EP1221967A1

EP1221967A1 - Highly efficient dendritic cell-targeted dna-vaccination

Info

Publication number: EP1221967A1
Application number: EP00967758A
Authority: EP
Inventors: Thomas Brocker
Original assignee: Individual
Current assignee: Glaxo Group Ltd
Priority date: 1999-09-23
Filing date: 2000-09-22
Publication date: 2002-07-17
Also published as: AU7781000A; CA2404709A1; WO2001021199A1; WO2001021199B1

Abstract

The present invention relates to a vaccine containing a nucleic acid molecule comprising (a) a promoter that is specifically active in antigen presenting cells; and, operatively linked thereto (b) a nucleic acid sequence encoding an antigen. The present invention also relates to a method of vaccinating a mammal wherein the vaccine of the invention is administered to a mammal at a suitable dose.

Description

Highly Efficient Dendritic Cell-Targeted DNA-Vaccination

In the specification, a number of prior art documents is cited. The disclosure content of these prior art documents is herewith incorporated by reference.

DNA vaccination has been demonstrated to induce protective immunity against experimental cancer and infectious diseases. In this approach antigen-encoding DNA is introduced directly into tissues, where the antigen is subsequently synthesized (1). While the mechanism of DNA-immunization remained obscure for some time, it became clear during the last years that professional APC (antigen presenting cells) play a major role during DNA-vaccinations. Early indirect evidence for an involvement of APC in the mechanism of DNA-vaccination came from a report describing an enhanced antibody response by coinjection of a plasmid encoding for GM-CSF, presumably because of increased recruitment of APCs to the site of antigen expression (2). Direct evidence for an involvement of bone marrow-derived APC was demonstrated with DNA-immunized parent-into-F1 bone marrow-chimeric mice (3, 4). Hints for the involvement of dendritic cells (DC), the most potent APC of the immunesystem (5), came from experiments that demonstrated the presence of directly transfected epidermal Langerhans cells and lymph node DC after DNA- vaccination in situ (6). It has also been demonstrated that DC isolated from DNA- vaccinated mice are efficiently presenting the vaccine-encoded peptides (7). Targeting the produced antigen as a chimeric protein to the regions of the lymph node and spleen, where DC reside, seemed to further increase immunization efficacy (8). The predominant role of DC in DNA vaccination was also suggested by a recent report showing that injection of an ex vivo transfected DC line was more potent in inducing an immune response than a transfected skin derived fibroblast line (9). On the other hand, it was demonstrated that following DNA-immunizations, the most frequently transfected cells are of the predominant cell type at the injection site, for example muscle cells after intramuscular DNA-injections (1 ). Therefore, predominantly non-APC will express the vaccine-antigen. The role of transfected and antigen (Ag)-expressing non-APC remains, however, unclear since it has been shown that only very few DC are directly transfected after DNA-immunizations (6), but that these low numbers of directly transfected DC are nevertheless sufficient and necessary to induce sustained immune responses (30). Whereas the role of these non-APC in the generation of a protective immune response requires further investigation, they might exert negative effects (e.g. tolerance induction by clonal anergy) on the immune response, due to absence of costimulatory molecules (10). Accordingly, mice where the DNA-injected muscle tissue was removed surgically immediately after vaccination, mounted similar or more efficient immune responses than intact animals in the same experiment (11). On the other hand, skin removal 24h after gene-gun bombardment abrogates the immune response (11 ), a result that suggests that different ways of DNA-application might depend differentially on the various tissues. Thus, a number of studies have been reported that demonstrate, in principle, the feasibility of nucleic acid, in particular DNA vaccination strategies. However, even today, practitioners are faced with an efficacy of vaccination protocols that is generally surmounted by traditional vaccination protocols. On top of this, optimization of DNA vaccination strategies on the basis of the protocols provided in (11) are clearly not feasible due to practical and ethical reasons. Consequently, the technical problem underlying the present invention was to provide means for improved nucleic acid vaccination protocols. The solution to said technical problem is achieved by providing the embodiments characterized in the claims.

Accordingly, the present invention relates to a composition containing a nucleic acid molecule comprising (a) a promoter that is specifically active in antigen presenting cells; and, operatively linked thereto (b) a nucleic acid sequence encoding an antigen. Preferably, said composition is a pharmaceutical composition and most preferably it is a vaccine.

The term "specifically active in antigen presenting cells" bears the meaning that the promoter confers expression only or essentially only in antigen presenting cells. Preferably, said antigen presenting cells are professional antigen presenting cells. The promoter must be active in dentritic cells and may be active in macrophages and B cells. Thus, said promoter would not be active, for example, in muscle cells. Promoters useful in accordance with the present invention may be identified by generating differential display libraries for genes from APC. In accordance with the invention, promoters of genes that are predominantly expressed in antigen presenting cells may be employed. Such a promoter is, for example, an MHC class II promoter, a DC-Lamp promoter, a Langerin-promoter or promoters driving expression of cytokines, a promoter driving the expression of an APC specific transcription factor, and their receptors specifically expressed in antigen presenting cells. Such an APC- specific expression can be tested easily by either in vitro transfection of APC or cell lines derived from APC or by in vivo immunisation studies using the modified promoter.

The term "operatively linked" means, in connection with the present invention, that the nucleic acid encoding said antigen is expressed under the control of said promoter. The term "antigen" denotes, in connection with the present invention, a proteinaceous compound that is capable of inducing or triggering an immune response.

The vaccine of the present invention is advantageous in several aspects in comparison to prior art DNA vaccines. This holds true for the potency of the immune response as well as the number of immunizations necessary to generate a protective immune response. Thus, as exemplified in the appended examples, DC-specific expression of DNA-vaccine antigens is sufficient to induce potent vaccination effects already after one single intramuscular vaccination. This is in clear contrast to conventional DNA-immunizations, where several booster immunizations are necessary to be similarly efficient. Further, the levels of antigen-specific serum titers in mice immunized with the DC-specific construct can be more than one magnitude higher as compared to a conventional DNA-vaccine with ubiquitous expression specificity. Since DNA vaccines have so far not been reported to induce specific Ab titers comparable to protein immunizations, the vaccines of the present invention are generally expected to greatly enhance DNA-vaccine efficiency in this respect. In accordance with the present invention, a conventional DNA-vaccine construct with ubiquitous expression specificity was compared to an APC-specific DNA vaccine strategy. The latter is exemplified by the DC-specific CD11c-promoter (12-14), while in the conventional DNA vaccine antigen expression was driven by a viral promoter (CMV). It is shown that a DC-specific gene expression results in more efficient immune responses with higher mAb titres as compared to a conventional DNA vaccine. It is further demonstrated that an APC-specific vaccination strategy leads to maximal serum titers of specific Abs already after one single DNA-injection, while the conventional virus promoter driven DNA-construct induces its maximal titres only after a total of three injections. When the quality of the Ab-response was determined, the APC-specific vaccine did not alter the Th-type (Th1/Th2) of the Abs as compared to the conventional DNA-vaccine.

The vaccine of the invention can be employed for a variety of purposes. In so far, the present invention also relates to the nucleic acid molecule as defined throughout this specification for the preparation of a vaccine for preventing or treating a variety of conditions or for biasing the immune response. For example, the vaccine of the invention can be used to prevent virus infections, bacterial infections or parasite infections. It can further be used to treat or prevent allergies by shifting the TH2 response to a T_H1 response. In a further alternative, the vaccine can be used for preventing or treating auto-immune conditions by shifting the T_H1 to a TH2 response or by eliminating the autoimmune T cells. If such a shift of the T helper cell response is envisaged, the nucleic acid molecule of the invention should advantageously be administered with IL-4, IL-12 or OX40L (L = ligand). If an anti-autoimmune response is desired, coexpression with CD30L, FasL is envisaged for the antigen-specific killing of T cells with the auto-immune specificity. Additionally, the nucleic acid molecule of the invention can be used in the treatment of tumors. Further, it can be employed for the production of monoclonal antibodies.

In a preferred embodiment of the vaccine of the present invention, said nucleic acid is DNA.

In a further preferred embodiment of the vaccine of the present invention, said antigen presenting cells are dendritic cells.

In a most preferred embodiment of the vaccine of the present invention, said promoter comprises the sequence (aa) TCTCTGCTGGTGCCTCACACGGGCATAC

ACTCCGTAACTCAGATATTACCAACCATGCGCGGTCCTTGCTTTTCTTTCCTTTTC

ACTTTATGGTTCT I I I I I I I I I CTTTTGTCTTCATTCTTTTCTCATATAATACATCCT

GACCTCAGTCTCCCCCCTTCCCAGTCCCTCCTTACCACTTCCCCTCTCTCCTTTC

CCTTCAGAAAAGTGCAGGCTCCCAGGGACATCAACCAAACCTGGTTCTCTGAAA

GGTGAATGTGACTATCTTATTCCTCATGCATGACTTCTCTACACTTCCTTCTGCCT

GCGGGATAAAAATAAAAGTCTTTCAAAACTCCCAGGTCCCGTGGCCTGCTCACT

CTCCAGTTTTCCAACACTCCAGCCTCATCTGTTGGCAGTCTTATCTCCCACGCTG

TCCTGTTAACTCTTTATGGTGTGCCAGAGAAACAAGGCCTCCAGCAAGAAGTCA

CTCCACAAAATGAGGAAAAATAAGGAGAAAACCTCTAATAAAAATAGTTTGTGTC

CAGTTTGGCTAGTGCCCAAAGAGAATCCAGTCCAGCATGGAAATTATTTGAGGC

GTATGTGGGTCTTGAGCTACAAAACTTCACCTATGATATCACCTGAGTATCTCTC

TAAAGTCCCAGCCCCAAGTTGCACTCTGAACATTAAAACATGTTTACAGAAATGT

ATGCTTAGCCATTTTAGACCAAACGAGATGCCATCAGTGTTACCTCTAAAGCAGG

TCAACATAGGAAGATTTGTACTGTAAAGGTACTGTCACAAATGCCAGCTACTTAG

CACCCCAGTTCTTTGCTGGCTGCTGCTATCCAAGGATGTTCTGGCGGCCTGGAA CAATCAAACTTTTCCTGGGAGAGGAATGAGAACCAGAACTTTCGATCCAATGCTT

ACCCCACCCCCTCTTTGGAGTGCCTGACAGAGGCAGGTTCTTGATAGGAGAAAG

GGCCTAATGGCCAGCTGTGGGCCAGGGTTATCTTCCAGAATAAGGTTTAAGGGA

TGATAATCCTAATGAACATATCCATTGCTTCTGAAATTCAGTTTTTAGTATTCTCTT

GACCTTGGCTGCCTTTAAGACTCAGCTCAAGTGCTACTTCCCCCAGAAAGCAGT

CTGAGGTCCTCTCGGTCTGAGTAATACTTCTAGTGGTTGGTCTCTGTACCTCTTT

TCTCACAGGGCCCACTTTAGTGTTCACCCATCTGCTTTTACTCTGATCTCTGGGT

TATGTTTCTCCTATACCTAGCAAAAGGCTCAGACCACCCCTCTTGATTATGTTGA

GCAAATGACTAATCCACTGAATGAATGAATGAGTGAGTGAATGAATGAATGAATG

AATGAATGCCAGCCTGTGCTCCCTACATGGATCATGTGCTTACTTCTTAGTCTAC

TTCCAGGCCAGAAGTGGAGGGCTCCGTCATCTGTTCTCTCTCCTCCTGTGGCTG

ACTCACACTTCAAG GTCAAG G G AAACTTCTGCCAGTACAAAAGTCTG AG AG G G A

TCAGATAATCCGGGAGTTTACATATATCCATCCGGGCAAGAATTGGGGAACCAG

AACAATATGTCACCAAGTCGTTTCAAGTAGAGCAACTCTTCCCTGGAAGTGTGTA

GGCTGCCTCGGTCCCCACTCTATCCATTTCATCTCAGTTTGCCCCCACCTCCTCT

GAGTCACGCTGACAACTTCCCTCCTGGTCTCTGGCCTCCTGACCACCTTTCTTCT

CATTTGCTTCTTCTGTGGTGACTTGGCAGCTGTCTCCAAGTTGCTCAGAGCCTGC

TTCTGTTCTCCAGT; or

(ab)CCTCCAGCAAGAAGTCACTCCACAAAATGAGGAAAAATAAGGAGAAAACCTC

TAATAAAAATAGTTTGTGTCCAGTTTGGCTAGTGCCCAAAGAGAATCCAGTCCAG

CATGGAAATTATTTGAGGCGTATGTGGGTCTTGAGCTACAAAACTTCACCTATGA

TATCACCTGAGTATCTCTCTAAAGTCCCAGCCCCAAGTTGCACTCTGAACATTAA

AACATGTTTACAGAAATGTATGCTTAGCCATTTTAGACCAAACGAGATGCCATCA

GTGTTACCTCTAAAGCAGGTCAACATAGGAAGATTTGTACTGTAAAGGTACTGTC

ACAAATG CCAGCTACTTAGCACCCCAGTTCTTTG CTG G CTG CTGCTATCCAAG G A

TGTTCTGGCGGCCTGGAACAATCAAACTTTTCCTGGGAGAGGAATGAGAACCAG AACTTTCGATCCAATGCTTACCCCACCCCCTCTTTGGAGTGCCTGACAGAGGCA

GGTTCTTGATAGGAGAAAGGGCCTAATGGCCAGCTGTGGGCCAGGGTTATCTTC

CAGAATAAGGTTTAAGGGATGATAATCCTAATGAACATATCCATTGCTTCTGAAAT

TCAGTTTTTAGTATTCTCTTGACCTTGGCTGCCTTTAAGACTCAGCTCAAGTGCTA

CTTCCCCCAGAAAGCAGTCTGAGGTCCTCTCGGTCTGAGTAATACTTCTAGTGG

TTGGTCTCTGTACCTCTTTTCTCACAGGGCCCACTTTAGTGTTCACCCATCTGCT

TTTACTCTGATCTCTGGGTTATGTTTCTCCTATACCTAGCAAAAGGCTCAGACCA

CCCCTCTTGATTATGTTGAGCAAATGACTAATCCACTGAATGAATGAATGAGTGA

GTGAATGAATGAATGAATGAATGAATGCCAGCCTGTGCTCCCTACATGGATCATG

TGCTTACTTCTTAGTCTACTTCCAGGCCAGAAGTGGAGGGCTCCGTCATCTGTTC

TCTCTCCTCCTGTGGCTGACTCACACTTCAAGGTCAAGGGAAACTTCTGCCAGTA

CAAAAGTCTGAGAGGGATCAGATAATCCGGGAGTTTACATATATCCATCCGGGC

AAGAATTGGGGAACCAGAACAATATGTCACCAAGTCGTTTCAAGTAGAGCAACTC

TTCCCTGGAAGTGTGTAGGCTGCCTCGGTCCCCACTCTATCCATTTCATCTCAGT

TTGCCCCCACCTCCTCTGAGTCACGCTGACAACTTCCCTCCTGGTCTCTGGCCT

CCTGACCACCTTTCTTCTCATTTGCTTCTTCTGTGGTGACTTGGCAGCTGTCTCC

AAGTTGCTCAGAGCCTGCTTCTGTTCTCCAGT; or (b) a sequence that deviates from said sequence (aa) and/or (ab) by substitution, deletion, insertion, duplication or inversion and essentially retains promoter function of said sequence (aa) and/or (ab).

Alternatively, the promoter comprises the sequence of the about 5kb fragment of the mouse CD11c 5'UT described in Example 1. In a further alternative, fragments of said promoter, optionally also comprising sequences that deviate from said sequences by substitution, deletion, insertion, duplication or inversion and essentially retain promoter function of said sequences are comprised by the present invention.

Retainment of the functionality or essentially the functionality of promoter activity can be readily tested by immunizing mice with the modified constructs or using in vitro cell culture assays and transfections with suitable readout systems, such as GFP, Luciferase etc. and checking whether an immune response is generated against the encoded (poly)peptide. The immune response can be assessed quantitatively and qualitatively. An immune response is triggered, if the readout provides a signal at least twice as high as the background level. Appropriate tests are described throughout this specification. However, other suitable tests are also available to the skilled artisan.

The "essentially" in connection with retainment of promoter functionality means that at least 70%, preferably at least 80% and more preferably at lest 90% of the functionality of the activity were retained. Activity can be tested as described throughout this specification. The boarder value of at least 70% must be retained in at least one of the activity tests. The term "allergen" is well understood in the art and refers to molecules capable of inducing an allergic reaction.

In an additional preferred embodiment of the vaccine of the present invention, said antigen is derived from a pathogen or is derived from an allergen.

In a particularly preferred embodiment of the vaccine of the present invention, said pathogen is a bacterium or a virus.

In another preferred embodiment of the vaccine of the present invention, said pathogen is an autoantigen involved in auto-immune diseases or a tumor-associated antigen.

The nucleic acid molecule may be formulated in said vaccine in a variety of ways, for example in saline. The invention in another preferred embodiment relates to a vaccine wherein said nucleic acid molecule is encapsulated in a cationic liposome or wherein said nucleic acid molecule is coated to a gold particle.

The latter embodiment is particularly advantageously employed in the so-called "gene-gun" technology (33, 34).

The vaccine of the invention may be administered once or several times. In a further preferred embodiment of the present invention, said vaccine is a single dose vaccine. The term "single dose vaccine" refers to a vaccine that is administered only once and provides a protective immune response. Nevertheless, further vaccinations may further enhance the immune response (e.g. enhance the specific antibody titer or the number of specific T cells).

In a further preferred embodiment of the invention, the vaccine comprises a further nucleic acid molecule suitable for expression of a further protein. The term "suitable for expression" implies that said further nucleic acid molecule is under the control of a suitable promoter and further necessary regulatory regions that are well-known in the art. These regulatory regions comprise splice sites, transcription start sites, termination signals as well as poly-A attachment sites. Said further protein preferably modifies the immune response, abrogates the immune response (e.g. Fas- ligand, CD30-ligand), members of the TNF family, growth factors).

In a further preferred embodiment, said further protein confers prolongation of survival or enhancement of the function of antigen presenting cells (APCs).

Examples of such molecules are bcl-2, TRANCE, cytokines like GM-CSF or chemokines.

In a preferred embodiment said APCs are dendritic cells (DC).

Due to the APC (preferably DC)-specific expression pattern of the vaccine, one can employ it to coexpress in addition to antigens of various sources other molecules on the very same cell. The molecules of choice exert preferentially a function on the DC (APC) themselves, such as survival-prolongation and enhancement of APC-function (molecule like bcl-2, TRANCE, cytokines like GM-CSF or chemokines). On the other hand, they can as well exert functions on other lymphocytes (e.g. T cells) during the process of antigen presentation (like TNF-family members OX40L, CD30L, 4BB1-L, fas-L or costimuiatory molecules). This double expression can be reached by intramuscular coinjection of two plasmids dissolved in saline. One of the plasmids encodes for the antigen, the other for the modifying protein. The APC-specific promoter described above controls the expression of both proteins. To ensure that each (APC) DC expressing the antigen does also express the modifying protein, both plasmids can be coupled to the same gold-particle in equal amounts and are injected by gene-gun.

The invention also relates to a method of vaccinating a mammal comprising administering the vaccine of the invention to a mammal. Vaccination protocols may comprise single or repeated vaccinations.

Whereas the mammal may be selected from a variety of animals, particularly pets or other domestic animals, said mammal preferably is a human.

In general, the amount of nucleic acid to be administered depends on various factors, which are well-known to the physician in charge. For example, increasing amounts of nucleic acid are required with increasing body weight. Vaccines comprising nucleic acid dissolved in a buffer such as saline would preferably be administered intradermally or subcutaneously. Vaccination via gene-gun technology is preferably done intradermally.

If the vaccine of the invention is administered as a naked nucleic acid, preferably DNA or as a liposome containing said nucleic acid, preferably DNA, then amounts of 1 yg to 5mg (usually in an aqueous solution, preferably phosphate buffered saline) of active ingredient (i.e. nucleic acid, preferably DNA) is administered per immunization. On the other hand, if the nucleic acid is complexed with gold/coated to gold particles, in particular for use in gene-gun vaccinations, amounts of 1 ng to 100 vg of nucleic acid are preferred (see, e.g. BioRad, Genegun Manual). Oral administration is a further option. The amount administered depends, inter alia, on the weight of the patient. In general, all conventional formulation protocols for nucleic acid vaccines can be employed.

The figures show:

Figure 1 : The CMV-promoter but not the CD11c-promoter driven construct is expressed in myoblasts. Immunofluorescence analysis of muscle tissue from mice immunized with 50μg of different GFP-encoding plasmid constructs. BALB/c-mice were injected with PBS (A, B), CMV-GFP (C, D) or CD11c-GFP (E, F) into the gastrocnemic muscle of their hind legs. 7 days after injection the muscles were surgically excised and histologically analyzed. Photographs were taken at x25 (A, C, E) and x100 (B, D, F).

Figure 2: DC from draining lymph nodes of CMV-GFP as well as CD11c-GFP immunized mice express GFP. Low density cells from draining popliteal lymph nodes were stained with CD11c for detection of DC. Then CD1 1 c⁺ (Fig. 2 CD11 c⁺) and

CD11c cells (Fig. 2 CD11c ) were further analyzed for expression of GFP in the FL-1 channel of the FACScalibur. Mice were injected either with PBS (Fig. 2a), 100//g of CMV-HA DNA (Fig. 2b) or 100 g of CD11 c-HA DNA (Fig. 2c) into their gastrocnemic muscles 7 days before analysis.

Figure 3: RT-PCR analysis of muscle tissue injected with DNA-vaccines. Muscles from mice vaccinated with 100 g CD11c-HA DNA (Fig. 3a CD11c-HA +), 100 g CMV-HA DNA (Fig. 3a CMV-HA +), mock (PBS) vaccinated muscles from the same animals (Fig. 3a CD11c-HA -, CMV-HA -) were surgically excised and homogenized for extraction of mRNA, which was then transcribed into cDNA with Reverse Transcriptase. To control equal quality of cDNA synthesis, undiluted, 10-fold and 100- fold diluted cDNA was PCR amplified with oligonucieotides specific for HPRT (Fig. 3a).

Then undiluted cDNA of each muscle was amplified with oligonucieotides specific for HA (Fig. 3b). cDNA derived from DNA-injected (Fig. 3b DNA:+) as well as mock- injected muscles (Fig. 3b DNA:-) were amplified. To control for absence of vaccine plasmid DNA in the preparations, cDNA preparations (Fig. 3b RT:+) were compared to amplifications of equal amounts of mRNA before the RT-step (Fig. 3b RT:-).

Figure 4: Immunization with the DC-specific promoter construct elicits stronger and faster antibody responses than the CMV-driven construct. HA-specific serum titre of BALB/c mice after DNA vaccination with CMV-HA (open squares) or CD11c-HA (closed squares) plasmids. Mice were immunized with DNA at day 0 and boosted 3 and 6 weeks later (indicated by arrowhead). Each animal received 1μg (a), 100 yg (b) in saline or 5 yg (c) of plasmid DNA in liposomes per injection. Plasmid DNA was injected either in both hind legs i.m. (a, b) or s.c. in the back (c). 12h before each immunization and 3 weeks after the last injection, mice were bled at the tail vein. Sera titre were determined by serial dilutions of the non-pooled sera of 5 to 6 mice per group by HA-specific ELISA.

Figure 5: CD11c-plasmid DNA does not contain more immunostimulatory sequences than the CMV-driven construct. HA-specific serum titre of BALB/c mice after DNA vaccination with a 40μg of a 1 :1 mixture of CMV-HA and pBCD11 c (open column) or 20 ;g CMV-HA only (gray column). Mice were immunized at day 0 and boosted 3 and 6 weeks later in their hind legs as described in the legend to Fig. 1. Three weeks after the last immunization mice were bled at the tail vein. Sera titre were determined by serial dilutions of the non-pooled sera of 5 mice per group by HA-specific ELISA. Figure 6: Confocal analysis of DC from lymph nodes of CMV-GFP and CD11c-GFP immunized mice. DC were positively selected by CD11c-MACS beads at day 2 (a, b) or day 9 (c, d, e, f) from draining popliteal (a, b, e, f) or non-draining brachial (c, d) lymph nodes of mice immunized into their hind legs with 100mg CMV-GFP (a, c, e) or CD11c-GFP (b, d, f) plasmids. Bright field images were overlaid with the green fluorescence images to show DC and the presence of the vaccination product (GFP). All micrographs were taken at 240x.

_; Figure 7: Coexpression of antigen and OX40L by dendritic cells modifies the antibody response after intramuscular DNA-vaccination. Two groups of BALB/c mice (n=5 per group) were DNA vaccinated with 00 vg DNA in saline i.m. in their hind legs as described in the legend of Figure 4. The DNA mixtures used for immunization were either CD11 c-HA plus CD11c-B2M as control plasmid (open bars) or CD11c-HA plus CD11c-OX40L (gray bars) in equal amounts. The sera of each group were pooled and analyzed by ELISA for HA-specific lgG2a (left panel) or lgG1 (right panel) antibodies in triplicates. No error bars are shown, because the error was beyond 5% of the respective values.

Figure 8: Gene-gun enforced coexpression of antigen and OX40L by dendritic cells modifies the antibody response after intradermal DNA-vaccination. Two groups of BALB/c mice (n=5 per group) were DNA vaccinated with gold particles coupled to either 1μg of CD11 c-HA plus 1μg of CD11c-OX40L (A, C, E) or 1μg of CD11 c-HA plus 1μg of control plasmid (B, D, F). These immunizations were performed at day 0 and day 28 and blood was taken at the indicated days. The sera were analysed for presence of HA-specific antibodies by ELISA and HA specific antibodies of the different subclasses lgG2a, lgG1 or total IgG were determined as described in material and methods for each individual mouse.

Figure 9: Coexpression of antigen and OX40L by dendritic cells after coadministration of CD11c-HA and CD11c-OX40L induces proliferative memory T cell responses. Two groups of BALB/c mice (n=5 per group) were gene-gun DNA- vaccinated with 1μg DNA coated to gold particles in their abdomen. They received either CD11c-HA plus CD11c-OX40L (A) or CD11 c-HA plus CD11c-B2M as control (B). 48 days later draining inguinal (Ing), axial (Ax) and non-draining popiietal (pop) _rlymph nodes were isolated, and single cell suspensions restimulated in the presence (100 HAU) or absence of the HA-antigen (0 HAU). 5 days later proliferation was measured by incorporation of ³H-Thymidine incorporation (cpm).

Figure 10: Coexpression of antigen and OX40L by dendritic cells after coadministration of CD11c-HA and CD11c-OX40L induces memory T cells producing IFN-γ. Supernatants from the T cell proliferation test shown in Figure 9 were collected 4 days after T cell culture. These supernatants were tested for IFN-g content by an IFN-g specific sandwhich-ELISA as described in Materials and methods.

Materials and Methods:

Mice. Mice used in this study were bred in the animal colony of the Basel Institute for Immunology (Basel, Switzerland). MAbs (monoclonal antibodies) and Antisera. The mAbs specific for CD19 (No. 09654) and CD11c (No. 09705) were purchased from PharMingen (San Diego, CA). Polyclonal goat anti-mouse IgG and goat anti-mouse IgM sera, as well as subtype specific goat anti-mouse lgG1 and lgG2a were purchased from Southern Biotechnology (Birmingham, AL). HA-specific mAb H36-4-5.2 is described in (15) and was kindly provided by Dr. W. Gerhard (Philadelphia, PA). The corresponding experiments can also be carried out by employing other HA-specific mAbs that are obtainable by conventional procedures.

Plasmids. Hemagglutinin (HA)-cDNA encoding influenza virus strain A/PR/8/34 HA rwas a kind gift of Dr. A. Rolink (Basel). Equivalent cDNAs can be prepared according to conventional procedures; see, e.g. (31 ). The HA-cDNA was cloned as a 1.7kb Xbal blunt-end fragment into the previously described, EcoRI opened, blunt-ended vector pBCD11 c (12). In this vector with 11 kb length, HA-expression is driven by the CD11 c- promoter, while intron and polyadenylation signal are provided by a rabbit β-globin gene fragment (16). The very same blunt-ended HA cDNA fragment was cloned into the commercially available, EcoRI/Clal opened and blunt-ended vector pBK- CMV(Stratagene, Basel), where cDNA expression is driven by the CMV-promoter and intron sequences as well as polyadenylation signals are derived from SV40. The resulting plasmid had a length of 5.2kb. The integrity of all constructs was controlled by DNA-sequencing. Plasmid DNA was prepared by Qiagen plasmid preparation kit (Qiagen, Hilden). The plasmid pHbAPr-1 -neo-HA was created by cloning the above described blunt end Xbal fragment of HA cDNA into the EcoRI opened and blunt ended vector pHbAPr-1-neo (17).

Isolation of DC from lymph nodes. Draining popliteal lymph nodes of DNA vaccinated mice were digested with collagenase (CLSPA, Worthington Biochemical Corp., Freehold, NJ) twice for 30 min. at 37°C. Cells were then recovered by centrifugation at 300 g for 5 min., resuspended in a 17% Optiprep™ (Nycomed Pharma, Oslo, Norway) solution diluted in Hank's balanced salt solution without Ca²⁺ and Mg²⁺, overlaid with 12% Optiprep™ diluted in 0.88% (w/v) NaCI, 1 mM EDTA, 10 mM HEPES and 0.5% BSA (bovine serum albumin) pH 7.4 and 2 ml Hank's without Ca²⁺ and Mg²⁺, respectively, and centrifuged at 600xg for 15 min. at 20°C. The low density cells at the Hank's 12% Optiprep™ interface were harvested, washed twice and used as a DC enriched fraction. This fraction was then stained with CD11 c-PE and CD19-FITC labeled mAb (Pharmingen, San Diego, CA) and analyzed on a FACScalibur (Becton Dickinson & Co., Mountain View, CA).

DNA-injections. Various amounts of plasmid DNA were diluted in saline and injected into the hind legs (M.gastrocnamii) of Methofane (Pitman-Moore, Mundelein, IL) anaesthetised mice in the indicated intervals. Total volume of each injection was 50μl/leg. When gene gun (BIO-RAD) was used, DNA-coating to gold-particles, preparation and immunisation were performed according to suppliers instructions Determination of HA-specific Ig Responses. ELISA plates were coated with A/PR/8/34-strain influenza viral particles (kind gift of Dr. A. Rolink, Basel, which can, for the purposes of this invention, be prepared according to conventional protocols) at 800 HAU/ml in 0.02M NaCI at 4°C for 12h. Plates were washed extensively with PBS and serial threefold dilutions of sera in PBS (phosphate buffered saline), 4% BSA, 0.2% Tween 20 were transferred to the virus coated plates and incubated for 2h at RT (room temperature). After 5 washes with PBS the AP (alkaline phosphatase)- conjugated second step reagent (Goat-anti-mouse IgG, lgG1 or lgG2a, Southern Biotechnology (Birmingham, AL)) was added and incubated for 2h at RT. After washing, the AP-substrate p-nitrophenyl phosphate was added according to manufacturer's instructions (Sigma, N-2765) and the coloration quantified at 405 nm with an ELISA-reader (SOFTMAX). Histology. To detect GFP-expression, animals were sacrificed at various time points after vaccine injection and the muscle bundle around the injection site was surgically excised. This tissue was fixed for 12h in PBS, 4% Paraformaldehyde and then embedded in O.C.T. medium (No. 4583; Miles Inc., Elkhart, IN), snap frozen and 20- μm section were cut with a cryostat for screening of whole muscles. Sections were air dried for 12h and mounted with PBS, 50% Glycerol for microscopical analysis. mRNA Extraction, cDNA Synthesis and specific PCR amplification. Muscle tissue from various mice was isolated and homogenized in 1 ml TriPure Isolation Reagent (Boehringer Mannheim, Germany) per 50mg tissue using a T8.10 Homogenizer (IKA, Staufen, Germany). mRNA was isolated according to manufacturer's instructions. 2μg of mRNA was then used for an oligodT-based cDNA synthesis with the Superscript™ RNase H^" Reverse Transcriptase kit (GibcoBRL, Karlsruhe, Germany). After a further 2.5-fold dilution of the cDNA, HPRT-specific PCR was performed with graded amounts of cDNA using the HPRT specific oligonucieotides 5'GCTGGTGAAAAGGACCTCT3' and 5'CACAGGACTAGAACACCTGC3'. For HA specific PCR amplification the oligonucieotides 5ΑTGGAATATGTTATCCAGGA3' and 5'GTTTGACACTTCGTGTTACA3' were used. To control presence of plasmid contaminations in our mRNA preparation, we submitted PCR with HA specific oligonucleotide directly on 2μg mRNA.

In vitro T cell proliferation assay. After immunisation draining and non-draining lymph nodes were isolated and teased through a steel mesh in order to receive single cell suspensions. These cells were resuspended in T cell culture medium (IMDM 10% FCS (GIBCO, Grand island, NY)) and cultured at adensity of 5x10⁵cells/200μl for 5 days in presence or absence of antigen hemagglutinin (HA). Proliferation was measured after addtion of ³H-Thymidin for the last 8h of culture. Cell were then harvested with a 96 well harvester (Skatron, Tronby, Norway) and incorporated radioactivity was determined on a β-counter (Betaplate, LKB Wallac) IFN-γ specific ELISA. To analyze the lymphokine-content of culture supernatants, serial dilutions of supernatants in PBS were incubated in 96-well U bottom plates (Nalge Nunc Int., Roskilde, Denmark). These plates had been previously coated with 5 μg/ml cytokine-specific mAb (PharMingen, San Diego, CA; anti IFN-g (#18181 D)), were blocked with PBS, 1 % BSA and washed with PBS. After 2h at 25°C the supernatants were washed off and the biotinylated detecting IL-specific mAb was added at a dilution of 1 :2000 (PharMingen, SanDiego, CA, anti IFN-g (#18112D)). After intense washing with PBS, Streptavidin coupled alkaline phosphatase (Southern Biotechnology Associates (Birmingham, AL) was added for 30min at RT. After a final washing the color reaction was started by addition of p-nitrophenyl phosphate (#N- 9389, SIGMA chemicals, St. Louis, MO) according to manufacturers instructions. The lymphokine content was calculated using an ELISA reader at 405nm and recombinant lymphokines (PharMingen, San Diego, CA) as an internal standard.

The examples illustrate the invention.

Example 1 : Construction of Plasmids and Analyses for Tissue Specificity of Expression

In order to create DNA-vaccines for Influenza strain A/PR/8/34 hemagglutinin (HA), two different plasmids were constructed: In the first construct HA-cDNA expression was driven by the CMV immediate early promoter with splice- and poly(A) sites derived from SV40. This expression system for eukaryotic cDNA is commercially available with minor modifications depending on the source (pCI, Promega; pCMV, Clontech; pcDNA, Invitrogen; pBK-CMV, Stratagene) and is the most widely used for DNA-vaccination studies. Strong viral promoters with broad cell type specificity such as CMV (and RSV) promoters have been described to generate the most consistently high levels of gene expression (18). In particular, the CMV/SV40 system has been successfully used as a DNA-vaccine for the HA antigen (11 ). It was further described to successfully induce immune responses against other antigens (Ag), when the corresponding cDNAs were introduced into the expression cassette (4); (19); (20). To compare the vaccine with broad expression specificity to a genetic immunization strategy where gene expression would be restricted to DC, in a second construct a 5 kb fragment of the mouse CD11c 5'UT region was used as a promoter containing element. This "CD11c-promoter" was recently isolated and has been demonstrated to be DC-specific (12, 14). The specificity of this promoter was initially tested by a transgenic approach with random integration of various CD11 c-constructs into the genome of transgenic mice. So far mice derived from more than 15 individual transgenic founders have been tested for expression of various transgenes. All animals showed transgene expression exclusively in lymphoid and myeloid DC of all organs, but not on other cell types (12, 14), underlining the stringent regulation by the DC-specific CD11c-promoter.

To test if this stringency was also observed when the construct was injected i.m. as a DNA-vaccine, green fluorescent protein (GFP) encoding constructs were employed. It has been described before that a CMV-GFP construct would transfect myocytes and lead to the production of GFP 3 days after transfection. This expression could be detected in isolated muscle fibers until 14 days post inoculation (21 ). A CMV-driven or CD11c-driven GFP-construct was injected intramuscularly into the gastrocnemic muscle of the hind leg, the muscle bundle was isolated and 20μm sections were prepared to screen whole muscles for GFP-expression. Fig. 1 shows an example of immunofluorescence analysis of muscle tissue at day 7. GFP-expression can clearly be detected in muscle fibres of CMV-GFP injected muscle bundles (Fig.l C, D), while CD11c-GFP injection did not lead to detectable expression of GFP (Fig.l E, F). The background fluorescence visible even in the PBS injected muscle in Fig.l A, B is due to autofluorescence induced by the thickness (20μm) of the sections. In no case at no timepoint was it possible to detect any green fluorescence above background in muscle tissue injected with CD11c-GFP.

In order to investigate if the CD11c-GFP construct would be functional, DC from the draining popliteal lymph nodes was analyzed for the presence of GFP-expressing DC. Similar numbers of CD11 c⁺ GFP⁺ DC were found in lymph nodes draining CMV-GFP (Fig. 2b) as well as CD11 c-GFP injected muscles (Fig. 2c). In both cases mainly CD11c positive cells expressed GFP (Fig.2, CD11 c⁺), while no substantial numbers of GFP-expressing cells were found in the CD11 c-negative fraction (Fig.2, CD11c^") . This indicates that in contrast to the CMV-driven vaccine, which is expressed in both, muscle cells (Fig. 1 ) and DC (Fig. 2), the CD11c-driven construct is expressed only in DC (Fig. 2), but not in muscle fibres (Fig. 1 ).

To confirm this data and to rule out unspecific expression on the molecular level RT- PCR was performed on RNA extracts from injected as well as uninjected muscle bundles. Therefore, 100μg of CMV-HA or CD11 c-HA constructs were injected into the gastrocnemic muscle of the hind legs of BALB/c mice and the muscle bundles were removed 5 days post injection. After RNA isolation a reverse transcriptase (RT) reaction was performed and in a PCR with oligonucieotides specific for HPRT the presence of similar amounts of cDNA in all samples (Fig. 3a) was controlled. The PCR reaction was then repeated with oligonucieotides specific for HA to determine whether the injected vaccines were expressed in the muscle tissues. As shown in Fig. 3b, only a weak but reproducible HA-specific signal could be detected in muscle tissue injected with CMV-HA (Fig.3b, CMV-HA, DNA+, RT+), but not in those injected with the CD11C-HA construct (Fig.3b, CD11c-HA, DNA+, RT+). In control reactions the RT-step was omitted in order to demonstrate the absence of vaccine plasmid DNA in the RNA-preparations as a possible template for the PCR (Fig. 3, RT-).

Example 2: CD11c-promoter Is More Efficient in Inducing Ab-responses than the CMV-promoter Driven Construct.

In order to compare the two DNA vaccination strategies, BALB/c mice were immunized with various amounts of the two different HA-encoding vaccines intramuscularly and bled regularly in order to determine the serum titre of HA-specific Abs. Each animal was bled one day before each immunization and three weeks after the third injection. Vaccines were injected in three week intervals at week 0, 3 and 6. The titres of HA-specific Abs showed a significant increase in all immunized animals of each group (Fig. 4). A comparison of kinetics and strengths of the anti-HA responses in the different experimental groups indicates a clear superiority of the CD11c-promoter driven HA-cDNA. In the group receiving the smallest amount of DNA (3x1μg/leg in 2 legs i.m.) the HA-specific Ab-titre induced by CD11cHA-DNA was approximately 30-fold stronger than the responses induced by the CMV-driven HA- construct after one single injection (Fig. 4a). After the second and third immunization this difference decreased to 23-fold and 14-fold, respectively. This indicates that the kinetics of the responses were clearly different. While the CMV-HA construct induced an increase of anti-HA titre after repeated DNA injections only, the DC-specific construct reached the maximal response already after the first initial injection. In the groups of mice receiving higher doses of CD11c-HA DNA-vaccines, the relative kinetics of the anti-HA titre was similar (Fig. 4b). Again the DC-specific construct induced after one single injection a strong anti-HA response, which was increased by further injections only marginally. In contrast, the CMV-driven construct needed longer inoculation and repeated injections to induce a similar effect (Fig. 4b). As described elsewhere, the administered amount of DNA-vaccine was in relation with the level of the final anti-HA titre, with higher doses of DNA yielding higher serum titres (22).

The efficiencies of both constructs were compared when they were injected in a different formulation. As described previously, DNA vaccines may be encapsulated in cationic liposomes, and seem to transfect in this form APC in situ more efficiently (23, 24). When both constructs were administered as liposome-DNA complexes subcutaneously, again the DC-specific CD11c-construct was inducing anti-HA Ab- _; production more efficiently (Fig. 4c). Also in this form, the CD11c-HA plasmid induced the maximal response after only one single injection, and further injections did not increase the anti-HA titre significantly. In contrast, the CMV-HA plasmid driven response needed two injections to become measurable and remained 5- to 30-fold lower than the CD11c-HA driven response (Fig. 4c).

In all experiments equal amounts (2 or 200 μg/injection) of the two different plasmids which were of different sizes (11 kb CD11c-HA, 5.2kb CMV-HA) were injected. As a consequence, in each experiment the CMV-HA plasmid was delivered approximately in a two-fold molar excess as compared to CD11c-HA. The fact that CD11c-HA gives still better results, underlines its superiority further.

Example 3: Higher Efficiency of CD11c-promoter Is Not Due to CpG- methylation.

It has been described that the effectiveness of DNA vaccines is in part due to the immunomodulatory effect of the bacterial DNA itself and can be related to the relative frequency of CpG methylation in the bacterial DNA, as opposed to vertebrate DNA (25). Further it has been shown that CpG motives have upon endosomal processing a pronounced activation effect on DC (26). They directly stimulate DC (27) and induce their maturation and activation (28). To exclude that the high efficiency of the CD11c- promoter in the experiments would be rather due to CpG motives than its expression specificity, mice were immunized with 20μg CMV-HA DNA and the serum antibody titres were compared to those of mice immunized with a 1 :1 mixture of 20μg CMV-HA and 20μg pBCD11c (Fig. 5). The latter construct contained all sequences of CD11c- HA except HA-encoding cDNA (see Materials and Methods). Both immunizations yielded similar levels of HA-serum titres indicating that the CD11 c-construct does not contain additional CpG motives being responsible for its higher stimulatory capacities _: (Fig. 5).

Example 4: The Different Constructs Generate Ab-responses with Comparable Isotypes.

It has been established that the quality of an immune response induced by DNA- vaccination depends largely on the way the genetic vaccine is applied. Intramuscular injections of DNA in saline have been described to induce a Th1 -like response with Abs predominantly of the lgG2a isotype, while gene-gun immunized mice (29) and mice immunized with DNA-liposome complexes (24) would respond to the same Ag with Th2-like responses and elevated levels of Abs of the lgG1 isotype. Therefore, sera of mice immunized with different DNA vaccines analyzed in order to compare the quality of the Ab-responses. As shown in Table 1 , both vaccines, when injected i.m. in saline generated predominantly lgG2a anti-HA Ab, while immunization with the same DNA entrapped into cationic liposomes produced mostly lgG1 anti-HA Ab (Table 1). Intramuscular immunizations with DNA in saline yielded lgG1/lgG2a ratios of <1 in ail cases for both constructs indicating more lgG2a Ab. DNA in liposome immunizations resulted in lgG1 to lgG2a ratios of >1 , signifying more lgG1 than lgG2a. Overall, CMV-HA injections induced a greater degree of isotype skewing as indicated by smaller lgG1/lgG2a ratios than CD11c-HA immunization. Booster DNA immunizations altered the quantity of anti-HA Ab, but had no influence on the isotypic nature of the response. Taken together, our results indicate that a DC-specific expression of DNA vaccine antigen increases the potency of the vaccine as compared to conventional DNA vaccines, but had no influence on the isotypic nature of the response.

Example 5: Direct Transfection of DC in vivo.

To investigate if and when DC do express antigen encoded by the different vaccines, we performed i.m. vaccinations as described above with CMV-GFP or CD11c-GFP plasmids and isolated DC at various time points (day 2, 6, 9 post injection; Fig.6 and data not shown) from draining lymph nodes (popliteal lymph nodes). As described before (6, 32) DC should be transfected by the vaccines and therefore express the encoded GFP. Isolated CD11c⁺ DC were therefore analyzed for GFP-expression by confocal microscopy as shown in Fig. 6. Already 2 days post immunization a strong green-fluorescence could be detected in DC from CD11 c-GFP immunized mice. In contrast, DC from CMV-GFP immunized animals showed no detectable GFP- expression at all, since only background green fluorescence was detectable. As background parameters we measured green fluorescence of DC isolated from non- draining (brachial) lymph nodes of the same animals (Fig.6c, d) or PBS-injected animals (data not shown). In contrast, at a later time point (day 9; Fig. 6e, f) GFP- expression could be detected with similar frequency and comparable intensity in DC isolated from both, CMV-GFP (Fig. 6e) and CD11C-GFP (Fig. 6f) immunized mice. At no time point we were able to detect GFP-expression in the CD11c-negative non-DC fraction of the lymph nodes (data not shown). Taken together these findings indicate that the CD11c-promoter induces expression of vaccine-Ag already 48h post immunization; this is in contrast to the CMV promoter driven vaccine, where we could detect significant expression only at a much later time point (Fig. 6e, day 9). Once GFP-expression was apparent, the average percentage of transfected DC was similar (-2-3% of total CD11c⁺ DC, data not shown) in both experimental groups. Since the GFP-fluorescence in DC was too low to be measured with FACS-analysis, a precise direct comparison of mean fluorescence intensities was impossible. But a rough estimation of the fluorescence on the confocal images (Fig. 6e, f and data not shown) indicates that expression levels of GFP induced by CD11c- vs. CMV-driven vaccines were comparable.

Example 6: Modification of the immune response by DC-specific coexpression of Antigen and OX40L after intramuscular administration of DNA-vaccines.

To investigate the feasibility of DNA-vaccine driven coexpression of immunologically active molecules and their qualitative influence on the antibody response, we chose OX40L, a member of the TNF family, believed to shift immune responses towards a TH2 type (35, 36). The cDNA encoding OX40L was cloned into the expression cassette of the CD11c-vector described above. This construct was mixed with the CD11c-HA plasmid at a ratio 1 :1 and 2x100μg of this mixture were injected i.m. into the hind legs of BALB/c mice (Figure 7). As a control, the second group of mice received the same CD11c-HA vector mixed with CD11c-B2M. The latter vector encodes beta-2-Microglobulin (B2M), a molecule which does not affect the immune response (the mixture CD11c-HA + CD11c-32M induces the same immune response as CD11c-HA alone). Mice were immunized 3 times in 3 week periods and the sera were analysed as described before for HA-specific Ab-responses. As expected for the i.m. route, the control group (Figure 7, CD11c-HA + CD11c-B2M, open bars) mounted an HA-specific antibody response of a Th1-type, dominated by lgG2a antibodies. In contrast, when the plasmid mixture CD11c-HA + CD11c-OX40L was injected, the response was more equilibrated, since now the TH2-type (IgGI )-antibody production was promoted (Figure 7, lgG1 , gray bars). As compared to the control group, the TH1 response is relatively lower, but not completely suppressed (Figure 7, lgG2a, gray bars).

Example 7: Modification of the immune response by DC-specific coexpression of Antigen and OX40L after intradermal administration of DNA-vaccines by the gene gun method. To test if the ballistic administration of the DC-specific vaccine would show similar features as the intramuscular route, two groups of mice were immunized with the gene-gun method. Gold-particles used for this method were coated either with CD11c-HA plus CD11c-OX40L (Fig.8 A, C, E) or CD11 c-HA plus a control vector (CD11c-B2M) (Fig.8 B, D, F) in a ratio of 1 :1 each. Before Immunization at day 0 and 28 blood was taken and the serum was analyzed for presence of HA- specific antibodies. Tthe group immunized with CD11c-HA plus a control vector showed the typical picture of DNA vaccination with gene gun, namely antibody titers which develop eventually at different time points within the group (Figure 8, B, D, F). In contrast, the co-administration of CD11c-HA plus CD11c-OX40L during immunization gave a more consistent picture (Figure 8, A, C, E). All mice within the group developed a strong and uniform response, resulting in much higher final sera- titers of specific antibody as compared to the control group. Again, as already observed in Figure 7 during intramuscular immunisation, the latter mice developed both, Th1 and Th2 type antibodies to a similar extent (Figure 8, A, C, E) as compared to the control group (Figure 8, B, D, F). Those show a predominant Th1 anti-HA response. Example 8: Coadministration of CD11 c-OX40L and CD11c-HA result in long- term (memory) T lymphocyte responses. To test if coadministration had a significant impact on T cell responses, we analyzed T cell proliferation 48 days after a single gene-gun immunization. When the CD11c-HA vector was injected together with the control plasmid used in Figures 8 and 7 (CD11c-β2M) (Figure 9B), the proliferative T cell response in the draining inguinal (Figure 9B, ing) or axial (Figure 9B, Ax) lymph nodes was not significantly elevated over proliferation observed in non-draining poplietal lymph nodes (Figure 9B, pop). In contrast, when a coinjection of CD11c-HA and CD11c-OX40L was performed, a significant proliferation was observed in the draining inguinal (Fig. 9, Ing) and axial (Figure 9, Ax) lymph nodes. This proliferation was antigen-specific, since in absense of the antigen HA in the restimulation test (Figure 9, OHAU), only background proliferation was measured. These data demonstrate, that the double immunisation using the CD11c-promoter is able to modify the immuneresponse significantly. As reported for OX40L, this molecule promotes T cell memory, a phenomenon that was enforced by the direct transfection of APC using the CD11c-promoter. The T cells which proliferated did also produce significant amounts of IFN-γ, as detected in the supernatants of the T cell stimulation assay (Figure 10). Only the T cells from CD11c-HA plus CD11c-β2M (Figure 10, left panel) but not those from CD11c-HA plus control (Figure 10, right panel) immunized mice showed significant IFN production. Again, only the cells from the draining axial lymphnode produced IFN in the presence (Axial +), but not in absence (Axial-) of HA antigen indicating antigen specific IFN production. Table 1

Plasmid DNA week IsG2a IsGl l2Gl/IsG2a

(μg)

CD 11 c-HAΛ.m./saline 20 300 30 0.1

9 900 100 0. 1 1

.00 3 2700 900

9 8100 2700 0.33

CDl lc-HA/s.c/liposome 10 9 30 900 30

CMV-HA/i.m./saline 20 ι j 100 30

9 900 30 0.03

200 900 100 0.1 1 c, 2700 100 0.04

CMV-HA^y's.c./liDOsoms 10 9 30 300 10

Table 1 : Isotype analysis of sera from DNA-vaccinated mice. BALB/c mice were immunized three times in three-weeks intervals with the indicated amounts of DNA either in saline or in a liposomal formulation. Blood was taken from the tail veins at weeks 3 and 9 and analyzed for its HA-titre by ELISA as described for Fig. 1. HA- specific antibodies in the non-pooled sera of 5 to 6 mice per group were detected with antiserum specific for either lgG1 or lgG2a. References:

1. Wolff, J.A., R.W. Malone, P. Williams, W. Chong, G. Acsadi, A. Jani, and P.L Feigner. 1990. Direct gene transfer into mouse muscle in vivo. Science 247:1465-8.

2. Xiang, Z., and H.C. Ertl. 1995. Manipulation of the immune response to a plasmid-encoded viral antigen by coinoculation with plasmids expressing cytokines. Immunity 2: 129-35.

3. Doe, B., M. Selby, S. Barnett, J. Baenziger, and CM. Walker. 1996. Induction of cytotoxic T lymphocytes by intramuscular immunization with plasmid DNA is facilitated by bone marrow-derived cells. Proceedings of the National Academy of Sciences of the United States of America 93:8578-83.

4. Corr, M., D.J. Lee, D.A. Carson, and H. Tighe. 1996. Gene vaccination with naked plasmid DNA: mechanism of CTL priming. Journal of Experimental Medicine 184:1555-60.

5. Banchereau, J., and R.M. Steinman. 1998. Dendritic cells and the control of immunity. Nature 392:245-52.

6. Condon, C, S.C. Watkins, CM. Celluzzi, K. Thompson, and L.D. Falo, Jr. 1996. DNA-based immunization by in vivo transfection of dendritic cells. Nature Medicine 2:1122-8.

7. Casares, S., K. Inaba, T.D. Brumeanu, R.M. Steinman, and CA. Bona. 1997. Antigen presentation by dendritic cells after immunization with DNA encoding a major histocompatibility complex class ll-restricted viral epitope. Journal of Experimental Medicine 186:1481-6.

8. Boyle, J.S., J.L. Brady, and A.M. Lew. 1998. Enhanced responses to a DNA vaccine encoding a fusion antigen that is directed to sites of immune induction. Nature 392:408-11. 9. Timares, L., A. Takashima, and S.A. Johnston. 1998. Quantitative analysis of the immunopotency of genetically transfected dendritic cells. Proc Natl Acad Sci U S 95:13147-52.

10. Schwartz, R.H. 1990. A cell culture model for T lymphocyte clonal anergy. Science 248:1349-56 Madison 53706.

11. Torres, C.A., A. Iwasaki, B.H. Barber, and H.L. Robinson. 1997. Differential dependence on target site tissue for gene gun and intramuscular DNA immunizations. Journal of Immunology 158:4529-32.

12. Brocker, T., M. Riedinger, and K. Karjalainen. 1997. Targeted Expression of Major Histocompatibility Complex (MHC) Class II Molecules Demonstrates that

Dendritic Cells Can Induce Negative but not Positive Selection of Thymocytes in vivo. J Exp Med 185:541 -550.

13. Brocker, T., M. Riedinger, and K. Karjalainen. 1997. Driving gene expression specifically in dendritic cells. Advances in Experimental Medicine & Biology 417:55-7.

14. Brocker, T. 1997. Survival of mature CD4 T lymphocytes is dependent on major histocompatibility complex class ll-expressing dendritic cells. Journal of Experimental Medicine 186:1223-32.

15. Mozdzanowska, K., M. Furchner, G. Washko, J. Mozdzanowski, and W. Gerhard. 1997. A pulmonary influenza virus infection in SCID mice can be cured by treatment with hemagglutinin-specific antibodies that display very low virus- neutralizing activity in vitro. J Virol 71 :4347-55 CTL response was mediated at least in part, by transfer of antigen from the transplanted muscle cells to a host cell.

16. Kouskoff, V., H.J. Fehling, M. Lemeur, C. Benoist, and D. Mathis. 1993. A vector driving the expression of foreign cDNAs in the MHC class ll-positive cells of transgenic mice. J Immunol Methods 166:287-91. 17. Brocker, T., M. Riedinger, and K. Karjalainen. 1996. Redirecting the complete T cell receptor/CD3 signaling machinery towards native antigen via modified T cell receptor. European Journal of Immunology 26:1770-4.

18. Pardoll, D.M., and A.M. Beckerleg. 1995. Exposing the immunology of naked DNA vaccines. Immunity 3:165-9.

19. Fynan, E.F., R.G. Webster, D.H. Fuller, J.R. Haynes, J.C. Santoro, and H.L Robinson. 1993. DNA vaccines: protective immunizations by parenteral, mucosal, and gene-gun inoculations. Proceedings of the National Academy of Sciences of the United States of America 90:11478-82.

-20. Schirmbeck, R., W. Bohm, K. Ando, F.V. Chisari, and J. Reimann. 1995. Nucleic acid vaccination primes hepatitis B virus surface antigen-specific cytotoxic T lymphocytes in nonresponder mice. Journal of Virology 69:5929-34.

21. Chattergoon, M.A., T.M. Robinson, J.D. Boyer, and D.B. Weiner. 1998. Specific immune induction following DNA-based immunization through in vivo transfection and activation of macrophages/antigen-presenting cells. J Immunol 160:5707-18.

22. Deck, R.R., CM. DeWitt, J.J. Donnelly, M.A. Liu, and J.B. Ulmer. 1997. Characterization of humoral immune responses induced by an influenza hemagglutinin DNA vaccine. Vaccine 15:71 -8.

23. Sedegah, M., R. Hedstrom, P. Hobart, and S.L Hoffman. 1994. Protection against malaria by immunization with plasmid DNA encoding circumsporozoite protein. Proceedings of the National Academy of Sciences of the United States of America 91 : 9866-70.

24. Gregoriadis, G., R. Saffie, and J.B. de Souza. 1997. Liposome-mediated DNA vaccination. FEBS Letters 402:107-10. 25. Sato, Y., M. Roman, H. Tighe, D. Lee, M. Corr, M.D. Nguyen, G.J. Silverman, M. Lotz, D.A. Carson, and E. Raz. 1996. Immunostimulatory DNA sequences necessary for effective intradermal gene immunization. Science 273:352-4.

26. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, K. Heeg, G.B. Lipford, and H. Wagner. 1998. CpG-DNA-specific activation of antigen- presenting cells requires stress kinase activity and is preceded by non-specific endocytosis and endosomal maturation. Embo J 17:6230-6240.

27. Jakob, T., P.S. Walker, A.M. Krieg, .C. Udey, and J.C Vogel. 1998. Activation of cutaneous dendritic cells by CpG-containing oligodeoxynucleotides: a role for dendritic cells in the augmentation of Th1 responses by immunostimulatory DNA. J Immunol 161 :3042-9.

28. Sparwasser, T., E.S. Koch, R.M. Vabulas, K. Heeg, G.B. Lipford, J.W. Ellwart, and H. Wagner. 1998. Bacterial DNA and immunostimulatory CpG oligonucieotides trigger maturation and activation of murine dendritic cells. EurJ Immunol 28:2045-54.

29. Feltquate, D.M., S. Heaney, R.G. Webster, and H.L. Robinson. 1997. Different T helper cell types and antibody isotypes generated by saline and gene gun DNA immunization. Journal of Immunology 158:2278-84.

30. Porgador, A., K.R. Irvine, A. Iwasaki, B.H. Barber, N.P. Restifo, and R.N. Germain. 1998. Predominant role for directly transfected dendritic cells in antigen presentation to CD8+ T cells after gene gun immunization. J Exp Med 188:1075-82.

31. Sambrook, J., et al. Molecular Cloning, A Laboratory Manual. 2^nd edition 1989. CSH Press, Cold Spring Harbor, N.Y.

32. Akbari O., Panjwani N., Garcia S. Tascon R., Lowrie D., Stockinger B. 1999. DNA vaccination: transfection and activation of dendritic cells as key events for immunity. J Exp Med 189:1 et seq. 33. Tang D.C, et al. 1992. Genetic immunization is a simple method for eliciting an immune response. Nature 356:152-4.

34. William R.S., et al. 1991. Introduction of foreign genes into tissues of living mice by DNA-coated microprojectiles. Proc Natl Acad Sci USA 88:2726-30.

35. Lane, P. Role of OX40 signals in coordinating CD4 T cell selection, migration and cytokine differentiation in T helper (Th)1 and Th2 cells. J.- Exp. Med. 2000. 191 : 201-6.

36. Akiba H et al. Critical contribution of OX40L to T helper cell type 2 differentiation in experimental leishmaniasis. J. Exp. Med. 2000. 191 :375-80.

Claims

1. A vaccine containing a nucleic acid molecule comprising

(a) a promoter that is specifically active in antigen presenting cells; and, operatively linked thereto

(b) a nucleic acid sequence encoding an antigen.

2. The vaccine of claim 1 wherein said nucleic acid is DNA.

3. The vaccine of claim 1 or 2 wherein said antigen presenting cells are dendritic cells.

4. The vaccine of claim 3 wherein said promoter comprises the sequence

(aa) TCTCTGCTGGTGCCTCACACGGGCATACACTCCGTAACTCAGATAT TACCAACCATGCGCGGTCCTTGCTTTTCTTTCCTTTTCACTTTATGG TTCTTT I I I I I I I CTTTTGTCTTCATTCTTTTCTCATATAATACATCCT GACCTCAGTCTCCCCCCTTCCCAGTCCCTCCTTACCACTTCCCCTC TCTCCTTTCCCTTCAGAAAAGTGCAGGCTCCCAGGGACATCAACCA AACCTGGTTCTCTGAAAGGTGAATGTGACTATCTTATTCCTCATGCA TGACTTCTCTACACTTCCTTCTGCCTGCGGGATAAAAATAAAAGTCT TTCAAAACTCCCAGGTCCCGTGGCCTGCTCACTCTCCAGTTTTCCA ACACTCCAGCCTCATCTGTTGGCAGTCTTATCTCCCACGCTGTCCT GTTAACTCTTTATGGTGTGCCAGAGAAACAAGGCCTCCAGCAAGAA GTCACTCCACAAAATGAGGAAAAATAAGGAGAAAACCTCTAATAAA AATAGTTTGTGTCCAGTTTGGCTAGTGCCCAAAGAGAATCCAGTCC AGCATGGAAATTATTTGAGGCGTATGTGGGTCTTGAGCTACAAAAC TTCACCTATGATATCACCTGAGTATCTCTCTAAAGTCCCAGCCCCAA GTTGCACTCTGAACATTAAAACATGTTTACAGAAATGTATGCTTAGC CATTTTAGACCAAACGAGATGCCATCAGTGTTACCTCTAAAGCAGG TCAACATAGGAAGATTTGTACTGTAAAGGTACTGTCACAAATGCCA GCTACTTAGCACCCCAGTTCTTTGCTGGCTGCTGCTATCCAAGGAT GTTCTGGCGGCCTGGAACAATCAAACTTTTCCTGGGAGAGGAATGA

GAACCAGAACTTTCGATCCAATGCTTACCCCACCCCCTCTTTGGAG

TGCCTGACAGAGGCAGGTTCTTGATAGGAGAAAGGGCCTAATGGC

CAGCTGTGGGCCAGGGTTATCTTCCAGAATAAGGTTTAAGGGATGA

TAATCCTAATGAACATATCCATTGCTTCTGAAATTCAG I I I I I AGTAT

TCTCTTGACCTTGGCTGCCTTTAAGACTCAGCTCAAGTGCTACTTC

CCCCAGAAAGCAGTCTGAGGTCCTCTCGGTCTGAGTAATACTTCTA

GTG GTTG GTCTCTGTACCTCTTTTCTC AC AG G G CCC ACTTTAGTGT

TCACCCATCTGCTTTTACTCTGATCTCTGGGTTATGTTTCTCCTATA

CCTAGCAAAAGGCTCAGACCACCCCTCTTGATTATGTTGAGCAAAT

GACTAATCCACTGAATGAATGAATGAGTGAGTGAATGAATGAATGA

ATGAATGAATGCCAGCCTGTGCTCCCTACATGGATCATGTGCTTAC

TTCTTAGTCTACTTCCAGGCCAGAAGTGGAGGGCTCCGTCATCTGT

TCTCTCTCCTCCTGTGGCTGACTCACACTTCAAGGTCAAGGGAAAC

TTCTGCCAGTACAAAAGTCTGAGAGGGATCAGATAATCCGGGAGTT

TACATATATCCATCCGGGCAAGAATTGGGGAACCAGAACAATATGT

CACCAAGTCGTTTCAAGTAGAGCAACTCTTCCCTGGAAGTGTGTAG

GCTGCCTCGGTCCCCACTCTATCCATTTCATCTCAGTTTGCCCCCA

CCTCCTCTGAGTCACGCTGACAACTTCCCTCCTGGTCTCTGGCCTC

CTGACCACCTTTCTTCTCATTTGCTTCTTCTGTGGTGACTTGGCAGC

TGTCTCCAAGTTGCTCAGAGCCTGCTTCTGTTCTCCAGT or

(ab)

CCTCCAGCAAGAAGTCACTCCACAAAATGAGGAAAAATAAGG AGAAAACCTCTAATAAAAATAGTTTGTGTCCAGTTTGGCTAGTGCCC AAAGAGAATCCAGTCCAGCATGGAAATTATTTGAGGCGTATGTGGG TCTTGAGCTACAAAACTTCACCTATGATATCACCTGAGTATCTCTCT AAAGTCCCAGCCCCAAGTTGCACTCTGAACATTAAAACATGTTTACA GAAATGTATGCTTAGCCATTTTAGACCAAACGAGATGCCATCAGTG TTACCTCTAAAGCAGGTCAACATAGGAAGATTTGTACTGTAAAGGTA CTGTCACAAATGCCAGCTACTTAGCACCCCAGTTCTTTGCTGGCTG CTGCTATCCAAGGATGTTCTGGCGGCCTGGAACAATCAAACTTTTC CTGGGAGAGGAATGAGAACCAGAACTTTCGATCCAATGCTTACCCC ACCCCCTCTTTGGAGTGCCTGACAGAGGCAGGTTCTTGATAGGAG AAAGGGCCTAATGGCCAGCTGTGGGCCAGGGTTATCTTCCAGAAT AAGGTTTAAGGGATGATAATCCTAATGAACATATCCATTGCTTCTGA AATTCAG I I I I I AGTATTCTCTTGACCTTGGCTGCCTTTAAGACTCA GCTCAAGTGCTACTTCCCCCAGAAAGCAGTCTGAGGTCCTCTCGGT CTGAGTAATACTTCTAGTGGTTGGTCTCTGTACCTCTTTTCTCACAG GGCCCACTTTAGTGTTCACCCATCTGCTTTTACTCTGATCTCTGGGT TATGTTTCTCCTATACCTAGCAAAAGGCTCAGACCACCCCTCTTGAT TATGTTGAGCAAATGACTAATCCACTGAATGAATGAATGAGTGAGT GAATGAATGAATGAATGAATGAATGCCAGCCTGTGCTCCCTACATG GATCATGTGCTTACTTCTTAGTCTACTTCCAGGCCAGAAGTGGAGG GCTCCGTCATCTGTTCTCTCTCCTCCTGTGGCTGACTCACACTTCA AGGTCAAGGGAAACTTCTGCCAGTACAAAAGTCTGAGAGGGATCA GATAATCCGGGAGTTTACATATATCCATCCGGGCAAGAATTGGGGA ACCAGAACAATATGTCACCAAGTCGTTTCAAGTAGAGCAACTCTTC CCTGGAAGTGTGTAGGCTGCCTCGGTCCCCACTCTATCCATTTCAT CTCAGTTTGCCCCCACCTCCTCTGAGTCACGCTGACAACTTCCCTC CTGGTCTCTGGCCTCCTGACCACCTTTCTTCTCATTTGCTTCTTCTG TGGTGACTTGGCAGCTGTCTCCAAGTTGCTCAGAGCCTGCTTCTGT TCTCCAGT; or (b) a sequence that deviates from said sequence (aa) and/or (ab) by substitution, deletion, insertion, duplication or inversion and essentially retains promoter function of said sequence (aa) and/or (ab).

The vaccine of any one of claims 1 to 5 wherein said antigen is derived from a pathogen or is or is derived from an allergen.

The vaccine of claim 5 wherein said pathogen is a bacterium or a virus.

7. The vaccine of any one of claims 1 to 5 wherein said pathogen is an autoantigen involved in auto-immune diseases or a tumor-associated antigen.

8. The vaccine of any one of claims 1 to 7 wherein said nucleic acid molecule is encapsulated in a cationic liposome or wherein said nucleic acid molecule is coated to a gold particle.

9. The vaccine of any one of claims 1 to 8 which is a single dose vaccine.

10. The vaccine of any one of claims 1 to 9 further comprising a further nucleic acid molecule suitable for expression of a further protein.

11. The vaccine of claim 11 wherein said further protein confers prolongation of survival or enhancement of function of antigen presenting cells.

12. The vaccine of claim 11 wherein said antigen presenting cells are dendritic cells.

13. A method of vaccinating a mammal wherein the vaccine of any one of claims 1 to 12 is administered to a mammal at a suitable dose.

14. The method of claim 12 wherein said mammal is a human.