EP1226161A2 - Apo-2 receptor antibodies - Google Patents

Apo-2 receptor antibodies

Info

Publication number
EP1226161A2
EP1226161A2 EP00963542A EP00963542A EP1226161A2 EP 1226161 A2 EP1226161 A2 EP 1226161A2 EP 00963542 A EP00963542 A EP 00963542A EP 00963542 A EP00963542 A EP 00963542A EP 1226161 A2 EP1226161 A2 EP 1226161A2
Authority
EP
European Patent Office
Prior art keywords
apo
cells
antibody
antibodies
cell
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00963542A
Other languages
German (de)
French (fr)
Inventor
Avi J. Ashkenazi
Anan Chuntherapai
K. Jin Kim
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Genentech Inc
Original Assignee
Genentech Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Genentech Inc filed Critical Genentech Inc
Priority to EP05014041A priority Critical patent/EP1616882A3/en
Publication of EP1226161A2 publication Critical patent/EP1226161A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70578NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/75Agonist effect on antigen
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/70Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/76Antagonist effect on antigen, e.g. neutralization or inhibition of binding
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2317/00Immunoglobulins specific features
    • C07K2317/90Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/92Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value

Definitions

  • the present invention relates generally to the identification, isolation, and recombinant production of novel polypeptides, designated herein as "Apo-2" and to ant -Apo—2 antibodies.
  • Apoptosis or "Programmed Cell Death” Control of cell numbers in mammals is believed to be determined, in part, by a balance between cell proliferation and cell death.
  • One form of cell death sometimes referred to as necrotic cell death, is typically characterized as a pathologic form of cell death resulting from some trauma or cellular injury.
  • necrotic cell death is typically characterized as a pathologic form of cell death resulting from some trauma or cellular injury.
  • physiologic form of cell death which usually proceeds in an orderly or controlled manner. This orderly or controlled form of cell death is often referred to as "apoptosis" [see, e.g., Barr et al., Bio/Technology, 12:487-493 (1994);
  • McGRAUND OF THE INVENTION Apoptosis or "Programmed Cell Death” Control of cell numbers in mammals is believed to be determined, in part, by a balance between cell proliferation and cell death.
  • necrotic cell death is typically characterized as a pathologic form of cell death resulting
  • Apoptotic cell death naturally occurs m many physiological processes, including embryonic development and clonal selection m the immune system [Itoh et al., Cell, 66:233-243 (1991)]. Decreased levels of apoptotic cell death have been associated with a variety of pathological conditions, including cancer, lupus, and herpes virus infection [Thompson, Science, 267 : 1456-1462 (1995)].
  • Increased levels of apoptotic cell death may be associated with a variety of other pathological conditions, including AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, myocardial infarction, stroke, reperfusion injury, and toxin-induced liver disease [see, Thompson, supra] .
  • pathological conditions including AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, myocardial infarction, stroke, reperfusion injury, and toxin-induced liver disease [see, Thompson, supra] .
  • Apoptotic cell death is typically accompanied by one or more characteristic morphological ana biochemical changes in cells, such as condensation of cytoplasm, loss or plasma membrane m crovilli, segmentation of the nucleus, degradation of chromosomal DNA or loss of mitochondrial function.
  • extrinsic and intrinsic signals are believed to trigger oi induce such morphological and biochemical cellular changes [Raff, Nature, 356:397-400 (1992); Sachs et al . , Blood, 82:15 (1993)].
  • they can be triggered by hormonal stimuli, such as glucocorticoid hormones for immature thymocytes, as well as withdrawal of certain growth factors [Watanabe-Fukunaga et al . , Nature, 356: 314-317 (1992)].
  • oncogenes such as myc, rel , and E1A, and tumor suppressors, like p53, have been reported to have a role in inducing apoptosis.
  • Certain chemotherapy drugs and some forms of radiation have likewise been observed to have apoptosis-inducing activity [Thompson, supra] .
  • tumor necrosis factor- ⁇ tumor necrosis factor- ⁇
  • TNF- ⁇ tumor necrosis factor- ⁇
  • TNF- ⁇ tumor necrosis factor- ⁇
  • lymphotoxm a tumor necrosis factor- ⁇ ligand
  • CD30 ligand CD27 ligand
  • CD40 ligand, OX-40 ligan ⁇ , 4-lBB ligand, Apo-1 ligand (also referred to as Fas ligand or CD95 ligand), and Apo-2 ligand (aiso referred to as TRAIL) have been identified as members of the tumor necrosis factor ("TNF") family of cytokines [See, e.g., Gruss ana Dower, Blood, 8_5: 3378-3404 (1995); Wiley et al., Immunity, 3:673-682 (1995); Pitti et al . , J. Biol. Chem., 271:12687-12690 (1996); WO 97/01633 published January 16, 1997].
  • TNF tumor necrosis factor
  • TNF- ⁇ , TNF- ⁇ , CD30 ligand, 4-lBB ligand, Apo-1 ligand, and Apo-2 ligand have been reported to De involved m apoptotic cell death. Both TNF- and TNF- ⁇ have been reported to induce apoptotic death in susceptible tumor cells [Schmid et al . , Proc. Natl. Acad. Sci., 83:1881 (1986); Dealtry et al . , Eur. J. Immunol., V7:689 (1987)]. Zheng et al.
  • TNF- ⁇ is involved in post-stimulation apoptosis of CD8-pos ⁇ t ⁇ ve T cells [Zheng et al . , Nature, 377:348-351 (1995)].
  • Other investigators have reported that CD30 ligand may be involved n deletion of self-reactive T cells m the thymus [Amakawa et al . , Cold Spring Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No. 10, (1995)].
  • Apo-1 ligand s also reported to induce post-stimulation apoptosis in CD4-pos ⁇ t ⁇ ve T lymphocytes and m B lymphocytes, and may be involved m the elimination of activated lymphocytes when their function is no longer needed [Krammer et al., supra; Nagata et al . , supra] .
  • Agonist mouse monoclonal antibodies specifically binding to the Apo-1 receptor have been reported to exmbit cell killing activity that is comparable to or similar to that of TNF- ⁇ [Yonehara et al., J. Exp. Med., 1_69: 1747-1756 (1989)].
  • TNF Family of Receptors In ⁇ uction cf various cellular responses mediated by such TNF family cytokines is believed to be initiated by their binding to specific cell receptors.
  • TNF receptors Two distinct TNF receptors of approximately 55-kDa (TNFR1) and 75- kDa (TNFR2) ha ⁇ e been identified [Hohmann et al., J. Biol. Chem., 264 : 14927- 14934 (1989 ⁇ ; Brockhaus et al., Proc. Natl. Acad. Sci., 87:3127-3131 (1990); EP 417,563, published March 20, 1991] and human and mouse cDNAs corresponding to both receptor types nave been isolated and characterized [Loetscher et al .
  • Both TNFRs share the typical structure of cell surface receptors including extracellular, transmembrane ana mtracellular regions.
  • the extracellular portions of both receptors are tound naturally also as soluble TNF-binding proteins [Nophai, i. et al., EMBO . , 9:3269 (1990); and Kohno, T. et al . , Proc. Natl. Acad. Sci. U.S.A., _87:8331 (1990) .
  • the cloning of recombinant soluble TNF receptors was reported by Hale et al . [J. Cell. Biochem. Supplement 15F, 1991, p. 113 (P424) ] .
  • the extracellular portion of type 1 and type 2 TNFRs contains a repetitive ammo acid sequence pattern of four cysteine- ⁇ ch domains (CRDs) designated 1 through 4, starting from the NH -terminus .
  • CRDs cysteine- ⁇ ch domains
  • Each CRD is about 40 ammo acids long and contains 4 to 6 cysteme residues at positions which are well conserved [Schall et al., supra; Loetscher et al . , supra; Smith et al . , supra; Nophar et al .
  • CRD1 includes ammo acids 17 to about 54; CRD2- ammo acids from about 55 to about 97; CRD3- ammo acids from about 98 to about 140; and CRD4- ammo acids from about 141 to about 179 [Banner et al., Cell, 73:431-445 (1993)].
  • CRDs The potential role of the CRDs in ligand binding is also described by Banner et al . , supra .
  • NGFR nerve growth factor receptor
  • CRDs are also found m the soluble TNFR (sTNFR)-l ⁇ ke T2 proteins of the Shope and myxoma poxviruses [Upton et al., Virology, 160:20-29 (1987); Smith et al., Biochem. Biophys. Res. Commun., 176:335 (1991); Upton et al . , Virology, 184:370 (1991)].
  • sTNFR soluble TNFR
  • ⁇ 75 NGFR contains a proline-rich stretch of about 60 ammo acids, between its CRD4 and transmembrane region, which is not involved in NGF binding [Peetre, C. et al., Eur. J. Heamatol., 4J.:414-419 (1988); Seckinger, P. et al., J. Biol. Cnem., 2j54 : 11966-11973 (1989); Yan, H. and Chao, M.V., supra] .
  • a similar proline-rich region is found TNFR2 but not m TNFRl.
  • TNF family ligands identified to date are type II transmembrane proteins, whose C-termmus is extracellular.
  • the receptors the TNF receptor (TNFR) family identified to date are type I transmembrane proteins.
  • ECD extracellular domain
  • TNF family cytokmes include cleaved proteolytically at the cell surface; the resulting protein in each case typically forms a homot ⁇ meric molecule that functions as a soluble cytok e.
  • TNF receptor family proteins are also usually cleaved proteolytically to release soluble receptor ECDs that can function as inhibitors of the cognate cytokmes .
  • Pan et al . have disclosed another TNF receptor family member referred to as "DR4" [Pan et al., Science, 276: 111-113 (1997)].
  • the DR4 was reported to contain a cytoplasmic death domain capable of engaging the cell suicide apparatus.
  • Pan et al . disclose that DR4 is believed to be a receptor for the ligand known as Apo-2 ligand or TRAIL.
  • the cell death program contains at least three important elements - activators, inhibitors, and effectors; C. elegans, these elements are encoded respectively by three genes, Ced-4 , Ced-9 and Ced 3 [Steller, Science, 267:1445 (1995); Chmnaiyan et al . , Science, 275:1122-1126 (1997)].
  • TNFRl and Fas/Apol CD95
  • CD95 can activate apoptotic cell death [Chmnaiyan and Dixit, Current Biology, 6:555-562 (1996); Fraser and Evan, Cell; £5:781-784 (1996)].
  • TNFRl is also known to mediate activation of the transcription factor, NF-KB [Tartaglia et al., Cell, 74:845-853 (1993); Hsu et al., Cell, 84:299-308 (1996)] .
  • these two receptors share homology m their mtracellular domain (ICD) in an oligome ⁇ zation interface known as the death domain [Tartaglia et al., supra; Nagata, Cell, 8_8:355 (1997)].
  • Death domains are also found in several metazoan proteins that regulate apoptosis, namely, the Drosophila protein, Reaper, and the mammalian proteins referred to as FADD/MORT1, TRADD, and RIP [Cleveland and Ihle, Cell, 81:479- 482 (1995) ] .
  • FADD/MORT1 the mammalian proteins referred to as FADD/MORT1
  • TRADD the mammalian proteins referred to as FADD/MORT1
  • RIP the mammalian proteins referred to as FADD/MORT1
  • CD95 purportedly binds FADD directly, while TNFRl binds FADD indirectly via TRADD [Chmnaiyan et al . , Cell, 81:505-512 (1995); Bold n et al . , J. Biol.
  • FADD serves as an adaptor protein which recruits the Ce -3-related protease, MACH ⁇ /FLICE (caspase 8), into the death signalling complex [Boldm et al . , Cell, 85:803-815 (1996); Muzio et al., Cell, 85:817-827 (1996)].
  • Caspase 8 appears to be the trigger that sets off a cascade of apoptotic proteases, including the terleukm-l ⁇ converting enzyme (ICE; caspase 1) and CPP32/Yama (caspase 3), which may execute some critical aspects of the cell death programme [Fraser and Evan, supra] .
  • ICE terleukm-l ⁇ converting enzyme
  • CPP32/Yama caspase 3
  • caspase 1 and 3 can be inhibited by the product of the cowpox virus gene, crmA [Ray et al . , Cell, £9:597-604 (1992); Tewari et al . , Cell, 81:801-809 (1995)].
  • crmA cowpox virus gene
  • CrmA can inhibit TNFRl- and CD95-mduced cell death [Enari et al .
  • TNFRl, TNFR2 and CD40 modulate the expression of proinflammatory and costimulatory cytokmes, cytokine receptors, and cell adhesion molecules through activation of the transcription factor, F-KB [Tewari et al., Curr. Op. Genet. Develop., 6:39-44
  • F- B is the prototype of a family of dimeric transcription factors whose subunits contain conserved Rel regions [Verma et al . , Genes Develop., 9:2723-2735 (1995); Baldwin, Ann. Rev. Immunol., 14:649-681 (1996)].
  • NF-KB is complexed with members of the 1KB inhibitor family; upon mactivation of the 1KB m response to certain stimuli, released NF-KB translocates to the nucleus where it binds to specific DNA sequences and activates gene transcription.
  • Apo-2 is a member of the TNFR family; full-length nat ⁇ ve sequence human Apo-2 polypeptide exhibits some similarities to some known TNFRs, including a cytoplasmic death domain region. Full-lenqth native sequence human Apo-2 also exhibits similarity to the TNFR family m its extracellular cysteme- ⁇ ch repeats. Apo-2 polypeptide has been found to be capable of triggering caspase-dependent apoptosis and activating NF-KB.
  • the invention provides isolated Apo-2 polypeptide.
  • the invention provides isolated native sequence Apo-2 polypeptide, which one embodiment, includes an am o acid sequence comprising residues 1 to 411 of Figure 1 (SEQ ID NO:l) .
  • the isolated Apo-2 polypeptide comprises at least about 80% am o acid sequence identity with native sequence Apo-2 polypeptide comprising residues 1 to 411 of Figure 1 (SEQ ID NO:l).
  • the Apo-2 polypeptide is obtained or obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited as ATCC 209021.
  • the invention provides an isolated extracellular domain (ECD) sequence of Apo-2.
  • ECD isolated extracellular domain
  • the isolated extracellular domain sequence comprises ammo acid residues 54 to 182 of Fig. 1 (SEQ ID NO:l) .
  • the invention provides an isolated death domain sequence of Apo-2.
  • the isolated death domain sequence comprises ammo acid residues 324 to 391 of Fig. 1 (SEQ ID NO:l).
  • the invention provides chimeric molecules comprising Apo-2 polypeptide fused to a heterologous polypeptide or amino acid sequence.
  • An example of such a chimeric molecule comprises an Apo-2 fused to an immunoglobulin sequence.
  • Another example comprises an extracellular domain sequence of Apo-2 fused to a heterologous polypeptide or ammo acid sequence, such as an immunoglobulin sequence.
  • the invention provides an isolated nucleic acid molecule encoding Apo-2 polypeptide.
  • the nucleic acid molecule is RNA or DNA that encodes an Apo-2 polypeptide or a particular domain of Apo-2, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions.
  • the nucleic acid sequence is selected from:
  • the isolated nucleic acid may comprise the Apo-2 polypeptide cDNA insert of the vector deposited as ATCC 209021 which includes the nucleotide sequence encoding Apo-2 polypeptide.
  • the invention provides a vector comprising the nucleic aci ⁇ molecule encoding the Apo-2 polypeptide or particular domain of Apo-2.
  • a host cell comprising the vector or the nucleic acid molecule is also provide ⁇ .
  • a method of producing Apo-2 is further provide ⁇ .
  • the invention provides an antibody which specifically binds to Apo-2.
  • the antibody may be an agonistic, antagonistic, neutralizing, or blocking antibody. Dime ⁇ c molecules, in particular homodime ⁇ c molecules, comprising Apo-2 antibody are also provided.
  • the invention provides non-human, transgenic or knock-out animals.
  • a further embodiment of the invention provides articles of manufacture and kits that include Apo-2 or Apo-2 antibodies.
  • Figure 1 shows the nucleotide sequence (SEQ ID NO: 2) of a native sequence human Apo-2 cDNA and its derived ammo acid sequence (SEQ ID NO:l).
  • Figure 2A shows the derived ammo acid sequence (SEQ ID NO: 6) of a native sequence human Apo-2 - the putative signal sequence is underlined, the putative transmembrane domain is boxed, and the putative death domain sequence is dash underlined.
  • the cysteines of the two cysteine-nch domains are individually underlined.
  • Figure 2B shows an alignment and comparison of the death domain sequences of native sequence human Apo-2 (SEQ ID NO: 7), DR4 (SEQ ID NO: 8), Apo-3/DR3 (SEQ ID NO: 9), TNFRl (SEQ ID NO: 10;, and Fas/Apo-1 (CD95) (SEQ ID NO: 7), DR4 (SEQ ID NO: 8), Apo-3/DR3 (SEQ ID NO: 9), TNFRl (SEQ ID NO: 10;, and Fas/Apo-1 (CD95) (SEQ ID NO: 7), DR4 (SEQ ID NO: 8), Apo-3/DR3 (SEQ ID NO: 9), TNFRl (SEQ ID NO: 10;, and Fas/Apo-1 (CD95) (SEQ ID NO: 7), DR4 (SEQ ID NO: 8), Apo-3/DR3 (SEQ ID NO: 9), TNFRl (SEQ ID NO: 10;, and Fas/Apo-1 (CD95) (
  • FIG. 3 shows the interaction of the Apo-2 ECD with Apo-2L.
  • Fi ⁇ ure 4 shows the induction of apoptosis by Apo-2 and inhibition of Apo-2L activity by soluble Apo-2 ECD.
  • Human 293 cells (A, B) or HeLa cells (C) were transrected by pRK5 vector or by pRK5-based plasmids encoding Apo-2 and/or CrmA. Apoptosis was assessed by morphology (A), DNA fragmentation (B), or by FACS (C-E ⁇ .
  • Soluble Apo-2L was pre-mcubated with buffer or affinity- purified Apo-2 ECD together with anti-Flag antioody or Apo-2 ECD immunoadhesm or DR4 or TNFRl lmmunoadhesms and added to HeLa cells. The cells were latei analyzed for apoptosis (D) . Dose-response analysis using Apo-2L with Apo-2
  • ECD immunoadhesm was also determined (E) .
  • Fi ⁇ ure 5 shows activation of NF-KB by Apo-2, DR4, and Apo-2L.
  • A* HeLa cells were transfected with expression plasmids encoding the indicated proteins. Nuclear extracts were prepared and analyzed by an electrophoretic mobility shift assay.
  • B HeLa cells or MCF7 cells were treated with bufter, Apo-2L or TNF-alpha and assayed for NF ⁇ KB activity.
  • C HeLa cells were premcubated with buffer, ALLN or cyclohexamide before addition of Apo-2L. Apoptosis was later analyzed by FACS.
  • Figure 6 shows expression of Apo-2 mRNA human tissues as analyzed by Northern hypndization of human tissue poly A RNA blots.
  • Figure 7 shows the FACS analysis of an Apo-2 antibody, 3F11.39.7 (illustrated by the bold lines) as compared to IgG controls (dotted lines).
  • the 3F11.39.7 antibody recognized the Apo-2 receptor expressed in human 9D cells .
  • Figure 8 is a graph showing percent (°) apoptosis induced m 9D cells by Apo-2 antibody 3F11.39.7, the absence of goat anti-mouse IgG Fc .
  • Figure 9 is a bar diagram showing percent (%) apoptosis, as compared to Apo-2L, m 9D cells by Apo-2 antibody 3F11.39.7 m the presence or absence of goat anti-mouse IgG Fc .
  • Figure 10 is a bar diagram illustrating the ability of Apo-2 antibody 3F11.39.7 to block the apoptosis induced by Apo-2L m 9D cells.
  • Figure 11 is a graph showing results of an ELISA testing binding of Apo-2 antibody 3F11.39.7 to Apo-2 and to other known Apo-2L receptors referred to as DR4 , DcRl, and DcR2.
  • Fi ⁇ ure 12 provides a table identifying Apo-2 antibodies, 2B3.7.1
  • FIG. 13 shows the binding affinities of Apo-2 antibodies 3F11 and 3H3, to Apo-2-IgG, as determined in a KinExA '1 " assay. Binding affinities, e.g., of DR4 and Apo-2 lmmunoadhes s to Apo-2 ligand are shown for comparison .
  • Figure 14 shows apoptotic activity of Apo-2 antibodies, 3D5; 3C9; 5C7; 3H3; 3F11; 4B9; 2B3; and 3H1, on SKMES tumor cells m the presence of goat anti-mouse IgG Fc .
  • Figure 15A shows apoptotic activity of Apo-2 antibodies, 3F11 and 3H3, on Colo205 tumor cells m the presence or absence of goat anti-mouse IgG Fc.
  • Fiqure 15B shows apoptotic activity of Apo-2 antibodies, 3F11 and
  • Fiqure 16 shows graphs illustrating results of an ELISA testing binding of Apo-2 antibodies, 3D5; 3F11; 3H1; and 3H3, to Apo-2 and to other known Apo-2 ligand receptors referred to as DR4 and DcRl .
  • Figure 17 shows the results of an ELISA testing for blocking activity of Apo-2 antibodies, 3F11; 3H3; 2B3; 4B9; 5C7; 3H1; 3D5; 3C9; and 4H10.
  • Fiqure 18 shows the effects of Apo-2 antibodies, 3F11 and 3H3, on the growth of Colo205 tumors athymic nude mice, as measured by tumor volume.
  • Figure 19 shows data collection and refinement statistics for the x-ray crystal structure of Apo-2 (DR5) bound to Apo-2 ligand.
  • Fiqure 20 shows the Aoo-2L/Apo-2 complex.
  • the Apo-2L trimer is drawn as ribbon and the three receptors are rendered as tubes.
  • the disordered loop (residues 132-143) Apo-2L is lendered as small spheres.
  • the bound zinc atom and the bound cnlo ⁇ de ion pink are shown as small spheres.
  • Beta strands and relevant loocs are labeled.
  • A Side view. In this orientation, the membrane of the receptor-containing cell is at the bottom of the figure.
  • (B) View down the three-fold axis of the complex, perpendicular to (A) .
  • Figure 21 shows an open-book view of the Apo-2L/Apo-2 interface.
  • Apo-2L and one receptor are rendered as space filling models, while the other two receptors are shown as tubes.
  • Residues m the interface are colored by ° 0 of buried accessible surface area upon complex formation (l-25o, very light grey; 25-50°, light grey; 50-75o, grey; 75-100°o, dark grey).
  • the interface divides into two patches, A and B (labeled) .
  • a probe size of 1.4 Angstrom was used to calculate the accessible surface area.
  • Apo-2 polypeptide and "Apo-2" when used herein encompass native sequence Apo-2 and Apo-2 variants (which are further defined herein). These terms encompass Apo-2 from a variety of mammals, including humans.
  • the Apo-2 may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.
  • a “native sequence Apo-2” comprises a polypeptide having the same ammo acid sequence as an Apo-2 derived from nature.
  • a native sequence Apo-2 can have the ammo acid sequence of naturally-occurring Apo-2 from any mammal.
  • Such native sequence Apo-2 can be isolated from nature or can be produced by recombinant or synthetic means.
  • the term "native sequence Apo-2” specifically encompasses naturally-occurring truncated or secreted forms of the Apo-2 ( e . g. , an extracellular domain sequence), naturally-occurring variant forms ⁇ e . g. , alternatively spliced forms) and naturally-occurring allelic variants of the Apo-2.
  • a naturally-occurring variant form of the Apo- 2 includes an Apo-2 having an ammo acid substitution at residue 410 m the ammo acid sequence shown m Figure 1 (SEQ ID NO : 1 ) .
  • the leucme residue at position 410 is substituted by a methionme residue.
  • the ammo acid residue at position 410 is identified as "Xa ⁇ " to indicate that the ammo acid may, optionally, be either leucme or methionme.
  • the native sequence Apo-2 is a mature or full- length native sequence Apo-2 comprising ammo acids 1 to 411 of Fig. 1 (SEQ ID N0:1) .
  • Apo-2 extracellular domain refers to a form of Apo-2 whicri is essentially free of the transmembrane and cytoplasmic domains of Apo-2.
  • Apo-2 ECD will have less than 1 of such transmembrane and/or cytoplasmic domains ano preferably, will have less than 0.5 of such domains.
  • Apo-2 ECD will comprise ammo acid residues 54 to 182 of Fig. 1 (SEQ ID NO : 1 ) or ammo acid residues 1 to 182 of Fig. 1 (SEQ ID N0:1) .
  • the Apo-2 extracellular domain sequence may also comprise am o acid residues 1 to 130 of Fig.
  • Apo-2 variant means a biologically active Apo-2 as defined below having at least about 80 ammo acid sequence identity with the Apo-2 having the deduced ammo acid sequence shown in Fig. 1 (SEQ ID NO:l) for a full- length native sequence human Apo-2 or with the deduced ammo acid sequences for an extracellular domain or death domain of Apo-2 identified herein.
  • Apo-2 variants include, for instance, Apo-2 polypeptides wherein one or more ammo acid residues are added, or deleted, at the N- or C-terminus of the sequence of Fig. 1 (SEQ ID NO:l).
  • an Apo-2 variant will have at least about 80 « ammo acid sequence identity, more preferably at least about 90% ammo acid sequence identity, and even more preferably at least about 95 o ammo acid sequence identity with the ammo acid sequence of Fig. 1 (SEQ ID NO:l) or with the extracellular domain or death domain sequences of Apo-2.
  • Percent (O ammo acid sequence identity” with respect to the sequences identified herein is defined as the percentage of ammo acid residues a candidate sequence that are identical with the ammo acid residues in the Apo-2 sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent ammo acid sequence identity can be achieved in various ways that are within the skill in the art can determine appropriate parameters for measuring alignment, including assigning algorithms needed to achieve maximal alignment over the full- length sequences being compared. For purposes herein, percent ammo acid identity values can be obtained using the sequence comparison computer program, ALIGN-2, which was authored by Genentech, Inc.
  • ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, CA. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
  • epitope tagged when used herein reters to a chimeric polypeptide comprising Apo-2, or a domain sequence thereof, fused to a "tag po ypeptide".
  • the tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the Apo-2.
  • the tag polypeptide preferably also is la rly unique so that the antibody does not substantially cross-react with other epitopes.
  • Suitable tag polypeptides generally have at least six am o acid residues and usually between about 8 to about 50 ammo acid residues (preferably, between about 10 to about 20 residues).
  • Isolated, when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separate ⁇ and/or recovered from a component of its natural environment. Contaminant components ot its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other protemaceous or non-protemaceous solutes.
  • the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-termmal or internal am o aci sequence y use o a spinning cup sequena or, or o omogenei y by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain.
  • Isolated polypeptide includes polypeptide m si tu within recombinant cells, since at least one component of the Apo-2 natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
  • An "isolated" Apo-2 nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated m the natural source of the Apo-2 nucleic acid.
  • An isolated Apo-2 nucleic acid molecule is other than in the form or setting in which it is found m nature. Isolated Apo-2 nucleic acid molecules therefore are distinguished from the Apo-2 nucleic acid molecule as it exists in natural cells.
  • an isolated Apo-2 nucleic acid molecule includes Apo-2 nucleic acid molecules contained in cells that ordinarily express Apo-2 where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
  • control sequences refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism.
  • the control se ⁇ uences that are suitable for prokaryotes include a promoter, optionally an operator sequence, and a ⁇ bosome binding site.
  • Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
  • Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence.
  • DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide;
  • a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or
  • a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation.
  • "operably linked” means that the DNA sequences bein ⁇ linked are contiguous, and, m the case of a secretory leader, contiguous and m reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites oo not exist, the synthetic oligonucleotide adaptors or linkers are used m accordance with conventional practice.
  • antibody is used m the broadest sense and specifically covers ant ⁇ -Apo-2 monoclonal antibodies (including agonist, antagonist, and blocking or neutralizing antibodies) and ant ⁇ -Apo-2 antibody compositions witn polyepitopic specificit .
  • monoclonal antibody refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present minor amounts. Monoclonal antioodies are highly specific, being directed against a single antigenic site.
  • m contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed agains i eren e erminan s epi opes , eac monoc ona an i o y is directed against a single determinant on the antigen.
  • the monoclonal antibodies herein include hybrid and recombinant antibodies produced by splicing a variable (including hyperva ⁇ able) domain of an ant ⁇ -Apo-2 antibody with a constant domain, or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F(ab') , and Fv) , so long as they exhibit the desired biological activity. See, e . g. U.S. Pat. No. 4,816,567 and Mage et al., in Monoclonal Antibody Production Techniques and Applications, pp.79-97 (Marcel Dekker, Inc. : New York, 1987) .
  • the modifier "monoclonal” indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method.
  • the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milste , Nature, 256: 495 (1975), or may be made by recombinant DNA methods such as described m U.S. Pat. No. 4,816,567.
  • the “monoclonal antibodies” may also be isolated from phage libraries generated using the techniques described in McCafferty et al . , Nature, 348 : 552-554 (1990), for example.
  • Humanized forms of non-human (e.g. murine) antibodies are specific chimeric lmmunoglobulms , immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')_ or other antigen-bmdmg subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin.
  • humanized antibodies are human lmmunoglobulms (recipient antibody) which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity.
  • Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • the humanized antibody may comprise residues which are found neither m the recipient antibody nor m the imported CDR oi framework sequences. These modifications are made to further refine and optimize antibody performance.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, m which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FP regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region or domain ( Fc ) , typically that of a human immunoglobulin.
  • cytotoxic agent refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells.
  • the term is intended to include radioactive isotopes (e.g. I 1 ! , I 1 " , Y 9( and Re l ' ) , chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or variants and/or fragments thereof.
  • chemotherapeutic agent is a chemical compound useful m the treatment of cancer.
  • chemotherapeutic agents include ad ⁇ amycm, doxorubicm, epirubic , 5-fluorouracil, cytosme arabmoside ("Ara-C”), cyclophosphamide, thiotepa, busulfan, cytox , taxoids, e.g.
  • paclitaxel TAXOLTM, Bristol-Myers Squibb Oncology, Princeton, NJ
  • doxetaxel Tetraxotere, Rh ⁇ ne-Poulenc Rorer, Antony, Rnace
  • toxotere methotrexate
  • cisplatm melphalan
  • vmblastme bleomycm
  • etoposide etoposide
  • lfosfamide mitomyc C
  • mitoxantrone vmcrist e
  • vmorelbme carboplatm, teniposide, daunomyc , carmmomycm, ammopterm, dactmomycm, mitomyc s, esperamicms
  • hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onap ⁇ stone
  • Bioly active and “desired biological activity” with respect to an Apo-2 polypeptide for the purposes herein means (1) having the ability to modulate apoptosis (either m an agonistic or stimulatmq manner or in an antagonistic or blocking manner) at least one type of mammalian cell in vivo or e vi vo; (2) having the ability to bind Apo-2 ligand; or (3) having the ability to modulate Apo-2 ligand signaling and Apo-2 ligand activity.
  • apoptosis and “apoptotic activity” are used in a broad sense and refer to the orderly or controlled form of cell death m mammals that is typically accompanied by one or more characteristic cell changes, including condensation of cytoplasm, loss of plasma membrane microvilli, segmentation of the nucleus, degradation of chromosomal DNA or loss of mitochond ⁇ al function. This activity can be determined and measured, for instance, by cell viability assays, FACS analysis or DNA electrophoresis, all of which are known in the art .
  • the terms “treating,” “treatment,” and “therapy” as used herein refer to curative therapy, prophylactic therapy, and preventative therapy.
  • cancer cancer
  • cancer cancer
  • carcinoma Ivmphom ⁇
  • blastoma blastoma
  • sarcoma sarcoma
  • leukemia reier tc
  • cancers include squamous cell cancel, small-cell lunq cancer, non-small cell lung cancer, blastoma, gastrointestinal cancel, renal cancer, pancreatic cancer, glioma, neuroblastoma , cervical cancer, ovarian cancer, lung cancer, liver cancer, stomach cancer, bladder cancer, hepatoma, breast cancer, colon cancer, glioblastoma, endometria carcinoma, salivary gland carcinoma, kidney cancer, colorectal cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer
  • mammal refers to any mammal classified as a mammal, includina humans, cows, horses, dogs and cats. In a preferred embodiment ot tie invention, the mammal is a human. II . Compositions and Methods of the Invention
  • the present invention provides newly identified and isolated Apo-2 polypeptides and Apo-2 antibodies.
  • Applicants have identified and isolated various human Apo-2 polypeptides.
  • the properties and characteristics of some of these Apo-2 polypeptides and ant ⁇ -A ⁇ o-2 antibodies are described m further detail in the Examples below.
  • a description follows as to how Apo-2 and Apo-2 variants, as well as Apo-2 chimeric molecules and ant ⁇ -Apo-2 antibodies, may be prepared.
  • the description below relates primarily to production of Apo-2 by culturmg cells transformed or transfected with a vector containing Apo-2 nucleic acid. It is of course, contemplated that alternative methods, which are well known m the art, may be employed to prepare Apo-2.
  • the DNA encoding Apo-2 may be obtained from any cDNA library prepared from tissue believed to possess the Apo-2 mRNA and to express it at a detectable level. Accordingly, human Apo-2 DNA can be conveniently obtained from a cDNA library prepared from human tissues, such as the bacte ⁇ ophage libraries of human pancreas and kidney cDNA described m Example 1.
  • the Apo- 2-encodmg gene may also be obtained from a genomic library or by oligonucleotide synthesis.
  • Probes such as antibodies to the Apo-2 or oligonucleotides of at least about 20-80 bases
  • Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described m Sambrool et al., Molecular Cloning: A Laboratory Manual (New York: Cola Spring Harbor Laboratory Press, 1989) .
  • An alternative means to isolate the gene encoding Apo-2 is to use PCR methodology [Sambrook et al . , supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)] .
  • a preferred method or screening employs selected oligonucleotide sequences to screen cDNA libraries from various human tissues.
  • Example 1 describes techniques for screening a cDNA library.
  • the oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized.
  • the oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA m the library being screened. Methods of labeling are well known m the art, and include the use of radiolabels like P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency ana high stringency, are provided m Sambrook et al., supra .
  • Nucleic acid having all the protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced ammo acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al . , supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
  • Apo-2 variants can be prepared by introducing appropriate nucleotide changes into the Apo-2 DNA, or by synthesis of the desired Apo-2 polypeptide.
  • amino acid changes may alter post-translational processes of the Apo-2, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics .
  • Variations m the native full-length sequence Apo-2 or in various domains of the Apo-2 described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Pat. No. 5,364,934.
  • Variations may be a substitution, deletion or insertion of one or more codons encoding the Apo-2 that results in a change the ammo acid sequence of the Apo-2 as compared with the native sequence Apo-2.
  • the variation is by substitution of at least one ammo acid with any other ammo acid in one or more of the domains of the Apo-2 molecule.
  • the variations can be made using methods known m the art such as oligonucleotide-med ated (site-directed) mutagenesis, alanme scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., £:4431 (1985); Zoller et al . , Nucl .
  • Scanning amino acid analysis can also be employed to identify one or more ammo acids along a contiguous sequence which are involved m the interaction with a particular ligand or receptor.
  • preferred scanning ammo acids are relatively small, neutral ammo acids.
  • ammo acids include alanme, glycme, serine, and cysteme.
  • Alanme is the preferred scanning ammo acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alanme is also preferred because it is the most common ammo acid. Further, it is frequently found m both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 105:1 (1976) J. If alanme substitution does not yield adequate amounts of variant, an isoteric ammo acid can be used.
  • Apo-2 variants are produced, they can be contacted with, for instance, Apo-2L, and the interaction, if any, can be determined.
  • the interaction between the Apo-2 variant and Apo-2L can be measured by an in vi tro assay, such as described n the Examples below. While any number of analytical measurements can be used to compare activities and properties between a native sequence Apo-2 and an Apo-2 variant, a convenient one for binding is the dissociation constant K of the complex formed between the Apo- 2 variant and Apo-2L as compared to the K d for the native sequence Apo-2.
  • representative sites m the Apo-2 sequence suitable for mutagenesis would include sites within the extracellular domain, and particularly, within one or both of the cysteme- ⁇ ch domains. Such variations can be accomplished using the methods described above.
  • Apo-2 resembles TNFRl m overall structure with relatively little defined secondary structure. It is tethered into an elongated shape by a series of seven disulfide bridges, six of which are found m subdomams of Apo-2 (residues 43-84 and 85-130, respectively; see Fig. 1, SEQ ID N0:1) that correspond structurally to the second and third CRDs of the TNFRl receptor.
  • the first disulfide bridge of Apo-2, between residues 28 and 41 Fig.
  • the C-termmal residues of Apo-2 are well ordered up to residue 128 m one copy (the " R" chain) and up to residue 130 the other two (the " S” and " T” chains) .
  • Residue 130 is predicted to be the final extracellular residue before the putative single transmembrane hel ⁇ > connecting the receptor to its mtracellular death domain.
  • the C-termmi of the receptors form a triangle approximately 50 A on a side.
  • the interface of the Apo-2 l ⁇ gand/Apo-2 complex is divided into two patches- patch A and patch B.
  • the dominant characteristic of patch B tne Apo-2L/Apo-2 interface is the interaction between Tyr 216 of Apo-2L (using the numbermq of the amino aci ⁇ sequence for Apo-2L provided m Pitti et al., J. Biol. Chem., 271: 12687-12690 (1996)) and the 50s loop of the Apo-2 receptor.
  • Residue Tyr 216 is conserved m many of the TNF superfamily ligands (including TNF-alpha, TNF-beta, FasL and OPGL), while other members have a similar large hydrophobic residue at this position.
  • patch A near the bottom of the interface involves interactions made by the 90s loop on CRD3 of Apo-2, which has a completely different conformation than the corresponding loop m tne TNFRl .
  • patch B it is believed that the 50s loop of the receptor and
  • Apo-2 ligand residue 216 provide a hydrophobic patch generally important for binding, whereas m patch A, the receptor 90s loop and the Apo-2 ligand residue at or near position 205 control the specificity and cross- reactivity. Based on the structure identified by Applicants, the 50s loop and the 90s loop of the Apo-2 receptor are expected to carry most of the ligand-bindmg determinants.
  • the Apo-2 variants of the invention will retain or possess native sequence ammo acid residues (as provided m Figure 1) m the 50s and/or 90s loop. It is contemplated that Apo-2 may be mutate ⁇ (by insertion, deletion, and/or substitution) in certain aspects which will affect ligand binding.
  • the histidine and phenylalanme residues at positions 53 and 59, respectively, of the Apo-2 sequence are both relatively large residues. These two residues are believed to contact residues Asp218 and Serl59 of the Apo-2 ligand; thus introducing larger side chains at the 53 and 59 positions of the Apo-2 sequence may adversely affect Apo-2L affinity for Apo-2 (but improve affinity tor DR4 ⁇ . Similar mutations may be accomplished at positions 6 , 65, and/or 104 of the Apo-2 sequence.
  • Mutations in any one or all of the Apo-2 residues at positions 50 through 62 may affect binding of ammo acid residues at or near residue Tyr216 of the Apo-2L sequence, while mutations m any one or all of the Apo-2 residues at positions 65 through 69, 90 through 104, 10b, 111, or 122 may affect binding ot ammo acid residues at or near residue Gln205 of Apo-2 ligand. It is contemplated that mutations at such residue vs) may enhance or decrease interactions (such as binding) with Apo-2 ligand. 2. Insertion of Nucleic Acid into A Replicable Vector
  • the nucleic acid e.g., cDNA or genomic DNA
  • the nucleic acid may be inserted into a replicable vector for further cloning (amplification of the DNA) or for expression.
  • a replicable vector for further cloning (amplification of the DNA) or for expression.
  • Various vectors are publicly available.
  • the vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence, each of which is described below.
  • the Apo-2 may be produced recomb antly not only directly, but also as a fusion polypeptide with a heteroloqous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N- terminus of the mature protein or polypeptide.
  • the signal sequence may be a component of the vector, or it may be a part of the Apo-2 DNA that is inserted into the vector.
  • the heterologous signal sequence selected preferably is one that is recognized and processed ( i . e . , cleaved by a signal peptidase) by the host cell.
  • the signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, pemcillmase, lpp, or heat-stable enterotoxm II leaders.
  • the signal sequence may be, e.g., the yeast vertase leader, alpha factor leader (including Saccharomyces and
  • Kl uyveromyces c f Xactor leaders the latter described m U.S. Pat. No. 5,010,182
  • acid phosphatase leader the C. albi cans glucoamylase leader
  • the signal described m WO 90/13646 published 15 November 1990 the signal described m WO 90/13646 published 15 November 1990.
  • the native Apo-2 presequence that normally directs insertion of Apo-2 in the cell membrane of human cells in vi vo is satisfactory, although other mammalian signal sequences may be used to direct secretion of the protein, such as siqnal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders, for example, the herpes simplex glycoprotem D signal.
  • Ihe DNA for such precursor region is preferably ligated m reading frame to DNA encoding Apo-2. (ii) Origin of Replication Component
  • Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells.
  • this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins ol replication or autonomously replicating sequences.
  • Such sequences are well known for a variety of bacteria, yeast, and viruses.
  • the origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2 ⁇ plasmid origin is suitable for yeast, and various viral origins (SV40, po yoma, adenovirus, VSV or BPV) are useful for cloning vectors m mammalian cells.
  • the origin of replication component is not needed for mammalian expression vectors (the SV40 origin may typically be used because it contains the early promoter) .
  • Most expression vectors are "shuttle" vectors, i.e., they are capable of replication m at least one class of organisms but can be transfected into another orqanism for expression.
  • a vector is cloned m E . cc and then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome.
  • DNA may also be amplified by insertion into the host genome. This is readily accomplished using Ba cill us species as hosts, for example, by including m the vector a DNA sequence that is complementary to a sequence found in Bacill us genomic DNA. Transfection of Bacill us with this vector results in homologous recombination with the genome and insertion of Apo-2 DNA. However, the recovery of genomic DNA encoding Apo-2 is more complex than that of an exogenously replicated vector because restriction enzyme digestion is required to excise the Apo-2 DNA.
  • Selection Gene Component Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium.
  • Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillm, neomycin, methotrexate, or tetracyclme, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanme racemase for Ba cill i .
  • One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs neomycin [Southern et al., J. Molec. Appl . Genet., £:327 (1982)], mycophenolic acid (Mulligan et al . , Science, 209 : 1422 (1980)] or hygromycin [Sugden et al . , Mol. Cell. Biol., 5:410-413 (1985)].
  • the three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (genetic ), xgpt (mycophenolic acid), or hygromycin, respectively.
  • suitable selectable markers for mammalian cells are those that enable tne identification of cells competent to take up the Apo-2 nucleic acid, such as DHFR or thymidme kmase.
  • the mammalian cell transformants are placed under selection pressure that only the transformants are uniquely adapted to survive by virtue of having taken up the marker.
  • Selection pressure is imposed by culturing the transformants under conditions in which the concentration of selection agent m the medium is successively changed, thereby leading to amplification of both the selection gene and the DNA that encodes Apo-2.
  • Amplification is the process by which genes m greater demand for the production of a protein critical for growth are reiterated tandem within the chromosomes of successive generations of recombinant cells. Increased quantities of Apo-2 are synthesized from the amplified DNA.
  • Other examples of ampliflable genes include metallothionein-I and -II, adenosine deaminase, ana ormthme decarboxylase .
  • Cells transformed with the DHFR selection gene may first oe identified by culturing all of the transformants a culture medium that contains methotrexate (Mtx) , a competitive antagonist of DHFR.
  • Mtx methotrexate
  • An appropriate ost ce w en wi -type DHFR is employed is the C inese amster ovary H cell line deficient m DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). The transformed cells are then exposed to increased levels of methotrexate.
  • This amplification technique can be used with any otherwise suitable host, e.g., ATCC No. CCL61 CHO-K1, notwithstanding the presence of endogenous DHFR if, for example, a mutant DHFR gene that is highly resistant to Mtx is employed (EP 117,060).
  • host cells transformed or co-transformed with DNA sequences encoding Apo-2, wild-type DHFR protein, and another selectable marker such as ammoglycoside 3 ' -phosphotransferase (APH) can be selected by cell growth medium containing a selection agent for the selectable marker such as an ammoglycosidic antibiotic, e.g., kanamycm, neomycin, or G418. See U.S. Patent No. 4, 965, 199.
  • APH ammoglycoside 3 ' -phosphotransferase
  • a suitable selection gene for use m yeast is the trpl gene present m the yeast plasmid YRp7 [Stmchcomb et al., Nature, 282:39 (1979); Kmgsman et al., Gene, 7:141 (1979); Tschumper et al., Gene, £0:157 (1980)].
  • the trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow m tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, £5:22-33 (1977)].
  • the presence of the trpl lesion the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan.
  • Leu2- deficient yeast strains (ATCC 20,622 or 38,626) are complemented by known plasmids bearing the Leu2 gene.
  • vectors derived from the 1.6 ⁇ m circular plasmid pKDl can be used for transformation of Kl uyveromyces yeasts [Bianchi et al . , Cur . Genet . , £2:185 (1987)]. More recently, an expression system for large-scale production of recombinant calf chvmosm was reported for K. la ctis [Van den Berg, Bio/Technology, 8:135 (1990)].
  • Promoters are untranslated sequences located upstream (5') to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of particular nucleic acid sequence, such as the Apo-2 nucleic acid sequence, to which they are operably linked.
  • Such promoters typically fall into two classes, inducible and constitutive.
  • Inducible promoters are promoters that initiate mcieased levels of transcription from DNA under their control in response to some change m culture conditions, e.g., the presence or absence of a nutrient or a chanqe temperature. At this time a larqe number of promoters recognized by a variety o potentia ost ce s are we nown.
  • ese promo ers are operably linked to Apo-2 encoding DNA by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native Apo-2 promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of the Apo-2 DNA.
  • Promoters suitable for use with prokaryotic hosts include the ⁇ - lactamase and lactose promoter systems [Chang et al . , Nature, 275 : 17-624 (1978); Goeddel et al., Nature, ££1:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., £:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, £0:21-25 (1983)].
  • other known bacterial promoters are suitable.
  • Promoter sequences are known for eukaryotes. Virtually all eukaryotic genes have an AT- ⁇ ch region located approximately 25 to 30 bases upstream from the site where transcription is initiated. Another sequence found 70 to 80 bases upstream from the start of transcription of many genes is a CXCAAT region where X may be any nucleotide. At the 3' end of most eukaryotic genes is an AATAAA sequence that may be the signal for addition of the poly A tail to the 3' end of the coding sequence. All of these sequences are suitably inserted into eukaryotic expression vectors.
  • Suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kmase [Hitzeman et al., J. Biol. Chem. , 255 : 12073 (1980)] or other glycolytic enzymes [Hess et al . , Adv. Enzyme Reg.
  • yeast promoters which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, deqradative enzymes associated with nitrogen metabolism, metallothionem, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization.
  • Suitable vectors and promoters for use m yeast expression are rurther described in EP 73,657.
  • Yeast enhancers also are advantageously used with yeast promoters.
  • Apo-2 transcription from vectors mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpoy virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian promoters, e . g.
  • viruses such as polyoma virus, fowlpoy virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian promoters,
  • the early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication [Fiers et al., Nature, 273 : 113 (1978); Mulligan and Berg, Science, 209:1422-1427 (1980); Pavlakis et al . , Proc. Natl. Acad. Sci. USA, 78:7398-7402 (1981)].
  • the immediate early promoter of the human cytomegalovirus is conveniently obtained as a H dlll E restriction fragment [Greenaway et al., Gene, £8:355-360 (1982)].
  • a system for expressing DNA m mammalian hosts using the bovme papilloma virus as a vector is disclosed m U.S. Patent No. 4,419,446. A modification of this system is described in U.S. Patent No. 4,601,978 [See also Gray et al .
  • Enhancers are cis-act q elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Enhancers are relatively orientation and position independent, having been found 5' [Laimms et al., Proc. Natl. Acad. Sci. USA, 78:464-468 (1981]) and 3' [Lusky et al . , Mol . Cell Bio.
  • enhancer sequences are now known from mammalian genes (globm, elastase, albumin, ⁇ ⁇ fetoprotem, and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus.
  • Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. See also Yaniv, Nature, 297 : 17-18 (1982) on enhancing elements for activation of eukaryotic promoters.
  • the enhancer may be spliced into the vector at a position 5' or 3' to the Apo-2 coding sequence, but is preferably located at a site 5' from the promoter.
  • Transcription Termination Component Expression vectors used eukaryotic host cells will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs . These regions contain nucleotide segments transcribed as polyadenylated fragments the untranslated portion of the mRNA encoding Apo-2.
  • the ligation mixtures can be used to transform E. col l K12 strain 294 (ATCC 31,446) and successful transformants selected by ampicillm or tetracycline resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction endonuclease digestion, and/or sequenced by the method of Messing et al., Nucleic Acids Res., 9:309 (1981) or by the method of Maxam et al., Methods m Enzymology, 65:499 (1980).
  • transient expression vectors that provide for the transient expression m mammalian cells of DNA encoding Apo-2 may be employed.
  • transient expression involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector and, m turn, synthesizes high levels of a desired polypeptide encoded by the expression vector [Sambrook et al., supra]
  • Transient expression systems comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by cloned DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties.
  • transient expression systems are particularly useful m the invention lor purposes of identifying Apo-2 variants.
  • Vertebrate Cell Vectors Othei methods, vectors, and host cells suitable for adaptation to the synthesis of Apo-2 m recombinant vertebrate cell culture are described m Gethmq et al . , Nature, £93:620-625 (1981); Mantei et al . , Nature, 281 : 40-46 (1979); EP 117,060; and EP 117,058.
  • Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above.
  • Suitable prokaryotes for this purpose include but are not limited to eubacteri ⁇ , such as Gram-negative or Gram-positive organisms, for example, Enterobacte ⁇ aceae such as Escne ⁇ cnia , e . ⁇ . , E . col i , En terobacter, Erwini ⁇ , Klebsiel la , Proteus, Salmonella , e . g . , Salmonella typnimu ⁇ um, erra tia , e . g.
  • B . subt il is and B. l i cneniformis (e.g., B . l i chenirormis 41P disclosed DD 266,710 published 12 April 1989), Pseudomonas such as P. aeruqmosa , and Strevtomyces .
  • the host cell should secrete minimal amounts or proteolytic enzymes .
  • eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for Apo-2- encoding vectors.
  • Sa ccharomyces cerevisiae, or common baker's yeast is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein.
  • Suitable host cells for the expression of glycosylated Apo-2 are derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture.
  • invertebrate cells include plant and insect cells.
  • Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar) , Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bomby mori have been identified [See, e.g., Luckow et al . , Bio/Technology, 6:47-55 (1988); Miller et al . , in Genetic Engineering, Setlow et al., eds., Vol. 8 (Plenum Publishing, 1986), pp.
  • a variety of viral strains for transfection are publicly available, e.g., the L-l variant of Au tographa cal if orni ca NPV and the Bm-5 strain of Bomby mori NPV.
  • Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts.
  • plant cells are transfected by incubation with certain strains of the bacterium Agroba cte ⁇ um tumefaciens .
  • the DNA encoding the Apo-2 can be transferred to the plant cell host such that it is transfected, and will, under appropriate conditions, express the Apo-2- encodmg DNA.
  • regulatory and signal sequences compatible with plant cells are available, such as the nopalme synthase promoter and polyadenylation signal sequences [Depicker et al., J. Mol. Appl .
  • DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant-expressiple genes m recombinant DNA-contammg plant tissue [EP 321,196 published 21 June 1989] .
  • Propagation of vertebrate cells m culture is also well known m the art [See, e . g. , Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)].
  • useful mammalian host cell lines are monkey kidney CVl line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth m suspension culture, Graham et al . , J. Gen Virol ⁇ , £6:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cellsXDHFR (CHO, Urlaub and Chasm, Proc. Natl. Acad. Sci.
  • mice sertoli cells TM4, Mather, Biol. Reprod. , £:243-251 (1980)
  • monkey kidney cells CVl ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); humar cervical carcinoma cells (HELA, ATCC CCL 2); canme kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci., £83:44-68 (1982)); MRC 5 cells; and FS4 cells.
  • Host cells are transfected and preferably transformed with the above-described expression or cloning vectors for Apo-2 production and cultured m conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
  • Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, CaP0 4 and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
  • Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells.
  • the calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers.
  • Infection with Agrobacte ⁇ um tumefaciens is used for transformation of certain plant cells, as described by Shaw et al., Gene, £:315 (1983) and WO 89/05859 published 29 June 1989.
  • plants may be transfected using ultrasound treatment as described in WO 91/00358 published 10 January 1991.
  • Prokaryotic cells used to produce Apo-2 may be cultured suitable media as described ⁇ enerally Sambrook et al., supra .
  • the mammalian host cells used to produce Apo-2 may be cultured m a variety of media. Examples or commercially available media include Ham's F10 (Sigma), Minimal Essential Medium (“MEM”, Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium (“DMEM”, Sigma).
  • Any such media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transfemn, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidme), antibiotics (such as Gentamycm drug) , trace elements (defined as inorganic compounds usually present at final concentrations m the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled m the art.
  • the culture conditions such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the host cells referred to this disclosure encompass cells in culture as well as cells that are within a host animal. 5. Detecting Gene Amplification/Expression Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA, £7:5201-5205 (1980)], dot blotting (DNA analysis), or m si tu hybridization, using an appropriately labeled probe, based on the sequences provided herein. Various labels may be employed, most commonly radioisotopes, and particularly J P.
  • biotin- modified nucleotides for introduction into a polynucleotide .
  • the biotin then serves as the site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionucleotides, fluorescers or enzymes.
  • antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-prote duplexes.
  • the antibodies m turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can oe detected.
  • Gene expression may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product.
  • immunohistochemical staining techniques a cell sample is prepared, typically P ⁇ dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually v ⁇ sual_y detectable, such as enzymatic labels, fluorescent labels, or luminescent lapels.
  • Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence Apo-2 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to Apo-2 DNA and encoding a specific antibody epitope. 6. Purification of Apo-2 Polypeptide
  • Forms of Apo-2 may be recovered from culture medium or from host cell lysates. If the Apo-2 is membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g. T ⁇ ton-X 100) or its extracellular domain may be released by enzymatic cleavage.
  • a suitable detergent solution e.g. T ⁇ ton-X 100
  • the Apo-2 When Apo-2 is produced in a recombinant cell other than one of human origin, the Apo-2 is free of proteins or polypeptides of human origin. However, it may be desired to purify Apo-2 from recombinant cell proteins or polypeptides to obtain preparations that are substantially homogeneous as to Apo-2. As a first step, the culture medium or lysate may be cent ⁇ fuged to remove particulate cell debris.
  • Apo-2 thereafter is purified from contaminant soluble proteins and polypeptides, with the following procedures being exemplary of suitable purification procedures: by fractionation on an ion- exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resm such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G- 75; and protein A Sepharose columns to remove contaminants such as IgG.
  • Apo-2 variants in which residues have been deleted, inserted, or substituted can be recovered m the same fashion as native sequence Apo-2, taking account of changes m properties occasioned by the variation.
  • preparation of an Apo-2 fusion with another protein or polypeptide may facilitate purification; an lmmunoaffmity column containing antibody to the sequence can be used to adsorb the fusion polypeptide.
  • another protein or polypeptide e.g., a bacterial or viral antigen, immunoglobulin sequence, or receptor sequence
  • an lmmunoaffmity column containing antibody to the sequence can be used to adsorb the fusion polypeptide.
  • Other types of affinity matrices also can be used.
  • a protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) also may be useful to inhibit proteolytic degradation during purification, and antibiotics may be included to prevent the growth of adventitious contaminants.
  • PMSF phenyl methyl sulfonyl fluoride
  • purification methods suitable for native sequence Apo-2 may require modification to account for changes the character of Apo-2 or its variants upon expression m recombinant cell culture. 7.
  • Covalent modifications of Apo-2 are included within the scope of this invention.
  • One type of covalent modification of the Apo-2 is introduced into the molecule by reacting targeted ammo acid residues of the Apo-2 with an organic de ⁇ at ⁇ zmg agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the Apo-2.
  • De ⁇ vatization with bifunctional agents is useful for crosslmking Apo-2 to a water-insoluble support matrix or surface for use m the method foi purifying ant ⁇ -Apo-2 antibodies, and vice-versa.
  • De ⁇ vatization with one or more bifunctional agents will also be useful for crosslmking Apo-2 molecules to generate Apo-2 dimers . Such dimers may increase binding avidity and extend half-life of the molecule in vivo .
  • Commonly used crosslmking agents include, e . g .
  • esters for example, esters with 4-az ⁇ dosal ⁇ cyl ⁇ c acid, homobifunctional lmidoesters, including disucc imidyl esters such as 3,3'- dithiobis (succiniiridylpropionate ⁇ , and bifunctional maleimides such as b s-N- male ⁇ m ⁇ do-1, 8-octane .
  • De ⁇ vatizmg agents such as methyl-3- [ (p-azidophenyl ) - dithio] propioimidate yield photoactivatable intermediates that are capable of forming crosslinks m the presence of light.
  • reactive water- msoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described m U.S. Patent Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.
  • Another type of covalent modification of the Apo-2 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found m native sequence Apo-2, and/or adding one or more glycosylation sites that are not present m the native sequence Apo-2.
  • N-lmked refers to the attachment of the carbohydrate moiety to the side chain of an asparagme residue.
  • the tripeptide sequences asparagme-X- se ⁇ ne and asparagme-X-threonme, where X is any ammo acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagme side chain.
  • X is any ammo acid except proline
  • 0-lmked glycos ⁇ lation refers to the attachment of one of the sugars N- aceylgalactosamme, galactose, or xylose to a hydroxylammo acid, most " commonly serine o 1 - threonme, although 5-hydroxyprolme or 5-hydroxylysme may also be used.
  • Addition of glycos lation sites to the Apo-2 polypeptide may be accomplished by altering the ammo acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-lmked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more serine or threonme residues to the native sequence Apo-2 (for 0-lmked glycosylation sites).
  • the Apo-2 ammo acid sequence may optionally be altered throu ⁇ h changes at the DNA level, particularly by mutating the DNA encoding the Apo-2 polypeptide at preselected bases such that codons are generated that will translate into the desired ammo acids.
  • the DNA mutation (s) mav be made using methods described above and m U.S. Pat. No. 5,364,934, supra.
  • Anotner means of mcreasin ⁇ the numoer of carbohydrate moieties on the Apo-2 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide.
  • the sugar (s) may be attached to (a) arginine and nistidme, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteme, (d) free hydroxyl groups such as those of serine, threonme, or hydroxyprolme, (e) aromatic residues such as those of phenylalanme, tyrosme, or tryptophan, or (f) the amide group of glutamine.
  • chemical deglycosylation by exposing the polypeptide to the compound trifluoromethanesulfonic acid, or an equivalent compound can result the cleavage of most or all sugars except the linking sugar (N-acetylglucosamme or N-acetylgalactosamme) , while leaving the polypeptide intact.
  • Chemical deglycosylation is described by Sojar, et al., Arch. Biochem. Biophys., 259: 52 (1987) and by Edge et al . , Anal. Biochem., 118 : 131 (1981).
  • Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al . , Meth. Enzymol., £££:350 (1987).
  • Glycosylation at potential glycosylation sites may be prevented by the use of the compound tunicamycm as described by Duskin et al . , J. Biol . Chem. , £57:3105 (1982 . Tunicamycm blocks the formation of protem-N- glycoside linkages.
  • Another type of covalent modification of Apo-2 comprises linking the Apo-2 polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth m U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791, 192 or 4, 179,337.
  • nonproteinaceous polymers e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes
  • the present invention also provides chimeric molecules comprising Apo-2 fused to another, heterologous polypeptide or ammo acid sequence.
  • the chimeric molecule comprises a fusion of the Apo-2 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind.
  • the epitope tag is generally placed at the ammo- or carboxyl- terminus of the Apo-2. The presence of such epitope - tagged forms of the Apo-2 can be detected using an antibody against the taq polypeptide. Also, provision of the epitope tag enables the Apo-2 to be readily purified by affinity purification using an anti-taq antibody or another type of affinity matri) that binds to the epitope tag.
  • tao polypeptides and their respective antibodies are well known the art. Examples include the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes virus glycoprote D iqD) tag and its antibody [Paborsky et ar., Protein Engineering, 3 ( t> * : 7-5o3 (1990)].
  • tag polypeptides include the Flaq- peptide [Hopp et al . , BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al . , Science, 255: 192-194 (1992)]; an ⁇ -tubulm epitope peptide [Skinner et al . , J Biol . Chem. , £66:14163-14166 (1991)]; and the T7 gene 10 protein peptide tag [Lut z-Freyermuth et al . , Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)].
  • an antibody thereto can be generated using the techniques disclosed herein.
  • epitope-tagged Apo-2 may be constructed and produced according to the methods described above. Epitope-tagged Apo-2 is also described m the Examples below.
  • Apo-2-tag polypeptide fusions are preferably constructed by fusing the cDNA sequence encoding the Apo-2 portion m-frame to the tag polypeptide DNA sequence and expressing the resultant DNA fusion construct in appropriate host cells.
  • nucleic acid encoding the Apo-2 will be fused at its 3' end to nucleic acid encoding the N-termmus of the tag polypeptide, however 5' fusions are also possible.
  • a polyhistidme sequence of about 5 to about 10 histidme residues may be fused at the N- terminus or the C- terminus and used as a purification handle in affinity chromatography.
  • Epitope-tagged Apo-2 can be purified by affinity chromatography using the anti-tag antibody.
  • the matrix to which the affinity antibody is attached may include, for instance, agarose, controlled pore glass or poly (styrenedivinyl) benzene .
  • the epitope-tagged Apo-2 can then be eluted from the affinity column using techniques known the art.
  • the chimeric molecule comprises an Apo-2 polypeptide fused to an immunoglobulin sequence.
  • the chimeric molecule may also comprise a particular domain sequence of Apo-2, such as the extracellular domain sequence of native Apo-2 fused to an immunoglobulin sequence.
  • these assembled lmmunoglobulms will have known unit structures as represented by the following diagrams.
  • a basic four chain structural unit is the form m which IgG, IgD, and IgE exist.
  • a four chain unit is repeated m the higher molecular weight lmmunoglobulms; IgM generally exists as a pentamer of basic four-cham units held together by disulfide bonds.
  • IgA globulin, and occasionally IgG globulin may also exist m a multimeric form m serum. In the case of multimers, each four chain unit may be the same or different.
  • a heterotetramer A ⁇ c L
  • A means an Apo-2 sequence or an Apo-2 sequence fused to a heterologous sequence
  • X is an additional agent, which may be the same as A or different, a portion of an immunoglobulin superfamily member such as a variable region or a variable region-like domain, including a native or chimeric immunoglobulin variable region, a toxin such a pseudomonas exotoxm or ricin, or a sequence functionally binding to another protein, such as other cytokmes (i.e., IL-1, interferon- ⁇ ) or cell surface molecules (i.e., NGFR, CD40, OX40, Fas antigen, T2 proteins of Shope and myxoma poxviruses), or a polypeptide therapeutic agent not otherwise normally associated with a constant domain;
  • Y is a linker or another receptor sequence; and V L , V H , C* and C H represent light or heavy chain variable or constant domains of an immunoglobulin.
  • Structures comprising at least one CRD of an Apo-2 sequence as "A” and another cell-surface protein having a repetitive pattern of CRDs (such as TNFR) as "X” are specifically included.
  • A an Apo-2 sequence
  • X another cell-surface protein having a repetitive pattern of CRDs
  • the above diagrams are merely exemplary of the possible structures of the chimeras of the present invention, and do not encompass all possibilities.
  • the heavy or light chain constant domains may be originated from the same or different lmmunoglobulms. All possible permutations of the illustrated and similar structures are all within tne scope of the invention herein.
  • the chimeric molecules can be constructed m a fashion similar to chimeric antibodies m which a variable domain from an antibody of one species is substituted for the variable domain of another species. See, for example, EP 0 125 023; EP 173,494; Munro, Nature, £12:597 (13 December 1984); Neuberger et al., Nature, 312: 604-608 (13 December 1984); Sharon et al., Nature, £09:364-367 (24 May 1984); Morrison et al . , Proc. Nat'l. Acad. Sci. USA, £1:6851-6855 (1984); Morrison et al . , Science, ££9:1202-1207 (1985); Boulianne et al . , Nature, ££2:643-646 (13 December 1984); Capon et al., Nature, ££7:525-531 (1989); Traunecker et al . , Nature, ££9:68-70 (1989).
  • the chimeric molecules may be constructed as follows.
  • the DNA including a region encoding the desired sequence, such as an Apo-2 and/or TNFR sequence is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the mmunoglobulm-like domain (s) and at a point at or near the DNA encoding the N-termmal end of the Apo-2 or TNFR polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminai coding region for TNFR (where the native signal is employed) .
  • DNA fragment then is readily inserted proximal to DNA encoding an immunoglobulin light or heavy chain constant region and, if necessary, the resulting construct tailored by deletional mutagenesis.
  • the Ig is a human immunoglobulin when the chimeric molecule is intended for m vivo therapy for humans.
  • DNA encoding immunoglobulin light or heavy chain constant regions is known or readily available from cDNA libraries or is synthesized. See for example, Adams et al . , Biochemistry, 19: 2711-2719 (1980); Gough et al., Biochemistry, £9:2702-2710 (1980); Dolby et al., Proc. Natl. Acad. Sci..
  • Immunoadhesms m general, and CD4-Ig fusion molecules specifically are disclosed m WO 89/02922, published 6 April 1989.
  • Molecules comprising the extracellular portion of CD4, the receptor for human immunodeficiency virus (HIV), linked to IgG heavy chain constant region are known m the art and have been found to have a markedly longer half-life and lower clearance than the soluble extracellular portion of CD4 [Capon et al., supra; Byrn et al., Nature, 344 : 667 (1990)].
  • Apo-2 as disclosed m the present specification, can be employed therapeutically to induce apoptosis mammalian cells. This therapy can be accomplished for instance, using in vivo or e vivo gene therapy techniques and includes the use of the death domain sequences disclosed herein.
  • the Apo- 2 chimeric molecules (including the chimeric molecules containing an extracellular domain sequence of Apo-2) comprising lmmunoqlobulm sequences can also be employed therapeutically to inhibit apoptosis or NF-KB induction by Apo-2L or by another ligand that Apo-2 binds to.
  • the Apo-2 of the invention also has utility m non-therapeutic applications.
  • Nucleic acid sequences encoding the Apo-2 may be used as a diagnostic for tissue-specific typing. For example, procedures like in si t u hybridization, Northern and Southern blotting, and PCR analysis may be used to determine whether DNA and/or RNA encoding Apo-2 is present m the cell type(s) being evaluated.
  • Apo-2 nucleic acid will also be useful for the preparation of Apo-2 by the recombinant techniques described herein.
  • the isolated Apo-2 may be used in quantitative diagnostic assays as a control against which samples containing unknown quantities of Apo-2 may be prepared.
  • Apo-2 preparations are also useful in generating antibodies, as standards m assays for Apo-2 (e.g., by labeling Apo-2 for use as a standard in a radioimmunoassay, radioreceptor assay, or enzyme-lmked immunoassay) , m affinity purification techniques, and competitive-type receptor binding assays when labele ⁇ with, for instance, radioiodme, enzymes, or fluorophores .
  • o i ie orms o the Apo-2 such as t e Apo- -IgG c imeric molecules (lmmunoadhesms ) described above, can be used as immunogens m producing ant ⁇ -Apo-2 antibodies.
  • Nucleic acids which encode Apo-2 or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, m turn, are useful m the development and screening of therapeutically useful reagents.
  • a transgenic animal e.g., a mouse or rat
  • a transgenic animal is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage.
  • a transgene is a DNA which is integrated into the genome of a cell from which a transgenic animal develops.
  • cDNA encoding Apo-2 or an appropriate sequence thereof can be used to clone genomic DNA encoding Apo-2 in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding Apo-2.
  • Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional m the art and are described, for example, U.S. Patent Nos. 4,736,866 and 4,870,009.
  • particular cells would be targeted for Apo-2 transgene incorporation with tissue-specific enhancers.
  • Transgenic animals that include a copy of a transgene encoding Apo-2 introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding Apo-2.
  • Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with excessive apoptosis.
  • an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition.
  • transgenic animals that carry a soluble form of Apo-2 such as an Apo-2 ECD or an immunoglobulin chimera of such form could be constructed to test the effect of chronic neutralization of Apo-2L, a ligand of Apo-2.
  • non-human homologues of Apo-2 can be used to construct an Apo-2 "knock out" animal which has a defective or altered gene encoding Apo-2 as a result of homologous recombination between the endogenous gene encoding Apo-2 and altere ⁇ genomic DNA encoding Apo-2 introduced into an embryonic cell of the animal.
  • cDNA encoding Apo-2 can be used to clone genomic DNA encoding Apo-2 m accordance with established techniques.
  • a portion of the genomic DNA encoding Apo-2 can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration.
  • flanking DNA typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included m the vector [see e.g., Thomas and Capecchi, Cell, ££:503 (1987 for a description of homologous recombination vectors] .
  • the vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells m which the introduced DNA has homologously recombmed with the endogenous DNA are selecte ⁇ [see e.g., Li et al., Cell, £9:915 (1992)].
  • the selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, Teratocarcmomas and Embryonic Stem Cells : A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-151].
  • a chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal.
  • Progeny harboring the homologously recombmed DNA m their germ cells can be identified by standard techniques and used to breed animals m which all cells of the animal contain the homologously recombmed DNA.
  • Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the Apo-2 polypeptide, including for example, development of tumors.
  • the present invention further provides ant ⁇ -Apo-2 antibodies.
  • Antibodies against Apo-2 may be prepared as follows. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies .
  • the Apo-2 antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised m a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected the mammal by multiple subcutaneous or mtrape ⁇ toneal injections.
  • the immunizing agent may include the Apo-2 polypeptide or a fusion protein thereof.
  • An example of a suitable immunizing agent is an Apo-2-IgG fusion protein, such as an Apo-2 ECD-IgG fusion protein. Cells expressing Apo-2 at their surface may also be employed.
  • the immunizing agent may be conjugate to a protein known to be lmmunogenic m the mammal being immunized.
  • lmmunogenic proteins include but are not limited to keyhole limpet hemocyanm, serum albumin, bovme thyroglobulin, and soybean trypsin inhibitor.
  • An aggregating agent such as alum may also be employed to enhance the mammal's immune response.
  • adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate) .
  • the immunization protocol may be selected by one skilled m the art without undue experimentation.
  • the mammal can then be bled, and the serum assayed for antibody titer. If desired, the mammal can be boosted until the antibody titer increases or plateaus.
  • the Apo-2 antibodies may, alternatively, be monoclonal antibodies.
  • Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, supra .
  • a hybridoma method a mouse, hamster, or other appropriate host animal, is typically immunized (such as described above) with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent.
  • the lymphocytes may be immunized in vi tro .
  • the immunizing agent will typically include the Apo-2 polypeptide or a fusion protein thereof.
  • An example of a suitable immunizing agent is an Apo-2-IgG fusion protein or chimeric molecule.
  • Apo-2 ECD-IgG immunogen is described in Example 9 below.
  • Cells expressing Apo-2 at their surface may also be employed. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired.
  • PBLs peripheral blood lymphocytes
  • spleen cells or lymph node cells are used if non-human mammalian sources are desired.
  • lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103].
  • a suitable fusing agent such as polyethylene glycol
  • Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovme and human origin.
  • rat or mouse myeloma cell lines are employed.
  • the hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells.
  • the culture medium for the hyb ⁇ domas typically will include hypoxanthme, ammopterm, and thymidme ("HAT medium”), which substances prevent the growth of HGPRT-deficient cells.
  • Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody- producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J.
  • the culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against Apo-2.
  • the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vi tr o binding assay, such as radioimmunoassay (RIA) or enzyme-lmked immunoabsorbent assay (ELISA) .
  • RIA radioimmunoassay
  • ELISA enzyme-lmked immunoabsorbent assay
  • the binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal . Biochem. , £07:220 (1980).
  • the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra] .
  • Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
  • the hybridoma cells may be grown in vi vo as ascites m a mammal .
  • the monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A- Sepharose, hydroxylapatite chromatography, gel electrophoresis , dialysis, or affinity chromatography .
  • the monoclonal antibodies may also be made by recombinant DNA methods, such as those described m U.S. Patent No. 4,816,567.
  • DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies) .
  • the hybridoma cells of the invention serve as a preferred source of such DNA.
  • the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies m the recombinant host cells.
  • host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies m the recombinant host cells.
  • the DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al .
  • non-immunoglobulm polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combmmg site of an antibody of the invention to create a chimeric bivalent antibody.
  • ant ⁇ -Apo-2 monoclonal antibodies have been prepared. Several of these antibodies have been deposited witn ATCC, as disclosed herein.
  • the monoclonal antibodies of the invention will have the same biological characteristics as the monoclonal antibodies secreted by the hybridoma cell lme(s) deposited under Accession No. HB-12456, HB-12535, HB-12534, or HB-12536.
  • biological characteristics is used to refer to the m vi tro and/or in vi vo activities or properties of the monoclonal antibody, such as the ability to specifically bind to Apo-2 or to substantially block, induce or enhance Apo-2 activation.
  • Particular activities and properties of various ant -Apo-2 antibodies are describe ⁇ in further detail in the Examples below.
  • the monoclonal antibody preferably has the hypervariable region residues of one or more of the above-mentioned ATCC deposited antibodies, e.g., it may comprise a humanized variant.
  • Chimeric and humanized Apo-2 antibodies derived from, constructed from, or containing sequence, regions or domains from any of the above-mentioned deposited antibodies are considered within the scope of the invention.
  • Such chimeric or humanized Apo-2 antibodies may be prepared using techniques known m the art and further described below.
  • the antibodies of the invention may also comprise monovalent antibodies.
  • Methods for preparing monovalent antibodies are well known m the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point the Fc region so as to prevent heavy chain crosslmking. Alternatively, the relevant cysteme residues are substituted with another ammo acid residue or are deleted so as to prevent crosslmking.
  • Fab fragments In vi tro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described m WO 94/29348 published 12/22/94 and U.S. Patent No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields an F(ab') t fragment that has two antigen combining sites and is still capable of cross-linking antigen.
  • the Fab fragments produced m the antibody digestion also contain the constant domains of the light chain and the first constant domain (CHi) of the heavy chain.
  • Fab 1 fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH- domain including one or more cysteines from the antibody hinge region.
  • Fab'-SH is the designation herein for Fab' which the cysteme residue (s) of the constant domains bear a free thiol group.
  • F(ab') antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. 3. Humanized Antibodies
  • the Apo-2 antibodies of the invention may further comprise humanized antibodies or human antibodies.
  • Humanized forms of non-human (e.g., murine) antibodies are chimeric lmmunoglobulms, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non- human immunoglobulin.
  • Humanized antibodies include human lmmunoglobulms (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, afrmity and capacity.
  • Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences.
  • the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all ol the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence.
  • the humanized antibo ⁇ y optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of ⁇ human immunoglobulin [Jones et al., Nature, 321 : 522-525 (1986); Riechmann et al., Nature, £££:323-327 (1988); and Presta, Curr.
  • Fc immunoglobulin constant region
  • humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • variable domains both light and heavy
  • the choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is very important in order to reduce antigenicity.
  • the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences.
  • the human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody [Sims et al., J. Immunol. , Var1:2296 (1993); Chothia and Lesk, J. Mol. Biol., 196: 901 (1987)].
  • Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains.
  • humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences.
  • Transgenic animals e.g., mice
  • transgenic animals that are capable, upon immunization, of producing a full repertoire of human antibodies m the absence ot endogenous immunoglobulin production
  • Transfer of the human germ-lme immunoglobulin gene array such germ-lme mutant mice will result m the production of human antibodies upon antigen challenge [see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-2555 (1993); Jakobovits et al . , Nature, 362 : 255-258 (1993); Bruggemann et al., Year m Immuno . , 7:33 (1993)].
  • Human antibodies can also be produced m phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1992); Marks et al., J. Mol. Biol., 222:581 (1991)].
  • the techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al . , J. Immunol., 147 (I) :86-95 (1991)].
  • Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens.
  • one of the binding specificities is for the Apo-2, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
  • bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-cham/light-cham pairs, where the two heavy chains have different specificities [Milstem and Cuello, Nature, 305 : 537-539 (1983)]. Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and m Traunecker et al . , EMBO J. , 10:3655-3659 (1991).
  • antibody variable domains with the desired binding specificities are fused to immunoglobulin constant domain sequences.
  • the fusion preferably is with an lmmunoqlobulm heavy-chain constant domain, comprising at least part of the ninge, CH2, and CH3 regions. It is preferred to have the firs'" heavy-chair constant region (CHI) containing the s te necessary for light-chain binding present m at least one of the fusions.
  • CHI heavy-chair constant region
  • the bispecific antibodies are composed or a hybrid immunoglobulin heavy chain with a first binding specificity m one arm, and a hybrid immunoglobulin heavy-cham/light- chain pair (providing a second binding specificity) m the other arm.
  • Heteroconjugate antibodies are also within the scope of the present invention.
  • Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [US Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/20373; EP 03089] .
  • the antibodies may be prepared m vi tro using known methods m synthetic protein chemistry, including those involving crosslmking agents.
  • lmmunotox s may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include lm othiolate and methyl-4-mercaptobuty ⁇ m ⁇ date and those disclosed, for example, m U.S. Pat. No. 4,676,980.
  • Triabodies are also within the scope of the invention. Such antibodies are described for instance m Iliades et al., FEBS Letters, 409:437-441 (1997) and Kortt et al., Protein Engineering, 10:423-433 (1997).
  • the invention also pertains to lmmunoconj ugates comprising Apo-2 antibody described herein conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g. an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope ( i . e . , a radioconj ugate ) .
  • a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g. an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope ( i . e . , a radioconj ugate ) .
  • chemotherapeutic agent e.g. an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof
  • a radioactive isotope i . e
  • Enzymatically active toxins and fragments thereof which can be used include diphtheria A chain, nonbmding active fragments of diphtheria toxin, exotoxm A chain (from Pseudomona s aeruqmosa ) , ⁇ cm A chain, ab ⁇ n A chain, modeccm A chain, alpha-sarcm, Al eu ⁇ tes fordn proteins, dianthin proteins, Pnytol a ca ame ⁇ cana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcm, crotrn, sapaona ⁇ a officmalis inhibitor, gelomn, mitogellm, restrictocm, phenomyc , enomycm and the tricothecenes .
  • Conjugates of the antibody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succm ⁇ m ⁇ dyl-3- ( 2- py ⁇ dyldithiol ) propionate (SPDP), lmmothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL) , active esters (such as disuccmimidyl suberate), aldehydes (such as glutareldehyde ) , bis- azido compounds (such as bis (p-azidobenzoyl ) hexanediamme), bis-diazonium derivatives (such as bis- (p-diazoniumbenzoyl ) -ethylenediamme) , dns
  • bifunctional protein coupling agents such as N-succm ⁇ m ⁇ dyl-3- ( 2- py ⁇ dyldithiol ) propionate (SPDP),
  • a ⁇ cin lmmunotoxm can be prepared as described in Vitetta et al . Science, 238:1098 (1987) .
  • Carbon-14-labeled l- ⁇ soth ⁇ ocyanatobenzyl-3-methyld ⁇ ethylene triammepentaacetic acid (MX-DTPA) is an exemplary chelatmg agent for conjugation of radionucleotide to the antibody. See WO94/11026.
  • the antibody may be conjugated to a "receptor" (sucn streptavidin) for utilization m tumor pretargetmg wherein the antibody-receptor conjugate is administered to the mammal, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand” (e.g. avidm) which is conjugated to a cytotoxic agent (e.g. a radionucleotide) .
  • a "ligand” e.g. avidm
  • cytotoxic agent e.g. a radionucleotide
  • Immunoliposomes comprising Apo-2 antibody may also be prepared.
  • Liposomes containing the antibody are prepared by methods known in the art, such as described Epstein et a l . , Proc. Natl. Acad. Sci. USA, 82:3688 (1985); Hwang et a l . , Proc. Natl Acad. Sci. USA, 77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed m U.S. Patent No. 5,013,556.
  • Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylchol e , cholesterol and PEG-de ⁇ vatized phosphatidylethanolamme (PEG-PE).
  • a lipid composition comprising phosphatidylchol e , cholesterol and PEG-de ⁇ vatized phosphatidylethanolamme (PEG-PE).
  • Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter.
  • Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described Martin et al . J. Biol. Chem. 257: 286-288 (1982) via a disulfide interchange reaction.
  • a chemotherapeutic agent (such as Doxorubicm) is optionally contained within the liposome. See Gabizon et al . J . National Cancer Inst. £1(19) : 1484 (1989)
  • the antibody of the present invention may also be used m ADEPT by conjugating the antibody to a prodrug-activatmg enzyme which converts a prodrug (e.g. a peptidyl chemotherapeutic agent, see WO81/01145) to an active anti-cancer drug.
  • a prodrug e.g. a peptidyl chemotherapeutic agent, see WO81/01145
  • WO 88/07378 and U.S. Patent No. 4, 975,278 See, for example, WO 88/07378 and U.S. Patent No. 4, 975,278.
  • the enzyme component of the immunocon ugate useful for ADEPT includes any enzyme capable ot acting on a orodrug m such a way so as to covert it into its more active, cytotoxic form.
  • Enzymes that are useful this invention include, but are not limited to, alkaline phosphatase useful for converting phosphate-contam q prodrugs into free drugs; arylsul datase useful for converting sulfate- contammg prodrugs into free drugs; cytosme deaminase useful for converting non-toxic 5-fluorocytosme into tne anti-cancer drug, 5- fluorouracil; proteases, such as serratia protease, thermolysin, subtilism, carboxypeptidases and catnepsms (such as cathepsins B and L) , that are useful for converting peptide-contain g prodrugs into free drugs; D- alanylcarboxypepti ⁇ ases, useful for converting prodrugs that contain D-ammo acid substituents; carbohydrate-cleavmg enzymes such as ⁇ -galactosidase and neurammidase useful
  • ⁇ 3 - drugs useful for converting drugs de ⁇ vatized at their amme nitrogens with phenoxyacetyl or phenylacetyl groups, respectively, into free drugs.
  • penicillin amidases such as penicillin V amidase or penicillin G amidase, useful for converting drugs de ⁇ vatized at their amme nitrogens with phenoxyacetyl or phenylacetyl groups, respectively, into free drugs.
  • antibodies with enzymatic activity also known m the art as "abzymes” can be used to convert the prodrugs of the invention into free active drugs [see, e.g., Massey, Nature 328: 457-458 (1987)].
  • Antibody- abzyme conjugates can be prepared as described herein for delivery of the abzyme to a tumor cell population.
  • the enzymes of this invention can be covalently bound to the antibody by techniques well known in the art such as the use of the heterobifunctional crosslmking reagents discussed above.
  • fusion proteins comprising at least the antigen-bmdmg region of an antibody of the invention linked to at least a functionally active portion of an enzyme of the invention can be constructed using recombinant DNA techniques well known in the art [see, e.g., Neuberger et al . , Nature, 312 : 604-608 (1984) ] .
  • an antibody fragment rather than an intact antibody, to increase tumor penetration, for example.
  • the salvage receptor binding epitope preferably constitutes a region wherein any one or more ammo acid residues from one or two loops of a Fc domain are transferred to an analogous position of the antibody fragment. Even more preferably, three or more residues from one or two loops of the Fc domain are transferred. Still more preferred, the epitope is taken from the CH2 domain of the Fc region (e.g., of an IgG) and transferred to the CHI, CH3, or V region, or more than one such region, of the antibody. Alternatively, the epitope is taken from the CH2 domain of the Fc region and transferred to the C region or V L region, or both, of the antibody fragment. See, e.g., U.S. Patent No. 5,747,035.
  • Covalent modifications of the antibody are included within the scope of this invention. They may be made by chemical synthesis or by enzymatic or chemical cleavage of the antibody, if applicable. Other types of covalent modifications of the antibody are introduced into the molecule by reacting targeted ammo acid residues of the antibody with an organic derivatizmg agent that is capable of reacting with selected side chains or the N- or C-termmal residues.
  • the antibodies may optionally be covalently attached or conjugated to one or more chemical groups.
  • a polyol for example, can be conjugated to an antibody molecule at one or more ammo acid residues, including lysine residues as disclosed m WO 93/00109.
  • the polyol is a poly (alkelene glycol), such as polv (ethylene glycol (PEG), however, those skilled in the art recognize that other polyols, such as, for example, poly (propylene glycol) and polyethylene-polypropylene glycol copolymers, can be employed using techniques for conjugating PEG to polypeptides.
  • PEG poly (alkelene glycol)
  • PEG ethylene glycol
  • pegylatmg polypeptides A variety of methods for pegylatmg polypeptides have been described. See, e.g. U.S. Patent No. 4,179,337 which discloses the conjugation of a number of hormones and enzymes to PEG and polypropylene
  • the antibodies may also be fused or linked to another heterologous polypeptide or ammo acid sequence such as an epitope tag.
  • Apo-2 antibodies are contemplated.
  • cysteme residue (s) may be introduced into the Fc region, thereby allowing interchain disulfide bond formation m this region.
  • the homodimeric antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing [see, e.g., Caron et al . , J. Exp . Med. , £76:1191-1195 (1992); Shopes, J ⁇ Immunol . , 148 : 2918-2922 (1992).
  • Homodimeric antibodies may also be prepared using heterobifunctional cross-linkers as described m Wolff et al., Cancer Research, 5£:2560-2565 (1993). Ghetie et al., Proc. Natl. Acad. Sci., ££: 7509-7514 (1997), further describe preparation of IgG-IgG homodimers and disclose that such homodimers can enhance apoptotic activity as compared to the monomers.
  • the antibodies can be engineered to have dual Fc regions [see, Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989)].
  • Apo-2 antibodies of the invention have therapeutic utility.
  • Agonistic Apo-2 antibodies for instance, may be employed to activate or stimulate apoptosis in cancer cells.
  • the antibody is preferably administered to the mammal a carrier.
  • Suitable carriers and their formulations are described m Remington's Pharmaceutical Sciences, 16th ed., 1980, Mack Publishing Co., edited by Oslo et al .
  • an appropriate amount of a pharmaceutically-acceptable salt is used the formulation to render the formulation lsotonic.
  • a pharmaceutically-acceptable carrier include saline, Ringer's solution and dextrose solution.
  • the pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5.
  • Further carriers include sustained release preparations sucn as semipermeable matrices of solid hydrophopic polymers containing the antibody, which matrices are the form of shaped articles, e.g., films, liposomes or microparticles . It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of antibody being administered.
  • the antibody can be administered to the mammal by injection (e.g., intravenous, mtraperitoneal, subcutaneous, intramuscular), or by o er me o s suc as in usion a ensure i s e ivery o e oo s ream m an effective form.
  • the antibody may also be administered by mtratumoral, pe ⁇ tumoral, mtralesional, or perilesional routes, to exert local as well as systemic therapeutic effects. Local or intravenous injection is preferred.
  • Effective dosages and schedules for administering the antibody may be determined empirically, and making such determinations is within the skill in the art. Those skilled m the art will understand that the dosage of antibody that must be administered will vary depending on, for example, the mammal which w ll receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered to the mammal. Guidance m selecting appropriate doses for antibody is found m the literature on therapeutic uses of antibodies, e . g. , Handbook of Monoclonal Antibodies, Ferrone et a l . , eds . , Noges Publications, Park Ridge, N.J., (1985) ch. 22 and pp. 303-357; Smith et al .
  • a typical daily dosage of the antibody used alone might range from about 1 ⁇ g/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above.
  • the antibody may also be administered to the mammal m combination with effective amounts of one or more other therapeutic agents or in conjunction with radiation treatment.
  • Therapeutic agents contemplated include chemotherapeutics as well as immunoad uvants and cytokmes.
  • the antibody may be administered sequentially or concurrently with the one or more other therapeutic agents.
  • the amounts of antibody and therapeutic agent depend, for example, on what type of drugs are used, the cancer being treated, and the scheduling and routes of administration but would generally be less than if each were used individually.
  • tumor mass may be observed physically or by standard v-ray imaging techniques.
  • the Apo-2 receptor antibodies of the invention may also be useful m enhancing immune-mediated cell death m cells expressmq Apo-2 receptor (s), for instance, through complement fixation or ADCC .
  • antagonistic ant ⁇ -Apo-2 receptor antibodies may be used to block excessive apoptosis (for instance m neurodeqenerative disease) or to block potential autoimmune/inflammatory effects of Apo-2 resulting from NF- ⁇ B activation.
  • Such therapeutic antibodies can be utilized according to the methods and techniques described above.
  • Apo-2 antibodies may further be used m diagnostic assays for Apo- 2, e.g., detecting its expression in specific cells, tissues, or serum.
  • diagnostic assay techniques known m the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual or Techniques, CRC Press, Inc.
  • the antibodies used m the diagnostic assays can be
  • T e etecta e moiety s ou e capa e o producing, either directly or indirectly, a detectable signal.
  • the detectable moiety may be a radioisotope, such as J H, 1-, C, J P, J5 S, or 12° I , a fluorescent or chemilummescent compound, such as fluorescem isothiocyanate, rhodamme, or lucife ⁇ n, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase.
  • any method known m the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al., Nature, 194 : 495-496 (1962); David et al., Biochemistry, 85:1014 (1974); Pain et al . , J. Immunol. Meth., 40:219 (1981); and Nygren, J. Histoche . and Cytochem. , 30:407 (1982).
  • Apo-2 antibodies also are useful for the affinity purification of Apo-2 from recombinant cell culture or natural sources.
  • the antibodies against Apo-2 are immobilized on a suitable support, such a Sephadex resm or filter paper, using methods well known m the art.
  • the immobilized antibody then is contacted with a sample containing the Apo-2 to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the Apo-2, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the Apo-2 from the antibody.
  • a suitable support such as Sephadex resm or filter paper
  • the article of manufacture comprises a container with a label.
  • Suitable containers include, for example, bottles, vials, and test tubes.
  • the containers may be formed from a variety of materials such as glass or plastic.
  • the container holds a composition which includes an active agent that is effective for therapeutic or non-therapeutic applications, such as described above.
  • the active agent m the composition is Apo-2 or an Apo-2 antibody.
  • the label on the container indicates that the composition is used for a specific therapy or non-therapeutic application, and may also indicate directions for either in vi vo or in vi tr o use, such as those described above.
  • the kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and packa ⁇ e inserts with instructions for use.
  • EST Expressed sequence tag DNA databases (LIFESEQTM, Incyte Pharmaceuticals, Palo Alto, CA) were searched and an EST was identified which showed homology to the death domain of the Apo-3 receptor [Marsters et al., Curr. Biol . , £:750 (1996)].
  • Human pancreas and kidney lgtlO bacte ⁇ ophage cDNA libraries were ligated into pRK5 vectors as follows.
  • Reagents were added together and incubated at 16°C for 16 hours: 5X T4 ligase buffer (3 ml); pRK5, Xhol, Notl digested vector, 0.5 mg, 1 ml); cDNA (5 ml) and distilled water (6 ml). Subsequently, additional distilled water (70 ml) and 10 mg/ l tRNA (0.1 ml) were added and the entire reaction was extracted through phenol : chloroform: isoamyl alcohol (25:24:1). The aqueous phase was removed, collected and diluted into 5M NaCl (10 ml) and absolute ethanol (-20°C, 250 ml) .
  • the ligated cDNA/pRK5 vector DNA prepared previously was chilled on ice to which was added electrocompetent DH10B bacteria (Life Tech., 20 ml).
  • the bacteria vector mixture was then electroporated as per the manufacturer' recommendation. Subsequently SOC media (1 ml) was added and the mixture was incubated at 37°C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillm and incubated for 16 hours (37°C) to allow the colonies to grow. Positive colonies were then scraped off and the DNA isolated from the bacterial pellet using standard CsCl-gradient protocols .
  • An enriched 5'-cDNA library was then constructed to obtain a bias of cDNA fragments which preferentially represents the 5' ends of cDNA's contained within the library.
  • 10 mg of the pooled isolated full-length library plasmid DNA (41 ml) was combined with Not 1 restriction buffer (New England Biolabs, 5 ml) and Not 1 (New England Biolabs, 4 ml) and incubated at 37°C for one hour.
  • the reaction was extracted through phenol : chloroform: isoamyl alcohol (25:24:1, 50 ml), the aqueous phase removed, collected and resuspended into 5M NaCl (5 ml) and absolute ethanol (-20°C, 150 ml).
  • the reaction was then extracted through phenol : chloroform: isoamyl alcohol (25:24:1, 50 ml) and the aqueous phase was removed, collected and resuspended into 5M NaCl (5 ml) and absolute ethanol (- 20°C, 150 ml) and centrifuged for 20 minutes at 14,000 x g.
  • the pellet was then decanted and resuspended 70 c - ethanol (0.5 ml), centrifuged again for 2 minutes at 14,000 x g, decanted, dried m a speedvac and resuspended into distilled water (10 ml).
  • the aqueous phase was removed, collected and diluted by 5M NaCl (10 ml) and absolute ethanol (-20°C, 250 ml) and centrifuged for 20 minutes at 14,000 x g.
  • the DNA pellet was decanted, resuspended into 701 ethanol (0.5 ml) and centrifuged again for 2 minutes at 14,000 x g.
  • the supernatant was removed and the residue pellet was dried m a speedvac and resuspended m distilled water (3 ml) .
  • the ligated cDNA/pSST-amy .1 vector DNA was chilled on ice to which was added electrocompetent DH10B bacteria (Life Tech., 20 ml) .
  • the bacteria vector mixture was then electroporated as recommended by the manufacturer. Subsequently, SOC media (Life Tech., 1 ml) was added and the mixture was incubated at 37°C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillm and incubated for 16 hours (37°C). Positive colonies were scraped off the plates and the DNA was isolated from the bacterial pellet using standard protocols, e.g. CsCl-gradient .
  • the cDNA libraries were screened by hybridization with a synthetic oligonucleotide probe: GGGAGCCGCTCATGAGGAAGTTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGGG ( SEQ ID NO:3) based on the EST.
  • Three cDNA clones were sequenced m entirety.
  • the overlapping coding regions of the cDNAs were identical except for codon 410 (using the numbering system for Fig. 1); this position encoded a leucme residue (TTG) m both pancreatic cDNAs, and a methionme residue (ATG) m the kidney cDNA, possibly due to polymorphism.
  • TTG leucme residue
  • ATG methionme residue
  • FIG. 1 The entire nucleotide sequence of Apo-2 is shown m Figure 1 (SEQ ID NO:2).
  • Clone 27868 also referred to as pRK5-Apo-2 deposited as ATCC 209021, as indicated below
  • Clone 27868 contains a single open reading frame with an apparent translational initiation site at nucleotide positions 140-142 [Kozak et al . , supra] ana ending at the stop codon found at nucleotide positions 1373-1375 (Fig. 1; SEQ ID NO : 2 ) .
  • the predicte ⁇ polypeptide precursor is 411 ammo acids long, a type I transmembrane protein, and has a calculated molecular weight of approximately 45 kDa .
  • Hydropathy analysis suggested the presence of a signal sequence (residues 1-53), followed by an extracellular domain (residues 54-182), a transmembrane domain (residues 183- , an an m race u ar omain resi ues - Fig. ; : .
  • N-termmal ammo acid sequence analysis of Apo-2-IgG expressed m 293 cells showed that the mature polypeptide starts at ammo acid residue 54, indicating that the actual signal sequence comprises residues 1-53.
  • Apo-2 polypeptide is obtained or obtainable by expressing the molecule encoded by the cDNA insert of the deposited ATCC 209021 vector.
  • TNF receptor family proteins are typically characterized by the presence of multiple (usually four) cysteme- ⁇ ch domains in their extracellular regions — each cysteme-rich domain being approximately 45 am o acids long and containing approximately 6, regularly spaced, cysteme residues. Based on the crystal structure of the type 1 TNF receptor, the cysteines in each domain typically form three disulfide bonds m which usually cysteines 1 and 2, 3 and 5, and 4 and 6 are paired together. Like DR4 , Apo-2 contains two extracellular cysteme-rich pseudorepeats (Fig. 2A) (SEQ ID NO: 6), whereas other identified mammalian TNFR family members contain three or more such domains [Smith et al., Cell, £6:959 (1994)].
  • the cytoplasmic region of Apo-2 contains a death domain (ammo acid residues 324-391 shown m Fig. 1 (SEQ ID NO : 2 ) ; see also Fig. 2A) (SEQ ID NO: 6) which shows significantly more ammo acid sequence identity to the death domain of DR4 (SEQ ID NO:8) (64°o) than to the death domain of TNFRl (SEQ ID NO: 10) (30%); CD95 (SEQ ID NO: 11) (19°o); or Apo-3/DR3 (SEQ ID NO: 9) (291) (Fig. 2B) .
  • a death domain ammo acids that are required for signaling by TNFRl [Tartaglia et al .
  • Apo-2 shows more sequence identity to DR4 (SEQ ID NO:8) (55u) than to other apoptosis-lmked receptors, such as TNFRl (SEQ ID NO: 10) (19 ); CD95 (SEQ ID NO: 11) (17c); or Apo-3 (SEQ ID NO: 9) (also referred to as DR3, WSL-1 or TRAMP) (29?).
  • DR4 SEQ ID NO:8
  • apoptosis-lmked receptors such as TNFRl (SEQ ID NO: 10) (19 ); CD95 (SEQ ID NO: 11) (17c); or Apo-3 (SEQ ID NO: 9) (also referred to as DR3, WSL-1 or TRAMP) (29?).
  • ECD extracellular domain
  • the Flag epitope-tagged molecule was then inserted into pRK5, and expressed by transient transfection into human 293 cells (ATCC CRL 1573) .
  • the immunoadhesm was expressed by transient transfection into human 293 cells and purified from cell supernatants by protein A affinity chromatography, as described by Ashkenazi et al . , supra.
  • the samples were subjected to immunoprecipitation using 25 ⁇ l anti-Flag conjugated agarose beads (Sigma) or Nickel-conjugated agarose beads (Qiagen) . After a 1.5 hour incubation at 4° C, the beads were spun down and washed four times m phosphate buffered saline (PBS) . By using anti-Flag agarose, the Apo-2L was precipitated through the Flag-tagged Apo-2 ECD; by using Nickel-agarose, the Apo-2 ECD was precipitated through the His-tagged Apo-2L.
  • PBS m phosphate buffered saline
  • the precipitated proteins were released by boiling the beads for 5 minutes m SDS-PAGE buffer, resolved by electrophoresis on 12°c polyacrylamide gels, and then detected by lmmunoblot with ant ⁇ -Apo-2L or anti-Flag antibody (2 ⁇ g/ml) as described m Marsters et al., J. Biol . Chem. , (1997) .
  • the binding interaction was further analyzed by purifying Apo-2 ECD from the transfected 293 cell supernatants with anti-Flag beads (see Example 2) and then analyzing the samples on a BIACORETM instrument.
  • BIACORETM analysis also showed that the Apo-2 ECD is not capable of binding other apoptosis-mduc g TNF family members, namely, TNF-alpha (Genentech, Inc., Pennica et al . , Nature, £12:724 (1984), lymphotoxm-alpha (Genentech, Inc.), or Fas/Apo-1 ligand (Alexis Biochemicals ) .
  • TNF-alpha Geneentech, Inc., Pennica et al .
  • lymphotoxm-alpha Geneentech, Inc.
  • Fas/Apo-1 ligand Alexis Biochemicals
  • the Apo-2 transfected 293 cells underwent marked apoptosis.
  • the HeLa cells were co-transfected with pRK5-CD4 as a marker for transfection and apoptosis was determined m
  • CD4-express ⁇ ng cells FADD was co-transfected with the Apo-2 plasmid; the data are means + SEM of at least three experiments, as described in Marsters et al., Curr. Biol., 6:1669 (1996).
  • the caspase inhibitors, DEVD-fmk (Enzyme Systems) or z-VAD-fmk (Research Biochemicals Intl.) were added at 200 ⁇ M at the time of transfection.
  • the caspase inhibitors CrmA, DEVD-fmk, and z-VAD-fmk blocked apoptosis induction by Apo-2, indicating the involvement of Ced-3-l ⁇ ke proteases m this response.
  • FADD is an adaptor protein that mediates apoptosis activation by CD95, TNFRl, and Apo-3/DR3 [Nagata et al . , supra] , but does not appear necessary for apoptosis induction by Apo-2L [Marsters et al., supra] or by DR4 [Pan et al., supra] .
  • a dominant-negative mutant form of FADD which blocks apoptosis induction by CD95, TNFRl, or Apo-3/DR3 [Frazer et al., supra; Nagata et al., supra; Chinnayian et al., supra] did not inhibit apoptosis induction by Apo-2 when co-transfected into HeLa cells with Apo-2 (Fig. 4C) .
  • Apo-2 signals apoptosis independently of FADD.
  • a glutathione-S-transferase fusion protein containing the Apo-2 cytoplasmic region did not bind to in vi tro transcribed and translated FADD (data not shown) .
  • Soluble Apo-2L (0.5 ⁇ g/ml, prepared as described Pitti et al., supra) was pre-mcubated for 1 hour at room temperature with PBS buffer or affinity-purified Apo-2 ECD (5 ⁇ g/ml) together with anti-Flag antibody (Sigma)
  • Apo-2 ECD was capable of blocking APO-2L action (Fig. 4D) , confirming a specific interaction between Apo-2L and Apo-2. Similar results were obtained with the Apo-2 ECD immunoadhesm (Fig. 4D) . Dose-response analysis showed half-maximal inhibition at approximately 0.3 nM Apo-2 immunoadhesm (Fig. 4E) .
  • EXAMPLE 6 Activation of NF-RB by Apo-2 An assay was conducted to determine whether Apo-2 activates NF- KB. HeLa cells were transfected with pRK5 expression plasmids encoding full-length native sequence Apo-2, DR4 or Apo-3 and harvested 24 hours after transfection.
  • Nuclear extracts were prepared and 1 ⁇ g of nuclear protein was reacted with a 32 P-labelled NF- ⁇ B-spec ⁇ f ⁇ c synthetic oligonucleotide probe ATCAGGGACTTTCCGCTGGGGACTTTCCG (SEQ ID NO:4) [see, also, MacKay et al., ⁇ Immunol., ££3:5274-5284 (1994)], alone or together with a 50-fold excess of unlabelled probe, or with an irrelevant 32 P-labelled synthetic oligonucleotide AGGATGGGAAGTGTGTGATATATCCTTGAT (SEQ ID NO:5).
  • NF-KB activation m the treated HeLa cells but not m the treated MCF7 cells; the TNF-alpha induced a more pronounced activation m both cell lines.
  • ALLN N-acetyl-Leu-Leu- norleucmal
  • cyclohexamide a transcription inhibitor
  • HeLa cells plated in 6-well dishes
  • PBS buffer 40 ⁇ g/ml
  • cyclohexamide 50 ⁇ g/ml
  • Apo-2L 1 ⁇ g/ml
  • FACS FACS
  • RNA blots were hybridized to a 4.6 kilobase 32 P-labelled DNA probe based on the full length Apo-2 cDNA; the probe was generated by digesting the pRK5-Apo-2 plasmid with EcoRI .
  • Human fetal RNA blot MTN (Clontech) and human adult RNA blot MTN-II (Clontech) were incubated with the DNA probes. Blots were incubated with the probes m hybridization buffer (5X SSPE; 2X Denhardt ' s solution; 100 mg/mL denatured sheared salmon sperm DNA; 50% formamide; 2% SDS) for 60 hours at 42°C.
  • m hybridization buffer 5X SSPE; 2X Denhardt ' s solution; 100 mg/mL denatured sheared salmon sperm DNA; 50% formamide; 2% SDS
  • the blots were washed several times in 2X SSC; 0.05% SDS for 1 hour at room temperature, followed by a 30 minute wash in 0. IX SSC; 0.1-5 SDS at 50°C. The blots were developed after overnight exposure.
  • a predominant mRNA transcript of approximately 4.6kb was detected in multiple tissues. Expression was relatively high m fetal and adult liver and lung, and in adult ovary and peripheral blood leukocytes (PBL), while no mRNA expression was detected m fetal and adult brain. Intermediate levels of expression were seen m adult colon, small intestine, testis, prostate, thymus, pancreas, kidney, skeletal muscle, placenta, and heart.
  • Apo-2 e.g., PBL, ovary, and spleen, have been shown previously to express DR4 [Pan et al., supra] , however, the relative levels of expression of each receptor mRNA appear to be different.
  • ECD immunoadhesm protein was generated by fusing an extracellular domain sequence of Apo-2 (ammo acids 1-184 shown m Fig. 1) (SEQ ID N0:1) to the hinge and Fc region of human immunoglobulin Gi heavy chain pRK5 as described previously [Ashkenazi et al., Proc. Natl. Acad. Sci., 88 : 10535-10539 .
  • e immunoa esm protein was expressed by transient trans ection into human 293 cells and purified from cell supernatants by protein A affinity chromatography, as described by Ashkenazi et al., supra (See also Example 2B above) .
  • lymph nodes were removed from the mice and a single cell suspension was prepared m DMEM media (obtained from Biowhitakker Corp. ) supplemented with 1% pemcillm- streptomycm.
  • the lymph node cells were then fused with murine myeloma cells P3X63AgU.l (ATCC CRL 1597) using 35% polyethylene glycol and cultured m 96- well culture plates. Hybridomas resulting from the fusion were selected m HAT medium.
  • hybridoma culture supernatants were screened m an ELISA to test for the presence of monoclonal antibodies binding to the Apo-2 ECD immunoadhesm protein.
  • 96-well microtiter plates (Maxisorb; Nunc, Kamstrup, Denmark) were coated by adding 50 ⁇ l of 2 ⁇ g/ml goat anti-human IgG Fc
  • HRP-conjugated goat anti-mouse IgG Fc purchased from Cappel Laboratories
  • diluted 1:1000 m assay buffer 0.5 bovme serum albumin, 0.05 r Tween-20, 0.01 Thimersol m PBS
  • TMB microwell peroxidase substrate (TMB microwell peroxidase substrate, Kirkegaard & Perry, Gaithersburg, MD)
  • substrate TMB microwell peroxidase substrate
  • Kirkegaard & Perry Gaithersburg, MD
  • TMB 1-component stop solution diethyl glycol, Kirkegaard & Perry
  • the supernatants testing positive m the ELISA were further analyzed by FACS analysis using 9D cells (a human B lymphoid cell line expressing Apo-2; Genentech, Inc.) and FITC-conju ⁇ ated goat anti-mouse IgG.
  • 9D cells a human B lymphoid cell line expressing Apo-2; Genentech, Inc.
  • FITC-conju ⁇ ated goat anti-mouse IgG 25 ⁇ l of ce s suspen e at X cells ml) m cell sorter buffer (PBS containing FCS and 0.02% NaN ) were added to U-bottom microtiter wells, mixed with 100 ⁇ l of culture supernatant or purified antibody (purified on Protein A-sepharose columns) (10 ⁇ g /ml) in cell sorter buffer, and incubated for 30 minutes on ice.
  • the cells were then washed and incubated with 100 ⁇ l FITC-con ugated goat anti-mouse IgG for 30 minutes at 4°C. Cells were then washed twice, resuspended in 150 ⁇ l of cell sorter buffer and then analyzed by FACScan (Becton Dickinson, Mountain View, CA) .
  • Figure 7 shows the FACS staining of 9D cells incubated with one of the Apo-2 antibodies, referred to as 3F11.39.7. As shown in Figure 7, the 3F11.39.7 antibody recognizes the Apo-2 receptor expressed m 9D cells.
  • Example 9 above were tested for activity to induce Apo-2 mediated 9D cell apoptosis.
  • the 9D cells (5 X lO"' cells/0. lml) were incubated with varying concentrations of antibodies in 100 ⁇ l complete RPMI media at 4 U C for 15 minutes. The cells were then incubated for 5 minutes at 37 l C with or without 10 ⁇ g of goat anti-mouse IgG Fc antibody (Cappel Laboratories) in 300 ⁇ l of complete RPMI. At this point, the cells were incubated overnight at 37°C and m the presence of 7% CO The cells were then harvested and washed once with PBS.
  • the apoptosis of the cells was determined by staining of FITC-annexm V binding to phosphatidylserme according to manufacturer recommendations (Clontech) .
  • the cells were washed m PBS and resuspended m 200 ⁇ l binding buffer.
  • Ten ⁇ l of annexm-V-FITC (1 ⁇ g/ml) and 10 ⁇ l of propidium iodide were added to the cells. After incubation for 15 minutes the dark, the 9D cells were analyzed by FACS.
  • the 3F11.39.7 antibody in the absence of the goat anti-mouse IgG Fc induced apoptosis m the 9D cells as compared to the control antibodies.
  • Agonistic activity was enhanced by Apo-2 receptor cross-lmkmg m the presence of the goat anti-mouse IgG Fc (see Figure 9).
  • Tnis enhanced apoptosis ( Figure 9) by the combination of antibodies is comparable to the apoptotic activity of Apo-2L in 9D cells (data not shown) .
  • Hybridoma supernatants and purified antibodies were tested for activity to block Apo-2 ligand induced 9D cell apoptosis.
  • the 9D cells (5 X 10 J cells/0. lml) were suspended m complete RPMI media (RPMI plus 10 FCS, glutamme, penicillin, streptomycin, sodium pyruvate) and placed into individual Falcon 2052 tubes. Cells were prerncubated with 10 ⁇ g ot antibodies m 200 ⁇ l media for 15 minutes on ice.
  • 0.2 ml of Apo-2 ligand (2.5 ⁇ g/ml) (soluble His-tagged Apo-2L prepared as described in WO 97 25428; see also Pitti et al., supra) was suspended into complete RPMI media, and then added into the tubes containing the 9D cells. The 9D cells were incubated overnight at 37°C and m the presence of 7% CO ⁇ The incubated cells were then harvested and washed once with PBS. The viability of the cells was determined by staining of FITC-annexm V binding to phosphatidylserme according to manufacturer recommendations (Clontech) .
  • the cells were washed m PBS and resuspended in 200 ⁇ l binding buffer. Ten ⁇ l of annexm-V-FITC (1 ⁇ g/ml) and 10 ⁇ l of propidium iodide were added to the cells. After incubation for 15 minutes m the dark, the 9D cells were analyzed by FACS.
  • EXAMPLE 12 ELISA Assay to Test Binding of Apo-2 Antibodies to Other Apo-2 Ligand Receptors An ELISA was conducted to determine if the monoclonal antibody described m Example 9 was able to bind other known Apo-2L receptors beside Apo-2. Specifically, the 3F11.39.7 antibody was tested for binding to DR4 [Pan et al., supra] , DcRl [Sheridan et al., supra] , and DcR2 [Marsters et al . , Curr. Biol., 7:1003-1006 (1997)]. The ELISA was performed essentially as described in Example 9 above.
  • the results are shown m Figure 11.
  • the Apo-2 antibody 3F11.39.7 bound to Apo-2.
  • the 3F11.39.7 antibody also showed some cross-reactivity to DR4, but not to DcRl or DcR2.
  • the isotype of the 3F11.39.7 antibody (as described above) was determined by coating microtiter plates with isotype specific goat anti-mouse
  • the isotyping analysis showed that the 3F11.39.7 antibody is an IgGl antibody.
  • EXAMPLE 14 Preparation of Monoclonal Antibodies Specific for DR4 Further monoclonal antibodies to Apo-2 were produced essentially as described in Example 9 above. Using the capture ELISA described m Example 9, additional ant ⁇ -Apo-2 antibodies, referred to as 2B3.7.1; 4B9.23.6; 5C7.9.1; 3C9.8.6; and 4H10.14.10, were identified (see Table m Figure 12). Analysis by FACS (using the technique described Example 9) confirmed binding of these antibodies to 9D cells expressing Apo-2 (data not shown) .
  • 3H1.18.10, 3H3.14.5 and 3D5.1.10 Three additional ant ⁇ -Apo-2 antibodies, referred to as 3H1.18.10, 3H3.14.5 and 3D5.1.10, were produced using a mixed antigen immunization protocol as follows. Animals were immunized with four receptor lmmunoadhesms - DR4 [Pan et a l . , Science, 276: 111-113 (1997)]; Apo-2 [as described herein]; DcRl [Sheridan et al . , Science 277:818-821 (1997)]; and DcR2 [Marsters et al . , Curr. Biol., £: 1003-1006 (1997)].
  • Receptor lmmunoadhesms (designated “DR4-IgG", “Apo-2-IgG” , “DcRl-IgG” and “DcR2-IgG") were prepared by fusing the extracellular domain sequence of each receptor to the hinge and Fc region of human immunoglobulin Gj heavy chain in pRK5 as described previously [Ashkenazi et al . , Proc. Natl. Acad. Sci., 88 : 10535-10539 (1991)] .
  • the immunoadhesm proteins were expressed by transient transfection into human 293 cells and purified from cell supernatants by protein A affinity chromatography, as described by Ashkenazi et al .
  • Purified immunoadhesm was suspended in phosphate buffered saline (PBS) .
  • PBS phosphate buffered saline
  • Balb/C mice from Charles River Laboratories were immunized into each hind foot pad 14 times at 3-4 day intervals, with a mixture of DR4-IgG, Apo-2-IgG, DcRl-IgG and DcR2-IgG (1 ⁇ g each) suspended in monophosphoryl lipid A plus trehalose dicorynomycolate adjuvant (MPL-TDM; Ribi Immunochem. Research Inc., Hamilton, MT ) at a 1:1 ratio of immunoadhes : adj uvant (DcR2-IgG was only included in the mixture used for tne final six immunizations) .
  • MPL-TDM monophosphoryl lipid A plus trehalose dicorynomycolate adjuvant
  • lymph node cells nodes were removed from the mice and a single cell suspension was prepared m DMEM media (obtained from Biowhita ker Corp.) supplemented with 1 penicillin- streptomycin.
  • the lymph node cells were fused with murine myeloma cells P3X63AgU.l (ATCC CRL 1597) using 35 polyethylene glycol and cultured in 96- well culture plates.
  • Hybridomas were selected m super DMEM [DMEM plus 10 c fetal calf serum
  • FCS 10 NCTC-109 (BioWittakei, Wakersville, MD) , 100 mM pyruvate, 10C U/ml msulm, 100 mM oxaloacetic acid, 2 mM glutamme, 1 nonessential ammo acids (GIBCO) , 100 U/ml penicillin and 100 ⁇ g/ml streptomycin] containing 100 ⁇ M hypoxanthme, 0.4 ⁇ M ammopterin, and 16 ⁇ M thymidme (lx HAT, Sigma Chemical Co., St. Louis, MO).
  • DR4-IgG, Apo-2-IgG and CD4-IgG control m a capture ELISA.
  • Hybridoma cells were re-fed with 200 ⁇ l of super DMEM containing 10% FCS and antibiotics. Two days later, 180 ⁇ l of culture supernatant was collected and screened for the presence of antibodies to another two different antigens (i.e. DcRl-IgG and DcR2-IgG) m a capture ELISA.. After careful examination of the ELISA results, potential positive hybridomas secreting monoclonal antibodies against each antigen were cloned twice using a limiting dilution method.
  • EXAMPLE 16 Determination of Monoclonal Antibody Affinities
  • the equilibrium dissociation and association constant rates of two of the Apo-2 antibodies were determined using KmExATM, an automated immunoassay system (Sapidyne Instruments, Inc., Boise, ID), as described with a modification by Blake et al . , Journal of Biological Chemistry, 271:27677-685 (1996); and Craig et al . , Journal of Molecular Biology, 281:183-201 (1998). Briefly, 1.0 ml of anti-human IgG agarose beads (5b ⁇ in, Sigma, St. Louis, MO) were coated with 20 ⁇ g of Apo-2- IgG (described m Example 9) m PBS by gentle mixing at room temperature for
  • a bead pack ( ⁇ 4 mm hi ⁇ h) was created m the observation flow cell by the KmExATM instrument.
  • the blocked beads were diluted into 30 ml of assay buffer (0.01 BSA/PBS).
  • the diluted beads (550 i l l) were next drawn through the flow cell with a 20 urn screen and washed with 1 ml of running buffer (0.01% BSA; 0.05 Tween 20 m PBS).
  • the beads were then disrupted gently with a brief backflush of running buffer, followed by a 20 second setting period to create a uniform and reproducible bead pack.
  • tne selected Apo-2 antibodies (3F11.39.7 and 3H3.14.5) (5 ng/ml m 0.01 BSA/PBS) were mixe ⁇ w th a serial dilution of Apo-2-IgG (starting from 2.5 nM to 5.0 pM) and were incubated at room temperature for
  • FIG. 13 Affinity determinations for immunoadhesm constructs of the DR4 and Apo-2 receptors for Apo-2L are shown for comparison.
  • the affinities (Kd-1) of the antibodies 3F11.39.7 and 3H3.14.5 were 20 pM and 5 pM, respectively, demonstrating that both antibodies have high affinities.
  • EXAMPLE 17 Apoptosis Assay of Human Tumor Cell Lines The apoptotic activities of the Apo-2 monoclonal antibodies were further examined in assays to determine the cell viability of cancer cells after treatment with the antibodies or Apo-2L.
  • SKMES-1 cells human lung tumor cell line; ATCC
  • Colo205 cells human colon tumor cell line; ATCC
  • G142 human glioma cells Dr. Manfred Westphal, Universitats Why Eppendorf, Hamburg, Germany
  • the media was then removed from the wells, and 0.1 ml of antibody (ant ⁇ -Apo-2 antibodies diluted 0.001-10 microgram/ml complete medium) was added to selected wells. Control wells without antibody received a media change with or without Apo-2L. The plates were then incubated for 1 hour at room temperature.
  • the culture supernatant was removed from the wells containing the test antibodies, and 10 microgram/ml goat anti-mouse IgG-Fc (Cappel Laboratories) was added to the wells. Media was changed m the control wells. The plates were incubated overnight at 37°C.
  • Apo-2L as described m Example 11
  • pH 7.0 potassium phosphate buffer, pH 7.0
  • 0.1 ml of the diluted Apo-2L solution was added to selected wells, and then serial three-fold dilutions were carried down the plate. Culture supernatants were then removed from the wells by aspiration, and the plates were flooded with 0.5 crystal violet m methanol solution.
  • the EC50 of the 3H3.14.5 antioody was approximately 10 ng/ml, while the EC50 of Apo-2 ligand was approximately 100 ng/ml, suggesting that the 3H3.14.5 antibody may have more potent apoptotic activity that Apo-2 ligand.
  • the monoclonal antibodies did not demonstrate significant apoptotic activity. This result suggests it may be important for oligome ⁇ zation of Apo-2 receptors to occur m order to induce apoptosis .
  • FIG. 15A and 15B show the activity of the Apo-2 antibodies on the Colo205 colon cancer cells and glioma cells, respectively.
  • the antibodies 3F11.39.7 and 3H3.14.5 demonstrated potent apoptotic activities on the Colo205 cells.
  • the 3H3.14.5 antibody appeared to be more potent that Apo-2 ligand. Even more striking effects of the 3H3.14.5 and 3F11.39.7 antibodies were obtained with the glioma G142 cells (which express Apo-2 receptor but not DR4 receptor). At 1 microgram/ml, Apo-2 ligand induced approximately 50" killing of the G142 cells. In contrast, the 3H3.14.5 and 3F11.39.7 antibodies (at 0.1 microgram/ml ) could induce approximately 90 killing of the G142 tumor cells. These results suggest that m cancer cells expressing Apo-2 receptor but not DR4 , such ant ⁇ -Apo-2 antibodies may be more potent apoptotic inducing agents.
  • An ELISA assay was conducted (as described m Examples 9 and 12) to determine binding of the Apo-2 antibodies to other known Apo-2L receptors, beside Apo-2.
  • Antibody 3D5.1.10 demonstrated a significant level of binding to DR4 although it did not bind to DcRl and DcR2.
  • Antibodies 3F11.39.7 and 3H1.18.10 bind Apo-2 specifically while antibody 3H3.14.5 demonstrated a low level of cross reactivities to DR4 and DcRl.
  • 96-well microtiter plates (Maxisorb; Nunc, Kamstrup, Denmark) were coated by adding 50 ⁇ l of 2 ⁇ g/ml goat anti-human IgG Fc (purchased from Cappel Laboratories) m PBS to each well and incubating at 4°C overnight. The plates were then washed three times w th wash buffer (PBS containing 0.05 Tween 20). The wells m the microtiter plates were then blocked with 200 ⁇ l of 2.0 bov e serum albumin m PBS and incubated at room temperature for 1 hour. The plates were then washed again three times with wash buffer.
  • Antibodies 3H3.14.5, 3F11.39.7, 3C9.8.6, and 4H10.14.10 inhibited the binding of Apo-2 ligand to the Apo-2 receptor captured to the goat anti human IgG-coated ELISA wells, demonstrating that these antibodies are blocking antibodies.
  • Antibody 3H3.14.5 appeared to have the strongest blocking activity.
  • the blocking activities of the antibodies are also summarized m Figure 12.
  • Colo205 cells human colon tumor cell line; ATCC
  • ATCC human colon tumor cell line
  • the cells were harvested after treating with cell dissociation medium (Sigma, IAC) for 5 minutes. After washing in PBS, the tumor cells were resuspended m PBS at a concentration of 3X10 7 cells/ml.
  • mice were injected with 3-5 X 10 b cells subcutaneously m the dorsal area m a volume of 0.1 ml. Control animals received either a control IgGl antibody or PBS vehicle alone. When the tumor size in the Colo205 tumor bearing animals became a desired size, the mice were injected l.p. with 100 ⁇ g of 3F11.39.7 or 3H3.14.5 ant ⁇ -Apo-2 antibody m PBS three times per week, and the tumor sizes were measured three times/week.
  • Apo-2L (residues 114-281; ammo acid sequence provided m Pitti et al . , supra) was expressed in E . col i and purified as described m Ashkenazi et al., J. Clm. Invest., ££4:155-162 (1999).
  • Apo-2 (residues 1-130; see Fig. 1; SEQ ID NO : 1 ) was expressed in H ⁇ 5 insect cells (Expression Systems LLC, Woddland, CA) with a baculovirus transfer vector (PharMingen, San Diego, CA) under the control of a polyhedron promoter. Protein was secreted from the cells grown at 27 °C over 72 hours.
  • the Apo-2-contammg medium was separated from the cells by centrifugation.
  • the supernatent was run over a Q-sepharose (Pharmacia) column and the protein eluted with a 0-1M NaCl gradient m 20mM T ⁇ s-HCl, pH 8.0.
  • the fractions containing Apo-2 were pooled and loaded onto a CNBr-Apo-2L affinity column.
  • the column was washed with 0.5M NaCl m 20mM Tris-HCL, pH 8.0, and Apo-2 was eluted with 2M KSCN m 50mM T ⁇ s, pH 8.0.
  • Apo-2 was further purified by size exclusion chromatography (S-200, Pharmacia).
  • Apo-2L in 20mM Tris-HCl, pH 8.0 was added to purified Apo-2 m approximately equimolar concentrations, and the complex was purified by size exclusion chromatography S-75, Pharmacia) m 100 mM NaCl, 20mM Tris-HCl, pH 8.0.
  • the fraction containing the Apo-2L/Apo- 2 complex was further purified by anion exchange chromatography (MonoQ, Pharmacia) and eluted with a 0-1M NaCl gradient m 20mM Tris, pH 8.0.
  • the complex was then concentrated to approximately 3.7 mg/mL and buffered with 20mM Tris-HCl, pH 8.0, 0.1 M NaCl. 2. Crystallization and data collection Crystals of the Apo-2L/Apo-2 complex were grown by vapor diffusion at
  • the initial crystals were growr m condition 37 of the Hampton Crystal Screen II (10 PEG 8000, 8 ethylene glycol, 0.1 M Heoes, pH 7.5).
  • the crystals used for data collection were grown by mixing 2 microtiter of protein solution with 2 microliter of reservoir consisting of 15 PEG 8000, 10 ethylene glycol, 0.2M ammonium sulfate, 0.1M Tris-HCl, pH 7.5, and grew to a size of 0.3 mm x 0.15 mm x 0.1 mm.
  • the crystals were transferred briefly to a droplet containing reservoir solution with 20 glycerol before flash-cooling liquid nitrogen.
  • the asymmetric unit contained one Apo-2L trimer and three receptor molecules.
  • a 3.5 A data set was collected on a MAR imaging plate system using a Rigaku rotating anode generator with CuKalpha radiation.
  • a subsequent data set to 2.4 A resolution was collected from a single crystal at beam line 1 - 1 of the Stanford Synchrotron Radiation Laboratory.
  • the data sets were processed using the programs m the HKL package (Otwmowski and Minor, Methods Enzymol . , 176 : 307-326 (1997)). 3.
  • the Apo-2/Apo-2L structure was determined by molecular replacement using the structure of Apo-2L alone as the search model in combination with three-fold non-crystallographic symmetry (NCS) map averaging.
  • NCS non-crystallographic symmetry
  • This model was refined with X-PLOR 98.1 (Brunger, X-PLOR Manual, Version 3.1, New Haven, Connecticut, Yale University (1992)) as modified by Molecular Simulations, Inc., using a maximum likelihood target function, NCS constraints, positional refinement, simulated annealing and grouped B- factors until Rfree reached 33.5%.
  • This partially refined model was then further refined aqainst the 2.4 A data set, using programs X-PLOR and REFMAC (CCP4, supra) .
  • Examination of sigma weighted 2Fo-Fc and Fo-Fc maps revealed that differences existed among the three receptor copies, especially between residues 100 to 130.
  • the Apo-2L turner was subject to tight NCS restraints, while weak restraints were applied to the most similar regions of the receptors.
  • An overall amsotropic B-factor correction was applied to the data as was a real space bulk solvent correction (Brunger, X-PLOR Manual, supra) .
  • the final model consists of three Apo-2L monomers (A, B, and D), containing residues 119-131 and 144-281 (using the ammo acid sequence numbering provided m Pitti et al., supra) , and Apo-2 receptor chains R (residues 21-128) and S and T (residues 22-130) .
  • Molsc ⁇ pt and Raster3D were used to make figures (Kraulis, J . Appl . Cryst . ,
  • patch A the 90s loop interacts with a cluster of Apo-2L residues around Gin 205 near the bottom of the t ⁇ mer, while patch B is formed by the 50s loop of Apo-2 and Apo-2L residues clustered around Tyr 216 near the top of tne t ⁇ mer ( Figure 21) .
  • Patch B is the smaller of the two patches (890 A total, 480 A from
  • the 50s loop of the receptor interacts with the 210s and the 150s loops of Apo-2L.
  • This patch is centered on Apo-2L residue Tyr 216, which binds m a hydrophobic groove on the receptor surface formed by the side chains of Apo-2 residues His 53, Asn 55, Leu 57, Leu 58 and Phe 59.
  • the interactions with the 150s loop are more peripheral and polar m nature, and are primarily mediated through contacts between Arg 62 on the receptor with Apo-2L residues Glu 155 and Ser 159.
  • the actual ligand-bmdmg motif found m CRDs 2 and 3 corresponds to Apo-2 residues 43 to 130. * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * *

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Veterinary Medicine (AREA)
  • Cell Biology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

Novel polypeptides, designated Apo-2, which are capable of modulating apoptosis are provided. Compositions including Apo-2 chimeras, nucleic acid encoding Apo-2, and antibodies to Apo-2 are also provided.

Description

Apo-2 Receptor Antibodies
FIELD OF THE INVENTION The present invention relates generally to the identification, isolation, and recombinant production of novel polypeptides, designated herein as "Apo-2" and to ant -Apo—2 antibodies.
BACKGROUND OF THE INVENTION Apoptosis or "Programmed Cell Death" Control of cell numbers in mammals is believed to be determined, in part, by a balance between cell proliferation and cell death. One form of cell death, sometimes referred to as necrotic cell death, is typically characterized as a pathologic form of cell death resulting from some trauma or cellular injury. In contrast, there is another, "physiologic" form of cell death which usually proceeds in an orderly or controlled manner. This orderly or controlled form of cell death is often referred to as "apoptosis" [see, e.g., Barr et al., Bio/Technology, 12:487-493 (1994); Steller et al., Science, 267 : 1445-1449 (1995)]. Apoptotic cell death naturally occurs m many physiological processes, including embryonic development and clonal selection m the immune system [Itoh et al., Cell, 66:233-243 (1991)]. Decreased levels of apoptotic cell death have been associated with a variety of pathological conditions, including cancer, lupus, and herpes virus infection [Thompson, Science, 267 : 1456-1462 (1995)]. Increased levels of apoptotic cell death may be associated with a variety of other pathological conditions, including AIDS, Alzheimer's disease, Parkinson's disease, amyotrophic lateral sclerosis, multiple sclerosis, retinitis pigmentosa, cerebellar degeneration, aplastic anemia, myocardial infarction, stroke, reperfusion injury, and toxin-induced liver disease [see, Thompson, supra] .
Apoptotic cell death is typically accompanied by one or more characteristic morphological ana biochemical changes in cells, such as condensation of cytoplasm, loss or plasma membrane m crovilli, segmentation of the nucleus, degradation of chromosomal DNA or loss of mitochondrial function.
A variety of extrinsic and intrinsic signals are believed to trigger oi induce such morphological and biochemical cellular changes [Raff, Nature, 356:397-400 (1992); Steller, supra; Sachs et al . , Blood, 82:15 (1993)]. For instance, they can be triggered by hormonal stimuli, such as glucocorticoid hormones for immature thymocytes, as well as withdrawal of certain growth factors [Watanabe-Fukunaga et al . , Nature, 356: 314-317 (1992)]. Also, some identified oncogenes such as myc, rel , and E1A, and tumor suppressors, like p53, have been reported to have a role in inducing apoptosis. Certain chemotherapy drugs and some forms of radiation have likewise been observed to have apoptosis-inducing activity [Thompson, supra] .
TNF Family of Cytokiπes
Various molecules, such as tumor necrosis factor-α ("TNF-α"), tumor necrosis factor-β ("TNF-β" or "lymphotoxm" ) , CD30 ligand, CD27 ligand,
CD40 ligand, OX-40 liganα, 4-lBB ligand, Apo-1 ligand (also referred to as Fas ligand or CD95 ligand), and Apo-2 ligand (aiso referred to as TRAIL) have been identified as members of the tumor necrosis factor ("TNF") family of cytokines [See, e.g., Gruss ana Dower, Blood, 8_5: 3378-3404 (1995); Wiley et al., Immunity, 3:673-682 (1995); Pitti et al . , J. Biol. Chem., 271:12687-12690 (1996); WO 97/01633 published January 16, 1997]. Among these molecules, TNF- α, TNF-β, CD30 ligand, 4-lBB ligand, Apo-1 ligand, and Apo-2 ligand (TRAIL) have been reported to De involved m apoptotic cell death. Both TNF- and TNF-β have been reported to induce apoptotic death in susceptible tumor cells [Schmid et al . , Proc. Natl. Acad. Sci., 83:1881 (1986); Dealtry et al . , Eur. J. Immunol., V7:689 (1987)]. Zheng et al. have reported that TNF-α is involved in post-stimulation apoptosis of CD8-posιtιve T cells [Zheng et al . , Nature, 377:348-351 (1995)]. Other investigators have reported that CD30 ligand may be involved n deletion of self-reactive T cells m the thymus [Amakawa et al . , Cold Spring Harbor Laboratory Symposium on Programmed Cell Death, Abstr. No. 10, (1995)]. Mutations in the mouse Fas/Apo-1 receptor or ligand genes (called lpr and gld, respectively) have been associated with some autoimmune disorders, indicating that Apo-1 ligand may play a role m regulating the clonal deletion or self-reactive lymphocytes m the periphery [Krammer et al . , Curr. Op. Immunol., 6:279-289 (1994); Nagata et al., Science, 267: 1449-1456 (1995)] . Apo-1 ligand s also reported to induce post-stimulation apoptosis in CD4-posιtιve T lymphocytes and m B lymphocytes, and may be involved m the elimination of activated lymphocytes when their function is no longer needed [Krammer et al., supra; Nagata et al . , supra] . Agonist mouse monoclonal antibodies specifically binding to the Apo-1 receptor have been reported to exmbit cell killing activity that is comparable to or similar to that of TNF- α [Yonehara et al., J. Exp. Med., 1_69: 1747-1756 (1989)].
TNF Family of Receptors Inαuction cf various cellular responses mediated by such TNF family cytokines is believed to be initiated by their binding to specific cell receptors. Two distinct TNF receptors of approximately 55-kDa (TNFR1) and 75- kDa (TNFR2) ha\e been identified [Hohmann et al., J. Biol. Chem., 264 : 14927- 14934 (1989^; Brockhaus et al., Proc. Natl. Acad. Sci., 87:3127-3131 (1990); EP 417,563, published March 20, 1991] and human and mouse cDNAs corresponding to both receptor types nave been isolated and characterized [Loetscher et al . , Cell, 61:351 (1990); Schall et al., Cell, 61:361 (1990); Smith et al . , Science, 24_8 : 1019-1023 1990); Lewis et al . , Proc. Natl. Acad. Sci., 8-8:2830- 2834 (1991- ; Goodwin et al . , Mol. Cell. Biol., 11:3020-3026 (1991)]. Extensive polymorphisrrs have been associated with both TNF receptor genes [see, e.g., Takao et d., Immunogenetics , 37:199-203 (1993)]. Both TNFRs share the typical structure of cell surface receptors including extracellular, transmembrane ana mtracellular regions. The extracellular portions of both receptors are tound naturally also as soluble TNF-binding proteins [Nophai, i. et al., EMBO . , 9:3269 (1990); and Kohno, T. et al . , Proc. Natl. Acad. Sci. U.S.A., _87:8331 (1990) . The cloning of recombinant soluble TNF receptors was reported by Hale et al . [J. Cell. Biochem. Supplement 15F, 1991, p. 113 (P424) ] . The extracellular portion of type 1 and type 2 TNFRs (TNFRl and TNFR2) contains a repetitive ammo acid sequence pattern of four cysteine-πch domains (CRDs) designated 1 through 4, starting from the NH -terminus . Each CRD is about 40 ammo acids long and contains 4 to 6 cysteme residues at positions which are well conserved [Schall et al., supra; Loetscher et al . , supra; Smith et al . , supra; Nophar et al . , supra; Kohno et al., supra] ■ In TNFRl, the approximate boundaries of the four CRDs are as follows: CRD1- ammo acids 14 to about 53; CRD2- ammo acids from about 54 to about 97; CRD3- ammo acids from about 98 to about 138; CRD4- ammo acids from about 139 to about 167. In TNFR2, CRD1 includes ammo acids 17 to about 54; CRD2- ammo acids from about 55 to about 97; CRD3- ammo acids from about 98 to about 140; and CRD4- ammo acids from about 141 to about 179 [Banner et al., Cell, 73:431-445 (1993)]. The potential role of the CRDs in ligand binding is also described by Banner et al . , supra . A similar repetitive pattern of CRDs exists several other cell- surface proteins, including the p75 nerve growth factor receptor (NGFR) [Johnson et al . , Cell, 47:545 (1986); Radeke et al . , Nature, 325:593 (1987)], the B cell antigen CD40 [Stamenkovic et al . , EMBO J . , 8:1403 (1989)], the T cell antigen OX40 [Mallett et al., EMBO J ■ , 9:1063 (1990)] and the Fas antigen [Yonehara et al., supra and Itoh et al., supra] . CRDs are also found m the soluble TNFR (sTNFR)-lιke T2 proteins of the Shope and myxoma poxviruses [Upton et al., Virology, 160:20-29 (1987); Smith et al., Biochem. Biophys. Res. Commun., 176:335 (1991); Upton et al . , Virology, 184:370 (1991)]. Optimal alignment of these sequences indicates that the positions of the cysteme residues are well conserved. These receptors are sometimes collectively referred to as members of the TNF/NGF receptor superfamily. Recent studies on p75NGFR showed that the deletion of CRD1 [Welcher, A.A. et al., Proc. Natl. Acad. Sci. USA, £8:159-163 (1991)] or a 5-ammo acid insertion m this domain [Yan, H. and Chao, M.V., J. Biol . Chem. , 266 : 12099- 12104 (1991)] had little or no effect on NGF binding [Yan, H. and Chao, M.V., supra] . ρ75 NGFR contains a proline-rich stretch of about 60 ammo acids, between its CRD4 and transmembrane region, which is not involved in NGF binding [Peetre, C. et al., Eur. J. Heamatol., 4J.:414-419 (1988); Seckinger, P. et al., J. Biol. Cnem., 2j54 : 11966-11973 (1989); Yan, H. and Chao, M.V., supra] . A similar proline-rich region is found TNFR2 but not m TNFRl.
Itoh et al . disclose that the Apo-1 receptor can signal an apoptotic cell death similar to that signaled by the 55-kDa TNFRl [Itoh et al., supra] . Expression of the Apo-1 antiαen has also been reported to be down-regulated along with that of TNFRl when cells are treated with either TNF~α or antι-Apo-1 mouse monoclonal antibody [Krammer et al . , supra; Nagata et al . , supra] . Accordingly, some investigators have hypothesized that cell lines that co-express both Apo-1 and TNFRl receptors may mediate cell killing through common signaling pathways [Id. ] .
The TNF family ligands identified to date, with the exception ot lymphotoxin-α, are type II transmembrane proteins, whose C-termmus is extracellular. In contrast, the receptors the TNF receptor (TNFR) family identified to date are type I transmembrane proteins. In both the TNF liganα and receptor families, however, homology identified between family members has been found mainly in the extracellular domain ("ECD"). Several of the TNF family cytokmes, includmg TNF- , Apo-1 ligand and CD40 ligand, are cleaved proteolytically at the cell surface; the resulting protein in each case typically forms a homotπmeric molecule that functions as a soluble cytok e. TNF receptor family proteins are also usually cleaved proteolytically to release soluble receptor ECDs that can function as inhibitors of the cognate cytokmes .
Recently, other members of the TNFR family have been identified. In Marsters et al., Curr . Biol. , 6:750 (1996), investigators describe a full length native sequence human polypeptide, called Apo-3, which exhibits similarity to the TNFR family in its extracellular cysteine-rich repeats and resembles TNFRl and CD95 in that it contains a cytoplasmic death domain sequence [see also Marsters et al . , Curr. Biol . , 6:1669 (1996)]. Apo-3 has also been referred to by other investigators as DR3, wsl-1 and TRAMP [Chmnaiyan et al., Science, 274:990 (1996); Kitson et al . , Nature, 384 :372 (1996); Bodmer et al., Immunity, 6:79 (1997)].
Pan et al . have disclosed another TNF receptor family member referred to as "DR4" [Pan et al., Science, 276: 111-113 (1997)]. The DR4 was reported to contain a cytoplasmic death domain capable of engaging the cell suicide apparatus. Pan et al . disclose that DR4 is believed to be a receptor for the ligand known as Apo-2 ligand or TRAIL.
The Apoptosis-Inducmg Signaling Complex As presently understood, the cell death program contains at least three important elements - activators, inhibitors, and effectors; C. elegans, these elements are encoded respectively by three genes, Ced-4 , Ced-9 and Ced 3 [Steller, Science, 267:1445 (1995); Chmnaiyan et al . , Science, 275:1122-1126 (1997)]. Two of the TNFR family members, TNFRl and Fas/Apol (CD95), can activate apoptotic cell death [Chmnaiyan and Dixit, Current Biology, 6:555-562 (1996); Fraser and Evan, Cell; £5:781-784 (1996)]. TNFRl is also known to mediate activation of the transcription factor, NF-KB [Tartaglia et al., Cell, 74:845-853 (1993); Hsu et al., Cell, 84:299-308 (1996)] . In addition to some ECD homology, these two receptors share homology m their mtracellular domain (ICD) in an oligomeπzation interface known as the death domain [Tartaglia et al., supra; Nagata, Cell, 8_8:355 (1997)].
Death domains are also found in several metazoan proteins that regulate apoptosis, namely, the Drosophila protein, Reaper, and the mammalian proteins referred to as FADD/MORT1, TRADD, and RIP [Cleveland and Ihle, Cell, 81:479- 482 (1995) ] . Upon ligand binding and receptor clustering, TNFRl and CD95 are believed to recruit FADD into a death-inducing signalling complex. CD95 purportedly binds FADD directly, while TNFRl binds FADD indirectly via TRADD [Chmnaiyan et al . , Cell, 81:505-512 (1995); Bold n et al . , J. Biol. Chem., 270: 387-391 (1995); Hsu et al . , supra; Chmnaiyan et al., J. Biol. Chem., 271 : 961-4965 (1996)]. It has been reported that FADD serves as an adaptor protein which recruits the Ce -3-related protease, MACHα/FLICE (caspase 8), into the death signalling complex [Boldm et al . , Cell, 85:803-815 (1996); Muzio et al., Cell, 85:817-827 (1996)]. Caspase 8 appears to be the trigger that sets off a cascade of apoptotic proteases, including the terleukm-lβ converting enzyme (ICE; caspase 1) and CPP32/Yama (caspase 3), which may execute some critical aspects of the cell death programme [Fraser and Evan, supra] .
It was recently disclosed that programmed cell death involves the activity of members of a family of cysteme proteases related to the C. elegans cell death gene, ced-3, and to the mammalian IL-1-convertmg enzyme, ICE (caspase 1). The activity of caspase 1 and 3 can be inhibited by the product of the cowpox virus gene, crmA [Ray et al . , Cell, £9:597-604 (1992); Tewari et al . , Cell, 81:801-809 (1995)]. Recent studies show that CrmA can inhibit TNFRl- and CD95-mduced cell death [Enari et al . , Nature, 375:78-81 (1995); Tewari et al., J. Biol. Chem., 270:3255-3260 (1995)]. As reviewed recently by Tewari et al . , TNFRl, TNFR2 and CD40 modulate the expression of proinflammatory and costimulatory cytokmes, cytokine receptors, and cell adhesion molecules through activation of the transcription factor, F-KB [Tewari et al., Curr. Op. Genet. Develop., 6:39-44
(1996)] . F- B is the prototype of a family of dimeric transcription factors whose subunits contain conserved Rel regions [Verma et al . , Genes Develop., 9:2723-2735 (1995); Baldwin, Ann. Rev. Immunol., 14:649-681 (1996)]. In its latent form, NF-KB is complexed with members of the 1KB inhibitor family; upon mactivation of the 1KB m response to certain stimuli, released NF-KB translocates to the nucleus where it binds to specific DNA sequences and activates gene transcription.
For a review of the TNF family of cytokmes and their receptors, see Gruss and Dower, supra .
SUMMARY OF THE INVENTION Applicants have identified cDNA clones that encode novel polypeptides, designated in the present application as "Apo-2." It is believed that Apo-2 is a member of the TNFR family; full-length nat±ve sequence human Apo-2 polypeptide exhibits some similarities to some known TNFRs, including a cytoplasmic death domain region. Full-lenqth native sequence human Apo-2 also exhibits similarity to the TNFR family m its extracellular cysteme-πch repeats. Apo-2 polypeptide has been found to be capable of triggering caspase-dependent apoptosis and activating NF-KB. Applicants surprisingly found that the soluble extracellular domain of Apo-2 binds Apo-2 l αand ("Apo-2L" ) and can inhibit Apo-2 ligand function. The crystal structure of the complex formed between Apo-2 ligand and an extracellular domain sequence of Apo-2 is described herein. It is presently believed that ADO-2 liσand can signal via at least two different receptors, DR4 and the newly αescribed Apo-2 herein.
In one embodiment, the invention provides isolated Apo-2 polypeptide. In particular, the invention provides isolated native sequence Apo-2 polypeptide, which one embodiment, includes an am o acid sequence comprising residues 1 to 411 of Figure 1 (SEQ ID NO:l) . In other embodiments, the isolated Apo-2 polypeptide comprises at least about 80% am o acid sequence identity with native sequence Apo-2 polypeptide comprising residues 1 to 411 of Figure 1 (SEQ ID NO:l). Optionally, the Apo-2 polypeptide is obtained or obtainable by expressing the polypeptide encoded by the cDNA insert of the vector deposited as ATCC 209021.
In another embodiment, the invention provides an isolated extracellular domain (ECD) sequence of Apo-2. Optionally, the isolated extracellular domain sequence comprises ammo acid residues 54 to 182 of Fig. 1 (SEQ ID NO:l) .
In another embodiment, the invention provides an isolated death domain sequence of Apo-2. Optionally, the isolated death domain sequence comprises ammo acid residues 324 to 391 of Fig. 1 (SEQ ID NO:l).
In another embodiment, the invention provides chimeric molecules comprising Apo-2 polypeptide fused to a heterologous polypeptide or amino acid sequence. An example of such a chimeric molecule comprises an Apo-2 fused to an immunoglobulin sequence. Another example comprises an extracellular domain sequence of Apo-2 fused to a heterologous polypeptide or ammo acid sequence, such as an immunoglobulin sequence. In another embodiment, the invention provides an isolated nucleic acid molecule encoding Apo-2 polypeptide. In one aspect, the nucleic acid molecule is RNA or DNA that encodes an Apo-2 polypeptide or a particular domain of Apo-2, or is complementary to such encoding nucleic acid sequence, and remains stably bound to it under at least moderate, and optionally, under high stringency conditions. In one embodiment, the nucleic acid sequence is selected from:
(a) the coding region of the nucleic acid sequence of Figure 1 (SEQ ID NO:2) that codes for residue 1 to residue 411 ( .e., nucleotides 140- 142 through 1370-1372), inclusive; (b^ the coding region of the nucleic acid sequence of Figure 1
(SEQ ID NO:2) that codes for residue 1 to residue 182 (i.e., nucleotides 140- 142 through 683-685), inclusive;
(c) the coding region of the nucleic acid sequence of Figure 1 (SEQ ID NO:2) that codes for residue 54 to residue 182 (i.e., nucleotides 299- 301 through 683-685), inclusive;
(d) the coαmg region of the nucleic acid sequence of Figure 1 (SEQ ID N0:2) that codes for residue 324 to residue 391 (i.e., nucleotides 1109-1111 throuσh 1310-1312), inclusive; or
(e) a sequence corresponding to the sequence of (a) , (b) , (c) or (d) within the scope of αegeneracy of the genetic code. The isolated nucleic acid may comprise the Apo-2 polypeptide cDNA insert of the vector deposited as ATCC 209021 which includes the nucleotide sequence encoding Apo-2 polypeptide. In a further embodiment, the invention provides a vector comprising the nucleic aciα molecule encoding the Apo-2 polypeptide or particular domain of Apo-2. A host cell comprising the vector or the nucleic acid molecule is also provideα. A method of producing Apo-2 is further provideα. In another embodiment, the invention provides an antibody which specifically binds to Apo-2. The antibody may be an agonistic, antagonistic, neutralizing, or blocking antibody. Dimeπc molecules, in particular homodimeπc molecules, comprising Apo-2 antibody are also provided. In another embodiment, the invention provides non-human, transgenic or knock-out animals.
A further embodiment of the invention provides articles of manufacture and kits that include Apo-2 or Apo-2 antibodies.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the nucleotide sequence (SEQ ID NO: 2) of a native sequence human Apo-2 cDNA and its derived ammo acid sequence (SEQ ID NO:l).
Figure 2A shows the derived ammo acid sequence (SEQ ID NO: 6) of a native sequence human Apo-2 - the putative signal sequence is underlined, the putative transmembrane domain is boxed, and the putative death domain sequence is dash underlined. The cysteines of the two cysteine-nch domains are individually underlined.
Figure 2B shows an alignment and comparison of the death domain sequences of native sequence human Apo-2 (SEQ ID NO: 7), DR4 (SEQ ID NO: 8), Apo-3/DR3 (SEQ ID NO: 9), TNFRl (SEQ ID NO: 10;, and Fas/Apo-1 (CD95) (SEQ ID
NO: 11). Asterisks indicate residues that are essential for death signaling by
TNFRl [Tartaglia et al . , supra] .
Figure 3 shows the interaction of the Apo-2 ECD with Apo-2L.
Supernatants from mock-transfected 293 cells or from 293 cells transfected with Flag epitope-tagged Apo-2 ECD were incubated with poly-His-tagged Apo-2L and subjected to immunoprecipitation with anti-Flag conjugated or Nickel conjugated agarose beads. The precipitated proteins were resolved by electrophoresis on polyacrylamide qels, and detected by immunoblot with anti-
Apo-2L or anti-Flag antibody. Fiαure 4 shows the induction of apoptosis by Apo-2 and inhibition of Apo-2L activity by soluble Apo-2 ECD. Human 293 cells (A, B) or HeLa cells (C) were transrected by pRK5 vector or by pRK5-based plasmids encoding Apo-2 and/or CrmA. Apoptosis was assessed by morphology (A), DNA fragmentation (B), or by FACS (C-E^ . Soluble Apo-2L was pre-mcubated with buffer or affinity- purified Apo-2 ECD together with anti-Flag antioody or Apo-2 ECD immunoadhesm or DR4 or TNFRl lmmunoadhesms and added to HeLa cells. The cells were latei analyzed for apoptosis (D) . Dose-response analysis using Apo-2L with Apo-2
ECD immunoadhesm was also determined (E) .
Fiσure 5 shows activation of NF-KB by Apo-2, DR4, and Apo-2L. (A* HeLa cells were transfected with expression plasmids encoding the indicated proteins. Nuclear extracts were prepared and analyzed by an electrophoretic mobility shift assay. (B) HeLa cells or MCF7 cells were treated with bufter, Apo-2L or TNF-alpha and assayed for NF~KB activity. (C) HeLa cells were premcubated with buffer, ALLN or cyclohexamide before addition of Apo-2L. Apoptosis was later analyzed by FACS.
Figure 6 shows expression of Apo-2 mRNA human tissues as analyzed by Northern hypndization of human tissue poly A RNA blots. Figure 7 shows the FACS analysis of an Apo-2 antibody, 3F11.39.7 (illustrated by the bold lines) as compared to IgG controls (dotted lines). The 3F11.39.7 antibody recognized the Apo-2 receptor expressed in human 9D cells . Figure 8 is a graph showing percent (°) apoptosis induced m 9D cells by Apo-2 antibody 3F11.39.7, the absence of goat anti-mouse IgG Fc .
Figure 9 is a bar diagram showing percent (%) apoptosis, as compared to Apo-2L, m 9D cells by Apo-2 antibody 3F11.39.7 m the presence or absence of goat anti-mouse IgG Fc . Figure 10 is a bar diagram illustrating the ability of Apo-2 antibody 3F11.39.7 to block the apoptosis induced by Apo-2L m 9D cells.
Figure 11 is a graph showing results of an ELISA testing binding of Apo-2 antibody 3F11.39.7 to Apo-2 and to other known Apo-2L receptors referred to as DR4 , DcRl, and DcR2. Fiαure 12 provides a table identifying Apo-2 antibodies, 2B3.7.1
("2B3"); 3F11.39.7 ("3F11"); 4B9.23.6 ("4B9"); 5C7.9.1 ("5C7"); 3H1.18.10 ("3H1"); 3H3.14.5 ("3H3"); 3D5.1.10 ("3D5"); 3C9.8.6 ("3C9"); 4H10.14.10 ("4H10"), as well as various properties and activities identified with each respective antibody. Figure 13 shows the binding affinities of Apo-2 antibodies 3F11 and 3H3, to Apo-2-IgG, as determined in a KinExA'1" assay. Binding affinities, e.g., of DR4 and Apo-2 lmmunoadhes s to Apo-2 ligand are shown for comparison .
Figure 14 shows apoptotic activity of Apo-2 antibodies, 3D5; 3C9; 5C7; 3H3; 3F11; 4B9; 2B3; and 3H1, on SKMES tumor cells m the presence of goat anti-mouse IgG Fc .
Figure 15A shows apoptotic activity of Apo-2 antibodies, 3F11 and 3H3, on Colo205 tumor cells m the presence or absence of goat anti-mouse IgG Fc. Fiqure 15B shows apoptotic activity of Apo-2 antibodies, 3F11 and
3H3, on glioma cells the presence or absence of goat anti-mouse IgG Fc .
Fiqure 16 shows graphs illustrating results of an ELISA testing binding of Apo-2 antibodies, 3D5; 3F11; 3H1; and 3H3, to Apo-2 and to other known Apo-2 ligand receptors referred to as DR4 and DcRl . Figure 17 shows the results of an ELISA testing for blocking activity of Apo-2 antibodies, 3F11; 3H3; 2B3; 4B9; 5C7; 3H1; 3D5; 3C9; and 4H10.
Fiqure 18 shows the effects of Apo-2 antibodies, 3F11 and 3H3, on the growth of Colo205 tumors athymic nude mice, as measured by tumor volume.
Figure 19 shows data collection and refinement statistics for the x-ray crystal structure of Apo-2 (DR5) bound to Apo-2 ligand.
Fiqure 20 shows the Aoo-2L/Apo-2 complex. The Apo-2L trimer is drawn as ribbon and the three receptors are rendered as tubes. The disordered loop (residues 132-143) Apo-2L is lendered as small spheres. The bound zinc atom and the bound cnloπde ion pink are shown as small spheres. Beta strands and relevant loocs are labeled. (A) Side view. In this orientation, the membrane of the receptor-containing cell is at the bottom of the figure. (B) View down the three-fold axis of the complex, perpendicular to (A) .
Figure 21 shows an open-book view of the Apo-2L/Apo-2 interface. Apo-2L and one receptor are rendered as space filling models, while the other two receptors are shown as tubes. Residues m the interface are colored by °0 of buried accessible surface area upon complex formation (l-25o, very light grey; 25-50°, light grey; 50-75o, grey; 75-100°o, dark grey). The interface divides into two patches, A and B (labeled) . A probe size of 1.4 Angstrom was used to calculate the accessible surface area.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS I . Definitions
The terms "Apo-2 polypeptide" and "Apo-2" when used herein encompass native sequence Apo-2 and Apo-2 variants (which are further defined herein). These terms encompass Apo-2 from a variety of mammals, including humans. The Apo-2 may be isolated from a variety of sources, such as from human tissue types or from another source, or prepared by recombinant or synthetic methods.
A "native sequence Apo-2" comprises a polypeptide having the same ammo acid sequence as an Apo-2 derived from nature. Thus, a native sequence Apo-2 can have the ammo acid sequence of naturally-occurring Apo-2 from any mammal. Such native sequence Apo-2 can be isolated from nature or can be produced by recombinant or synthetic means. The term "native sequence Apo-2" specifically encompasses naturally-occurring truncated or secreted forms of the Apo-2 ( e . g. , an extracellular domain sequence), naturally-occurring variant forms { e . g. , alternatively spliced forms) and naturally-occurring allelic variants of the Apo-2. A naturally-occurring variant form of the Apo- 2 includes an Apo-2 having an ammo acid substitution at residue 410 m the ammo acid sequence shown m Figure 1 (SEQ ID NO : 1 ) . In one embodiment of such naturally-occurring variant rorm, the leucme residue at position 410 is substituted by a methionme residue. In Fig. 1 (SEQ ID NO : 1 ) , the ammo acid residue at position 410 is identified as "Xaα" to indicate that the ammo acid may, optionally, be either leucme or methionme. In F g. 1 (SEQ ID NO:?), the nucleotide at position 1367 is identified as "W" to indicate that the nucleotide may be either adenme (A) or thymme (T) or uracil (U) . In one embodiment of the invention, the native sequence Apo-2 is a mature or full- length native sequence Apo-2 comprising ammo acids 1 to 411 of Fig. 1 (SEQ ID N0:1) .
The "Apo-2 extracellular domain" or "Apo-2 ECD" refers to a form of Apo-2 whicri is essentially free of the transmembrane and cytoplasmic domains of Apo-2. Ordinarily, Apo-2 ECD will have less than 1 of such transmembrane and/or cytoplasmic domains ano preferably, will have less than 0.5 of such domains. Optionally, Apo-2 ECD will comprise ammo acid residues 54 to 182 of Fig. 1 (SEQ ID NO : 1 ) or ammo acid residues 1 to 182 of Fig. 1 (SEQ ID N0:1) . The Apo-2 extracellular domain sequence may also comprise am o acid residues 1 to 130 of Fig. 1 (SEQ ID NO : 1 ) . "Apo-2 variant" means a biologically active Apo-2 as defined below having at least about 80 ammo acid sequence identity with the Apo-2 having the deduced ammo acid sequence shown in Fig. 1 (SEQ ID NO:l) for a full- length native sequence human Apo-2 or with the deduced ammo acid sequences for an extracellular domain or death domain of Apo-2 identified herein. Such Apo-2 variants include, for instance, Apo-2 polypeptides wherein one or more ammo acid residues are added, or deleted, at the N- or C-terminus of the sequence of Fig. 1 (SEQ ID NO:l). Ordinarily, an Apo-2 variant will have at least about 80« ammo acid sequence identity, more preferably at least about 90% ammo acid sequence identity, and even more preferably at least about 95 o ammo acid sequence identity with the ammo acid sequence of Fig. 1 (SEQ ID NO:l) or with the extracellular domain or death domain sequences of Apo-2.
"Percent (O ammo acid sequence identity" with respect to the sequences identified herein is defined as the percentage of ammo acid residues a candidate sequence that are identical with the ammo acid residues in the Apo-2 sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity, and not considering any conservative substitutions as part of the sequence identity. Alignment for purposes of determining percent ammo acid sequence identity can be achieved in various ways that are within the skill in the art can determine appropriate parameters for measuring alignment, including assigning algorithms needed to achieve maximal alignment over the full- length sequences being compared. For purposes herein, percent ammo acid identity values can be obtained using the sequence comparison computer program, ALIGN-2, which was authored by Genentech, Inc. and the source code of which has been filed with user documentation m the US Copyright Office, Washington, DC, 20559, registered under the US Copyright Registration No. TXU510087. The ALIGN-2 program is publicly available through Genentech, Inc., South San Francisco, CA. All sequence comparison parameters are set by the ALIGN-2 program and do not vary.
The term "epitope tagged" when used herein reters to a chimeric polypeptide comprising Apo-2, or a domain sequence thereof, fused to a "tag po ypeptide". The tag polypeptide has enough residues to provide an epitope against which an antibody can be made, yet is short enough such that it does not interfere with activity of the Apo-2. The tag polypeptide preferably also is la rly unique so that the antibody does not substantially cross-react with other epitopes. Suitable tag polypeptides generally have at least six am o acid residues and usually between about 8 to about 50 ammo acid residues (preferably, between about 10 to about 20 residues). "Isolated, " when used to describe the various polypeptides disclosed herein, means polypeptide that has been identified and separateα and/or recovered from a component of its natural environment. Contaminant components ot its natural environment are materials that would typically interfere with diagnostic or therapeutic uses for the polypeptide, and may include enzymes, hormones, and other protemaceous or non-protemaceous solutes. In preferred embodiments, the polypeptide will be purified (1) to a degree sufficient to obtain at least 15 residues of N-termmal or internal am o aci sequence y use o a spinning cup sequena or, or o omogenei y by SDS-PAGE under non-reducing or reducing conditions using Coomassie blue or, preferably, silver stain. Isolated polypeptide includes polypeptide m si tu within recombinant cells, since at least one component of the Apo-2 natural environment will not be present. Ordinarily, however, isolated polypeptide will be prepared by at least one purification step.
An "isolated" Apo-2 nucleic acid molecule is a nucleic acid molecule that is identified and separated from at least one contaminant nucleic acid molecule with which it is ordinarily associated m the natural source of the Apo-2 nucleic acid. An isolated Apo-2 nucleic acid molecule is other than in the form or setting in which it is found m nature. Isolated Apo-2 nucleic acid molecules therefore are distinguished from the Apo-2 nucleic acid molecule as it exists in natural cells. However, an isolated Apo-2 nucleic acid molecule includes Apo-2 nucleic acid molecules contained in cells that ordinarily express Apo-2 where, for example, the nucleic acid molecule is in a chromosomal location different from that of natural cells.
The term "control sequences" refers to DNA sequences necessary for the expression of an operably linked coding sequence in a particular host organism. The control seαuences that are suitable for prokaryotes, for example, include a promoter, optionally an operator sequence, and a πbosome binding site. Eukaryotic cells are known to utilize promoters, polyadenylation signals, and enhancers.
Nucleic acid is "operably linked" when it is placed into a functional relationship with another nucleic acid sequence. For example, DNA for a presequence or secretory leader is operably linked to DNA for a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it affects the transcription of the sequence; or a ribosome binding site is operably linked to a coding sequence if it is positioned so as to facilitate translation. Generally, "operably linked" means that the DNA sequences beinα linked are contiguous, and, m the case of a secretory leader, contiguous and m reading phase. However, enhancers do not have to be contiguous. Linking is accomplished by ligation at convenient restriction sites. If such sites oo not exist, the synthetic oligonucleotide adaptors or linkers are used m accordance with conventional practice.
The term "antibody" is used m the broadest sense and specifically covers antι-Apo-2 monoclonal antibodies (including agonist, antagonist, and blocking or neutralizing antibodies) and antι-Apo-2 antibody compositions witn polyepitopic specificit . The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible naturally-occurring mutations that may be present minor amounts. Monoclonal antioodies are highly specific, being directed against a single antigenic site. Furthermore, m contrast to conventional (polyclonal) antibody preparations which typically include different antibodies directed agains i eren e erminan s epi opes , eac monoc ona an i o y is directed against a single determinant on the antigen.
The monoclonal antibodies herein include hybrid and recombinant antibodies produced by splicing a variable (including hypervaπable) domain of an antι-Apo-2 antibody with a constant domain, or a light chain with a heavy chain, or a chain from one species with a chain from another species, or fusions with heterologous proteins, regardless of species of origin or immunoglobulin class or subclass designation, as well as antibody fragments (e.g., Fab, F(ab') , and Fv) , so long as they exhibit the desired biological activity. See, e . g. U.S. Pat. No. 4,816,567 and Mage et al., in Monoclonal Antibody Production Techniques and Applications, pp.79-97 (Marcel Dekker, Inc. : New York, 1987) .
Thus, the modifier "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, the monoclonal antibodies to be used in accordance with the present invention may be made by the hybridoma method first described by Kohler and Milste , Nature, 256: 495 (1975), or may be made by recombinant DNA methods such as described m U.S. Pat. No. 4,816,567. The "monoclonal antibodies" may also be isolated from phage libraries generated using the techniques described in McCafferty et al . , Nature, 348 : 552-554 (1990), for example.
"Humanized" forms of non-human (e.g. murine) antibodies are specific chimeric lmmunoglobulms , immunoglobulin chains, or fragments thereof (such as Fv, Fab, Fab', F(ab')_ or other antigen-bmdmg subsequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies are human lmmunoglobulms (recipient antibody) which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat, or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, the humanized antibody may comprise residues which are found neither m the recipient antibody nor m the imported CDR oi framework sequences. These modifications are made to further refine and optimize antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, m which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FP regions are those of a human immunoglobulin consensus sequence. The humanized antibody optimally also will comprise at least a portion of an immunoglobulin constant region or domain ( Fc ) , typically that of a human immunoglobulin.
The term "cytotoxic agent" as used herein refers to a substance that inhibits or prevents the function of cells and/or causes destruction of cells. The term is intended to include radioactive isotopes (e.g. I1 !, I1" , Y9( and Rel ' ) , chemotherapeutic agents, and toxins such as enzymatically active toxins of bacterial, fungal, plant or animal origin, or variants and/or fragments thereof.
A "chemotherapeutic agent" is a chemical compound useful m the treatment of cancer. Examples of chemotherapeutic agents include adπamycm, doxorubicm, epirubic , 5-fluorouracil, cytosme arabmoside ("Ara-C"), cyclophosphamide, thiotepa, busulfan, cytox , taxoids, e.g. paclitaxel (TAXOLTM, Bristol-Myers Squibb Oncology, Princeton, NJ) , and doxetaxel (Taxotere, Rhδne-Poulenc Rorer, Antony, Rnace), toxotere, methotrexate, cisplatm, melphalan, vmblastme, bleomycm, etoposide, lfosfamide, mitomyc C, mitoxantrone, vmcrist e, vmorelbme, carboplatm, teniposide, daunomyc , carmmomycm, ammopterm, dactmomycm, mitomyc s, esperamicms (see U.S. Pat. No. 4,675,187), melphalan and other related nitrogen mustards. Also included this definition are hormonal agents that act to regulate or inhibit hormone action on tumors such as tamoxifen and onapπstone.
"Biologically active" and "desired biological activity" with respect to an Apo-2 polypeptide for the purposes herein means (1) having the ability to modulate apoptosis (either m an agonistic or stimulatmq manner or in an antagonistic or blocking manner) at least one type of mammalian cell in vivo or e vi vo; (2) having the ability to bind Apo-2 ligand; or (3) having the ability to modulate Apo-2 ligand signaling and Apo-2 ligand activity.
The terms "apoptosis" and "apoptotic activity" are used in a broad sense and refer to the orderly or controlled form of cell death m mammals that is typically accompanied by one or more characteristic cell changes, including condensation of cytoplasm, loss of plasma membrane microvilli, segmentation of the nucleus, degradation of chromosomal DNA or loss of mitochondπal function. This activity can be determined and measured, for instance, by cell viability assays, FACS analysis or DNA electrophoresis, all of which are known in the art . The terms "treating," "treatment," and "therapy" as used herein refer to curative therapy, prophylactic therapy, and preventative therapy.
The terms "cancer", "cancerous" or "malignant" reier tc or describe the physiological condition m mammals that is typically characterized by unreαuiated cell growth. Examples of cancer include but are not limited to, carcinoma, Ivmphomα, blastoma, sarcoma, and leukemia
More particular examples or such cancers include squamous cell cancel, small-cell lunq cancer, non-small cell lung cancer, blastoma, gastrointestinal cancel, renal cancer, pancreatic cancer, glioma, neuroblastoma , cervical cancer, ovarian cancer, lung cancer, liver cancer, stomach cancer, bladder cancer, hepatoma, breast cancer, colon cancer, glioblastoma, endometria carcinoma, salivary gland carcinoma, kidney cancer, colorectal cancer, liver cancer, prostate cancer, vulval cancer, thyroid cancer, hepatic carcinoma and various types of head and neck cancer
The term "mammal" as used herein refers to any mammal classified as a mammal, includina humans, cows, horses, dogs and cats. In a preferred embodiment ot tie invention, the mammal is a human. II . Compositions and Methods of the Invention
The present invention provides newly identified and isolated Apo-2 polypeptides and Apo-2 antibodies. In particular, Applicants have identified and isolated various human Apo-2 polypeptides. The properties and characteristics of some of these Apo-2 polypeptides and antι-Aρo-2 antibodies are described m further detail in the Examples below. Based upon the properties and characteristics of tne Apo-2 polypeptides disclosed herein, it is Applicants' present belief that Apo-2 is a member of the TNFR family. A description follows as to how Apo-2 and Apo-2 variants, as well as Apo-2 chimeric molecules and antι-Apo-2 antibodies, may be prepared.
A. Preparation of Apo-2
The description below relates primarily to production of Apo-2 by culturmg cells transformed or transfected with a vector containing Apo-2 nucleic acid. It is of course, contemplated that alternative methods, which are well known m the art, may be employed to prepare Apo-2. 1. Isolation of DNA Encoding Apo-2 The DNA encoding Apo-2 may be obtained from any cDNA library prepared from tissue believed to possess the Apo-2 mRNA and to express it at a detectable level. Accordingly, human Apo-2 DNA can be conveniently obtained from a cDNA library prepared from human tissues, such as the bacteπophage libraries of human pancreas and kidney cDNA described m Example 1. The Apo- 2-encodmg gene may also be obtained from a genomic library or by oligonucleotide synthesis.
Libraries can be screened with probes (such as antibodies to the Apo-2 or oligonucleotides of at least about 20-80 bases) designed to identify the gene of interest or the protein encoded by it. Screening the cDNA or genomic library with the selected probe may be conducted using standard procedures, such as described m Sambrool et al., Molecular Cloning: A Laboratory Manual (New York: Cola Spring Harbor Laboratory Press, 1989) . An alternative means to isolate the gene encoding Apo-2 is to use PCR methodology [Sambrook et al . , supra; Dieffenbach et al., PCR Primer: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 1995)] . A preferred method or screening employs selected oligonucleotide sequences to screen cDNA libraries from various human tissues. Example 1 below describes techniques for screening a cDNA library. The oligonucleotide sequences selected as probes should be of sufficient length and sufficiently unambiguous that false positives are minimized. The oligonucleotide is preferably labeled such that it can be detected upon hybridization to DNA m the library being screened. Methods of labeling are well known m the art, and include the use of radiolabels like P-labeled ATP, biotinylation or enzyme labeling. Hybridization conditions, including moderate stringency ana high stringency, are provided m Sambrook et al., supra . Nucleic acid having all the protein coding sequence may be obtained by screening selected cDNA or genomic libraries using the deduced ammo acid sequence disclosed herein for the first time, and, if necessary, using conventional primer extension procedures as described in Sambrook et al . , supra, to detect precursors and processing intermediates of mRNA that may not have been reverse-transcribed into cDNA.
Apo-2 variants can be prepared by introducing appropriate nucleotide changes into the Apo-2 DNA, or by synthesis of the desired Apo-2 polypeptide. Those skilled m the art will appreciate that amino acid changes may alter post-translational processes of the Apo-2, such as changing the number or position of glycosylation sites or altering the membrane anchoring characteristics . Variations m the native full-length sequence Apo-2 or in various domains of the Apo-2 described herein, can be made, for example, using any of the techniques and guidelines for conservative and non-conservative mutations set forth, for instance, in U.S. Pat. No. 5,364,934. Variations may be a substitution, deletion or insertion of one or more codons encoding the Apo-2 that results in a change the ammo acid sequence of the Apo-2 as compared with the native sequence Apo-2. Optionally the variation is by substitution of at least one ammo acid with any other ammo acid in one or more of the domains of the Apo-2 molecule. The variations can be made using methods known m the art such as oligonucleotide-med ated (site-directed) mutagenesis, alanme scanning, and PCR mutagenesis. Site-directed mutagenesis [Carter et al., Nucl. Acids Res., £3:4431 (1985); Zoller et al . , Nucl . Acids Res., 10:6487 (1982)], cassette mutagenesis [Wells et al., Gene, 34:315 (1985)], restriction selection mutagenesis [Wells et al., Philos. Trans. R. Soc. London SerA, 317:415 (1986)] or other known techniques can be performed on the cloned DNA to produce the Apo-2 variant DNA.
Scanning amino acid analysis can also be employed to identify one or more ammo acids along a contiguous sequence which are involved m the interaction with a particular ligand or receptor. Among the preferred scanning ammo acids are relatively small, neutral ammo acids. Such ammo acids include alanme, glycme, serine, and cysteme. Alanme is the preferred scanning ammo acid among this group because it eliminates the side-chain beyond the beta-carbon and is less likely to alter the main-chain conformation of the variant. Alanme is also preferred because it is the most common ammo acid. Further, it is frequently found m both buried and exposed positions [Creighton, The Proteins, (W.H. Freeman & Co., N.Y.); Chothia, J. Mol. Biol., 105:1 (1976) J. If alanme substitution does not yield adequate amounts of variant, an isoteric ammo acid can be used.
Once selected Apo-2 variants are produced, they can be contacted with, for instance, Apo-2L, and the interaction, if any, can be determined. The interaction between the Apo-2 variant and Apo-2L can be measured by an in vi tro assay, such as described n the Examples below. While any number of analytical measurements can be used to compare activities and properties between a native sequence Apo-2 and an Apo-2 variant, a convenient one for binding is the dissociation constant K of the complex formed between the Apo- 2 variant and Apo-2L as compared to the Kd for the native sequence Apo-2.
Generally, a > 3-fold increase or decrease m Kd per substituted residue in ica es t at t e su stitute resi ue (s is active m t e interaction o e native sequence Apo-2 with the Apo-2L.
Optionally, representative sites m the Apo-2 sequence suitable for mutagenesis would include sites within the extracellular domain, and particularly, within one or both of the cysteme-πch domains. Such variations can be accomplished using the methods described above.
As described m the Examples below, the crystal structure of the complex between Apo-2 ligand and an extracellular domain sequence of Apo-2 receptor has been determined. Apo-2 resembles TNFRl m overall structure with relatively little defined secondary structure. It is tethered into an elongated shape by a series of seven disulfide bridges, six of which are found m subdomams of Apo-2 (residues 43-84 and 85-130, respectively; see Fig. 1, SEQ ID N0:1) that correspond structurally to the second and third CRDs of the TNFRl receptor. The first disulfide bridge of Apo-2, between residues 28 and 41 (Fig. 1; SEQ ID NO:l), corresponds to the last disulfide bridge (between Cys 33 and Cys 52) m CRD1 of TNFRl, while the first 21 residues of Apo-2 are disordered. Thus, Apo-2 residues 1-42, 43-85, and 86-130 (Fig. 1; SEQ ID NO:l) form analogous subdomams to CRD1, CRD2 and CRD3 of TNFRl. The three copies of Apo-2 m the complex are very similar to each other, with the exception of the C-termmal portion of CRD3 (residues 104-130; Fig. 1; SEQ ID N0:1), which exhibits a rigid-body variation m orientation. The two loops that form most of the contacts with the ligand have very similar conformations all three copies.
Unlike the TNF-beta-TNFRl complex, where the C-termmal subdomam of the receptor was disordered, the C-termmal residues of Apo-2 are well ordered up to residue 128 m one copy (the " R" chain) and up to residue 130 the other two (the " S" and " T" chains) . Residue 130 is predicted to be the final extracellular residue before the putative single transmembrane helι> connecting the receptor to its mtracellular death domain. In the complex as described m Example 21 below, the C-termmi of the receptors form a triangle approximately 50 A on a side. Intπgumgiy , this same spacing is also found for the receptor binding sites on the TRAF-2 tπmer, which is known to interact with the mtracellular portions or some TNFR family members (albeit not with DR4 or Apo-2) (Park et al., Nature, 39£:533-538 (1999^; McWnirter et al., Proc. Natl. Acad. Sci., 96:8408-8^13 (1999)). This suggests that the observed extracellular geometry could ot propagated through the rigid transmembrane helix to the death domains, and that this spacing may be important for proper triggering of the mtracellular apoptotic cascade. The interface of the Apo-2 lιgand/Apo-2 complex is divided into two patches- patch A and patch B. The dominant characteristic of patch B tne Apo-2L/Apo-2 interface is the interaction between Tyr 216 of Apo-2L (using the numbermq of the amino aciα sequence for Apo-2L provided m Pitti et al., J. Biol. Chem., 271: 12687-12690 (1996)) and the 50s loop of the Apo-2 receptor. Residue Tyr 216 is conserved m many of the TNF superfamily ligands (including TNF-alpha, TNF-beta, FasL and OPGL), while other members have a similar large hydrophobic residue at this position. Mutagenesis studies on TNF-a pha, TNF-beta, FasL and Apo-2L have all shown that this residue is critical for binding (Schneider et al . , J. Biol . Chem. , £72:18827-18833 (1997); Goh et al., Protein Eng., _4:785-791 (1991); Yamagishi et al . , Protein Eng., 3:713-719 (1990); Van Ostade et al., Protein Eng. , 7:5-22 (1990); Hymowitz et al., personal communication). The interactions of the tyrosme side chain are conserved between the Apo- 2L/Apo-2 and TNF-beta-TNFRl complexes. Moreover, the backbone conformation of the 50s loop of the receptor, which forms the binding pocket for the side chain, is virtually identical between Apo-2 and the TNFRl (rmsd of only 0.35 between the C-alpha atoms of residues 51 to 62) . Additionally, the length of this loop is conserved among the different TNF receptor superfamily members. It is believed that this loop may function as a general hydrophobic binding patch interacting with conserved hydrophobic features on the ligand which may help properly orient the upper part of the receptor for more specific contacts mediated by CRD3.
In contrast to the conserved interactions patch B, patch A near the bottom of the interface involves interactions made by the 90s loop on CRD3 of Apo-2, which has a completely different conformation than the corresponding loop m tne TNFRl . In patch B, it is believed that the 50s loop of the receptor and
Apo-2 ligand residue 216 provide a hydrophobic patch generally important for binding, whereas m patch A, the receptor 90s loop and the Apo-2 ligand residue at or near position 205 control the specificity and cross- reactivity. Based on the structure identified by Applicants, the 50s loop and the 90s loop of the Apo-2 receptor are expected to carry most of the ligand-bindmg determinants. Optionally, the Apo-2 variants of the invention will retain or possess native sequence ammo acid residues (as provided m Figure 1) m the 50s and/or 90s loop. It is contemplated that Apo-2 may be mutateα (by insertion, deletion, and/or substitution) in certain aspects which will affect ligand binding. The histidine and phenylalanme residues at positions 53 and 59, respectively, of the Apo-2 sequence are both relatively large residues. These two residues are believed to contact residues Asp218 and Serl59 of the Apo-2 ligand; thus introducing larger side chains at the 53 and 59 positions of the Apo-2 sequence may adversely affect Apo-2L affinity for Apo-2 (but improve affinity tor DR4 ^ . Similar mutations may be accomplished at positions 6 , 65, and/or 104 of the Apo-2 sequence. Mutations in any one or all of the Apo-2 residues at positions 50 through 62 may affect binding of ammo acid residues at or near residue Tyr216 of the Apo-2L sequence, while mutations m any one or all of the Apo-2 residues at positions 65 through 69, 90 through 104, 10b, 111, or 122 may affect binding ot ammo acid residues at or near residue Gln205 of Apo-2 ligand. It is contemplated that mutations at such residue vs) may enhance or decrease interactions (such as binding) with Apo-2 ligand. 2. Insertion of Nucleic Acid into A Replicable Vector
The nucleic acid (e.g., cDNA or genomic DNA) encoding Apo-2 may be inserted into a replicable vector for further cloning (amplification of the DNA) or for expression. Various vectors are publicly available. The vector components generally include, but are not limited to, one or more of the following: a signal sequence, an origin of replication, one or more marker genes, an enhancer element, a promoter, and a transcription termination sequence, each of which is described below.
(1) Signal Sequence Component The Apo-2 may be produced recomb antly not only directly, but also as a fusion polypeptide with a heteroloqous polypeptide, which may be a signal sequence or other polypeptide having a specific cleavage site at the N- terminus of the mature protein or polypeptide. In general, the signal sequence may be a component of the vector, or it may be a part of the Apo-2 DNA that is inserted into the vector. The heterologous signal sequence selected preferably is one that is recognized and processed ( i . e . , cleaved by a signal peptidase) by the host cell. The signal sequence may be a prokaryotic signal sequence selected, for example, from the group of the alkaline phosphatase, pemcillmase, lpp, or heat-stable enterotoxm II leaders. For yeast secretion the signal sequence may be, e.g., the yeast vertase leader, alpha factor leader (including Saccharomyces and
Kl uyveromyces cfXactor leaders, the latter described m U.S. Pat. No. 5,010,182), or acid phosphatase leader, the C. albi cans glucoamylase leader (EP 362,179 published 4 April 1990), or the signal described m WO 90/13646 published 15 November 1990. In mammalian cell expression the native Apo-2 presequence that normally directs insertion of Apo-2 in the cell membrane of human cells in vi vo is satisfactory, although other mammalian signal sequences may be used to direct secretion of the protein, such as siqnal sequences from secreted polypeptides of the same or related species, as well as viral secretory leaders, for example, the herpes simplex glycoprotem D signal.
Ihe DNA for such precursor region is preferably ligated m reading frame to DNA encoding Apo-2. (ii) Origin of Replication Component
Both expression and cloning vectors contain a nucleic acid sequence that enables the vector to replicate in one or more selected host cells. Generally, m cloning vectors this sequence is one that enables the vector to replicate independently of the host chromosomal DNA, and includes origins ol replication or autonomously replicating sequences. Such sequences are well known for a variety of bacteria, yeast, and viruses. The origin of replication from the plasmid pBR322 is suitable for most Gram-negative bacteria, the 2μ plasmid origin is suitable for yeast, and various viral origins (SV40, po yoma, adenovirus, VSV or BPV) are useful for cloning vectors m mammalian cells. Generally, the origin of replication component is not needed for mammalian expression vectors (the SV40 origin may typically be used because it contains the early promoter) .
Most expression vectors are "shuttle" vectors, i.e., they are capable of replication m at least one class of organisms but can be transfected into another orqanism for expression. For example, a vector is cloned m E . cc and then the same vector is transfected into yeast or mammalian cells for expression even though it is not capable of replicating independently of the host cell chromosome.
DNA may also be amplified by insertion into the host genome. This is readily accomplished using Ba cill us species as hosts, for example, by including m the vector a DNA sequence that is complementary to a sequence found in Bacill us genomic DNA. Transfection of Bacill us with this vector results in homologous recombination with the genome and insertion of Apo-2 DNA. However, the recovery of genomic DNA encoding Apo-2 is more complex than that of an exogenously replicated vector because restriction enzyme digestion is required to excise the Apo-2 DNA.
(in) Selection Gene Component Expression and cloning vectors typically contain a selection gene, also termed a selectable marker. This gene encodes a protein necessary for the survival or growth of transformed host cells grown in a selective culture medium. Host cells not transformed with the vector containing the selection gene will not survive in the culture medium. Typical selection genes encode proteins that (a) confer resistance to antibiotics or other toxins, e.g., ampicillm, neomycin, methotrexate, or tetracyclme, (b) complement auxotrophic deficiencies, or (c) supply critical nutrients not available from complex media, e.g., the gene encoding D-alanme racemase for Ba cill i .
One example of a selection scheme utilizes a drug to arrest growth of a host cell. Those cells that are successfully transformed with a heterologous gene produce a protein conferring drug resistance and thus survive the selection regimen. Examples of such dominant selection use the drugs neomycin [Southern et al., J. Molec. Appl . Genet., £:327 (1982)], mycophenolic acid (Mulligan et al . , Science, 209 : 1422 (1980)] or hygromycin [Sugden et al . , Mol. Cell. Biol., 5:410-413 (1985)]. The three examples given above employ bacterial genes under eukaryotic control to convey resistance to the appropriate drug G418 or neomycin (genetic ), xgpt (mycophenolic acid), or hygromycin, respectively.
Another example of suitable selectable markers for mammalian cells are those that enable tne identification of cells competent to take up the Apo-2 nucleic acid, such as DHFR or thymidme kmase. The mammalian cell transformants are placed under selection pressure that only the transformants are uniquely adapted to survive by virtue of having taken up the marker.
Selection pressure is imposed by culturing the transformants under conditions in which the concentration of selection agent m the medium is successively changed, thereby leading to amplification of both the selection gene and the DNA that encodes Apo-2. Amplification is the process by which genes m greater demand for the production of a protein critical for growth are reiterated tandem within the chromosomes of successive generations of recombinant cells. Increased quantities of Apo-2 are synthesized from the amplified DNA. Other examples of ampliflable genes include metallothionein-I and -II, adenosine deaminase, ana ormthme decarboxylase . Cells transformed with the DHFR selection gene may first oe identified by culturing all of the transformants a culture medium that contains methotrexate (Mtx) , a competitive antagonist of DHFR. An appropriate ost ce w en wi -type DHFR is employed is the C inese amster ovary H cell line deficient m DHFR activity, prepared and propagated as described by Urlaub et al., Proc. Natl. Acad. Sci. USA, 77:4216 (1980). The transformed cells are then exposed to increased levels of methotrexate. This leads to the synthesis of multiple copies of the DHFR gene, and, concomitantly, multiple copies of other DNA comprising the expression vectors, such as the DNA encoding Apo-2. This amplification technique can be used with any otherwise suitable host, e.g., ATCC No. CCL61 CHO-K1, notwithstanding the presence of endogenous DHFR if, for example, a mutant DHFR gene that is highly resistant to Mtx is employed (EP 117,060).
Alternatively, host cells (particularly wild-type hosts that contain endogenous DHFR) transformed or co-transformed with DNA sequences encoding Apo-2, wild-type DHFR protein, and another selectable marker such as ammoglycoside 3 ' -phosphotransferase (APH) can be selected by cell growth medium containing a selection agent for the selectable marker such as an ammoglycosidic antibiotic, e.g., kanamycm, neomycin, or G418. See U.S. Patent No. 4, 965, 199.
A suitable selection gene for use m yeast is the trpl gene present m the yeast plasmid YRp7 [Stmchcomb et al., Nature, 282:39 (1979); Kmgsman et al., Gene, 7:141 (1979); Tschumper et al., Gene, £0:157 (1980)]. The trpl gene provides a selection marker for a mutant strain of yeast lacking the ability to grow m tryptophan, for example, ATCC No. 44076 or PEP4-1 [Jones, Genetics, £5:22-33 (1977)]. The presence of the trpl lesion the yeast host cell genome then provides an effective environment for detecting transformation by growth in the absence of tryptophan. Similarly, Leu2- deficient yeast strains (ATCC 20,622 or 38,626) are complemented by known plasmids bearing the Leu2 gene.
In addition, vectors derived from the 1.6 μm circular plasmid pKDl can be used for transformation of Kl uyveromyces yeasts [Bianchi et al . , Cur . Genet . , £2:185 (1987)]. More recently, an expression system for large-scale production of recombinant calf chvmosm was reported for K. la ctis [Van den Berg, Bio/Technology, 8:135 (1990)]. Stable multi-copy expression vectors for secretion of mature recombinant human serum albumin by industrial strains of Kl uyveromvces have also been disclosed [Fleer et al., Bio/Technology, 9:968- 975 (1991) ] .
(iv ■ Promoter Component Expression and cloning vectors usually contain a promoter that is recognized by the host organism and is operably linked to the Apo-2 nucleic acid sequence. Promoters are untranslated sequences located upstream (5') to the start codon of a structural gene (generally within about 100 to 1000 bp) that control the transcription and translation of particular nucleic acid sequence, such as the Apo-2 nucleic acid sequence, to which they are operably linked. Such promoters typically fall into two classes, inducible and constitutive. Inducible promoters are promoters that initiate mcieased levels of transcription from DNA under their control in response to some change m culture conditions, e.g., the presence or absence of a nutrient or a chanqe temperature. At this time a larqe number of promoters recognized by a variety o potentia ost ce s are we nown. ese promo ers are operably linked to Apo-2 encoding DNA by removing the promoter from the source DNA by restriction enzyme digestion and inserting the isolated promoter sequence into the vector. Both the native Apo-2 promoter sequence and many heterologous promoters may be used to direct amplification and/or expression of the Apo-2 DNA.
Promoters suitable for use with prokaryotic hosts include the β- lactamase and lactose promoter systems [Chang et al . , Nature, 275 : 17-624 (1978); Goeddel et al., Nature, ££1:544 (1979)], alkaline phosphatase, a tryptophan (trp) promoter system [Goeddel, Nucleic Acids Res., £:4057 (1980); EP 36,776], and hybrid promoters such as the tac promoter [deBoer et al., Proc. Natl. Acad. Sci. USA, £0:21-25 (1983)]. However, other known bacterial promoters are suitable. Their nucleotide sequences have been published, thereby enabling a skilled worker operably to ligate them to DNA encoding Apo- 2 [Siebenlist et al., Cell, £0:269 (1980)] using linkers or adaptors to supply any required restriction sites. Promoters for use m bacterial systems also will contain a Shme-Dalgarno (S.D.) sequence operably linked to the DNA encoding Apo-2.
Promoter sequences are known for eukaryotes. Virtually all eukaryotic genes have an AT-πch region located approximately 25 to 30 bases upstream from the site where transcription is initiated. Another sequence found 70 to 80 bases upstream from the start of transcription of many genes is a CXCAAT region where X may be any nucleotide. At the 3' end of most eukaryotic genes is an AATAAA sequence that may be the signal for addition of the poly A tail to the 3' end of the coding sequence. All of these sequences are suitably inserted into eukaryotic expression vectors.
Examples of suitable promoting sequences for use with yeast hosts include the promoters for 3-phosphoglycerate kmase [Hitzeman et al., J. Biol. Chem. , 255 : 12073 (1980)] or other glycolytic enzymes [Hess et al . , Adv. Enzyme Reg. , 7:149 (1968); Holland, Biochemistry, £7:4900 (1978)], such as enolase, glyceraldehyde-3-pnospnate dehydrogenase, hexok ase, pyruvate decarboxylase, phosphofructokmase, qlucose-6-phosphate isomerase, 3-phosphoglycerate mutase, pyruvate kmase, triosephosphate isomerase, phosphoglucose isomerase, and glucokmase . Other yeast promoters, which are inducible promoters having the additional advantage of transcription controlled by growth conditions, are the promoter regions for alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, deqradative enzymes associated with nitrogen metabolism, metallothionem, glyceraldehyde-3-phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Suitable vectors and promoters for use m yeast expression are rurther described in EP 73,657. Yeast enhancers also are advantageously used with yeast promoters.
Apo-2 transcription from vectors mammalian host cells is controlled, for example, by promoters obtained from the genomes of viruses such as polyoma virus, fowlpoy virus (UK 2,211,504 published 5 July 1989), adenovirus (such as Adenovirus 2), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis-B virus and most preferably Simian Virus 40 (SV40), from heterologous mammalian promoters, e . g. , the act promoter or an immunoglobulin promoter, from heat-shock promoters, and from the promoter normally associated with the Apo-2 sequence, provided such promoters are compatible with the host cell systems. The early and late promoters of the SV40 virus are conveniently obtained as an SV40 restriction fragment that also contains the SV40 viral origin of replication [Fiers et al., Nature, 273 : 113 (1978); Mulligan and Berg, Science, 209:1422-1427 (1980); Pavlakis et al . , Proc. Natl. Acad. Sci. USA, 78:7398-7402 (1981)]. The immediate early promoter of the human cytomegalovirus is conveniently obtained as a H dlll E restriction fragment [Greenaway et al., Gene, £8:355-360 (1982)]. A system for expressing DNA m mammalian hosts using the bovme papilloma virus as a vector is disclosed m U.S. Patent No. 4,419,446. A modification of this system is described in U.S. Patent No. 4,601,978 [See also Gray et al . , Nature, 295:503-508 (1982) on expressing cDNA encoding immune mterferon m monkey cells; Reyes et al., Nature, 297 : 598-601 (1982) on expression of human β-mterferon cDNA in mouse cells under the control of a thymidme kinase promoter from herpes simplex virus; Canaani and Berg, Proc. Natl. Acad. Sci. USA 79:5166-5170 (1982) on expression of the human mterferon gene m cultured mouse and rabbit cells; and Gorman et al., Proc. Natl. Acad. Sci. USA, 79:6777-6781 (1982) on expression of bacterial CAT sequences m CV-1 monkey kidney cells, chicken embryo fibroblasts, Chinese hamster ovary cells, HeLa cells, and mouse NIH-3T3 cells using the Rous sarcoma virus long terminal repeat as a promoter] .
(v) Enhancer Element Component
Transcription of a DNA encoding the Apo-2 of this invention by higher eukaryotes may be increased by inserting an enhancer sequence into the vector. Enhancers are cis-act q elements of DNA, usually about from 10 to 300 bp, that act on a promoter to increase its transcription. Enhancers are relatively orientation and position independent, having been found 5' [Laimms et al., Proc. Natl. Acad. Sci. USA, 78:464-468 (1981]) and 3' [Lusky et al . , Mol . Cell Bio. , 3:1108 (1983]) to the transcription unit, within an intron [Banerji et al., Cell, £3:729 (1983)], as well as within the coding sequence itself [Osborne et al., Mol. Cell Bio., 4:1293 (1984)]. Many enhancer sequences are now known from mammalian genes (globm, elastase, albumin, α~ fetoprotem, and insulin) . Typically, however, one will use an enhancer from a eukaryotic cell virus. Examples include the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers. See also Yaniv, Nature, 297 : 17-18 (1982) on enhancing elements for activation of eukaryotic promoters. The enhancer may be spliced into the vector at a position 5' or 3' to the Apo-2 coding sequence, but is preferably located at a site 5' from the promoter.
(vi ) Transcription Termination Component Expression vectors used eukaryotic host cells (yeast, fungi, insect, plant, animal, human, or nucleated cells from other multicellular will also contain sequences necessary for the termination of transcription and for stabilizing the mRNA. Such sequences are commonly available from the 5' and, occasionally 3', untranslated regions of eukaryotic or viral DNAs or cDNAs . These regions contain nucleotide segments transcribed as polyadenylated fragments the untranslated portion of the mRNA encoding Apo-2.
(vn) Construction and Analysis of Vectors Construction of suitable vectors containing one or more of the above-listed components employs standard ligation techniques. Isolated plasmids or DNA fragments are cleaved, tailored, and re-ligated in the form desired to generate the plasmids required.
For analysis to confirm correct sequences plasmids constructed, the ligation mixtures can be used to transform E. col l K12 strain 294 (ATCC 31,446) and successful transformants selected by ampicillm or tetracycline resistance where appropriate. Plasmids from the transformants are prepared, analyzed by restriction endonuclease digestion, and/or sequenced by the method of Messing et al., Nucleic Acids Res., 9:309 (1981) or by the method of Maxam et al., Methods m Enzymology, 65:499 (1980).
(vm) Transient Expression Vectors Expression vectors that provide for the transient expression m mammalian cells of DNA encoding Apo-2 may be employed. In general, transient expression involves the use of an expression vector that is able to replicate efficiently in a host cell, such that the host cell accumulates many copies of the expression vector and, m turn, synthesizes high levels of a desired polypeptide encoded by the expression vector [Sambrook et al., supra] ■ Transient expression systems, comprising a suitable expression vector and a host cell, allow for the convenient positive identification of polypeptides encoded by cloned DNAs, as well as for the rapid screening of such polypeptides for desired biological or physiological properties. Thus, transient expression systems are particularly useful m the invention lor purposes of identifying Apo-2 variants.
( lx) Suitable Exemplary Vertebrate Cell Vectors Othei methods, vectors, and host cells suitable for adaptation to the synthesis of Apo-2 m recombinant vertebrate cell culture are described m Gethmq et al . , Nature, £93:620-625 (1981); Mantei et al . , Nature, 281 : 40-46 (1979); EP 117,060; and EP 117,058.
3. Selection and Transformation of Host Cells
Suitable host cells for cloning or expressing the DNA in the vectors herein are the prokaryote, yeast, or higher eukaryote cells described above. Suitable prokaryotes for this purpose include but are not limited to eubacteriα, such as Gram-negative or Gram-positive organisms, for example, Enterobacteπaceae such as Escneπ cnia , e . α . , E . col i , En terobacter, Erwiniα , Klebsiel la , Proteus, Salmonella , e . g . , Salmonella typnimuπ um, erra tia , e . g. , Serra tia marcescans, and Shigella , as well as Bacil l i such as B . subt il is and B. l i cneniformis (e.g., B . l i chenirormis 41P disclosed DD 266,710 published 12 April 1989), Pseudomonas such as P. aeruqmosa , and Strevtomyces .
Preferably, the host cell should secrete minimal amounts or proteolytic enzymes . In addition to prokaryotes, eukaryotic microbes such as filamentous fungi or yeast are suitable cloning or expression hosts for Apo-2- encoding vectors. Sa ccharomyces cerevisiae, or common baker's yeast, is the most commonly used among lower eukaryotic host microorganisms. However, a number of other genera, species, and strains are commonly available and useful herein.
Suitable host cells for the expression of glycosylated Apo-2 are derived from multicellular organisms. Such host cells are capable of complex processing and glycosylation activities. In principle, any higher eukaryotic cell culture is workable, whether from vertebrate or invertebrate culture.
Examples of invertebrate cells include plant and insect cells. Numerous baculoviral strains and variants and corresponding permissive insect host cells from hosts such as Spodoptera frugiperda (caterpillar) , Aedes aegypti (mosquito), Aedes albopictus (mosquito), Drosophila melanogaster (fruitfly), and Bomby mori have been identified [See, e.g., Luckow et al . , Bio/Technology, 6:47-55 (1988); Miller et al . , in Genetic Engineering, Setlow et al., eds., Vol. 8 (Plenum Publishing, 1986), pp. 277-279; and Maeda et al . , Nature, 315 : 592-594 (1985)]. A variety of viral strains for transfection are publicly available, e.g., the L-l variant of Au tographa cal if orni ca NPV and the Bm-5 strain of Bomby mori NPV.
Plant cell cultures of cotton, corn, potato, soybean, petunia, tomato, and tobacco can be utilized as hosts. Typically, plant cells are transfected by incubation with certain strains of the bacterium Agroba cteπ um tumefaciens . During incubation of the plant cell culture with A . tumefaciens, the DNA encoding the Apo-2 can be transferred to the plant cell host such that it is transfected, and will, under appropriate conditions, express the Apo-2- encodmg DNA. In addition, regulatory and signal sequences compatible with plant cells are available, such as the nopalme synthase promoter and polyadenylation signal sequences [Depicker et al., J. Mol. Appl . Gen., £:561 (1982)] . In addition, DNA segments isolated from the upstream region of the T-DNA 780 gene are capable of activating or increasing transcription levels of plant-expressiple genes m recombinant DNA-contammg plant tissue [EP 321,196 published 21 June 1989] .
Propagation of vertebrate cells m culture (tissue culture) is also well known m the art [See, e . g. , Tissue Culture, Academic Press, Kruse and Patterson, editors (1973)]. Examples of useful mammalian host cell lines are monkey kidney CVl line transformed by SV40 (COS-7, ATCC CRL 1651); human embryonic kidney line (293 or 293 cells subcloned for growth m suspension culture, Graham et al . , J. Gen Virol ■ , £6:59 (1977)); baby hamster kidney cells (BHK, ATCC CCL 10); Chinese hamster ovary cellsXDHFR (CHO, Urlaub and Chasm, Proc. Natl. Acad. Sci. USA, 77:4216 (1980)); mouse sertoli cells (TM4, Mather, Biol. Reprod. , £3:243-251 (1980)); monkey kidney cells (CVl ATCC CCL 70); African green monkey kidney cells (VERO-76, ATCC CRL-1587); humar cervical carcinoma cells (HELA, ATCC CCL 2); canme kidney cells (MDCK, ATCC CCL 34); buffalo rat liver cells (BRL 3A, ATCC CRL 1442); human lung cells (W138, ATCC CCL 75); human liver cells (Hep G2, HB 8065); mouse mammary tumor (MMT 060562, ATCC CCL51); TRI cells (Mather et al., Annals N.Y. Acad. Sci., £83:44-68 (1982)); MRC 5 cells; and FS4 cells.
Host cells are transfected and preferably transformed with the above-described expression or cloning vectors for Apo-2 production and cultured m conventional nutrient media modified as appropriate for inducing promoters, selecting transformants, or amplifying the genes encoding the desired sequences.
Transfection refers to the taking up of an expression vector by a host cell whether or not any coding sequences are fact expressed. Numerous methods of transfection are known to the ordinarily skilled artisan, for example, CaP04 and electroporation. Successful transfection is generally recognized when any indication of the operation of this vector occurs within the host cell.
Transformation means introducing DNA into an organism so that the DNA is replicable, either as an extrachromosomal element or by chromosomal integrant. Depending on the host cell used, transformation is done using standard techniques appropriate to such cells. The calcium treatment employing calcium chloride, as described in Sambrook et al., supra, or electroporation is generally used for prokaryotes or other cells that contain substantial cell-wall barriers. Infection with Agrobacteπum tumefaciens is used for transformation of certain plant cells, as described by Shaw et al., Gene, £3:315 (1983) and WO 89/05859 published 29 June 1989. In addition, plants may be transfected using ultrasound treatment as described in WO 91/00358 published 10 January 1991. For mammalian cells without such cell walls, the calcium phosphate precipitation method of Graham and van der Eb, Virology, £2:456-467 (1973) is preferred. General aspects of mammalian cell host system transformations have been described m U.S. Pat. No. 4,399,216. Transformations into yeast are typically carried out according to the method of Van Sol ngen et al., £^ Bact. , ££0:946 (1977) and Hsiao et al., Proc. Natl. Acad. Sci. (USA), 76:3829 (1979). However, other methods tor introducing DNA into cells, such as by nuclear microm ection, electroporation, bacterial protoplast fusion with intact cells, or polycations, e.g., polybrene, polyornith e, may also be used. For various techniques for transforming mammalian cells, see Keown et al., Methods m Enzymology, 185:527-537 (1990) and Mansour et al . , Nature, £36:348-352 (1988) .
4. Culturing the Host Cells
Prokaryotic cells used to produce Apo-2 may be cultured suitable media as described αenerally Sambrook et al., supra . The mammalian host cells used to produce Apo-2 may be cultured m a variety of media. Examples or commercially available media include Ham's F10 (Sigma), Minimal Essential Medium ("MEM", Sigma), RPMI-1640 (Sigma), and Dulbecco's Modified Eagle's Medium ("DMEM", Sigma). Any such media may be supplemented as necessary with hormones and/or other growth factors (such as insulin, transfemn, or epidermal growth factor), salts (such as sodium chloride, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleosides (such as adenosine and thymidme), antibiotics (such as Gentamycm drug) , trace elements (defined as inorganic compounds usually present at final concentrations m the micromolar range), and glucose or an equivalent energy source. Any other necessary supplements may also be included at appropriate concentrations that would be known to those skilled m the art. The culture conditions, such as temperature, pH, and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
In general, principles, protocols, and practical techniques for maximizing the productivity of mammalian cell cultures can be found in Mammalian Cell Biotechnology: a Practical Approach, M. Butler, ed. (IRL Press, 1991) .
The host cells referred to this disclosure encompass cells in culture as well as cells that are within a host animal. 5. Detecting Gene Amplification/Expression Gene amplification and/or expression may be measured in a sample directly, for example, by conventional Southern blotting, Northern blotting to quantitate the transcription of mRNA [Thomas, Proc. Natl. Acad. Sci. USA, £7:5201-5205 (1980)], dot blotting (DNA analysis), or m si tu hybridization, using an appropriately labeled probe, based on the sequences provided herein. Various labels may be employed, most commonly radioisotopes, and particularly J P. However, other techniques may also be employed, such as using biotin- modified nucleotides for introduction into a polynucleotide . The biotin then serves as the site for binding to avidin or antibodies, which may be labeled with a wide variety of labels, such as radionucleotides, fluorescers or enzymes. Alternatively, antibodies may be employed that can recognize specific duplexes, including DNA duplexes, RNA duplexes, and DNA-RNA hybrid duplexes or DNA-prote duplexes. The antibodies m turn may be labeled and the assay may be carried out where the duplex is bound to a surface, so that upon the formation of duplex on the surface, the presence of antibody bound to the duplex can oe detected.
Gene expression, alternatively, may be measured by immunological methods, such as immunohistochemical staining of cells or tissue sections and assay of cell culture or body fluids, to quantitate directly the expression of gene product. With immunohistochemical staining techniques, a cell sample is prepared, typically P\ dehydration and fixation, followed by reaction with labeled antibodies specific for the gene product coupled, where the labels are usually vιsual_y detectable, such as enzymatic labels, fluorescent labels, or luminescent lapels.
Antibodies useful for immunohistochemical staining and/or assay of sample fluids may be either monoclonal or polyclonal, and may be prepared in any mammal. Conveniently, the antibodies may be prepared against a native sequence Apo-2 polypeptide or against a synthetic peptide based on the DNA sequences provided herein or against exogenous sequence fused to Apo-2 DNA and encoding a specific antibody epitope. 6. Purification of Apo-2 Polypeptide
Forms of Apo-2 may be recovered from culture medium or from host cell lysates. If the Apo-2 is membrane-bound, it can be released from the membrane using a suitable detergent solution (e.g. Tπton-X 100) or its extracellular domain may be released by enzymatic cleavage.
When Apo-2 is produced in a recombinant cell other than one of human origin, the Apo-2 is free of proteins or polypeptides of human origin. However, it may be desired to purify Apo-2 from recombinant cell proteins or polypeptides to obtain preparations that are substantially homogeneous as to Apo-2. As a first step, the culture medium or lysate may be centπfuged to remove particulate cell debris. Apo-2 thereafter is purified from contaminant soluble proteins and polypeptides, with the following procedures being exemplary of suitable purification procedures: by fractionation on an ion- exchange column; ethanol precipitation; reverse phase HPLC; chromatography on silica or on a cation-exchange resm such as DEAE; chromatofocusing; SDS-PAGE; ammonium sulfate precipitation; gel filtration using, for example, Sephadex G- 75; and protein A Sepharose columns to remove contaminants such as IgG. Apo-2 variants in which residues have been deleted, inserted, or substituted can be recovered m the same fashion as native sequence Apo-2, taking account of changes m properties occasioned by the variation. For example, preparation of an Apo-2 fusion with another protein or polypeptide, e.g., a bacterial or viral antigen, immunoglobulin sequence, or receptor sequence, may facilitate purification; an lmmunoaffmity column containing antibody to the sequence can be used to adsorb the fusion polypeptide. Other types of affinity matrices also can be used.
A protease inhibitor such as phenyl methyl sulfonyl fluoride (PMSF) also may be useful to inhibit proteolytic degradation during purification, and antibiotics may be included to prevent the growth of adventitious contaminants. One skilled m the art will appreciate that purification methods suitable for native sequence Apo-2 may require modification to account for changes the character of Apo-2 or its variants upon expression m recombinant cell culture. 7. Covalent Modifications of Apo-2 Polypeptides
Covalent modifications of Apo-2 are included within the scope of this invention. One type of covalent modification of the Apo-2 is introduced into the molecule by reacting targeted ammo acid residues of the Apo-2 with an organic deπ\atιzmg agent that is capable of reacting with selected side chains or the N- or C- terminal residues of the Apo-2.
Deπvatization with bifunctional agents is useful for crosslmking Apo-2 to a water-insoluble support matrix or surface for use m the method foi purifying antι-Apo-2 antibodies, and vice-versa. Deπvatization with one or more bifunctional agents will also be useful for crosslmking Apo-2 molecules to generate Apo-2 dimers . Such dimers may increase binding avidity and extend half-life of the molecule in vivo . Commonly used crosslmking agents include, e . g . , 1, 1-bιs ,αιazoacetyl ) -2-phenylethane, glutaraldehyde, N-nydroxy- succmimide esters, for example, esters with 4-azιdosalιcylιc acid, homobifunctional lmidoesters, including disucc imidyl esters such as 3,3'- dithiobis (succiniiridylpropionate ■ , and bifunctional maleimides such as b s-N- maleιmιdo-1, 8-octane . Deπvatizmg agents such as methyl-3- [ (p-azidophenyl ) - dithio] propioimidate yield photoactivatable intermediates that are capable of forming crosslinks m the presence of light. Alternatively, reactive water- msoluble matrices such as cyanogen bromide-activated carbohydrates and the reactive substrates described m U.S. Patent Nos. 3,969,287; 3,691,016; 4,195,128; 4,247,642; 4,229,537; and 4,330,440 are employed for protein immobilization.
Other modifications include deamidation of glutaminyl and asparag yl residues to the corresponding glutamyl and aspartyl residues, respectively, hydroxylation of proline and lysine, phosphorylation of hydroxyl groups of seryl or threonyl residues, methylation of the ~ammo groups of lysine, arginine, and histid e side chains [T.E. Creighton, Proteins :
Structure and Molecular Properties, W.H. Freeman & Co., San Francisco, pp. 79- 86 (1983)], acetylation of the N-termmal amine, and a idation of any C- ter inal carboxyl group. The modified forms of the residues fall within the scope of the present invention. Another type of covalent modification of the Apo-2 polypeptide included within the scope of this invention comprises altering the native glycosylation pattern of the polypeptide. "Altering the native glycosylation pattern" is intended for purposes herein to mean deleting one or more carbohydrate moieties found m native sequence Apo-2, and/or adding one or more glycosylation sites that are not present m the native sequence Apo-2.
Glycosylation of polypeptides is typically either N-lmked or O- J inked. N-lmked refers to the attachment of the carbohydrate moiety to the side chain of an asparagme residue. The tripeptide sequences asparagme-X- seπne and asparagme-X-threonme, where X is any ammo acid except proline, are the recognition sequences for enzymatic attachment of the carbohydrate moiety to the asparagme side chain. Thus, the presence of either of these tripeptide sequences m a polypeptide creates a potential glycosylation site.
0-lmked glycos\ lation refers to the attachment of one of the sugars N- aceylgalactosamme, galactose, or xylose to a hydroxylammo acid, most" commonly serine o1- threonme, although 5-hydroxyprolme or 5-hydroxylysme may also be used.
Addition of glycos lation sites to the Apo-2 polypeptide may be accomplished by altering the ammo acid sequence such that it contains one or more of the above-described tripeptide sequences (for N-lmked glycosylation sites). The alteration may also be made by the addition of, or substitution by, one or more serine or threonme residues to the native sequence Apo-2 (for 0-lmked glycosylation sites). The Apo-2 ammo acid sequence may optionally be altered throuαh changes at the DNA level, particularly by mutating the DNA encoding the Apo-2 polypeptide at preselected bases such that codons are generated that will translate into the desired ammo acids. The DNA mutation (s) mav be made using methods described above and m U.S. Pat. No. 5,364,934, supra.
Anotner means of mcreasinσ the numoer of carbohydrate moieties on the Apo-2 polypeptide is by chemical or enzymatic coupling of glycosides to the polypeptide. Depending on the coupling mode used, the sugar (s) may be attached to (a) arginine and nistidme, (b) free carboxyl groups, (c) free sulfhydryl groups such as those of cysteme, (d) free hydroxyl groups such as those of serine, threonme, or hydroxyprolme, (e) aromatic residues such as those of phenylalanme, tyrosme, or tryptophan, or (f) the amide group of glutamine. These methods are described m WO 87/05330 published 11 September 1987, and in Aplm and Wπston, CRC Crit. Rev. Biochem., pp. 259-306 (1981). Removal of carbohydrate moieties present on the Apo-2 polypeptide may be accomplished chemically or enzymatically or by mutational suostitution of codons encoding for ammo acid residues that serve as targets for glycosylation. For instance, chemical deglycosylation by exposing the polypeptide to the compound trifluoromethanesulfonic acid, or an equivalent compound can result the cleavage of most or all sugars except the linking sugar (N-acetylglucosamme or N-acetylgalactosamme) , while leaving the polypeptide intact. Chemical deglycosylation is described by Sojar, et al., Arch. Biochem. Biophys., 259: 52 (1987) and by Edge et al . , Anal. Biochem., 118 : 131 (1981). Enzymatic cleavage of carbohydrate moieties on polypeptides can be achieved by the use of a variety of endo- and exo-glycosidases as described by Thotakura et al . , Meth. Enzymol., £££:350 (1987).
Glycosylation at potential glycosylation sites may be prevented by the use of the compound tunicamycm as described by Duskin et al . , J. Biol . Chem. , £57:3105 (1982 . Tunicamycm blocks the formation of protem-N- glycoside linkages.
Another type of covalent modification of Apo-2 comprises linking the Apo-2 polypeptide to one of a variety of nonproteinaceous polymers, e.g., polyethylene glycol, polypropylene glycol, or polyoxyalkylenes, in the manner set forth m U.S. Patent Nos. 4,640,835; 4,496,689; 4,301,144; 4,670,417; 4,791, 192 or 4, 179,337.
8. Apo-2 Chimeras
The present invention also provides chimeric molecules comprising Apo-2 fused to another, heterologous polypeptide or ammo acid sequence.
In one emboαiment, the chimeric molecule comprises a fusion of the Apo-2 with a tag polypeptide which provides an epitope to which an anti-tag antibody can selectively bind. The epitope tag is generally placed at the ammo- or carboxyl- terminus of the Apo-2. The presence of such epitope - tagged forms of the Apo-2 can be detected using an antibody against the taq polypeptide. Also, provision of the epitope tag enables the Apo-2 to be readily purified by affinity purification using an anti-taq antibody or another type of affinity matri) that binds to the epitope tag.
Various tao polypeptides and their respective antibodies are well known the art. Examples include the flu HA tag polypeptide and its antibody 12CA5 [Field et al., Mol. Cell. Biol., 8:2159-2165 (1988)]; the c-myc tag and the 8F9, 3C7, 6E10, G4, B7 and 9E10 antibodies thereto et al., Molecular and Cellular Biology, 5:3610-3616 (1985)]; and the Herpes virus glycoprote D iqD) tag and its antibody [Paborsky et ar., Protein Engineering, 3 ( t> * : 7-5o3 (1990)]. Other tag polypeptides include the Flaq- peptide [Hopp et al . , BioTechnology, 6:1204-1210 (1988)]; the KT3 epitope peptide [Martin et al . , Science, 255: 192-194 (1992)]; an α-tubulm epitope peptide [Skinner et al . , J Biol . Chem. , £66:14163-14166 (1991)]; and the T7 gene 10 protein peptide tag [Lut z-Freyermuth et al . , Proc. Natl. Acad. Sci. USA, 87:6393-6397 (1990)]. Once the tag polypeptide has been selected, an antibody thereto can be generated using the techniques disclosed herein.
Generally, epitope-tagged Apo-2 may be constructed and produced according to the methods described above. Epitope-tagged Apo-2 is also described m the Examples below. Apo-2-tag polypeptide fusions are preferably constructed by fusing the cDNA sequence encoding the Apo-2 portion m-frame to the tag polypeptide DNA sequence and expressing the resultant DNA fusion construct in appropriate host cells. Ordinarily, when preparing the Apo-2-tag polypeptide chimeras of the present invention, nucleic acid encoding the Apo-2 will be fused at its 3' end to nucleic acid encoding the N-termmus of the tag polypeptide, however 5' fusions are also possible. For example, a polyhistidme sequence of about 5 to about 10 histidme residues may be fused at the N- terminus or the C- terminus and used as a purification handle in affinity chromatography. Epitope-tagged Apo-2 can be purified by affinity chromatography using the anti-tag antibody. The matrix to which the affinity antibody is attached may include, for instance, agarose, controlled pore glass or poly (styrenedivinyl) benzene . The epitope-tagged Apo-2 can then be eluted from the affinity column using techniques known the art. In another embodiment, the chimeric molecule comprises an Apo-2 polypeptide fused to an immunoglobulin sequence. The chimeric molecule may also comprise a particular domain sequence of Apo-2, such as the extracellular domain sequence of native Apo-2 fused to an immunoglobulin sequence. This includes chimeras m monomeric, homo- or heteromultimeπc, and particularly homo- or heterodimeric, or -tetrameric forms; optionally, the chimeras may be dimeπc forms or homodimeric heavy chain forms. Generally, these assembled lmmunoglobulms will have known unit structures as represented by the following diagrams.
X or A
\ C„ or CL
X or A
\ CH or CL
A
A \.
\
A V„ \_ \
vL
A V \
X
A \
\
A x \
\ c,
A basic four chain structural unit is the form m which IgG, IgD, and IgE exist. A four chain unit is repeated m the higher molecular weight lmmunoglobulms; IgM generally exists as a pentamer of basic four-cham units held together by disulfide bonds. IgA globulin, and occasionally IgG globulin, may also exist m a multimeric form m serum. In the case of multimers, each four chain unit may be the same or different.
The following diagrams depict some exemplary monomer, homo- and heterodimer and homo- and heteromultimer structures. These diagrams are merely illustrative, and the chains of the multimers are believed to be disulfide bonded the same fashion as native lmmunoglobulms. monomer: A C1 or C* homodimer : A
_CL or CH CL or C„
A
heterodimer : A
\_ _CL or C„ _CL or C„ /
A homotetramer : -λ \ cL
\ CL or CH
X or CH
A /
A
A heterotetramer : A \ cL
\ CL or CH
CL or C„
/ CL
/ X
and
A
K \ X
\ CL or CH
CL or C„
/ CL
A / X
In the foregoing diagrams, "A" means an Apo-2 sequence or an Apo-2 sequence fused to a heterologous sequence; X is an additional agent, which may be the same as A or different, a portion of an immunoglobulin superfamily member such as a variable region or a variable region-like domain, including a native or chimeric immunoglobulin variable region, a toxin such a pseudomonas exotoxm or ricin, or a sequence functionally binding to another protein, such as other cytokmes (i.e., IL-1, interferon-γ) or cell surface molecules (i.e., NGFR, CD40, OX40, Fas antigen, T2 proteins of Shope and myxoma poxviruses), or a polypeptide therapeutic agent not otherwise normally associated with a constant domain; Y is a linker or another receptor sequence; and VL, VH, C* and CH represent light or heavy chain variable or constant domains of an immunoglobulin. Structures comprising at least one CRD of an Apo-2 sequence as "A" and another cell-surface protein having a repetitive pattern of CRDs (such as TNFR) as "X" are specifically included. It will be understood that the above diagrams are merely exemplary of the possible structures of the chimeras of the present invention, and do not encompass all possibilities. For example, there might desirably be several different "A"s, "X"s, or "Y"s m any of these constructs. Also, the heavy or light chain constant domains may be originated from the same or different lmmunoglobulms. All possible permutations of the illustrated and similar structures are all within tne scope of the invention herein.
In general, the chimeric molecules can be constructed m a fashion similar to chimeric antibodies m which a variable domain from an antibody of one species is substituted for the variable domain of another species. See, for example, EP 0 125 023; EP 173,494; Munro, Nature, £12:597 (13 December 1984); Neuberger et al., Nature, 312: 604-608 (13 December 1984); Sharon et al., Nature, £09:364-367 (24 May 1984); Morrison et al . , Proc. Nat'l. Acad. Sci. USA, £1:6851-6855 (1984); Morrison et al . , Science, ££9:1202-1207 (1985); Boulianne et al . , Nature, ££2:643-646 (13 December 1984); Capon et al., Nature, ££7:525-531 (1989); Traunecker et al . , Nature, ££9:68-70 (1989).
Alternatively, the chimeric molecules may be constructed as follows. The DNA including a region encoding the desired sequence, such as an Apo-2 and/or TNFR sequence, is cleaved by a restriction enzyme at or proximal to the 3' end of the DNA encoding the mmunoglobulm-like domain (s) and at a point at or near the DNA encoding the N-termmal end of the Apo-2 or TNFR polypeptide (where use of a different leader is contemplated) or at or proximal to the N-terminai coding region for TNFR (where the native signal is employed) . This DNA fragment then is readily inserted proximal to DNA encoding an immunoglobulin light or heavy chain constant region and, if necessary, the resulting construct tailored by deletional mutagenesis. Preferably, the Ig is a human immunoglobulin when the chimeric molecule is intended for m vivo therapy for humans. DNA encoding immunoglobulin light or heavy chain constant regions is known or readily available from cDNA libraries or is synthesized. See for example, Adams et al . , Biochemistry, 19: 2711-2719 (1980); Gough et al., Biochemistry, £9:2702-2710 (1980); Dolby et al., Proc. Natl. Acad. Sci.. USA, 77:6027-6031 (1980); Rice et al . , Proc. Natl. Acad. Sci., 79:7862-7865 (1982); Falkner et al., Nature, £98:286-288 (1982); and Morrison et al., Ann. Rev. Immunol., 2:239-256 (1984).
Further details of how to prepare such fusions are found m publications concerning the preparation of immunoadhesins . Immunoadhesms m general, and CD4-Ig fusion molecules specifically are disclosed m WO 89/02922, published 6 April 1989. Molecules comprising the extracellular portion of CD4, the receptor for human immunodeficiency virus (HIV), linked to IgG heavy chain constant region are known m the art and have been found to have a markedly longer half-life and lower clearance than the soluble extracellular portion of CD4 [Capon et al., supra; Byrn et al., Nature, 344 : 667 (1990)]. The construction of specific chimeric TNFR-IgG molecules is also described m Ashkenazi et al. Proc. Natl. Acad. Sci., £8:10535-10539 (1991); Lesslauer et al. [J. Cell. Biochem. Supplement 15F, 1991, p. 115 (P 432)]; and Peppel and Beutler, J. Cell. Biochem. Supplement 15F, 1991, p. 118 (P 439) ] . B. Therapeutic and Non-therapeutic Uses for Apo-2
Apo-2, as disclosed m the present specification, can be employed therapeutically to induce apoptosis mammalian cells. This therapy can be accomplished for instance, using in vivo or e vivo gene therapy techniques and includes the use of the death domain sequences disclosed herein. The Apo- 2 chimeric molecules (including the chimeric molecules containing an extracellular domain sequence of Apo-2) comprising lmmunoqlobulm sequences can also be employed therapeutically to inhibit apoptosis or NF-KB induction by Apo-2L or by another ligand that Apo-2 binds to.
The Apo-2 of the invention also has utility m non-therapeutic applications. Nucleic acid sequences encoding the Apo-2 may be used as a diagnostic for tissue-specific typing. For example, procedures like in si t u hybridization, Northern and Southern blotting, and PCR analysis may be used to determine whether DNA and/or RNA encoding Apo-2 is present m the cell type(s) being evaluated. Apo-2 nucleic acid will also be useful for the preparation of Apo-2 by the recombinant techniques described herein.
The isolated Apo-2 may be used in quantitative diagnostic assays as a control against which samples containing unknown quantities of Apo-2 may be prepared. Apo-2 preparations are also useful in generating antibodies, as standards m assays for Apo-2 (e.g., by labeling Apo-2 for use as a standard in a radioimmunoassay, radioreceptor assay, or enzyme-lmked immunoassay) , m affinity purification techniques, and competitive-type receptor binding assays when labeleα with, for instance, radioiodme, enzymes, or fluorophores . o i ie orms o the Apo-2, such as t e Apo- -IgG c imeric molecules (lmmunoadhesms ) described above, can be used as immunogens m producing antι-Apo-2 antibodies.
Nucleic acids which encode Apo-2 or its modified forms can also be used to generate either transgenic animals or "knock out" animals which, m turn, are useful m the development and screening of therapeutically useful reagents. A transgenic animal (e.g., a mouse or rat) is an animal having cells that contain a transgene, which transgene was introduced into the animal or an ancestor of the animal at a prenatal, e.g., an embryonic stage. A transgene is a DNA which is integrated into the genome of a cell from which a transgenic animal develops. In one embodiment, cDNA encoding Apo-2 or an appropriate sequence thereof (such as Apo-2-IgG) can be used to clone genomic DNA encoding Apo-2 in accordance with established techniques and the genomic sequences used to generate transgenic animals that contain cells which express DNA encoding Apo-2. Methods for generating transgenic animals, particularly animals such as mice or rats, have become conventional m the art and are described, for example, U.S. Patent Nos. 4,736,866 and 4,870,009. Typically, particular cells would be targeted for Apo-2 transgene incorporation with tissue-specific enhancers. Transgenic animals that include a copy of a transgene encoding Apo-2 introduced into the germ line of the animal at an embryonic stage can be used to examine the effect of increased expression of DNA encoding Apo-2. Such animals can be used as tester animals for reagents thought to confer protection from, for example, pathological conditions associated with excessive apoptosis. In accordance with this facet of the invention, an animal is treated with the reagent and a reduced incidence of the pathological condition, compared to untreated animals bearing the transgene, would indicate a potential therapeutic intervention for the pathological condition. In another embodiment, transgenic animals that carry a soluble form of Apo-2 such as an Apo-2 ECD or an immunoglobulin chimera of such form could be constructed to test the effect of chronic neutralization of Apo-2L, a ligand of Apo-2.
Alternatively, non-human homologues of Apo-2 can be used to construct an Apo-2 "knock out" animal which has a defective or altered gene encoding Apo-2 as a result of homologous recombination between the endogenous gene encoding Apo-2 and altereα genomic DNA encoding Apo-2 introduced into an embryonic cell of the animal. For example, cDNA encoding Apo-2 can be used to clone genomic DNA encoding Apo-2 m accordance with established techniques. A portion of the genomic DNA encoding Apo-2 can be deleted or replaced with another gene, such as a gene encoding a selectable marker which can be used to monitor integration. Typically, several kilobases of unaltered flanking DNA (both at the 5' and 3' ends) are included m the vector [see e.g., Thomas and Capecchi, Cell, ££:503 (1987 for a description of homologous recombination vectors] . The vector is introduced into an embryonic stem cell line (e.g., by electroporation) and cells m which the introduced DNA has homologously recombmed with the endogenous DNA are selecteα [see e.g., Li et al., Cell, £9:915 (1992)]. The selected cells are then injected into a blastocyst of an animal (e.g., a mouse or rat) to form aggregation chimeras [see e.g., Bradley, Teratocarcmomas and Embryonic Stem Cells : A Practical Approach, E. J. Robertson, ed. (IRL, Oxford, 1987), pp. 113-151]. A chimeric embryo can then be implanted into a suitable pseudopregnant female foster animal and the embryo brought to term to create a "knock out" animal. Progeny harboring the homologously recombmed DNA m their germ cells can be identified by standard techniques and used to breed animals m which all cells of the animal contain the homologously recombmed DNA. Knockout animals can be characterized for instance, for their ability to defend against certain pathological conditions and for their development of pathological conditions due to absence of the Apo-2 polypeptide, including for example, development of tumors. C. Antι-Apo-2 Antibody Preparation
The present invention further provides antι-Apo-2 antibodies. Antibodies against Apo-2 may be prepared as follows. Exemplary antibodies include polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies .
1. Polyclonal Antibodies
The Apo-2 antibodies may comprise polyclonal antibodies. Methods of preparing polyclonal antibodies are known to the skilled artisan. Polyclonal antibodies can be raised m a mammal, for example, by one or more injections of an immunizing agent and, if desired, an adjuvant. Typically, the immunizing agent and/or adjuvant will be injected the mammal by multiple subcutaneous or mtrapeπtoneal injections. The immunizing agent may include the Apo-2 polypeptide or a fusion protein thereof. An example of a suitable immunizing agent is an Apo-2-IgG fusion protein, such as an Apo-2 ECD-IgG fusion protein. Cells expressing Apo-2 at their surface may also be employed. It may be useful to conjugate the immunizing agent to a protein known to be lmmunogenic m the mammal being immunized. Examples of such lmmunogenic proteins which may be employed include but are not limited to keyhole limpet hemocyanm, serum albumin, bovme thyroglobulin, and soybean trypsin inhibitor. An aggregating agent such as alum may also be employed to enhance the mammal's immune response. Examples of adjuvants which may be employed include Freund's complete adjuvant and MPL-TDM adjuvant (monophosphoryl Lipid A, synthetic trehalose dicorynomycolate) . The immunization protocol may be selected by one skilled m the art without undue experimentation. The mammal can then be bled, and the serum assayed for antibody titer. If desired, the mammal can be boosted until the antibody titer increases or plateaus.
2. Monoclonal Antibodies
The Apo-2 antibodies may, alternatively, be monoclonal antibodies. Monoclonal antibodies may be prepared using hybridoma methods, such as those described by Kohler and Milstein, supra . In a hybridoma method, a mouse, hamster, or other appropriate host animal, is typically immunized (such as described above) with an immunizing agent to elicit lymphocytes that produce or are capable of producing antibodies that will specifically bind to the immunizing agent. Alternatively, the lymphocytes may be immunized in vi tro .
The immunizing agent will typically include the Apo-2 polypeptide or a fusion protein thereof. An example of a suitable immunizing agent is an Apo-2-IgG fusion protein or chimeric molecule. A specific example of an Apo-2 ECD-IgG immunogen is described in Example 9 below. Cells expressing Apo-2 at their surface may also be employed. Generally, either peripheral blood lymphocytes ("PBLs") are used if cells of human origin are desired, or spleen cells or lymph node cells are used if non-human mammalian sources are desired. The lymphocytes are then fused with an immortalized cell line using a suitable fusing agent, such as polyethylene glycol, to form a hybridoma cell [Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, (1986) pp. 59-103]. Immortalized cell lines are usually transformed mammalian cells, particularly myeloma cells of rodent, bovme and human origin.
Usually, rat or mouse myeloma cell lines are employed. The hybridoma cells may be cultured in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival of the unfused, immortalized cells. For example, if the parental transformed cells lack the enzyme hypoxanthme guanine phosphoπbosyl transferase (HGPRT or HPRT), the culture medium for the hybπdomas typically will include hypoxanthme, ammopterm, and thymidme ("HAT medium"), which substances prevent the growth of HGPRT-deficient cells.
Preferred immortalized cell lines are those that fuse efficiently, support stable high level expression of antibody by the selected antibody- producing cells, and are sensitive to a medium such as HAT medium. More preferred immortalized cell lines are murine myeloma lines, which can be obtained, for instance, from the Salk Institute Cell Distribution Center, San Diego, California and the American Type Culture Collection, Manassas, Virginia. Human myeloma and mouse-human heteromyeloma cell lines also have been described for the production of human monoclonal antibodies [Kozbor, J.
Immunol . , 133 : 3001 (1984); Brodeur et al., Monoclonal Antibody Production
Techniques and Applications, Marcel Dekker, Inc., New York, (1987) pp. 51-63] .
The culture medium in which the hybridoma cells are cultured can then be assayed for the presence of monoclonal antibodies directed against Apo-2. Preferably, the binding specificity of monoclonal antibodies produced by the hybridoma cells is determined by immunoprecipitation or by an in vi tr o binding assay, such as radioimmunoassay (RIA) or enzyme-lmked immunoabsorbent assay (ELISA) . Such techniques and assays are known m the art. The binding affinity of the monoclonal antibody can, for example, be determined by the Scatchard analysis of Munson and Pollard, Anal . Biochem. , £07:220 (1980).
After the desired hybridoma cells are identified, the clones may be subcloned by limiting dilution procedures and grown by standard methods [Goding, supra] . Suitable culture media for this purpose include, for example, Dulbecco's Modified Eagle's Medium and RPMI-1640 medium.
Alternatively, the hybridoma cells may be grown in vi vo as ascites m a mammal .
The monoclonal antibodies secreted by the subclones may be isolated or purified from the culture medium or ascites fluid by conventional immunoglobulin purification procedures such as, for example, protein A- Sepharose, hydroxylapatite chromatography, gel electrophoresis , dialysis, or affinity chromatography . The monoclonal antibodies may also be made by recombinant DNA methods, such as those described m U.S. Patent No. 4,816,567. DNA encoding the monoclonal antibodies of the invention can be readily isolated and sequenced using conventional procedures (e.g., by using oligonucleotide probes that are capable of binding specifically to genes encoding the heavy and light chains of murine antibodies) . The hybridoma cells of the invention serve as a preferred source of such DNA. Once isolated, the DNA may be placed into expression vectors, which are then transfected into host cells such as simian COS cells, Chinese hamster ovary (CHO) cells, or myeloma cells that do not otherwise produce immunoglobulin protein, to obtain the synthesis of monoclonal antibodies m the recombinant host cells. The DNA also may be modified, for example, by substituting the coding sequence for human heavy and light chain constant domains place of the homologous murine sequences [U.S. Patent No. 4,816,567; Morrison et al . , supra] or by covalently joining to the immunoglobulin coding sequence all or part of the coding sequence for a non- lmmunoglobulm polypeptide. Such a non-immunoglobulm polypeptide can be substituted for the constant domains of an antibody of the invention, or can be substituted for the variable domains of one antigen-combmmg site of an antibody of the invention to create a chimeric bivalent antibody. As described m the Examples below, antι-Apo-2 monoclonal antibodies have been prepared. Several of these antibodies have been deposited witn ATCC, as disclosed herein. In one embodiment, the monoclonal antibodies of the invention will have the same biological characteristics as the monoclonal antibodies secreted by the hybridoma cell lme(s) deposited under Accession No. HB-12456, HB-12535, HB-12534, or HB-12536. The term "biological characteristics" is used to refer to the m vi tro and/or in vi vo activities or properties of the monoclonal antibody, such as the ability to specifically bind to Apo-2 or to substantially block, induce or enhance Apo-2 activation. Particular activities and properties of various ant -Apo-2 antibodies are describeα in further detail in the Examples below. lo determine whether a monoclonal antibody has the same specificity as the 3F11.39.7 antibody spec_lιcally disclosed, for instance, one can compare activity m Apo-2 blocking and apoptosis induction assays, such as those described m the Examples below. The monoclonal antibody preferably has the hypervariable region residues of one or more of the above-mentioned ATCC deposited antibodies, e.g., it may comprise a humanized variant. Chimeric and humanized Apo-2 antibodies derived from, constructed from, or containing sequence, regions or domains from any of the above-mentioned deposited antibodies are considered within the scope of the invention. Such chimeric or humanized Apo-2 antibodies may be prepared using techniques known m the art and further described below.
The antibodies of the invention may also comprise monovalent antibodies. Methods for preparing monovalent antibodies are well known m the art. For example, one method involves recombinant expression of immunoglobulin light chain and modified heavy chain. The heavy chain is truncated generally at any point the Fc region so as to prevent heavy chain crosslmking. Alternatively, the relevant cysteme residues are substituted with another ammo acid residue or are deleted so as to prevent crosslmking.
In vi tro methods are also suitable for preparing monovalent antibodies. Digestion of antibodies to produce fragments thereof, particularly, Fab fragments, can be accomplished using routine techniques known in the art. For instance, digestion can be performed using papain. Examples of papain digestion are described m WO 94/29348 published 12/22/94 and U.S. Patent No. 4,342,566. Papain digestion of antibodies typically produces two identical antigen binding fragments, called Fab fragments, each with a single antigen binding site, and a residual Fc fragment. Pepsin treatment yields an F(ab')t fragment that has two antigen combining sites and is still capable of cross-linking antigen.
The Fab fragments produced m the antibody digestion also contain the constant domains of the light chain and the first constant domain (CHi) of the heavy chain. Fab1 fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CH- domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' which the cysteme residue (s) of the constant domains bear a free thiol group. F(ab') antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known. 3. Humanized Antibodies
The Apo-2 antibodies of the invention may further comprise humanized antibodies or human antibodies. Humanized forms of non-human (e.g., murine) antibodies are chimeric lmmunoglobulms, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab') or other antigen-binding subsequences of antibodies) which contain minimal sequence derived from non- human immunoglobulin. Humanized antibodies include human lmmunoglobulms (recipient antibody) in which residues from a complementary determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, afrmity and capacity. In some instances, Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all ol the CDR regions correspond to those of a non-human immunoglobulin and all or substantially all of the FR regions are those of a human immunoglobulin consensus sequence. The humanized antiboαy optimally also will comprise at least a portion of an immunoglobulin constant region (Fc), typically that of α human immunoglobulin [Jones et al., Nature, 321 : 522-525 (1986); Riechmann et al., Nature, £££:323-327 (1988); and Presta, Curr. Op. Struct. Biol., 2:59^- 596 (1992) ] . Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody has one or more ammo acid residues introduced into it from a source which is non-human. These non-human amm^
-3y- acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers [Jones et al., Nature, £21:522-525 (1986); Riech ann et al., Nature, ££2:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)], by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric antibodies (U.S. Patent No. 4,816,567), wherein substantially less than an intact human variable domain has been substituted by the corresponding sequence from a non-human species. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
The choice of human variable domains, both light and heavy, to be used in making the humanized antibodies is very important in order to reduce antigenicity. According to the "best-fit" method, the sequence of the variable domain of a rodent antibody is screened against the entire library of known human variable domain sequences. The human sequence which is closest to that of the rodent is then accepted as the human framework (FR) for the humanized antibody [Sims et al., J. Immunol. , £51:2296 (1993); Chothia and Lesk, J. Mol. Biol., 196: 901 (1987)]. Another method uses a particular framework derived from the consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same framework may be used for several different humanized antibodies [Carter et al . , Proc. Natl. Acad. Sci. USA, £9:4285 (1992); Presta et al., J. Immunol., 151:2623 (1993)]. It is further important that antibodies be humanized with retention of high affinity for the antigen and other favorable biological properties. To achieve this goal, according to a preferred method, humanized antibodies are prepared by a process of analysis of the parental sequences and various conceptual humanized products using three dimensional models of the parental and humanized sequences. Three dimensional immunoglobulin models are commonly available and are familiar to those skilled in the art. Computer programs are available which illustrate and display probable three-dimensional conformational structures of selected candidate immunoglobulin sequences. Inspection of these displays permits analysis of the likely role of the residues m the functioning of the candidate immunoglobulin sequence, i.e., the analysis of residues that influence the ability of the candidate immunoglobulin to bind its antigen. In this way, FR residues can be selected and combined from the consensus and import sequence so that the desired antibody characteristic, such as increased affinity for the target antιgen(s), is achieved. In general, the CDR residues are directly and most substantially involved m influencing antigen binding [see, WO 94/04679 published 3 March 1994] .
Transgenic animals (e.g., mice) that are capable, upon immunization, of producing a full repertoire of human antibodies m the absence ot endogenous immunoglobulin production can be employed. Transfer of the human germ-lme immunoglobulin gene array such germ-lme mutant mice will result m the production of human antibodies upon antigen challenge [see, e.g., Jakobovits et al., Proc. Natl. Acad. Sci. USA, 90:2551-2555 (1993); Jakobovits et al . , Nature, 362 : 255-258 (1993); Bruggemann et al., Year m Immuno . , 7:33 (1993)]. Human antibodies can also be produced m phage display libraries [Hoogenboom and Winter, J. Mol. Biol., 227:381 (1992); Marks et al., J. Mol. Biol., 222:581 (1991)]. The techniques of Cole et al. and Boerner et al. are also available for the preparation of human monoclonal antibodies (Cole et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Liss, p. 77 (1985) and Boerner et al . , J. Immunol., 147 (I) :86-95 (1991)].
4. Bispecific Antibodies
Bispecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at least two different antigens. In the present case, one of the binding specificities is for the Apo-2, the other one is for any other antigen, and preferably for a cell-surface protein or receptor or receptor subunit.
Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-cham/light-cham pairs, where the two heavy chains have different specificities [Milstem and Cuello, Nature, 305 : 537-539 (1983)]. Because of the random assortment of immunoglobulin heavy and light chains, these hybridomas (quadromas) produce a potential mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in WO 93/08829, published 13 May 1993, and m Traunecker et al . , EMBO J. , 10:3655-3659 (1991).
According to a different and more preferred approach, antibody variable domains with the desired binding specificities (antibody-antigen combining sites) are fused to immunoglobulin constant domain sequences. The fusion preferably is with an lmmunoqlobulm heavy-chain constant domain, comprising at least part of the ninge, CH2, and CH3 regions. It is preferred to have the firs'" heavy-chair constant region (CHI) containing the s te necessary for light-chain binding present m at least one of the fusions. DNAs encoding the immunoglobulin heavy-chain fusions and, if desired, the immunoglobulin liαht chair, are inserted into separate expression vectors, and are co-transfected into α suitable host orαanism. This provides for great flexibility m adjusting the mutual proportions of the three polypeptide fragments m embodiments when unequal ratios of the three polypeptide chains used the construction provide the optimum yields. It is, however, possible to insert the coding sequences for two or all three polypeptide chains m one expression vector when tre expression of at least two polypeptide chains m equal ratios results m nigh yields or when the ratios are of no particular significance. In a preferred embodiment of this approach, the bispecific antibodies are composed or a hybrid immunoglobulin heavy chain with a first binding specificity m one arm, and a hybrid immunoglobulin heavy-cham/light- chain pair (providing a second binding specificity) m the other arm. It was found that this asymmetric structure facilitates the separation of the desired bispecific compound from unwanted immunoglobulin chain combinations, as the presence of an immunoglobulin light chain m only one half of the bispecific molecule provides for a facile way of separation. This approach is disclosed WO 94/04690 published 3 March 1994. For further details of generating bispecific antibodies see, for example, Suresh et al., Methods m Enzymology, 121:210 (1986).
5. Heteroconjugate Antibodies
Heteroconjugate antibodies are also within the scope of the present invention. Heteroconjugate antibodies are composed of two covalently joined antibodies. Such antibodies have, for example, been proposed to target immune system cells to unwanted cells [US Patent No. 4,676,980], and for treatment of HIV infection [WO 91/00360; WO 92/20373; EP 03089] . It is contemplated that the antibodies may be prepared m vi tro using known methods m synthetic protein chemistry, including those involving crosslmking agents. For example, lmmunotox s may be constructed using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include lm othiolate and methyl-4-mercaptobutyπmιdate and those disclosed, for example, m U.S. Pat. No. 4,676,980.
6. Triabodies Triabodies are also within the scope of the invention. Such antibodies are described for instance m Iliades et al., FEBS Letters, 409:437-441 (1997) and Kortt et al., Protein Engineering, 10:423-433 (1997).
7. Conjugates
The invention also pertains to lmmunoconj ugates comprising Apo-2 antibody described herein conjugated to a cytotoxic agent such as a chemotherapeutic agent, toxin (e.g. an enzymatically active toxin of bacterial, fungal, plant or animal origin, or fragments thereof), or a radioactive isotope ( i . e . , a radioconj ugate ) . Chemotherapeutic agents useful in the geneiation of such lmmunoconj ugates have been described above. Enzymatically active toxins and fragments thereof which can be used include diphtheria A chain, nonbmding active fragments of diphtheria toxin, exotoxm A chain (from Pseudomona s aeruqmosa ) , πcm A chain, abπn A chain, modeccm A chain, alpha-sarcm, Al euπ tes fordn proteins, dianthin proteins, Pnytol a ca ameπ cana proteins (PAPI, PAPII, and PAP-S), momordica charantia inhibitor, curcm, crotrn, sapaonaπa officmalis inhibitor, gelomn, mitogellm, restrictocm, phenomyc , enomycm and the tricothecenes . A variety of radionuclides are available for the production of radioconjugate antibodies. Examples include 1_Bι, JJI, 1 ]In, qX and lbϋRe. Conjugates of the antibody and cytotoxic agent may be made using a variety of bifunctional protein coupling agents such as N-succmιmιdyl-3- ( 2- pyπdyldithiol ) propionate (SPDP), lmmothiolane (IT), bifunctional derivatives of imidoesters (such as dimethyl adipimidate HCL) , active esters (such as disuccmimidyl suberate), aldehydes (such as glutareldehyde ) , bis- azido compounds (such as bis (p-azidobenzoyl ) hexanediamme), bis-diazonium derivatives (such as bis- (p-diazoniumbenzoyl ) -ethylenediamme) , dnsocyanates (such as tolyene 2, 6-dιιsocyanate) , and bis-active fluorine compounds (such as 1, 5-dιfluoro-2, 4-dmιtrobenzene) . For example, a πcin lmmunotoxm can be prepared as described in Vitetta et al . Science, 238:1098 (1987) . Carbon-14-labeled l-ιsothιocyanatobenzyl-3-methyldιethylene triammepentaacetic acid (MX-DTPA) is an exemplary chelatmg agent for conjugation of radionucleotide to the antibody. See WO94/11026.
In another embodiment, the antibody may be conjugated to a "receptor" (sucn streptavidin) for utilization m tumor pretargetmg wherein the antibody-receptor conjugate is administered to the mammal, followed by removal of unbound conjugate from the circulation using a clearing agent and then administration of a "ligand" (e.g. avidm) which is conjugated to a cytotoxic agent (e.g. a radionucleotide) .
Immunoliposomes comprising Apo-2 antibody may also be prepared. Liposomes containing the antibody are prepared by methods known in the art, such as described Epstein et a l . , Proc. Natl. Acad. Sci. USA, 82:3688 (1985); Hwang et a l . , Proc. Natl Acad. Sci. USA, 77:4030 (1980); and U.S. Pat. Nos. 4,485,045 and 4,544,545. Liposomes with enhanced circulation time are disclosed m U.S. Patent No. 5,013,556.
Particularly useful liposomes can be generated by the reverse phase evaporation method with a lipid composition comprising phosphatidylchol e , cholesterol and PEG-deπvatized phosphatidylethanolamme (PEG-PE).
Liposomes are extruded through filters of defined pore size to yield liposomes with the desired diameter. Fab' fragments of the antibody of the present invention can be conjugated to the liposomes as described Martin et al . J. Biol. Chem. 257: 286-288 (1982) via a disulfide interchange reaction. A chemotherapeutic agent (such as Doxorubicm) is optionally contained within the liposome. See Gabizon et al . J . National Cancer Inst. £1(19) : 1484 (1989)
The antibody of the present invention may also be used m ADEPT by conjugating the antibody to a prodrug-activatmg enzyme which converts a prodrug (e.g. a peptidyl chemotherapeutic agent, see WO81/01145) to an active anti-cancer drug. See, for example, WO 88/07378 and U.S. Patent No. 4, 975,278.
The enzyme component of the immunocon ugate useful for ADEPT includes any enzyme capable ot acting on a orodrug m such a way so as to covert it into its more active, cytotoxic form.
Enzymes that are useful this invention include, but are not limited to, alkaline phosphatase useful for converting phosphate-contam q prodrugs into free drugs; arylsul fatase useful for converting sulfate- contammg prodrugs into free drugs; cytosme deaminase useful for converting non-toxic 5-fluorocytosme into tne anti-cancer drug, 5- fluorouracil; proteases, such as serratia protease, thermolysin, subtilism, carboxypeptidases and catnepsms (such as cathepsins B and L) , that are useful for converting peptide-contain g prodrugs into free drugs; D- alanylcarboxypeptiαases, useful for converting prodrugs that contain D-ammo acid substituents; carbohydrate-cleavmg enzymes such as β-galactosidase and neurammidase useful for converting glycosylated prodrugs into free drugs; β-lactamase useful for converting drugs derivatizeα with 3-lactams into free
- Δ 3 - drugs; and penicillin amidases, such as penicillin V amidase or penicillin G amidase, useful for converting drugs deπvatized at their amme nitrogens with phenoxyacetyl or phenylacetyl groups, respectively, into free drugs. Alternatively, antibodies with enzymatic activity, also known m the art as "abzymes", can be used to convert the prodrugs of the invention into free active drugs [see, e.g., Massey, Nature 328: 457-458 (1987)]. Antibody- abzyme conjugates can be prepared as described herein for delivery of the abzyme to a tumor cell population.
The enzymes of this invention can be covalently bound to the antibody by techniques well known in the art such as the use of the heterobifunctional crosslmking reagents discussed above. Alternatively, fusion proteins comprising at least the antigen-bmdmg region of an antibody of the invention linked to at least a functionally active portion of an enzyme of the invention can be constructed using recombinant DNA techniques well known in the art [see, e.g., Neuberger et al . , Nature, 312 : 604-608 (1984) ] .
In certain embodiments of the invention, it may be desirable to use an antibody fragment, rather than an intact antibody, to increase tumor penetration, for example. In this case, it may be desirable to modify the antibody fragment m order to increase its serum half life. This may be achieved, for example, by incorporation of a salvage receptor binding epitope into the antibody fragment (e.g. by mutation of the appropriate region m the antibody fragment or by incorporating the epitope into a peptide tag that is then fused to the antibody fragment at either end or m the middle, e . g . , by DNA or peptide synthesis).
The salvage receptor binding epitope preferably constitutes a region wherein any one or more ammo acid residues from one or two loops of a Fc domain are transferred to an analogous position of the antibody fragment. Even more preferably, three or more residues from one or two loops of the Fc domain are transferred. Still more preferred, the epitope is taken from the CH2 domain of the Fc region (e.g., of an IgG) and transferred to the CHI, CH3, or V region, or more than one such region, of the antibody. Alternatively, the epitope is taken from the CH2 domain of the Fc region and transferred to the C region or VL region, or both, of the antibody fragment. See, e.g., U.S. Patent No. 5,747,035.
Covalent modifications of the antibody are included within the scope of this invention. They may be made by chemical synthesis or by enzymatic or chemical cleavage of the antibody, if applicable. Other types of covalent modifications of the antibody are introduced into the molecule by reacting targeted ammo acid residues of the antibody with an organic derivatizmg agent that is capable of reacting with selected side chains or the N- or C-termmal residues.
The antibodies may optionally be covalently attached or conjugated to one or more chemical groups. A polyol, for example, can be conjugated to an antibody molecule at one or more ammo acid residues, including lysine residues as disclosed m WO 93/00109. Optionally, the polyol is a poly (alkelene glycol), such as polv (ethylene glycol (PEG), however, those skilled in the art recognize that other polyols, such as, for example, poly (propylene glycol) and polyethylene-polypropylene glycol copolymers, can be employed using techniques for conjugating PEG to polypeptides. A variety of methods for pegylatmg polypeptides have been described. See, e.g. U.S. Patent No. 4,179,337 which discloses the conjugation of a number of hormones and enzymes to PEG and polypropylene glycol to produce physiologically active compositions having reduced immunogenicities .
The antibodies may also be fused or linked to another heterologous polypeptide or ammo acid sequence such as an epitope tag. 8. Other Modifications
Other modifications of the Apo-2 antibodies are contemplated. For example, it may be desirable to modify the antibodies of the invention with respect to effector function, so as to enhance the therapeutic effectiveness of the antibodies. For instance, cysteme residue (s) may be introduced into the Fc region, thereby allowing interchain disulfide bond formation m this region. The homodimeric antibody thus generated may have improved internalization capability and/or increased complement-mediated cell killing [see, e.g., Caron et al . , J. Exp . Med. , £76:1191-1195 (1992); Shopes, J^ Immunol . , 148 : 2918-2922 (1992). Homodimeric antibodies may also be prepared using heterobifunctional cross-linkers as described m Wolff et al., Cancer Research, 5£:2560-2565 (1993). Ghetie et al., Proc. Natl. Acad. Sci., ££: 7509-7514 (1997), further describe preparation of IgG-IgG homodimers and disclose that such homodimers can enhance apoptotic activity as compared to the monomers. Alternatively, the antibodies can be engineered to have dual Fc regions [see, Stevenson et al., Anti-Cancer Drug Design, 3:219-230 (1989)].
D. Therapeutic and Non-therapeutic Uses for Apo-2 Antibodies
The Apo-2 antibodies of the invention have therapeutic utility. Agonistic Apo-2 antibodies, for instance, may be employed to activate or stimulate apoptosis in cancer cells.
The antibody is preferably administered to the mammal a carrier. Suitable carriers and their formulations are described m Remington's Pharmaceutical Sciences, 16th ed., 1980, Mack Publishing Co., edited by Oslo et al . Typically, an appropriate amount of a pharmaceutically-acceptable salt is used the formulation to render the formulation lsotonic. Examples of a pharmaceutically-acceptable carrier include saline, Ringer's solution and dextrose solution. The pH of the solution is preferably from about 5 to about 8, and more preferably from about 7 to about 7.5. Further carriers include sustained release preparations sucn as semipermeable matrices of solid hydrophopic polymers containing the antibody, which matrices are the form of shaped articles, e.g., films, liposomes or microparticles . It will be apparent to those persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of antibody being administered.
The antibody can be administered to the mammal by injection (e.g., intravenous, mtraperitoneal, subcutaneous, intramuscular), or by o er me o s suc as in usion a ensure i s e ivery o e oo s ream m an effective form. The antibody may also be administered by mtratumoral, peπtumoral, mtralesional, or perilesional routes, to exert local as well as systemic therapeutic effects. Local or intravenous injection is preferred.
Effective dosages and schedules for administering the antibody may be determined empirically, and making such determinations is within the skill in the art. Those skilled m the art will understand that the dosage of antibody that must be administered will vary depending on, for example, the mammal which w ll receive the antibody, the route of administration, the particular type of antibody used and other drugs being administered to the mammal. Guidance m selecting appropriate doses for antibody is found m the literature on therapeutic uses of antibodies, e . g. , Handbook of Monoclonal Antibodies, Ferrone et a l . , eds . , Noges Publications, Park Ridge, N.J., (1985) ch. 22 and pp. 303-357; Smith et al . , Antibodies Human Diagnosis and Therapy, Haber et al . , eds., Raven Press, New York (1977) pp. 365-389. A typical daily dosage of the antibody used alone might range from about 1 μg/kg to up to 100 mg/kg of body weight or more per day, depending on the factors mentioned above. The antibody may also be administered to the mammal m combination with effective amounts of one or more other therapeutic agents or in conjunction with radiation treatment. Therapeutic agents contemplated include chemotherapeutics as well as immunoad uvants and cytokmes. The antibody may be administered sequentially or concurrently with the one or more other therapeutic agents. The amounts of antibody and therapeutic agent depend, for example, on what type of drugs are used, the cancer being treated, and the scheduling and routes of administration but would generally be less than if each were used individually.
Following administration of antibody to the mammal, the mammal's cancer and physiological condition can be monitored in various ways well known to the skilled practitioner. For instance, tumor mass may be observed physically or by standard v-ray imaging techniques.
The Apo-2 receptor antibodies of the invention may also be useful m enhancing immune-mediated cell death m cells expressmq Apo-2 receptor (s), for instance, through complement fixation or ADCC . Alternatively, antagonistic antι-Apo-2 receptor antibodies may be used to block excessive apoptosis (for instance m neurodeqenerative disease) or to block potential autoimmune/inflammatory effects of Apo-2 resulting from NF-χB activation. Such therapeutic antibodies can be utilized according to the methods and techniques described above.
Apo-2 antibodies may further be used m diagnostic assays for Apo- 2, e.g., detecting its expression in specific cells, tissues, or serum. Various diagnostic assay techniques known m the art may be used, such as competitive binding assays, direct or indirect sandwich assays and immunoprecipitation assays conducted in either heterogeneous or homogeneous phases [Zola, Monoclonal Antibodies: A Manual or Techniques, CRC Press, Inc.
(1987) pp. 14'7-158J . The antibodies used m the diagnostic assays can be
-4b- a e e wi a etecta e moiety. T e etecta e moiety s ou e capa e o producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as JH, 1-,C, J P, J5S, or 12° I , a fluorescent or chemilummescent compound, such as fluorescem isothiocyanate, rhodamme, or lucifeπn, or an enzyme, such as alkaline phosphatase, beta- galactosidase or horseradish peroxidase. Any method known m the art for conjugating the antibody to the detectable moiety may be employed, including those methods described by Hunter et al., Nature, 194 : 495-496 (1962); David et al., Biochemistry, £3:1014 (1974); Pain et al . , J. Immunol. Meth., 40:219 (1981); and Nygren, J. Histoche . and Cytochem. , 30:407 (1982).
Apo-2 antibodies also are useful for the affinity purification of Apo-2 from recombinant cell culture or natural sources. In this process, the antibodies against Apo-2 are immobilized on a suitable support, such a Sephadex resm or filter paper, using methods well known m the art. The immobilized antibody then is contacted with a sample containing the Apo-2 to be purified, and thereafter the support is washed with a suitable solvent that will remove substantially all the material in the sample except the Apo-2, which is bound to the immobilized antibody. Finally, the support is washed with another suitable solvent that will release the Apo-2 from the antibody. E. Kits Containing Apo-2 or Apo-2 Antibodies
In a further embodiment of the invention, there are provided articles of manufacture and kits containing Apo-2 or Apo-2 antibodies which can be used, for instance, for the therapeutic or non-therapeutic applications described above. The article of manufacture comprises a container with a label. Suitable containers include, for example, bottles, vials, and test tubes. The containers may be formed from a variety of materials such as glass or plastic. The container holds a composition which includes an active agent that is effective for therapeutic or non-therapeutic applications, such as described above. The active agent m the composition is Apo-2 or an Apo-2 antibody. The label on the container indicates that the composition is used for a specific therapy or non-therapeutic application, and may also indicate directions for either in vi vo or in vi tr o use, such as those described above.
The kit of the invention will typically comprise the container described above and one or more other containers comprising materials desirable from a commercial and user standpoint, including buffers, diluents, filters, needles, syringes, and packaαe inserts with instructions for use.
*****************************
The following examples are offered tor illustrative purposes only, and are not intended to limit the scope of the present invention m any way.
All patent and literature references cited m the present specification are hereby incorporated by reference m their entirety.
EXAMPLES All restriction enzymes referred to m the examples were purchased from New England Biolabs and used according to manufacturer's instructions. All other commercially available reagents referred to the examples were use accor ing to manu acturer's instructions unless otherwise indicated. The source of those cells identified the following examples, and throughout the specification, by ATCC accession numbers is the American Type Culture Collection, Manassas, Virginia.
EXAMPLE 1 Isolation of cDNA clones Encoding Human Apo-2
Expressed sequence tag (EST) DNA databases (LIFESEQ™, Incyte Pharmaceuticals, Palo Alto, CA) were searched and an EST was identified which showed homology to the death domain of the Apo-3 receptor [Marsters et al., Curr. Biol . , £:750 (1996)]. Human pancreas and kidney lgtlO bacteπophage cDNA libraries (both purchased from Clontech) were ligated into pRK5 vectors as follows. Reagents were added together and incubated at 16°C for 16 hours: 5X T4 ligase buffer (3 ml); pRK5, Xhol, Notl digested vector, 0.5 mg, 1 ml); cDNA (5 ml) and distilled water (6 ml). Subsequently, additional distilled water (70 ml) and 10 mg/ l tRNA (0.1 ml) were added and the entire reaction was extracted through phenol : chloroform: isoamyl alcohol (25:24:1). The aqueous phase was removed, collected and diluted into 5M NaCl (10 ml) and absolute ethanol (-20°C, 250 ml) . This was then centrifuged for 20 minutes at 14,000 x g, decanted, and the pellet resuspended into 70c ethanol (0.5 ml) and centrifuged again for 2 minutes at 14,000 x g. The DNA pellet was then dried m a speedvac and eluted into distilled water (3 ml) for use m the subsequent procedure .
The ligated cDNA/pRK5 vector DNA prepared previously was chilled on ice to which was added electrocompetent DH10B bacteria (Life Tech., 20 ml).
The bacteria vector mixture was then electroporated as per the manufacturer' recommendation. Subsequently SOC media (1 ml) was added and the mixture was incubated at 37°C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillm and incubated for 16 hours (37°C) to allow the colonies to grow. Positive colonies were then scraped off and the DNA isolated from the bacterial pellet using standard CsCl-gradient protocols .
An enriched 5'-cDNA library was then constructed to obtain a bias of cDNA fragments which preferentially represents the 5' ends of cDNA's contained within the library. 10 mg of the pooled isolated full-length library plasmid DNA (41 ml) was combined with Not 1 restriction buffer (New England Biolabs, 5 ml) and Not 1 (New England Biolabs, 4 ml) and incubated at 37°C for one hour. The reaction was extracted through phenol : chloroform: isoamyl alcohol (25:24:1, 50 ml), the aqueous phase removed, collected and resuspended into 5M NaCl (5 ml) and absolute ethanol (-20°C, 150 ml). This was then centrifuqed for 20 minutes at 14,000 x g, decanted, resuspended into 70 ethanol (0.5 ml) and centrifuged again for 2 minutes at 14,000 x g. The supernatant was then removed, the pellet dried m a speedvac and resuspended m distilled water (10 ml) . The following reagents were brought together and incubated at 37°C for 2 hours: distilled water v3 ml); linearized DNA library (1 mg, 1 ml); Ribonucleotide mix (Invitrogen, 10 ml); transcription buffer (Invitrogen, 2 ml) and Sp6 enzyme mix. The reaction was then extracted through phenol : chloroform: isoamyl alcohol (25:24:1, 50 ml) and the aqueous phase was removed, collected and resuspended into 5M NaCl (5 ml) and absolute ethanol (- 20°C, 150 ml) and centrifuged for 20 minutes at 14,000 x g. The pellet was then decanted and resuspended 70c- ethanol (0.5 ml), centrifuged again for 2 minutes at 14,000 x g, decanted, dried m a speedvac and resuspended into distilled water (10 ml).
The following reagents were added together and incubated at 16°C for 16 hours: 5X T4 ligase buffer (Life Tech., 3 ml); pRK5 Cla-Sal digested vector, 0.5 mg, 1 ml); cDNA (5 ml); distilled water (6 ml ) . Subsequently, additional distilled water (70 ml) and 10 mg/ml tRNA (0.1 ml) was added and the entire reaction was extracted through phenol : chloroform: isoamyl alcohol (25:24:1, 100 ml) . The aqueous phase was removed, collected and diluted by 5M NaCl (10 ml) and absolute ethanol (-20°C, 250 ml) and centrifuged for 20 minutes at 14,000 x g. The DNA pellet was decanted, resuspended into 701 ethanol (0.5 ml) and centrifuged again for 2 minutes at 14,000 x g. The supernatant was removed and the residue pellet was dried m a speedvac and resuspended m distilled water (3 ml) . The ligated cDNA/pSST-amy .1 vector DNA was chilled on ice to which was added electrocompetent DH10B bacteria (Life Tech., 20 ml) . The bacteria vector mixture was then electroporated as recommended by the manufacturer. Subsequently, SOC media (Life Tech., 1 ml) was added and the mixture was incubated at 37°C for 30 minutes. The transformants were then plated onto 20 standard 150 mm LB plates containing ampicillm and incubated for 16 hours (37°C). Positive colonies were scraped off the plates and the DNA was isolated from the bacterial pellet using standard protocols, e.g. CsCl-gradient .
The cDNA libraries were screened by hybridization with a synthetic oligonucleotide probe: GGGAGCCGCTCATGAGGAAGTTGGGCCTCATGGACAATGAGATAAAGGTGGCTAAAGCTGAGGCAGCGGG ( SEQ ID NO:3) based on the EST.
Three cDNA clones were sequenced m entirety. The overlapping coding regions of the cDNAs were identical except for codon 410 (using the numbering system for Fig. 1); this position encoded a leucme residue (TTG) m both pancreatic cDNAs, and a methionme residue (ATG) m the kidney cDNA, possibly due to polymorphism.
The entire nucleotide sequence of Apo-2 is shown m Figure 1 (SEQ ID NO:2). Clone 27868 (also referred to as pRK5-Apo-2 deposited as ATCC 209021, as indicated below) contains a single open reading frame with an apparent translational initiation site at nucleotide positions 140-142 [Kozak et al . , supra] ana ending at the stop codon found at nucleotide positions 1373-1375 (Fig. 1; SEQ ID NO : 2 ) . The predicteα polypeptide precursor is 411 ammo acids long, a type I transmembrane protein, and has a calculated molecular weight of approximately 45 kDa . Hydropathy analysis (not shown) suggested the presence of a signal sequence (residues 1-53), followed by an extracellular domain (residues 54-182), a transmembrane domain (residues 183- , an an m race u ar omain resi ues - Fig. ; : . N-termmal ammo acid sequence analysis of Apo-2-IgG expressed m 293 cells showed that the mature polypeptide starts at ammo acid residue 54, indicating that the actual signal sequence comprises residues 1-53. Apo-2 polypeptide is obtained or obtainable by expressing the molecule encoded by the cDNA insert of the deposited ATCC 209021 vector.
TNF receptor family proteins are typically characterized by the presence of multiple (usually four) cysteme-πch domains in their extracellular regions — each cysteme-rich domain being approximately 45 am o acids long and containing approximately 6, regularly spaced, cysteme residues. Based on the crystal structure of the type 1 TNF receptor, the cysteines in each domain typically form three disulfide bonds m which usually cysteines 1 and 2, 3 and 5, and 4 and 6 are paired together. Like DR4 , Apo-2 contains two extracellular cysteme-rich pseudorepeats (Fig. 2A) (SEQ ID NO: 6), whereas other identified mammalian TNFR family members contain three or more such domains [Smith et al., Cell, £6:959 (1994)].
The cytoplasmic region of Apo-2 contains a death domain (ammo acid residues 324-391 shown m Fig. 1 (SEQ ID NO : 2 ) ; see also Fig. 2A) (SEQ ID NO: 6) which shows significantly more ammo acid sequence identity to the death domain of DR4 (SEQ ID NO:8) (64°o) than to the death domain of TNFRl (SEQ ID NO: 10) (30%); CD95 (SEQ ID NO: 11) (19°o); or Apo-3/DR3 (SEQ ID NO: 9) (291) (Fig. 2B) . Four out of six death domain ammo acids that are required for signaling by TNFRl [Tartaglia et al . , supra] are conserved m Apo-2 while the other two residues are semi-conserved (see Fig. 2B) . Based on an alignment analysis (using the ALIGN™ computer program) of the full-length sequence, Apo-2 shows more sequence identity to DR4 (SEQ ID NO:8) (55u) than to other apoptosis-lmked receptors, such as TNFRl (SEQ ID NO: 10) (19 ); CD95 (SEQ ID NO: 11) (17c); or Apo-3 (SEQ ID NO: 9) (also referred to as DR3, WSL-1 or TRAMP) (29?).
EXAMPLE 2
A. Expression of Apo-2 ECD
A soluble extracellular domain (ECD) fusion construct was prepared. An Apo-2 ECD (ammo acid residues 1-184 shown Figure 1) (SEQ ID NO:l) was obtained by PCR and fused to a C-termmal Flag epitope tag (Sigma) .
(The Apo-2 ECD construct included residues 183 and 184 shown m Figure 1 (SEQ
ID NO:l) to provide flexibility at the junction, even though residues 183 and
184 are predicted to be m the transmembrane region) . The Flag epitope-tagged molecule was then inserted into pRK5, and expressed by transient transfection into human 293 cells (ATCC CRL 1573) .
After a 48 hour incubation, the cell supernatants were collected and either used directly for co-precipitation studies (see Example 3) or subjected to purification of the Apo-2 ECD-Flag by affinity chromatography on anti-Flag agarose beads, according to manufacturer's instructions (Sigma). . Expression o Apo- ECD as an Immunoa esm A soluble Apo-2 ECD immunoadhesm construct was prepared. The Apo-2 ECD (ammo acids 1-184 shown in Fig. 1) (SEQ ID NO:l) was fused to the hinge and Fc region of human immunoglobulin Gi heavy chain m pRK5 as described previously [Ashkenazi et al . , Proc. Natl. Acad. Sci., 88 : 10535-10539 (1991)]. The immunoadhesm was expressed by transient transfection into human 293 cells and purified from cell supernatants by protein A affinity chromatography, as described by Ashkenazi et al . , supra.
EXAMPLE 3
Immunoprecipitation Assay Showing Binding Interaction Between Apo-2 and Apo-2 Ligand
To determine whether Apo-2 and Apo-2L interact or associate with each other, supernatants from mock-transfected 293 cells or from 293 cells transfected with Apo-2 ECD-Flag (described in Example 2 above) (5 ml) were incubated with 5 μg poly-histidme-tagged soluble Apo-2L [Pitti et al . , supra] for 30 minutes at room temperature and then analyzed for complex formation by a co-precipitation assay.
The samples were subjected to immunoprecipitation using 25 μl anti-Flag conjugated agarose beads (Sigma) or Nickel-conjugated agarose beads (Qiagen) . After a 1.5 hour incubation at 4° C, the beads were spun down and washed four times m phosphate buffered saline (PBS) . By using anti-Flag agarose, the Apo-2L was precipitated through the Flag-tagged Apo-2 ECD; by using Nickel-agarose, the Apo-2 ECD was precipitated through the His-tagged Apo-2L. The precipitated proteins were released by boiling the beads for 5 minutes m SDS-PAGE buffer, resolved by electrophoresis on 12°c polyacrylamide gels, and then detected by lmmunoblot with antι-Apo-2L or anti-Flag antibody (2 μg/ml) as described m Marsters et al., J. Biol . Chem. , (1997) .
The results, shown in Figure 3, indicate that the Apo-2 ECD and Apo-2L can associate with each other.
The binding interaction was further analyzed by purifying Apo-2 ECD from the transfected 293 cell supernatants with anti-Flag beads (see Example 2) and then analyzing the samples on a BIACORE™ instrument. The BIACORE1" analysis indicated a dissociation constant (Kd) of about 1 nM. BIACORE™ analysis also showed that the Apo-2 ECD is not capable of binding other apoptosis-mduc g TNF family members, namely, TNF-alpha (Genentech, Inc., Pennica et al . , Nature, £12:724 (1984), lymphotoxm-alpha (Genentech, Inc.), or Fas/Apo-1 ligand (Alexis Biochemicals ) . The data thus shows that Apo-2 is a specific receptor for Apo-2L.
EXAMPLE 4
Induction of Apoptosis by Apo-2
Because death domains can function as oligomeπzation interfaces, over-expression or receptors that contain death domains may lead to activation of signaling m the absence of ligand [Frazer et al., supra, Nagata et al . , supra] . To determine whether Apo-2 was capable of inducing cell death, human 3 cells or HeLa cells (ATCC CCL 2.2) were transiently transfected by ca cium phosphate precipitation (293 cells) or electroporation (HeLa cells) with a pRK5 vector or pRK5-based plasmids encoding Apo-2 and/or CrmA. When applicable, the total amount of plasmid DNA was adjusted by adding vector DNA. Apoptosis was assessed 24 hours after transfection by morphology (Fig. 4A) ;
DNA fragmentation (Fig. 4B) ; or by FACS analysis of phosphatydilsenne exposure (Fig. 4C) as described m Marsters et al . , Curr. Biol . , £:1669
(1996). As shown m Figs. 4A and 4B, the Apo-2 transfected 293 cells underwent marked apoptosis. For samples assayed by FACS, the HeLa cells were co-transfected with pRK5-CD4 as a marker for transfection and apoptosis was determined m
CD4-expressιng cells; FADD was co-transfected with the Apo-2 plasmid; the data are means + SEM of at least three experiments, as described in Marsters et al., Curr. Biol., 6:1669 (1996). The caspase inhibitors, DEVD-fmk (Enzyme Systems) or z-VAD-fmk (Research Biochemicals Intl.) were added at 200 μM at the time of transfection. As shown m Fig. 4C, the caspase inhibitors CrmA, DEVD-fmk, and z-VAD-fmk blocked apoptosis induction by Apo-2, indicating the involvement of Ced-3-lιke proteases m this response.
FADD is an adaptor protein that mediates apoptosis activation by CD95, TNFRl, and Apo-3/DR3 [Nagata et al . , supra] , but does not appear necessary for apoptosis induction by Apo-2L [Marsters et al., supra] or by DR4 [Pan et al., supra] . A dominant-negative mutant form of FADD, which blocks apoptosis induction by CD95, TNFRl, or Apo-3/DR3 [Frazer et al., supra; Nagata et al., supra; Chinnayian et al., supra] did not inhibit apoptosis induction by Apo-2 when co-transfected into HeLa cells with Apo-2 (Fig. 4C) . These results suggest that Apo-2 signals apoptosis independently of FADD. Consistent with this conclusion, a glutathione-S-transferase fusion protein containing the Apo-2 cytoplasmic region did not bind to in vi tro transcribed and translated FADD (data not shown) .
EXAMPLE 5
Inhioition of Apo-2L Activity by Soluble Apo-2 ECD
Soluble Apo-2L (0.5 μg/ml, prepared as described Pitti et al., supra) was pre-mcubated for 1 hour at room temperature with PBS buffer or affinity-purified Apo-2 ECD (5 μg/ml) together with anti-Flag antibody (Sigma)
(1 μg/ml) and added to HeLa cells. After a 5 hour incubation, the cells were analyzed for apoptosis by FACS (as above) (Fig. 4D) .
Apo-2L induced marked apoptosis m HeLa cells, and the soluble
Apo-2 ECD was capable of blocking APO-2L action (Fig. 4D) , confirming a specific interaction between Apo-2L and Apo-2. Similar results were obtained with the Apo-2 ECD immunoadhesm (Fig. 4D) . Dose-response analysis showed half-maximal inhibition at approximately 0.3 nM Apo-2 immunoadhesm (Fig. 4E) . EXAMPLE 6 Activation of NF-RB by Apo-2 An assay was conducted to determine whether Apo-2 activates NF- KB. HeLa cells were transfected with pRK5 expression plasmids encoding full-length native sequence Apo-2, DR4 or Apo-3 and harvested 24 hours after transfection. Nuclear extracts were prepared and 1 μg of nuclear protein was reacted with a 32P-labelled NF-κB-specιfιc synthetic oligonucleotide probe ATCAGGGACTTTCCGCTGGGGACTTTCCG (SEQ ID NO:4) [see, also, MacKay et al., ^ Immunol., ££3:5274-5284 (1994)], alone or together with a 50-fold excess of unlabelled probe, or with an irrelevant 32P-labelled synthetic oligonucleotide AGGATGGGAAGTGTGTGATATATCCTTGAT (SEQ ID NO:5). In some samples, antibody to p65/RelA subunits of NF-KB (1 μg/ml; Santa Cruz Biotechnology) was added. DNA binding was analyzed by an electrophoretic mobility shift assay as described by Hsu et al . , supra; Marsters et al . , supra, and MacKay et al., supra.
The results are shown in Fig. 5. As shown m Fig. 5A, upon transfection into HeLa cells, both Apo-2 and DR4 induced significant NF-KB activation as measured by the electrophoretic mobility shift assay; the level of activation was comparable to activation observed for Apo-3/DR3. Antibody to the p65/RelA subunit of NF-KB inhibited the mobility of the NF-KB probe, implicating p65 m the response to all 3 receptors.
An assay was also conducted to determine if Apo-2L itself can regulate NF-KB activity. HeLa cells or MCF7 cells (human breast adenocarcmoma cell line, ATCC HTB 22) were treated with PBS buffer, soluble Apo-2L (Pitti et al . , supra) or TNF-alpha (Genentech, Inc., see Pennica et al., Nature, £12:724 (1984)) (1 μg/ml) and assayed for NF-KB activity as above. The results are shown m Fig. 5B. The Apo-2L induced a significant
NF-KB activation m the treated HeLa cells but not m the treated MCF7 cells; the TNF-alpha induced a more pronounced activation m both cell lines. Several studies have disclosed that NF-KB activation by TNF can protect cells against TNF-mduced apoptosis [Nagata, supra] .
The effects of a NF-KB inhibitor, ALLN (N-acetyl-Leu-Leu- norleucmal) and a transcription inhibitor, cyclohexamide, were also tested.
The HeLa cells (plated in 6-well dishes) were prerncubated with PBS buffer, ALLN (40 μg/ml) or cyclohexamide (Sigma) (50 μg/ml) for 1 hour before addition of Apo-2L (1 μg/ml). After a 5 hour incubation, apoptosis was analyzed by FACS (see Fig. 5C) .
The results are shown m Fig. 5C. Both ALLN and cyclohexamide increased the level of Apo-2L-mduced apoptosis in the HeLa cells. The data indicates that Apo-2L can induce protective NF-KB-dependent genes. The data also indicates that Apo-2L is capable of activating NF-RB in certain cell lines and that both Apo-2 and DR4 may mediate that function. EXAMPLE 7 Northern Blot Analysis Expression of Apo-2 mRNA m human tissues was examined by Northern blot analysis. Human RNA blots were hybridized to a 4.6 kilobase 32P-labelled DNA probe based on the full length Apo-2 cDNA; the probe was generated by digesting the pRK5-Apo-2 plasmid with EcoRI . Human fetal RNA blot MTN (Clontech) and human adult RNA blot MTN-II (Clontech) were incubated with the DNA probes. Blots were incubated with the probes m hybridization buffer (5X SSPE; 2X Denhardt ' s solution; 100 mg/mL denatured sheared salmon sperm DNA; 50% formamide; 2% SDS) for 60 hours at 42°C. The blots were washed several times in 2X SSC; 0.05% SDS for 1 hour at room temperature, followed by a 30 minute wash in 0. IX SSC; 0.1-5 SDS at 50°C. The blots were developed after overnight exposure.
As shown in Fig. 6, a predominant mRNA transcript of approximately 4.6kb was detected in multiple tissues. Expression was relatively high m fetal and adult liver and lung, and in adult ovary and peripheral blood leukocytes (PBL), while no mRNA expression was detected m fetal and adult brain. Intermediate levels of expression were seen m adult colon, small intestine, testis, prostate, thymus, pancreas, kidney, skeletal muscle, placenta, and heart. Several adult tissues that express Apo-2, e.g., PBL, ovary, and spleen, have been shown previously to express DR4 [Pan et al., supra] , however, the relative levels of expression of each receptor mRNA appear to be different.
EXAMPLE 8
Chromosomal Localization of the Apo-2 gene
Chromosomal localization of the human Apo-2 gene was examined by radiation hybrid (RH) panel analysis. RH mapping was performed by PCR using a human-mouse cell radiation hybrid panel (Research Genetics) and primers based on the coding region of the Apo-2 cDNA [Gelb et al., Hum. Genet., 98 : 141 (1996)]. Analysis of the PCR data using the Stanford Human Genome Center Database indicates that Apo-2 is linked to the marker D8S481, with an LOD of 11.05; D8S481 is linked turn to D8S2055, which maps to human chromosome 8p21. A similar analysis of DR4 showed that DR4 is linked to the marker D8S2127 (with an LOD of 13.00), which maps also to human chromosome 8p21.
EXAMPLE 9
Preparation of Monoclonal Antibodies Specific for Apo-2 Balb/c mice (obtained from Charles River Laboratories) were immunized by injecting 0.5μg/50μl of an Apo-2 ECD immunoadhesm protein
(diluted m MPL-TDM adjuvant purchased from Ribi Immunochemical Research Inc.,
Hamilton, MT) 11 times into each hind foot pad at 3-4 day intervals. The Apo-
2 ECD immunoadhesm protein was generated by fusing an extracellular domain sequence of Apo-2 (ammo acids 1-184 shown m Fig. 1) (SEQ ID N0:1) to the hinge and Fc region of human immunoglobulin Gi heavy chain pRK5 as described previously [Ashkenazi et al., Proc. Natl. Acad. Sci., 88 : 10535-10539 . e immunoa esm protein was expressed by transient trans ection into human 293 cells and purified from cell supernatants by protein A affinity chromatography, as described by Ashkenazi et al., supra (See also Example 2B above) . Three days after the final boost, popliteal lymph nodes were removed from the mice and a single cell suspension was prepared m DMEM media (obtained from Biowhitakker Corp. ) supplemented with 1% pemcillm- streptomycm. The lymph node cells were then fused with murine myeloma cells P3X63AgU.l (ATCC CRL 1597) using 35% polyethylene glycol and cultured m 96- well culture plates. Hybridomas resulting from the fusion were selected m HAT medium. Ten days after the fusion, hybridoma culture supernatants were screened m an ELISA to test for the presence of monoclonal antibodies binding to the Apo-2 ECD immunoadhesm protein.
In the ELISA, 96-well microtiter plates (Maxisorb; Nunc, Kamstrup, Denmark) were coated by adding 50 μl of 2 μg/ml goat anti-human IgG Fc
(purchased from Cappel Laboratories) in PBS to each well and incubating at 4°C overnight. The plates were then washed three times with wash buffer (PBS containing 0.05c Tween 20). The wells m the microtiter plates were then blocked with 200 μl of 2.0C bovme serum albumin m PBS and incubated at room temperature for 1 hour. The plates were then washed again three times with wash buffer.
After the washing step, 50 μl of 0.4 μg/ml Apo-2 ECD immunoadhesm protein (as described above) m assay buffer was added to each well. The plates were incubated for 1 hour at room temperature on a shaker apparatus, followed by washing three times with wash buffer.
Following the wash steps, 100 μl of the hybridoma supernatants or various concentrations of purified antibody (using Protein A-sepharose columns) was added to designated wells the presence of CD4-IgG. 100 μl of P3X63AgU.l myeloma cell conditioned medium was added to other designated wells as controls. The plates were incubated at room temperature for 1 hour on a shaker apparatus and then washed three times w th wash buffer.
Next, 50 μl HRP-conjugated goat anti-mouse IgG Fc (purchased from Cappel Laboratories), diluted 1:1000 m assay buffer (0.5 bovme serum albumin, 0.05r Tween-20, 0.01 Thimersol m PBS), was added to each well ana the plates incubated for 1 hour at room temperature on a shaker apparatus.
The plates were washed three times with wash buffer, followed by addition of 50 μl of substrate (TMB microwell peroxidase substrate, Kirkegaard & Perry, Gaithersburg, MD) to each well and incubation at room temperature for 10 minutes. The reaction was stopped by adding 50 μl of TMB 1-component stop solution (diethyl glycol, Kirkegaard & Perry) to each well, and absorbance at 450 nm was read m an automated microtiter plate reader.
The supernatants testing positive m the ELISA (calculated as approximately 4 times above background) were further analyzed by FACS analysis using 9D cells (a human B lymphoid cell line expressing Apo-2; Genentech, Inc.) and FITC-conjuαated goat anti-mouse IgG. For this analysis, 25 μl of ce s suspen e at X cells ml) m cell sorter buffer (PBS containing FCS and 0.02% NaN ) were added to U-bottom microtiter wells, mixed with 100 μl of culture supernatant or purified antibody (purified on Protein A-sepharose columns) (10 μg /ml) in cell sorter buffer, and incubated for 30 minutes on ice. The cells were then washed and incubated with 100 μl FITC-con ugated goat anti-mouse IgG for 30 minutes at 4°C. Cells were then washed twice, resuspended in 150 μl of cell sorter buffer and then analyzed by FACScan (Becton Dickinson, Mountain View, CA) .
Figure 7 shows the FACS staining of 9D cells incubated with one of the Apo-2 antibodies, referred to as 3F11.39.7. As shown in Figure 7, the 3F11.39.7 antibody recognizes the Apo-2 receptor expressed m 9D cells.
EXAMPLE 10
Assay for Ability of Apo-2 Abs to Agonistically induce Apoptosis Hybridoma supernatants and purified antibodies (as described m
Example 9 above) were tested for activity to induce Apo-2 mediated 9D cell apoptosis. The 9D cells (5 X lO"' cells/0. lml) were incubated with varying concentrations of antibodies in 100 μl complete RPMI media at 4UC for 15 minutes. The cells were then incubated for 5 minutes at 37lC with or without 10 μg of goat anti-mouse IgG Fc antibody (Cappel Laboratories) in 300 μl of complete RPMI. At this point, the cells were incubated overnight at 37°C and m the presence of 7% CO The cells were then harvested and washed once with PBS. The apoptosis of the cells was determined by staining of FITC-annexm V binding to phosphatidylserme according to manufacturer recommendations (Clontech) . The cells were washed m PBS and resuspended m 200 μl binding buffer. Ten μl of annexm-V-FITC (1 μg/ml) and 10 μl of propidium iodide were added to the cells. After incubation for 15 minutes the dark, the 9D cells were analyzed by FACS.
As shown in Eigure 8, the 3F11.39.7 antibody (in the absence of the goat anti-mouse IgG Fc) induced apoptosis m the 9D cells as compared to the control antibodies. Agonistic activity, however, was enhanced by Apo-2 receptor cross-lmkmg m the presence of the goat anti-mouse IgG Fc (see Figure 9). Tnis enhanced apoptosis (Figure 9) by the combination of antibodies is comparable to the apoptotic activity of Apo-2L in 9D cells (data not shown) .
EXAMPLE ll Assay for Antibody Ability to Block Apo-2 ligand-mduced Apoptosis
Hybridoma supernatants and purified antibodies (as described m Example 9 above) were tested for activity to block Apo-2 ligand induced 9D cell apoptosis. The 9D cells (5 X 10J cells/0. lml) were suspended m complete RPMI media (RPMI plus 10 FCS, glutamme, penicillin, streptomycin, sodium pyruvate) and placed into individual Falcon 2052 tubes. Cells were prerncubated with 10 μg ot antibodies m 200 μl media for 15 minutes on ice. 0.2 ml of Apo-2 ligand (2.5 μg/ml) (soluble His-tagged Apo-2L prepared as described in WO 97 25428; see also Pitti et al., supra) was suspended into complete RPMI media, and then added into the tubes containing the 9D cells. The 9D cells were incubated overnight at 37°C and m the presence of 7% CO^ The incubated cells were then harvested and washed once with PBS. The viability of the cells was determined by staining of FITC-annexm V binding to phosphatidylserme according to manufacturer recommendations (Clontech) .
Specifically, the cells were washed m PBS and resuspended in 200 μl binding buffer. Ten μl of annexm-V-FITC (1 μg/ml) and 10 μl of propidium iodide were added to the cells. After incubation for 15 minutes m the dark, the 9D cells were analyzed by FACS.
The results are shown in Figure 10. Since 9D cells express more than one receptor for Apo-2L, Apo-2L can induce apoptosis in the 9D cells by interacting with either Apo-2 or the DR4 receptor. Thus, to detect any blocking activity of the Apo-2 antibodies, the interaction between DR4 and Apo-2L needed to be blocked. In combination with the antι-DR4 antibody, 4H6.17.8 (ATCC HB-12455), the Apo-2 antibody 3F11.39.7 was able to block approximately 50% of apoptosis induced by Apo-2L. The remaining approximately 50- apoptotic activity is believed to be due to the agonistic activities of these two antibodies by themselves, as shown m Figure 10. Accordingly, it is believed that the 3F11.39.7 antibody is a blocking Apo-2 antibody.
EXAMPLE 12 ELISA Assay to Test Binding of Apo-2 Antibodies to Other Apo-2 Ligand Receptors An ELISA was conducted to determine if the monoclonal antibody described m Example 9 was able to bind other known Apo-2L receptors beside Apo-2. Specifically, the 3F11.39.7 antibody was tested for binding to DR4 [Pan et al., supra] , DcRl [Sheridan et al., supra] , and DcR2 [Marsters et al . , Curr. Biol., 7:1003-1006 (1997)]. The ELISA was performed essentially as described in Example 9 above.
The results are shown m Figure 11. The Apo-2 antibody 3F11.39.7 bound to Apo-2. The 3F11.39.7 antibody also showed some cross-reactivity to DR4, but not to DcRl or DcR2.
EXAMPLE 13
Antibody Isotypmg
The isotype of the 3F11.39.7 antibody (as described above) was determined by coating microtiter plates with isotype specific goat anti-mouse
Ig (Fisher Biotech, Pittsburgh, PA) overnight at 4°C. The plates were then washed with wash buffer (as αescπbed in Example 9 above) . The wells m the microtiter plates were then blocked with 200 μl of 2% bov e serum albumin and incubated at room temperature for one hour. The plates were washed again three times with wash buffer. Next, 100 μl of 5 μg/ml of purified 3F11.39.7 antibody was added to designated wells. The plates were incubated at room temperature for 30 minutes and then 50 μl HRP-conjugated goat anti-mouse IgG
(as described above) was added to each well. The plates were incubated for 30 minutes at room temperature. The level of HRP bound to the plate was detected using HRP substrate as described above.
The isotyping analysis showed that the 3F11.39.7 antibody is an IgGl antibody.
EXAMPLE 14 Preparation of Monoclonal Antibodies Specific for DR4 Further monoclonal antibodies to Apo-2 were produced essentially as described in Example 9 above. Using the capture ELISA described m Example 9, additional antι-Apo-2 antibodies, referred to as 2B3.7.1; 4B9.23.6; 5C7.9.1; 3C9.8.6; and 4H10.14.10, were identified (see Table m Figure 12). Analysis by FACS (using the technique described Example 9) confirmed binding of these antibodies to 9D cells expressing Apo-2 (data not shown) .
Three additional antι-Apo-2 antibodies, referred to as 3H1.18.10, 3H3.14.5 and 3D5.1.10, were produced using a mixed antigen immunization protocol as follows. Animals were immunized with four receptor lmmunoadhesms - DR4 [Pan et a l . , Science, 276: 111-113 (1997)]; Apo-2 [as described herein]; DcRl [Sheridan et al . , Science 277:818-821 (1997)]; and DcR2 [Marsters et al . , Curr. Biol., £: 1003-1006 (1997)]. Receptor lmmunoadhesms (designated "DR4-IgG", "Apo-2-IgG" , "DcRl-IgG" and "DcR2-IgG") were prepared by fusing the extracellular domain sequence of each receptor to the hinge and Fc region of human immunoglobulin Gj heavy chain in pRK5 as described previously [Ashkenazi et al . , Proc. Natl. Acad. Sci., 88 : 10535-10539 (1991)] . The immunoadhesm proteins were expressed by transient transfection into human 293 cells and purified from cell supernatants by protein A affinity chromatography, as described by Ashkenazi et al . , supra . Purified immunoadhesm was suspended in phosphate buffered saline (PBS) . Balb/C mice (from Charles River Laboratories) were immunized into each hind foot pad 14 times at 3-4 day intervals, with a mixture of DR4-IgG, Apo-2-IgG, DcRl-IgG and DcR2-IgG (1 μg each) suspended in monophosphoryl lipid A plus trehalose dicorynomycolate adjuvant (MPL-TDM; Ribi Immunochem. Research Inc., Hamilton, MT ) at a 1:1 ratio of immunoadhes : adj uvant (DcR2-IgG was only included in the mixture used for tne final six immunizations) .
Three days after tne final boost, popliteal lymph node cells nodes were removed from the mice and a single cell suspension was prepared m DMEM media (obtained from Biowhita ker Corp.) supplemented with 1 penicillin- streptomycin. The lymph node cells were fused with murine myeloma cells P3X63AgU.l (ATCC CRL 1597) using 35 polyethylene glycol and cultured in 96- well culture plates. Hybridomas were selected m super DMEM [DMEM plus 10c fetal calf serum
(FCS), 10 NCTC-109 (BioWittakei, Wakersville, MD) , 100 mM pyruvate, 10C U/ml msulm, 100 mM oxaloacetic acid, 2 mM glutamme, 1 nonessential ammo acids (GIBCO) , 100 U/ml penicillin and 100 μg/ml streptomycin] containing 100 μM hypoxanthme, 0.4 μM ammopterin, and 16 μM thymidme (lx HAT, Sigma Chemical Co., St. Louis, MO). Ten days after the fusion, 180 μl of each hybridoma culture supernatant was screened for the presence of antibodies to three different antigens (i.e. DR4-IgG, Apo-2-IgG and CD4-IgG control) m a capture ELISA. Hybridoma cells were re-fed with 200 μl of super DMEM containing 10% FCS and antibiotics. Two days later, 180 μl of culture supernatant was collected and screened for the presence of antibodies to another two different antigens (i.e. DcRl-IgG and DcR2-IgG) m a capture ELISA.. After careful examination of the ELISA results, potential positive hybridomas secreting monoclonal antibodies against each antigen were cloned twice using a limiting dilution method.
EXAMPLE 15 Antibody Isotypmg The isotypes of the 2B3.7.1; 4B9.23.6; 5C7.9.1; 3H1.18.10; 3C9.8.6; 4H10.14.10; 3H3.14.5 and 3D5.1.10 antι-Apo-2 antibodies (described Example 14) were determined essentially as described m Example 13.
The isotypmg analysis showed that the 2B3.7.1; 5C7.9.1; 3H1.18.10; 3H3.14.5 and 3D5.1.10 antibodies are IgGl antibodies. Antι-Apo-2 antibodies 4B9.23.6 and 4H10.14.10 are IgG2a antibodies, and antibody 3C9.8.6 is an IgG2b antibody. (See, also, Figure 12)
EXAMPLE 16 Determination of Monoclonal Antibody Affinities The equilibrium dissociation and association constant rates of two of the Apo-2 antibodies (described m the Examples above) were determined using KmExA™, an automated immunoassay system (Sapidyne Instruments, Inc., Boise, ID), as described with a modification by Blake et al . , Journal of Biological Chemistry, 271:27677-685 (1996); and Craig et al . , Journal of Molecular Biology, 281:183-201 (1998). Briefly, 1.0 ml of anti-human IgG agarose beads (5b πin, Sigma, St. Louis, MO) were coated with 20 μg of Apo-2- IgG (described m Example 9) m PBS by gentle mixing at room temperature for
1 hour. After washing with PBS, non-specific binding sites were blocked by incubating with 10 „ human serum in PBS for 1 hour at room temperature.
A bead pack (~4 mm hiαh) was created m the observation flow cell by the KmExA™ instrument. The blocked beads were diluted into 30 ml of assay buffer (0.01 BSA/PBS). The diluted beads (550 ill) were next drawn through the flow cell with a 20 urn screen and washed with 1 ml of running buffer (0.01% BSA; 0.05 Tween 20 m PBS). The beads were then disrupted gently with a brief backflush of running buffer, followed by a 20 second setting period to create a uniform and reproducible bead pack. For equilibrium measurements, tne selected Apo-2 antibodies (3F11.39.7 and 3H3.14.5) (5 ng/ml m 0.01 BSA/PBS) were mixeα w th a serial dilution of Apo-2-IgG (starting from 2.5 nM to 5.0 pM) and were incubated at room temperature for
2 hours. Once equilibrium was reached, 4.5 ml of this mixture was drawn through the beaαs, followed by 250 μl of running buffer to wash out the unbound antibodies. The primary antibodies bound to beads were detected by 1.5 ml of phycoerythrm labeled goat anti-mouse IgG (Jackson Immunoresearch) . Unbound labeled material was removed by drawing 4.5 ml of 0.5 M NaCl through the bead pack over a 3 minute period. The equilibrium constant was calculated using the software provided by the manufacturer (Sapidyne, Inc. ) .
The affinity determinations for the Apo-2 antibodies are shown m
Figure 13. Affinity determinations for immunoadhesm constructs of the DR4 and Apo-2 receptors for Apo-2L are shown for comparison. The affinities (Kd-1) of the antibodies 3F11.39.7 and 3H3.14.5 were 20 pM and 5 pM, respectively, demonstrating that both antibodies have high affinities.
EXAMPLE 17 Apoptosis Assay of Human Tumor Cell Lines The apoptotic activities of the Apo-2 monoclonal antibodies were further examined in assays to determine the cell viability of cancer cells after treatment with the antibodies or Apo-2L.
SKMES-1 cells (human lung tumor cell line; ATCC) , Colo205 cells (human colon tumor cell line; ATCC), or G142 human glioma cells (Dr. Manfred Westphal, Universitats Krankenhaus Eppendorf, Hamburg, Germany) were seeded at 4x10' cells/well complete high glucose 50:50 medium supplemented with glutamme, penicillin and streptomycin, in tissue culture plates and allowed to attach overnight at 37 °C. The media was then removed from the wells, and 0.1 ml of antibody (antι-Apo-2 antibodies diluted 0.001-10 microgram/ml complete medium) was added to selected wells. Control wells without antibody received a media change with or without Apo-2L. The plates were then incubated for 1 hour at room temperature.
The culture supernatant was removed from the wells containing the test antibodies, and 10 microgram/ml goat anti-mouse IgG-Fc (Cappel Laboratories) was added to the wells. Media was changed m the control wells. The plates were incubated overnight at 37°C. As a control, Apo-2L (as described m Example 11) (in potassium phosphate buffer, pH 7.0) was diluted to 2 microgram/ml . 0.1 ml of the diluted Apo-2L solution was added to selected wells, and then serial three-fold dilutions were carried down the plate. Culture supernatants were then removed from the wells by aspiration, and the plates were flooded with 0.5 crystal violet m methanol solution. After 15 minutes, the crystal violet solution was removed by flooding the plates with running tap water. The plates were then allowed to dry overnight . Absorbance was read on an SLT 340 ATC plate reader (Salzburg, Austria) at 540 nm. The αata was analyzed using an Excel macro and 4p-fιt. The results illustrating the activity of the Apo-2 antibodies on SKMES cells are shown in Figure 14. Figure 14 shows that all the monoclonal antibodies tested (except 3H1.18.10) induced apoptosis when the monoclonal antibodies were linked by the addition of goat anti-mouse IgG-Fc antibodies. The most potent apoptotic activity was observed with antibody 3H3.14.5. The EC50 of the 3H3.14.5 antioody was approximately 10 ng/ml, while the EC50 of Apo-2 ligand was approximately 100 ng/ml, suggesting that the 3H3.14.5 antibody may have more potent apoptotic activity that Apo-2 ligand. In the absence of the goat anti-mouse IgG-Fc linker, the monoclonal antibodies did not demonstrate significant apoptotic activity. This result suggests it may be important for oligomeπzation of Apo-2 receptors to occur m order to induce apoptosis .
The results illustrated m Figure 15A and 15B show the activity of the Apo-2 antibodies on the Colo205 colon cancer cells and glioma cells, respectively. As shown above for the SKMES cells, the antibodies 3F11.39.7 and 3H3.14.5 demonstrated potent apoptotic activities on the Colo205 cells.
The 3H3.14.5 antibody appeared to be more potent that Apo-2 ligand. Even more striking effects of the 3H3.14.5 and 3F11.39.7 antibodies were obtained with the glioma G142 cells (which express Apo-2 receptor but not DR4 receptor). At 1 microgram/ml, Apo-2 ligand induced approximately 50" killing of the G142 cells. In contrast, the 3H3.14.5 and 3F11.39.7 antibodies (at 0.1 microgram/ml ) could induce approximately 90 killing of the G142 tumor cells. These results suggest that m cancer cells expressing Apo-2 receptor but not DR4 , such antι-Apo-2 antibodies may be more potent apoptotic inducing agents.
EXAMPLE 18
ELISA Assay to Test Binding of Apo-2 Antibodies to Other Apo-2L Receptors
An ELISA assay was conducted (as described m Examples 9 and 12) to determine binding of the Apo-2 antibodies to other known Apo-2L receptors, beside Apo-2.
The results are shown m Figure 12 and 16. Antibody 3D5.1.10 demonstrated a significant level of binding to DR4 although it did not bind to DcRl and DcR2. Antibodies 3F11.39.7 and 3H1.18.10 bind Apo-2 specifically while antibody 3H3.14.5 demonstrated a low level of cross reactivities to DR4 and DcRl.
EXAMPLE 19 Determination of Blocking Activity of antι-Apo-2 Antibodies
In a capture ELISA, 96-well microtiter plates (Maxisorb; Nunc, Kamstrup, Denmark) were coated by adding 50 μl of 2 μg/ml goat anti-human IgG Fc (purchased from Cappel Laboratories) m PBS to each well and incubating at 4°C overnight. The plates were then washed three times w th wash buffer (PBS containing 0.05 Tween 20). The wells m the microtiter plates were then blocked with 200 μl of 2.0 bov e serum albumin m PBS and incubated at room temperature for 1 hour. The plates were then washed again three times with wash buffer.
After the washing step, 100 μl of various concentrations of anti- Apo-2 antibodies in assay buffer was added to each well. The plates were incubated for 1 nour at room temperature on a shaker apparatus, followed by washing three times with wash buffer. Following the wash steps, the plate wells were incubated with 50 μl/well of 10 ng/ml of Apo-2L (ammo acids 114-281; prepared as described in Example 11) . The plates were incubated at room temperature for 1 hour on a shaker apparatus. The Apo-2L bound to the wells was then detected by the addition of biot ylated anti-Apo—2L monoclonal antibody, 2E11 (ATCC HB- 12256), followed by the addition of streptavid .
The results are illustrated m Figure 17. Antibodies 3H3.14.5, 3F11.39.7, 3C9.8.6, and 4H10.14.10 inhibited the binding of Apo-2 ligand to the Apo-2 receptor captured to the goat anti human IgG-coated ELISA wells, demonstrating that these antibodies are blocking antibodies. Antibody 3H3.14.5 appeared to have the strongest blocking activity. The blocking activities of the antibodies are also summarized m Figure 12.
EXAMPLE 20 In vivo Activity of Apo-2 Antibodies
Colo205 cells (human colon tumor cell line; ATCC) were grown m high glucose F-12:DMEM (50:50) medium supplemented with 10 u FCS, 2 mM glutamme,
100 μg/ml of penicillin, and 100 μg/ml streptomycin. The cells were harvested after treating with cell dissociation medium (Sigma, IAC) for 5 minutes. After washing in PBS, the tumor cells were resuspended m PBS at a concentration of 3X107 cells/ml.
Nude mice were injected with 3-5 X 10b cells subcutaneously m the dorsal area m a volume of 0.1 ml. Control animals received either a control IgGl antibody or PBS vehicle alone. When the tumor size in the Colo205 tumor bearing animals became a desired size, the mice were injected l.p. with 100 μg of 3F11.39.7 or 3H3.14.5 antι-Apo-2 antibody m PBS three times per week, and the tumor sizes were measured three times/week.
The results illustrated m Figure 18 show that both 3F11.39.7 antibody and 3H3.14.5 antibody inhibited qrowth of Colo205 tumors. Compared to the tumor growth n the group of mice treated with control IgGl or none, the group of mice treated with antibody 3H3.14.5 or 3F11.39.7 showed almost no detectable tumor qrowth. On Day 20, four out of eight mice showed no visible tumor growth after treatment with antibody 3H3.14.5, while two out of eight mice showed no visible tumor growth after treatment with antibody 3F11.39.7. The results suggest that the monoclonal antibodies alone may be potent anti-cancer therapeutic agents. It is presently believed that component (s) in the treated animals' serum may link the administered (IgGl) monoclonal antibodies, resulting m the potent agonistic anti-cancer activity observed.
EXAMPLE 21
Crystal Structure Analysis of Apo-2 Receptor/Apo-2L Complex Experiments were conducted to determine the crystal structure of the complex between Aoo-2L and an extracellular domain sequence of Apo-2. As described below, the structure revealed three thin, elongated receptors snuggled into long crevices between pairs of monomers of the homotrimeric Apo-2 ligand. The interface is divided into two distinct patches, one near the "bottom" of the complex close to the receptor cell surface and one near the "top" closest to the ligand cell surface. Both patches contain residues that are believed to be critical for high-affmity binding. It is believed that the top patch may recognize conserved hydophobic features, while the bottom patch may control specificity and cross-reactivity .
1. Expression and purification Apo-2L (residues 114-281; ammo acid sequence provided m Pitti et al . , supra) was expressed in E . col i and purified as described m Ashkenazi et al., J. Clm. Invest., ££4:155-162 (1999). Apo-2 (residues 1-130; see Fig. 1; SEQ ID NO : 1 ) was expressed in Hι5 insect cells (Expression Systems LLC, Woddland, CA) with a baculovirus transfer vector (PharMingen, San Diego, CA) under the control of a polyhedron promoter. Protein was secreted from the cells grown at 27 °C over 72 hours. The Apo-2-contammg medium was separated from the cells by centrifugation. The supernatent was run over a Q-sepharose (Pharmacia) column and the protein eluted with a 0-1M NaCl gradient m 20mM Tπs-HCl, pH 8.0. The fractions containing Apo-2 were pooled and loaded onto a CNBr-Apo-2L affinity column. The column was washed with 0.5M NaCl m 20mM Tris-HCL, pH 8.0, and Apo-2 was eluted with 2M KSCN m 50mM Tπs, pH 8.0. Apo-2 was further purified by size exclusion chromatography (S-200, Pharmacia). Apo-2L in 20mM Tris-HCl, pH 8.0 was added to purified Apo-2 m approximately equimolar concentrations, and the complex was purified by size exclusion chromatography S-75, Pharmacia) m 100 mM NaCl, 20mM Tris-HCl, pH 8.0. The fraction containing the Apo-2L/Apo- 2 complex was further purified by anion exchange chromatography (MonoQ, Pharmacia) and eluted with a 0-1M NaCl gradient m 20mM Tris, pH 8.0. The complex was then concentrated to approximately 3.7 mg/mL and buffered with 20mM Tris-HCl, pH 8.0, 0.1 M NaCl. 2. Crystallization and data collection Crystals of the Apo-2L/Apo-2 complex were grown by vapor diffusion at
19°C using the hanging drop method The initial crystals were growr m condition 37 of the Hampton Crystal Screen II (10 PEG 8000, 8 ethylene glycol, 0.1 M Heoes, pH 7.5). The crystals used for data collection were grown by mixing 2 microtiter of protein solution with 2 microliter of reservoir consisting of 15 PEG 8000, 10 ethylene glycol, 0.2M ammonium sulfate, 0.1M Tris-HCl, pH 7.5, and grew to a size of 0.3 mm x 0.15 mm x 0.1 mm. The crystals were transferred briefly to a droplet containing reservoir solution with 20 glycerol before flash-cooling liquid nitrogen. The crystals belonged to space group P2χ2ι2χ and had unit cell dimensions a=66.8 A, b= 112.0 A, c=130.8 A. The asymmetric unit contained one Apo-2L trimer and three receptor molecules. A 3.5 A data set was collected on a MAR imaging plate system using a Rigaku rotating anode generator with CuKalpha radiation. A subsequent data set to 2.4 A resolution was collected from a single crystal at beam line 1 - 1 of the Stanford Synchrotron Radiation Laboratory. The data sets were processed using the programs m the HKL package (Otwmowski and Minor, Methods Enzymol . , 176 : 307-326 (1997)). 3. Structure determination and refinement The Apo-2/Apo-2L structure was determined by molecular replacement using the structure of Apo-2L alone as the search model in combination with three-fold non-crystallographic symmetry (NCS) map averaging. Using all data from 8-4 A, the program AMoRe (CCP4, Acta Cryst., £50:760-763 (1994)) gave a clear rotation solution with a correlation coefficient of 30.4° (the nearest incorrect peak had a correlation coefficient of 7.3%). The top solution to the translation function had an initial Rfree (Brunger, Nature, ££5:472-475 (1992)) of 42.4% following rigid-body fitting using all data between 8 and 3.5A. Similar searches using the structure of Apo-2L bound to a homology model of Apo-2 based on the TNF-beta-TNFRl complex resulted m worse molecular replacement statistics, but a three-fold NCS-averaged and solvent-flattened map using program DM (CCP4, supra) revealed partial density for the receptor. Three cycles of model building, NCS mask refinement, and density averaging allowed building of receptor residues 22- 130. This model was refined with X-PLOR 98.1 (Brunger, X-PLOR Manual, Version 3.1, New Haven, Connecticut, Yale University (1992)) as modified by Molecular Simulations, Inc., using a maximum likelihood target function, NCS constraints, positional refinement, simulated annealing and grouped B- factors until Rfree reached 33.5%. This partially refined model was then further refined aqainst the 2.4 A data set, using programs X-PLOR and REFMAC (CCP4, supra) . Examination of sigma weighted 2Fo-Fc and Fo-Fc maps revealed that differences existed among the three receptor copies, especially between residues 100 to 130. In subsequent refinement the Apo-2L turner was subject to tight NCS restraints, while weak restraints were applied to the most similar regions of the receptors. An overall amsotropic B-factor correction was applied to the data as was a real space bulk solvent correction (Brunger, X-PLOR Manual, supra) . The final model consists of three Apo-2L monomers (A, B, and D), containing residues 119-131 and 144-281 (using the ammo acid sequence numbering provided m Pitti et al., supra) , and Apo-2 receptor chains R (residues 21-128) and S and T (residues 22-130) .
Refinement and model statistics are shown Figure 19. The programs
Molscπpt and Raster3D were used to make figures (Kraulis, J . Appl . Cryst . ,
£4:946-950 (1991); Merπt and Murphy, Acta Cryst. , ££0:869-873 (1994)). The comple-* formed between the extracellular domain sequence of Apo-2
(residues 1-130) and Apo-2L (residues 114-281) crystallized readily and was found to contain three receptors and three ligands assembled as a hexameric complex m the asymmetric unit. Diffraction data were collected using synchrotron radiation, and the structure was refined to 2.4 A resolution and an R-value of 23.2 (Rfree of 27.7 ; Figure 19). The final model consists of Apo-2L residues 119-131 ana 144-281 in each monomer, and Apo-2 residues
21-128 of one cop\ and 22-130 of the other two (Figure 20).
2 Each of the three extensive interaction surfaces buries 2750 A of
2 X solvent accessible surface area, 1400 A from the receptor and 1350 A from the ligand. Two receptor loops mediate most of the interactions, dividing the interface in two distinct patches (Figure 21): the "50s loop" (residues 51-65; Fig. 1; SEQ ID NO : 1 ) and the "90s loop" (residues 91-104; Fig. 1, SEQ
ID NO:l). In patch A, the 90s loop interacts with a cluster of Apo-2L residues around Gin 205 near the bottom of the tπmer, while patch B is formed by the 50s loop of Apo-2 and Apo-2L residues clustered around Tyr 216 near the top of tne tπmer (Figure 21) .
*.2 Patch A is the larger of the two, with 1790 A of total buried
. 2 . 2 accessible surface area (880 A from the receptor and 910 A from the ligand) . The 90s loop of Apo-2 contributes 85% of the buried surface area
2 .2
(750 A ) while the remaining 130 A is a result of small contributions from Apo-2 receptor residues 65-69 and 108, 111, 122, and 125.
• 2 .2
Patch B is the smaller of the two patches (890 A total, 480 A from
• 2 the receptor, 410 A from the ligand) . Here, the 50s loop of the receptor interacts with the 210s and the 150s loops of Apo-2L. This patch is centered on Apo-2L residue Tyr 216, which binds m a hydrophobic groove on the receptor surface formed by the side chains of Apo-2 residues His 53, Asn 55, Leu 57, Leu 58 and Phe 59. The interactions with the 150s loop are more peripheral and polar m nature, and are primarily mediated through contacts between Arg 62 on the receptor with Apo-2L residues Glu 155 and Ser 159. The actual ligand-bmdmg motif found m CRDs 2 and 3 corresponds to Apo-2 residues 43 to 130. * * * * *
Deposit of Material
The following materials have been deposited with the American Type Culture Collection, 10801 University Blvd., Manassas, Virginia, USA (ATCC): Material ATCC Pep. No. Deposit Date pRK5-Apo-2 209021 May 8, 1997
3F11.39.7 HB-12456 January 13, 1998
3H3.14.5 HB-12534 June 2, 1998
3D5.1.10 HB-12536 June 2, 1998 3H1.18.10 HB-12535 June 2, 1998
This deposit was made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the
Purpose of Patent Procedure and the Regulations thereunder (Budapest Treaty) .
This assures maintenance of a viable culture of the deposit for 30 years from the date of deposit. The deposit will be made available by ATCC under the terms of the Budapest Treaty, and subject to an agreement between Genentech, Inc. and ATCC, wn^ch assures permanent and unrestricted availability of the progeny of the culture of the deposit to the public upon issuance of the pertinent U.S. patent or upon laying open to the public of any U.S. or foreign patent applicatio , whichever comes first, and assures availability of the progeny to one determined by the U.S. Commissioner of Patents and Trademarks to be entitled thereto according to 35 USC Section 122 and the Commissioner's rules pursuant thereto (including 37 CFR Section 1.14 witn particular reference to 886 OG 638). T e assignee of the present application has agreed that if a culture of the materials on deposit should die or be lost or destroyed when cultivated under suitable conditions, the materials will be promptly replaced on notification with another of the same. Availability of the deposited material is not to be construed as a license to practice the invention m contravention of the rights granted under the authority of any government in accordance with its patent laws.
The foregoing written specification is considered to be sufficient to enable one skilled m the art to practice the invention. The present invention is not to be limited m scope by the construct deposited, since the deposited embodiment is intended as a single illustration of certain aspects of the invention and any constructs that are functionally equivalent are within the scope of this invention. The deposit of material herein does not constitute an admission that the written description herein contained is inadequate to enable the practice of any aspect of the invention, including the best mode thereof, nor is it to be construed as limiting the scope of the claims to the specific illustrations that it represents. Indeed, various modifications of the invention in addition to those shown and described herein will become apparent to those skilled m the art from the foregoing description and fall within the scope of the appended claims.

Claims

at is c aime is:
1. A method of inducing apoptosis mammalian cells expressing Apo-2 receptor comprising exposing mammalian cells expressing Apo-2 receptor to an effective amount of an Apo-2 agonist antibody.
2. The method of claim 1 wherein said Apo-2 agonist antibody is a monoclonal antibody.
3. The method of claim 1 wherein said Apo-2 agonist antibody is a chimeric antibody.
4. The method of claim 1 wherein said Apo-2 agonist antibody is a humanized antibody .
5. The method of claim 1 wherein said Apo-2 agonist antibody is a human antibody.
6. The method of claim 2 wherein said monoclonal antibody is produced by the hybridoma deposited as ATCC HB-12456.
7. The method of claim 2 wherein said monoclonal antibody is produced by the hybridoma deposited as ATCC HB-12534.
8. The method of claim 2 wherein said monoclonal antibody is produced by the hybridoma deposited as ATCC HB-12536.
9. The method of claim 2 wherein said monoclonal antibody is produced by the hybridoma deposited as ATCC HB-12535.
10. A method of treating cancer, comprising exposing mammalian cancer cells to an effective amount of an Apo-2 agonist antibody.
11. The method or claim 10, wherein said cancer cells are lung cancer cells.
12. The methoα of claim 10, wherein said cancer cells are colon cancer cells .
13. The method of claim 10, wherein said cancer cells are glioma cells.
EP00963542A 1999-09-15 2000-09-14 Apo-2 receptor antibodies Withdrawn EP1226161A2 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
EP05014041A EP1616882A3 (en) 1999-09-15 2000-09-14 Apo-2 receptor antibodies

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US39671099A 1999-09-15 1999-09-15
US396710 1999-09-15
PCT/US2000/025436 WO2001019861A2 (en) 1999-09-15 2000-09-14 Apo-2 receptor antibodies

Related Child Applications (1)

Application Number Title Priority Date Filing Date
EP05014041A Division EP1616882A3 (en) 1999-09-15 2000-09-14 Apo-2 receptor antibodies

Publications (1)

Publication Number Publication Date
EP1226161A2 true EP1226161A2 (en) 2002-07-31

Family

ID=23568354

Family Applications (2)

Application Number Title Priority Date Filing Date
EP05014041A Withdrawn EP1616882A3 (en) 1999-09-15 2000-09-14 Apo-2 receptor antibodies
EP00963542A Withdrawn EP1226161A2 (en) 1999-09-15 2000-09-14 Apo-2 receptor antibodies

Family Applications Before (1)

Application Number Title Priority Date Filing Date
EP05014041A Withdrawn EP1616882A3 (en) 1999-09-15 2000-09-14 Apo-2 receptor antibodies

Country Status (6)

Country Link
EP (2) EP1616882A3 (en)
JP (1) JP2003510253A (en)
AU (2) AU7494300A (en)
CA (1) CA2384762A1 (en)
IL (1) IL148266A0 (en)
WO (1) WO2001019861A2 (en)

Families Citing this family (13)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7528239B1 (en) 1997-02-13 2009-05-05 Immunex Corporation Receptor that binds trail
US7279160B2 (en) 2000-05-02 2007-10-09 The Uab Research Foundation Combinations of DR5 antibodies and other therapeutic agents
US7476383B2 (en) 2000-05-02 2009-01-13 The Uab Research Foundation Antibody selective for DR4 and uses thereof
TWI318983B (en) 2000-05-02 2010-01-01 Uab Research Foundation An antibody selective for a tumor necrosis factor-related apoptosis-inducing ligand receptor and uses thereof
US7115717B2 (en) 2001-05-18 2006-10-03 Kirin Beer Kabushiki Kaisha Anti-TRAIL-R antibodies
US7361341B2 (en) 2001-05-25 2008-04-22 Human Genome Sciences, Inc. Methods of treating cancer using antibodies that immunospecifically bind to trail receptors
US7348003B2 (en) 2001-05-25 2008-03-25 Human Genome Sciences, Inc. Methods of treating cancer using antibodies that immunospecifically bind to TRAIL receptors
IL161686A0 (en) * 2001-11-01 2004-09-27 Uab Research Foundation Combinations of antibodies selective for a tumor necrosis factor-related apoptosis-inducing ligand receptor and other therapeutic agents
US20050069549A1 (en) 2002-01-14 2005-03-31 William Herman Targeted ligands
KR20060132006A (en) 2004-03-23 2006-12-20 비오겐 아이덱 엠에이 아이엔씨. Receptor Coupling Agents and Their Therapeutic Uses
JP5562521B2 (en) 2005-02-02 2014-07-30 ザ ユーエービー リサーチ ファンデーション Agents and methods relating to reducing resistance to apoptosis-inducing death receptor agonists
PE20071101A1 (en) 2005-08-31 2007-12-21 Amgen Inc POLYPEPTIDES AND ANTIBODIES
CA2631327C (en) 2005-12-02 2015-10-13 Genentech, Inc. Her2 binding polypeptides and uses thereof

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6046048A (en) * 1996-01-09 2000-04-04 Genetech, Inc. Apo-2 ligand
ES2293682T5 (en) * 1997-05-15 2011-11-17 Genentech, Inc. ANTI-APO2 ANTIBODY.
IL133122A0 (en) * 1997-06-18 2001-03-19 Genentech Inc Apo-2dcr polypeptides

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0119861A2 *

Also Published As

Publication number Publication date
WO2001019861A3 (en) 2001-05-17
WO2001019861A2 (en) 2001-03-22
EP1616882A3 (en) 2007-02-28
AU2009238386A1 (en) 2009-12-10
IL148266A0 (en) 2002-09-12
AU7494300A (en) 2001-04-17
JP2003510253A (en) 2003-03-18
WO2001019861A9 (en) 2002-09-26
EP1616882A2 (en) 2006-01-18
CA2384762A1 (en) 2001-03-22

Similar Documents

Publication Publication Date Title
CA2287911C (en) Apo-2 receptor
US7807153B2 (en) Apo-2 receptor agonist antibodies
AU2009238386A1 (en) Apo-2 receptor antibodies
US20060177456A1 (en) Apo-2 receptor antibodies
EP1009817A1 (en) Rtd receptor
US20120042400A1 (en) Rtd receptor
AU2005246957A1 (en) APO-2 receptor antibodies
US20100152426A1 (en) Apo-2 receptor fusion proteins
AU2008202977A1 (en) APO-2 receptor
AU2011202895A1 (en) APO-2 receptor
AU2008201807A1 (en) Apo-2dcr

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17P Request for examination filed

Effective date: 20020314

RIN1 Information on inventor provided before grant (corrected)

Inventor name: KIM, K., JIN

Inventor name: ASHKENAZI, AVI, J.

Inventor name: CHUNTHERAPAI, ANAN

17Q First examination report despatched

Effective date: 20040607

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060815