA (epithelial), HUVEC (endothelial), Reh (B-cell), Saos-2 (osteoblast), HUVAC (aortic), or Cardiomyocyte.
Example 17: High-Throughput Screening Assay for T-cell Activity.
The following protocol is used to assess T-cell activity by identifying factors, and determining whether supernate containing a polypeptide of the invention proliferates and/or differentiates T-cells. T-cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 16. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway. The T-cell used in this assay is Jurkat T-cells (ATCC Accession No. TEB- 152), although Molt-3 cells (ATCC Accession No. CRL-1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.
Jurkat T-cells are lymphoblastic CD4+ Thl helper cells. In order to generate stable cell lines, approximately 2 million Jurkat cells are transfected with the GAS- SEAP/neo vector using DMRIE-C (Life Technologies)(transfection procedure described below). The transfected cells are seeded to a density of approximately 20,000 cells per well and transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are expanded and then tested for their response to increasing concentrations of interferon gamma. The dose response of a selected clone is demonstrated.
Specifically, the following protocol will yield sufficient cells for 75 wells containing 200 ul of cells. Thus, it is either scaled up, or performed in multiple to generate sufficient cells for multiple 96 well plates. Jurkat cells are maintained in RPMI + 10% serum with l%Pen-Strep. Combine 2.5 mis of OPTI-MEM (Life Technologies) with 10 ug of plasmid DNA in a T25 flask. Add 2.5 ml OPTI-MEM containing 50 ul of DMRIE-C and incubate at room temperature for 15-45 mins. During the incubation period, count cell concentration, spin down the required number of cells (107 per transfection), and resuspend in OPTI-MEM to a final concentration of 107 cells/ml. Then add lml of 1 x 107 cells in OPTI-MEM to T25 flask and incubate at 37 degree C for 6 hrs. After the incubation, add 10 ml of RPMI + 15% serum. The Jurkat:GAS-SEAP stable reporter lines are maintained in RPMI + 10%) serum, 1 mg/ml Genticin, and 1% Pen- Strep. These cells are treated with supernatants containing CKβ- 13 polypeptides or CKβ- 13 induced polypeptides as produced by the protocol described in Example 15.
On the day of treatment with the supernatant, the cells should be washed and resuspended in fresh RPMI + 10% serum to a density of 500,000 cells per ml. The exact number of cells required will depend on the number of supernatants being screened. For one 96 well plate, approximately 10 million cells (for 10 plates, 100 million cells) are required.
Transfer the cells to a triangular reservoir boat, in order to dispense the cells into a 96 well dish, using a 12 channel pipette. Using a 12 channel pipette, transfer 200 ul of cells into each well (therefore adding 100, 000 cells per well).
After all the plates have been seeded, 50 ul of the supernatants are transferred directly from the 96 well plate containing the supernatants into each well using a 12 channel pipette. In addition, a dose of exogenous interferon gamma (0.1, 1.0, 10 ng) is added to wells H9, HlO, and Hl l to serve as additional positive controls for the assay.
The 96 well dishes containing Jurkat cells treated with supernatants are placed in an incubator for 48 hrs (note: this time is variable between 48-72 hrs). 35 ul samples from each well are then transferred to an opaque 96 well plate using a 12 channel pipette. The opaque plates should be covered (using sellophene covers) and stored at -20 degree C until SEAP assays are performed according to Example 18. The plates containing the remaining treated cells are placed at 4 degree C and serve as a source of material for repeating the assay on a specific well if desired.
As a positive control, 100 Unit/ml interferon gamma can be used which is known to activate Jurkat T cells. Over 30 fold induction is typically observed in the positive control wells.
The above protocol may be used in the generation of both transient, as well as, stable transfected cells, which would be apparent to those of skill in the art.
Example 18: High-Throughput Screening Assay Identifying Myeloid
Activity
The following protocol is used to assess myeloid activity of CKβ- 13 by determining whether CKβ- 13 proliferates and/or differentiates myeloid cells.
Myeloid cell activity is assessed using the GAS/SEAP/Neo construct produced in Example 16. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway. The myeloid cell used in this assay is U937, a pre-monocyte cell line, although TF-1, HL60, or KG1 can be used.
To transiently transfect U937 cells with the GAS/SEAP/Neo construct produced in Example 16, a DEAE-Dextran method (Kharbanda et. al, 1994, Cell Growth & Differentiation, 5:259-265) is used. First, harvest 2xl0e7 U937 cells and wash with PBS. The U937 cells are usually grown in RPMI 1640 medium containing 10%) heat-inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100 mg/ml streptomycin.
Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing 0.5 mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid DNA, 140 mM NaCl, 5 mM KC1, 375 uM Na2.HPO4.7H2O, 1 mM MgC12, and 675 uM CaC12. Incubate at 37 degrees C for 45 min.
Wash the cells with RPMI 1640 medium containing 10% FBS and then resuspend in 10 ml complete medium and incubate at 37 degree C for 36 hr. The GAS-SEAP/U937 stable cells are obtained by growing the cells in 400 ug/ml G418. The G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 400 ug/ml G418 for couple of passages.
These cells are tested by harvesting lxl 08 cells (this is enough for ten 96-well plates assay) and wash with PBS. Suspend the cells in 200 ml above described growth medium, with a final density of 5x105 cells/ml. Plate 200 ul cells per well in the 96-well plate (or lxl 05 cells/well).
Add 50 ul of the supernatant prepared by the protocol described in Example
15. Incubate at 37 degee C for 48 to 72 hr. As a positive control, 100 Unit/ml interferon gamma can be used which is known to activate U937 cells. Over 30 fold induction is typically observed in the positive control wells. SEAP assay the supernatant according to the protocol described in Example 18. Example 19: High-Throughput Screening Assay Identifying Neuronal Activity.
When cells undergo differentiation and proliferation, a group of genes are activated through many different signal transduction pathways. One of these genes,
EGR1 (early growth response gene 1), is induced in various tissues and cell types upon activation. The promoter of EGR 1 is responsible for such induction. Using the
EGR1 promoter linked to reporter molecules, activation of cells can be assessed by
CKβ-13. Particularly, the following protocol is used to assess neuronal activity in PC 12 cell lines. PC 12 cells (rat phenochromocytoma cells) are known to proliferate and/or differentiate by activation with a number of mitogens, such as TPA (tetradecanoyl phorbol acetate), NGF (nerve growth factor), and EGF (epidermal growth factor).
The EGR1 gene expression is activated during this treatment. Thus, by stably transfecting PC 12 cells with a construct containing an EGR promoter linked to
SEAP reporter, activation of PC12 cells by CKβ-13 can be assessed.
The EGR SEAP reporter construct can be assembled by the following protocol. The EGR-1 promoter sequence (-633 to +l)(Sakamoto K et al., Oncogene 6:867-871 (1991)) can be PCR amplified from human genomic DNA using the following primers:
5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3' (SEQ ID NO: 14)
5' GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3' (SEQ ID NO15)
Using the GAS/SEAP/Neo vector produced in Example 16, EGR1 amplified product can then be inserted into this vector. Linearize the GAS:SEAP/Neo vector using restriction enzymes Xhol/Hindlll, removing the GAS/SV40 sniffer. Restrict the EGR1 amplified product with these same enzymes. Ligate the vector and the
EGR1 promoter.
To prepare 96 well-plates for cell culture, two mis of a coating solution (1 :30 dilution of collagen type I (Upstate Biotech Inc. Cat#08-115) in 30% ethanol (filter sterilized)) is added per one 10 cm plate or 50 ml per well of the 96-well plate, and allowed to air dry for 2 hr.
PC 12 cells are routinely grown in RPMI- 1640 medium (Bio Whittaker) containing 10% horse serum (JRH BIOSCIENCES, Cat. # 12449-78P), 5% heat- inactivated fetal bovine serum (FBS) supplemented with 100 units/ml penicillin and 100 ug/ml streptomycin on a precoated 10 cm tissue culture dish. One to four split is done every three to four days. Cells are removed from the plates by scraping and resuspended with pipetting up and down for more than 15 times.
Transfect the EGR SEAP/Neo construct into PC 12 using the Lipofectamine protocol described in Example 15. EGR-SEAP/PC12 stable cells are obtained by growing the cells in 300 ug/ml G418. The G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 300 ug/ml
G418 for couple of passages.
To assay for neuronal activity, a 10 cm plate with cells around 70 to 80% confluent is screened by removing the old medium. Wash the cells once with PBS (Phosphate buffered saline). Then starve the cells in low serum medium (RPMI- 1640 containing 1% horse serum and 0.5% FBS with antibiotics) overnight.
The next morning, remove the medium and wash the cells with PBS. Scrape off the cells from the plate, suspend the cells well in 2 ml low serum medium. Count the cell number and add more low serum medium to reach final cell density as 5x105 cells/ml.
Add 200 ul of the cell suspension to each well of 96-well plate (equivalent to 1x105 cells/well). Add 50 ul supernatant produced by Example 15, 37 degree C for 48 to 72 hr. As a positive control, a growth factor known to activate PC12 cells through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor (NGF). Over fifty-fold induction of SEAP is typically seen in the positive control wells. SEAP assay the supernatant according to Example 18. Example 20: High-Throughput Screening Assay for T-cell Activity
NF-kappaB (Nuclear Factor kappaB) is a transcription factor activated by a wide variety of agents including the inflammatory cytokines IL-1 and TNF, CD30 and CD40, lymphotoxin-alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression of certain viral gene products. As a transcription factor, NF-kappaB regulates the expression of genes involved in immune cell activation, control of apoptosis (NF-kappaB appears to shield cells from apoptosis), B and T- cell development, anti-viral and antimicrobial responses, and multiple stress responses. In non-stimulated conditions, NF-kappaB is retained in the cytoplasm with I- kappaB (Inhibitor kappaB). However, upon stimulation, I-kappaB is phosphorylated and degraded, causing NF-kappaB to shuttle to the nucleus, thereby activating transcription of target genes. Target genes activated by NF-kappaB include IL-2, EL- 6, GM-CSF, ICAM-1 and class 1 MHC. Due to its central role and ability to respond to a range of stimuli, reporter constructs utilizing the NF-kappaB promoter element are used to screen the supernatants produced in Example 15. Activators or inhibitors of NF-kappaB would be useful in treating diseases. For example, inhibitors of NF-kappaB could be used to treat those diseases related to the acute or chronic activation of NF-kappaB, such as rheumatoid arthritis.
To construct a vector containing the NF-kappaB promoter element, a PCR based strategy is employed. The upstream primer contains four tandem copies of the NF-kappaB binding site (GGGGACTTTCCC) (SEQ ID NO: 16), 18 bp of sequence complementary to the 5' end of the SV40 early promoter sequence, and is flanked with an Xhol site:
5':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCC GGGACTTTCCATCCTGCC ATCTC AATTAG: 3 ' (SEQ ID NO 17)
The downstream primer is complementary to the 3' end of the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO12) PCR amplification is performed using the SV40 promoter template present in the pB -gal: promoter plasmid obtained from Clontech. The resulting PCR fragment is digested with Xhol and Hind III and subcloned into BLSK2- (Stratagene).
Sequencing with the T7 and T3 primers confirms the insert contains the following sequence:
5 ' : CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGAC TTTCCATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTC CGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATG GCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCT GAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTG CAAAAAGCTT:3' (SEQ ID NO18)
Next, replace the SV40 minimal promoter element present in the pSEAP2- promoter plasmid (Clontech) with this NF-kappaB/SV40 fragment using Xhol and Hindlll. However, this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems.
In order to generate stable mammalian cell lines, the NF-kappaB/SV40/SEAP cassette is removed from the above NF-kappaB/SEAP vector using restriction enzymes Sail and Notl, and inserted into a vector containing neomycin resistance.
Particularly, the NF-kappaB/SV40/SEAP cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after restricting pGFP-1 with Sail and Notl.
Once NF-kappaB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells are created and maintained according to the protocol described in Example 17.
Similarly, the method for assaying supernatants with these stable Jurkat T-cells is also described in Example 17. As a positive control, exogenous TNF alpha (0.1,1, 10 ng) is added to wells H9, HlO, and HI 1, with a 5-10 fold activation typically observed.
Example 21: Assay for SEAP Activity
As a reporter molecule for the assays described in Examples 17-20, SEAP activity is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the following general procedure The Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction Buffers used below
Prime a dispenser with the 2 5x Dilution Buffer and dispense 15 ul of 2 5x dilution buffer into Optiplates containing 35 ul of a supernatant Seal the plates with a plastic sealer and incubate at 65 degree C for 30 min Separate the Optiplates to avoid uneven heating
Cool the samples to room temperature for 15 minutes Empty the dispenser and prime with the Assay Buffer Add 50 ml Assay Buffer and incubate at room temperature 5 min Empty the dispenser and prime with the Reaction Buffer (see the table below) Add 50 ul Reaction Buffer and incubate at room temperature for 20 minutes Since the intensity of the chemiluminescent signal is time dependent, and it takes about 10 minutes to read 5 plates on luminometer, one should treat 5 plates at each time and start the second set 10 minutes later
Read the relative light unit in the luminometer Set H12 as blank, and print the results An increase in chemiluminescence indicates reporter activity
Reaction Buffer Formulation:
# of Rxn buffer diluent CSPD plates (ml) (ml)
10 60 3
11 65 3 25
12 70 3 5
13 75 3 75
14 80 4
15 85 4 25
16 90 4 5
17 95 4 75
18 100 5
19 105 5 25 20 110 5.5
21 115 5.75
22 120 6
23 125 6.25
24 130 6.5
25 135 6.75
26 140 7
27 145 7.25
28 150 7.5
29 155 7.75
30 160
31 165 8.25
32 170 8.5
33 175 8.75
34 180 9
35 185 9.25
36 190 9.5
37 195 9.75
38 200 10
39 205 10.25
40 210 10.5
41 215 10.75
42 220 11
43 225 11.25
44 230 11.5
45 235 11.75
46 240 12
47 245 12.25
48 250 12.5 49 255 12.75
50 260 13
Example 22: High-Throughput Screening Assay Identifying Changes in Small Molecule Concentration and Membrane Permeability Binding of a ligand to a receptor is known to alter intracellular levels of small molecules, such as calcium, potassium, sodium, and pH, as well as alter membrane potential. These alterations can be measured in an assay to identify supernatants which bind to receptors of a particular cell. Although the following protocol describes an assay for calcium, this protocol can easily be modified to detect changes in potassium, sodium, pH, membrane potential, or any other small molecule which is detectable by a fluorescent probe.
The following assay uses Fluorometric Imaging Plate Reader ("FLIPR") to measure changes in fluorescent molecules (Molecular Probes) that bind small molecules. Clearly, any fluorescent molecule detecting a small molecule can be used instead of the calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.; catalog no. F- 14202), used here.
For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star black 96-well plate with clear bottom. The plate is incubated in a CO2 incubator for 20 hours. The adherent cells are washed two times in Biotek washer with 200 ul of HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after the final wash. A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To load the cells with fluo-4, 50 ul of 12 ug/ml fluo-4 is added to each well. The plate is incubated at 37 degrees C in a CO2 incubator for 60 min. The plate is washed four times in the Biotek washer with HBSS leaving 100 ul of buffer. For non-adherent cells, the cells are spun down from culture media. Cells are re-suspended to 2-5x106 cells/ml with HBSS in a 50-ml conical tube. 4 ul of 1 mg/ml fluo-4 solution in 10% pluronic acid DMSO is added to each ml of cell suspension. The tube is then placed in a 37 degrees C water bath for 30-60 min. The cells are washed twice with HBSS, resuspended to lxl 06 cells/ml, and dispensed into a microplate, 100 ul/well. The plate is centrifuged at 1000 rpm for 5 min. The plate is then washed once in Denley CellWash with 200 ul, followed by an aspiration step to 100 ul final volume. For a non-cell based assay, each well contains a fluorescent molecule, such as fluo-4. The supernatant is added to the well, and a change in fluorescence is detected.
To measure the fluorescence of intracellular calcium, the FLIPR is set for the following parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4 second; (3) Camera F/stop is F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6) Sample addition is 50 ul. Increased emission at 530 nm indicates an extracellular signaling event caused by the a molecule, either CKβ- 13 or a molecule induced by CKβ- 13, which has resulted in an increase in the intracellular Ca++ concentration.
Example 23: High-Throughput Screening Assay Identifying Tyrosine Kinase Activity
The Protein Tyrosine Kinases (PTK) represent a diverse group of transmembrane and cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group are receptors for a range of mitogenic and metabolic growth factors including the PDGF, FGF, EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large family of RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include mainly secreted small proteins, but also membrane-bound and extracellular matrix proteins.
Activation of RPTK by ligands involves ligand-mediated receptor dimerization, resulting in transphosphorylation of the receptor subunits and activation of the cytoplasmic tyrosine kinases. The cytoplasmic tyrosine kinases include receptor associated tyrosine kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor linked and cytosolic protein tyrosine kinases, such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
Because of the wide range of known factors capable of stimulating tyrosine kinase activity, identifying whether CKβ- 13 or a molecule induced by CKβ- 13 is capable of activating tyrosine kinase signal transduction pathways is of interest.
Therefore, the following protocol is designed to identify such molecules capable of activating the tyrosine kinase signal transduction pathways.
Seed target cells (e.g., primary keratinocytes) at a density of approximately 25,000 cells per well in a 96 well Loprodyne Silent Screen Plates purchased from Nalge Nunc (Naperville, EL). The plates are sterilized with two 30 minute rinses with 100% ethanol, rinsed with water and dried overnight. Some plates are coated for 2 hr with 100 ml of cell culture grade type I collagen (50 mg/ml), gelatin (2%) or polylysine (50 mg/ml), all of which can be purchased from Sigma Chemicals (St. Louis, MO) or 10% Matrigel purchased from Becton Dickinson (Bedford, MA), or calf serum, rinsed with PBS and stored at 4 degree C. Cell growth on these plates is assayed by seeding 5,000 cells/well in growth medium and indirect quantitation of cell number through use of alamarBlue as described by the manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hr. Falcon plate covers #3071 from Becton Dickinson (Bedford, MA) are used to cover the Loprodyne Silent Screen Plates. Falcon Microtest III cell culture plates can also be used in some proliferation experiments.
To prepare extracts, A431 cells are seeded onto the nylon membranes of Loprodyne plates (20,000/200ml/well) and cultured overnight in complete medium. Cells are quiesced by incubation in serum-free basal medium for 24 hr. After 5-20 minutes treatment with EGF (60ng/ml) or 50 ul of the supernatant produced in Example 15, the medium was removed and 100 ml of extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-l 00, 0.1% SDS, 2 mM Na3VO4, 2 mM Na4P2O7 and a cocktail of protease inhibitors (# 1836170) obtained from Boeheringer Mannheim (Indianapolis, IN) is added to each well and the plate is shaken on a rotating shaker for 5 minutes at 4oC. The plate is then placed in a vacuum transfer manifold and the extract filtered through the 0.45 mm membrane bottoms of each well using house vacuum. Extracts are collected in a 96-well catch/assay plate in the bottom of the vacuum manifold and immediately placed on ice. To obtain extracts clarified by centrifugation, the content of each well, after detergent solubilization for 5 minutes, is removed and centrifuged for 15 minutes at 4 degree C at 16,000 x g.
Test the filtered extracts for levels of tyrosine kinase activity. Although many methods of detecting tyrosine kinase activity are known, one method is described here. Generally, the tyrosine kinase activity of a supernatant is evaluated by determining its ability to phosphorylate a tyrosine residue on a specific substrate (a biotinylated peptide). Biotinylated peptides that can be used for this purpose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a range of tyrosine kinases and are available from Boehringer Mannheim.
The tyrosine kinase reaction is set up by adding the following components in order. First, add lOul of 5uM Biotinylated Peptide, then lOul ATP/Mg2+ (5mM ATP/50mM MgC12), then lOul of 5x Assay Buffer (40mM imidazole hydrochloride, pH7.3, 40 mM beta-glycerophosphate, ImM EGTA, lOOmM MgC12, 5 mM MnC12, 0.5 mg/ml BSA), then 5ul of Sodium Vanadate (ImM), and then 5ul of water. Mix the components gently and preincubate the reaction mix at 30 degree C for 2 min. Initial the reaction by adding lOul of the control enzyme or the filtered supernatant.
The tyrosine kinase assay reaction is then terminated by adding 10 ul of 120mm EDTA and place the reactions on ice. Tyrosine kinase activity is determined by transferring 50 ul aliquot of reaction mixture to a microtiter plate (MTP) module and incubating at 37 degree C for 20 min. This allows the streptavadin coated 96 well plate to associate with the biotinylated peptide. Wash the MTP module with 300ul/well of PBS four times. Next add 75 ul of anti-phospotyrosine antibody conjugated to horse radish peroxidase(anti-P-Tyr-POD(0.5u/ml)) to each well and incubate at 37 degree C for one hour. Wash the well as above.
Next add lOOul of peroxidase substrate solution (Boehringer Mannheim) and incubate at room temperature for at least 5 mins (up to 30 min). Measure the absorbance of the sample at 405 nm by using ELISA reader. The level of bound peroxidase activity is quantitated using an ELISA reader and reflects the level of tyrosine kinase activity.
Example 24: High-Throughput Screening Assay Identifying
Phosphorylation Activity
As a potential alternative and/or compliment to the assay of protein tyrosine kinase activity described in Example 23, an assay which detects activation (phosphorylation) of major intracellular signal transduction intermediates can also be used. For example, as described below one particular assay can detect tyrosine phosphorylation of the Erk-1 and Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK, p38 MAP, Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK, Tec, and Janus, as well as any other phosphoserine, phosphotyrosine, or phosphothreonine molecule, can be detected by substituting these molecules for Erk-1 or Erk-2 in the following assay.
Specifically, assay plates are made by coating the wells of a 96-well ELISA plate with 0.1ml of protein G (lug/ml) for 2 hr at room temp, (RT). The plates are then rinsed with PBS and blocked with 3% BS A/PBS for 1 hr at RT. The protein G plates are then treated with 2 commercial monoclonal antibodies (lOOng/well) against Erk-land Erk-2 (1 hr at RT) (Santa Cruz Biotechnology). (To detect other molecules, this step can easily be modified by substituting a monoclonal antibody detecting any of the above described molecules.) After 3-5 rinses with PBS, the plates are stored at 4 degree C until use.
A431 cells are seeded at 20,000/well in a 96-well Loprodyne filterplate and cultured overnight in growth medium. The cells are then starved for 48 hr in basal medium (DMEM) and then treated with EGF (6ng/well) or 50 ul of the supernatants obtained in Example 15 for 5-20 minutes. The cells are then solubilized and extracts filtered directly into the assay plate.
After incubation with the extract for 1 hr at RT, the wells are again rinsed. As a positive control, a commercial preparation of MAP kinase (lOng/well) is used in place of A431 extract. Plates are then treated with a commercial polyclonal (rabbit) antibody (lug/ml) which specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-2 kinases (1 hr at RT). This antibody is biotinylated by standard procedures. The bound polyclonal antibody is then quantitated by successive incubations with Europium-streptavidin and Europium fluorescence enhancing reagent in the Wallac DELFIA instrument (time-resolved fluorescence). An increased fluorescent signal over background indicates a phosphorylation by CKβ- 13 or a molecule induced by CKβ-13.
Example 25: Method of Determining Alterations in the CKβ-13 Gene
RNA isolated from entire families or individual patients presenting with a phenotype of interest (such as a disease) is be isolated. cDNA is then generated from these RNA samples using protocols known in the art. (See, Sambrook.) The cDNA is then used as a template for PCR, employing primers surrounding regions of interest in SEQ ID NO1. Suggested PCR conditions consist of 35 cycles at 95 degree C for 30 seconds; 60-120 seconds at 52-58 degree C; and 60-120 seconds at 70 degree C, using buffer solutions described in Sidransky, D., et al., Science 252:706 (1991). PCR products are then sequenced using primers labeled at their 5' end with
T4 polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre Technologies). The intron-exon borders of selected exons of CKβ- 13 is also determined and genomic PCR products analyzed to confirm the results. PCR products harboring suspected mutations in CKβ- 13 is then cloned and sequenced to validate the results of the direct sequencing. PCR products of CKβ- 13 are cloned into T-tailed vectors as described in Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19: 1156 (1991) and sequenced with T7 polymerase (United States Biochemical). Affected individuals are identified by mutations in CKβ- 13 not present in unaffected individuals. Genomic rearrangements are also observed as a method of determining alterations in a gene corresponding to CKβ-13. Genomic clones isolated according to Example 2 are nick-translated with digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and FISH performed as described in Johnson, Cg. et al., Methods Cell Biol. 35:73-99 (1991). Hybridization with the labeled probe is carried out using a vast excess of human cot-1 DNA for specific hybridization to the CKβ- 13 genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium iodide, producing a combination of C- and R-bands. Aligned images for precise mapping are obtained using a triple-band filter set (Chroma Technology, Brattleboro, VT) in combination with a cooled charge-coupled device camera (Photometries, Tucson, AZ) and variable excitation wavelength filters. (Johnson, Cv. et al, Genet. Anal. Tech. Appl., 8:75 (1991).) Image collection, analysis and chromosomal fractional length measurements are performed using the ISee Graphical Program System, (lnovision Corporation, Durham, NC.) Chromosome alterations of the genomic region of CKβ- 13 (hybridized by the probe) are identified as insertions, deletions, and translocations. These CKβ- 13 alterations are used as a diagnostic marker for an associated disease.
Example 26: Method of Detecting Abnormal Levels of CKβ-13 in a
Biological Sample
CKβ- 13 polypeptides can be detected in a biological sample, and if an increased or decreased level of CKβ- 13 is detected, this polypeptide is a marker for a particular phenotype. Methods of detection are numerous, and thus, it is understood that one skilled in the art can modify the following assay to fit their particular needs.
For example, antibody-sandwich ELISAs are used to detect CKβ- 13 in a sample, preferably a biological sample. Wells of a microtiter plate are coated with specific antibodies to CKβ-13, at a final concentration of 0.2 to 10 ug/ml. The antibodies are either monoclonal or polyclonal and are produced by the method described in Example 11. The wells are blocked so that non-specific binding of CKβ- 13 to the well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample containing CKβ-13. Preferably, serial dilutions of the sample should be used to validate results. The plates are then washed three times with deionized or distilled water to remove unbounded CKβ-13.
Next, 50 ul of specific antibody-alkaline phosphatase conjugate, at a concentration of 25-400 ng, is added and incubated for 2 hours at room temperature. The plates are again washed three times with deionized or distilled water to remove unbounded conjugate.
Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate (NPP) substrate solution to each well and incubate 1 hour at room temperature. Measure the reaction by a microtiter plate reader. Prepare a standard curve, using serial dilutions of a control sample, and plot CKβ- 13 polypeptide concentration on the X-axis (log scale) and fluorescence or absorbance of the Y-axis (linear scale). Interpolate the concentration of the CKβ- 13 in the sample using the standard curve.
Example 27: Formulation
The invention also provides methods of treatment and/or prevention of diseases or disorders (such as, for example, any one or more of the diseases or disorders disclosed herein) by administration to a subject of an effective amount of a Therapeutic. By therapeutic is meant a polynucleotides or polypeptides of the invention (including fragments and variants), agonists or antagonists thereof, and/or antibodies thereto, in combination with a pharmaceutically acceptable carrier type (e g , a sterile carrier)
The Therapeutic will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the Therapeutic alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to practitioners The "effective amount" for purposes herein is thus determined by such considerations As a general proposition, the total pharmaceutically effective amount of the
Therapeutic administered parenterally per dose will be in the range of about lug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion More preferably, this dose is at least 0 01 mg/kg/day, and most preferably for humans between about 0 01 and 1 mg/kg/day for the hormone If given continuously, the Therapeutic is typically administered at a dose rate of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump An intravenous bag solution may also be employed The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect
Therapeutics can be are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray "Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion
Therapeutics of the invention are also suitably administered by sustained- release systems Suitable examples of sustained-release Therapeutics are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
Therapeutics of the invention are also suitably administered by sustained- release systems. Suitable examples of sustained-release Therapeutics include suitable polymeric materials (such as, for example, semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt).
Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al, Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res. 15167-277 (1981), and Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988). Sustained-release Therapeutics also include liposomally entrapped
Therapeutics of the invention (see generally, Langer, Science 2491527-1533 (1990); Treat et al, in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez- Berestein and Fidler (eds.), Liss, New York, pp. 317 -327 and 353-365 (1989)). Liposomes containing the Therapeutic are prepared by methods known per se: DE 3,218,121; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.(USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal Therapeutic.
In yet an additional embodiment, the Therapeutics of the invention are delivered by way of a pump (see Langer, supra, Sefton, CRC Crit. Ref Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl.
J. Med. 321 :574 (1989)).
Other controlled release systems are discussed in the review by Langer
(Science 2491527-1533 (1990)).
For parenteral administration, in one embodiment, the Therapeutic is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the Therapeutic.
Generally, the formulations are prepared by contacting the Therapeutic uniformly and intimately with liquid carriers or finely divided solid carriers or both.
Then, if necessary, the product is shaped into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline,
Ringer's solution, and dextrose solution. Non-aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG. The Therapeutic is typically formulated in such vehicles at a concentration of about 0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of polypeptide salts.
Any pharmaceutical used for therapeutic administration can be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Therapeutics generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
Therapeutics ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous Therapeutic solution, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized Therapeutic using bacteriostatic Water-for- Injection. The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the Therapeutics of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the Therapeutics may be employed in conjunction with other therapeutic compounds.
The Therapeutics of the invention may be administered alone or in combination with adjuvants. Adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Corp.), QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment, Therapeutics of the invention are administered in combination with alum. In another specific embodiment, Therapeutics of the invention are administered in combination with QS-21. Further adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines that may be administered with the Therapeutics of the invention include, but are not limited to, vaccines directed toward protection against MMR (measles, mumps, rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavirus, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second. The Therapeutics of the invention may be administered alone or in combination with other therapeutic agents. Therapeutic agents that may be administered in combination with the Therapeutics of the invention, include but not limited to, other members of the TNF family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatories, conventional immunotherapeutic agents, cytokines and/or growth factors. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second.
In one embodiment, the Therapeutics of the invention are administered in combination with members of the TNF family. TNF, TNF-related or TNF-like molecules that may be administered with the Therapeutics of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), AIM-I (International Publication No. WO 97/33899), endokine-alpha (International Publication No. WO 98/07880), TR6 (International Publication No. WO 98/30694), OPG, and neutrokine-alpha (International Publication No. WO 98/18921, OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5 (International Publication No. WO 98/30693), TR6 (International Publication No. WO 98/30694), TR7 (International Publication No. WO 98/41629), TRANK, TR9 (International Publication No. WO 98/56892),TR10 (International Publication No. WO 98/54202), 312C2 (International Publication No. WO 98/06842), and TR12, and soluble forms CD 154, CD70, and CD 153.
In certain embodiments, Therapeutics of the invention are administered in combination with antiretro viral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors. Nucleoside reverse transcriptase inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, RETRO V1R™ (zidovudine/AZT), VTDEX™ (didanosine/ddl), HIVID™ (zalcitabine/ddC), ZERIT™ (stavudine/d4T), EPIVIR™ (lamivudine/3TC), and COMBIVIR™ (zidovudine/lamivudine). Non-nucleoside reverse transcriptase inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, VIRAMUNE™ (nevirapine), RESCRIPTOR™ (delavirdine), and SUSTIVA™ (efavirenz). Protease inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, CR1XIVAN™ (indinavir), NORVIR™ (ritonavir), INVIRASE™ (saquinavir), and VIRACEPT™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors may be used in any combination with Therapeutics of the invention to treat AIDS and/or to prevent or treat HIV infection.
In other embodiments, Therapeutics of the invention may be administered in combination with anti-opportunistic infection agents. Anti-opportunistic agents that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, TRIMETHOPRIM-SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDINE™, ATOVAQUONE™, ISONIAZID™,
RIFAMPIN™, PYRAZINAMIDE™, ETHAMBUTOL™, RIFABUTIN™, CLARITHROMYCIN™, AZITHROMYCIN™, GANCICLOVIR™, FOSCARNET™, CIDOFOVIR™, FLUCONAZOLE™, ITRACONAZOLE™, KETOCONAZOLE™, ACYCLOVIR™, FAMCICOLVDΛ™, PYRIMETHAMINE™, LEUCOVORIN™, NEUPOGEN™ (filgrastim/G-CSF), and LEUKINE™ (sargramostim/GM-CSF). In a specific embodiment, Therapeutics of the invention are used in any combination with TRIMETHOPRIM-SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDINE™, and/or ATOVAQUONE™ to prophylactically treat or prevent an opportunistic Pneumocystis carinii pneumonia infection. In another specific embodiment, Therapeutics of the invention are used in any combination with ISONIAZID™, RIFAMPIN™, PYRAZINAMIDE™, and/or ETHAMBUTOL™ to prophylactically treat or prevent an opportunistic Mycobacterium avium complex infection. In another specific embodiment, Therapeutics of the invention are used in any combination with RIFABUTIN™, CLARITHROMYCIN™, and/or AZITHROMYCIN™ to prophylactically treat or prevent an opportunistic Mycobacterium tuberculosis infection. In another specific embodiment, Therapeutics of the invention are used in any combination with GANCICLOVIR™, FOSCARNET™, and/or CIDOFOVIR™ to prophylactically treat or prevent an opportunistic cytomegalovirus infection. In another specific embodiment, Therapeutics of the invention are used in any combination with FLUCONAZOLE™, ITRACONAZOLE™, and/or KETOCONAZOLE™ to prophylactically treat or prevent an opportunistic fungal infection. In another specific embodiment, Therapeutics of the invention are used in any combination with ACYCLOVIR™ and/or FAMCICOLVIR™ to prophylactically treat or prevent an opportunistic herpes simplex virus type I and/or type II infection. In another specific embodiment, Therapeutics of the invention are used in any combination with PYRIMETHAMINE™ and/or LEUCOVORIN™ to prophylactically treat or prevent an opportunistic Toxoplasma gondii infection. In another specific embodiment, Therapeutics of the invention are used in any combination with LEUCOVORIN™ and/or NEUPOGEN™ to prophylactically treat or prevent an opportunistic bacterial infection. In a further embodiment, the Therapeutics of the invention are administered in combination with an antiviral agent. Antiviral agents that may be administered with the Therapeutics of the invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantidine.
In a further embodiment, the Therapeutics of the invention are administered in combination with an antibiotic agent. Antibiotic agents that may be administered with the Therapeutics of the invention include, but are not limited to, amoxicillin, beta- lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim- sulfamthoxazole, and vancomycin.
Conventional nonspecific immunosuppressive agents, that may be administered in combination with the Therapeutics of the invention include, but are not limited to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells. In specific embodiments, Therapeutics of the invention are administered in combination with immunosuppressants. Immunosuppressants preparations that may be administered with the Therapeutics of the invention include, but are not limited to, ORTHOCLONE™ (OKT3), SANDIMMUNE™/NEORAL™/SANGDYA™
(cyclosporin), PROGRAF™ (tacrolimus), CELLCEPT™ (mycophenolate), Azathioprine, glucorticosteroids, and RAPAMUNE™ (sirolimus). In a specific embodiment, immunosuppressants may be used to prevent rejection of organ or bone marrow transplantation.
In an additional embodiment, Therapeutics of the invention are administered alone or in combination with one or more intravenous immune globulin preparations. Intravenous immune globulin preparations that may be administered with the Therapeutics of the invention include, but not limited to, GAMMAR™, IVEEGAM™, SANDOGLOBULIN™, GAMMAGARD S/D™, and GAMIMUNE™. In a specific embodiment, Therapeutics of the invention are administered in combination with intravenous immune globulin preparations in transplantation therapy (e.g., bone marrow transplant).
In an additional embodiment, the Therapeutics of the invention are administered alone or in combination with an anti-inflammatory agent. Anti- inflammatory agents that may be administered with the Therapeutics of the invention include, but are not limited to, glucocorticoids and the nonsteroidal anti- inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e- acetamidocaproic acid, S-adenosylmethionine, 3-amino-4-hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole, and tenidap. ln another embodiment, compostions of the invention are administered in combination with a chemotherapeutic agent. Chemo therapeutic agents that may be administered with the Therapeutics of the invention include, but are not limited to, antibiotic derivatives (e.g., doxorubicin, bleomycin, daunorubicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis-platin, and vincristine sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., mephalen, chorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (e.g., bethamethasone sodium phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide).
In a specific embodiment, Therapeutics of the invention are administered in combination with CHOP (cyclophosphamide, doxorubicin, vincristine, and prednisone) or any combination of the components of CHOP. In another embodiment, Therapeutics of the invention are administered in combination with Rituximab. In a further embodiment, Therapeutics of the invention are administered with Rituxmab and CHOP, or Rituxmab and any combination of the components of CHOP.
In an additional embodiment, the Therapeutics of the invention are administered in combination with cytokines. Cytokines that may be administered with the Therapeutics of the invention include, but are not limited to, IL2, EL3, EL4, EL5, IL6, IL7, IL10, IL12, IL13, IL15, anti-CD40, CD40L, IFN-gamma and TNF- alpha. In another embodiment, Therapeutics of the invention may be administered with any interleukin, including, but not limited to, IL-1 alpha, IL-1 beta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, EL- 19, IL-20, and EL-21.
In an additional embodiment, the Therapeutics of the invention are administered in combination with angiogenic proteins. Angiogenic proteins that may be administered with the Therapeutics of the invention include, but are not limited to, Glioma Derived Growth Factor (GDGF), as disclosed in European Patent Number EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110; Platelet Derived Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317; Placental Growth Factor (P1GF), as disclosed in International Publication Number WO 92/06194; Placental Growth Factor-2 (P1GF-2), as disclosed in Hauser et al., Gorwth Factors, 4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in International Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A (VEGF- A), as disclosed in European Patent Number EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-2), as disclosed in International Publication Number WO 96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular Endothelial Growth Factor B-186 (VEGF-B186), as disclosed in International Publication Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in German Patent Number DEI 9639601. The above mentioned references are incorporated herein by reference herein.
In an additional embodiment, the Therapeutics of the invention are administered in combination with hematopoietic growth factors. Hematopoietic growth factors that may be administered with the Therapeutics of the invention include, but are not limited to, LEUKINE™ (SARGRAMOSTIM™) and NEUPOGEN™ (FILGRASTIM™).
In an additional embodiment, the Therapeutics of tlie invention are administered in combination with Fibroblast Growth Factors. Fibroblast Growth Factors that may be administered with the Therapeutics of the invention include, but are not limited to, FGF-1, FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF-10, FGF-1 1, FGF-12, FGF-13, FGF-14, and FGF-15.
In additional embodiments, the Therapeutics of the invention are administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.
Example 28: Method of Treating Decreased Levels of CKβ-13
The present invention relates to a method for treating an individual in need of an increased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an agonist of the invention (including polypeptides of the invention). Moreover, it will be appreciated that conditions caused by a decrease in the standard or normal expression level of CKβ- 13 in an individual can be treated by administering CKβ-13, preferably in the secreted form. Thus, the invention also provides a method of treatment of an individual in need of an increased level of CKβ- 13 polypeptide comprising administering to such an individual a Therapeutic comprising an amount of CKβ- 13 to increase the activity level of CKβ- 13 in such an individual.
For example, a patient with decreased levels of CKβ- 13 polypeptide receives a daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days. Preferably, the polypeptide is in the secreted form. The exact details of the dosing scheme, based on administration and formulation, are provided in Example 27.
Example 29: Method of Treating Increased Levels of CKβ-13
The present invention also relates to a method of treating an individual in need of a decreased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an antagonist of the invention (including polypeptides and antibodies of the invention)
In one example, antisense technology is used to inhibit production of CKβ- 13 This technology is one example of a method of decreasing levels of CKβ- 13 polypeptide, preferably a secreted form, due to a variety of etiologies, such as cancer
For example, a patient diagnosed with abnormally increased levels of CKβ- 13 is administered intravenously antisense polynucleotides at 0 5, 1 0, 1 5, 2 0 and 3 0 mg/kg day for 21 days This treatment is repeated after a 7-day rest period if the treatment was well tolerated The formulation of the antisense polynucleotide is provided in Example 27
Example 30: Method of Treatment Using Gene Therapy - Ex Vivo One method of gene therapy transplants fibroblasts, which are capable of expressing CKβ- 13 polypeptides, onto a patient Generally, fibroblasts are obtained from a subject by skin biopsy The resulting tissue is placed in tissue-culture medium and separated into small pieces Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask The flask is turned upside down, closed tight and left at room temperature over night After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e g , Ham's F12 media, with 10%) FBS, penicillin and streptomycin) is added The flasks are then incubated at 37 degree C for approximately one week At this time, fresh media is added and subsequently changed every several days After an additional two weeks in culture, a monolayer of fibroblasts emerge The monolayer is trypsinized and scaled into larger flasks pMV-7 (Kirschmeier, P T et al , DNA, 7 219-25 (1988)), flanked by the long terminal repeats of the Moloney murine sarcoma virus, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads.
The cDNA encoding CKβ- 13 can be amplified using PCR primers which correspond to the 5' and 3' end sequences respectively as set forth in Example 1. Preferably, the 5' primer contains an EcoRI site and the 3' primer includes a Hindlll site. Equal quantities of the Moloney murine sarcoma virus linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is then used to transform bacteria HB101, which are then plated onto agar containing kanamycin for the purpose of confirming that the vector contains properly inserted CKβ-13.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf serum (CS), penicillin and streptomycin. The MSV vector containing the CKβ- 13 gene is then added to the media and the packaging cells transduced with the vector. The packaging cells now produce infectious viral particles containing the CKβ-13 gene(the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub-confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of virus is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his. Once the fibroblasts have been efficiently infected, the fibroblasts are analyzed to determine whether CKβ- 13 protein is produced.
The engineered fibroblasts are then transplanted onto the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. Example 31: Gene Therapy Using Endogenous CKβ-13 Gene
Another method of gene therapy according to the present invention involves operably associating the endogenous CKβ- 13 sequence with a promoter via homologous recombination as described, for example, in U.S. Patent No. 5,641,670, issued June 24, 1997; International Publication No. WO 96/29411, published September 26, 1996; International Publication No. WO 94/12650, published August 4, 1994; Roller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989). This method involves the activation of a gene which is present in the target cells, but which is not expressed in the cells, or is expressed at a lower level than desired.
Polynucleotide constructs are made which contain a promoter and targeting sequences, which are homologous to the 5' non-coding sequence of endogenous CKβ- 13, flanking the promoter. The targeting sequence will be sufficiently near the 5' end of CKβ- 13 so the promoter will be operably linked to the endogenous sequence upon homologous recombination. The promoter and the targeting sequences can be amplified using PCR. Preferably, the amplified promoter contains distinct restriction enzyme sites on the 5' and 3' ends. Preferably, the 3' end of the first targeting sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5' end of the second targeting sequence contains the same restriction site as the 3' end of the amplified promoter.
The amplified promoter and the amplified targeting sequences are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter and digested targeting sequences are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The construct is size fractionated on an agarose gel then purified by phenol extraction and ethanol precipitation.
In this Example, the polynucleotide constructs are administered as naked polynucleotides via electroporation. However, the polynucleotide constructs may also be administered with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, precipitating agents, etc. Such methods of delivery are known in the art.
Once the cells are transfected, homologous recombination will take place which results in the promoter being operably linked to the endogenous CKβ- 13 sequence. This results in the expression of CKβ- 13 in the cell. Expression may be detected by immunological staining, or any other method known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in DMEM + 10% fetal calf serum. Exponentially growing or early stationary phase fibroblasts are trypsinized and rinsed from the plastic surface with nutrient medium. An aliquot of the cell suspension is removed for counting, and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is resuspended in 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KC1, 0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated, and the cells resuspended in electroporation buffer containing 1 mg/ml acetylated bovine serum albumin. The final cell suspension contains approximately 3X106 cells/ml. Electroporation should be performed immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For example, to construct a plasmid for targeting to the CKβ- 13 locus, plasmid pUC18 (MB1 Fermentas, Amherst, NY) is digested with Hindlll. The CMV promoter is amplified by PCR with an Xbal site on the 5' end and a BamHI site on the 3 'end. Two CKβ- 13 non-coding sequences are amplified via PCR: one CKβ- 13 non-coding sequence CKβ-13 fragment 1) is amplified with a Hindlll site at the 5' end and an Xba site at the 3 'end; the other CKβ- 13 non-coding sequence CKβ- 13 fragment 2) is amplified with a BamHI site at the 5'end and a Hindlll site at the 3 'end. The CMV promoter and CKβ- 13 fragments (1 and 2) are digested with the appropriate enzymes (CMV promoter - Xbal and BamHI; CKβ- 13 fragment 1 - Xbal; CKβ- 13 fragment 2 - BamHI) and ligated together. The resulting ligation product is digested with
Hindlll, and ligated with the Hindlll-digested pUC18 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap
(Bio-Rad). The final DNA concentration is generally at least 120 μg/ml. 0.5 ml of the cell suspension (containing approximately 1.5.X106 cells) is then added to the cuvette, and the cell suspension and DNA solutions are gently mixed. Electroporation is performed with a Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage are set at 960 μF and 250-300 V, respectively. As voltage increases, cell survival decreases, but the percentage of surviving cells that stably incorporate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 mSec should be observed.
Electroporated cells are maintained at room temperature for approximately 5 min, and the contents of the cuvette are then gently removed with a sterile transfer pipette. The cells are added directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf serum) in a 10 cm dish and incubated at 37 degree C. The following day, the media is aspirated and replaced with 10 ml of fresh media and incubated for a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product. The fibroblasts can then be introduced into a patient as described above.
Example 32: Method of Treatment Using Gene Therapy - In Vivo Another aspect of the present invention is using in vivo gene therapy methods to treat disorders, diseases and conditions. The gene therapy method relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) CKβ- 13 sequences into an animal to increase or decrease the expression of the CKβ- 13 polypeptide. The CKβ- 13 polynucleotide may be operatively linked to a promoter or any other genetic elements necessary for the expression of the CKβ- 13 polypeptide by the target tissue. Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90/1 1092, WO98/1 1779; U.S. Patent NO. 5693622, 5705151, 5580859; Tabata H. et al. (1997) Cardiovasc. Res. 35(3):470- 479, Chao J et al. (1997) Pharmacol. Res. 35(6):517-522, Wolff J.A. (1997) Neuromuscul. Disord. 7(5):314-318, Schwartz B. et al. (1996) Gene Ther. 3(5):405- 41 1, Tsurumi Y. et al. (1996) Circulation 94(12):3281-3290 (incorporated herein by reference).
The CKβ- 13 polynucleotide constructs may be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and the like). The CKβ- 13 polynucleotide constructs can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that are free from any delivery vehicle that acts to assist, promote, or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like. However, the CKβ- 13 polynucleotides may also be delivered in liposome formulations (such as those taught in Feigner P.L. et al. (1995) Ann. NY Acad. Sci. 772126-139 and Abdallah B. et al. (1995) Biol. Cell 85(1)1-7) which can be prepared by methods well known to those skilled in the art. The CKβ- 13 polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication. Any strong promoter known to those skilled in the art can be used for driving the expression of DNA. Unlike other gene therapies techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
The CKβ- 13 polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, uterus, rectum, nervous system, eye, gland, and connective tissue. Interstitial space of the tissues comprises the intercellular fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels. Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.
For the naked CKβ- 13 polynucleotide injection, an effective dosage amount of DNA or RNA will be in the range of from about 0.05 g/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection. The appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose. In addition, naked CKβ-13 polynucleotide constructs can be delivered to arteries during angioplasty by the catheter used in the procedure. The dose response effects of injected CKβ- 13 polynucleotide in muscle in vivo is determined as follows. Suitable CKβ- 13 template DNA for production of mRNA coding for CKβ- 13 polypeptide is prepared in accordance with a standard recombinant DNA methodology. The template DNA, which may be either circular or linear, is either used as naked DNA or complexed with liposomes. The quadriceps muscles of mice are then injected with various amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized by intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made on the anterior thigh, and the quadriceps muscle is directly visualized. The CKβ- 13 template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute, approximately 0.5 cm from the distal insertion site of the muscle into the knee and about 0.2 cm deep. A suture is placed over the injection site for future localization, and the skin is closed with stainless steel clips.
After an appropriate incubation time (e.g., 7 days) muscle extracts are prepared by excising the entire quadriceps. Every fifth 15 um cross-section of the individual quadriceps muscles is histochemically stained for CKβ- 13 protein expression. A time course for CKβ- 13 protein expression may be done in a similar fashion except that quadriceps from different mice are harvested at different times. Persistence of CKβ- 13 DNA in muscle following injection may be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. The results of the above experimentation in mice can be use to extrapolate proper dosages and other treatment parameters in humans and other animals using CKβ- 13 naked DNA.
Example 33: CKβ-13 Transgenic Animals.
The CKβ- 13 polypeptides can also be expressed in transgenic animals. Animals of any species, including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate transgenic animals. In a specific embodiment, techniques described herein or otherwise known in the art, are used to express polypeptides of the invention in humans, as part of a gene therapy protocol
Any technique known in the art may be used to introduce the transgene (i e , polynucleotides of the invention) into animals to produce the founder lines of transgenic animals Such techniques include, but are not limited to, pronuclear microinjection (Paterson et al , Appl Microbiol Biotechnol 40 691-698 (1994), Carver et al , Biotechnology (NY) 11 1263-1270 (1993), Wright et al , Biotechnology (NY) 9 830-834 (1991), and Hoppe et al , U S Pat No 4,873,191 (1989)), retrovirus mediated gene transfer into germ lines (Van der Putten et al , Proc Natl Acad Sci , USA 82 6148-6152 (1985)), blastocysts or embryos, gene targeting in embryonic stem cells (Thompson et al , Cell 56 313-321 (1989)), electroporation of cells or embryos (Lo, 1983, Mol Cell Biol 3 1803-1814 (1983)), introduction of the polynucleotides of the invention using a gene gun (see, e g , Ulmer et al , Science 259 1745 (1993), introducing nucleic acid constructs into embryonic pleuripotent stem cells and transferring the stem cells back into the blastocyst, and sperm-mediated gene transfer (Lavitrano et al , Cell 57 717-723 (1989), etc For a review of such techniques, see Gordon, "Transgenic Animals," Intl Rev Cytol 115 171-229 (1989), which is incorporated by reference herein in its entirety
Any technique known in the art may be used to produce transgenic clones containing polynucleotides of the invention, for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells induced to quiescence (Campell et al , Nature 380 64-66 (1996), Wilmut et al , Nature 385 810- 813 (1997))
The present invention provides for transgenic animals that carry the transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i e , mosaic animals or chimeric The transgene may be integrated as a single transgene or as multiple copies such as in concatamers, e g , head-to-head tandems or head-to-tail tandems The transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. When it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred.
Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenous gene are designed for the purpose of integrating, via homologous recombination with chromosomal sequences, into and disrupting the function of the nucleotide sequence of the endogenous gene. The transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenous gene in only that cell type, by following, for example, the teaching of Gu et al. (Gu et al., Science 265103-106 (1994)). The regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. The contents of each of the documents recited in this paragraph is herein incorporated by reference in its entirety.
Any of the CKβ- 13 polypeptides disclosed throughout this application can be used to generate transgenic animals. For example, the DNA encoding the full length CKβ- 13 protein (nucleotides 1-279 of SEQ ID NO1) can be inserted into a vector containing a promoter, such as the actin promoter, which will ubiquitously express the inserted fragment. Therefore, DNA encoding the full length CKβ- 13 protein can be inserted into a vector using the following primers: A 5' primer containing a BamHI restriction site shown in bold: GCAGCAGGATCCGCCATCATGGCTCGCCTACAGACTGCACTCCTGG (SEQ ID NO: 19) and a 3' primer, containing a Xba restriction site shown in bold: GCAGCATCTAGATCATTGGCTCAGCTTATTGAGAATCATCTTCACCC (SEQ ID NO: 20). Besides these two examples, other fragments of CKβ-13 can also be inserted into a vector to create transgenics having ubiquitous expression. Alternatively, polynucleotides of the invention can be inserted in a vector which controls tissue specific expression through a tissue specific promoter. For example, a construct having a transferrin promoter would express the CKβ- 13 polypeptide in the liver of transgenic animals. Therefore, DNA encoding the full length CKβ-13 protein (nucleotides 1-279 of SEQ ID NO1) can be inserted into a vector for tissue specific expression using the following primers: A 5' primer containing a BamHI restriction site shown in bold:
GCAGCAGGATCCGCCATCATGGCTCGCCTACAGACTGCACTCCTGG (SEQ ID NO: 21) and a 3' primer, containing a Xba restriction site shown in bold: GCAGCATCTAGATCATTGGCTCAGCTTATTGAGAATCATCTTCACCC (SEQ ID NO: 22).
Once transgenic animals have been generated, the expression of the recombinant gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-expressing tissue may also be evaluated immunocytochemically or immunohistochemically using antibodies specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred, outbred, or crossbred to produce colonies of the particular animal. Examples of such breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic animals to produce animals homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; and breeding to place the transgene on a distinct background that is appropriate for an experimental model of interest.
Transgenic animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of
CKβ- 13 polypeptides, studying conditions and/or disorders associated with aberrant
CKβ- 13 expression, and in screening for compounds effective in ameliorating such conditions and/or disorders.
Example 34: CKβ-13 Knock-Out Animals.
Endogenous CKβ- 13 gene expression can also be reduced by inactivating or "knocking out" the CKβ- 13 gene and/or its promoter using targeted homologous recombination. (E.g., see Smithies et al., Nature 317:230-234 (1985); Thomas & Capecchi, Cell 51 :503-512 (1987); Thompson et al., Cell 5:3 13-321 (1989); each of which is incorporated by reference herein in its entirety). For example, a mutant, non-functional polynucleotide of the invention (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous polynucleotide sequence (either the coding regions or regulatory regions of the gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express polypeptides of the invention in vivo. In another embodiment, techniques known in the art are used to generate knockouts in cells that contain, but do not express the gene of interest. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the targeted gene. Such approaches are particularly suited in research and agricultural fields where modifications to embryonic stem cells can be used to generate animal offspring with an inactive targeted gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra). However this approach can be routinely adapted for use in humans provided the recombinant DNA constructs are directly administered or targeted to the required site in vivo using appropriate viral vectors that will be apparent to those of skill in the art.
In further embodiments of the invention, cells that are genetically engineered to express the polypeptides of the invention, or alternatively, that are genetically engineered not to express the polypeptides of the invention (e.g., knockouts) are administered to a patient in vivo. Such cells may be obtained from the patient (i.e., animal, including human) or an MHC compatible donor and can include, but are not limited to fibroblasts, bone marrow cells, blood cells (e.g., lymphocytes), adipocytes, muscle cells, endothelial cells etc. The cells are genetically engineered in vitro using recombinant DNA techniques to introduce the coding sequence of polypeptides of the invention into the cells, or alternatively, to disrupt the coding sequence and/or endogenous regulatory sequence associated with the polypeptides of the invention, e.g.. by transduction (using viral vectors, and preferably vectors that integrate the transgene into the cell genome) or transfection procedures, including, but not limited to, the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. The coding sequence of the polypeptides of the invention can be placed under the control of a strong constitutive or inducible promoter or promoter/enhancer to achieve expression, and preferably secretion, of the CKβ- 13 polypeptides. The engineered cells which express and preferably secrete the polypeptides of the invention can be introduced into the patient systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incorporated into a matrix and implanted in the body, e.g., genetically engineered fibroblasts can be implanted as part of a skin graft; genetically engineered endothelial cells can be implanted as part of a lymphatic or vascular graft. (See, for example, Anderson et al. U.S. Patent No. 5,399,349; and Mulligan & Wilson, U.S. Patent No. 5,460,959 each of which is incorporated by reference herein in its entirety).
When the cells to be administered are non-autologous or non-MHC compatible cells, they can be administered using well known techniques which prevent the development of a host immune response against the introduced cells. For example, the cells may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system.
Knock-out animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of CKβ-
13 polypeptides, studying conditions and/or disorders associated with aberrant CKβ-
13 expression, and in screening for compounds effective in ameliorating such conditions and/or disorders.
Example 35: Assays Detecting Stimulation or Inhibition of B cell Proliferation and Differentiation
Generation of functional humoral immune responses requires both soluble and cognate signaling between B-lineage cells and their microenvironment. Signals may impart a positive stimulus that allows a B-lineage cell to continue its programmed development, or a negative stimulus that instructs the cell to arrest its current developmental pathway. To date, numerous stimulatory and inhibitory signals have been found to influence B cell responsiveness including IL-2, EL-4, EL-5, IL-6, EL-7, EL 10, EL- 13, EL- 14 and IL-15. Interestingly, these signals are by themselves weak effectors but can, in combination with various co-stimulatory proteins, induce activation, proliferation, differentiation, homing, tolerance and death among B cell populations.
One of the best studied classes of B-cell co-stimulatory proteins is the TNF- superfamily. Within this family CD40, CD27, and CD30 along with their respective ligands CD 154, CD70, and CD 153 have been found to regulate a variety of immune responses. Assays which allow for the detection and/or observation of the proliferation and differentiation of these B-cell populations and their precursors are valuable tools in determining the effects various proteins may have on these B-cell populations in terms of proliferation and differentiation. Listed below are two assays designed to allow for the detection of the differentiation, proliferation, or inhibition of B-cell populations and their precursors.
In Vitro Assay- Purified CKβ- 13 protein, or truncated forms thereof, is assessed for its ability to induce activation, proliferation, differentiation or inhibition and/or death in B-cell populations and their precursors. The activity of CKβ- 13 protein on purified human tonsillar B cells, measured qualitatively over the dose range from 0.1 to 10,000 ng/mL, is assessed in a standard B-lymphocyte co- stimulation assay in which purified tonsillar B cells are cultured in the presence of either formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized anti- human IgM antibody as the priming agent. Second signals such as EL-2 and EL- 15 synergize with SAC and IgM crosslinking to elicit B cell proliferation as measured by tritiated-thymidine incorporation. Novel synergizing agents can be readily identified using this assay. The assay involves isolating human tonsillar B cells by magnetic bead (MACS) depletion of CD3 -positive cells. The resulting cell population is greater than 95% B cells as assessed by expression of CD45R(B220).
Various dilutions of each sample are placed into individual wells of a 96-well plate to which are added 105 B-cells suspended in culture medium (RPMI 1640 containing 10% FBS, 5 X 10"5M 2ME, lOOU/ml penicillin, lOug/ml streptomycin, and 10"5 dilution of SAC) in a total volume of 150ul. Proliferation or inhibition is quantitated by a 20h pulse (luCi/well) with 3H-thymidine (6.7 Ci/mM) beginning 72h post factor addition. The positive and negative controls are IL2 and medium respectively.
In Vivo Assay- BALB/c mice are injected (i.p.) twice per day with buffer only, or 2 mg/Kg of CKβ-13 protein, or truncated forms thereof. Mice receive this treatment for 4 consecutive days, at which time they are sacrificed and various tissues and serum collected for analyses. Comparison of H&E sections from normal and CKβ- 13 protein-treated spleens identify the results of the activity of CKβ- 13 protein on spleen cells, such as the diffusion of peri-arterial lymphatic sheaths, and/or significant increases in the nucleated cellularity of the red pulp regions, which may indicate the activation of the differentiation and proliferation of B-cell populations Immunohistochemical studies using a B cell marker, anti-CD45R(B220), are used to determine whether any physiological changes to splenic cells, such as splenic disorganization, are due to increased B-cell representation within loosely defined B- cell zones that infiltrate established T-cell regions
Flow cytometric analyses of the spleens from CKβ- 13 protein-treated mice is used to indicate whether CKβ- 13 protein specifically increases the proportion of ThB+, CD45R(B220)dull B cells over that which is observed in control mice
Likewise, a predicted consequence of increased mature B-cell representation in vivo is a relative increase in serum Ig titers Accordingly, serum IgM and IgA levels are compared between buffer and CKβ- 13 protein-treated mice
The studies described in this example tested activity in CKβ- 13 protein However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ- 13 polynucleotides (e g , gene therapy), agonists, and/or antagonists of CKβ-13
Example 36: T CeU Proliferation Assay
A CD3 -induced proliferation assay is performed on PBMCs and is measured by the uptake of 3H-thymidine The assay is performed as follows Ninety-six well plates are coated with 100 μl/well of mAb to CD3 (HIT3a, Pharmingen) or isotype- matched control mAb (B33 1) overnight at 4°C (1 μg/ml in 05M bicarbonate buffer, pH 9 5), then washed three times with PBS PBMC are isolated by F/H gradient centrifugation from human peripheral blood and added to quadruplicate wells (5 x 104/well) of mAb coated plates in RPMI containing 10% FCS and P/S in the presence of varying concentrations of CKβ- 13 protein (total volume 200 μl) Relevant protein buffer and medium alone are controls After 48 hr culture at 37°C, plates are spun for 2 min at 1000 rpm and 100 μl of supernatant is removed and stored -20°C for measurement of IL-2 (or other cytokines) if effect on proliferation is observed Wells are supplemented with 100 μl of medium containing 0 5 μCi of 3H- thymidine and cultured at 37°C for 18-24 hr. Wells are harvested and incorporation of 3H-thymidine used as a measure of proliferation. Anti-CD3 alone is the positive control for proliferation. IL-2 (100 U/ml) is also used as a control which enhances proliferation. Control antibody which does not induce proliferation of T cells is used as the negative controls for the effects of CKβ- 13 proteins.
The studies described in this example tested activity in CKβ- 13 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ-13.
Example 37: Effect of CKβ-13 on the Expression of MHC Class II, Costimulatory and Adhesion Molecules and Cell Differentiation of Monocytes and Monocyte-Derived Human Dendritic Cells
Dendritic cells Eire generated by the expansion of proliferating precursors found in the peripheral blood: adherent PBMC or elutriated monocytic fractions are cultured for 7-10 days with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells have the characteristic phenotype of immature cells (expression of CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activating factors, such as TNF-α, causes a rapid change in surface phenotype (increased expression of MHC class I and II, costimulatory and adhesion molecules, downregulation of FCγRII, upregulation of CD83). These changes correlate with increased antigen-presenting capacity and with functional maturation of the dendritic cells.
FACS analysis of surface antigens is performed as follows. Cells are treated 1-3 days with increasing concentrations of CKβ- 13 or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1 :20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4°C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACS can (Becton Dickinson). Effect on the production of cytokines. Cytokines generated by dendritic cells, in particular IL-12, are important in the initiation of T-cell dependent immune responses. EL- 12 strongly influences the development of Thl helper T-cell immune response, and induces cytotoxic T and NK cell function. An ELISA is used to measure the EL- 12 release as follows. Dendritic cells (106/ml) are treated with increasing concentrations of CKβ-13 for 24 hours. LPS (100 ng/ml) is added to the cell culture as positive control. Supernatants from the cell cultures are then collected and analyzed for EL-12 content using commercial ELISA kit (e. g, R & D Systems (Minneapolis, MN)). The standard protocols provided with the kits are used.
Effect on the expression of MHC Class II, costimulatory and adhesion molecules. Three major families of cell surface antigens can be identified on monocytes: adhesion molecules, molecules involved in antigen presentation, and Fc receptor. Modulation of the expression of MHC class II antigens and other costimulatory molecules, such as B7 and ICAM-1, may result in changes in the antigen presenting capacity of monocytes and ability to induce T cell activation. Increase expression of Fc receptors may correlate with improved monocyte cytotoxic activity, cytokine release and phagocytosis. FACS analysis is used to examine the surface antigens as follows. Monocytes are treated 1-5 days with increasing concentrations of CKβ-13 or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1 :20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4°C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).
Monocyte activation and/or increased survival. Assays for molecules that activate (or alternatively, inactivate) monocytes and/or increase monocyte survival
(or alternatively, decrease monocyte survival) are known in the art and may routinely be applied to determine whether a molecule of the invention functions as an inhibitor or activator of monocytes. CKβ-13, agonists, or antagonists of CKβ- 13 can be screened using the three assays described below. For each of these assays, Peripheral blood mononuclear cells (PBMC) are purified from single donor leukopacks (American Red Cross, Baltimore, MD) by centrifugation through a Histopaque gradient (Sigma). Monocytes are isolated from PBMC by counterflow centrifugal elutriation.
Monocyte Survival Assay. Human peripheral blood monocytes progressively lose viability when cultured in absence of serum or other stimuli. Their death results from internally regulated process (apoptosis). Addition to the culture of activating factors, such as TNF-alpha dramatically improves cell survival and prevents DNA fragmentation. Propidium iodide (PI) staining is used to measure apoptosis as follows. Monocytes are cultured for 48 hours in polypropylene tubes in serum-free medium (positive control), in the presence of 100 ng/ml TNF-alpha (negative control), and in the presence of varying concentrations of the compound to be tested. Cells are suspended at a concentration of 2 x 106/ml in PBS containing PI at a final concentration of 5 μg/ml, and then incubaed at room temperature for 5 minutes before FACScan analysis. PI uptake has been demonstrated to correlate with DNA fragmentation in this experimental paradigm.
Effect on cytokine release. An important function of monocytes/macrophages is their regulatory activity on other cellular populations of the immune system through the release of cytokines after stimulation. An ELISA to measure cytokine release is performed as follows. Human monocytes are incubated at a density of 5xl05 cells/ml with increasing concentrations of CKβ- 13 and under the same conditions, but in the absence of CKβ-13. For IL-12 production, the cells are primed overnight with IFN (100 U/ml) in presence of CKβ-13. LPS (10 ng/ml) is then added. Conditioned media are collected after 24h and kept frozen until use. Measurement of TNF-alpha, EL- 10, MCP-1 and EL-8 is then performed using a commercially available ELISA kit (e.g, R & D Systems (Minneapolis, MN)) and applying the standard protocols provided with the kit.
Oxidative burst. Purified monocytes are plated in 96-w plate at 2-lxl 05 cell/well. Increasing concentrations of CKβ- 13 are added to the wells in a total volume of 0.2 ml culture medium (RPMI 1640 + 10% FCS, glutamine and antibiotics). After 3 days incubation, the plates are centrifuged and the medium is removed from the wells. To the macrophage monolayers, 0.2 ml per well of phenol red solution (140 mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the stimulant (200 nM PMA). The plates are incubated at 37°C for 2 hours and the reaction is stopped by adding 20 μl IN NaOH per well. The absorbance is read at 610 nm. To calculate the amount of H2O2 produced by the macrophages, a standard curve of a H2O2 solution of known molarity is performed for each experiment. The studies described in this example tested activity in CKβ- 13 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ-13.
Example 38: CKβ-13 Biological Effects Astrocyte and Neuronal Assays.
Recombinant CKβ-13, expressed in Escherichia coli and purified as described above, can be tested for activity in promoting the survival, neurite outgrowth, or phenotypic differentiation of cortical neuronal cells and for inducing the proliferation of glial fibrillary acidic protein immunopositive cells, astrocytes. The selection of cortical cells for the bioassay is based on the prevalent expression of FGF-1 and FGF-2 in cortical structures and on the previously reported enhancement of cortical neuronal survival resulting from FGF-2 treatment. A thymidine incorporation assay, for example, can be used to elucidate CKβ-13's activity on these cells. Moreover, previous reports describing the biological effects of FGF-2 (basic FGF) on cortical or hippocampal neurons in vitro have demonstrated increases in both neuron survival and neurite outgrowth (Walicke, P. et al., "Fibroblast growth factor promotes survival of dissociated hippocampal neurons and enhances neurite extension." Proc. Natl Acad. Sci. USA 53:3012-3016. (1986), assay herein incorporated by reference in its entirety). However, reports from experiments done on PC- 12 cells suggest that these two responses are not necessarily synonymous and may depend on not only which FGF is being tested but also on which receptor(s) are expressed on the target cells. Using the primary cortical neuronal culture paradigm, the ability of CKβ- 13 to induce neurite outgrowth can be compared to the response achieved with FGF-2 using, for example, a thymidine incorporation assay.
Fibroblast and endothelial cell assays.
Human lung fibroblasts are obtained from Clonetics (San Diego, CA) and maintained in growth media from Clonetics. Dermal microvascular endothelial cells are obtained from Cell Applications (San Diego, CA). For proliferation assays, the human lung fibroblasts and dermal microvascular endothelial cells can be cultured at 5,000 cells/well in a 96-well plate for one day in growth medium. The cells are then incubated for one day in 0.1 % BSA basal medium. After replacing the medium with fresh 0.1 % BSA medium, the cells are incubated with the test proteins for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each well to a final concentration of 10%. The cells are incubated for 4 hr. Cell viability is measured by reading in a CytoFluor fluorescence reader. For the PGE2 assays, the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1 % BSA basal medium, the cells are incubated with FGF-2 or CKβ- 13 with or without IL-lα for 24 hours. The supernatants are collected and assayed for PGE2 by EIA kit (Cayman, Ann Arbor, MI). For the EL-6 assays, the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or CKβ- 13 with or without EL-lα for 24 hours. The supernatants are collected and assayed for EL-6 by ELISA kit (Endogen, Cambridge, MA).
Human lung fibroblasts are cultured with FGF-2 or CKβ- 13 for 3 days in basal medium before the addition of Alamar Blue to assess effects on growth of the fibroblasts. FGF-2 should show a stimulation at 10 - 2500 ng/ml which can be used to compare stimulation with CKβ-13.
Parkinson Models.
The loss of motor function in Parkinson's disease is attributed to a deficiency of striatal dopamine resulting from the degeneration of the nigrostriatal dopaminergic projection neurons. An animal model for Parkinson's that has been extensively characterized involves the systemic administration of l-methyl-4 phenyl 1,2,3,6- tetrahydropyridine (MPTP). In the CNS, MPTP is taken-up by astrocytes and catabolized by monoamine oxidase B to 1 -methyl-4-phenyl pyridine (MPP+) and released. Subsequently, MPP+ is actively accumulated in dopaminergic neurons by the high-affinity reuptake transporter for dopamine. MPP+ is then concentrated in mitochondria by the electrochemical gradient and selectively inhibits nicotidamide adenine disphosphate: ubiquinone oxidoreductionase (complex I), thereby interfering with electron transport and eventually generating oxygen radicals. It has been demonstrated in tissue culture paradigms that FGF-2 (basic FGF) has trophic activity towards nigral dopaminergic neurons (Ferrari et al, Dev. Biol. 1989). Recently, Dr. Unsicker's group has demonstrated that administering FGF-2 in gel foam implants in the striatum results in the near complete protection of nigral dopaminergic neurons from the toxicity associated with MPTP exposure (Otto and Unsicker, J. Neuroscience, 1990).
Based on the data with FGF-2, CKβ- 13 can be evaluated to determine whether it has an action similar to that of FGF-2 in enhancing dopaminergic neuronal survival in vitro and it can also be tested in vivo for protection of dopaminergic neurons in the striatum from the damage associated with MPTP treatment. The potential effect of CKβ- 13 is first examined in vitro in a dopaminergic neuronal cell culture paradigm. The cultures are prepared by dissecting the midbrain floor plate from gestation day 14 Wistar rat embryos. The tissue is dissociated with trypsin and seeded at a density of 200,000 cells/cm2 on polyorthinine-laminin coated glass coverslips. The cells are maintained in Dulbecco's Modified Eagle's medium and F12 medium containing hormonal supplements (Nl). The cultures are fixed with paraformaldehyde after 8 days in vitro and are processed for tyrosine hydroxylase, a specific marker for dopminergic neurons, immunohistochemical staining. Dissociated cell cultures are prepared from embryonic rats. The culture medium is changed every third day and the factors are also added at that time. Since the dopaminergic neurons are isolated from animals at gestation day 14, a developmental time which is past the stage when the dopaminergic precursor cells are proliferating, an increase in the number of tyrosine hydroxylase immunopositive neurons would represent an increase in the number of dopaminergic neurons surviving in vitro. Therefore, if CKβ- 13 acts to prolong the survival of dopaminergic neurons, it would suggest that CKβ- 13 may be involved in Parkinson's Disease.
The studies described in this example tested activity in CKβ- 13 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ- 13. This example will be used to explore the possibility that CKβ- 13 may stimulate lymphatic endothelial cell migration.
Endothelial cell migration assays are performed using a 48 well microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD; Falk, W., et al, J. Immunological Methods 1980;33:239-247). Polyvinylpyrrolidone-free polycarbonate filters with a pore size of 8 um (Nucleopore Corp. Cambridge, MA) are coated with 0.1%) gelatin for at least 6 hours at room temperature and dried under sterile air. Test substances are diluted to appropriate concentrations in Ml 99 supplemented with 0.25%) bovine serum albumin (BSA), and 25 ul of the final dilution is placed in the lower chamber of the modified Boyden apparatus. Subconfluent, early passage (2-6) HUVEC or BMEC cultures are washed and trypsinized for the minimum time required to achieve cell detachment. After placing the filter between lower and upper chamber, 2.5 x 105 cells suspended in 50 ul Ml 99 containing 1% FBS are seeded in the upper compartment. The apparatus is then incubated for 5 hours at 37°C in a humidified chamber with 5% CO2 to allow cell migration. After the incubation period, the filter is removed and the upper side of the filter with the non-migrated cells is scraped with a rubber policeman. The filters are fixed with methanol and stained with a Giemsa solution (Diff-Quick, Baxter, McGraw Park, IL). Migration is quantified by counting cells of three random high-power fields (40x) in each well, and all groups are performed in quadruplicate. The studies described in this example tested activity in CKβ-13 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ-13.
Example 39: Stimulation of Nitric Oxide Production by Endothelial Cells
Nitric oxide released by the vascular endothelium is believed to be a mediator of vascular endothelium relaxation. Thus, CKβ- 13 activity can be assayed by determining nitric oxide production by endothelial cells in response to CKβ-13.
Nitric oxide is measured in 96-well plates of confluent microvascular endothelial cells after 24 hours starvation and a subsequent 4 hr exposure to various levels of a positive control (such as VEGF-1) and CKβ-13. Nitric oxide in the medium is determined by use of the Griess reagent to measure total nitrite after reduction of nitric oxide-derived nitrate by nitrate reductase. The effect of CKβ- 13 on nitric oxide release is examined on HUVEC. Briefly, NO release from cultured HUVEC monolayer is measured with a
NO-specific polarographic electrode connected to a NO meter (Iso-NO, World Precision Instruments Inc.) (1049). Calibration of the NO elements is performed according to the following equation:
2 KNO2 + 2 KI + 2 H2SO4 6 2 NO + I2 + 2 H2O + 2 K2SO4 The standard calibration curve is obtained by adding graded concentrations of KNO2 (0, 5, 10, 25, 50, 100, 250, and 500 nmol/L) into the calibration solution containing KI and H2SO4. The specificity of the Iso-NO electrode to NO is previously determined by measurement of NO from authentic NO gas (1050). The culture medium is removed and HUVECs are washed twice with Dulbecco's phosphate buffered saline. The cells are then bathed in 5 ml of filtered Krebs- Henseleit solution in 6-well plates, and the cell plates are kept on a slide warmer (Lab Line Instruments Inc.) To maintain the temperature at 37°C. The NO sensor probe is inserted vertically into the wells, keeping the tip of the electrode 2 mm under the surface of the solution, before addition of the different conditions. S-nitroso acetyl penicillamin (SNAP) is used as a positive control. The amount of released NO is expressed as picomoles per lxl 06 endothelial cells. All values reported are means of four to six measurements in each group (number of cell culture wells). See, Leak et al. Biochem. and Biophys. Res. Comm. 277:96-105 (1995). The studies described in this example tested activity in CKβ- 13 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists ofCKβ-13.
Example 40: Rat Cornea! Wound Healing Model
This animal model shows the effect of CKβ- 13 on neovascularization. The experimental protocol includes: a) Making a 1-1.5 mm long incision from the center of cornea into the stromal layer. b) Inserting a spatula below the lip of the incision facing the outer corner of the eye. c) Making a pocket (its base is 1-1.5 mm form the edge of the eye). d) Positioning a pellet, containing 50ng- 5ug of CKβ-13, within the pocket. e) CKβ- 13 treatment can also be applied topically to the corneal wounds in a dosage range of 20mg - 500mg (daily treatment for five days).
The studies described in this example tested activity in CKβ- 13 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ- 13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ-13.
Example 41: Diabetic Mouse and Glucocorticoid-Impaired Wound Healing Models
A. Diabetic db+/db+ Mouse Model.
To demonstrate that CKβ- 13 accelerates the healing process, the genetically diabetic mouse model of wound healing is used. The full thickness wound healing model in the db+/db+ mouse is a well characterized, clinically relevant and reproducible model of impaired wound healing. Healing of the diabetic wound is dependent on formation of granulation tissue and re-epithelialization rather than contraction (Gartner, M.H. et al, J. Surg. Res. 52:389 (1992); Greenhalgh, D.G. et al, Am. J. Pathol. 7361235 (1990)).
The diabetic animals have many of the characteristic features observed in Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison to their normal heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single autosomal recessive mutation on chromosome 4 (db+) (Coleman et al. Proc. Natl Acad. Sci. USA 77:283-293 (1982)). Animals show polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+) have elevated blood glucose, increased or normal insulin levels, and suppressed cell-mediated immunity (Mandel et al, J. Immunol. 7201375 (1978); Debray-Sachs, M. et al, Clin. Exp. Immunol 51(l): \-7 (1983); Leiter et al, Am. J. of Pathol. 114:46-55 (1985)). Peripheral neuropathy, myocardial complications, and microvascular lesions, basement membrane thickening and glomerular filtration abnormalities have been described in these animals (Norido, F. et al, Exp. Neurol 83(2):22\-232 (1984); Robertson et al, Diabetes 29(1): 60-67 (1980); Giacomelli et al, Lab Invest. 40(4):460-473 (1979); Coleman, D.L., Diabetes 31 (Sιψpl): \-6 (1982)). These homozygous diabetic mice develop hyperglycemia that is resistant to insulin analogous to human type II diabetes (Mandel et al, J. Immunol 7201375-1377 (1978)).
The characteristics observed in these animals suggests that healing in this model may be similar to the healing observed in human diabetes (Greenhalgh, et al, Am. J. of Pathol 7361235-1246 (1990)).
Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-diabetic (db+/+m) heterozygous littermates are used in this study (Jackson Laboratories). The animals are purchased at 6 weeks of age and are 8 weeks old at the beginning of the study. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. The experiments are conducted according to the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.
Wounding protocol is performed according to previously reported methods (Tsuboi, R. and Rifkin, D.B., J. Exp. Med. 772:245-251 (1990)). Briefly, on the day of wounding, animals are anesthetized with an intraperitoneal injection of Avertin (0.01 mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized water. The dorsal region of the animal is shaved and the skin washed with 70% ethanol solution and iodine. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is then created using a Keyes tissue punch. Immediately following wounding, the surrounding skin is gently stretched to eliminate wound expansion. The wounds are left open for the duration of the experiment. Application of the treatment is given topically for 5 consecutive days commencing on the day of wounding. Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the day of surgery and at two day intervals thereafter. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium. CKβ-13 is administered using at a range different doses of CKβ-13, from
4mg to 500mg per wound per day for 8 days in vehicle. Vehicle control groups received 50mL of vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested for histology and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.
Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls) are evaluated: 1) Vehicle placebo control, 2) untreated; and 3) treated group.
Wound closure is analyzed by measuring the area in the vertical and horizontal axis and obtaining the total square area of the wound. Contraction is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64mm2, the corresponding size of the dermal punch. Calculations are made using the following formula:
[Open area on day 8] - [Open area on day 1] / [Open area on day 1]
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned perpendicular to the wound surface (5mm) and cut using a Reichert- Jung microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross- sections of bisected wounds. Histologic examination of the wounds are used to assess whether the healing process and the morphologic appearance of the repaired skin is altered by treatment with CKβ-13. This assessment included verification of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, re- epithelialization and epidermal maturity (Greenhalgh, D.G. et al, Am. J. Pathol. 136:1235 (1990)). A calibrated lens micrometer is used by a blinded observer.
Tissue sections are also stained immunohistochemically with a polyclonal rabbit anti-human keratin antibody using ABC Elite detection system. Human skin is used as a positive tissue control while non-immune IgG is used as a negative control.
Keratinocyte growth is determined by evaluating the extent of reepithelialization of the wound using a calibrated lens micrometer.
Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is demonstrated by using anti-PCNA antibody (1 :50) with an ABC Elite detection system. Human colon cancer can serve as a positive tissue control and human brain tissue can be used as a negative tissue control. Each specimen includes a section with omission of the primary antibody and substitution with non-immune mouse IgG. Ranking of these sections is based on the extent of proliferation on a scale of 0-8, the lower side of the scale reflecting slight proliferation to the higher side reflecting intense proliferation.
Experimental data are analyzed using an unpaired t test. A p value of < 0.05 is considered significant.
B. Steroid Impaired Rat Model The inhibition of wound healing by steroids has been well documented in various in vitro and in vivo systems (Wahl, S.M. Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects. 280-302 (1989); Wahl, S.M.et al, J. Immunol 115: 476-481 (1975); Werb, Z. et al, J. Exp. Med. 147:1684- 694 (1978)). Glucocorticoids retard wound healing by inhibiting angiogenesis, decreasing vascular permeability (Ebert, R.H., et al, An. Intern. Med. 37:701-705 (1952)), fibroblast proliferation, and collagen synthesis (Beck, L S. et al, Growth Factors. 5: 295-304 (1991); Haynes, B.F. et al, J. Clin. Invest. 61: 703- 797 (1978)) and producing a transient reduction of circulating monocytes (Haynes, B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989)). The systemic administration of steroids to impaired wound healing is a well establish phenomenon in rats (Beck, L.S. et al, Growth Factors. 5: 295-304 (1991); Haynes, B.F., et al, J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989); Pierce, G.F. et al, Proc. Natl. Acad. Sci. USA 86: 2229- 2233 (1989)).
To demonstrate that CKβ- 13 can accelerate the healing process, the effects of multiple topical applications of CKβ- 13 on full thickness excisional skin wounds in rats in which healing has been impaired by the systemic administration of methylprednisolone is assessed.
Young adult male Sprague Dawley rats weighing 250-300 g (Charles River Laboratories) are used in this example. The animals are purchased at 8 weeks of age and are 9 weeks old at the beginning of the study. The healing response of rats is impaired by the systemic administration of methylprednisolone (17mg/kg/rat intramuscularly) at the time of wounding. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. This study is conducted according to the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.
The wounding protocol is followed according to section A, above. On the day of wounding, animals are anesthetized with an intramuscular injection of ketamine (50 mg/kg) and xylazine (5 mg/kg). The dorsal region of the animal is shaved and the skin washed with 70% ethanol and iodine solutions. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is created using a Keyes tissue punch. The wounds are left open for the duration of the experiment. Applications of the testing materials are given topically once a day for 7 consecutive days commencing on the day of wounding and subsequent to methylprednisolone administration. Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges. Wounds are visually examined and photographed at a fixed distance at the day of wounding and at the end of treatment. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.
CKβ- 13 is administered using at a range different doses of CKβ- 13, from 4mg to 500mg per wound per day for 8 days in vehicle. Vehicle control groups received 50mL of vehicle solution. Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital (300mg/kg). The wounds and surrounding skin are then harvested for histology. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.
Four groups of 10 animals each (5 with methylprednisolone and 5 without glucocorticoid) are evaluated: 1) Untreated group 2) Vehicle placebo control 3) CKβ- 13 treated groups.
Wound closure is analyzed by measuring the area in the vertical and' horizontal axis and obtaining the total area of the wound. Closure is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64mm2, the corresponding size of the dermal punch. Calculations are made using the following formula:
[Open area on day 8] - [Open area on day 1] / [Open area on day 1]
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned perpendicular to the wound surface (5mm) and cut using an Olympus microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross- sections of bisected wounds. Histologic examination of the wounds allows assessment of whether the healing process and the morphologic appearance of the repaired skin is improved by treatment with CKβ-13. A calibrated lens micrometer is used by a blinded observer to determine the distance of the wound gap.
Experimental data are analyzed using an unpaired t test. A p value of < 0.05 is considered significant. The studies described in this example tested activity in CKβ-13 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ-13.
Example 42: Lymphadema Animal Model
The purpose of this experimental approach is to create an appropriate and consistent lymphedema model for testing the therapeutic effects of CKβ- 13 in lymphangiogenesis and re-establishment of the lymphatic circulatory system in the rat hind limb. Effectiveness is measured by swelling volume of the affected limb, quantification of the amount of lymphatic vasculature, total blood plasma protein, and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more importantly, the chronic progress of the edema is followed for up to 3-4 weeks.
Prior to beginning surgery, blood sample is drawn for protein concentration analysis. Male rats weighing approximately ~350g are dosed with Pentobarbital. Subsequently, the right legs are shaved from knee to hip. The shaved area is swabbed with gauze soaked in 70% EtOH. Blood is drawn for serum total protein testing. Circumference and volumetric measurements are made prior to injecting dye into paws after marking 2 measurement levels (0.5 cm above heel, at mid-pt of dorsal paw). The intradermal dorsum of both right and left paws are injected with 0.05 ml of 1% Evan's Blue. Circumference and volumetric measurements are then made following injection of dye into paws.
Using the knee joint as a landmark, a mid-leg inguinal incision is made circumferentially allowing the femoral vessels to be located. Forceps and hemostats are used to dissect and separate the skin flaps. After locating the femoral vessels, the lymphatic vessel that runs along side and underneath the vessel(s) is located. The main lymphatic vessels in this area are then electrically coagulated or suture ligated. Using a microscope, muscles in back of the leg (near the semitendinosis and adductors) are bluntly dissected. The popliteal lymph node is then located. The 2 proximal and 2 distal lymphatic vessels and distal blood supply of the popliteal node are then and ligated by suturing. The popliteal lymph node, and any accompanying adipose tissue, is then removed by cutting connective tissues.
Care is taken to control any mild bleeding resulting from this procedure.
After lymphatics are occluded, the skin flaps are sealed by using liquid skin (Vetbond) (AJ Buck). The separated skin edges are sealed to the underlying muscle tissue while leaving a gap of -0.5 cm around the leg. Skin also may be anchored by suturing to underlying muscle when necessary.
To avoid infection, animals are housed individually with mesh (no bedding).
Recovering animals are checked daily through the optimal edematous peak, which typically occurred by day 5-7. The plateau edematous peak are then observed. To evaluate the intensity of the lymphedema, the circumference and volumes of 2 designated places on each paw before operation and daily for 7 days are measured.
The effect plasma proteins on lymphedema is determined and whether protein analysis is a useful testing perimeter is also investigated. The weights of both control and edematous limbs are evaluated at 2 places. Analysis is performed in a blind manner.
Circumference Measurements: Under brief gas anesthetic to prevent limb movement, a cloth tape is used to measure limb circumference. Measurements are done at the ankle bone and dorsal paw by 2 different people then those 2 readings are averaged. Readings are taken from both control and edematous limbs.
Volumetric Measurements: On the day of surgery, animals are anesthetized with Pentobarbital and are tested prior to surgery. For daily volumetrics animals are under brief halothane anesthetic (rapid immobilization and quick recovery), both legs are shaved and equally marked using waterproof marker on legs. Legs are first dipped in water, then dipped into instrument to each marked level then measured by Buxco edema software(Chen/Victor). Data is recorded by one person, while the other is dipping the limb to marked area.
Blood-plasma protein measurements: Blood is drawn, spun, and serum separated prior to surgery and then at conclusion for total protein and Ca2+ comparison.
Limb Weight Comparison: After drawing blood, the animal is prepared for tissue collection. The limbs are amputated using a quillitine, then both experimental and control legs are cut at the ligature and weighed. A second weighing is done as the tibio-cacaneal joint is disarticulated and the foot is weighed. Histological Preparations: The transverse muscle located behind the knee
(popliteal) area is dissected and arranged in a metal mold, filled with freezeGel, dipped into cold methylbutane, placed into labeled sample bags at - 80EC until sectioning. Upon sectioning, the muscle is observed under fluorescent microscopy for lymphatics.. The studies described in this example tested activity in CKβ- 13 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ- 13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ- 13.
Example 43: Suppression of TNF alpha-induced adhesion molecule expression by CKβ-13
The recruitment of lymphocytes to areas of inflammation and angiogenesis involves specific receptor-ligand interactions between cell surface adhesion molecules (CAMs) on lymphocytes and the vascular endothelium. The adhesion process, in both normal and pathological settings, follows a multi-step cascade that involves intercellular adhesion molecule- 1 (ICAM-1), vascular cell adhesion molecule- 1 (VCAM-1), and endothelial leukocyte adhesion molecule- 1 (E-selectin) expression on endothelial cells (EC). The expression of these molecules and others on the vascular endothelium determines the efficiency with which leukocytes may adhere to the local vasculature and extravasate into the local tissue during the development of an inflammatory response. The local concentration of cytokines and growth factor participate in the modulation of the expression of these CAMs.
Tumor necrosis factor alpha (TNF-a), a potent proinflammatory cytokine, is a stimulator of all three CAMs on endothelial cells and may be involved in a wide variety of inflammatory responses, often resulting in a pathological outcome.
The potential of CKβ-13 to mediate a suppression of TNF-a induced CAM expression can be examined. A modified ELISA assay which uses ECs as a solid phase absorbent is employed to measure the amount of CAM expression on TNF-a treated ECs when co-stimulated with a member of the FGF family of proteins.
To perform the experiment, human umbilical vein endothelial cell (HUVEC) cultures are obtained from pooled cord harvests and maintained in growth medium (EGM-2; Clonetics, San Diego, CA) supplemented with 10% FCS and 1% penicillin/streptomycin in a 37 degree C humidified incubator containing 5% CO2. HUVECs are seeded in 96-well plates at concentrations of 1 x 104 cells/well in EGM medium at 37 degree C for 18-24 hrs or until confluent. The monolayers are subsequently washed 3 times with a serum-free solution of RPMI- 1640 supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin, and treated with a given cytokine and/or growth factor(s) for 24 h at 37 degree C. Following incubation, the cells are then evaluated for CAM expression.
Human Umbilical Vein Endothelial cells (HUVECs) are grown in a standard 96 well plate to confluence. Growth medium is removed from the cells and replaced with 90 ul of 199 Medium (10% FBS). Samples for testing and positive or negative controls are added to the plate in triplicate (in 10 ul volumes). Plates are incubated at 37 degree C for either 5 h (selectin and integrin expression) or 24 h (integrin expression only). Plates are aspirated to remove medium and 100 μl of 0.1 % paraformaldehyde-PBS(with Ca++ and Mg++) is added to each well. Plates are held at 4°C for 30 min. Fixative is then removed from the wells and wells are washed IX with PBS(+Ca,Mg)+0.5% BSA and drained. Do not allow the wells to dry. Add 10 μl of diluted primary antibody to the test and control wells. Anti-ICAM-1-Biotin, Anti- VCAM-1-Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 μg/ml (1 : 10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at 37°C for 30 min. in a humidified environment. Wells are washed X3 with PBS(+Ca,Mg)+0.5% BSA.
Then add 20 μl of diluted Extr A vi din- Alkaline Phosphotase (1 :5,000 dilution) to each well and incubated at 37°C for 30 min. Wells are washed X3 with PBS(+Ca,Mg)+0.5% BSA. 1 tablet of p-Nitrophenol Phosphate pNPP is dissolved in 5 ml of glycine buffer (pH 10.4). 100 μl of pNPP substrate in glycine buffer is added to each test well. Standard wells in triplicate are prepared from the working dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer: 1 :5,000 (10°) > 10" 0 5 > 10"1 > 10"1'5. 5 μl of each dilution is added to triplicate wells and the resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100 μl of pNNP reagent must then be added to each of the standard wells. The plate must be incubated at 37°C for 4h. A volume of 50 μl of 3M NaOH is added to all wells. The results are quantified on a plate reader at 405 nm. The background subtraction option is used on blank wells filled with glycine buffer only. The template is set up to indicate the concentration of AP-conjugate in each standard well [ 5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. Results are indicated as amount of bound AP-conjugate in each sample.
The studies described in this example tested activity in CKβ- 13 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of CKβ-13 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of CKβ- 13.
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims. The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the Background of the Invention, Detailed Description, and Examples is hereby incorporated herein by reference. Moreover, the sequence listing from U.S. application Serial No. 08/986,188 is herein incorporated by reference.

Claims

W at Is Claimed Is:
1. An isolated nucleic acid molecule nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of:
(a) a nucleotide sequence encoding the CKβ- 13 polypeptide having the complete amino acid sequence in SEQ ID NO:2;
(b) a nucleotide sequence encoding the CKβ- 13 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 97113;
(c) a nucleotide sequence encoding a mature form of the CKβ- 13 polypeptide having the amino acid sequence at positions 25-93 in SEQ ID NO:2;
(d) a nucleotide sequence encoding a mature form of the CKβ- 13 polypeptide having the amino acid sequence at positions 29-93 in SEQ ID NO:2;
(e) a nucleotide sequence encoding a mature form of the CKβ- 13 polypeptide as encoded by the cDNA clone contained in the ATCC Deposit No. 97113; and
(f) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d) or (e) above.
2. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence in Figure 1 (SEQ ID NO1).
3. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO1) encoding the CKβ-13 polypeptide having the complete amino acid sequence in SEQ ID NO:2.
4. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO1) encoding a mature form of the CKβ- 13 polypeptide having the nucleotide sequence from about 73 to about 279 in SEQ ID NO: 1.
5. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 1 (SEQ ID NO1) encoding a mature form of the CKβ- 13 polypeptide having the nucleotide sequence from about 85 to about 279 in SEQ ID NO: 1.
6. An isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence at least 95% identical to a sequence selected from the group consisting of:
(a) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of residues n-93 of SEQ ID NO:2, where n is an integer in the range of l-35;
(b) a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of residues 1-m of SEQ ID NO:2, where m is an integer in the range of 77-93;
(c) a nucleotide sequence encoding a polypeptide having the amino acid sequence consisting of residues n-m of SEQ ID NO:2, where n and m are integers as defined respectively in (a) and (b) above; and
(d) a nucleotide sequence encoding a polypeptide consisting of a portion of the complete CKβ- 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113 wherein said portion excludes from 1 to about 35 amino acids from the amino terminus of said complete amino acid sequence;
(e) a nucleotide sequence encoding a polypeptide consisting of a portion of the complete CKβ- 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113 wherein said portion excludes from 1 to about 17 amino acids from the carboxy terminus of said complete amino acid sequence; and
(f) a nucleotide sequence encoding a polypeptide consisting of a portion of the complete CKβ- 13 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113 wherein said portion include a combination of any of the amino terminal and carboxy terminal deletions in (d) and (e), above.
7. The nucleic acid molecule of claim 1 wherein said polynucleotide has the complete nucleotide sequence of the cDNA clone contained in ATCC Deposit No. 97113.
8. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding the CKβ- 13 polypeptide having the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113.
9. The nucleic acid molecule of claim 1 wherein said polynucleotide has the nucleotide sequence encoding a mature CKβ- 13 polypeptide having the amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 97113.
10. An isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to a nucleotide sequence in (a), (b), (c), (d), or (e) of claim 1 wherein said polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
11. An isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a CKβ- 13 polypeptide having an amino acid sequence in (a), (b), (c), (d), or (e) of claim 1.
12. The isolated nucleic acid molecule of claim 11, which encodes an epitope-bearing portion of a CKβ- 13 polypeptide selected from the group consisting of: a polypeptide comprising amino acid residues from about Thr-22 to about Gly- 28 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Asn- 30 to about Leu-47 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Thr-56 to about Val-65 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about Phe-70 to about Trp-83 (SEQ ID NO:2).
13. A method for making a recombinant vector comprising inserting an isolated nucleic acid molecule of claim 1 into a vector.
14. A recombinant vector produced by the method of claim 13.
15. A method of making a recombinant host cell comprising introducing the recombinant vector of claim 14 into a host cell.
16. A recombinant host cell produced by the method of claim 15.
17. A recombinant method for producing a CKβ- 13 polypeptide, comprising culturing the recombinant host cell of claim 16 under conditions such that said polypeptide is expressed and recovering said polypeptide.
18. An isolated CKβ-13 polypeptide comprising an amino acid sequence at least 95% identical to a sequence selected from the group consisting of:
(a) the complete amino acid sequence in SEQ ID NO:2 or as encoded by the cDNA clone contained in ATCC Deposit No. 97113; and
(b) the amino acid sequence of a mature CKβ- 13 polypeptide having the amino acid sequence at positions 25-93 or 29-93 in SEQ ID NO:2, or as encoded by the cDNA clone contained in the ATCC Deposit No. 97113.
19. An isolated polypeptide comprising an epitope-bearing portion of the CKβ- 13 protein, wherein said portion is selected from the group consisting of: a polypeptide comprising amino acid residues from about Thr-22 to about Gly-28 (SEQ ED NO:2); a polypeptide comprising amino acid residues from about Asn-30 to about Leu-47 (SEQ ID NO:2); a polypeptide comprising amino acid residues from about Thr-56 to about Val-65 (SEQ ID NO:2); and a polypeptide comprising amino acid residues from about Phe-70 to about Trp-83 (SEQ ID NO:2).
20. An isolated antibody that binds specifically to a CKβ-13 polypeptide of claim 18.
21. An isolated polynucleotide comprising a nucleic acid encoding a polypeptide fragment of SEQ ID NO:2; wherein said fragment has the same biological function or activity as CKβ-13.
22. The isolated polynucleotide of claim 21, wherein said biological function or activity is the modulation of leukocyte-endothelial cell interactions.
23. The isolated polynucleotide of claim 21, wherein said biological function or activity is the negative regulation of memory T cell recruitment and/or attachment to endothelial cells.
24. The isolated polynucleotide of claim 21, wherein said biological function or activity is the positive regulation of naive T cell recruitment and/or attachment to endothelial cells.
EP00978340A 1999-11-03 2000-11-02 CHIMIOKINE BETA 13 HUMAN Withdrawn EP1229795A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US432768 1995-05-02
US43276899A 1999-11-03 1999-11-03
PCT/US2000/030237 WO2001032128A2 (en) 1999-11-03 2000-11-02 Human chemokine beta-13

Publications (2)

Publication Number Publication Date
EP1229795A2 true EP1229795A2 (en) 2002-08-14
EP1229795A4 EP1229795A4 (en) 2004-07-28

Family

ID=23717510

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00978340A Withdrawn EP1229795A4 (en) 1999-11-03 2000-11-02 CHIMIOKINE BETA 13 HUMAN

Country Status (5)

Country Link
EP (1) EP1229795A4 (en)
JP (1) JP2003514517A (en)
AU (1) AU1581301A (en)
CA (1) CA2387808A1 (en)
WO (1) WO2001032128A2 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6737513B1 (en) 1996-06-07 2004-05-18 Icos Corporation Macrophage derived chemokine (MDC) and chemokine analogs and assay to identify modulators of MDC activity, and therapeutic uses for same
US7018627B1 (en) 1995-06-07 2006-03-28 Icos Corporation Macrophage derived chemokine (MDC), MDC analogs, MDC inhibitor substances, and uses thereof
US20060228331A1 (en) 2003-10-10 2006-10-12 Novo Nordisk A/S IL-21 Derivatives and variants
JP2007508332A (en) * 2003-10-17 2007-04-05 ノボ ノルディスク アクティーゼルスカブ Combination therapy

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
AU713267B2 (en) * 1995-06-06 1999-11-25 Human Genome Sciences, Inc. Human chemokine beta-13
ATE262346T1 (en) * 1995-11-30 2004-04-15 Us Gov Health & Human Serv C-C CHEMOKINES THAT PREVENT INFECTION WITH RETOVIRUSES
WO1998024908A1 (en) * 1996-12-05 1998-06-11 Human Genome Sciences, Inc. Human chemokine beta-13

Also Published As

Publication number Publication date
WO2001032128A2 (en) 2001-05-10
JP2003514517A (en) 2003-04-22
WO2001032128A9 (en) 2002-05-16
EP1229795A4 (en) 2004-07-28
WO2001032128A3 (en) 2001-11-08
AU1581301A (en) 2001-05-14
CA2387808A1 (en) 2001-05-10

Similar Documents

Publication Publication Date Title
US20060121514A1 (en) Prostacyclin-stimulating Factor-2
US6982320B2 (en) Cytokine receptor common gamma chain like
WO1999062927A1 (en) Connective tissue growth factor-4
WO2001032128A2 (en) Human chemokine beta-13
US6849413B2 (en) PGRP-L polynucleotides, polypeptides, and antibodies
WO2000009148A9 (en) Vascular endothelial growth factor 3
EP1223946A1 (en) Human neuropeptide receptor
EP1137656A1 (en) 31 human secreted proteins
US6534485B1 (en) Bone marrow-specific protein
US20020055147A1 (en) Human chemokine beta-13
WO2000023572A1 (en) Tnfr related gene 12
US6936688B2 (en) Human chemokine beta-10 mutant polypeptides
US20050026838A1 (en) Fibroblast Growth Factor-13
WO2001011046A1 (en) Dendritic enriched secreted lymphocyte activation molecule
WO2000071715A1 (en) Fibroblast growth factor 11
WO2000067775A1 (en) Fibroblast growth factor 15
WO2000071567A2 (en) Fibroblast growth factor 13
US20030082532A1 (en) Tumor necrosis factor receptor related gene 12 polypeptides
WO2000040726A1 (en) Human chemokine beta-10 mutant polypeptides
NZ527126A (en) An antibody that immunospecifically binds G-protein chemokine receptor (CCR5) polypeptide
US20030171319A1 (en) Human chemokine beta-10 mutant polypeptides
US20020098541A1 (en) TNFR related gene 12
WO2001094557A1 (en) Human chemokine beta-10 mutant polypeptides

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020603

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE TR

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SMITHKLINE BEECHAM CORPORATION

Owner name: THE BRIGHAM AND WOMEN'S HOSPITAL, INC.

Owner name: HUMAN GENOME SCIENCES, INC.

A4 Supplementary search report drawn up and despatched

Effective date: 20040615

RIC1 Information provided on ipc code assigned before grant

Ipc: 7C 12Q 1/68 B

Ipc: 7G 01N 33/68 B

Ipc: 7A 61K 48/00 B

Ipc: 7A 61K 39/395 B

Ipc: 7A 61K 38/19 B

Ipc: 7A 61K 31/713 B

Ipc: 7A 61K 31/7088 B

Ipc: 7A 01K 67/027 B

Ipc: 7C 07K 16/24 B

Ipc: 7C 07K 14/52 B

Ipc: 7C 12N 5/10 B

Ipc: 7C 12N 1/21 B

Ipc: 7C 12N 15/63 B

Ipc: 7C 12N 15/62 B

Ipc: 7C 12N 15/19 A

17Q First examination report despatched

Effective date: 20050202

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20050614