EP1212430A1 - Nuclease variant and their use in genotyping assays - Google Patents

Nuclease variant and their use in genotyping assays

Info

Publication number
EP1212430A1
EP1212430A1 EP00949725A EP00949725A EP1212430A1 EP 1212430 A1 EP1212430 A1 EP 1212430A1 EP 00949725 A EP00949725 A EP 00949725A EP 00949725 A EP00949725 A EP 00949725A EP 1212430 A1 EP1212430 A1 EP 1212430A1
Authority
EP
European Patent Office
Prior art keywords
exonuclease
nucleic acid
polypeptide
dna
polypeptide according
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00949725A
Other languages
German (de)
French (fr)
Inventor
Jon Sayers
Dipak Patel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Sheffield
Original Assignee
University of Sheffield
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Sheffield filed Critical University of Sheffield
Publication of EP1212430A1 publication Critical patent/EP1212430A1/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6827Hybridisation assays for detection of mutation or polymorphism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10Transferases (2.)
    • C12N9/12Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1241Nucleotidyltransferases (2.7.7)
    • C12N9/1252DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14Hydrolases (3)
    • C12N9/16Hydrolases (3) acting on ester bonds (3.1)
    • C12N9/22Ribonucleases [RNase]; Deoxyribonucleases [DNase]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6813Hybridisation assays
    • C12Q1/6816Hybridisation assays characterised by the detection means
    • C12Q1/6823Release of bound markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844Nucleic acid amplification reactions
    • C12Q1/6858Allele-specific amplification

Definitions

  • the invention relates to exonuclease variants characterised in that they lack detectable 5' ⁇ 3' exonuclease activity but retain endonuclease activity; vectors encoding said variant exonucleases; and production of said variant exonucleases.
  • DNA metabolism involves a number of distinct enzyme activities involved in a variety of processes related to the synthesis, degradation and function of DNA. For example, and not by way of limitation, DNA replication; DNA recombination and repair; regulation of gene expression; stabilisation of chromosomes; and the segregation of chromosomes during mitosis and/or meiosis. A vast array of enzyme activities are involved in regulating these processes.
  • E. coli DNA polymerase I E. coli DNA polymerase I
  • ECPolI E. coli DNA polymerase I
  • Similar enzyme activity must exist in all cells, if only to process Okazaki fragments.
  • This large family of enzymes possess 5'- 3' exonuclease activity on duplex DNA with a free 5'-terminus, such as blunt-ended duplexes and on oligonucleotides annealed to a complimentary template.
  • circular duplex DNA molecules containing a nick are also substrates for exonuclease activity and are converted to partially gapped or fully singled-stranded circular products.
  • 5'— >3' exonuclease activity many of these enzymes also display structure-specific endonuclease activity. Bifurcated structures are cleaved at or close to the site of branching by the structured-specific endonuclease component of the 5'- 3' exonuclease, please see Figure 1.
  • Examples of 5'— »3' exonucleases containing endonuclease activity include, amongst others, T7 gene 6 exonuclease, and the DNA Pol I enzymes from Escherichia coli and Thermus aquaticus which show structure specific DNA binding and endonucleolytic cleavage of certain substrates.
  • the phage exonuclease T5 D15 exonuclease is an example of a single stranded endonuclease which can also process circular DNA molecules.
  • the Cleavase tm assay exploits both the exonuclease and endonuclease activities of Thermus aquaticus DNA polymerase I.
  • the Cleavase tm assay is a means to rapidly identify known and unknown mutations at specific gene loci.
  • target DNA molecules are heat denatured to separate double stranded
  • the strands are rapidly cooled to prevent reannealing of complementary strands.
  • secondary structures form in the separated DNA strands which are dependant on the primary DNA sequence.
  • these are stem-loop structures which are substrates for the exonuclease and endonuclease activities of T. aquaticus DNA polymerase I.
  • Single base changes in the primary DNA sequence can alter the secondary structures formed after separation and cooling.
  • These altered secondary structures are also substrates for endonuclease digestion resulting in differential patterns of labelled DNA fragments when the assay products are separated and compared to the wild-type or control DNA.
  • the digestion products are separated by conventional denaturing polyacrylamide gel electrophoresis.
  • the strands are labelled by conventional means prior to digestion (eg radio-isotopic, fluorescence) and visualised by autoradiography to produce a "bar code" typical of a specific DNA. Variations in the pattern of DNA fragments between wild-type and test DNA reveals a polymorphism typical of a mutation within the test DNA.
  • the Cleavase tm assay is described in US 5,719,028.
  • telomere tm An alternative genotyping assay is described by the so called “Taqman tm " assay.
  • This PCR based assay exploits the endonuclease activity of thermostable DNA polymerase and a single fluorescently labelled oligonucleotide which has been modified by the provision of two fluorescent tags, one positioned at the 5' terminus of the oligonucleotide, the other at the 3' terminus.
  • the tagged oligonucleotide (“reporter”) is designed to anneal to a site in a gene potentially containing a mutation of interest.
  • the annealed reporter is flanked by two additional oligonucleotides designed to anneal up-stream and down-stream of the reporter.
  • the tagged oligonucleotide anneals entirely with the target sequence leaving no free 5' end or region of non- complementarity between the target and reporter.
  • the polymerase used in the PCR reaction polymerises between the two flanking oligonucleotides incorporating the reporter into the PCR product.
  • the PCR reaction is exposed to UV excitation which results in fluorescent resonance energy transfer (FRET) between the 5' and 3' fluorophores on the reporter. If there is mis-matching between the reporter and the target DNA the endonuclease activity removes the 5' terminus of the reporter thus removing the 5' fluorophore.
  • FRET fluorescent resonance energy transfer
  • the 5'-»3' exonuclease used contains both exonuclease and endonuclease activities.
  • the endonuclease activity is relatively easy to control since there are a finite number of secondary structures that can form with a primary DNA sequence under a set of defined, controllable conditions.
  • exonuclease activity is processive and in the presence of a free 5' end the exonuclease will digest the substrate to completion if the assay is not terminated. Therefore a problem associated with prior art genotyping assays is that the control of the assay to provide a reliable, reproducible result is primarily by control of asssay conditions.
  • a modified exonuclease which advantageously lacks detectable exonuclease activity but retains endonuclease activity and a wild-type binding constant for its DNA substrate.
  • exonuclease activity is in a 5'->3' direction.
  • said exonuclease polypeptide, or said fragment thereof is modified by addition, deletion, substitution, or inversion, of at least one part of said exonuclease polypeptide such that exonuclease activity is substantially reduced but endonuclease activity is substantially retained.
  • said modified exonuclease polypeptide retains wild- type endonuclease activity and lacks detectable exonuclease activity. More ideally still said modified exonuclease has a wild-type binding constant for its nucleic acid substrate.
  • the invention includes polypeptides in which the modification comprises the addition, deletion, or substitution of at least one amino acid residue or modified amino acid residue.
  • said modification is substitution of amino acid 83 of the sequences presented in Table 1, or substitution of a homologous amino acid in another, ideally, related exonuclease.
  • said modification is the replacement of lysine 83 with an arginine amino acid residue.
  • said modification is the replacement of lysine 83 with a modified amino acid residue.
  • modified or synthetic amino acids include, and not by way of limitation, 4-hydroxyproline, 5-hydroxylysine, N 6 - acetyllysine, N 6 -methyHysine, N 6 ,N 6 -dimethyllysine, N 6 ,N 6 ,N 6 - trimethyllysine, cyclohexyalanine, D-amino acids, ornithine.
  • the incorporation of modified amino acids may confer advantageous properties on 5'— 3' exonuclease according to the invention.
  • the incorporation of modified amino acids can increase the affinity of the enzyme for its binding site or can confer increased stability on the enzyme thus allowing a decrease in the effective amount used.
  • said modified exonuclease is derived from DNA polymerase I.
  • said modified exonuclease is derived from a bacterial DNA polymerase I. More ideally still said bacterial species is selected from; E.coli; Dienococcus radiodurans; Mycobacterium tuberculosis; Neisseria meningitdis; Mycoplasma spp.; Haemophilus spp.; Heliobacter spp.
  • thermophilic bacterial species is selected from; Thermus aquaticus; Thermus thermophilus; Thermosipho africanus; Thermotosa maritima.
  • exonuclease is 5 '-3 'exonuclease of Aquifex aeolicus.
  • DNA polymerase I homologues mesophilic or thermophilic bacterial species
  • DNA polymerase I homologues with at least 25 % homology to the first 250 amino acids of E.coli DNA polymerase I are the preferred DNA polymerase enzymes.
  • said exonuclease is phage exonuclease. More ideally still said phage exonuclease is 5 '-3 'exonuclease of T3 phage; T4 phage; T5 phage; T7 phage; BF23 phage.
  • Modified exonucleases are known in the art.
  • US 5,716,819 describes a modified T5 DNA polymerase I with reduced 3'- 5' exonuclease activity.
  • US 5,716,819 describes a modified T5 DNA polymerase I with reduced 3'- 5' exonuclease activity.
  • 5547859 describes a family of B DNA polymerases which lack detectable 3'- 5' exonuclease activity.
  • WO9206200 and US5885813 describes modified thermostable DNA polymerases with reduced 5 '-3' exonuclease activity for use in DNA sequencing and PCR.
  • US 5882904 describes DNA polymerase mutants of the Thermococcus barossii with reduced 3 '-5' exonuclease activity and an increased ability to incorporate ribonucleotides and dideoxynucleotides. It was not reported that any of the afore referred to modifications had any effect on the endonuclease activity.
  • DNA molecule encoding a polypeptide, or an effective fragment thereof, according to any preceding aspect or embodiment of the invention.
  • said DNA molecule is cDNA.
  • said DNA molecule is genomic DNA.
  • said DNA molecule is synthetically derived.
  • Reference herein to the term synthetic comprises reference to an oligonucleotide manufactured using DNA oligo-synthesising technology.
  • the invention includes such DNA molecules which are modified by addition, deletion, substitution, or inversion of at least one nucleic acid-base pair.
  • any of the following techniques may be used: restriction digestion may be undertaken using selected restriction enzymes; and/or polymerised chain- reaction methods may be undertaken to amplify selected regions of DNA molecules encoding said exonuclease polypeptides; or incorporation of point-mutations may be undertaken using both PCR methodology and/or conventional methods to introduce point -mutations and/or small deletions.
  • a vector containing a DNA molecule encoding a modified exonuclease of the invention is provided.
  • said vector is provided with means to recombinantly manufacture the modified exonuclease of the invention.
  • said vector will be provided with promoter sequences that facilitate the constitutive and/or regulated expression of the DNA sequence encoding said exonuclease. Further, said promoter sequences will be selected such that expression in eukaryotic and/or prokaryotic cells is facilitated. In addition, said vector is provided with polyadenylation signals and/or termination signals that optimise expression of said vector in either a eukaryotic cell and/or prokaryotic cell.
  • the above described vectors are provided with necessary selectable markers that will facilitate their selection in a eukaryotic or prokaryotic cell(s).
  • a method to recombinantly manufacture modified exonuclease polypeptides according to the invention comprising: i) growing said cell or cell-line transformed or transfected with the vector according to the invention in conditions conducive to the manufacture of said polypeptide; and ii) purifying said polypeptide from said cell, or its growth environment, by conventional means.
  • said vector encodes, and thus said recombinant polypeptide is provided with, a secretion signal or affinity tag to facilitate purification of said polypeptide.
  • an assay for comparing a nucleic acid with a comparison sequence comprising:
  • an assay for comparing a nucleic acid with a comparison nucleic acid sequence comprising: i) providing a sample of nucleic acid to be assayed; ii) providing conditions for the denaturation of the nucleic acid; iii) incubating the denatured nucleic acid with at least two probes, one of which is labelled, both of which are adapted to bind to different parts of the nucleic acid; iv) incubating the complex of nucleic acid and probes with the exonuclease according to the invention; and v) analysing the products of the activity of the exonuclease of (iv) above.
  • a method for the detection of sequence variation in nucleic acid target substrates comprising: i) providing an enzymatic cleavage means according to the invention; ii) providing a nucleic acid target substrate suspected of containing sequence variation relative to a reference control; iii) mixing said cleavage means and said substrate under conditions such that said substrate forms one or more secondary structures and said cleavage means cleaves said secondary structures resulting in the generation of multiple cleavage products; and iv) separating said multiple cleavage products so as to detect said sequence variation.
  • a method for performing combined polymerase chain reaction (PCR) amplification and hybridisation probing comprising the steps of: i) contacting a target nucleic acid with PCR reagents , including at least two
  • an oligonucleotide probe comprising: a) an oligonucleotide capable of hybridising to a target nucleic acid; b) a fluorescer molecule attached to the first end of the oligonucleotide; c) a quencher molecule attached to a second end of the oligonucleotide such that the quencher molecule substantially quenches the fluorescer molecule whenever the oligonucleotide probe is in a single-stranded state and such that the fluorescer is substantially unquenched whenever the oligonucleotide probe is hybridised to the target nucleic acid; d) a 5' end which is rendered impervious to digestion by the exonuclease according to the invention; and e) a 3' end which is rendered impervious to digestion by the exonuclease according to the invention; and ii) subjecting the target nucle
  • kits comprising: the exonuclease according to the invention; deoxynucleotide triphosphates; buffers; standard DNA (undigested); standard DNA(digested); oligonucleotide primers; cofactors.
  • Table 1 is a multiple sequence alignment showing representatives of prokaryotic 5' nuclease family.
  • the N-termini of Pol-I homologues ( _POL) and discrete exonuclease ( _ EXO) are aligned to show conserved residues ( AA, A.aeolicus; EC, E.coli; DR, D. radiodurans; TA, T. aquaticus; MT, M. tuberculosis; BS, B. subtilis.; MP, M.pneumoniae).
  • Perfectly conserved residues are shown in the consensus line ( Consen), a* indicates conserved character, lower case residues are somewhat conserved.
  • the underlined lysine residue corresponds to lysine 83 in T5 exonuclease;
  • Figure 1 represents a diagrammatic representation of some of the 5'-»3' exonuclease and endonuclease nucleic acid substrates
  • Figure 2a represents a SDS- PAGE DNA gel of recombinant wild-type and modified T5 D15 exonuclease
  • Figure 2b is a PAGE DNA gel showing exonuclease activity of renatured T5 D15 exonuclease
  • Lane 1 protein standards, molecular weight in kDa as marked to the left of the gel.
  • Lane 2 purified wild-type T5 D15 exonuclease.
  • Lanes 3 to 6 unpurified modified (K83R) T5 D15 exonuclease.
  • Lanes 3 and 4 Uninduced modified T5 D15 exonuclease.
  • Lanes 5 and 6 Induced modified T5 D15 exonuclease;
  • Figure 3 represents a graphical comparison of the 5'- 3' exonclease activity of wild
  • Figure 4 represents substrate binding by the modified T5 D15 exonuclease.
  • A Pseudo-Y substrate was incubated with the enzyme on ice, and the enzyme-substrate complex was separated from the unbound substrate by electrophoresis on a nondenaturing acrylamide gel. The substrate concentration was constant, the enzyme concentration was varied as shown.
  • B Data from the gel retardation (EMSA) experiments were plotted as percentage of free substrate against the enzyme concentration. Results shown are from three separate experiments. The enzyme concentration required to bind half the substrate was determined graphically. The dissociation constant for K83R was 28 nM; and
  • Figure 5 represents degradation of pseudo-Y substrate by wild-type and modified T5 D15 exonuclease. Enzymes were incubated with the substrate at 37°C for 5 and 30 min in the presence of 10 mM MgCl 2 , and reaction products were separated by denaturing PAGE. A control reaction lacking enzyme was incubated for 30 min;
  • Figure 6 represents degradation of PCR products by T5 K83R exonuclease.
  • the enzyme 300 nM was incubated with PCR products from homozygous 1.1 (lanes 1 & 2), 2.2 (lanes 5 &6) and heterozygous 1.2 (lanes 3 & 4) individuals. Reactions were performed at 37°C in the presence of 0.2 mM MnCl 2 and reaction products were separated by denaturing PAGE. Lanes 1, 3 & 5 show cleavage after 5 mins and lanes 2, 4, & 6 show cleavage after 15 mins; Figure 7 represents a SDS-PAGE DNA gel of recombinant wild-type and K82R Taq polymerase.
  • Lanes 1 & 2 show Taq K82R, and lane 3 shows wild-type Taq polymerase.
  • Panel B shows exonuclease activity of renatured Taq polymerase.
  • Panel A shows the gel subsequently stained with Coomassie blue;
  • Figure 8 represents degradation of single-stranded substrate by wild-type and K82R Taq polymerase. Enzymes (600 nM) were incubated with the substrate at 55°C for 5 min, 30 min and 4 hours in the presence of 1 mM MnCl 2 , and reaction products were separated by denaturing PAGE. A control reaction lacking enzyme was incubated for the same time period. The filled triangles represent increasing time as indicated above;
  • Figure 9 represents degradation of pseudo-Y substrate by wild-type and K82R Taq polymerase.
  • Enzymes 600 nM were incubated with the substrate at 55°C for 5 min, 30 min and 4 hours in the presence of 1 mM MnCl 2 , and reaction products were separated by denaturing PAGE. A control reaction lacking enzyme was incubated for the same time period. The filled triangles represent increasing time as indicated above;
  • Figure 10 represents degradation of PCR products by T5 K83R exonuclease.
  • the enzyme was incubated with allele 1.1 PCR product at 50°C in the presence of 0.2 mM MnCl 2 and reaction products were separated by denaturing PAGE;
  • Figure 11 represents PCR products (135 bps) obtained after reaction with wild-type Taq (lanes 5-8) and Taq K82R (lanes 1-4). Lanes 1 & 5 show the no template control, lanes 2 & 6 show allele 1.1 PCR product, lanes 3 & 7 show allele 2.2 PCR product, and lanes 4 & 8 show allele 1.2 PCR product; and
  • Figure 12 represent allelic discrimination in Taqman assays using wild-type and mutant Taq polymerase. Materials and Methods
  • Oligonucleotide site-directed mutagenesis was carried out on a single-stranded Ml 3 derivative carrying the cloned T5 D15 exonuclease gene (1).
  • the phosphorothioate- based high efficiency mutagenesis procedure (2) was used to alter the Lys83 codon, resulting in a substitution of Lys to Arg. This was achieved using the primer: 5 ' -d(C ATCACGATTACCGCGATACTCTGGTAG); (the anticodon change is shown underlined).
  • Mutagenesis of the Taq polymerase gene was carried out by published methods using a derivative of plasmid pTTQ18 carrying a Taq polymerase gene (12) designated pTaql .
  • pTaql a derivative of plasmid pTTQ18 carrying a Taq polymerase gene (12) designated pTaql .
  • an EcoRI-BamHI fragment was excised from this plasmid and cloned into the EcoRI/BamHI sites of phagemid pT7T3 ⁇ l 8 (Genbank accession no. L08953).
  • Oligonucleotide site-directed mutagenesis (13) was carried out on a single-stranded phagemid derived from this recombinant.
  • Codon 82 (encoding lysine) was replaced with an arginine codon using primer Taq82R 5'-d(GAGGCCTACG GGGGGTACCG GGCGGGCCGG GCCCCCA). Mutated clones were identified by dideoxy sequencing and the mutant EcoRI-BamHI fragments were used to replace the wild-type sequence in the corresponding region of the pTaql generating pTaq82R. Plasmids were transformed into strain XLl-Blue (Stratagene).
  • the mutated gene was subcloned into the expression vector pJONEX4 as described for the wild-type exonuclease gene (1, 4) and designated K83R.
  • the wild-type and mutant protein were purified as described (1), except that an initial urea solubilisation stage was included for the mutant protein, as it was found insoluble on overexpression. Protein concentration was determined using the Bradford assay (5).
  • pTaq82R-6 and pTaq82R-8 Two independent clones of the mutation were used for characterisation purposes. These clones were designated pTaq82R-6 and pTaq82R-8.
  • Recombinant Proteins were expressed and purified from pTaql and its derivatives essentially as described originally (12). Proteins were dialysed against buffer A (25 mM potassium phosphate buffer [pH 6.5] containing 1 mM EDTA, 1 mM DTT, 10% glycerol and 25 ⁇ g/ml phenylmethylsulphonylflouride) and purified by linear salt gradient (NaCl in buffer A) on heparin ion exchange columns. The proteins eluted between 500 and 600 mM NaCl. Fractions containing purified enzyme (as judged by analytical SDS-PAGE) were pooled, concentrated by ultrafiltration and stored in 50% glycerol (buffer A) at -20 °C.
  • a discontinuous SDS-PAGE gel containing 20 ⁇ g/ml Type XIV DNA from herring testes in the resolving gel was prepared as described (6).
  • the separated proteins were separated on this gel, the protein renatured in situ and MgCl 2 added to a concentration of 10 mM (for T5 enzymes) or 2 mM for ( for Taq polymerase enzymes).
  • MgCl 2 added to a concentration of 10 mM (for T5 enzymes) or 2 mM for (for Taq polymerase enzymes).
  • exonuclease activity was visualised as a shadow against a fluorescent background when viewed on a UV transilluminator.
  • the gel was then Coomassie stained.
  • Pseudo-Y substrate was prepared by annealing 5'- 32 P-end labeled FLAP oligonucleotide:
  • the FLAP oligonucleotide was end-labeled with [ 32 P]ATP under standard conditions and purified from a 7M urea- 15% acrylamide gel essentially as described (9).
  • Pseudo-Y substrates were diluted to contain 4.5 nM BRIDGE oligonucleotide, 150 pM 32 P-labeled FLAP oligonucleotide in 25 mM potassium glycinate, pH 9.3, 100 mM KCl, 1 mM EDTA, 5% glycerol, 1 mM DTT, 0.1 mg/ml acetylated BSA and modified T5 exonuclease at the concentration stated.
  • the enzyme was diluted in 25 mM potassium glycinate, pH 9.3, 1 mM EDTA, 50% glycerol, 1 mM DTT, and 0.1 mg/ml acetylated BSA.
  • the enzyme and pseudo-Y substrate in a final reaction volume of lO ⁇ l, were incubated on ice for 10 min and analysed on a 17% native polyacrylamide gel, buffered in 100 mM Tris-Bicine, pH 8.3, 2 mM EDTA, 1 mM DTT at 4°C for 2 h at 15 V/cm.
  • the gel was visualised and results quantified with a Molecular Imager (BioRad) and Molecular Dynamics software.
  • Human genomic DNA was prepared using standard procedures. To obtain PCR product and substrate for nuclease activity by Taq polymerase, a standard PCR reaction was prepared containing 20 mM Tris-HCl pH 8.5, 50 mM KCl, 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 mM MgCl 2 , 1 ⁇ M each primer, 2.5 units Taq polymerase, with 500 ng template DNA, in a final volume of 100 ⁇ l. Also included in the reaction were 0.4 mM each of dATP, dGTP, dTTP, 0.1 mM dCTP and 3.3 pmol 32 P- -dCTP (specific activity 10 ⁇ Ci).
  • the forward primer was TGGCATTGATCTGGTTCA and the reverse primer was GTTTAGGAATCTTCCCACTT.
  • the thermocycling conditions were; 5 min at 95°C; followed by 95°C for 1 min, 53°C for 1 min, 72°C for 1 min (35 cycles); and 5 min at 72°C.
  • the PCR products were purified using the Promega DNA clean-up kit after electrophoresis using a 1% agarose gel. The purified PCR products were eluted in 100 ⁇ l sterile water. The resultant PCR products from three donors (two homozygous for the two common alleles, i.e.
  • T5 K83R enzyme 300 nM end concentration
  • an aliquot of PCR product was made up to a final volume of 13 ⁇ l with water and heated to 95°C for 30 sec, using a programmable thermocycler, to denature the double-stranded DNA.
  • the DNA was cooled to 37°C. Enzyme (T5 K83R) or sterile water in the control solution was added.
  • the reactions contained 25 mM potassium glycinate pH 9.3, 0.5 mg/ml acetylated BSA, 0.2 mM MnCl 2 and were incubated at 37°C. An aliquot (10 ⁇ l) was stopped after 5 min with 8 ⁇ l stop solution (95% formamide, 10 mM EDTA pH 8.0, 0.05% xylene cyanol, 0.05% bromophenol blue). The remaining aliquot was stopped after 15 min reaction. The digested products were resolved on a (50 cm) 9% denaturing polyacrylamide gel (19:1 acrylamide :bisacrylamide, 7M urea, 1 x TBE pH 8.3) at 50W for 1.5 h. Cleavage products were visualised using autoradiography. The results are shown in Figure 6
  • Human genomic DNA was prepared using standard procedures. To obtain PCR product and substrate for nuclease activity by Taq polymerase, a standard PCR reaction was prepared containing 20 mM Tris-HCl pH 8.5, 50 mM KCl, 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 mM MgCl 2 , 1 ⁇ M each primer, 2.5 units Taq polymerase, with 500 ng template DNA, in a final volume of 100 ⁇ l. Also included in the reaction were 0.4 mM each of dATP, dGTP, dTTP, 0.1 mM dCTP and 0.5 ⁇ l 32 P- ⁇ dCTP.
  • the forward primer was TGGCATTGATCTGGTTCA and the reverse primer was GTTTAGGAATCTTCCCACTT.
  • the thermocycling conditions were; 5 min at 95°C; followed by 95°C for 1 min, 53 °C for 1 min, 72°C for 1 min (35 cycles); and 5 min at 72°C.
  • the PCR products were purified using the Promega DNA clean-up kit after electrophoresis using a 1% agarose gel. The purified PCR products were eluted in 100 ⁇ l sterile water.
  • the cleavage assay or CFLP assay was performed as described (Third Wave Technologies (15). Briefly, an aliquot of PCR product was made up to a final volume of 13 ⁇ l with water and heated to 95°C for 30 sec, using a programmable thermocycler, to denature the double-stranded DNA. Immediately after denaturation, the DNA was cooled to 50°C and 7 ⁇ l of Taq polymerase or control solution was added (see protocol provided by Third Wave Technologies, (15). The wild-type and mutant Taq polymerase enzymes were diluted with 1 x CFLP buffer as appropriate. Enzyme was replaced with sterile water in the control solution.
  • the reactions contained 1 x CFLP buffer (10 mM MOPS pH 7.5, 0.05% Tween 20, 0.05% Nonidet P-40) and 0.2 mM MnCl 2 .
  • the temperature was held at 50°C to allow partial digestion of the single-stranded DNA.
  • An aliquot (10 ⁇ l) was stopped after 5 min with 8 ⁇ l stop solution (95% formamide, 10 mM EDTA pH 8.0, 0.05% xylene cyanol, 0.05% bromophenol blue). The remaining aliquot was stopped after 15 min reaction.
  • the digested products were resolved on a (50 cm) 9% denaturing polyacrylamide gel (19:1 acrylamide :bisacrylamide, 7M urea, 1 x TBE pH 8.3) at 50W for 1.5 h. Cleavage products were visualised using autoradiography (Figure 10).
  • Human genomic DNA was prepared using standard procedures. To obtain PCR product and substrate for exonucleolytic activity by Taq polymerase, 25 ⁇ l reactions were set up with 50 ng of genomic DNA, 500 nM each primer, 0.2 mM each dATP, dCTP, dGTP and dTTP, 1 x Taqman buffer (Perkin Elmer), 1 mM MgCl 2 , 25 nM Fam probe, 37.5 nM Tet probe, and 0.5 ⁇ g wild-type or mutant Taq polymerase. For reactions with Life Technologies recombinant Taq polymerase, 20 ng genomic DNA, 100 nM each primer, 3.5 mM MgCl 2 , and 0.1 units Taq polymerase were used.
  • the forward PCR primer was TTGAGGGTGTGGGTCTCTACCT and the reverse was AGG AGCCTGAACCCTGCATAC.
  • the Taqman probe for Allele 1 (Fam label) was TTCTCTGCCTCGGGAGCTCTCTGT and for Allele 2 (Tet label) was TTCTCTGCCTCAGGAGCTCTCTGTCA.
  • thernocycling conditions were; 2 min at 95°C; followed by 95°C for 15 sec, 59°C for 1 min, 72°C for 30 sec (39 cycles); and 5 min at 72°C. Allele discrimination was assessed using an ABI Prism 7200 Sequence Detector (Figure 12). PCR products were visualised by electrophoresis using a 2% agarose gel with ethidium bromide staining ( Figure 11).
  • Figure 2 illustrates the loss of exonuclease activity of the T5 D15 K83R mutant compared to the wild-type as demonstrated by SDS-PAGE substrate gel analyses. After staining with ethidium bromide, exonuclease activity was visualised as a shadow against a fluorescent background when viewed on a UV transilluminator, this was true only for the wild-type enzyme ( Figure 2b). The loss of exonuclease activity was further demonstrated by the exonuclease (nuclease activity) assay ( Figure 3). The purified protein carrying the K83R mutation was found to be almost inactive; it retained less than 5% of the activity of the wild-type enzyme.
  • the wild- type and K83R enzymes were assayed for their ability to cleave a pseudo-Y structure substrate ( Figure 5).
  • the pattern of cleavage observed for the wild-type enzyme demonstrated both endonucleolytic and exonucleolytic activity; exonucleolytic cleavage of the single-stranded portion of the substrate releasing 3-mers and 5-mers, and endonucleolytic cleavage of the hinge region of the substrate, releasing oligonucleotides 19 and 21 nucleotides long.
  • the K83R mutant showed very little evidence of exonucleolytic cleavage.
  • the modified T5 D15 exonuclease retained less than 4% exonucleolytic activity of that of the wild-type enzyme as estimated using Molecular Imager software.
  • the percentage of exonucleolytic activity, as determined by production of 3-mer nucleotides, was approximately 36%) and 0.6% after 5 min incubation of substrate with 0.6 nM wild-type and K83R, respectively. Further incubation did not yield greater activity; percentage of exonucleolytic activity was approximately 41% and 1.4% after 30 min incubation of substrate with 0.6 nM wild-type and K83R, respectively.
  • the T5 D15 K83R mutant retained endonuclease activity close or similar to that of the wild-type enzyme (19 and 21 mers products) ( Figure 5).
  • the T5 D15 K83R enzyme can be used to discriminate between genotypes
  • the gel was incubated in three changes of 100 ml refolding buffer (50 mM Tris.HCl pH 8, 2.5 mM MgCl 2 , 1 mM DTT) for 1 hr each at 50 °C.
  • the gel was then stained with 100 ml ethidum bromide (2 ⁇ g/ml) for 30 min in 10 mM Tris.HCl pH8, 1 mM EDTA (TE) at room temperature.
  • the gel was destained overnight in 200 ml TE and photographed under short wave UV transillumination (Panel B) and subsequently stained with Coomassie blue (Panel A).
  • Panel B shows that the wild type possesses detectable exonuclease activity while the K82R mutants lack exonuclease activity in this assay.
  • the wild type and K82R Taq polymerases retain the ability to digest a flap structure in an endonucleolytic manner as expected. As with the T5 K83R enzyme, the Taq K82R lacks exonucleolytic activity as expected ( Figure 9).
  • the wild-type protein shows exonucleolytically derived products (small oligomers ⁇ 10 nucleotides in length are absent) in addition to the major endonucleolytically derived 21 and 19 mer products.
  • Wild-type and K82R Taq polymerases were incubated with allele 1.1 PCR product internally labelled as described above and their cleavage patterns are shown in Figure 10. It can be seen that the wild-type Taq polymerase produces extensive cleavage with many bands visible. However, the pattern obtained with the K82R protein is deconvoluted in comparison.
  • the mutant Taq polymerases allowed successful genotyping of the ILl-beta -511 polymorphism.
  • PCR products (135 bps) were obtained ( Figure 11).
  • Lanes 1 & 5 show the no-template control reactions.
  • Lanes 2 to 4 show amplification of the PCR product using wild-type Taq polymerase with template from 1.1, 2.2 and 1.2 genotype individuals, respectively.
  • Lanes 6 to 8 show amplification of the PCR product using K82R Taq polymerase with template from 1.1, 2.2 and 1.2 genotype individuals, respectively.
  • the Taqman assay was performed in triplicate and the results of unoptimised assays are shown (Figure 12) for each enzyme.
  • lysine 83 to arginine mutation (K83R) of T5 exonuclease and the equivalent mutation in Taq polymerase (lysine 82 to arginine) binds substrate with close to wild-type affinity and retains the structure-specific endonuclease activity which is characteristic of the 5' nuclease family. Furthermore, the rate of endonucleolytic digestion remains high compared with wild type enzymes.
  • the engineered T5 D15 exonuclease enzyme has a number of advantages over existing 5' nucleases; since it has no significant 5 '-3' exonuclease activity there is no possibility of exonucleolytic degradation of either target or probe; the reaction products are deconvoluted, since released single-stranded tails are not subject to further degradation; this enzyme can be used at lower temperatures but with high reaction rates compared with the thermophilic Cleavase protein.
  • the engineered Taq polymerase mutant retains the ability to perform the polymerase chain reaction and retains substantial endonuclease activity. Due to the thermophilic nature of the enzyme, it can be used at elevated temperatures and as such is useful in the Taqman and CFLP assays and will offer an alternative to native Taq polymerase.
  • the thermophilic, exonuclease-free Taq K82R enzyme will complement the use of wild-type Taq polymerase in CFLP analysis as the mutant enzyme produces fewer cleavage fragments offering simplified analysis of the CFLP products. This will also allow the development of more robust protocols as more of the starting material can be converted to reaction products as they are less likely to be over-digested than is the case when using wild-type polymerase.
  • the lack of exonuclease activity will also reduce the degradation of components of polymerase chain reactions viz the primers and template and may lead to the production of cleaner PCR products.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Analytical Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Enzymes And Modification Thereof (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention relates to exonuclease variants characterised in that said variants lack detectable 5'→3' exonuclease activity but retain endonuclease activity. The invention also relates to vectors encoding the variant exonucleases; the recombinant production of same; and use of the variants in genotyping assays.

Description

NUCLEAR VARIANT AND THEIR USE IN GENOTYPING ASSAYS
The invention relates to exonuclease variants characterised in that they lack detectable 5'→3' exonuclease activity but retain endonuclease activity; vectors encoding said variant exonucleases; and production of said variant exonucleases.
DNA metabolism involves a number of distinct enzyme activities involved in a variety of processes related to the synthesis, degradation and function of DNA. For example, and not by way of limitation, DNA replication; DNA recombination and repair; regulation of gene expression; stabilisation of chromosomes; and the segregation of chromosomes during mitosis and/or meiosis. A vast array of enzyme activities are involved in regulating these processes.
Many DNA polymerases, apart from their DNA synthesising properties, have exonuclease acitivities. These activities digest DNA either in a 3'-»5' direction or in a 5'— >3' direction. For example, and not by way of limitation, the 5'→3' exonuclease domain of E. coli DNA polymerase I (ECPolI) has major roles in replication, DNA repair and recombination, including processing the Okazaki fragments formed on the lagging strand during DNA synthesis. Similar enzyme activity must exist in all cells, if only to process Okazaki fragments.
In addition, a number of 5'— >3' exonuclease enzymes have been identified which are not DNA polymerases but separate enzymes. Genes encoding many prokaryotic 5'-»3' exonucleases have been identified and they show a number of highly similar sequence elements between each other and with respect to DNA polymerases. This implies a conserved biochemical mechanism of action, please see Table 1. Recently, a number of eukaryotic 5'- 3' exonucleases have been purified and their sequences were shown to be similar to their prokaryotic counterparts ( Leiber et al (1997) Bioessays 19, 233-40 ). Moreover, given the conservation in structural features of these enzymes it is not suprising that mutations in genes encoding 5'-»3' exonucleases have deleterious effects on cells carrying these mutations.
This large family of enzymes possess 5'- 3' exonuclease activity on duplex DNA with a free 5'-terminus, such as blunt-ended duplexes and on oligonucleotides annealed to a complimentary template. In addition, circular duplex DNA molecules containing a nick are also substrates for exonuclease activity and are converted to partially gapped or fully singled-stranded circular products.
In addition to the 5'— >3' exonuclease activity, many of these enzymes also display structure-specific endonuclease activity. Bifurcated structures are cleaved at or close to the site of branching by the structured-specific endonuclease component of the 5'- 3' exonuclease, please see Figure 1. Examples of 5'— »3' exonucleases containing endonuclease activity, include, amongst others, T7 gene 6 exonuclease, and the DNA Pol I enzymes from Escherichia coli and Thermus aquaticus which show structure specific DNA binding and endonucleolytic cleavage of certain substrates. Moreover, the phage exonuclease T5 D15 exonuclease is an example of a single stranded endonuclease which can also process circular DNA molecules.
All of the above described exonuclease and endonuclease activities have been exploited to provide sensitive DNA genotyping assays referred to as Cleavasetm and Taqmantm .
The Cleavasetm assay exploits both the exonuclease and endonuclease activities of Thermus aquaticus DNA polymerase I. The Cleavasetm assay is a means to rapidly identify known and unknown mutations at specific gene loci.
Briefly, target DNA molecules are heat denatured to separate double stranded
DNA and prevent formation of any higher order structures. The strands are rapidly cooled to prevent reannealing of complementary strands. Once cooled, secondary structures form in the separated DNA strands which are dependant on the primary DNA sequence. Typically, these are stem-loop structures which are substrates for the exonuclease and endonuclease activities of T. aquaticus DNA polymerase I. Single base changes in the primary DNA sequence can alter the secondary structures formed after separation and cooling. These altered secondary structures are also substrates for endonuclease digestion resulting in differential patterns of labelled DNA fragments when the assay products are separated and compared to the wild-type or control DNA.
Upon termination of the nuclease reaction the digestion products are separated by conventional denaturing polyacrylamide gel electrophoresis. The strands are labelled by conventional means prior to digestion (eg radio-isotopic, fluorescence) and visualised by autoradiography to produce a "bar code" typical of a specific DNA. Variations in the pattern of DNA fragments between wild-type and test DNA reveals a polymorphism typical of a mutation within the test DNA. The Cleavasetm assay is described in US 5,719,028.
An alternative genotyping assay is described by the so called "Taqmantm" assay. This PCR based assay exploits the endonuclease activity of thermostable DNA polymerase and a single fluorescently labelled oligonucleotide which has been modified by the provision of two fluorescent tags, one positioned at the 5' terminus of the oligonucleotide, the other at the 3' terminus. The tagged oligonucleotide ("reporter") is designed to anneal to a site in a gene potentially containing a mutation of interest. The annealed reporter is flanked by two additional oligonucleotides designed to anneal up-stream and down-stream of the reporter.
If the test DNA lacks the mutation of interest, the tagged oligonucleotide anneals entirely with the target sequence leaving no free 5' end or region of non- complementarity between the target and reporter. The polymerase used in the PCR reaction polymerises between the two flanking oligonucleotides incorporating the reporter into the PCR product. To detect the incorporation of the reporter into the PCR product the PCR reaction is exposed to UV excitation which results in fluorescent resonance energy transfer (FRET) between the 5' and 3' fluorophores on the reporter. If there is mis-matching between the reporter and the target DNA the endonuclease activity removes the 5' terminus of the reporter thus removing the 5' fluorophore. This results in an unstable hybrid between the reporter and target DNA and failure to incorporate the reporter into the amplified PCR product. Upon excitation with UV there is no detectable signal which is indicative of the presence of a mutation in the DNA. The Taqman1"1 assay provides a rapid mass screening method for the identification of mutations. There are some 4000 genetic disorders which afflict mankind or predispose him to disease. Clearly means to rapidly and accurately identify genetic polymorphisms is highly desirable since this will allow clinicians to diagnose a particular disease and offer either therapy or prophylactic treatment.
In each of the above assays the 5'-»3' exonuclease used contains both exonuclease and endonuclease activities. The endonuclease activity is relatively easy to control since there are a finite number of secondary structures that can form with a primary DNA sequence under a set of defined, controllable conditions. However exonuclease activity is processive and in the presence of a free 5' end the exonuclease will digest the substrate to completion if the assay is not terminated. Therefore a problem associated with prior art genotyping assays is that the control of the assay to provide a reliable, reproducible result is primarily by control of asssay conditions. We have provided a solution to this problem by providing a modified exonuclease which advantageously lacks detectable exonuclease activity but retains endonuclease activity and a wild-type binding constant for its DNA substrate.
According to a first aspect of the invention there is provided an exonuclease polypeptide, or functional fragment thereof, wherein said polypeptide contains at least one modification such that said polypeptide substantially lacks exonuclease activity but substantially retains endonuclease activity.
In a preferred embodiment of the invention said exonuclease activity is in a 5'->3' direction.
In a preferred embodiment of the invention said exonuclease polypeptide, or said fragment thereof, is modified by addition, deletion, substitution, or inversion, of at least one part of said exonuclease polypeptide such that exonuclease activity is substantially reduced but endonuclease activity is substantially retained. Ideally said modified exonuclease polypeptide retains wild- type endonuclease activity and lacks detectable exonuclease activity. More ideally still said modified exonuclease has a wild-type binding constant for its nucleic acid substrate.
The invention includes polypeptides in which the modification comprises the addition, deletion, or substitution of at least one amino acid residue or modified amino acid residue.
In yet still a further preferred embodiment of the invention said modification is substitution of amino acid 83 of the sequences presented in Table 1, or substitution of a homologous amino acid in another, ideally, related exonuclease.
In yet still a further preferred embodiment of the invention said modification is the replacement of lysine 83 with an arginine amino acid residue.
In yet still a further preferred embodiment of the invention said modification is the replacement of lysine 83 with a modified amino acid residue.
It will be apparent to one skilled in the art that modified or synthetic amino acids include, and not by way of limitation, 4-hydroxyproline, 5-hydroxylysine, N6 - acetyllysine, N6-methyHysine, N6,N6-dimethyllysine, N6,N6,N6- trimethyllysine, cyclohexyalanine, D-amino acids, ornithine. The incorporation of modified amino acids may confer advantageous properties on 5'— 3' exonuclease according to the invention. For example, the incorporation of modified amino acids can increase the affinity of the enzyme for its binding site or can confer increased stability on the enzyme thus allowing a decrease in the effective amount used.
In yet still a further preferred embodiment of the invention said modified exonuclease is derived from DNA polymerase I. Ideally said modified exonuclease is derived from a bacterial DNA polymerase I. More ideally still said bacterial species is selected from; E.coli; Dienococcus radiodurans; Mycobacterium tuberculosis; Neisseria meningitdis; Mycoplasma spp.; Haemophilus spp.; Heliobacter spp.
Ideally said bacterial species is a thermophilic bacterial species. More ideally still said thermophilic bacterial species is selected from; Thermus aquaticus; Thermus thermophilus; Thermosipho africanus; Thermotosa maritima. Alternatively said exonuclease is 5 '-3 'exonuclease of Aquifex aeolicus.
DNA polymerase I homologues ( mesophilic or thermophilic bacterial species) with at least 25 % homology to the first 250 amino acids of E.coli DNA polymerase I are the preferred DNA polymerase enzymes.
In yet still a further preferred embodiment of the invention said exonuclease is phage exonuclease. More ideally still said phage exonuclease is 5 '-3 'exonuclease of T3 phage; T4 phage; T5 phage; T7 phage; BF23 phage.
Modified exonucleases are known in the art. For example, US 5,716,819 describes a modified T5 DNA polymerase I with reduced 3'- 5' exonuclease activity. US
5547859 describes a family of B DNA polymerases which lack detectable 3'- 5' exonuclease activity. WO9206200 and US5885813 describes modified thermostable DNA polymerases with reduced 5 '-3' exonuclease activity for use in DNA sequencing and PCR. US 5882904 describes DNA polymerase mutants of the Thermococcus barossii with reduced 3 '-5' exonuclease activity and an increased ability to incorporate ribonucleotides and dideoxynucleotides. It was not reported that any of the afore referred to modifications had any effect on the endonuclease activity.
According to a second aspect of the invention there is provided DNA molecule encoding a polypeptide, or an effective fragment thereof, according to any preceding aspect or embodiment of the invention.
In a preferred embodiment of the invention said DNA molecule is cDNA.
In yet a further preferred embodiment of the invention said DNA molecule is genomic DNA.
In yet still a further preferred embodiment of the invention said DNA molecule is synthetically derived.
Reference herein to the term synthetic comprises reference to an oligonucleotide manufactured using DNA oligo-synthesising technology.
The invention includes such DNA molecules which are modified by addition, deletion, substitution, or inversion of at least one nucleic acid-base pair.
It will be apparent to one skilled in the art that conventional genetic engineering techniques may be undertaken to produce said modification. For example, and not by way of limitation, any of the following techniques may be used: restriction digestion may be undertaken using selected restriction enzymes; and/or polymerised chain- reaction methods may be undertaken to amplify selected regions of DNA molecules encoding said exonuclease polypeptides; or incorporation of point-mutations may be undertaken using both PCR methodology and/or conventional methods to introduce point -mutations and/or small deletions.
According to a further aspect of the invention there is provided a vector containing a DNA molecule encoding a modified exonuclease of the invention.
In a preferred embodiment of the invention said vector is provided with means to recombinantly manufacture the modified exonuclease of the invention.
It will be apparent to one skilled in the art that said vector will be provided with promoter sequences that facilitate the constitutive and/or regulated expression of the DNA sequence encoding said exonuclease. Further, said promoter sequences will be selected such that expression in eukaryotic and/or prokaryotic cells is facilitated. In addition, said vector is provided with polyadenylation signals and/or termination signals that optimise expression of said vector in either a eukaryotic cell and/or prokaryotic cell.
Advantageously, the above described vectors are provided with necessary selectable markers that will facilitate their selection in a eukaryotic or prokaryotic cell(s).
In a further aspect of the invention there is provided a cell or cell-line transformed or transfected with the vector according to the invention.
In yet a further aspect of the invention there is provided a method to recombinantly manufacture modified exonuclease polypeptides according to the invention comprising: i) growing said cell or cell-line transformed or transfected with the vector according to the invention in conditions conducive to the manufacture of said polypeptide; and ii) purifying said polypeptide from said cell, or its growth environment, by conventional means.
In a preferred method of the invention said vector encodes, and thus said recombinant polypeptide is provided with, a secretion signal or affinity tag to facilitate purification of said polypeptide.
According to a yet further aspect of the invention there is provided an assay for comparing a nucleic acid with a comparison sequence comprising:
i) providing a sample of nucleic acid to be assayed; ii) providing conditions for the denaturation of the nucleic acid; iii) incubating the denatured nucleic acid sample with an exonuclease according to the invention; and iv) analysing the products of the exonuclease activity of (iii) above.
According to a further aspect of the invention there is provided an assay for comparing a nucleic acid with a comparison nucleic acid sequence comprising: i) providing a sample of nucleic acid to be assayed; ii) providing conditions for the denaturation of the nucleic acid; iii) incubating the denatured nucleic acid with at least two probes, one of which is labelled, both of which are adapted to bind to different parts of the nucleic acid; iv) incubating the complex of nucleic acid and probes with the exonuclease according to the invention; and v) analysing the products of the activity of the exonuclease of (iv) above.
According to a further aspect of the invention there is provided a method for the detection of sequence variation in nucleic acid target substrates comprising: i) providing an enzymatic cleavage means according to the invention; ii) providing a nucleic acid target substrate suspected of containing sequence variation relative to a reference control; iii) mixing said cleavage means and said substrate under conditions such that said substrate forms one or more secondary structures and said cleavage means cleaves said secondary structures resulting in the generation of multiple cleavage products; and iv) separating said multiple cleavage products so as to detect said sequence variation.
According to a yet further aspect of the invention there is provided a method for performing combined polymerase chain reaction (PCR) amplification and hybridisation probing comprising the steps of: i) contacting a target nucleic acid with PCR reagents , including at least two
PCR primers and an exonuclease according to the invention, and an oligonucleotide probe comprising: a) an oligonucleotide capable of hybridising to a target nucleic acid; b) a fluorescer molecule attached to the first end of the oligonucleotide; c) a quencher molecule attached to a second end of the oligonucleotide such that the quencher molecule substantially quenches the fluorescer molecule whenever the oligonucleotide probe is in a single-stranded state and such that the fluorescer is substantially unquenched whenever the oligonucleotide probe is hybridised to the target nucleic acid; d) a 5' end which is rendered impervious to digestion by the exonuclease according to the invention; and e) a 3' end which is rendered impervious to digestion by the exonuclease according to the invention; and ii) subjecting the target nucleic acid, the oligonucleotide probe, and the PCR reagents to thermal cycling, including a polymerisation step, the thermal cycling being sufficient to amplify the target nucleic acid specified by the PCR reagents. According to a yet further aspect of the invention there is provided a kit comprising: the exonuclease according to the invention; deoxynucleotide triphosphates; buffers; standard DNA (undigested); standard DNA(digested); oligonucleotide primers; cofactors.
An embodiment of the invention will now be described, by way of example only, and with reference to the following table and figures;
Table 1 is a multiple sequence alignment showing representatives of prokaryotic 5' nuclease family. The N-termini of Pol-I homologues ( _POL) and discrete exonuclease ( _ EXO) are aligned to show conserved residues ( AA, A.aeolicus; EC, E.coli; DR, D. radiodurans; TA, T. aquaticus; MT, M. tuberculosis; BS, B. subtilis.; MP, M.pneumoniae). Perfectly conserved residues are shown in the consensus line ( Consen), a* indicates conserved character, lower case residues are somewhat conserved. The underlined lysine residue corresponds to lysine 83 in T5 exonuclease;
Figure 1 represents a diagrammatic representation of some of the 5'-»3' exonuclease and endonuclease nucleic acid substrates;
Figure 2a represents a SDS- PAGE DNA gel of recombinant wild-type and modified T5 D15 exonuclease; Figure 2b is a PAGE DNA gel showing exonuclease activity of renatured T5 D15 exonuclease; Lane 1 : protein standards, molecular weight in kDa as marked to the left of the gel. Lane 2: purified wild-type T5 D15 exonuclease. Lanes 3 to 6: unpurified modified (K83R) T5 D15 exonuclease. Lanes 3 and 4: Uninduced modified T5 D15 exonuclease. Lanes 5 and 6: Induced modified T5 D15 exonuclease;
Figure 3 represents a graphical comparison of the 5'- 3' exonclease activity of wild
-type and modified T5 D15 exonuclease; exonucleolytic digestion of high molecular weight DNA was assayed spectrophotometrically. Results of at least 3 separate assays were plotted; second order polynomial non-linear regression analyses was performed on the data. The r values (goodness to fit) was 0.99 for both wild-type and K83R. Initial velocities for each reaction was determined. The specific activities calculated were 23.9 and 1.1 units for wild-type and K83R, respectively. 1 unit is 1 nmol of released nucleotides per min per μg of protein in the standard spectrophotometric assay at 37°C;
Figure 4 represents substrate binding by the modified T5 D15 exonuclease. (A) Pseudo-Y substrate was incubated with the enzyme on ice, and the enzyme-substrate complex was separated from the unbound substrate by electrophoresis on a nondenaturing acrylamide gel. The substrate concentration was constant, the enzyme concentration was varied as shown. (B) Data from the gel retardation (EMSA) experiments were plotted as percentage of free substrate against the enzyme concentration. Results shown are from three separate experiments. The enzyme concentration required to bind half the substrate was determined graphically. The dissociation constant for K83R was 28 nM; and
Figure 5 represents degradation of pseudo-Y substrate by wild-type and modified T5 D15 exonuclease. Enzymes were incubated with the substrate at 37°C for 5 and 30 min in the presence of 10 mM MgCl2, and reaction products were separated by denaturing PAGE. A control reaction lacking enzyme was incubated for 30 min;
Figure 6 represents degradation of PCR products by T5 K83R exonuclease. The enzyme (300 nM) was incubated with PCR products from homozygous 1.1 (lanes 1 & 2), 2.2 (lanes 5 &6) and heterozygous 1.2 (lanes 3 & 4) individuals. Reactions were performed at 37°C in the presence of 0.2 mM MnCl2 and reaction products were separated by denaturing PAGE. Lanes 1, 3 & 5 show cleavage after 5 mins and lanes 2, 4, & 6 show cleavage after 15 mins; Figure 7 represents a SDS-PAGE DNA gel of recombinant wild-type and K82R Taq polymerase. Lanes 1 & 2 show Taq K82R, and lane 3 shows wild-type Taq polymerase. Panel B shows exonuclease activity of renatured Taq polymerase. Panel A shows the gel subsequently stained with Coomassie blue;
Figure 8 represents degradation of single-stranded substrate by wild-type and K82R Taq polymerase. Enzymes (600 nM) were incubated with the substrate at 55°C for 5 min, 30 min and 4 hours in the presence of 1 mM MnCl2, and reaction products were separated by denaturing PAGE. A control reaction lacking enzyme was incubated for the same time period. The filled triangles represent increasing time as indicated above;
Figure 9 represents degradation of pseudo-Y substrate by wild-type and K82R Taq polymerase. Enzymes (600 nM) were incubated with the substrate at 55°C for 5 min, 30 min and 4 hours in the presence of 1 mM MnCl2, and reaction products were separated by denaturing PAGE. A control reaction lacking enzyme was incubated for the same time period. The filled triangles represent increasing time as indicated above;
Figure 10 represents degradation of PCR products by T5 K83R exonuclease. The enzyme was incubated with allele 1.1 PCR product at 50°C in the presence of 0.2 mM MnCl2 and reaction products were separated by denaturing PAGE;
Figure 11 represents PCR products (135 bps) obtained after reaction with wild-type Taq (lanes 5-8) and Taq K82R (lanes 1-4). Lanes 1 & 5 show the no template control, lanes 2 & 6 show allele 1.1 PCR product, lanes 3 & 7 show allele 2.2 PCR product, and lanes 4 & 8 show allele 1.2 PCR product; and
Figure 12 represent allelic discrimination in Taqman assays using wild-type and mutant Taq polymerase. Materials and Methods
Mutagenesis of conserved lysine 83 residue in bacteriophage T5 5'->'3 exonuclease
Site-directed mutagenesis of T5 D15 exonuclease
Oligonucleotide site-directed mutagenesis was carried out on a single-stranded Ml 3 derivative carrying the cloned T5 D15 exonuclease gene (1). The phosphorothioate- based high efficiency mutagenesis procedure (2) was used to alter the Lys83 codon, resulting in a substitution of Lys to Arg. This was achieved using the primer: 5 ' -d(C ATCACGATTACCGCGATACTCTGGTAG); ( the anticodon change is shown underlined).
Dideoxy sequencing was used to determine that only the desired sequence changes had been introduced (3).
Site-directed mutagenesis of Taq Polymerase
Mutagenesis of the Taq polymerase gene was carried out by published methods using a derivative of plasmid pTTQ18 carrying a Taq polymerase gene (12) designated pTaql . First, an EcoRI-BamHI fragment was excised from this plasmid and cloned into the EcoRI/BamHI sites of phagemid pT7T3αl 8 (Genbank accession no. L08953). Oligonucleotide site-directed mutagenesis (13) was carried out on a single-stranded phagemid derived from this recombinant. Codon 82 (encoding lysine) was replaced with an arginine codon using primer Taq82R 5'-d(GAGGCCTACG GGGGGTACCG GGCGGGCCGG GCCCCCA). Mutated clones were identified by dideoxy sequencing and the mutant EcoRI-BamHI fragments were used to replace the wild-type sequence in the corresponding region of the pTaql generating pTaq82R. Plasmids were transformed into strain XLl-Blue (Stratagene).
Protein expression and purification of T5 D15 exonuclease & modified Taq polymersase
i T5 D15
The mutated gene was subcloned into the expression vector pJONEX4 as described for the wild-type exonuclease gene (1, 4) and designated K83R. The wild-type and mutant protein were purified as described (1), except that an initial urea solubilisation stage was included for the mutant protein, as it was found insoluble on overexpression. Protein concentration was determined using the Bradford assay (5).
ipModified Taq Polymerase
Two independent clones of the mutation were used for characterisation purposes. These clones were designated pTaq82R-6 and pTaq82R-8. Recombinant Proteins were expressed and purified from pTaql and its derivatives essentially as described originally (12). Proteins were dialysed against buffer A (25 mM potassium phosphate buffer [pH 6.5] containing 1 mM EDTA, 1 mM DTT, 10% glycerol and 25 μg/ml phenylmethylsulphonylflouride) and purified by linear salt gradient (NaCl in buffer A) on heparin ion exchange columns. The proteins eluted between 500 and 600 mM NaCl. Fractions containing purified enzyme (as judged by analytical SDS-PAGE) were pooled, concentrated by ultrafiltration and stored in 50% glycerol (buffer A) at -20 °C.
SDS-PAGE substrate gel
A discontinuous SDS-PAGE gel containing 20μg/ml Type XIV DNA from herring testes in the resolving gel was prepared as described (6). The separated proteins were separated on this gel, the protein renatured in situ and MgCl2 added to a concentration of 10 mM (for T5 enzymes) or 2 mM for ( for Taq polymerase enzymes). After staining with ethidium bromide, exonuclease activity was visualised as a shadow against a fluorescent background when viewed on a UV transilluminator. The gel was then Coomassie stained.
Nuclease activity assays
The release of acid-soluble nucleotides from high molecular weight DNA (herring sperm Type XIV) was determined with a standard UV spectrophotometric assay (1), except that the assay contained DNA at 670 μg/ml in 600 μl 25 mM potassium glycinate, pH 9.3, 10 mM MgCl2 and l μg protein. Curves were plotted from the data obtained and estimates of the initial velocity were calculated.
Oligonucleotide purification and labelling
Pseudo-Y substrate was prepared by annealing 5'-32P-end labeled FLAP oligonucleotide:
d(GATGTCAAGCAGTCCTAACTTTGAGGCAGAGTCC) with BRIDGE oligonucleotide d(GGACTCTGCCTCAAGACGGTAGTCAACGTG)
essentially as described (7, 8). The FLAP oligonucleotide was end-labeled with [32P]ATP under standard conditions and purified from a 7M urea- 15% acrylamide gel essentially as described (9).
Electrophoretic Mobility-Shift Assay (EMSA1
Pseudo-Y substrates were diluted to contain 4.5 nM BRIDGE oligonucleotide, 150 pM 32P-labeled FLAP oligonucleotide in 25 mM potassium glycinate, pH 9.3, 100 mM KCl, 1 mM EDTA, 5% glycerol, 1 mM DTT, 0.1 mg/ml acetylated BSA and modified T5 exonuclease at the concentration stated. The enzyme was diluted in 25 mM potassium glycinate, pH 9.3, 1 mM EDTA, 50% glycerol, 1 mM DTT, and 0.1 mg/ml acetylated BSA. The enzyme and pseudo-Y substrate, in a final reaction volume of lOμl, were incubated on ice for 10 min and analysed on a 17% native polyacrylamide gel, buffered in 100 mM Tris-Bicine, pH 8.3, 2 mM EDTA, 1 mM DTT at 4°C for 2 h at 15 V/cm. The gel was visualised and results quantified with a Molecular Imager (BioRad) and Molecular Dynamics software.
Structure-specific DNA cleavage
Structure specific cleavage of pseudo-Y and single-stranded DNA substrates by wild- type and mutant Taq polymerase (final concentration 600nM) were examined essentially as described for T5 exonuclease (8) except the substrates were diluted in 10 mM Tris-HCl pH 8.0, 50 mM KCl, 0.5 mg/ml acetylated BSA, 1 mM MnCl2 and incubated for various times. The enzyme was diluted in 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 10 % glycerol, 1 mM DTT and 1 mg/ml acetylated BSA. A final concentration of EDTA of 0.2 mM was used. Reactions were performed at 55°C. Results are shown in Figures 8 and 9.
Use of T5 exonuclease K83R in genotyping assay for IL-lβ -511 polymorphism
Human genomic DNA was prepared using standard procedures. To obtain PCR product and substrate for nuclease activity by Taq polymerase, a standard PCR reaction was prepared containing 20 mM Tris-HCl pH 8.5, 50 mM KCl, 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 mM MgCl2, 1 μM each primer, 2.5 units Taq polymerase, with 500 ng template DNA, in a final volume of 100 μl. Also included in the reaction were 0.4 mM each of dATP, dGTP, dTTP, 0.1 mM dCTP and 3.3 pmol 32P- -dCTP (specific activity 10 μCi). The forward primer was TGGCATTGATCTGGTTCA and the reverse primer was GTTTAGGAATCTTCCCACTT. For the PCR, the thermocycling conditions were; 5 min at 95°C; followed by 95°C for 1 min, 53°C for 1 min, 72°C for 1 min (35 cycles); and 5 min at 72°C. The PCR products were purified using the Promega DNA clean-up kit after electrophoresis using a 1% agarose gel. The purified PCR products were eluted in 100 μl sterile water. The resultant PCR products from three donors (two homozygous for the two common alleles, i.e. 1.1 and 2.2 and one heterozygous individual, 1.2) containing the polymorphic -511 site (14), were treated with T5 K83R enzyme (300 nM end concentration) as follows; an aliquot of PCR product was made up to a final volume of 13 μl with water and heated to 95°C for 30 sec, using a programmable thermocycler, to denature the double-stranded DNA. Immediately after denaturation, the DNA was cooled to 37°C. Enzyme (T5 K83R) or sterile water in the control solution was added. The reactions contained 25 mM potassium glycinate pH 9.3, 0.5 mg/ml acetylated BSA, 0.2 mM MnCl2 and were incubated at 37°C. An aliquot (10 μl) was stopped after 5 min with 8 μl stop solution (95% formamide, 10 mM EDTA pH 8.0, 0.05% xylene cyanol, 0.05% bromophenol blue). The remaining aliquot was stopped after 15 min reaction. The digested products were resolved on a (50 cm) 9% denaturing polyacrylamide gel (19:1 acrylamide :bisacrylamide, 7M urea, 1 x TBE pH 8.3) at 50W for 1.5 h. Cleavage products were visualised using autoradiography. The results are shown in Figure 6
Cleavage assay for IL-lβ -511 polymorphism
Human genomic DNA was prepared using standard procedures. To obtain PCR product and substrate for nuclease activity by Taq polymerase, a standard PCR reaction was prepared containing 20 mM Tris-HCl pH 8.5, 50 mM KCl, 0.5% Tween 20, 0.5% Nonidet P-40, 2.5 mM MgCl2, 1 μM each primer, 2.5 units Taq polymerase, with 500 ng template DNA, in a final volume of 100 μl. Also included in the reaction were 0.4 mM each of dATP, dGTP, dTTP, 0.1 mM dCTP and 0.5 μl 32P-αdCTP. The forward primer was TGGCATTGATCTGGTTCA and the reverse primer was GTTTAGGAATCTTCCCACTT. For the PCR, the thermocycling conditions were; 5 min at 95°C; followed by 95°C for 1 min, 53 °C for 1 min, 72°C for 1 min (35 cycles); and 5 min at 72°C. The PCR products were purified using the Promega DNA clean-up kit after electrophoresis using a 1% agarose gel. The purified PCR products were eluted in 100 μl sterile water.
The cleavage assay or CFLP assay was performed as described (Third Wave Technologies (15). Briefly, an aliquot of PCR product was made up to a final volume of 13 μl with water and heated to 95°C for 30 sec, using a programmable thermocycler, to denature the double-stranded DNA. Immediately after denaturation, the DNA was cooled to 50°C and 7 μl of Taq polymerase or control solution was added (see protocol provided by Third Wave Technologies, (15). The wild-type and mutant Taq polymerase enzymes were diluted with 1 x CFLP buffer as appropriate. Enzyme was replaced with sterile water in the control solution. The reactions contained 1 x CFLP buffer (10 mM MOPS pH 7.5, 0.05% Tween 20, 0.05% Nonidet P-40) and 0.2 mM MnCl2. The temperature was held at 50°C to allow partial digestion of the single-stranded DNA. An aliquot (10 μl) was stopped after 5 min with 8 μl stop solution (95% formamide, 10 mM EDTA pH 8.0, 0.05% xylene cyanol, 0.05% bromophenol blue). The remaining aliquot was stopped after 15 min reaction. The digested products were resolved on a (50 cm) 9% denaturing polyacrylamide gel (19:1 acrylamide :bisacrylamide, 7M urea, 1 x TBE pH 8.3) at 50W for 1.5 h. Cleavage products were visualised using autoradiography (Figure 10).
Taqman assay for IL-lβ -511 polymorphism
Human genomic DNA was prepared using standard procedures. To obtain PCR product and substrate for exonucleolytic activity by Taq polymerase, 25 μl reactions were set up with 50 ng of genomic DNA, 500 nM each primer, 0.2 mM each dATP, dCTP, dGTP and dTTP, 1 x Taqman buffer (Perkin Elmer), 1 mM MgCl2, 25 nM Fam probe, 37.5 nM Tet probe, and 0.5 μg wild-type or mutant Taq polymerase. For reactions with Life Technologies recombinant Taq polymerase, 20 ng genomic DNA, 100 nM each primer, 3.5 mM MgCl2, and 0.1 units Taq polymerase were used. The forward PCR primer was TTGAGGGTGTGGGTCTCTACCT and the reverse was AGG AGCCTGAACCCTGCATAC. The Taqman probe for Allele 1 (Fam label) was TTCTCTGCCTCGGGAGCTCTCTGT and for Allele 2 (Tet label) was TTCTCTGCCTCAGGAGCTCTCTGTCA. For the PCR, the thernocycling conditions were; 2 min at 95°C; followed by 95°C for 15 sec, 59°C for 1 min, 72°C for 30 sec (39 cycles); and 5 min at 72°C. Allele discrimination was assessed using an ABI Prism 7200 Sequence Detector (Figure 12). PCR products were visualised by electrophoresis using a 2% agarose gel with ethidium bromide staining (Figure 11).
RESULTS
Figure 2 illustrates the loss of exonuclease activity of the T5 D15 K83R mutant compared to the wild-type as demonstrated by SDS-PAGE substrate gel analyses. After staining with ethidium bromide, exonuclease activity was visualised as a shadow against a fluorescent background when viewed on a UV transilluminator, this was true only for the wild-type enzyme (Figure 2b). The loss of exonuclease activity was further demonstrated by the exonuclease (nuclease activity) assay (Figure 3). The purified protein carrying the K83R mutation was found to be almost inactive; it retained less than 5% of the activity of the wild-type enzyme. However, it is worth noting that the exonuclease (nuclease activity) assay will also detect release of short oligomers which remain acid soluble (oligos of up to 10 residues). Thus, this assay tends to over estimate exonuclease activity. Binding of K83R to pseudo-Y substrate was assayed by electrophoretic mobility shift in the absence of divalent metal cofactor (Figure 4). An approximation to the dissociation constant (k d) for the binding reaction was calculated as the protein concentration at which half the substrate remained unbound (10). The dissociation constant of K83R was 28 nM, close to that estimated for the wild-type enzyme (10 nM, data not shown). The wild- type and K83R enzymes were assayed for their ability to cleave a pseudo-Y structure substrate (Figure 5). The pattern of cleavage observed for the wild-type enzyme demonstrated both endonucleolytic and exonucleolytic activity; exonucleolytic cleavage of the single-stranded portion of the substrate releasing 3-mers and 5-mers, and endonucleolytic cleavage of the hinge region of the substrate, releasing oligonucleotides 19 and 21 nucleotides long. The K83R mutant showed very little evidence of exonucleolytic cleavage. The modified T5 D15 exonuclease retained less than 4% exonucleolytic activity of that of the wild-type enzyme as estimated using Molecular Imager software. For example, the percentage of exonucleolytic activity, as determined by production of 3-mer nucleotides, was approximately 36%) and 0.6% after 5 min incubation of substrate with 0.6 nM wild-type and K83R, respectively. Further incubation did not yield greater activity; percentage of exonucleolytic activity was approximately 41% and 1.4% after 30 min incubation of substrate with 0.6 nM wild-type and K83R, respectively. However, the T5 D15 K83R mutant retained endonuclease activity close or similar to that of the wild-type enzyme (19 and 21 mers products) (Figure 5).
The T5 D15 K83R enzyme can be used to discriminate between genotypes
Autoradiography of radiolabelled PCR products separated by denaturing PAGE after treatment with T5 D15 K83R enzyme are shown (Figure 6). Undigested starting material can be seen at the top of the gel. The enlarged section shows clear differences between the homozygous 1.1 (lanes 1 & 2), 2.2 (lanes 5 & 6) and heterozygous individual (lanes 3 & 4) for the IL1 beta -511 polymorphism (15) after 5 mins (even lanes) and 15 mins (odd lane numbers) of incubation.
The results shown in Figure 7 demonstrate that purified Taq polymerase carrying the K82R mutation (analagous to T5 exonuclease K83R) is devoid of detectable exonuclease activity as compared with the wild-type polymerase as expected. Approx. 8 μg each of recombinant Taq polymerases (lane 1 K82R clone 8, lane 2; K82R clone 6, and lane 3; wild type enzyme) were run out on a 10% SDS-PAGE gel. The gel contained 20 μg/ml of herring sperm DNA (Sigma). After electrophoresis the gel was incubated in three changes of 100 ml refolding buffer (50 mM Tris.HCl pH 8, 2.5 mM MgCl2, 1 mM DTT) for 1 hr each at 50 °C. The gel was then stained with 100 ml ethidum bromide (2 μg/ml) for 30 min in 10 mM Tris.HCl pH8, 1 mM EDTA (TE) at room temperature. The gel was destained overnight in 200 ml TE and photographed under short wave UV transillumination (Panel B) and subsequently stained with Coomassie blue (Panel A). Panel B shows that the wild type possesses detectable exonuclease activity while the K82R mutants lack exonuclease activity in this assay.
The results shown in Figure 8 demonstrate that Taq K82R lacks exonuclease activity on single-stranded DNA (the 34 nucleotide FLAP oligomer alone) as expected, while wild-type Taq polymerase retains activity on this substrate. Reaction times were 5, 30 and 240 mins at 55 °C with all enzymes present at 600 nM concentration.
The wild type and K82R Taq polymerases retain the ability to digest a flap structure in an endonucleolytic manner as expected. As with the T5 K83R enzyme, the Taq K82R lacks exonucleolytic activity as expected (Figure 9). The wild-type protein shows exonucleolytically derived products (small oligomers < 10 nucleotides in length are absent) in addition to the major endonucleolytically derived 21 and 19 mer products.
Dissociation constants of Taq polymerase and K82R mutant protein
These were determined for pseudo-Y substrate as described for T5 exonuclease EMSA described above. Wild type Taq polymerase bound this substrate with a Kd of 14 nM compared with 8 nM for the Taq K82R mutant. Comparison of wild -type and mutant Taq polymerases in CFLP
Wild-type and K82R Taq polymerases were incubated with allele 1.1 PCR product internally labelled as described above and their cleavage patterns are shown in Figure 10. It can be seen that the wild-type Taq polymerase produces extensive cleavage with many bands visible. However, the pattern obtained with the K82R protein is deconvoluted in comparison.
Allelic discrimination in Taqman assays using mutant Taq polymerases
The mutant Taq polymerases (K82R) allowed successful genotyping of the ILl-beta -511 polymorphism. PCR products (135 bps) were obtained (Figure 11). Lanes 1 & 5 show the no-template control reactions. Lanes 2 to 4 show amplification of the PCR product using wild-type Taq polymerase with template from 1.1, 2.2 and 1.2 genotype individuals, respectively. Lanes 6 to 8 show amplification of the PCR product using K82R Taq polymerase with template from 1.1, 2.2 and 1.2 genotype individuals, respectively. The Taqman assay was performed in triplicate and the results of unoptimised assays are shown (Figure 12) for each enzyme.
DISCUSSION
We have engineered a mutated 5 ' nuclease which retains high levels of endonuclease activity, but which lacks significant exonuclease activity. The lysine 83 to arginine mutation (K83R) of T5 exonuclease and the equivalent mutation in Taq polymerase (lysine 82 to arginine) binds substrate with close to wild-type affinity and retains the structure-specific endonuclease activity which is characteristic of the 5' nuclease family. Furthermore, the rate of endonucleolytic digestion remains high compared with wild type enzymes. This is in contrast to another reported 5' nuclease mutation (K83A) which lacks exonuclease activity but binds substrate weakly and is a very poor catalyst (reaction rate reduced by over 1000 fold (10). The engineered T5 D15 exonuclease enzyme has a number of advantages over existing 5' nucleases; since it has no significant 5 '-3' exonuclease activity there is no possibility of exonucleolytic degradation of either target or probe; the reaction products are deconvoluted, since released single-stranded tails are not subject to further degradation; this enzyme can be used at lower temperatures but with high reaction rates compared with the thermophilic Cleavase protein. This latter point is important as lower temperature will allow different conformations of nucleic acids to be frozen out compared with reactions run at higher temperature where fewer, or different, secondary structures will be stable. Since the enzyme is mesophilic, reactions can be performed at much lower temperatures with high reaction rates compared with the Cleavase system allowing a wider range of structural conformations to be probed.
The engineered Taq polymerase mutant retains the ability to perform the polymerase chain reaction and retains substantial endonuclease activity. Due to the thermophilic nature of the enzyme, it can be used at elevated temperatures and as such is useful in the Taqman and CFLP assays and will offer an alternative to native Taq polymerase. The thermophilic, exonuclease-free Taq K82R enzyme will complement the use of wild-type Taq polymerase in CFLP analysis as the mutant enzyme produces fewer cleavage fragments offering simplified analysis of the CFLP products. This will also allow the development of more robust protocols as more of the starting material can be converted to reaction products as they are less likely to be over-digested than is the case when using wild-type polymerase. The lack of exonuclease activity will also reduce the degradation of components of polymerase chain reactions viz the primers and template and may lead to the production of cleaner PCR products.
References 1. Sayers, JR. and Eckstein, F. (1990) J. Biol. Chem., 265, 18311-18317. 2. Sayers, JR. and Krekel, C. and Eckstein, F. (1992) Biotechniques, 13, 592-596.
3. Sanger, F. Nicklen, S. and Coulsen, AR. (1977) Proc. Natl. Acad. Sci. USA, 80, 5463-5467.
4. Sayers, JR. and Eckstein, F. (1991) Nucl. Acids. Res., 19, 4127-4132.
5. Bradford, MM. (1976) Anal. Biochem.., 72, 248-254.
6. Rosenthal, AL. and Kacks, SA. (1977) Anal. Biochem., 80, 76-90.
7. Harrington, JJ. and Lieber, MR. (1994) EMBO J., 13, 1235-1246.
8. Garforth, SJ. and Sayers, JR. (1997) Nucl. Acids. Res., 25, 3801-3807.
9. Sambrook, J., Fritsch, EF. and Manniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Edn. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
10. Pickering, TJ, Garforth, SJ, Sayers, JR & Grasby, JA. (1999) J. Biol. Chem. 274:17711-17717.
1 1. Carey, J. (1991) Methods Enzymol., 208, 103-117.
12. Engelke, DR, Krikos, A, Bruck, ME, Ginsburg D. (1900) Purification of Thermus aquaticus DNA-polymerase expressed in Escherichia-coli. Analytical Biochemistry 191 : (2) 396-400. 13. Yuckenberg, PD, Witney, F, Geisselsoder, J and McClary, J. (1991) Site directed in vitro mutagenesis using uracil-containing DNA and phagemid vectors in "Directed mutagenesis; a practical approach" MJ McPherson (ed), IRL Press at Oxford University Press, Oxford.
14. di Giovine, FS., Takhsh, E., Blakemore, AIF., and Duff, GW. (1992) Single base change at -511 in the human interleukin l β-gene (IL1B). Hum. Mol. Genet., 1, 450.
15. Brow, A.A.D., Oldenburg, M., Lyamichev, V., Heisler, L., Grotelueschen, J., Lyamichev, N., Kozyavkin, S., Fors, L., Dahlberg, J., Smith, L., and Olive, D.M. (1996) Mutation Detection by Cleavase Fragment Length Polymorphism Analysis. FOCUS, 18 (1), 2-5.
to A A A to < α cs i-s ι • e • Z H Q Z W Q « « co -s ω
_ϋ (-J -4 s-J wl Kl >d «l »4 -4 • co w • CS IxS OS Oi o « 2 S Z J α 01 X
> x x X x X X X X X > > m to 33 < o s z < cs cs w w x B^a Q s cs CS a B H O Z z z H i>S 2 « « <
Bj o ft w w σ W ft O . e-s z x x x X 6, b, X μ3 σ < «! w i i-i as OS < σ
« M O" CO W Q 2 X
X SB μ3 « O Z 33 X σ o αs os βs os ps os os r- os αs O M iJ (J > o . en -< z . X < « « « t< l» H H f< H tι > B « < m cs s • s
OS o> ft !-5 ft Ot BS « !>5 ft 01 01 ft i-s oi tts i-s cs s-i cs a: < < co cs σ ft
• Q O Q Q Q Q Q D a ft >
«
« « « » A to 61 EH OS Z Q A > < < ω w K « D Q Q J W
J J j z Et to CO s σ > > > > > S S CS W 61 OS 33 K X ES X X Q X W 61 W w cs w σ w
CS S CS S S A W X S σ ω w » os α os t<s
2 S-S W W A ω α >-> w ι4 -3 t-l 2 C5 t<S Z Z K Z l-S S3 ιJ J J S
CS S S CS S CS z H « EU K H CS 01 X « « tn « Eil Z • > X X X X z fc3 En -< BS < σ σ χ H χ
> > 2 K σ O W rt! rt! rt; < <; rt: cS CS ft
< A OS X Z S a z CO 33 < < tLS X ϊ-J K S-i l- H ixS oS *
• OS J J J > <
H > A > CO 01 CO O CS CS CS CS CS CB CS CS CS
' • H 2 A A A S S CS CS Bl
2 ft J Oι Oi M M > M > M > + ω Bi CS > > OS
O 0 U 0 2 D 0 2 -1 2 o Q Q Q α a a
Q Q Q Q a a z < < A A A A A A oi to σ z ω ca u w ω ω ω z B z z K > X Ct, > X cs cs CS CD CS CS X z ft CO < Q OS Q ω > ω CS CS O CS CS CS CS CS ω w a o s cs s S S CS S CS 0] > ft ft ft ! OS A
H H X μl H > < < < < • z z z z z z z z z
Q o α Q D Q O Q Q fc. S3 X fc< 33 6. CO O CO l CS «
X fa, En X υ A n H < < < < w • α CO CO Z μ3 «
Q D Q Q Q
OS PS OS PS OS Pi ια α t-i E-, «4 J ιJ ι4 S CS CS CS S S S
_ X Ix, X X 6, A i-i A A A K >< - W > 2 2 > 2 -H
« ft l-S X 2 0 o σ σ σ σ o σ σ oi cs σ os Q os z ta i-S ϊx w oi z z !-i OS W cs cs o5 cs > «: ft > ι-ι w σ z S S « ft z 01 X αs ft < o os >H ι-ι α α s ft
H S > > > σ A H cs cs s > w >
< α α ω z α ω ω ia w Eϊ w * s*s ω a w ω z Id Q Ki α H Ϊ > S«S > X « 33
> > > Ex, > 2 α σ < Z W Z z
A < W W H 6I M 33
« X ft ft > ft MS Z 33 ft
2 . CS EH CS Z W CO
* O ft CO ft ft rtl i-S Oi K X - X X X EE
• «c t (-j . oι > α cs > • σ
« •
• C3 CS Z Z 33 Z t«S Z Z I ,4 μ3 -3 μ3 μl X 2 2 > o o ω O O o o
J ft ft ft « ft « cα I I I C a I I I I 1 I I I I fi
< I I I I I I OS A EH O oi ft ιn ^ o «: u ft ^« 0 OS -Cj EH -C U Ol ft LO 'W o a ω m 2 EH EH U ω cα 2 u Q EH 2 «C W -a EH H O

Claims

1. An exonuclease polypeptide, or functional fragment thereof, characterised in that it has been modified such that it substantially lacks exonuclease activity but retains endonuclease activity.
2. A polypeptide according to claim 1 wherein said exonuclease activity is in the 5' - 3' direction.
3. A polypeptide according to claim 1 or 2 which is modified by addition, deletion, substitution or inversion of at least one part of said polypeptide.
4. A polypeptide according to claim 3 wherein said modification comprises the addition, deletion, or substitution of an amino acid residue.
5. A polypeptide according to any of claims 1 - 4 wherein said modified polypeptide has its natural binding constant for its nucleic acid substrate.
6. A polypeptide according to any of claims 1 -5 wherein said modification is substitution of lysine 83 of the sequences presented in Table 1, or substitution of the corresponding amino acid in a homologous polypeptide.
7. A polypeptide according to claim 6 wherein the substitution of lysine 83 is with an arginine residue.
8. A polypeptide according to any of claims 5 - 7 wherein said modification comprises the addition or substitution of at least one modified amino acid residue.
9. A polypeptide according to any of claims 1 - 8 which is a modified DNA polymerase I.
10. A polypeptide according to claim 9 which is a modified bacterial DNA polymerase I.
11. A polypeptide according to claim 10 wherein said bacterium is selected from the following bacterial genus/species: Escherichia coli; Dienococcus radiodurans; Mycobacterium tuberculosis; Neisseria meningitdis; Mycoplasma spp.; Haemophilus spp.; Heliobacter spp.
12. A polypeptide according to claim 10 wherein said bacterial DNA polymerase I is from a thermophilic bacterial species.
13. A polypeptide according to claim 12 wherein said thermophilic bacterial species is selected from: Thermus aquaticus; Thermus thermophilus; Thermosipho africanus; Thermotosa maritima; Aquifex aeolicus.
14. A polypeptide according to any of claims 9 - 13 wherein said DNA polymerase I is at least 25% homologous to the first 250 amino acids of E.coli DNA polymerase I.
15. A polypeptide according to any of claims 1 - 8 which is a phage exonuclease.
16. A polypeptide according to claim 15 which is the 5' — >3' exonuclease selected from: T3 phage; T4 phage; T5 phage; T7 phage; DF23 phage.
17. A polypeptide according to claim 16 wherein said phage is T5 phage.
18. A DNA molecule encoding a polypeptide according to any of claims 1 - 17.
19 DNA molecule according to claim 18 wherein said DNA molecule is synthetically made.
20. A DNA molecule according to claim 18 or 19 which is modified by addition, deletion, substitution, or inversion of at least one nucleic acid base pair.
21. A vector including a DNA molecule according to any of claims 18 - 20
22. A vector according to claim 21 which is provided with means to recombinantly manufacture the polypeptide according to claims 1 - 17.
23. A cell-line transformed or transfected with the vector according to claim 21 or 22.
24. A method to manufacture a polypeptide according to any of claims 1 - 17 comprising: i) growing a cell or cell-line according to claim 23 in conditions conducive to the manufacture of the polypeptide according to the invention; and ii) purifying said polypeptide from said cell or its growth environment.
25. A method according to claim 24 wherein said vector encodes, and thus said recombinant polypeptide is provided with, a secretion signal or affinity tag to facilitate purification of said polypeptide.
26. An assay for comparing a nucleic acid with a comparison sequence comprising: i) providing a sample of nucleic acid to be assayed; ii) providing conditions for the denaturation of the nucleic acid; iii) incubating the denatured nucleic acid sample with an exonuclease according to any of claims 1 - 17; and iv) analysing the products of the exonuclease activity of (iii) above.
27. An assay for comparing a nucleic acid with a comparison nucleic acid sequence comprising: i) providing a sample of nucleic acid to be assayed; ii) providing conditions for the denaturation of the nucleic acid; iii) incubating the denatured nucleic acid with at least two probes, one of which is labelled, both of which are adapted to bind to different parts of the nucleic acid; iv) incubating the complex of nucleic acid and probes with the exonuclease according to claims 12 or 13; and v) analysing the products of the activity of the exonuclease of (iv) above.
28. A method for the detection of sequence variation in nucleic acid target substrates comprising: i) providing an exonuclease according to any of claims 1 - 17; ii) providing a nucleic acid target substrate suspected of containing sequence variation relative to a reference control; iii) mixing said cleavage means and said substrate under conditions such that said substrate forms one or more secondary structures and said cleavage means cleaves said secondary structures resulting in the generation of multiple cleavage products; and iv) separating said multiple cleavage products so as to detect said sequence variation.
29. A method for performing combined polymerase chain reaction (PCR) amplification and hybridisation probing comprising the steps of: i) contacting a target nucleic acid with PCR reagents , including at least two
PCR primers and a polymerase enzyme according to claim 12 or 13, and an oligonucleotide probe comprising: a) an oligonucleotide capable of hybridising to a target nucleic acid; b) a fluorescer molecule attached to the first end of the oligonucleotide; c) a quencher molecule attached to a second end of the oligonucleotide such that the quencher molecule substantially quenches the fluorescer molecule whenever the oligonucleotide probe is in a single-stranded state and such that the fluorescer is substantially unquenched whenever the oligonucleotide probe is hybridised to the target nucleic acid; d) a 5' end which is rendered impervious to digestion by the exonuclease according to claim 12 or 13; and e) a 3' end which is rendered impervious to digestion by the exonuclease according to claim 12 or 13; and ii) subjecting the target nucleic acid, the oligonucleotide probe, and the PCR reagents to thermal cycling, including a polymerisation step, the thermal cycling being sufficient to amplify the target nucleic acid specified by the PCR reagents.
30. The use of an exonuclease according to any of claims 1 - 17 for detection of sequence variation in nucleic acid target substrates comprising: i) providing an exonuclease according to any of claims 1 - 17; ii) providing a nucleic acid target substrate suspected of containing sequence variation relative to a reference control; iii) mixing said cleavage means and said substrate under conditions such that said substrate forms one or more secondary structures and said cleavage means cleaves said secondary structures resulting in the generation of multiple cleavage products; and iv) separating said multiple cleavage products so as to detect said sequence variation.
31. The use of the exonuclease according to any of claims 1 -17 for performing combined polymerase chain reaction (PCR) amplification and hybridisation probing comprising the steps of: i) contacting a target nucleic acid with PCR reagents , including at least two
PCR primers and a polymerase enzyme according to claim 12 or 13, and an oligonucleotide probe comprising: a) an oligonucleotide capable of hybridising to a target nucleic acid; b) a fluorescer molecule attached to the first end of the oligonucleotide; c) a quencher molecule attached to a second end of the oligonucleotide such that the quencher molecule substantially quenches the fluorescer molecule whenever the oligonucleotide probe is in a single-stranded state and such that the fluorescer is substantially unquenched whenever the oligonucleotide probe is hybridised to the target nucleic acid; d) a 5' end which is rendered impervious to digestion by the exonuclease according to claim 12 or 13; and e) a 3' end which is rendered impervious to digestion by the exonuclease according to claim 12 or 13; and ii) subjecting the target nucleic acid, the oligonucleotide probe, and the PCR reagents to thermal cycling, including a polymerisation step, the thermal cycling being sufficient to amplify the target nucleic acid specified by the PCR reagents.
32 A kit comprising : the exonuclease according to any of claims 1-17; deoxynucleotide triphosphates; buffers; standard DNA (undigested); standard DNA(digested); oligonucleotide primers.; cofactors.
EP00949725A 1999-08-03 2000-08-02 Nuclease variant and their use in genotyping assays Withdrawn EP1212430A1 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
GBGB9918150.5A GB9918150D0 (en) 1999-08-03 1999-08-03 Nuclease variant
GB9918150 1999-08-03
PCT/GB2000/002915 WO2001009343A1 (en) 1999-08-03 2000-08-02 Nuclease variant and their use in genotyping assays

Publications (1)

Publication Number Publication Date
EP1212430A1 true EP1212430A1 (en) 2002-06-12

Family

ID=10858406

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00949725A Withdrawn EP1212430A1 (en) 1999-08-03 2000-08-02 Nuclease variant and their use in genotyping assays

Country Status (5)

Country Link
EP (1) EP1212430A1 (en)
AU (1) AU6300000A (en)
CA (1) CA2380836A1 (en)
GB (1) GB9918150D0 (en)
WO (1) WO2001009343A1 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3681729B2 (en) * 2001-02-15 2005-08-10 タカラバイオ株式会社 Detection method of base substitution
US20130040365A1 (en) * 2011-08-10 2013-02-14 Life Technologies Corporation Polymerase compositions, methods of making and using same
US11208636B2 (en) 2011-08-10 2021-12-28 Life Technologies Corporation Polymerase compositions, methods of making and using same
CA2843766A1 (en) 2011-08-16 2013-02-21 Destiny Software Productions Inc. Script-based video rendering
GB201414745D0 (en) 2014-08-19 2014-10-01 Articzymes As Exonucleases
US10344268B2 (en) 2015-10-01 2019-07-09 Life Technologies Corporation Polymerase compositions and kits, and methods of using and making the same

Family Cites Families (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5108892A (en) * 1989-08-03 1992-04-28 Promega Corporation Method of using a taq dna polymerase without 5'-3'-exonuclease activity
EP0894860B1 (en) * 1990-09-28 2012-12-12 F. Hoffmann-La Roche AG Thermostable DNA polymerases and deletion mutants thereof
US5474920A (en) * 1993-11-23 1995-12-12 State Of Oregon, Acting By And Through The Oregon State Board Of Higher Education On Behalf Of The Oregon Health Sciences University Modified thermo-resistant DNA polymerases
AU4234796A (en) * 1994-11-09 1996-06-06 Third Wave Technologies, Inc. Rapid detection and identification of nucleic acid variants and pathogens
CA2222744C (en) * 1995-05-31 2008-03-25 Amersham Life Science, Inc. Thermostable dna polymerases

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
See references of WO0109343A1 *

Also Published As

Publication number Publication date
CA2380836A1 (en) 2001-02-08
WO2001009343A1 (en) 2001-02-08
AU6300000A (en) 2001-02-19
GB9918150D0 (en) 1999-10-06

Similar Documents

Publication Publication Date Title
US5744312A (en) Thermostable DNA polymerase from Thermoanaerobacter thermohydrosulfuricus
US20220010346A1 (en) Dna polymerase mutants having enhanced template discrimination activity
CA2351634C (en) Thermostable enzyme promoting the fidelity of thermostable dna polymerases- for improvement of nucleic acid synthesis and amplification in vitro
US5888780A (en) Rapid detection and identification of nucleic acid variants
US5422253A (en) Method of site specific nucleic acid cleavage
Southworth et al. Cloning of thermostable DNA polymerases from hyperthermophilic marine Archaea with emphasis on Thermococcus sp. 9 degrees N-7 and mutations affecting 3'-5'exonuclease activity.
JP3170229B2 (en) Denatured thermostable DNA polymerase
US5795763A (en) Synthesis-deficient thermostable DNA polymerase
US6008031A (en) Method of analysis and manipulation of DNA utilizing mismatch repair systems
US5861482A (en) Solutions containing mismatch repair system proteins mutL and mutS
JP2005518223A (en) RNA detection enzyme
KR20150131146A (en) Method for using heat-resistant mismatch endonuclease
EP1064296B1 (en) Thermostable dna polymerase from thermoanaerobacter thermohydrosulfuricus
US8183023B2 (en) Thermus egertssonii DNA polymerases
WO2001009343A1 (en) Nuclease variant and their use in genotyping assays
US6444429B1 (en) Gene coding for DNA ligase of hyperthermophilic bacteria Aquifex pyrophilus and protein expressed therefrom
US7981653B2 (en) Highly efficient hyperthermophilic DNA ligase
US20030087278A1 (en) Nuclease assay
CA2175490C (en) Methods of analysis and manipulation of dna utilizing mismatch repair systems
Kim et al. Cloning, expression, and characterization of thermostable DNA polymerase from Thermoanaerobacter yonseiensis
WO2021064115A1 (en) Method and kit for assembly of multiple dna fragments at room temperature

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20020125

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

17Q First examination report despatched

Effective date: 20030612

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20031023