EP1222212A1 - Il13 mutants - Google Patents

Il13 mutants

Info

Publication number
EP1222212A1
EP1222212A1 EP00968773A EP00968773A EP1222212A1 EP 1222212 A1 EP1222212 A1 EP 1222212A1 EP 00968773 A EP00968773 A EP 00968773A EP 00968773 A EP00968773 A EP 00968773A EP 1222212 A1 EP1222212 A1 EP 1222212A1
Authority
EP
European Patent Office
Prior art keywords
mutant
cell
receptor
composition
cells
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00968773A
Other languages
German (de)
French (fr)
Other versions
EP1222212A4 (en
Inventor
Waldemar Debinski
Jeffrey P. Thompson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Penn State Research Foundation
Original Assignee
Penn State Research Foundation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Penn State Research Foundation filed Critical Penn State Research Foundation
Publication of EP1222212A1 publication Critical patent/EP1222212A1/en
Publication of EP1222212A4 publication Critical patent/EP1222212A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/54Interleukins [IL]
    • C07K14/5437IL-13
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P11/00Drugs for disorders of the respiratory system
    • A61P11/06Antiasthmatics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P37/00Drugs for immunological or allergic disorders
    • A61P37/08Antiallergic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K2319/00Fusion polypeptide

Definitions

  • Human interleukin 13 (hIL13) is a 114 amino acid cytokine secreted by activated T
  • hIL13 is involved in regulating several different physiological conditions
  • hIL13 has been shown to downregulate the production of cytokines
  • IL-13 has also been shown to act on other cell types.
  • IL13 has been shown to modulate expression of vascular cell adhesion mole-
  • VCAM-1 cule-1 (VCAM-1) on endothelial cells. Sirom et al. (1994) Blood, 84:1913-1921; Bochner et
  • hIL13 is a globular protein comp ⁇ sed mamly of four alpha-helical regions (helices A, B, C,
  • pi 40 a heterodimer that includes a first subunit of approximately 140 kDa termed pi 40, and a
  • hIL 13 does not bind pi 40 m the absence of ⁇ ' Vita et al. (1995) J Biol
  • the rest ⁇ cted receptor binds hIL13 but not hIL4
  • the rest ⁇ cted receptor is also sometimes called the
  • IL13 has been shown to be involved in pathways that regulate airway
  • the invention relates to the development and characte ⁇ zation of several mutants of
  • Mutants withm the invention include those having one or more of the e amino acids
  • X is the letter abbreviation of the ammo acid that was replaced, and X 2 is the letter
  • hIL13 E13K represents a mutant
  • hIL13 replaced with a lvsme residue Representative mutants within the invention include ML13.E13K, ML13.E13I, hIL13.E13C, ML13.E13S, hIL13.E13R, ML13.E13Y,
  • compositions including a mutant hIL13 having an ammo
  • mutants can have a mutation in a domain corresponding to the A, C, or D alpha-helices of
  • Exemplary mutants include those with a polypeptide having an ammo acid
  • Mutants of hIL13 withm the invention can be those that specifically bind the shared
  • IL4/IL13 receptor but not the rest ⁇ cted (IL4-mdependent) receptor; those that specifically
  • Some hIL13 mutants of the invention specifically bind to an hIL13 receptor
  • This change can be of greater or less magnitude than a change in the cell's physiology that
  • compositions within the invention can include both an ML 13 mutant and a
  • Mutants of ML 13 withm the invention can be conjugated to an effector molecule such as
  • cytotoxin e g . Pseudomonas exotoxin, PE38QQR. PE1E, PE4E, Dipthe ⁇ a toxin, ⁇ cm.
  • the invention includes a purified nucleic acid encoding a mutant
  • ML13 Also within the invention is an antibody that specifically binds a mutant ML 13
  • the invention features a
  • the method can include the steps of:
  • interleukin 13 the amino acid sequence of which is shown herein as SEQ ID NO: l.
  • hIL13 mutant or a "mutant ML 13 molecule” means an ML 13 in which
  • one or more of the amino acids differ from the corresponding amino acids in the native
  • ML 13 can have an ammo acid other than glutamic acid at position 13 (e.g., glutamic acid is
  • mutant IL13 molecules of this invention are substituted with lysine. It will appreciated that mutant IL13 molecules of this invention.
  • mutant IL13 molecules of other mammalian species e.g., rat, murine, porcine, ovine.
  • mutant IL13 in veterinary as well as human medical conditions.
  • protein and “polypeptide” are used synonymously to mean
  • polypeptide is one that
  • polypeptide occurs (e.g., 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99,
  • nucleic acid or a “nucleic acid molecule” means a chain of two or
  • nucleo tides such as RNA (ribonucleic acid) and DNA (deoxy ⁇ bonucleic acid).
  • nucleic acid from other nucleic acid sequences m a cell or organism in wMch the nucleic acid naturally
  • a recombinant nucleic acid molecule incorporated into a vector
  • nucleic acid examples include a virus, or a genome of a prokaryote or eukaryote.
  • purified nucleic acid examples include a virus, a virus, or a genome of a prokaryote or eukaryote.
  • acids include cDNAs. fragments of genomic nucleic acids, nucleic acids produced
  • PCR polymerase chain reaction
  • genomic nucleic acids recombinant nucleic acids, and chemically synthesized nucleic acid
  • a "recombinant" nucleic acid molecule is one made by an artificial combination
  • sequence identity means the percentage of identical subumts at
  • both of the two sequences is occupied by the same monome ⁇ c subunit. e.g., if a given
  • sequence identity is typically measured
  • sequence analysis software e.g., Sequence Analysis Software Package of the Genetics
  • antibody an immunoglobulin as well as any portion or
  • immunoglobulin or by techniques in molecular biology.
  • the term also refers to a mixture
  • an immunoglobulin or portion or fragment thereof
  • an antiserum such as an antiserum
  • the specified ligand or antibody binds to its particular "target” (e.g. an antibody).
  • IL13 specifically binds to an IL13 receptor) and does not bind in a significant amount to other
  • molecule has a binding affinity greater than about 10 5 (e.g., 10 6 , 10 7 , 10 8 , 10 9 , 10 10 , 10".
  • a “mutation” in a polypeptide refers to the substitution of an amino acid at a
  • the mutation ML13.E13K indicates that the native amino acid at position 13 in IL13
  • a mutation can be the deletion
  • FIG. 1 is a photograph of a SDS-PAGE (A) and Western blot (B) analysis of purified
  • FIG. 2 is circular dichroism (CD) spectra obtained from purified ML 13 and va ⁇ ous
  • ML13 mutants Each protein was diluted in PBS (0.1 mg/ml), thermally equilibrated to 37°C.
  • FIG. 3 is grapMcal representations of data obtained from proliferation assays using
  • TF-1 cells induced with ML 13 and various ML 13 mutants were cultured in the
  • Panels represents ML 13 alpha-helix A mutants that increased TF-1 cell
  • FIG. 4 is a series of photomicrographs of indirect immuno fluorescence analyses of
  • sensitivity of the imaging camera was set to detect the level of fluorescence in the control
  • FIG. 5 is grapMcal representations of data obtained from cytotoxicity assays
  • the reported data is the average of t ⁇ plicate samples with the error bars representing the
  • TMs invention encompasses compositions and methods relating to ML 13 mutants.
  • PCR polymerase chain reaction
  • PCR-primer pairs can be
  • RT-PCR Reaction Reaction
  • nucleic acids can be synthesized, for example, on
  • mutant ML 13 molecules of the invention are based on the amino acid sequence of
  • the ML 13 mutants within the invention differ by one or more
  • ML 13 mutants witiiin the invention can have
  • ML13 examples of ML 13 mutants within the invention are those having the amino acid
  • the invention are those with two or more (e.g., 3, 4, 5, 6, 7, 8, 9,10 or more) such amino acid
  • substitutions as well as deletion (e.g., truncation) and addition (i.e., those with additional
  • Mutants of ML13 can be made in a number of ways by adapting techniques well
  • ML 13 mutants can be synthesized as a single polypeptide. Alternatively, shorter
  • ohgopeptide portions of the mutant ML 13 molecule can first be synthesized and then fused
  • the fusions can then be pu ⁇ fied by standard protein chemistry
  • Mutants of ML 13 can also be produced through recombinant expression of ML 13- encoding nucleic acids (see below) in wMch the nucleic acid is modified, randomly or m a
  • Site-specific mutations can be introduced into the IL 13 -encoding
  • ML 13 mutants can be prepared by chemically modifying native ML 13
  • nucleic acids as desc ⁇ bed above can be chemicallv modified to make
  • Mutants of ML13 can have characteristics that differ from those native ML13.
  • native ML13 has the functional characteristics of binding both shared receptor and
  • Native ML 13 also has the characteristic of inducing transmembrane
  • second messengers e.g, an increase in intracellular [Ca 2+ ], activation of protein kinases
  • transducers and activators of transcription etc. They can also be changes in the cell
  • proteome e.g., from increased or decreased transcription or translation. Or they can be
  • ML 13 to TF-1 cells can increase their rate of proliferation.
  • native ML 13 can cause HUVEC to increase their expression of VCAM-1.
  • mutants can be characterized as those that bind both the shared receptor and/or the restrictive
  • receptor those that bind only one of the receptors, and those that do not bind either receptor.
  • physiology can be those that modulate the proliferation rate of a cell line that expresses an
  • EL13 receptor such as TF-1 cells.
  • Antagonistic ML13 mutants are those that reduce the
  • mutants are those that induce about same (e.g., 50-150%) or 75-125% of) proliferation rate of
  • the invention also provides a chimeric molecule including a mutant ML 13 molecule
  • the effector molecule can be any molecule that can be
  • molecules include cytotoxins, drugs, detectable labels, targeting ligands, and delivery
  • a mutant ML13 molecule conjugated with a one or more cytoxins can be used to kill
  • Cytotoxins for use in the invention can be any suitable compound that can be used in the invention.
  • cytotoxic agent i.e., molecule that can kill a cell after contacting the cell
  • cytotoxins include, without limitation, radionuclides (e.g., 35 S, 14 C, 32 P, 125 I, 131 1, 90 Y, 89 Zr, 201 T1, I86 Re, 188 Re, 57 Cu, 213 Bi, 2U At, etc.),
  • radionuclides e.g., 35 S, 14 C, 32 P, 125 I, 131 1, 90 Y, 89 Zr, 201 T1, I86 Re, 188 Re, 57 Cu, 213 Bi, 2U At, etc.
  • antimetabolites e.g., 5-flourouricil (5-FU)
  • methotrexate e.g., 5-flourouricil (5-FU)
  • antimetabolites e.g., 5-flourouricil (5-FU)
  • methotrexate e.g., 5-flourouricil (5-FU)
  • MTX fludarabine
  • anti-microtubule agents e.g., vincristine, vinblastine, colchicine
  • taxanes such as paclitaxel and docetaxel
  • al ylating agents e.g., cyclophasphamide
  • melphalan bischloroethylnitrosurea (BCNU), etc.
  • platinum agents e.g., cisplatin (also
  • doxorubicin doxorubicin, daunorubicin, etc.
  • antibiotic agents e.g., mitomycin-C
  • topoisomerase e.g., mitomycin-C
  • ii ⁇ ibitors e.g., etoposide, tenoposide, and camptothecins
  • cytotoxic agents such as
  • ricin diptheria toxin (DT), Pseudomonas exotoxin (PE) A, PE40, abrin, saporin, pokeweed
  • PE38QQR see, U.S. Patent No.
  • Mutant ML 13 molecules conjugated with one or more detectable labels can be
  • Detectable labels for use in the invention can be any amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids, amino acids
  • detectable labels are those that can be detected, for example, by spectroscopic,
  • detectable labels in the present invention include biotin or streptavidin, magnetic beads (e.g., DynabeadsTM), fluorescent dyes (e.g., fluorescein isothiocyanate, texas red, rhodamine, green
  • radiolabels e.g., 3 H, 125 I, 35 S, 14 C, 32 P, In, 97 Ru, 67 Ga,
  • radioopaque substances such as metals for radioimaging, paramagnetic agents
  • enzymes e.g., horseradish peroxidase, alkaline phosphatase
  • colorimetric labels such as colloidal gold or
  • colored glass or plastic e.g. polystyrene, polypropylene, latex, etc. beads.
  • radiolabels may be detected using photograpMc film or scintillation counters,
  • fluorescent markers may be detected using a photo detector to detect emitted illumination.
  • colorimetric labels are detected by simply visualizing the colored label, and so forth.
  • Mutant ML13 molecules conjugated with one or more targeting ligands i.e.,
  • soluble cytokine receptors e.g., those lacking a transmembrane domain
  • IL-2 IL-4, IL-6, IL-7, tumor necrosis factor (TNF), anti-Tac,
  • TGF-alpha. SEA, SEB. and the like.
  • an ML13 mutant can be
  • conjugated with a soluble form of a ML13 receptor could be
  • Mutant ML13 molecules conjugated with one or more nucleic acids can be used to generate ML13 molecules conjugated with one or more nucleic acids.
  • a target cell e.g., one expressing an
  • ML 13 mutant can be used.
  • the nucleic acids can be attached directly to the mutant ML13,
  • lipid attached via a linker, or complexed with or encapsulated in another moiety (e.g., a lipid, a
  • nucleic acid that is attached to the mutant IL13 molecule.
  • nucleic acid can provide any of number of effector functions.
  • one or more proteins can be used to deliver a particular enzymatic activity, substrate, and/or
  • the nucleic acid is preferably a component of an
  • Suitable expression cassettes typically include promoter imtiation and
  • termination codons and are selected to optimize expression in the target cell.
  • a mutant ML 13 molecule conjugated with a one or more drugs can be used to deliver
  • conjugated to ML 13 or an ML 13 mutant can be used.
  • examples of such drugs include
  • sensitizing agents that render a target (e.g., tumor) cell susceptible to various cancer
  • the sensitizing agent can be a small molecule drug or a gene (under the control
  • HSV herpes simplex virus
  • TK thymidine kinase
  • conditional "killing" function is the bacte ⁇ al cytosine deammase gene, which confers
  • employed need not be a gene.
  • it can be one of the compounds that can treat
  • chemotherapy drugs such as doxorubicin.
  • a mutant ML 13 molecule conjugated to a one or more deliver *' vehicles is also withm
  • conjugates can be used to deliver other substances such as a drug to cells
  • Any delivery vehicle that can be conjugated to ML 13 or an ML 13 mutant can be used.
  • Examples of such delivery vehicles include
  • Liposomes and lipids e.g., micelles.
  • Liposomes encapsulatmg drugs or micelles including
  • Effector molecules can be conjugated (e.g., covalently bonded) to a mutant ML 13 by
  • mutant ML 13 can be chemically de ⁇ vatized with an effector molecule either directly or using
  • linker spacer
  • reagents e.g., cross-linkers
  • radionuchde metal chelates, toxins, and drugs to proteins are desc ⁇ bed,
  • the effector molecule is a polypeptide
  • the chimenc molecule including the
  • ML 13 mutant and the effector can be a fusion protein. Fusion proteins can be prepared using
  • a mutant ML13 may be conjugated to one or more effector molecule(s) in various
  • effector molecule may be joined to either the amino or
  • mutant IL13 carboxy termini of the mutant ML13.
  • the mutant IL13 molecule may also be joined to an
  • the effector molecule may be joined to
  • conjugates comprising linkages that are cleavable in the vicinity of the target site may be used
  • effector molecule from the mutant IL13 molecule may be prompted by enzymatic activity or
  • the target site is a tumor
  • a linker which is cleavable under conditions
  • present at the tumor site e.g. when exposed to tumor-associated enzymes or acidic pH.
  • an agent from these linker groups include, for example, irradiation of a photo labile bond and
  • irnmunoconjugates comprising linkers which are cleaved at the target site in vivo by the
  • radiotherapeutic compounds, drugs, toxins, and other agents to antibodies one skilled in the art will be able to determine a suitable method for attacMng a given effector molecule to a mutant ML 13 molecule.
  • the invention also provides pu ⁇ fied nucleic acids encoding the mutant ML 13
  • DNA encoding the mutant ML13 molecules or the fusion proteins may be prepared by any method.
  • sequences may be obtained by the ligation of shorter sequences.
  • subsequences may be obtained by the ligation of shorter sequences.
  • the fragments may then be hgated to produce the desired DNA sequence
  • DNA encoding the mutant ML 13 molecules or the fusion proteins may be cloned
  • the gene for ML 13 is PCR amplified, using primers that introduce one
  • the primers preferably include restrictions sites, e.g., a sense primer
  • the primers are selected to amplify the nucleic acid starting
  • Triis produces a nucleic acid
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may be obtained from available sources.
  • the PE38QQR fragment may
  • Pseudomonas exotoxin e.g., PE38QQR sequences and insertion into a vector produces a
  • the two molecules are joined directly. Alternatively there can be an intervening
  • peptide linker e.g., a three amino acid junction consisting of glutamic acid, alanine, and
  • the molecules may be separated by a peptide spacer consisting of one
  • the spacer will have no specific biological activity other than
  • constituent amino acids of the spacer may be selected to influence some property of the molecule such as the solubility, folding, net charge, or
  • proteins may be expressed in a variety of host cells, including E. coli, other bacterial hosts,
  • yeast and various Mgher eukaryotic cells such as the COS, CHO and HeLa cells lines and
  • the recombinant protein gene will be operably linked to appropriate
  • T7, trp, or lambda promoters a ribosome binding site and preferably a transcription
  • control sequences will include a promoter and
  • SV 40 preferably an enhancer derived from immunoglobulin genes.
  • SV 40 cytomegalovirus, etc.
  • polyadenylation sequence and a polyadenylation sequence, and may include splice donor and acceptor sequences.
  • Plasmid vectors of the invention made as described above can be transferred into the
  • Cells transformed by the plasmids can be selected by resistance to antibiotics conferred
  • genes contained on the plasmids such as the amp, gpt, neo and hyg genes.
  • the recombinant mutant ML 13 molecules or fusion proteins can be expressed.
  • compositions of at least about 90 to 95% homogeneity are provided.
  • polypeptides may then be used
  • mutant ML 13 After chemical synthesis, biological expression, or purification, the mutant ML 13
  • the molecules or the fusion proteins may possess a conformation substantially different than the
  • Mutants of ML 13 can be used to raise
  • polypeptides useful in the invention can be produced by recombinant
  • ML 13 mutants can be coupled to a
  • employed host animals include rabbits, mice, guinea pigs, and rats.
  • surface active substances such as lysolecitMn, pluronic polyols, polyanions, peptides, oil
  • BCG Bacille Calmette-Guerin
  • Corynebacterium parvum include BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
  • Polyclonal antibodies are heterogeneous populations of antibody molecules that are
  • Monoclonal antibodies which are homogeneous populations of antibodies to a
  • antigen can be prepared using the mutants of ML 13 described above and standard
  • monoclonal antibodies can be obtained by any technique that provides
  • IgG immunoglobulin class
  • IgM immunoglobulin class
  • IgE immunoglobulin class
  • IgA immunoglobulin class
  • IgD immunoglobulin class
  • a hybridoma producing a mAb of the invention may be cultivated in vitro or in vivo.
  • polyclonal or monoclonal antibodies can be tested for specific
  • antibodies can be used to monitor the amount of an ML 13 mutant associated with a cell or to
  • Antibodies of the invention can be produced using fragments of the ML 13 mutants
  • fragments are generated by standard techniques of
  • proteins are expressed in E.coli and purified using a glutathione agarose affinity matrix as
  • Non-cross reactive antibodies can be prepared by
  • antisera prepared against a particular ML13 mutant can be adsorbed with other
  • each protein, and each fusion can be injected into at least two rabbits. Antisera can be raised
  • proteins such as glucocorticoid receptor, CAT, or luciferase.
  • Single chain antibodies are formed by linking
  • Antibody fragments that recognize and bind to specific epitopes can be generated by
  • fragments include but are not limited to F(ab') 2
  • Fab expression libraries can be constructed (Huse et al., Science 246: 1275, 1989) to produce Fab expression libraries (Huse et al., Science 246: 1275, 1989) to produce Fab expression libraries (Huse et al., Science 246: 1275, 1989) to produce Fab expression libraries (Huse et al., Science 246: 1275, 1989) to produce Fab expression libraries (Huse et al., Science 246: 1275, 1989) to
  • the antibodies of the invention can be used, for example, in the detection of a ML 13
  • Antibodies can also be used to interfere with the interaction of
  • an ML 13 mutant and other molecules that bind the mutant (e.g., an ML13 receptor).
  • the invention also provides a method of delivering an IL13 mutant to a cell.
  • a method is useful, among other things, for directing a chimeric molecule including the ML 13 mutant and an effector molecule to a cell so that the effector molecule can exert its function.
  • an ML 13 mutant conjugated to a cytotoxin can be delivered to a target cell to be
  • an ML 13 mutant expressing a receptor that binds the mutant.
  • an ML 13 mutant expressing a receptor that binds the mutant.
  • composition containing the chimeric molecule with the target cell expressing a receptor that
  • Mutant ML 13 molecules can be delivered to a cell by any known method. For example, Mutant ML 13 molecules can be delivered to a cell by any known method.
  • composition containing the ML 13 mutant can be added to cells suspended in
  • a mutant ML 13 can be admimstered to an animal (e.g., by a
  • mutant ILI3 molecules of mis invention are particularly well
  • carcinoma tumor cells e.g. renal carcinoma cells
  • ILI3 ILI3
  • receptors at levels ranging from about 2100 sites/cell to greater than 150,000 sites per cell.
  • ILI3 receptors ILI3 receptors
  • the methods of this invention can be used to target an effector molecule to a variety of conditions.
  • cancers are well known to those of skill in the art and include, but are not
  • cancers of the skin e.g., basal or squamous cell carcinoma, melanoma, Kaposi's
  • cancers of the reproductive system e.g., testicular, ovarian, cervical
  • cancers of the reproductive system e.g., testicular, ovarian, cervical
  • gastrointestinal tract e.g., stomach, small intestine, large intestine, colorectal. etc.
  • cancers of the mouth and throat e.g. esophageal. larynx, oropharynx, nasopharynx, oral. etc.).
  • cancers of the head and neck bone cancers, breast cancers, liver cancers, prostate cancers (e.g., prostate carcinoma), thyroid cancers, heart cancers, retinal cancers (e.g., melanoma),
  • kidney cancers e.g., kidney cancers, lung cancers (e.g., mesothelioma), pancreatic cancers, brain cancers (e.g.
  • gliomas medulloblastomas, meningiomas, etc.
  • cancers of the lymph system e.g.
  • lymphoma lymphoma
  • tMs involves providing a labeled molecule that specifically binds to the ILI3
  • the cells in question are then contacted with tMs
  • ILI3 receptor ILI3 receptor
  • IL13 receptor may be quantified by measuring the binding of
  • invention also provides a method of modulating an allergic response by contacting a cell
  • lymphocyte such as a B cell, an eosinophil, a mast cell
  • a mutant ML 13 can be used to block this
  • the interaction between native ML 13 and the IL13 receptor can be blocked, for example, by contacting the cell 1 can with an ML 13 mutant
  • mutant could be administered by inhalation of a pharmaceutical composition containing the
  • mutant ML13 molecules including those conjugated with an effector molcule
  • tMs invention can be prepared for parenteral, topical, oral, or local admimstration, such as by
  • compositions can be administered m a va ⁇ ety of unit dosage forms depending upon the
  • unit dosage forms suitable for oral administration for example, unit dosage forms suitable for oral administration
  • digested e.g., when administered orally. This can be accomplished either by complexmg
  • the protein with a composition that renders it resistant to acidic and enzymatic hydrolysis, or
  • compositions can also be delivered to an animal by inhalation by
  • nebulizer with the use of a suitable propellant such as dichlorodifluromethane, trichlorot ⁇ - fluoromethane, dichlorotetraflurorethane, carbon dioxide, or any other suitable gas.
  • a suitable propellant such as dichlorodifluromethane, trichlorot ⁇ - fluoromethane, dichlorotetraflurorethane, carbon dioxide, or any other suitable gas.
  • the dosage unit may be controlled using a valve to deliver a
  • Capsules and cartridges e.g., of gelatin contammg a powder mix of the
  • ML13 mutant and a suitable base e.g., lactose or starch
  • a suitable base e.g., lactose or starch
  • insufflator to deliver the mutant to the respiratory tract of an animal
  • compositions of tMs invention are particularly useful for the following reasons:
  • parenteral administration such as intravenous admimstration or admimstration into a body
  • compositions for admimstration will commonly comp ⁇ se a
  • va ⁇ ety of aqueous earners can be used, e g , buffered salme
  • compositions may be ste ⁇ hzed by conventional, well known stenhzation
  • compositions may contain pharmaceutically acceptable auxiliary substances
  • agents for example, sodium acetate, sodium chlonde,
  • potassium chlonde calcium chlonde. sodium lactate and the like The concentration of the
  • mutant ML 13 m these formulations can vary widely, and will be selected p ⁇ manly based on
  • invention can be determined by standard pharmaceutical procedures, using either cells in
  • the ED 50 the dose therapeutically effective in 50% of the population.
  • compositions lies preferably witMn a range of circulating concentrations that include an ED 50
  • the dosage may vary witMn this range depending upon the dosage
  • the therapeutically effective dose can be estimated initially
  • a dose can be formulated in animal models to achieve an IC 50 (that
  • Levels in plasma can be measured, for example, by high
  • intravenous administration would be about 0.1 to 10 mg per patient per day.
  • 0.1 up to about 100 mg per patient per day may be used, particularly when the pharmaceutical compositions is admmistered to a secluded site and not into the blood stream, such as into a body cavity or into a lumen of an organ.
  • compositions contammg the present ML13 mutants, or a cocktail thereof i e.,
  • compositions are administered to a patient suffenng from a disease, m an
  • compositions may be admmistered
  • composition should provide a sufficient quantity of the proteins of tMs invention to
  • vanous uses of the cytotoxic fusion proteins of the present invention are:
  • va ⁇ ety of disease conditions caused by specific human cells that may be
  • cancer te g a ghoma
  • a ghoma such as by the use of an mutant IL13 ligand attached to a cytotoxin
  • bram cancers is constrained by the blood-brain barner which resists the entry of macro ⁇
  • the therapeutic compositions of tMs invention can be admimstered directly to the tumor site.
  • brain tumors e.g., gliomas
  • gliomas can be admimstered directly to the tumor site.
  • the therapeutic composition directly to the tumor site (e.g., a tumor site).
  • the therapeutic composition can be placed at the target site in a slow
  • Such formulations can include, for example, a thrombin-fibrinogen mixture.
  • Such formulations can include, for example, a thrombin-fibrinogen mixture.
  • the catheter, or catheters, or time release formulation will be placed at the
  • tumor site as part of a surgical procedure.
  • major tumor mass is
  • the perfusing catheter or time release formulation can be emplaced at the
  • tumor site as an adjunct therapy.
  • surgical removal of the tumor mass may be
  • compositions of tMs invention may comprise the primary therapeutic modality.
  • the invention also provides a method of imaging a cell expressing a receptor that
  • labels useful for diagnostic imaging include radiolabels such as 131 1, In, 123 I, 99 mTc, 32 P, 125 1, ⁇ , 14 C, and 188 Rh; fluorescent
  • labels such as fluorescein and rhodamine; nuclear magnetic resonance active labels; positron
  • PET positron emission tomography
  • chemiluminescent labels such as luciferin
  • enzymatic markers such as peroxidase or
  • Mutants of ML 13 can be labeled with such reagents as described above or
  • Any imaging techmque compatible with the labeled-ML13 mutant can be used.
  • paramagnetic labeled-ML13 mutant is used; PET where an ML 13 mutant is conjugated with a
  • radioopaque label e.g., a metal particle.
  • the location of glioma tumor cells in an animal can be
  • composition determined by injecting (e.g., parenterally or in situ) an animal with a composition including
  • a detectable label e.g., a gamma emitting
  • composition is then allowed to equilibrate in the animal, and to bind to the
  • glioma cells The ammal is then subjected to imaging (e.g., using a gamma camera) to image
  • glioma cells where the glioma cells are.
  • tMs invention provides for kits for the treatment of tumors or
  • Kits will typically comprise a
  • cMmenc molecule of the present invention e.g., a mutant ML 13 conjugated to a detectable
  • kits will typically include instructional matenals disclosmg means of
  • cMmenc molecule e.g., as a cytotoxin, for detection of tumor cells, to augment an
  • kits may also include additional components to facilitate the
  • kits contains a
  • the kit may
  • filter sets to detect fluorescent labels, appropnate secondary labels such as a sheep anti-
  • kits may additionally include buffers and other reagents
  • kits and appropnate contents are routinely used for the practice of a particular method. Such kits and appropnate contents are
  • Oligonucleotide primers were synthesized at the Macromolecular Core Laboratory, Penn
  • Antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
  • IL IL
  • Cell lines were obtained from the Amencan Type Culture Collection (RockviUe. MD).
  • genes encoding proteins of interest were under a T7 promoter-based expression system.
  • BL21(1DE3) E. coli. which carry the T7 RNA polymerase gene in an isopropyl- 1-th ⁇ o-
  • FPLC protein liquid chromatography
  • mutations of the ML 13 gene were made by standard PCR protocols
  • PVDF membrane for Western blot analysis.
  • the PVDF For Western blot analysis, the PVDF with the
  • the membrane was washed tMee times, five mm. each, with 0 05%
  • CD spectra for the proteins were obtained over the
  • Proteins (0 1 mg/ml) were resuspended in phosphate buffered salme (PBS) and then analyzed. For uMolded samples, protein was resuspended in 8M urea
  • cytotoxins concentrations of cytotoxins were diluted m 0 1% BSA/PBS and 25 ml of each dilution was
  • Mgh concentrations of cycloheximide served as background for the assay.
  • HUVEC were seeded onto an eight
  • glioblastoma cells U-251 MG and SNB-19 were used for cytotoxicity-blocking assays.
  • recombinant ML13.E13Y was lodo-labeled with 125 I by using
  • binding buffer 200 mM sucrose, 50 mM HEPES, 1% BSA,
  • TfR human transfernn receptor
  • the IL13 mutein, ML13.E13Y, was prepared as described above and tested for its
  • TF-1 cells ability to modulate the interleukin-induced proliferative responses of TF-1 cells.
  • TfR transfernn receptor
  • I25 I-ML13 fails to interact with normal brain or
  • ML13-based cytotoxin was investigated using two different human malignant glioma cell
  • Glioma cells in culture were pretreated with either ML13, ML13.E13Y or ML13.E13K before ML13-PE1E was added.
  • the cytotoxicity of hIL13-PElE was neutralized m these cultures using ML 13, ML13.E13Y, or ML13.E13K.
  • Example 1 The prokaryotic production of the cytokines or their mutants under
  • TF-1 cells express the shared IL13/4 receptor (but not the
  • ML13 consistently produced a maximal proliferative response in TF-1 cells of -300% that of
  • the ML13.F113D mutant was equivalent to
  • VCAM-1 ( Figure 4. panels B and H). The pattern of the staimng appeared to be specific for
  • ML13-PE1E an extremely potent anti-tumor agent on glioma cells (see Debinski et al. (1996)

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pulmonology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Immunology (AREA)
  • Pain & Pain Management (AREA)
  • Rheumatology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

This invention provides mutant human interleukin 13 molecules showing varying specificity for the restricted (IL4 independent) IL13 receptor. The mutant hIL13 molecules include those made by substituting the amino acid residues that occur in the alpha-helix regions of native hIL13 with various other amino acid residues. Some of the mutants retain the ability to bind and cause signaling through IL13 receptors, while other mutants do not.

Description

IL13 MUTANTS
CROSS- REFERENCE TO RELATED APPLICATIONS
The present application is a continuation-in-part of U.S. patent application number
09/054,711 filed on April 3, 1998, and is related to and claims the benefit of U.S. Provisional
patent application number 60/157,934 filed October 6, 1999.
STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT
This invention was made in part with Government support under grant CA741145
awarded by the National Institutes of Health. The Government may have certain rights in the
invention.
BACKGROUND OF THE INVENTION
Human interleukin 13 (hIL13) is a 114 amino acid cytokine secreted by activated T
cells. Minty et al. (1993) Nature. 362:248-250; and McKenzie et al. (1993) Proc. Natl. Acad.
Sci. USA. 90:3735-3739. hIL13 is involved in regulating several different physiological
responses. .Among these. hIL13 has been shown to downregulate the production of cytokines
involved in inflammation. Minty et al., supra; and de Waal Malefyt et al. (1993) J.
Immunol.. 151 :6370-6381. It has also been shown to upregulate expression of major histo-
compatibility class II molecules and CD23 on monocytes. and to regulate various aspects of
B cell function De Waal Malefyt et al. (1993) Res. Immunol. 144:629-633; McKenzie et al..
supra; and de Waal Malefyt et al. (1993) J. Immunol., 151 :6370-6381. In addition to
regulating cells of the immune system. IL-13 has also been shown to act on other cell types. For example, IL13 has been shown to modulate expression of vascular cell adhesion mole-
cule-1 (VCAM-1) on endothelial cells. Sirom et al. (1994) Blood, 84:1913-1921; Bochner et
al. (1995) J. Immunol., 154:799-803; and Schnyder et al. (1996) Blood, 87:4286-4295.
Based on its predicted secondary structure, ML 13 has been added to a growing family
of growth hormone-like cytokines that all exhibit bundled alpha-helical core topology
Bamborough et al. (1994) Prot. Engm., 7:1077-1082. Structural analyses indicated that
hIL13 is a globular protein compπsed mamly of four alpha-helical regions (helices A, B, C,
and D) arranged in a "bundled core." Miyajima et al. (1992) Ann. Rev. Immunol., 10, 295-
331. While dissimilar at the primary ammo acid level. ML13 and human interleukin -I*
(hIL4) bind and signal through a shared receptor complex. Zurawski et al. (1993) EMBO J.,
12:2663-2670; and Tony et al. (1994) Eur. J. Biochem.. 225:659-66. This shared receptor is
a heterodimer that includes a first subunit of approximately 140 kDa termed pi 40, and a
second subunit of approximately 52 kDa termed α' or IL13Rαl. Idzerda et al. (1990) J Exp.
Med., 173.861-873. Obiπ et al. (1995) J. Biol. Chem., 270:8797-8804, Hilton et al. (1996)
Proc Natl Acad. Sci. USA, 93-497-501; and Miloux et al. (1997) FEBS Letters. 401 163-
166. Unlike hIL4. hIL 13 does not bind pi 40 m the absence of α' Vita et al. (1995) J Biol
Chem.. 270 3512-3517. In addition to the shared receptor, another hIL13 receptor termed the
restπcted (IL4 independent) receptor exists. In contrast to the shared receptor, the latter
receptor binds hIL13 but not hIL4 The restπcted receptor is also sometimes called the
g oma-associated receptor because it is preferentially expressed at high levels in certain
malignant cells, including high grade human gliomas. Debmski et al. (1995) Chn. Cancer
Res.. 1 1253-1258. and Debinski et al. (1996) J. Biol. Chem , 271, 22428-22433 In addition
.?. to bemg associated with malignancies. hIL13 has also been associated with other pathological
conditions. Notably, IL13 has been shown to be involved in pathways that regulate airway
inflammation, suggesting that this cytokme might play an important role in asthma and
perhaps other allergic pathologies Webb et al, (2000) J Immunol 165:108-113, and
Djukanovic, R. (2000) Chn Exp. Allergy 30 Suppl 1 46-50
SUMMARY OF THE INVENTION
The invention relates to the development and characteπzation of several mutants of
hIL13 Using these mutants, three regions of native hIL13 were identified as being required
for signaling through the shared receptor These regions were localized to alpha-helices A, C
and D and were generally separated from the regions involved in binding to the restπcted
receptor Glutamic acids at positions 13 and 16 in hIL13 alpha-helix A, argmme and seπne at
positions 66 and 69 in helix C, and argimne at position 109 m helix D were found to be
important in inducing biological signaling because these mutations resulted the loss and/or
gain ot functional phenomena
Mutants withm the invention include those having one or more of the e amino
acids of hIL13 at positions 13. 16. 17, 66. 69. 99. 102. 104. 105. 106. 107. 108. 109. 1 12,
113. and 1 14 replaced w ith a different ammo acid These mutants are expressed nerem as
hIL13X,PX2, where P is a number corresponding to the position of the mutated ammo acid m
hIL13. X, is the letter abbreviation of the ammo acid that was replaced, and X2 is the letter
abbrev iation of the replacement ammo acid For example. hIL13 E13K represents a mutant
form of hIL13 that has the glutamic acid residue that naturally occurs at position 13 in native
hIL13 replaced with a lvsme residue Representative mutants within the invention include ML13.E13K, ML13.E13I, hIL13.E13C, ML13.E13S, hIL13.E13R, ML13.E13Y,
ML13.E13D, ML13.E16K, ML13.E17K, hIL13.R66D, hIL13.S69D, hIL13.D99K,
ML13.L102A, hIL13.L104A, hIL13.K105D, ML13.K106D, ML13.L107A, hIL13.F108Y,
L13.R109D, hIL13.R112D, hIL13.F113D, and hIL13.N114D.
Also withm the invention are compositions including a mutant hIL13 having an ammo
acid sequence having at least 90% sequence identity to native hIL13 (SEQ ID NO:l) Such
mutants can have a mutation in a domain corresponding to the A, C, or D alpha-helices of
native hIL13 Exemplary mutants include those with a polypeptide having an ammo acid
sequence of one of SEQ ED NOs: 2-23
Mutants of hIL13 withm the invention can be those that specifically bind the shared
IL4/IL13 receptor but not the restπcted (IL4-mdependent) receptor; those that specifically
bind the restπcted (IL4-ιndependent) receptor but not the shared IL4/IL13 receptor; or those
that bind both receptors
Some hIL13 mutants of the invention specifically bind to an hIL13 receptor
associated with a cell in a manner that induces a measurable change in the cell's physiologv
This change can be of greater or less magnitude than a change in the cell's physiology that
would be induced by specifically binding the IL13 receptor with native ML 13
Compositions within the invention can include both an ML 13 mutant and a
pharmaceutically acceptable earner
Mutants of ML 13 withm the invention can be conjugated to an effector molecule such
as a cytotoxin (e g . Pseudomonas exotoxin, PE38QQR. PE1E, PE4E, Diptheπa toxin, πcm.
abπn. sapoπn. and pokeweed viral protein), a detectable label (e.g., radionuchde), an
antibody, a hposome. or a hpid In another aspect the invention includes a purified nucleic acid encoding a mutant
ML13. Also within the invention is an antibody that specifically binds a mutant ML 13
molecule, but not a native ML 13 molecule. And in another aspect, the invention features a
method of delivering a mutant ML13 to a cell. The method can include the steps of:
providing a mutant ML 13 and a cell; and contacting the cell with the mutant ML13.
Unless otherwise defined, all techmcal terms used herein have the same meaning as
commonly understood by one of ordinary skill in the art to which this invention belongs.
Commonly understood definitions of molecular biology terms can be found in Rieger et al.,
Glossary of Genetics: Classical and Molecular, 5th edition, Springer- Verlag: New York.
1991 ; and Lewin, Genes V, Oxford University Press: New York, 1994.
As used herein, the phrase "native ML13" means the mature form of human
interleukin 13, the amino acid sequence of which is shown herein as SEQ ID NO: l.
The phrase "hIL13 mutant" or a "mutant ML 13 molecule" means an ML 13 in which
one or more of the amino acids differ from the corresponding amino acids in the native
ML13. Thus, for example, where a native ML 13 has a glutamic acid at position 13, a mutant
ML 13 can have an ammo acid other than glutamic acid at position 13 (e.g., glutamic acid is
substituted with lysine). It will appreciated that mutant IL13 molecules of this invention
include mutant IL13 molecules of other mammalian species (e.g., rat, murine, porcine, ovine.
goats, non-human primates, bovine, canus, and the like) and this invention contemplates the
use of mutant IL13 in veterinary as well as human medical conditions.
As used herein, the terms "protein" and "polypeptide" are used synonymously to mean
any peptide-linked chain of amino acids, regardless of length or post-translational
modification, e.g., glycosylation or phosphorylation. An "purified" polypeptide is one that
- has been substantially separated or isolated away from other polypeptides in a cell, organism,
or mixture m wMch the polypeptide occurs (e.g., 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99,
100% free of contaminants).
As used herein, a "nucleic acid" or a "nucleic acid molecule" means a chain of two or
more nucleo tides such as RNA (ribonucleic acid) and DNA (deoxyπbonucleic acid). A
"puπfied" nucleic acid molecule is one that has been substantially separated or isolated away
from other nucleic acid sequences m a cell or organism in wMch the nucleic acid naturally
occurs (e.g., 30, 40, 50, 60, 70, 80, 90, 95, 96, 97, 98, 99, 100% free of contaminants). The
term includes, e.g., a recombinant nucleic acid molecule incorporated into a vector, a
plasmid, a virus, or a genome of a prokaryote or eukaryote. Examples of purified nucleic
acids include cDNAs. fragments of genomic nucleic acids, nucleic acids produced
polymerase chain reaction (PCR), nucleic acids formed by restriction enzyme treatment of
genomic nucleic acids, recombinant nucleic acids, and chemically synthesized nucleic acid
molecules. A "recombinant" nucleic acid molecule is one made by an artificial combination
of two otherwise separated segments of sequence, e.g., by chemical synthesis or by the
manipulation of isolated segments of nucleic acids by genetic engineeπng techniques
As used herein, "sequence identity" means the percentage of identical subumts at
corresponding positions in two sequences when the two sequences are aligned to maximize
subumt matching, i.e.. taking into account gaps and insertions. When a subunit position in
both of the two sequences is occupied by the same monomeπc subunit. e.g., if a given
position is occupied by an alanme in each of two polypeptide molecules, then the molecules
are identical at that position. For example, if 7 positions m a sequence 10 amino acids m
length are identical to the corresponding positions in a second 10 ammo acid sequence, then the two sequences have 70% sequence identity. Sequence identity is typically measured
using sequence analysis software (e.g., Sequence Analysis Software Package of the Genetics
Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue,
Madison, WI 53705).
By the term "antibody" is meant an immunoglobulin as well as any portion or
fragment of an immunoglobulin whether made by enzymatic digestion of intact
immunoglobulin or by techniques in molecular biology. The term also refers to a mixture
containing an immunoglobulin (or portion or fragment thereof) such as an antiserum.
The term "specifically binds", as used herein, when referring to a polypeptide
(including antibodies) or receptor, refers to a binding reaction wMch is determinative of the
presence of the protein or polypeptide or receptor in a heterogeneous population of proteins
and other biologies. Thus, under designated conditions (e.g. immunoassay conditions in the
case of an antibody), the specified ligand or antibody binds to its particular "target" (e.g. an
IL13 specifically binds to an IL13 receptor) and does not bind in a significant amount to other
proteins present in the sample or to other proteins to which the ligand or antibody may come
in contact in an organism. Generally, a first molecule that '"specifically binds" a second
molecule has a binding affinity greater than about 105 (e.g., 106, 107, 108, 109, 1010, 10". and
1012 or more) moles/liter for that second molecule.
A "mutation" in a polypeptide refers to the substitution of an amino acid at a
particular position in a polypeptide with a different amino acid at that position. Thus, for
example, the mutation ML13.E13K indicates that the native amino acid at position 13 in IL13
(glutamic acid, E) is replaced with lysine (K). In some cases, a mutation can be the deletion,
addition, or substitution of more than one amino acid in a polypeptide. The mutation does not require an actual removal and substitution of the amino acid(s) in question. The protein
can be created de novo with the replacement amino acid in the position(s) of the desired
mutation(s) so the net result is equivalent to the replacement of the amino acid in question.
Although methods and materials similar or equivalent to those described herein can
be used in the practice or testing of the present invention, suitable methods and materials are
described below. All publications, patent applications, patents, and other references
mentioned herein are incorporated by reference in their entirety. In the case of conflict, the
present specification, including definitions will control. In addition, the particular
embodiments discussed below are illustrative only and not intended to be limiting.
BRIEF DESCRIPTION OF THE DRAWINGS
The invention is pointed out with particularity in the appended claims. The above and
further advantages of fhis invention may be better understood by referring to the following
description taken in conjunction with the accompanying drawings, in which:
FIG. 1 is a photograph of a SDS-PAGE (A) and Western blot (B) analysis of purified
ML 13 and various ML 13 mutants. Five hundred nanograms of each purified cytokine was
loaded per sample. Proteins were detected using a Coomassie Blue stain, panel A. Separated
proteins from a duplicate gel were electroblotted to a PVDF membrane and detected with an
anti-ML13 antibody in a Western blot protocol using an enhanced chemiluminescence
detection system, panel B.
FIG. 2 is circular dichroism (CD) spectra obtained from purified ML 13 and vaπous
ML13 mutants. Each protein was diluted in PBS (0.1 mg/ml), thermally equilibrated to 37°C.
and its CD spectrum recorded over the wavelength range of 185 nm to 260 nm. The CD spectrum of unfolded ML 13 (panel D) was obtained by diluting the protein in 8 M urea
containing 40 mM ditiiiothreitol prior to analysis. The reported spectra were the average of
three consecutive measurements. The mutants in each panel, listed from top to bottom,
represent the order of the spectra in each panel, from top to bottom.
FIG. 3 is grapMcal representations of data obtained from proliferation assays using
TF-1 cells induced with ML 13 and various ML 13 mutants. TF-1 cells were cultured in the
presence of increasing concentrations of the indicated protein for 72 h. The amount of TF-1
cell proliferation, compared to control experiments induced with buffer alone, was
determined colorimetrically. The reported data is the average of triplicate samples with the
error bars representing the standard deviation witMn a data set. Experiments were repeated
several times. Panels represents ML 13 alpha-helix A mutants that increased TF-1 cell
proliferation (A), ML 13 alpha-helix A mutants that failed to increase TF-1 cell proliferation
(B), and ML 13 alpha-helix C mutants that failed to increase TF-1 cell proliferation (C).
FIG. 4 is a series of photomicrographs of indirect immuno fluorescence analyses of
HUVEC for VCAM-1 expression induced by ML 13 and various ML 13 mutants. Panels A-F
and G-J are from two separate experiments, each with its own set of controls. HUVEC cells
were cultured overnight in media containing buffer alone (panels A and G) or 1 mg/ml of
either wild-type ML 13 (panels B and H) or various mutants (panels C-F, I and J). Induced
expression of the protein was detected through a rhodamine filter using goat anti- VCAM-1
IgG primary antibody and rabbit anti-goat IgG CY3 -conjugated secondary antibody. The
sensitivity of the imaging camera was set to detect the level of fluorescence in the control
field, panels A and G. No further adjustments were made to the sensitivity, allowing for the
amount of increased or decreased fluorescence in the experimental fields to be directly related to the amount of interleukin-induced VCAM-1 expression. Photomicrographs are shown at
20X magnification (20X).
FIG. 5 is grapMcal representations of data obtained from cytotoxicity assays
performed to assess the ability of ML13 and ML13 mutants to block the killing of U-251MG
(panel A) and SNB-19 (panel B) cells by ML13-PE1E. Cultured cells were incubated with
buffer alone, shown in all panels by closed diamonds, or 1 mg/ml of ML 13 or the indicated
mutant for 1 hour at 37°C, prior to the addition of increasing concentrations of ML13-PE1E.
The reported data is the average of tπplicate samples with the error bars representing the
standard deviation witMn a data set. Experiments were repeated several times.
DETAILED DESCRIPTION
TMs invention encompasses compositions and methods relating to ML 13 mutants.
The below descπbed preferred embodiments illustrate adaptations of these compositions and
methods. Nonetheless, from the descπption of these embodiments, other aspects of the
invention can be made and/or practiced based on the descπption provided below
Biological Methods
Methods involving conventional molecular biology techniques are descπbed herein.
Such techniques are generally known m the art and are descπbed in detail in methodology
treatises such as Molecular Cloning: A Laboratory Manual. 2nd ed.. vol. 1 -3. ed. Sambrook et
al.. Cold Spπng Harbor Laboratory Press. Cold Spπng Harbor, N.Y., 1989; and Current
Protocols in Molecular Biology, ed. Ausubel et al., Greene Publishing and
Wiley- Interscience. New York, 1992 (with peπodic updates). Various techniques using polymerase chain reaction (PCR) are described, e.g., in Irmis et al., PCR Protocols: A Guide
to Methods and Applications, Academic Press: San Diego, 1990. PCR-primer pairs can be
derived from known sequences by known techniques such as using computer programs
intended for that purpose (e.g., Primer, Version 0.5, ©1991, WMtehead Institute for
Biomedical Research, Cambridge, MA.). The Reverse Transcriptase Polymerase Chain
Reaction (RT-PCR) method used to identify and amplify certain polynuleotide sequences
witiiin the invention was performed as described in Elek et al, In Vivo, 14:172-182, 2000).
Methods for chemical synthesis of nucleic acids are discussed, for example, in Beaucage and
Carruthers, Terra. Letts. 22:1859-1862, 1981, and Matteucci et al., J. Am. Chem. Soc.
103:3185, 1981. Chemical synthesis of nucleic acids can be performed, for example, on
commercial automated oligonucleotide synthesizers. Immunological methods (e.g.,
preparation of antigen-specific antibodies, immunoprecipitation, and immunoblotting) are
described, e.g., in Current Protocols in Immunology, ed. Coligan et al, John Wiley & Sons,
New York, 1991 ; and Methods of Immunological Analysis, ed. Masseyeff et al, John Wiley
& Sons. New York, 1992.
Mutant ML 13 Molecules
The mutant ML 13 molecules of the invention are based on the amino acid sequence of
native ML 13 (SEQ ID NO:l). The ML 13 mutants within the invention differ by one or more
amino acids from native ML13. For example. ML 13 mutants witiiin the invention can have
90% or more (e.g., 91. 92. 93, 94, 95. 96, 97, 98, and 99%) sequence identity with native
ML13. Examples of ML 13 mutants within the invention are those having the amino acid
sequences of SEQ ID NOs:2-23. These mutants each have a mutation m a domam corresponding to either
the A (residues 9-25 of SEQ ID NO:l), C (residues 59-71 of SEQ ID NO:l), or D (residues
97-113 of SEQ ID NO:l) alpha-helices of native ML13. Each of these features a substitution
of one of the ammo acid residues that occurs in native ML13. Other ML 13 mutants witiiin
the invention are those with two or more (e.g., 3, 4, 5, 6, 7, 8, 9,10 or more) such amino acid
substitutions, as well as deletion (e.g., truncation) and addition (i.e., those with additional
ammo acids added to the native ML 13 sequence) mutations.
Mutants of ML13 can be made in a number of ways by adapting techniques well
known in the art. See, e.g., Sambrook et al., supra; and Ausubel et al, supra. For example,
starting with the known ammo acid sequence of ML13 (i.e., SEQ ID NO:l), the skilled
artisan can chemically synthesize vaπous mutant ML 13 molecules using, e.g, automated
commercial polypeptide synthesizers. Techniques for solid phase synthesis of polypeptides
are well known. See, e.g., Barany and Memfield, Solid-Phase Peptide Synthesis; pp. 3-284
in 77 e Peptides: Analysis, Synthesis, Biology. Vol. 2. Special Methods in Peptide Synthesis,
Part A., Memfield. et al, J. Am. Chem Soc, 85: 2149-2156 (1963), and Stewart et al, Solid
Phase Peptide Sxnthesis, 2nd ed. Pierce Chem. Co.. Rockford. IL (1984). Using this
technique. ML 13 mutants can be synthesized as a single polypeptide. Alternatively, shorter
ohgopeptide portions of the mutant ML 13 molecule can first be synthesized and then fused
together to form the full length mutant by condensation of the ammo terminus of one
ohgopeptide portion with the carboxyl terminus of the another ohgopeptide portion to
forming a peptide bond. The fusions can then be puπfied by standard protein chemistry
techniques
Mutants of ML 13 can also be produced through recombinant expression of ML 13- encoding nucleic acids (see below) in wMch the nucleic acid is modified, randomly or m a
site-specific manner, to change (substitute), add to, or delete, some or all of the ammo acids
in the encoded polypeptide. Site-specific mutations can be introduced into the IL 13 -encoding
nucleic acid by a vaπety of conventional techmques well descπbed m the scientific and patent
literature. Illustrative examples include: site-directed mutagenesis by overlap extension
polymerase chain reaction (OE-PCR), as m Urban (1997) Nucleic Acids Res 25: 2227-2228,
Ke (1997) Nucleic Acids Res , 25: 3371-3372, and Chattopadhyay (1997) Biotechmques 22.
1054- 1056, descπbmg PCR-based site-directed mutagenesis "megapπmer" method,
Bohnsack (1997) Mol Bwtechnol 7 181-188, Ailenberg (1997) Biotechmques 22 624-626,
descπbmg site-directed mutagenesis using a PCR-based staggered re-annealing method
without restπction enzymes, Nicolas (1997) Biotechmques 22. 430-434, site-directed
mutagenesis using long pπmer-umque site elimination and exonuclease III Unique-site
elimination mutagenesis can also be used (see, e g , Dang et al (1992) Anal Biochem , 200
81) The production of mutants of biologically active proteins such as IFN-beta and IL-2 is
descπbed in detail in U S Patent No 4,853,332 and the mutation of ML13 is descπbed in
Example 1 below
Other ML 13 mutants can be prepared by chemically modifying native ML 13
according to known chemical modification methods See, e g , Belousov (1997) Nucleic
Acids Res 25 3440-3444, Frenkel (1995) Free Radic Biol Med 19 373-380, Blommers
(1994) Biochemistry 33 7886- 7896 Likewise, ML 13 mutants made by chemical synthesis
or by expression of nucleic acids as descπbed above can be chemicallv modified to make
additional ML 13 mutants Characterizing ML 13 Mutants
Mutants of ML13 can have characteristics that differ from those native ML13. For
example, native ML13 has the functional characteristics of binding both shared receptor and
the restrictive receptor. Native ML 13 also has the characteristic of inducing transmembrane
signals through binding shared receptors expressed on a cell surface. Such signaling can
result in a measurable change in the cell's physiology. Changes can be the production of
second messengers- e.g, an increase in intracellular [Ca2+], activation of protein kinases
and/or phosphorylases, changes in phosphorylation of a substrate, changes in signal
transducers and activators of transcription, etc. They can also be changes in the cell
proteome, e.g., from increased or decreased transcription or translation. Or they can be
changes in a functional or phenotypic characteristic of the cell. For instance, adding native
ML 13 to TF-1 cells can increase their rate of proliferation. As another example, adding
native ML 13 can cause HUVEC to increase their expression of VCAM-1.
Characteristics of a given mutant ML 13 molecule can therefore be assessed by
examining the ability of the molecule to bind the shared receptor and/or the restrictive
receptor. Similarly, the ability of the mutant molecule to induce transmembrane signaling
can be assessed by examining whether contacting a cell expressing an IL13 receptor with the
mutant molecule results in a change in the cell's physiology. By these methods, ML13
mutants can be characterized as those that bind both the shared receptor and/or the restrictive
receptor, those that bind only one of the receptors, and those that do not bind either receptor.
By quantifying the affinity of a mutant ML 13 molecule, it can also be characterized as one
that binds with less, about equal, or more affinity than native ML13. Mutants of ML 13 can
also be characterized as having or lacking the ability to cause a transmembrane signal and/or a change in a cell's function or phenotype. The changes caused by a mutant ML13 molecule
can also be quantified to further characterize the molecule as one that causes such changes
less than (of less magnitude), about equal to, or more than (of greater magnitude) those
caused by native ML13. For instance mutants of ML 13 that specifically bind to an ML 13
receptor associated with a cell in a manner that induces a measurable change in the cell's
physiology can be those that modulate the proliferation rate of a cell line that expresses an
EL13 receptor such as TF-1 cells. Antagonistic ML13 mutants are those that reduce the
proliferation rate of the cell line compared to that induced by native ML13; agonistic ML 13
mutants are those that induce about same (e.g., 50-150%) or 75-125% of) proliferation rate of
the cell line as that induced by native ML13; and superagomstic ML 13 mutants are those that
increase the proliferation rate of the cell line compared to that induced by native ML13. See
Examples, below.
Chimeric Molecules of Mutant ML13 and Effector Molecules
The invention also provides a chimeric molecule including a mutant ML 13 molecule
conjugated to an effector molecule. The effector molecule can be any molecule that can be
conjugated to an ML 13 mutant and exert a particular function. Examples of effector
molecules include cytotoxins, drugs, detectable labels, targeting ligands, and delivery
veMcles.
A mutant ML13 molecule conjugated with a one or more cytoxins can be used to kill
cells expressing a receptor to which the mutant binds. Cytotoxins for use in the invention can
be any cytotoxic agent (i.e., molecule that can kill a cell after contacting the cell) that can be
conjugated to ML 13 or an ML 13 mutant. Examples of cytotoxins include, without limitation, radionuclides (e.g.,35S, 14C, 32P,125I, 1311, 90Y, 89Zr, 201T1, I86Re, 188Re, 57Cu, 213Bi, 2UAt, etc.),
conjugated radionuclides, and chemotherapeutic agents. Further examples of cytotoxins
include, but are not limited to, antimetabolites (e.g., 5-flourouricil (5-FU), methotrexate
(MTX), fludarabine, etc.), anti-microtubule agents (e.g., vincristine, vinblastine, colchicine,
taxanes (such as paclitaxel and docetaxel), etc.), al ylating agents (e.g., cyclophasphamide,
melphalan. bischloroethylnitrosurea (BCNU), etc.), platinum agents (e.g., cisplatin (also
termed cDDP), carboplatin, oxaliplatin, JM-216, CI-973, etc.), anthracyclines (e.g.,
doxorubicin, daunorubicin, etc.), antibiotic agents (e.g., mitomycin-C), topoisomerase
ii±ibitors (e.g., etoposide, tenoposide, and camptothecins), or other cytotoxic agents such as
ricin, diptheria toxin (DT), Pseudomonas exotoxin (PE) A, PE40, abrin, saporin, pokeweed
viral protein, eύhidium bromide, glucocorticoid, and others. See, e.g. U.S. Patent No.
5,932,188. Useful variations of PE and DT include PE38QQR (see, U.S. Patent No.
5,614,191), PE1E and PE4E (see, e.g., Chaudhary et al. (1995) J. Biol. Chem., 265:16306),
and DT388 and DT398 (Chaudhary, et al. (1991) Bioch. Biophys. Res. Comm., 180: 545-
551) can also be used.
Mutant ML 13 molecules conjugated with one or more detectable labels can be
used to detect the presence of a receptor to which the mutant binds, e.g., in diagnostic assays
(e.g., in the detection of shed tumor cells overexpression the IL13 receptor) and/or in the in
vivo localization of tumor cells. Detectable labels for use in the invention can be any
substance that can be conjugated to ML 13 or an ML 13 mutant and detected. Suitable
detectable labels are those that can be detected, for example, by spectroscopic,
photochemical, biochemical, immunochemical, electrical, optical or chemical means. Useful
detectable labels in the present invention include biotin or streptavidin, magnetic beads (e.g., Dynabeads™), fluorescent dyes (e.g., fluorescein isothiocyanate, texas red, rhodamine, green
fluorescent protein, and the like), radiolabels (e.g., 3H, 125I, 35S, 14C, 32P, In, 97Ru, 67Ga,
6 Ga, or 72As,), radioopaque substances such as metals for radioimaging, paramagnetic agents
for magnetic resonance imaging, enzymes (e.g., horseradish peroxidase, alkaline phosphatase
and others commonly used in an ELISA), and colorimetric labels such as colloidal gold or
colored glass or plastic (e.g. polystyrene, polypropylene, latex, etc.) beads.
Means of detecting such labels are well known to those of skill in the art. Thus, for
example, radiolabels may be detected using photograpMc film or scintillation counters,
fluorescent markers may be detected using a photo detector to detect emitted illumination.
Enzymatic labels are typically detected by providing the enzyme with a substrate and
detecting the reaction product produced by the action of the enzyme on the substrate, and
colorimetric labels are detected by simply visualizing the colored label, and so forth.
Mutant ML13 molecules conjugated with one or more targeting ligands (i.e.,
molecules that can bind a particular receptor) can be used to mediate binding of the mutants
to a particular receptor or cell expressing the receptor. Any targeting ligand that can be
conjugated to ML 13 or an ML 13 mutant can be used. Examples of such targeting ligands
includes antibodies (or the antigen-binding portion of antibodies); and chemokines, growth
factors, soluble cytokine receptors (e.g., those lacking a transmembrane domain),
sup eranti gens, or other molecules that bind a particular receptor. A large number of these
molecules are known, e.g., IL-2, IL-4, IL-6, IL-7, tumor necrosis factor (TNF), anti-Tac,
TGF-alpha., SEA, SEB. and the like. As a representative example, an ML13 mutant can be
conjugated with a soluble form of a ML13 receptor. This conjugate, for example, could be
used to both antagonize an endogenous ML 13 receptor on a cell and neutralize any ML 13 present in the vicinity of the cell.
Mutant ML13 molecules conjugated with one or more nucleic acids can be used to
specifically target delivery of the nucleic acid(s) to a target cell (e.g., one expressing an
receptor to which the mutant binds). Any nucleic acid that can be conjugated to ML13 or an
ML 13 mutant can be used. The nucleic acids can be attached directly to the mutant ML13,
attached via a linker, or complexed with or encapsulated in another moiety (e.g., a lipid, a
liposome, a viral coat, or the like) that is attached to the mutant IL13 molecule. The nucleic
acid can provide any of number of effector functions. For example, a nucleic acid encoding
one or more proteins can be used to deliver a particular enzymatic activity, substrate, and/or
epitope to a target cell. For these applications or others where expression (e.g. transcription
or translation) of the nucleic acid is desired, the nucleic acid is preferably a component of an
expression cassette that includes all the regulatory sequences necessary to express the nucleic
acid in the cell. Suitable expression cassettes typically include promoter imtiation and
termination codons. and are selected to optimize expression in the target cell. Methods of
constructing suitable expression cassettes are well known to those of skill in the art. See, e.g.,
Sambrook et al.. supra.
A mutant ML 13 molecule conjugated with a one or more drugs can be used to deliver
such drug(s) to cells expressing a receptor to which the mutant binds. Any drug which can be
conjugated to ML 13 or an ML 13 mutant can be used. Examples of such drugs include
sensitizing agents that render a target (e.g., tumor) cell susceptible to various cancer
therapeutics. The sensitizing agent can be a small molecule drug or a gene (under the control
of a promoter in an appropriate expression cassette to induce expression in the target cell).
For example, it has been proposed that expression of the herpes simplex virus (HSV) thymidine kinase (TK) gene in proliferating cells, renders the cells sensitive to the
deoxynucleoside analog, ganciclovir. Moolten et at. (1986) Cancer Res. 46:5276-5281;
Moolten et al. (1990) Hum. Gene Ther. 1 : 125-134; Moolten et al. (1990) J. Nat/. Cancer
Inst. 82: 297-300; Short et al. (1990) J. Neurosci. Res. 27:427-433; Ezzedine et al. (1991)
New Biol. 3: 608-614, Boviatsis et al. (1994) Hum. Gene Ther. 5: 183- 191. HSV-TK
mediates the phosphorylation of ganciclovir, wMch is incorporated into DΝA strands during
DΝA replication (S-phase) in the cell cycle, leading to chain termination and cell death.
Elion (1983) Antimicr. Chemother 12, sup. B:9-l 7. A second example of a gene with a drug-
conditional "killing" function is the bacteπal cytosine deammase gene, which confers
chemosensitivity to the relatively non-toxic 5 -fluoro uracil precursor 5-fluorocytosme.
Mullen et al. (1992) Proc. Natl. Acad. Set. USA 89: 33-37; Huber et al. (1993) Cancer Res.
53: 4619-4626; Mullen et al. (1994) Cancer Res. 54: 1503-1506. Still another example of a
gene with a drug-conditional "killing" function is a cytochrome P450 gene. Expression, of the
gene product renders tumor cells sensitive to a chemotherapeutic agent, in particular,
cyclophosphamide or lfosphamide. See, U.S. Patent No. 5,688.773 The drug
employed need not be a gene. For example, it can be one of the compounds that can treat
multiple drug resistance of susceptible tumor cells descπbed in U.S Patent No. 4,282.233.
Other drugs can also be used. For example, chemotherapy drugs such as doxorubicin.
vinblastme, gemstein. and other descπbed above can be conjugated to the mutant ML 13
molecule.
A mutant ML 13 molecule conjugated to a one or more deliver*' vehicles is also withm
the invention. Such conjugates can be used to deliver other substances such as a drug to cells
expressing a receptor to which the mutant binds. Any delivery vehicle that can be conjugated to ML 13 or an ML 13 mutant can be used. Examples of such delivery vehicles include
liposomes and lipids (e.g., micelles). Liposomes encapsulatmg drugs or micelles including
drugs may also be used. Methods for prepaπng liposomes attached to proteins are well
known to those of skill in the art. See, for example, U.S. Patent No. 4,957,735; and Connor et
al, Pharm. Ther., 28: 341-365 (1985).
Effector molecules can be conjugated (e.g., covalently bonded) to a mutant ML 13 by
any method known in the art for conjugating two such molecules together. For example, the
mutant ML 13 can be chemically deπvatized with an effector molecule either directly or using
a linker (spacer). Several methods and reagents (e.g., cross-linkers) for mediating tMs
conjugation are known. See, e.g., catalog of Pierce Chemical Company; and Means and
Feeney. Chemical Modification of Proteins, Holden-Day Inc., San Francisco, CA 1971.
Vaπous procedures and linker molecules for attaching vaπous compounds including
radionuchde metal chelates, toxins, and drugs to proteins (e.g., to antibodies) are descπbed,
for example, in European Patent Application No. 188,256; U.S. Patent Nos. 4,671,958;
4,659.839. 4,414,148; 4,699,784; 4,680.338: 4,569,789; and 4,589,071; and Borhnghaus et
al Cancer Res 47' 4071-4075 (1987). In particular, production of vaπous lmmunotoxms is
well-known withm the art and can be found, for example m "Monoclonal Antibody- Toxin
Conjugates: Aiming the Magic Bullet," Thorpe et al. Monoclonal Antibodies in Clinical
Medicine, Academic Press, pp. 168-190 (1982), Waldmann (1991) Science, 252: 1657; and
U.S Patent Nos. 4,545,985 and 4,894,443
Where the effector molecule is a polypeptide, the chimenc molecule including the
ML 13 mutant and the effector can be a fusion protein. Fusion proteins can be prepared using
conventional techmques in molecular biology to join the two genes m frame into a single nucleic acid, and then expressing the nucleic acid in an appropriate host cell under conditions
in which the fusion protein is produced.
A mutant ML13 may be conjugated to one or more effector molecule(s) in various
orientations. For example, the effector molecule may be joined to either the amino or
carboxy termini of the mutant ML13. The mutant IL13 molecule may also be joined to an
internal region of the effector molecule, or conversely, the effector molecule may be joined to
an internal location of the mutant IL13 molecule.
In some circumstances, it is desirable to free the effector molecule from the mutant
ML 13 molecule when the chimenc molecule has reached its target site. Therefore, chimeric
conjugates comprising linkages that are cleavable in the vicinity of the target site may be used
when the effector is to be released at the target site. Cleaving of the linkage to release the
effector molecule from the mutant IL13 molecule may be prompted by enzymatic activity or
conditions to which the conjugate is subjected either inside the target cell or in the vicinity of
the target site. When the target site is a tumor, a linker which is cleavable under conditions
present at the tumor site (e.g. when exposed to tumor-associated enzymes or acidic pH) may
be used. A number of different cleavable linkers are known to those of skill in the art. See.
e.g.. U.S. Patent Nos. 4.618.492: 4.542,225; and 4.625,014. The mechanisms for release of
an agent from these linker groups include, for example, irradiation of a photo labile bond and
acid-catalyzed hydrolysis. U.S. Patent No. 4,671,958, for example, includes a description of
irnmunoconjugates comprising linkers which are cleaved at the target site in vivo by the
proteolytic enzymes of the patient's complement system. In view of the large number of
methods that have been reported for attaching a variety of radiodiagnostic compounds,
radiotherapeutic compounds, drugs, toxins, and other agents to antibodies one skilled in the art will be able to determine a suitable method for attacMng a given effector molecule to a mutant ML 13 molecule.
Nucleic Acids Encoding Mutant ML 13 Molecules and Methods of Making Mutant ML 13 Molecules Using Nucleic Acids
The invention also provides puπfied nucleic acids encoding the mutant ML 13
molecules and the fusion proteins descπbed above. Starting with a known protein sequence,
DNA encoding the mutant ML13 molecules or the fusion proteins may be prepared by any
suitable method, including, for example, clomng and restπction of appropπate sequences or
direct chemical synthesis by methods such as the phosphotπester method of Narang et al
(1979) Meth Enzvmol 68: 90-99; the phosphodiester method of Brown et al (1979) Meth
Enzvmol 68 109-151, the diethylphosphoramidite method of Beaucage et al (1981) Tetra
Lett , 22. 1859-1862. and the solid support method of U S. Patent No. 4,458,066. Because of
the degeneracy of the genetic code, a large number of different nucleic acids will encode the
mutant ML 13 molecules and the fusion proteins Each of these is included witMn the
invention
Chemical synthesis produces a single stranded ohgonucleotide This may be
converted into double stranded DNA by hybπdization with a complementary sequence, or by
polymeπzation with a DNA polymerase using the single strand as a template Longer DNA
sequences may be obtained by the ligation of shorter sequences. Alternatively, subsequences
may be cloned and the appropπate subsequences cleaved using appropπate restπction
enzymes The fragments may then be hgated to produce the desired DNA sequence
DNA encoding the mutant ML 13 molecules or the fusion proteins may be cloned
using DNA amplification methods such as polymerase chain reaction (PCR). Thus, in a preferred embodiment, the gene for ML 13 is PCR amplified, using primers that introduce one
or more mutations. The primers preferably include restrictions sites, e.g., a sense primer
containing the restriction site for N el and an antisense primer contacting the restriction site
for Hindl . In one embodiment, the primers are selected to amplify the nucleic acid starting
at position 19, as described by McKenzie et al. (1987), supra. Triis produces a nucleic acid
encoding the mature IL13 sequence (or mutant ML 13 molecules) and having terminal
restriction sites.
For making DΝA encoding the fusion proteins, the DΝA encoding the effector
molecule can be obtained from available sources. For example, the PE38QQR fragment may
be excised from the plasmid ρWDMH4-38QQR or plasmid pSGC242FdΝl as described by
Debinski et al. Int. J. Cancer, 58: 744-748 (1994), and by Debinski et al. ( 1994) Clin.
Cancer Res. 1 :1015-1022 respectively. Ligation of the mutant IL13 molecule and a
Pseudomonas exotoxin (e.g., PE38QQR) sequences and insertion into a vector produces a
vector encoding the mutant IL13 joined to the terminus of the Pseudomonas exotoxin (e.g.,
joined to the amino terminus of PE38QQR, PE1E, or PE4E (position 253)). In a preferred
embodiment, the two molecules are joined directly. Alternatively there can be an intervening
peptide linker (e.g., a three amino acid junction consisting of glutamic acid, alanine, and
phenylalanine introduced by the restriction site).
While the two molecules are preferably essentially directly joined together, one of
skill will appreciate that the molecules may be separated by a peptide spacer consisting of one
or more amino acids. Generally the spacer will have no specific biological activity other than
to join the proteins or to preserve some minimum distance or other spatial relationsMp
between them. However, the constituent amino acids of the spacer may be selected to influence some property of the molecule such as the solubility, folding, net charge, or
hydrophobicity.
The nucleic acid sequences encoding the mutant ML 13 molecules or the fusion
proteins may be expressed in a variety of host cells, including E. coli, other bacterial hosts,
yeast, and various Mgher eukaryotic cells such as the COS, CHO and HeLa cells lines and
myeloma cell lines. The recombinant protein gene will be operably linked to appropriate
expression control sequences for each host. F or E. coli this includes a promoter such as the
T7, trp, or lambda promoters, a ribosome binding site and preferably a transcription
termination signal. For eukaryotic cells, the control sequences will include a promoter and
preferably an enhancer derived from immunoglobulin genes. SV 40, cytomegalovirus, etc.,
and a polyadenylation sequence, and may include splice donor and acceptor sequences.
Plasmid vectors of the invention made as described above can be transferred into the
chosen host cell by well-known methods such as calcium chloride, or heat shock,
transformation for E. coli and calcium phosphate treatment or electroporation for mammalian
cells. Cells transformed by the plasmids can be selected by resistance to antibiotics conferred
by genes contained on the plasmids, such as the amp, gpt, neo and hyg genes.
Once expressed, the recombinant mutant ML 13 molecules or fusion proteins can be
purified according to standard procedures of the art, including ammonium sulfate
precipitation, affinity columns, column chromatography, gel electrophoresis and the like.
See. generally, R. Scopes, Protein Purification, Springer- Verlag, N.Y. (1982); and Deutscher,
Methods in Enzymology Vol. 182: Guide to Protein Purification, Academic Press. Inc. N.Y.
( 1990). Substantially pure compositions of at least about 90 to 95% homogeneity are
preferred, and 98 to 99% or more homogeneity are most preferred for pharmaceutical uses. Once purified, partially or to homogeneity as desired, the polypeptides may then be used
therapeutically.
After chemical synthesis, biological expression, or purification, the mutant ML 13
molecules or the fusion proteins may possess a conformation substantially different than the
native conformations of the constituent polypeptides. In tMs case, it may be necessary to
denature and reduce the polypeptide and then to cause the polypeptide to re-fold into the
preferred conformation. Methods of reducing and denaturing proteins and inducing re¬
folding are well known to those of skill in the art. See, Debinski et al. (1993) J. Biol. Chem ,
268: 14065-14070; Kreitman and Pastan (1993) Bioconjug. Chem., 4: 581-585; and Buchner,
et al. (1992) Anal. Bwchem., 205: 263-270.
Modifications can be made to the IL13 receptor targeted fusion proteins without
dunimsMng their biological activity. Some modifications may be made to facilitate the
clomng, expression, or incorporation of the targeting molecule into a fusion protein. Such
modifications are well known to those of skill in the art and include, for example, a
methiomne added at the amino terminus to provide an initiation site, or additional ammo
acids placed on either terminus to create conveniently located restπction sites or termination
codons.
.Antibodies
Mutants of ML 13 (or lmmunogenic fragments or analogs thereof) can be used to raise
antibodies useful in the invention. Such polypeptides can be produced by recombinant
techmques or synthesized as descπbed above. In general, ML 13 mutants can be coupled to a
earner protein, such as KLH, as descπbed in Ausubel et al, supra, mixed with an adjuvant. and injected into a host mammal. Antibodies produced in that animal can then be purified by
peptide antigen affinity chromatography. In particular, various host animals can be
immunized by injection with an ML13 mutant or an antigenic fragment thereof. Commonly
employed host animals include rabbits, mice, guinea pigs, and rats. Various adjuvants that
can be used to increase the immunological response depend on the host species and include
Freund's adjuvant (complete and incomplete), mineral gels such as aluminum hydroxide,
surface active substances such as lysolecitMn, pluronic polyols, polyanions, peptides, oil
emulsions, keyhole limpet hemocyanin, and dinitrophenol. Other potentially useful adjuvants
include BCG (bacille Calmette-Guerin) and Corynebacterium parvum.
Polyclonal antibodies are heterogeneous populations of antibody molecules that are
contained in the sera of the immunized animals. Antibodies within the invention therefore
include polyclonal antibodies and, in addition, monoclonal antibodies, single chain
antibodies. Fab fragments, F(ab')2 fragments, and molecules produced using a Fab expression
library. Monoclonal antibodies, which are homogeneous populations of antibodies to a
particular antigen, can be prepared using the mutants of ML 13 described above and standard
hybπdoma technology (see. for example. Kohler et al.. Nature 256:495, 1975; Kohler et al.,
Eur. J. Immunol. 6:51 1. 1976: Kohler et al.. Eur. J. Immunol. 6:292. 1976; Hammerling et al..
"Monoclonal Antibodies and T Cell Hybridomas," Elsevier. N.Y., 1981 ; Ausubel et al.,
supra). In particular, monoclonal antibodies can be obtained by any technique that provides
for the production of antibody molecules by continuous cell lines in culture such as descnbed
in Kohler et al.. Nature 256:495, 1975. and U.S. Pat. No. 4.376.110; the human B-cell
hybridoma technique (Kosbor et al., Immunology Today 4:72. 1983; Cole et al., Proc. Natl.
Acad. Sci. USA 80:2026, 1983), and the EBV-hybridoma technique (Cole et al, "Monoclonal Antibodies and Cancer Therapy," Alan R. Liss, Inc., pp. 77-96, 1983). Such antibodies can
be of any immunoglobulin class including IgG, IgM, IgE, IgA, IgD and any subclass thereof.
A hybridoma producing a mAb of the invention may be cultivated in vitro or in vivo. The
ability to produce high titers of mAbs in vivo makes mis a particularly useful method of
production.
Once produced, polyclonal or monoclonal antibodies can be tested for specific
recognition of the mutants by Western blot or immunoprecipitation analysis by standard
methods, for example, as described in Ausubel et al., supra. Antibodies that specifically
recognize and bind to ML 13 mutants are useful in the invention. For example, such
antibodies can be used to monitor the amount of an ML 13 mutant associated with a cell or to
block binding of a particular mutant a receptor.
Antibodies of the invention can be produced using fragments of the ML 13 mutants
that lie outside highly conserved regions and appear likely to be antigenic, by criteria such as
high frequency of charged residues. Cross-reactive anti-ML13 mutant antibodies are produced
using a fragment of a ML 13 mutant that is conserved amongst members of this family of
proteins. In one specific example, such fragments are generated by standard techniques of
PCR. and are then cloned into the pGEX expression vector (Ausubel et al, supra). Fusion
proteins are expressed in E.coli and purified using a glutathione agarose affinity matrix as
described in Ausubel, et al., supra. Non-cross reactive antibodies can be prepared by
adsorbing the antibody with the antigen(s) that the antibody is desired not to react with. For
example, antisera prepared against a particular ML13 mutant can be adsorbed with other
ML 13 mutants and/or native ML 13 to reduce or eliminate cross-reactivity.
In some cases it may be desirable to minimize the potential problems of low affinity WO 01/25282 PCTYUSOO/27567 or specificity of antisera. In such circumstances, two or three fusions can be generated for
each protein, and each fusion can be injected into at least two rabbits. Antisera can be raised
by injections in a series, preferably including at least three booster injections. Antiserum is
also checked for its ability to immunoprecipitate recombinant mutants of ML 13 or control
proteins, such as glucocorticoid receptor, CAT, or luciferase.
Techniques described for the production of single chain antibodies (U.S. Pat. Nos.
4,946,778, 4,946,778, and 4,704,692) can be adapted to produce single chain antibodies
against an ML 13 mutant, or a fragment thereof. Single chain antibodies are formed by linking
the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a
single chain polypeptide.
Antibody fragments that recognize and bind to specific epitopes can be generated by
known techniques. For example, such fragments include but are not limited to F(ab')2
fragments that can be produced by pepsin digestion of the antibody molecule, and Fab
fragments that can be generated by reducing the disulfide bridges of F(ab')2 fragments. Alter-
natively, Fab expression libraries can be constructed (Huse et al., Science 246: 1275, 1989) to
allow rapid and easy identification of monoclonal Fab fragments with the desired specificity.
The antibodies of the invention can be used, for example, in the detection of a ML 13
mutant in a biological sample. Antibodies can also be used to interfere with the interaction of
an ML 13 mutant and other molecules that bind the mutant (e.g., an ML13 receptor).
Methods of Delivering a Mutant ML 13 Molecule to a Cell
The invention also provides a method of delivering an IL13 mutant to a cell. This
method is useful, among other things, for directing a chimeric molecule including the ML 13 mutant and an effector molecule to a cell so that the effector molecule can exert its function.
For example, an ML 13 mutant conjugated to a cytotoxin can be delivered to a target cell to be
killed by mixing a composition containing the chimeric molecule with the target cell
expressing a receptor that binds the mutant. As another example, an ML 13 mutant
conjugated to a detectable label can be directed to a target cell to be labeled by mixing a
composition containing the chimeric molecule with the target cell expressing a receptor that
binds the mutant.
Mutant ML 13 molecules can be delivered to a cell by any known method. For
example, a composition containing the ML 13 mutant can be added to cells suspended in
medium. Alternatively, a mutant ML 13 can be admimstered to an animal (e.g., by a
parenteral route) having a cell expressing a receptor that binds the mutant so that the mutant
binds to the cell in situ. The mutant ILI3 molecules of mis invention are particularly well
suited as targeting moieties for binding tumor cells because tumor cells overexpress ILI3
receptors. In particular, carcinoma tumor cells (e.g. renal carcinoma cells) overexpress ILI3
receptors at levels ranging from about 2100 sites/cell to greater than 150,000 sites per cell.
Similarly, gliomas and other transformed cells also overexpress ILI3 receptors (ILI3R).
Thus, the methods of this invention can be used to target an effector molecule to a variety of
cancers. Such cancers are well known to those of skill in the art and include, but are not
limited to. cancers of the skin (e.g., basal or squamous cell carcinoma, melanoma, Kaposi's
sarcoma, etc.), cancers of the reproductive system (e.g., testicular, ovarian, cervical), cancers
of the gastrointestinal tract (e.g., stomach, small intestine, large intestine, colorectal. etc.),
cancers of the mouth and throat (e.g. esophageal. larynx, oropharynx, nasopharynx, oral. etc.).
cancers of the head and neck, bone cancers, breast cancers, liver cancers, prostate cancers (e.g., prostate carcinoma), thyroid cancers, heart cancers, retinal cancers (e.g., melanoma),
kidney cancers, lung cancers (e.g., mesothelioma), pancreatic cancers, brain cancers (e.g.
gliomas, medulloblastomas, meningiomas, etc.) and cancers of the lymph system (e.g.
lymphoma). In a particularly preferred embodiment, the methods of tiiis invention are used
to target effector molecules to brain cancers (especially gliomas).
One of skill in the art will appreciate that identification and confirmation of ILI3
overexpression by other cells requires only routine screening using well-known methods.
Typically tMs involves providing a labeled molecule that specifically binds to the ILI3
receptor (e.g., a native or mutant ILI3). The cells in question are then contacted with tMs
molecule and washed. Quantifying the amount of label remaining associated with the test
cell provides a measure of the amount of ILI3 receptor (ILI3R) present on the surface of that
cell. In a preferred embodiment, IL13 receptor may be quantified by measuring the binding of
125I-labeled IL13 (125I-ILI3) to the cell in question. Details of such a binding assay are
provided in U.S. Patent 5,614,191.
As IL13 has been implicated in playing an important regulatory role in allergic
hyperactivity reactions such as asthma (Webb et al. (2000) J. Immunol. 165: 108-1 13), the
invention also provides a method of modulating an allergic response by contacting a cell
important in the response (e.g., a lymphocyte such as a B cell, an eosinophil, a mast cell,
and/or any other cells involved in Th2-dominated inflammatory responses) with one or more
ML 13 mutants. Thus, for example, where interaction of native ML 13 with an ML 13 receptor
expressed on a cell causes transmembrane signals that contribute to the cell's role in an
allergic reaction (e.g., inducing inflammation), a mutant ML 13 can be used to block this
interaction and inMbit the allergic reaction. The interaction between native ML 13 and the IL13 receptor can be blocked, for example, by contacting the cell 1 can with an ML 13 mutant
that binds to the IL13 receptor (m some cases with more affimty than native ML13) but does
not cause the transmembrane signaling through the receptor. For asthma, such an ML 13
mutant could be administered by inhalation of a pharmaceutical composition containing the
mutant.
Pharmaceutical Compositions
The mutant ML13 molecules (including those conjugated with an effector molcule) of
tMs invention can be prepared for parenteral, topical, oral, or local admimstration, such as by
aerosol or transdermally, for prophylactic and/or therapeutic treatment. The pharmaceutical
compositions can be administered m a vaπety of unit dosage forms depending upon the
method of admimstration. For example, unit dosage forms suitable for oral administration
include powder, tablets, pills, capsules and lozenges. It some cases it may be desirable to
protect the fusion proteins and pharmaceutical compositions of this invention, from being
digested (e.g., when administered orally). This can be accomplished either by complexmg
the protein with a composition that renders it resistant to acidic and enzymatic hydrolysis, or
by packaging the protein in an appropnately resistant earner such as a hposome. Means of
protecting compounds from digestion are well known in the art (see, e.g., U.S. Patent
5,391,377 descnbmg hpid compositions for oral delivery of therapeutic agents).
The pharmaceutical compositions can also be delivered to an animal by inhalation by
any presently known suitable technique. For example, the ML13 mutants of the invention
can be delivered in the form of an aerosol spray produced from pressunzed packs or a
nebulizer, with the use of a suitable propellant such as dichlorodifluromethane, trichlorotπ- fluoromethane, dichlorotetraflurorethane, carbon dioxide, or any other suitable gas. the
case of a pressuπzed aerosol, the dosage unit may be controlled using a valve to deliver a
metered amount. Capsules and cartridges (e.g., of gelatin) contammg a powder mix of the
ML13 mutant and a suitable base (e.g., lactose or starch) can be used m an inhaler or
insufflator to deliver the mutant to the respiratory tract of an animal
The pharmaceutical compositions of tMs invention are particularly useful for
parenteral administration, such as intravenous admimstration or admimstration into a body
cavity or lumen of an organ. The compositions for admimstration will commonly compπse a
solution of the mutant ML 13 molecule dissolved in a pharmaceutically acceptable camer,
preferably an aqueous camer A vaπety of aqueous earners can be used, e g , buffered salme
and the like. These solutions are stenle and generally free of undesirable matter (e.g ,
pyrogens) These compositions may be steπhzed by conventional, well known stenhzation
techmques The compositions may contain pharmaceutically acceptable auxiliary substances
as required to approximate physiological conditions such as pH adjusting and buffenng
agents, toxicity adjusting agents and the like, for example, sodium acetate, sodium chlonde,
potassium chlonde. calcium chlonde. sodium lactate and the like The concentration of the
mutant ML 13 m these formulations can vary widely, and will be selected pπmanly based on
fluid v olumes, viscosities, body weight and the like in accordance with the particular mode of
administration selected and the patient's needs Actual methods for prepanng parenterally
admimstrable compositions will be known or apparent to those skilled m the art and are
descnbed in more detail in such publications as Remington 's Pharmaceutical Science 15th
ed . Mack Publishing Company, Easton, Pennsylvania (1980)
-21- Toxicity and therapeutic efficacy of the pharmaceutical compositions utilized in the
invention can be determined by standard pharmaceutical procedures, using either cells in
culture or experimental ammals to determine the LD;0(the dose lethal to 50% of the
population) and the ED50 (the dose therapeutically effective in 50% of the population). The
dose ratio between toxic and therapeutic effects is the therapeutic index and it can be
expressed as the ratio LD5O/ED50. Doses that exMbit large therapeutic indices are preferred.
WMle those that exMbit toxic side effects may be used, care should be taken to design a
delivery system that targets the pharmaceutical composition to the site of affected tissue in
order to minimize potential damage to umnfected cells and, thereby, reduce side effects.
The data obtained from cell culture assays and ammal studies can be used in
formulating a range of dosage for use in humans. The dosage of such pharmaceutical
compositions lies preferably witMn a range of circulating concentrations that include an ED50
with little or no toxicity. The dosage may vary witMn this range depending upon the dosage
form employed and the route of admimstration utilized. For any pharmaceutical composition
used in a method of the invention, the therapeutically effective dose can be estimated initially
from cell culture assays. A dose can be formulated in animal models to achieve an IC50 (that
is. the concentration of the test compound which achieves a half-maximal inhibition of
symptoms) as determined in cell culture. Such information can be used to more accurately
determine useful doses in humans. Levels in plasma can be measured, for example, by high
performance liquid chromatography. Although dosage should be determined for each
particular application, it is expected that a dose of a typical pharmaceutical composition for
intravenous administration would be about 0.1 to 10 mg per patient per day. Dosages from
0.1 up to about 100 mg per patient per day may be used, particularly when the pharmaceutical compositions is admmistered to a secluded site and not into the blood stream, such as into a body cavity or into a lumen of an organ.
The compositions contammg the present ML13 mutants, or a cocktail thereof (i e.,
with other proteins), can be admmistered for therapeutic treatments. In therapeutic
applications, compositions are administered to a patient suffenng from a disease, m an
amount sufficient to cure or at least partially arrest the disease and its complications. An
amount adequate to accomplish tMs is defined as a "therapeutically effective dose." Amounts
effective for this use will depend upon the seventy of the disease and the general state of the
patient's health. Single or multiple admimstrations of the compositions may be admmistered
dependmg on the dosage and frequency as required and tolerated by the patient In any event,
the composition should provide a sufficient quantity of the proteins of tMs invention to
effectively treat the patient.
Among vanous uses of the cytotoxic fusion proteins of the present invention are
included a vaπety of disease conditions caused by specific human cells that may be
eliminated by the toxic action of the protein One prefeπed application is the treatment of
cancer te g , a ghoma), such as by the use of an mutant IL13 ligand attached to a cytotoxin
(e g , PE or a PE deπvative)
It will be appreciated by one of skill in the art that there are some regions that are not
heavily vasculanzed or that are protected by cells joined by tight junctions and/or active
transport mechanisms which reduce or prevent the entry of macromolecules present in the
blood stream For example, systemic administration of therapeutics to treat gliomas. or other
bram cancers, is constrained by the blood-brain barner which resists the entry of macro¬
molecules into the subarachnoid space Thus, the therapeutic compositions of tMs invention can be admimstered directly to the tumor site. For instance, brain tumors (e.g., gliomas) can
be treated by admimstering the therapeutic composition directly to the tumor site (e.g.,
through a surgically implanted catheter). Where the fluid delivery through the catheter is
pressurized, small molecules ( e.g. the therapeutic molecules of tMs invention) will typically
infiltrate as much as two to tMee centimeters beyond the tumor margin.
Alternatively, the therapeutic composition can be placed at the target site in a slow
release formulation (e.g., a thrombin-fibrinogen mixture). Such formulations can include, for
example, a biocompatible sponge or other inert or resorbable matrix material impregnated
with the therapeutic composition, slow dissolving time release capsules or microcapsules, and
the like.
Typically the catheter, or catheters, or time release formulation will be placed at the
tumor site as part of a surgical procedure. Thus, for example, where major tumor mass is
surgically debulked, the perfusing catheter or time release formulation can be emplaced at the
tumor site as an adjunct therapy. Of course, surgical removal of the tumor mass may be
undesired. not required, or impossible, in which case, the delivery of the therapeutic
compositions of tMs invention may comprise the primary therapeutic modality.
Imaging
The invention also provides a method of imaging a cell expressing a receptor that
binds an ML13 mutant in vivo. In an exemplary method, an ML13 mutant conjugated to a
label detectable by the chosen imaging technique is admimstered to an ammal having the cell
expressing a receptor that binds the particular ML 13 mutant. The animal is then imaged
using the chosen imaging technique. Examples of labels useful for diagnostic imaging include radiolabels such as 1311, In, 123I, 99mTc, 32P, 1251, Η,14C, and 188Rh; fluorescent
labels such as fluorescein and rhodamine; nuclear magnetic resonance active labels; positron
emitting isotopes detectable by a positron emission tomography ("PET") scanner;
chemiluminescent labels such as luciferin; and enzymatic markers such as peroxidase or
phosphatase. Mutants of ML 13 can be labeled with such reagents as described above or
using techmques known in the art.
Any imaging techmque compatible with the labeled-ML13 mutant can be used.
Examples of such techmques include immunoscintigraphy where a gamma camera is used to
detect the location and distribution of gamma-emitting radioisotopes; MRI where a
paramagnetic labeled-ML13 mutant is used; PET where an ML 13 mutant is conjugated with a
positron emitting label; and X-ray imaging where an ML 13 mutant is conjugated with a
radioopaque label (e.g., a metal particle). A more detailed description of such techniques is
provided in Handbook of Targeted Delivery of Imaging Agents (Handbook of Pharmacology
and Toxicology), ed. V. TorcMlin, CRC Press, 1995; Armstrong et al., Diagnostic Imaging,
Black vell Science Inc., 1998; and Diagnostic Nuclear Medicine, ed. C. Schiepers, Springer
Verlag. 2000.
As an illustrative example, the location of glioma tumor cells in an animal can be
determined by injecting (e.g., parenterally or in situ) an animal with a composition including
native ML13 or an ML13 mutant conjugated to a detectable label (e.g., a gamma emitting
radioisotope). The composition is then allowed to equilibrate in the animal, and to bind to the
glioma cells. The ammal is then subjected to imaging (e.g., using a gamma camera) to image
where the glioma cells are.
56- Diagnostic Kits another embodiment, tMs invention provides for kits for the treatment of tumors or
for the detection of cells overexpressing IL 13 receptors. Kits will typically comprise a
cMmenc molecule of the present invention (e.g., a mutant ML 13 conjugated to a detectable
label, a mutant ML13 conjugated to cytotoxin, a mutant IL13 conjugated to a targeting ligand.
etc.). In addition the kits will typically include instructional matenals disclosmg means of
use of cMmenc molecule ( e.g., as a cytotoxin, for detection of tumor cells, to augment an
immune response, etc.). The kits may also include additional components to facilitate the
particular application for wMch the kit is designed. Thus, for example, where a kit contains a
cMmenc molecule in which the effector molecule is a detectable label, the kit may
additionally contain means of detecting the label (e.g. enzyme substrates for enzymatic labels,
filter sets to detect fluorescent labels, appropnate secondary labels such as a sheep anti-
mouse-HRP , or the like). The kits may additionally include buffers and other reagents
routinely used for the practice of a particular method. Such kits and appropnate contents are
well known to those of skill in the art.
EXAMPLES
The present invention is further illustrated by the following specific examples. The
examples are provided for illustration only and are not to be construed as limiting the scope
or content of the invention in any way
/- Example 1 : Materials and Methods
Restriction endonucleases and DNA ligase were obtained from New England Biolabs
(Beverly, MA), Bethesda Research Laboratories (BRL, Gaithersburg, MD) and Boehringer
Mannheim (Mdianapolis, IN). U.S.E. mutagenesis kit, fast protem liquid cMomatograpMc
(FPLC) system, columns and media were obtained from Pharmacia (Piscataway, NJ).
Oligonucleotide primers were synthesized at the Macromolecular Core Laboratory, Penn
State College of Medicine. Polymerase chain reaction (PCR) kit was from Perkin-Elmer
Cetus Norwalk, CT). Tissue culture ware was from Coming (Coming, NY). 3-(4,5-
dimethyltMazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (inner
salt)/phenazme methasulfate (MTS/PMS) non-radioactive cell proliferation assay was
purchased from Promega (Madison. WI). SDS-PAGE supplies were from BioRad (Hercules.
CA). Antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).
SuperSignal Substrate for chemiluminescent detection was purchased from Pierce (Rockford,
IL). Cell lines were obtained from the Amencan Type Culture Collection (RockviUe. MD).
MTS/PMS for cell titer 96 aqueous non-radioactive cell proliferation assay was purchased
from Promega (Madison. WI).
For recombinant protein expression in a prokaryotic system, all plasmids carrying the
genes encoding proteins of interest were under a T7 promoter-based expression system. The
plasmids were constructed as descπbed in Debinski et al.. (1998) Nature Biotech.. 16:449-
453. BL21(1DE3) E. coli. which carry the T7 RNA polymerase gene in an isopropyl- 1-thιo-
b-galactopyranoside (EPTG) inducible form, were used as the host for recombinant protem
expression. Production of recombinant proteins driven by T7 RNA polymerase allowed production of milligram quantities of recombinant protein from a 1.0 liter culture induced at
A6O0 of2.0.
For expression of proteins, competent BL21 cells were transformed with the
appropriate plasmids and grown in Terrific Broth (DIFCO Laboratories, Detroit MI) to A600
equal to 2.0, at which point IPTG was added to a final concentration of 250 mM. Cells were
harvested 90 min. later. The inclusion body fraction of the cells was isolated and denatured
in 7M guanidine HC1, then renatured by rapid dilution into buffer, using the disulfide-
shuffling method as was previously described in Debinski et al. (1993) J. Biol. Chem.,
268: 14065-14070. .After dialysis, the renatured proteins were purified using a Pharmacia fast
protein liquid chromatography (FPLC) system.
For mutagenesis, mutations of the ML 13 gene were made by standard PCR protocols
(using the mutated oligonucleotides as sense or anti-sense primers in PCR) or by using a
umque site elimination (U.S.E.) mutagenesis kit, based on the procedure developed by Deng
and Nickoloff in Anal. Biochem., 200:81-88, 1992. Examples of primers used for the
mutagenesis are shown below in table 1. All mutated plasmids were isolated and sequenced
to verify the correct mutation pπor to use.
Table 1 hIL13 E13D TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGACCTCATTGAGGAG hIL13 E1 1 TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGATCCTCATTGAGGAG hlL13 E13 AGGAGATATACATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGAAGCTCATTGAGGA hIL13 E13R TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGCGCCTCATTGAGGAG hIL13 E13S TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGTCTCTCATTGAGGAG hIL13 E13Y TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGTACCTCATTGAGGAG hIL13 E1όK TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCCTCTACAGCCCTCAGGGAGCTCATTAAGGAGCTGGT hI 13 E17K TTTGTGTGTCATATGTCCCCAGGCCCTGTGCCTCCTCTACAGCCCTCAGGGAGCTCATTGAGAAGCTGGTCA hIL13 R66D ATCGAGAAGACCCAGGACATGCTGAGCGGATTC hIL13 D69D ACCCAGAGGATGCTGGACGGATTCTGCCCGCAC
For polyacrylamide gel electrophoresis and lmmunoblottmg, the punty of the isolated
recombinant proteins was determined by sodium dodecyl sulfate polyacrylamide gel
electrophoresis, under nonreducmg conditions. The separated proteins m the gel were stained
either with Coomassie Blue for visual inspection or transferred to polyvmyhdene difluonde
(PVDF) membrane for Western blot analysis. For Western blot analysis, the PVDF with the
transferred proteins was incubated m 5% nonfat milk m phosphate buffered salme (PBS) for
one hour at room temperature The membrane was incubated for one hour m 5% milk/PBS
containing goat anti-human IL13 antibody (1 1,000 dilution) The antibody was raised
against a ML 13 specific peptide located at the carboxy terminus of ML 13 After incubation
with the pnmary antibody, the membrane was washed tMee times, five mm. each, with 0 05%
Tween 20 PBS The membrane was then incubated for one hour m 5% milk/PBS containing
donkey anti-goat IgG conjugated with horseradish peroxidase ( 1 20.000 dilution) The
membrane was washed tMee times, five mm each, with 0 05% T een 20/PBS The
lmmuno-reactive proteins were identified on film, using enhanced chemiluminescence
detection Images were digitized using a Hewlett Packard Scan-Jet 6100C scanner and
composited using Microsoft Powerpomt software
For circular dicMoism (CD), CD spectra for the proteins were obtained over the
wavelength range of 185-260 nm using a Jasco J-710 spectropolaπmeter All measurements
were earned at 37 °C, using the same cuvette, the same onentation of the cuvette to the light
source, and a 2 mm light path Proteins (0 1 mg/ml) were resuspended in phosphate buffered salme (PBS) and then analyzed. For uMolded samples, protein was resuspended in 8M urea
containing 40 mM DTT (denaturation buffer). Reported spectra were the average of tMee
consecutive runs for each sample. Spectra from appropπate blanks, PBS alone or
denaturation buffer, were subtracted from each sample so that the resulting spectra reflected
only the CD contπbution of the proteins
For cell proliferation assays, cell killing by cytotoxins was tested as follows. 5 x 103
cells per well were plated in a 96-well tissue culture plate m 150 ml of media. Vaπous
concentrations of cytotoxins were diluted m 0 1% BSA/PBS and 25 ml of each dilution was
added to cells 18-24 h following cell plating. Cells were incubated at 37 °C for another 48 h
Then, the cytotoxicity was determined using a colonmetnc MTS [3-(4,5-dιmethylthιazol-2-
yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolιum, inner salt] / PMS
(phenazme methasulfate) cell proliferation assay. MTS PMS was added at a half final
concentration as recommended by the manufacturer. The cells were incubated with the dye
for 4 M and then the absorbance was measured at 490 nm for each well using a micro-plate
reader (Cambndge Technology, Inc . Watertown, MA) The wells containing cells treated
with cvcloheximide (10 mM) or wells with no viable cells left served as a background for the
assay For blocking studies, interleukins at a concetration of 1 0 ug/ml were added to cells
for 60 mm before the cytotoxins addition
Cell proliferation studies using TF-1 cells (pre-leukemic human B cells, which
express the shared IL13/4 receptor) were performed by growing the cells in the presence of
different concentrations of wild-type mterleukms or their mutants in 96 well culture plates
After 72 h of incubation at 37 °C, the rate of proliferation of the TF-1 cells was determined
t>y a colonmetnc MTS [3-(4,5-dιmethylthιazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4- sulfophenyl)-2H-tetrazolium, inner salt]/PMS (phenazine methasulfate) cell proliferation
assay. The cell samples were incubated with the dye for four h then their absorbance at 490
nm was recorded for each well using a microplate reader. The wells with cells treated with
Mgh concentrations of cycloheximide served as background for the assay.
For indirect immunofluorescence analyses, HUVEC were seeded onto an eight
chambered slide, 50,000 cells per chamber, and incubated overnight at 37 °C to allow cells to
attach. The media was removed and replaced with media contaimng ML 13 or its mutants (1
mg ml final concentration). The cells were incubated again overnight at 37 °C. The next
day, the media was removed, the cells were fixed in ethanol and incubated with blocking
media ( 10% normal rabbit serum in PBS) at room temperature for 20 min. The blocking
media was removed and goat anti-VCAM-1 antibody (1 ug ml) in 1.5% normal rabbit
serumPBS was added. Cells were incubated at room temperature for one hour, then primary
antibody was removed and cells rinsed tMee times, five min. each, with PBS. Cells were
incubated with rabbit anti-goat IgG-Cy3 conjugate (1 :150 dilution) in 1.5% normal rabbit
seru PBS for 45 min. at room temperature, in the dark. After 45 min., the cells were rinsed
tMee times, five min. each, with PBS, a coverslip was mounted using aqueous mounting
medium, and the fluorescent staining determined using a rhodamine filter set. Images were
obtained from the same experiment without adjusting the microscope between samples on a
Zeiss Axioplan microscope and captured digitally using Snappy by Play Inc.
For cytotoxicity-blocking assays, glioblastoma cells (U-251 MG and SNB-19) were
plated into 96-well culture plates and incubated for 24 h. After 24 h, ML13 or its mutants
were added to cells and incubated for one hour at 37 °C. An equal volume of 0.1% BSA in
PBS was added to cells for assays without blocking ligand. After the hour incubation. increasing concentration of the ML13 chimeric toxm (ML13-PE1E; see Debinski, et al.
(1996) J. Biol. Chem., 271, 22428-22433)) was added (0.001-10 ng ml final concentration)
and the cells were incubated for tMee days. After tMee days, the number of proliferating
cells in each well was determined using the colorimetric MTS/PMS method described above.
The wells with cells treated with Mgh concentrations of cvcloheximide served as background
for the assay.
For autoradiography, recombinant ML13.E13Y was lodo-labeled with 125I by using
the IODO-GEN reagent (Pierce) according to the manufacturer's instructions. The specific
activity of 125I-ML13.E13Y was ~ 300 mCi/mg of protein. All studies involving human
specimens were approved by the respective Human Subjects Protection Offices at the Perm
State College of Medicine (Protocol No. IRB 96-123EP). Serial tissue sections were cut (10
mm) on a cryostat. thaw-mouncMome alumme-alum coated slides, and stored at 4 °C until
analyzed. To observe binding distribution of 125I-ML13.E13Y. sections were incubated (1 M,
22 °C) with 1.0 nM 125I-ML13 in binding buffer (200 mM sucrose, 50 mM HEPES, 1% BSA,
10 mM EDTA). Adjacent senal sections were incubated with the radiolabeled recombinant
ML13.E13Y after a 30 mm pre-mcubation at 22 °C in the presence of binding buffer alone or
of a 100- to 500-fold molar excess of unlabeled ML13. ML13.E13Y or ML4, or a monoclonal
antibody against human transfernn receptor (TfR). To dissociate non-specifically bound
radioligand. sections were nnsed in four consecutive changes (5 minutes each) of ice-cold 0.1
M PBS. At least two sections of each of the tissue specimens were assayed for the evaluation
of 125I-ML13.E13Y binding specificity. After drying, labeled sections were apposed to Kodak
autoradiography film at -65 °C for 8 M to 11 days. Example 2-Radioimmunodetection and Radioimmunotherapy of Human High Grade Gliomas
The IL13 mutein, ML13.E13Y, was prepared as described above and tested for its
ability to modulate the interleukin-induced proliferative responses of TF-1 cells. TF-1 cells
were treated with ML13, ML13.E13Y, or ML13.E13K. WMle ML13 was very potent in
stimulating the growth of TF- 1 cells, ML 13.E 13K showed no activity and ML 13.E 13 Y
exMbited only very weak activity, if any at all.
The ability of ML13.E13Y to compete for the ML13 bindmg sites in climcal
specimens of glioblastoma (GBM) in situ was investigated in autoradiograpMc studies. The
two GBM tissues sMdied labeled densely with 125I-ML13.E13Y bindmg sites, as well as with
labeled wild type ML13. The binding was specific since both ML13.E13Y and the wild type
IL13 blocked the binding of 125I-ML13.E13Y. In contrast, an excess of recombinant ML4
was largely without influence on the 125I-ML13.E13Y binding to GBM specimens.
another test of specificity of the ML13.E13Y binding to GBM, the ability of a
monoclonal antibody against the transfernn receptor (TfR) to displace the binding of
radiolabeled interleukin was examined. No cross-competition for the ML 13 binding sites in
the GBMs examined was observed. The binding of ML13.E13Y to GBM appears to be very
specific as others studies have shown that I25I-ML13 fails to interact with normal brain or
normal human cells and that 125I-ML13.E13Y does not interact with normal human cells, such
as HUVEC.
M other tests, the ability of ML13.E13Y to block the action of ML13-PE1E (an
ML13-based cytotoxin) was investigated using two different human malignant glioma cell
lines. Glioma cells in culture were pretreated with either ML13, ML13.E13Y or ML13.E13K before ML13-PE1E was added. The cytotoxicity of hIL13-PElE was neutralized m these cultures using ML 13, ML13.E13Y, or ML13.E13K.
Example 3-Mutants of Interleukin 13 with Altered Reactivity Towards Interleukin 13 Receptors
Recombinant IL-13 and IL-13 mutants were prepared, isolated, and punfied as
descπbed in Example 1. The prokaryotic production of the cytokines or their mutants under
control of the T7 promoter was very efficient. After purification, between 0.5 mg and 1.5 mg
of each cytokine or mutant was obtained from a 1 liter culture. When each punfied protem
was analyzed using SDS-PAGE and stained with Coomassie Blue, a single protem band was
observed migrating at approximately 13 kDa (Figure 1, panel A). Visual inspection
suggested that all preparations were greater than 95%> pure. A corresponding Western blot of
the samples using a goat polyclonal antι-ML13 antibody (that was not cross-reactivity with
any other cytokine) indicated that the isolated proteins were immuno-reactive with ML 13
(Figure 1, panel B) The alpha-helix D mutants, ML13.R109D and ML13.F1 13D, also
reacted with this antibody indicating that they too were immuno-reactive with ML 13 (data
not shown). Traces of a dimeπc form (-26 kDa) of some of the mutated cytokines were also
detected.
To determine whether the recombinant lnterleukms had refolded correctly and that
their mutation had not destroyed their general pattern of conformation, circular dicMoism
(CD) was used to determine the proteins' folded structure. The secondary structure data from
the spectropolaπmeter indicated that each protem sample produced a spectrum consistent
with an alpha-helical ennched protem, having two spectral mimma at approximately 208 nm
and 222 nm (Figure 2). Furthermore, the CD spectrum of each mutant could be super- imposed on the CD spectrum of the wild-type ML 13, although slight variations in spectra
intensity were observed between samples (Figure 2, panels A, B, C). ML13.R109D and
ML13.F113D both produced CD spectra similar to the other mutants (not shown). For
comparison, the CD spectrum of unfolded ML13 was also obtained (Figure 2, panel D). The
panel illustrates the collapse of the characteristic alpha-helical pattern when the protein is
unfolded.
Functional assays were employed to examine whether the IL13 mutants exMbited an
altered association with the shared signaling EL 13/4 receptor by measuring their effect on
induced TF-1 cell proliferation. TF-1 cells express the shared IL13/4 receptor (but not the
restricted receptor) and proliferate in a dose-dependent manner in the presence of ML 13 or
ML4. Under the conditions used in tMs assay, a concentration of 100 ng/ml of wild-type
ML13 consistently produced a maximal proliferative response in TF-1 cells of -300% that of
the baseline value (Figure 3, panel A). Differences were observed in TF-1 cell proliferation
depending on whether the mutants were in the predicted alpha-helices A, C, or D. Of the
alpha-helix A mutants, ML 13.E 13K induced only a minimal proliferative response over the
range tested (Figure 3, panel B), and ML13.E13I. ML13.E13S, and ML13.E13Y failed to
induce any proliferative response (Figure 3, panel B). Mutants ML 13. El 3D and,
unexpectedly, ML13.E13R both induced a dose-dependent increase in proliferation of the TF-
1 cells. Their induction of TF-1 cell proliferation followed the same pattern as wild-type
ML13. although ML13.E13D had a lesser effect on proliferation than did ML13.E13R (Figure
3, panel A). Both ML13.E16K and ML13.E17K (with mutated sites one turn of the alpha-
helix up from position 13) induced a dose-dependent increase in the proliferative response of
the TF-1 cells (Figure 3, panel A). While the ML13.E17K-induced effect was comparable to wild-type ML13, the ML13.E16K-induced effect was sigmficantly greater than that caused
by wild- type ML13.
The alpha-helix C mutants, ML13.R66D and ML13.S69D, both showed a
sigmficantly impaired ability to stimulate TF-1 cells, compared to wild-type ML 13 (Figure 3,
panel C) Their action on TF-1 cells, however, can be classified between that caused by
mutants shown in Figure 3, panels A and B. The alpha-helix D mutants also exMbited
contrasting patterns of action on TF-1 cells. The ML13.F113D mutant was equivalent to
wild-type ML 13 in inducing TF-1 cell proliferation, wMle the ML13.R109D mutant was
inactive on these cells (not shown).
The ability of the ML 13 mutants to interact with the shared ML 13/4 receptor on
normal cells was assessed by examimng their effect on VCAM-1 expression on the surface of
HUVEC. Cytokine binding of the shared IL13/4 receptor on the HUVEC cell surface results
in transmembrane signaling events that induce VCAM-1 expression on these cells. Results
from two separate experiments are shown in FIG. 4. Cells incubated in the absence of ML 13
showed minimal, nonspecific VCAM-1 staining (Figure 4, panels A and G). In contrast, cells
incubated overnight in media containing wild-type ML 13 exhibited a marked increase in
VCAM-1 (Figure 4. panels B and H). The pattern of the staimng appeared to be specific for
certain areas of the cell surface, compared to the minimal, homogeneous staining of cells that
had not been incubated with cytokine (Figure 4, panels A and G). Cells incubated with
mutants ML 13. El 31. ML13.E13K, and ML13.E13Y, which are unable to induce TF-1 cell
proliferation (Figure 3), showed less VCAM-1 expression than those treated with wild-type
ML 13 (Figure 4, panels C, D, F, and B, respectively). Although mutant ML13.F113D was
not tested, the ML13.R109D-induced VCAM-1 staimng was negligible (not shown), suggesting agam the involvement of alpha-helix D of the cytokine in effective signaling
tMough the shared receptor. Cells treated with mutants ML 13.E 13R and L 13.E 17K
showed an increase in VCAM-1 staimng similar to that induced by wild-type ML 13, when
compared to their respective controls (Figure 4, panels E and J). Mutant ML13.E16K
appeared to have a superagomstic effect on VCAM-1 expression compared to its wild-type
IL13 control (Figure 4, panels I and H, respectively).
The ability of ML13 and its mutants to block the cancer-restrictive ML13 receptor on
two different human glioblastoma cell lines was examined in cytotoxicity assays using
ML13-PE1E, an extremely potent anti-tumor agent on glioma cells (see Debinski et al. (1996)
J. Biol. Chem.. 271 : 22428-22433). The cytotoxin caused a Mgh level of cytotoxicty in
cultured U-251-MG cells (Figure 5, panel A) and SNB-19 cells (Figure 5, panel B) when the
cells were cultured in the absence of a competing ligand for the receptor. When cultured in
the presence of ML 13 or any of its A or C helix mutants, the level of cytotoxicity was
reduced even at the highest concentration of cytotoxin used (Figure 5, panels A and B). IC50s
for tests without blocking ligand were 0.1 ng/ml (1.25 pM) for U-251-MG cells and 0.07
ng/ml (0.875 pM) for SNB-19 cells. In contrast, the blocking assay using ML13 mutants
showed their ability to increase the IC50 by at least 100 times. For concentrations of ML 13 or
its mutants up to 1000 x (by weight) over ML13-PE1E, no discemable differences were
detected between these various mutants and wild-type ML 13 in blocking the cytotoxin 's
activity on the glioma cells (Figure 5. panels A and B). ML13.F113D. an alpha-helix D
mutant, behaved as the wild-type cytokine. In contrast, addition of ML13.R109D to the cell
cultures did not reduce the cytotoxin-induced cytotoxicity. ML4 did not display any
neutralizing activity in these assays. Other Embodiments
TMs description has been by way of example of how the compositions and methods of
invention can be made and carried out. Those of ordinary skill in the art will recogmze that
various details may be modified in arriving at the other detailed embodiments, and that many
of these embodiments will come witMn the scope of the invention.
Therefore, to apprise the public of the scope of the invention and the embodiments
covered by the invention, the following claims are made.

Claims

What is claimed is:
L A composition comprising a mutant ML 13 having an amino acid sequence
having at least 90% sequence identity to native ML 13 (SEQ ID NO: 1).
2. The composition of claim 1 , wherein the mutant has a mutation in a domain
correspondmg to the A alpha-helix of native ML 13.
3. The composition of claim 1 , wherein the mutant has a mutation in a domain
corresponding to the C alpha-helix of native ML 13.
4. The composition of claim 1, wherein the mutant has a mutation in a domain
corresponding to the D alpha-helix of native ML 13.
5. The composition of claim 1, wherein the mutant specifically binds the shared
IL4/IL13 receptor but not the restricted (IL4-independent) receptor.
6. The composition of claim 1, wherein the mutant specifically binds the restricted
(IL4-independent) receptor but not the shared IL4/IL 13 receptor.
7. The composition of claim 1, wherein the mutant specifically binds both the
restricted (IL4-independent) receptor and the shared IL4/IL13 receptor.
8. The composition of claim 1 , wherein the mutant specifically binds to an ML 13
receptor associated with a cell in a manner that induces a measurable change in the cell's
physiology.
9. The composition of claim 8, wherein the change in the cell's physiology is of less
mag tude than a change in the cell's physiology that would be induced by specifically
binding the IL 13 receptor with native ML 13.
10. The composition of claim 8, wherein the change in the cell's physiology is of
greater magmtude than a change in the cell's physiology that would be induced by
specifically binding the IL 13 receptor with native ML 13.
11. The composition of claim 1. wherein the mutant comprises a polypeptide having
an amino acid sequence selected from the group consisting of SEQ ID NOs: 2-23.
12. The composition of claim 1 1. wherein the polypeptide consists of an amino acid
sequence selected from the group consisting of SEQ ID NOs: 2-23.
13. The composition of claim 1. further comprising a pharmaceutically acceptable
carrier.
14. The composition of claim 1. wherein the mutant is conjugated to an effector
molecule.
15. The composition of claim 14, wherem the effector molecule is selected from the
group consistmg of a cytotoxm, a detectable label, an antibody, a liposome, and a lipid.
16. The composition of claim 15, wherein the effector molecule is a cytotoxin
selected from the group consisting of a Pseudomonas exotoxin, Diptheria toxin, ricin, abrin,
saporin, and pokeweed viral protein.
17. The chimeric molecule of claim 16, wherein the cytotoxm is selected from the
group consisting of PE38QQR, PE1E, and PE4E.
18. The chimeric molecule of claim 15, wherein the effector molecule comprises a
radionuclide.
19. A purified nucleic acid encoding a polypeptide having an amino acid sequence
selected from the group consisting of SEQ ID NOs: 2-23.
20. The purified nucleic acid of claim 19, wherein the nucleic acid encodes a
polypeptide consisting of an amino acid sequence selected from the group consisting of SEQ
ID NOs: 2-23.
21. An antibody that specifically binds a mutant ML 13 molecule but not a native
ML 13 molecule.
22. The antibody of claim 21 , wherem the mutant ML 13 is a polypeptide having an
ammo acid sequence selected from the group consistmg of SEQ ED NOs: 2-23.
23. A method of delivering a mutant ML13 to a cell comprising the steps of:
providmg the mutant ML 13 ;
providing the cell; and
contacting the cell with the mutant ML 13.
24. The method of claim 23, wherein the mutant ML 13 is a polypeptide having an
amino acid sequence selected from the group consisting of SEQ ED NOs: 2-23.
25. The method of claim 23, wherem the mutant ML 13 is conjugated to an effector
molecule.
26. The method of claim 25, wherem the effector molecule is selected from the group
consisting of a cytotoxin. a detectable label, an antibody, a liposome, and a lipid.
27. The method of claim 26, wherem the effector molecule is a cytotoxin selected
from the group consisting of a Pseudomonas exotoxin. Dφthena toxm, ncin, abnn, saponn,
and pokeweed viral protem.
28. The method of claim 27, wherem the cytotoxin is selected from the group
consisting of PE38QQR, PE1E, and PE4E.
9. The method of claim 25, wherein the effector molecule comprises a radionuclide.
EP00968773A 1999-10-06 2000-10-05 Il13 mutants Withdrawn EP1222212A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US15793499P 1999-10-06 1999-10-06
US157934P 1999-10-06
PCT/US2000/027567 WO2001025282A1 (en) 1999-10-06 2000-10-05 Il13 mutants

Publications (2)

Publication Number Publication Date
EP1222212A1 true EP1222212A1 (en) 2002-07-17
EP1222212A4 EP1222212A4 (en) 2005-05-04

Family

ID=22565965

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00968773A Withdrawn EP1222212A4 (en) 1999-10-06 2000-10-05 Il13 mutants

Country Status (5)

Country Link
EP (1) EP1222212A4 (en)
JP (1) JP2003511019A (en)
AU (1) AU7863900A (en)
CA (1) CA2386248A1 (en)
WO (1) WO2001025282A1 (en)

Families Citing this family (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20010053371A1 (en) * 1999-01-07 2001-12-20 Waldemar Debinski Method for diagnosing, imaging, and treating tumors using restrictive receptor for interleukin 13
US7553487B2 (en) 1998-12-14 2009-06-30 Genetics Institute, Llc Method and compositions for treating asthma
US7507706B1 (en) 1998-12-14 2009-03-24 Genetics Institute, Llc Cytokine receptor chain
CA2404763A1 (en) * 1999-11-11 2001-05-17 Raj K. Puri Mutated il-13 molecules and their uses
JP4863150B2 (en) * 2000-08-30 2012-01-25 ザ・ペン・ステート・リサーチ・ファンデーション Amino acid substitution mutant of interleukin-13
CA2466443A1 (en) * 2001-11-09 2003-05-15 Neopharm, Inc. Selective treatment of il-13 expressing tumors
JP4943161B2 (en) * 2003-12-23 2012-05-30 ジェネンテック, インコーポレイテッド Treatment of cancer with a novel anti-IL13 monoclonal antibody
AR049390A1 (en) 2004-06-09 2006-07-26 Wyeth Corp ANTIBODIES AGAINST HUMAN INTERLEUQUINE-13 AND USES OF THE SAME
US7501121B2 (en) 2004-06-17 2009-03-10 Wyeth IL-13 binding agents
ES2412005T3 (en) 2005-04-15 2013-07-09 The Government Of The United States Of America, As Represented By The Secretary Of Health And Human Services Treatment and prevention of inflammatory bowel disease involving IL-13 and NKT cells
EP2850093B1 (en) * 2012-01-27 2019-01-09 The Board of Trustees of the Leland Stanford Junior University Therapeutic il-13 polypeptides
IN2015KN00329A (en) 2012-08-09 2015-07-10 Univ Leland Stanford Junior
CN105764926A (en) 2013-09-24 2016-07-13 梅迪塞纳医疗股份有限公司 Interleukin-4 receptor binding fusion protein and application thereof
CA3078434A1 (en) 2017-10-10 2019-04-18 Medicenna Therapeutics, Inc. Il-4-fusion formulations for treatment of central nervous system (cns) tumors
US12404497B2 (en) 2018-06-01 2025-09-02 Medicenna Therapeutics Inc. Uses and methods for oncolytic virus targeting of IL-4/IL-13 and fusions thereof
CA3102097A1 (en) 2018-06-01 2019-12-05 The Board Of Trustees Of The Leland Stanford Junior Unversity Il-13/il-4 superkines: immune cell targeting constructs and methods of use thereof
CN115515971A (en) * 2020-03-12 2022-12-23 希望之城公司 T cell modified by targeting chimeric antigen receptor for treating IL13R alpha 2 positive malignant diseases

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5696234A (en) * 1994-08-01 1997-12-09 Schering Corporation Muteins of mammalian cytokine interleukin-13
US5614191A (en) * 1995-03-15 1997-03-25 The United States Of America As Represented By The Department Of Health And Human Services IL-13 receptor specific chimeric proteins and uses thereof
US6296843B1 (en) * 1998-04-03 2001-10-02 The Penn State Research Foundation Mutagenized IL 13-based chimeric molecules
AU6376100A (en) * 1999-08-02 2001-02-19 Regents Of The University Of Michigan, The Targeted fiberless radiative effectors

Also Published As

Publication number Publication date
CA2386248A1 (en) 2001-04-12
JP2003511019A (en) 2003-03-25
EP1222212A4 (en) 2005-05-04
AU7863900A (en) 2001-05-10
WO2001025282A1 (en) 2001-04-12

Similar Documents

Publication Publication Date Title
US6576232B1 (en) IL13 mutants
JP4202417B2 (en) IL-13 receptor-specific chimeric protein and use thereof
US6428788B1 (en) Compositions and methods for specifically targeting tumors
US6296843B1 (en) Mutagenized IL 13-based chimeric molecules
AU2001288405B2 (en) Amino acid substitution mutants of interleukin 13
JP6622814B2 (en) Novel PD-L1 binding polypeptides for imaging
US6518061B1 (en) IL-13 receptor specific chimeric proteins and uses thereof
US7750136B2 (en) Modified bouganin proteins, cytotoxins and methods and uses thereof
WO2001025282A1 (en) Il13 mutants
US6884603B2 (en) Nucleic acids encoding IL13 mutants
US6630576B2 (en) Amino acid substitution mutants of interleukin 13
CA2333923A1 (en) Treatment of celiac disease with interleukin-15 antagonists
US20030129132A1 (en) IL-13 receptor specific chimeric proteins & uses thereof
AU2001288405A1 (en) Amino acid substitution mutants of interleukin 13

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020506

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20050321

17Q First examination report despatched

Effective date: 20050623

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20090715