EP1210595A1 - System for monitoring the expression and/or location of transgenes - Google Patents
System for monitoring the expression and/or location of transgenesInfo
- Publication number
- EP1210595A1 EP1210595A1 EP00957513A EP00957513A EP1210595A1 EP 1210595 A1 EP1210595 A1 EP 1210595A1 EP 00957513 A EP00957513 A EP 00957513A EP 00957513 A EP00957513 A EP 00957513A EP 1210595 A1 EP1210595 A1 EP 1210595A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- transgene
- sequence encoding
- nucleic acid
- polypeptide
- marker polypeptide
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
Definitions
- the invention is related to the area of gene therapy. In particular it is related to the field of expression and localization monitoring.
- the invention contemplates a method of monitoring the production of a therapeutic polypeptide in a mammal, comprising the steps of (a) administering to a mammal in need thereof nucleic acid construct encoding a therapeutic polypeptide and a sequence encoding a marker polypeptide; and (b) detecting the marker polypeptide which has been released into extracellular body fluid of the mammal as an indication of the amount of therapeutic polypeptide produced from the nucleic acid construct.
- the step of detecting is used as a qualitative or semi-quantitative test merely to determine the presence or absence of the marker peptide.
- the presence of the marker peptide is an indication that the transgene has been successfully delivered to the target cell, tissue, or organ of the mammal.
- the nucleic acid construct also encodes a protease-cleavable linker that is situated between the therapeutic polypeptide and the marker peptide.
- the invention also provides a method for monitoring the expression of a transgene.
- the method comprises the steps of (a) transfecting a cell using nucleic acid, (b) obtaining a biological fluid sample from a mammal containing the transfected cell, and (c) quantifying a marker peptide in the sample.
- the nucleic acid comprises a transgene and a sequence encoding a marker peptide that is non-immunogenic and non-functional.
- the marker peptide is released from the transfected cell into extracellular body fluid of the mammal.
- the nucleic acid construct also comprises a sequence encoding a protease-cleavable linker which is positioned between the transgene and the sequence encoding a marker peptide.
- the level of expression of the transgene is monitored by quantifying the marker peptide in the biological fluid sample.
- the invention also provides a method of monitoring the expression of a transgene in a mammal, comprising the steps of: (a) transfecting a host cell ex vivo with nucleic acid comprising a transgene and a sequence encoding a marker polypeptide; (b) introducing the transfected host cell into a mammal; and (c) quantifying the amount of marker polypeptide which has been released into extracellular body fluid of the mammal, whereby the amount of the marker polypeptide is used to monitor the level of expression of said transgene.
- the nucleic acid construct also encodes a protease-cleavable linker which is positioned between the transgene and the coding sequence for the marker polypeptide.
- the invention also provides a nucleic acid construct.
- the nucleic acid construct comprises a transgene and a sequence encoding a marker polypeptide that is released from the cell where it is produced into extracellular fluid.
- the marker polypeptide is non-immunogenic and nonfunctional.
- the construct also comprises a sequence encoding a protease- cleavable linker.
- the fusion polypeptide encoded by the construct does not form part of a naturally occurring precursor polypeptide from which the polypeptide encoded by the transgene is released by proteolytic cleavage.
- the transgene encodes a fusogenic polypeptide.
- the sequence encoding a protease-cleavable linker if present, is positioned between the transgene and the sequence encoding a marker polypeptide.
- the invention also provides a host cell comprising the nucleic acid construct of the preceding paragraph.
- the nucleic acid comprises a sequence encoding a sodium iodide symporter.
- the invention also provides a kit for practicing the invention.
- the kit comprises the nucleic acid construct described above and one or more reagents for monitoring the release of the marker polypeptide.
- the invention also provides a kit comprising a host cell transfected with the nucleic acid construct described above and one or more reagents for monitoring the release of the marker polypeptide.
- One embodiment of the invention provides a nucleic acid construct for transfecting a cell with a transgene.
- the construct contains a sequence that encodes a marker polypeptide which serves as a detectable marker and a sequence that encodes a protease-cleavable linker peptide.
- the marker polypeptide and the linker are co-expressed in like amount.
- the linker is cleaved during normal post-translational processing by endogenous proteases within the cell to release a stoichiometric amount (i.e., a proportionate amount) of the marker polypeptide from the transgene product.
- the marker polypeptide is released from the cell where it is synthesized into extracellular fluid and is detectable in blood or other easily obtainable biological fluid samples and can be used to monitor the level and kinetics of expression of the transgene in the transfected cell or tissue.
- the construct does not encode a protease-cleavable linker, but instead the marker polypeptide is regulated by a different promoter from that which regulates the transgene.
- the construct does not encode a protease-cleavable linker, but instead the construct is transcribed to a polycistronic mRNA which comprises a ribosome entry site between the transgene and the sequence encoding the marker polypeptide.
- Another embodiment of the invention provides a method for monitoring the expression of a transgene.
- the method employs the nucleic acid construct described in the preceding paragraph.
- a cell that has been transfected with this construct expresses the transgene as a fusion protein containing a marker polypeptide which is secreted from the cell and can be detected in blood or other easily obtainable biological fluid samples.
- the marker polypeptide is non-immunogenic and non-functional.
- the marker polypeptide is released from the cell where it is made into the extracellular fluid.
- the marker paptide serves only as a marker whose level and kinetics of expression parallel those of the transgene product.
- Still another embodiment of the invention provides another method for monitoring the expression of a transgene.
- a cell that has been transfected with the nucleic acid construct described above is introduced into a mammal who has been transfected with the same transgene.
- the bulk of the target cells are transfected with the transgene but not transfected with the marker polypeptide or linker of this invention; the cell which has been transfected with the construct of this invention, including the transgene, the marker polypeptide, and the linker, is used merely for expression monitoring of the transgene and is present only in sufficient amount to allow detection of the marker polypeptide.
- the marker polypeptide is released from the transfected cell into the extracellular fluid and serves as an indicator of transgene expression.
- the cell is transfected with a construct that does not encode a protease-cleavable linker. Instead, a first promoter is operable assiciated with the transgene, and a second promoter is operable associated with the sequence encoding the marker polypeptide.
- the cell is transfected with a construct that is transcribed to a polycistronic mRNA which comprises an internal ribosome entry site between the transgene and the sequence encoding the marker peptide. Because of the position of the ribosome entry site, both the transgene product and the marker peptide are expressed separately without the need for protease cleavage.
- Yet another embodiment of the invention provides a method of monitoring a therapeutic transgene.
- the nucleic acid construct of this invention is used to transfect a cell as described in either of the two previous embodiments.
- the transgene is a therapeutic gene which is introduced into the mammal to remedy a functional deficiency, treat a pathological condition, or destroy certain cells of the mammal by the activity of the transgene product.
- the marker polypeptide released from the transfected cell is detected and the information obtained is used to gage the progress of therapy with the transgene.
- a transgene product which destroys cancer cells is monitored as a means of assessing the effectiveness of the therapy and deciding whether to repeat or adjust the therapy.
- the invention contemplates a method of monitoring the location of a transgene in a mammal, comprising the steps of (a) administering to a mammal in need thereof nucleic acid comprising a transgene and a sequence encoding a sodium-iodide symporter (NIS), wherein expression of NIS in cells permits cellular uptake of iodine (b) administering to a mammal labeled iodine in an amount sufficient to permit transport of the labeled iodine by NIS and detection of transported labeled iodine; and (c) detecting the location of the transported labeled iodine in the mammal as an indication of the location of the transgene.
- NIS sodium-iodide symporter
- the step of detecting is performed quantitatively to determine the amount of transported labeled iodine in a mammal.
- the location of the transported labeled iodine is indicative of the location of NIS, whereby the location of NIS is indicative of the location of the transgene.
- the invention also provides a method of monitoring the location of a transgene in a mammal, comprising the steps of (a) transfecting a host cell ex vivo with nucleic acid comprising a transgene and a sequence encoding and expressing NIS, wherein the NIS permits cellular uptake of iodine by the host cells; (b) introducing the transfected host cell into a mammal; (c) administering to the mammal labeled iodine in an amount sufficient to permit transport of the labeled iodine by NIS and detection of transported labeled iodine; and (d) determining the location of transported labeled iodine in the mammal; whereby the location of transported labeled iodine is indicative of the location of the transgene.
- the labeled iodine is radioactive iodine.
- the invention also provides a nucleic acid construct comprising a chimeric gene comprising the transgene and the sequence encoding an NIS, wherein the chimeric gene also comprises a sequence encoding a protease-cleavable linker between the transgene and the sequence encoding NIS.
- sequence encoding the protease-cleavable amino acid linker comprises a sequence encoding an auto-cleaving sequence.
- the invention also provides a nucleic acid construct comprising a first promoter operably associated with the transgene and a second promoter operably associated with the sequence encoding NIS.
- the invention further provides a nucleic acid construct comprising a chimeric gene comprising a transgene and the sequence encoding NIS, wherein the chimeric gene also comprises between the transgene and the sequence encoding NIS, a sequence encoding an internal ribosome entry site.
- the nucleic acid also comprises a sequence encoding a marker polypeptide.
- sequence encoding a protease cleabvable linker is attached to the 5' end of the transgene.
- sequence encoding the protease-cleavable linker is attached to the 3' end of the transgene.
- the protease cleavable linker is cleaved by furin, or is identical to a linker present in a cytoplasmic protein.
- the transgene encodes a fusogenic polypeptide
- the fusogenic polypeptide encodes a viral fusion protein
- the fusogenic polypeptide encodes a measles virus H glycoprotein
- the fusogenic polypeptide encodes a gibbon ape leukemia virus envelope glycoprotein.
- the invention additionally provides a host cell comprising (a) a nucleic acid construct comprising a sequence encoding a transgene and a sequence encoding a sodium-iodide symporter (NIS), wherein the chimeric gene also comprises a sequence encoding a protease-cleavable linker between the transgene and the sequence encoding NIS; (b) a construct comprising a first promoter operable associated with the transgene and a second promoter is operable associated with the sequence encoding NIS; or (c) a construct comprising a chimeric gene comprising the transgene and the sequence encoding NIS, wherein the chimeric gene also comprises between the transgene and the sequence encoding NIS, a sequence encoding an internal ribosome entry site.
- NIS sodium-iodide symporter
- the invention further provides a kit comprising, in a ready to use format, one or more of the nucleic acid constructs described above, and one or more reagents for monitoring the location of the transported labeled iodine.
- the invention still further provides a kit comprising, in a ready to use format, a host cell transfected with one or more of the nucleic acid constructs described above, and one or more reagents for monitoring the location of the transported labeled iodine.
- the reagents of the kit include labeled iodine.
- the reagents of the kit include radioactive iodine.
- the nucleic acid comprises a first promoter operable associated with a transgene, and a second promoter operably associated with a chimeric gene comprising a sequence encoding a marker polypeptide and a sequence encoding NIS, wherein the chimeric gene also comprises a sequence encoding a protease cleavable linker, according to the invention.
- the nucleic acid according to the invention comprises a transgene, and a chimeric gene comprising a sequence encoding a marker polypeptide and a sequence encoding NIS, wherein the chimeric gene also comprises a sequence encoding a protease cleavable linker, and wherein the transgene and the chimeric gene are separated by a sequence encoding an IRES.
- the invention thus provides the art with methods and materials for conveniently and effectively monitoring either or both of the level and kinetics of expression of transgenes and the tissue-specific distribution of expressed transgenes in cells, tissues, animals or human mammals without the need for disruptive and expensive sampling methods including surgery.
- cell-associated protease refers to any protease within the cell, such as a protease located in the cytoplasm, or within, or associated with an organelle.
- cell-associated protease also refers to any protease associated with the cell, including, but not limited to a protease located on the cell surface or in the extracellular space near the cell surface, such that the protease cleaves a peptide with the appropriate sequence near the cell surface.
- mammal refers to any warm blooded organism of the class Mammalia, including, but not limited to rodents, feline, canine, or ungulates. In preferred embodiments of the invention, a “mammal” is a human.
- transgene refers to any nucleic acid sequence introduced into a cell and which encodes a polypeptide of interest.
- a transgene can be a gene which is endogenous to the mammal of the present invention, and which may or may not be endogenously expressed by the cells of the invention into which it is introduced. According to the present invention, a “transgene” can be applied to remedy a disease condition in the process known as gene therapy.
- auto-cleaving sequence refers to a short polypeptide sequence of between 10 and 20 amino acids, but preferably between 12 and 18 amino acids, but more preferably between 15 and 17 amino acids, in which cleavage of the propeptide at the C-terminus occurs cotranslationally in the absence of a cell associated protease. Moreover, cleavage can occur in the presence of heterologus sequence information at the 5' and/or 3' ends of the "auto- cleaving sequence".
- An example of an "auto-cleaving sequence" useful in the present invention is the that of the foot and mouth disease virus (FMDV) 2 A propeptide, in which cleavage occurs at the C-terminus of the peptide at the final glycine-proline amino acid pair. Cleavage of FMDV 2 A propeptide is independent of the presence of other FMDV sequences and can generate cleavage in the presence of heterologous sequences.
- FMDV foot and mouth disease virus
- Insertion of this sequence between two protein coding regions results in the formation of a self-cleaving chimera which cleaves itself into a C-terminal fragment which carries the C-terminal proline of the 2 A protease on its N-terminal end, and an N-terminal fragment that carries the rest of the 2 A protease peptide on its C-terminus (P. deFelipe et al., Gene Therapy 6: 198-208 (1999)).
- the self-cleaving FMDV 2A protease sequence can be employed to link the NIS to the polypeptide encoded by the transgene, resulting in spontaneous release of the NIS from the polypeptide encoded by the transgene.
- a "fusogenic polypeptide” refers to a membrane glycoprotein, including, but not limited to Type I and Type II membrane glycoproteins, which kill cells on which they are expressed by fusing the cells into a partial or complete multinucleated syncytia, which die by sequestration of cell nuclei and subsequent nuclear fusion.
- Examples of "fusogenic polypeptides” include, but are not limited to gibbon ape leukemia virus and measles virus H glycoprotein.
- detecting refers to the use any in vivo, ex vivo, or in vitro imaging technique capable of measuring a radio-labeled moiety, including, but not limited to standard single positron emission computed tomography (SPECT) or positron emission tomography (PET) imaging systems, used to measure the amount of labeled iodine in a mammal.
- Labeled iodine of the present invention is "detected" if the levels of labeled iodine measured following administration of one or more of the nucleic acid constructs described above, or the host cells transfected with one or more of the nucleic acid constructs described above are at all higher than the levels measured prior to administration.
- Labeled iodine of the present invention is also "detected" if it is localized to one or more organs, tissues, or cells following the administration of one or more of the nucleic acid constructs described above, or the host cells transfected with one or more of the nucleic acid constructs described above, that it was not localized to prior to the administration of the constructs or cells.
- labeled iodine is "detected" if the quantitative or semi-quantitative measurements of labeled iodine yield levels which are between 0.001-90% of the administered labeled iodine dose, preferably between 0.01-70%, preferably between 0.1-50%, more preferably between 1.0-20%, more preferably between 5-10% of the administered labeled iodine dose.
- the concentration of labeled iodine in organs, tissues, or cells can be determined by comparing the quantity of labeled iodine measured by methods of the invention, including, but not limited to SPECT or PET, to a standard sample of known labeled iodine concentration.
- labeled iodine refers to the movement of labeled iodine from the outside of one or more cells to the inside of one or more cells as a result of the expression of an NIS by the cell or cells which "transported” the labeled iodine.
- Labeled iodine is considered to be “transported” if the measured levels of iodine in organs, tissues or cells of the invention are between 0.001-90% of the administered labeled iodine dose, preferably between 0.01-70%, preferably between 0.1-50%, more preferably between 1.0-20%, more preferably between 5-10% of the administered labeled iodine dose.
- NIS activity or "NIS function” is the transport or sequestration of iodine across the cell membrane, i.e., from outside a cell to inside a cell.
- NIS is an intrinsic membrane glycoprotein with 13 putative transmembrane domains which is responsible for the ability of cells of the thyroid gland to transport and sequester iodide.
- NIS polypeptide useful in the invention with "NIS activity” or “NIS function” thus is a membrane glycoprotein with a transmembrane domain and is capable of transporting iodine if the polypeptide is present in a thyroid cell, and can also transport iodine in a non-thyroid cell type described herein.
- a sequence encoding an NIS refers to a nucleotide sequence encoding a polypeptide having the activity of a sodium iodide symporter (NIS).
- NIS nucleotide sequences and amino acid sequences include, but are not limited to, SEQ ID Nos 1 and 3 and SEQ ID Nos 2 and 4 respectively, as shown in Figures 8-11.
- NIS nucleotide and/or amino acid sequences also include, but are not limited to homologs or analogs of the nucleotide and/or amino acid sequences of Figures 8-11, wherein “homologs” are natural variants of NIS which retain NIS activity, and “analogs” are engineered variants of NIS which retain NIS activity.
- NIS is a self-protein, and as such does not stimulate a host immune reaction. Furthermore, the NIS functions solely to sequester iodine into a cell, which does not adversely affect normal cellular function, or overall cell biology.
- Figure 1 displays an expression construct of insulin C-peptide linked to the N-terminus of gibbon ape leukemia virus (GALV) envelope protein via a furin cleavable linker (RLKRGSR).
- GALV gibbon ape leukemia virus
- RLKRGSR furin cleavable linker
- Figure 2 displays an expression construct of insulin C-peptide linked to the C-terminus of measles virus H glycoprotein via a furin cleavable linker (RLKR) or via a non-cleavable linker (G4S).
- Figure 3 shows dose-response relationships for both cytopathic effects (per cent cell death, squares) and insulin C-peptide concentration in the culture medium (circles) as a function of the amount of DNA encoding GALV envelope protein used for transfection.
- the DNA expression construct contained sequences encoding GALV envelope protein, a furin-cleavable linker, and insulin C-peptide.
- Figure 4 shows dose-response relationships for both cytopathic effects (per cent cell death, squares) and insulin C-peptide concentration in the culture medium (circles) as a function of the amount of DNA encoding measles H glycoprotein used for transfection.
- the DNA expression construct contained sequences encoding measles H glycoprotein, a furin-cleavable linker, and insulin C-peptide.
- Figure 5 presents the time course of C-peptide released into the medium of cultured TELCeB ⁇ cells transfected with a construct which expresses C-peptide (CP1 GALV) and a construct which does not express C-peptide (Fus GALV).
- CP1 GALV C-peptide
- Fus GALV Fus GALV
- Figure 6 shows the post-infection time course for both recombinant measles virus titer (left panel) and C-peptide concentration in the culture medium (right panel).
- Recombinant measles virions were generated using the chimeric H glycoprotein, and used to infect Vero cells at an MOI of O.Ol.
- Figure 7 shows the effects of two cycles of concentration on the titer of the HIV-1 4070 A transducing vectior. Viral titer is increased 100-fold after concentration using the CaPO4 method.
- Figure 8 displays the nucleotide sequence of SEQ ID NO: 1 which encodes human NIS.
- Figure 9 displays the amino acid sequence of human NIS (SEQ ID NO: 2).
- Figure 10 displays the nucleotide sequence of SEQ ID NO: 3 which encodes rat NIS.
- Figure 11 displays the amino acid sequence of rat NIS (SEQ ID NO: 4)
- Figure 12 displays a schematic representation of the sodium-iodide symporter in the cell membrane.
- Figure 13 displays the expression constructs of the present invention in which the sequence encoding the NIS is linked to the N-terminus of the gibbon ape leukemia virus (GALV) envelope protein via a furin cleavable linker (RLKRGSR).
- GALV gibbon ape leukemia virus
- RLKRGSR furin cleavable linker
- Figure 14 displays an expression construct of the present invention in which the sequence encoding the NIS is linked to the C-terminus of measles virus H glycoprotein via a furin cleavable linker (RLKR) or via a non-cleavable linker (G4S).
- RLKR furin cleavable linker
- G4S non-cleavable linker
- Figure 15 displays a schematic representation of a host cell of the invention which contains a nucleic acid construct comprising a first promoter operably linked to a sequence encoding NIS at the 5' end of the construct and a second promoter operably linked to a transgene at the 3' end of the construct.
- Figure 16 displays a schematic representation of a host cell of the invention which contains a nucleic acid construct comprising a first promoter operably linked to a sequence encoding NIS at the 3' end of the construct and a second promoter operably linked to a transgene at the 5' end of the construct.
- Figure 17 displays a mixed host cell population comprising one or more cells which contain a nucleic acid construct comprising a first promoter operably linked to a transgene and a second promoter operably linked to a sequence encoding NIS (marker cells), and one or more cells which contain a nucleic acid construct comprising a transgene alone.
- NIS marker cells
- Figure 18 displays a mixed host cell population comprising one or more cells which contain a nucleic acid construct comprising a sequence encoding NIS (marker cells), and one or more cells which contain a nucleic acid construct comprising a transgene.
- the inventors have developed a novel strategy for monitoring the expression of transgenes in vivo.
- An easily quantifiable marker polypeptide which preferably is non-immunogenic and biologically inactive is genetically fused to the N-terminus or the C-terminus of the product of the therapeutic transgene through a linker peptide that is cleavable by a cell-associated protease.
- Expression of the therapeutic transgene then results in the formation of a fusion protein carrying a protease-cleavable N or C-terminal peptide extension.
- the protease-cleavage signal is chosen such that at some point during the subsequent folding, assembly, and transport of the molecule within the cell, a cell-associated protease cleaves the peptide from the transgene product, and the peptide is released from the cell into the extracellular fluid.
- a constant relationship should exist between the level of expression of the therapeutic transgene and the amount of marker polypeptide released from the genetically modified cell.
- the present invention further provides a novel method of monitoring the distribution in a cell or tissue of a transgene in vivo.
- the present invention encompasses localizing the presence and/or expression of a transgene comprising administering to a mammal a nucleic acid comprising (a) a chimeric nucleic acid sequence encoding the transgene and a sequence encoding the NIS, wherein the chimeric construct also comprises a sequence encoding a protease-cleavable linker between the transgene and the sequence encoding the NIS, (b) a nucleic acid sequence wherein a first promoter is operably associated with the transgene and a second promoter is operably associated with the sequence encoding the NIS, or (c) a chimeric gene comprising the transgene and the sequence encoding the NIS, wherein the chimeric gene also comprises, between the transgene and the sequence encoding the NIS, a sequence encoding an internal ribosome entry
- a NIS is genetically fused to the N- terminus or the C-terminus of the polypeptide product of a transgene such that the activities of both polypeptides are present in the polypeptide.
- the NIS and the polypeptide product of the transgene are associated through a linker polypeptide that is cleavable by a cell-associated protease.
- the protease cleavage signal is chosen such that at some point during the subsequent folding, assembly, and transport of the molecule within a cell, a cell-associated protease cleaves the NIS from the transgene product.
- the mammal is subsequently administered labeled iodine, which is transported into any cell which possesses an NIS.
- the labeled iodine can then be localized using non-invasive imaging techniques such as SPECT or PET, such that localization of labeled iodine indicates the expression of the transgene product.
- the construct does not encode a protease-cleavable linker, but instead the NIS is operationally associated with a different promoter from that which is associated with the transgene.
- the construct does not encode a protease-cleavable linker, but instead the construct is transcribed to a polycistronic mRNA which comprises a ribosome entry site between the transgene and the sequence encoding the NIS.
- Still another embodiment of the invention provides another method for monitoring the localization of a transgene.
- a cell that has been transfected ex vivo with the nucleic acid construct described above (host cell) is introduced into a mammal. Expression of the transgene and NIS from the host cell will lead to the transport of labeled iodine from the outside to the inside of the host cell.
- the labeled iodine may be localized by standard SPECT or PET scan as an indication of the location of transgene expression.
- the cell is transfected with a construct that does not encode a protease-cleavable linker. Instead, the NIS is operationally associated with a different promoter from that which is associated with the transgene.
- the cell is transfected with a construct that is transcribed to a polycistronic mRNA which comprises an internal ribosome entry site between the transgene and the sequence encoding the NIS. Because of the position of the ribosome entry site, both the transgene product and the NIS are expressed separately without the need for protease cleavage.
- nucleic acid comprising a transgene and a chimeric gene comprising a sequence encoding NIS and a sequence encoding a marker polypeptide, wherein the chimeric gene also comprises a sequence encoding a protease cleavable linker, and wherein the transgene and chimeric gene are separated by an internal ribosomal entry site.
- the nucleic acid of the invention can comprise a first promoter operable associated with a transgene, and a second promoter operable associated with a chimeric gene comprising a sequence encoding NIS and a sequence encoding a marker polypeptide
- Yet another embodiment of the invention provides a method of monitoring the location of a therapeutic transgene.
- the nucleic acid construct of this invention is used to transfect a cell as explained in either of the two previous embodiments.
- the transgene is a therapeutic gene which is introduced into a mammal to remedy a functional deficiency, treat a pathological condition, or destroy certain cells of the mammal by the activity of the transgene product. Detection of transgene localization may be used to gage the progress of therapy, and to insure that the tissue-specific distribution of the transgene is appropriate for the intended treatment.
- a transgene product which destroys cancer cells is monitored as a means of assessing the effectiveness of the therapy and deciding whether to repeat or adjust the therapy.
- the transgene of the present invention is any nucleic acid sequence introduced into a cell.
- Transgenes can be applied to remedy a disease condition in the process known as gene therapy.
- the term gene therapy can be applied to any therapeutic procedure in which genes or genetically modified cells are administered for therapeutic benefit.
- the transgene will be one which encodes a polypeptide that selectively kills a certain group of undesired cells such as cancer cells.
- the transgene can encode a fusogenic polypeptide such as a viral fusion protein or an artificial polypeptide which causes the fusion of cells expressing the polypeptide, resulting in syncytium formation and cell death.
- the transgene can be introduced into a target cell or host cell by any mechanism of transfer known in the art, including any type of gene therapy, gene transfer, transfection, and the like.
- the term "marker polypeptide” refers to a polypeptide that is used to monitor the expression of a transgene and is readily detectable in biological fluid samples.
- the marker polypeptide is non-immunogenic, meaning that it is not likely to produce any significant immune response in the host organism undergoing gene therapy with the marker polypeptide. Not only might an immune response raised against the marker polypeptide be deleterious to the host organism, particularly if repeated bouts of gene therapy are required, but the production of antibodies reacting with the marker polypeptide would also accelerate the kinetics of removal of the marker polypeptide from the host and complicate its detection using immunological methods.
- the marker polypeptide is also preferably non-functional, which means that it lacks any significant known biological activity other than that required to serve its use as a marker (i.e., an activity that is detectable). Both the properties of non- immunogenicity and non-functionality are merely intended to improve the performance of the marker polypeptide by preventing undesirable side effects in the host organism. The requirements of non- immunogenicity and non-functionality are not intended to be absolute, and it is understood that a marker polypeptide of the invention may possess an insignificant remnant of biological activity or immunogenicity in the host organism and may possess significant immunogenicity or biological activity in an organism other than the host organism.
- the marker polypeptide is also preferably not part of a naturally occurring precursor polypeptide from which the transgene of interest is released by proteolytic cleavage. Instead, it is preferred that the marker polypeptide be selected either from a different naturally occurring polypeptide precursor or from a completely artificial sequence.
- extracellular body fluid encompasses any body fluid that is not the intracellular fluid, including but not limited to extracellular fluids such as blood, urine, interstitial fluid, cerebrospinal fluid lymph, etc.
- the marker polypeptide should be linked to the expression of the therapeutic transgene such that there is a fixed stoichiometric relationship between the expression of the two genes.
- the marker polypeptide should have the following properties: (1) It is preferably small (molecular weight below 10 kD) and soluble in biological fluids so as to allow rapid equilibration between the interstitial and intravascular fluid spaces. Larger marker polypeptides up to 1 OOkD can also be used, but allowance must be made for the kinetics of release of such larger peptides from the cell of origin and their transport into and removal from the biological fluid being tested.
- This gene marking strategy is useful for monitoring the expression of a variety of both cell-associated and cytoplasmic transgene products.
- the use of a variety of different peptides is envisaged.
- Naturally occurring peptides with a very low background level of expression are ideally suited to this application since they are unlikely to be immunogenic.
- Biologically inactive peptide fragments derived from prohormone processing are particularly suited for use in the invention.
- insulin is synthesized as a biologically inactive prohormone, proinsulin, which is cleaved to release insulin and biologically inactive C-peptide.
- Plasma levels of these products in humans are: proinsulin, 3-20 pmol/1; fasting insulin, 43-186 pmol/1; and C-peptide, 170-900 pmol/1. Endogenous insulin and C-peptide can be suppressed using somatostatin for improved background correction, and C-peptide peripheral kinetics have been extensively studied in both normal volunteers and diabetic patients. Patients with type I diabetes do not synthesize insulin and therefore have zero background levels of C-peptide (K.S. Polonsky et al., J. Clin. Invest. 77: 98-105 (1986)). An assay for quantifying C-peptide in human blood is described in P.C. Kao et al., Ann. Clin. Lab. Science 22: 307-316 (1992).
- Another source of biologically inactive peptide fragments is those derived from proteolytic processing of zymogens to generate active enzymes such as proteases.
- proteases many pancreatic proenzymes release an activation peptide during their trypsin-induced activation (see e.g., K. Mithofer et al., Anal. Biochem. 230: 348-350 (1995), which describes an assay for trypsinogen activation peptide used to diagnose or monitor acute pancreatitis).
- Most such peptides are small (less than 1 kDa) and rapidly excreted in the urine.
- procarboxypeptidase B Small, rapidly excreted polypeptides are well suited for urine tests to monitor transgene expression and for quick, semi-quantitative testing of whether a transgene has been successfully delivered or is still operational.
- Other proenzymes such as procarboxypeptidase B, have larger activation peptides of about lOkD (K.K. Yamamoto et al., J. Biol. Chem. 267: 2575-2581 (1992)) and are therefore suitable as serum or urine markers.
- the activation peptide of procarboxypeptidase B has been applied as a marker for pancreatitis (S. Appelros et al., Gut 42: 97-102 (1998)).
- marker polypeptides for the invention is the fragments derived from proteolytic inactivation of hormones, proteases, and other biologically active molecules. Caution should be exercised that such peptides, if used in the invention, are non-immunogenic and nonfunctional as described above.
- Marker polypeptides can also be derived from tumor antigens, which are polypeptides produced in excessive amounts by specific tumor subtypes. These polypeptides are currently used monitor the response of a tumor to chemotherapy and to monitor patients for relapse. Convenient, sensitive assays have been developed for these antigens.
- tumor antigens include CA125 (ovarian cancer), alphafetoprotein (AFP, liver cancer), carcinoembryonic antigen (CEA, colon cancer), intact monoclonal immunoglobulin or light chain fragments (myeloma), and the beta subunit of human chorionic gonadotrophin (HCG, germ cell tumors).
- marker polypeptides Another source of marker polypeptides is the inactive variants of naturally occurring peptides.
- Assays exist which can detect inactive fragments or sequence variants of a wide range of biologically active molecules.
- a fragment or sequence variant derived from the active portion of any polypeptide hormone can be used as a marker.
- these include gastrin, renin, prolactin, adrenocorticotrophic hormone, parathyroid hormone, parathyroid hormone related polypeptide, arginine vasopressin, beta endorphin, atrial naturetic factor, calcitonin, insulin, insulin-like growth factor, glucagon, osteocalcin, erythropoietin, thrombopoietin, human growth hormone, and others.
- Analogous hormones from other non-human species are also a source of peptide sequences which could be adopted or modified to serve as a marker polypeptide in the invention.
- Many of the commercially available assays for such hormones have the power to detect biologically inactive, truncated, or point-mutated variants of the natural polypeptide. For example, deletion of the first six N-terminal amino acids of parathyroid hormone (an 84 residue polypeptide whose normal blood level is 1.0 -5.2 pmol/1) destroys biological activity, but the truncated molecule is still detectable using a standard immunoassay.
- Unprocessible variants of naturally occurring precursor polypeptides can also serve as marker polypeptides.
- proinsulin is processed to insulin and C-peptide by cellular proteases that cleave the junctions between the C-peptide and the A and B chains. Processing can be inhibited by mutation of these cleavage sites, such that the inactive, point-mutated proinsulin (normal level 3-20 pmol/1) will be released from the cell and detected in the blood.
- variants of naturally occurring polypeptides with prolonged circulating half-lives can be used as marker polypeptides.
- Peptide elimination can be reduced by modifications that increase size or anionic charge (reduced glomerular filtration), by mutations in the recognition sites for inactivating proteases, and by mutations that lead to loss of receptor binding activity (reduced receptor-mediated clearance) (C. McMartin, Biochem. Soc. Trans.17: 931-934 (1989)).
- Fully synthetic or non-human peptides are also useful as marker polypeptides. Such peptides have been used to monitor protein expression and to track synthetic proteins during purification (e.g., FLAG tag, myc tag, strep tag). Similar peptides can be designed which lack immunogenicity in humans.
- Radioactive iodine therapy given the intrinsic ability of thyroid cells, cancerous or not, to concentrate iodine from extracellular fluid.
- the iodine trapping activity of thyroidal cells is utilized in diagnosis as well as therapy of thyroid cancer. Functioning thyroid cancer metastases can be detected by administering radioiodine and then imaging with a gamma camera.
- NIS is an intrinsic membrane glycoprotein with 13 putative transmembrane domains which is responsible for the ability of cells of the thyroid gland to transport and sequester iodide.
- An NIS of the present invention is comprised of a polypeptide having the activity of a sodium iodide symporter, including, but not limited to the polypeptide encoded by the amino acid sequences of SEQ ID Nos 2 and 4 for human and rat respectively, wherein the amino acid sequences of SEQ ID Nos 2 and 4 are encoded by polynucleotide sequences comprising SEQ ID Nos 1 and 3 for human and rat respectively.
- NIS expression in thyroid tissues is dependent upon stimulation of the cells by pituitary-derived thyroid stimulating hormone (TSH) and can therefore be readily suppresses in this tissue by treatment with Thyroxine.
- TSH pituitary-derived thyroid stimulating hormone
- TSH-regulated NIS expression is specific for thyroid cells, whereas many other organs do not concentrate iodine due to lack of NIS expression.
- Cloning and characterization of the human and rat NIS genes (SEQ ID NO: 1 and 3 respectively; GenBank Accession numbers A005796 and U60282 respectively) permits NIS gene delivery into non-thyroid cells, thereby allowing these cells to trap and sequester radio-labeled iodine.
- the NIS functions well as a localization tag for several reasons.
- the NIS according to the present invention, is synthesized in the mammal, using the mammals own protein synthetic machinery, and thus is recognized as self, thereby avoiding a potential immune response.
- the NIS is a useful localization tag according to the present invention as it should have no significant effect on the biological properties of the genetically modified cells. Given that the only known function of the NIS is to transport iodine across the cell membrane, it should not adversely affect endogenous cellular function.
- nucleic acid constructs of the invention in addition to a transgene and optional protease cleavable linker, can contain a sequence encoding a NIS in place of, or in addition to a sequence encoding a marker polypeptide.
- the nucleic acid construct can be an expression vector, a plasmid that can be prepared and grown in bacteria, or an engineered virus capable of transfecting the host cell.
- the nucleic acid sequences of the construct can contain DNA, RNA, a synthetic nucleic acid, or any combination thereof, as known in the art.
- the nucleic acid construct can be packaged in any manner known in the art consistent with its delivery to the target cell.
- the construct can be packaged into a liposome, a DNA- or retro-virus, or another structure.
- the sequences should be arranged so that the protease-cleavable linker peptide, if one is included, is situated between the transgene product and the marker polypeptide and/or NIS, resulting in the cleavage of the marker polypeptide and/or NIS from the transgene product by a selected protease, which can be a protease that is encountered in the host cell or organism during post-translational processing.
- a selected protease which can be a protease that is encountered in the host cell or organism during post-translational processing.
- One means of accomplishing this is to design the nucleic acid construct such that the sequences encoding both the marker polypeptide and/or NIS and the linker polypeptide are attached to either the 3' end or the 5' end of the transgene.
- sequences encoding each of the four components may be interspersed with other sequences as needed.
- the protease cleavable linker sequence be interposed between the transgene product and the marker polypeptide or NIS.
- Promoters of the invention include, but are not limited to any promoter that is operable in a selected host cell according to the invention.
- a promoter of the invention can be the endogenous promoter for NIS or the endogenous promoter for a transgene, or the endogenous promoter for a marker polypeptide, or can be any promoter that will be operative in the expression of the sequence encoding the NIS, marker polypeptide, or the transgene in a host cell of the invention.
- the sequences encoding each of the four components are all under control of a single promoter sequence, resulting in the expression of a fusion protein containing each of the elements.
- the chosen promoter can be one which regulates the expression of the transgene in a manner consistent with its use in the host organism, for example, in a manner consistent with the intended gene therapy.
- the expression of the marker polypeptide can be driven from a second promoter inserted into the construct or it can be encoded on the same transcript as the transgene, but translated from an internal ribosome entry site.
- the expression of the NIS can also be driven from a second promoter inserted into the construct or it can be encoded on the same transcript as the transgene, but translated from an internal ribosome entry site.
- the use of two promoters can, in some embodiments, obviate the need for including a protease-cleavable linker peptide. If the marker polypeptide is regulated by a separate promoter, it will be translated separately from the transgene product and released from the cell without requiring proteolysis. Similarly, if the NIS is regulated by a separate promoter, it too will be translated separately form the transgene product without requiring proteolysis.
- the transgene is operably associated with a first promoter, while a second promoter is operably associated with a chimeric gene comprising a sequence encoding a marker polypeptide, and a sequence encoding NIS separated by a sequence encoding a protease cleavable linker. Subsequent cleavage of the protease cleavable linker between the marker polypeptide and NIS permits both the localization of the transgene as described herein, and monitoring of transgene expression.
- the two promoters regulating the transgene and the marker polypeptide and/or NIS can be different, they can also be the same promoter, in which case the expression of both transgene and marker polypeptide are quite likely to be parallel, thereby increasing the effectiveness of the marker polypeptide for monitoring expression of the transgene, and of the NIS for monitoring the location of the transgene.
- Another alternative strategy to using a protease-cleavable linker is to include an internal ribosome entry site in the construct between the transgene or the coding sequence for the therapeutic polypeptide and the coding sequence for the marker polypeptide or NIS.
- Internal ribosomal entry sites are sequences that enable a ribosome to attach to mRNA downstream from the 5' cap region and scan for a downstream AUG start codon, for example in polycistronic mRNA. See generally, Miles et al., U.S. Patent 5,738,985 and N. Sonenberg and K. Meerovitch, Enzyme 44: 278-91 (1990). Addition of an IRES between the coding sequences for the transgene product and the marker peptide and/or NIS can enable the independent translation of either the transgene product or the marker peptide and/or NIS from a dicistronic or polycistronic transcript.
- IRES Internal ribosomal entry sites
- IRES sequences can be obtained from a number of RNA viruses (e.g., picornaviruses, hepatitis A, B, and C viruses, and influenza viruses) and DNA viruses (e.g., adeno virus). IRES have also been reported in mRNAs from eukaryotic cells (Macejak and Sarnow, Nature 353: 90-94 (1991) and Jackson, Nature 353: 14015 (1991)). Viral IRES sequences are detailed in the following publications:
- Rhinovirus Deuchler et al. Proc. Natl. Acad. Sci. USA 84: 2605-2609 (1984)
- the invention permits a great deal of flexibility and discretion in terms of the choice of the protease cleavable linker peptide.
- the protease specificity of the linker is determined by the amino acid sequence of the linker. Specific amino acid sequences can be selected in order to determine which protease will cleave the linker; this is an important indication of the location of cleavage within the cell or following secretion from the cell and can have a major effect on the release of either the marker polypeptide or the NIS.
- the furin cleavage signal is ideal for cell-associated transgenes that are transported to the cell surface through the Golgi compartment.
- Cell surface receptors such as the LDL receptor used for the treatment of hypercholesterolemia or chimeric T cell receptors used for retargeting T cells can therefore be marked using furin-cleavable peptides.
- cleavage signals that are recognized by cytoplasmic proteases and to use peptides with appropriate hydrophilic/ hydrophobic balance so that they can escape across the plasma membrane.
- Proprotein convertases of the subtilisin/kexin family (furin, PCI, PC2, PC4, PACE4, PC5, PC)
- Proprotein convertases cleaving at hydrophobic residues (e.g., Leu, Phe, Val, or Met)
- Proprotein convertases cleaving at small amino acid residues such as Ala or Thr
- PCE Proopiomelanocortin converting enzyme
- Chromaffin granule aspartic protease (CGAP)
- Carboxypeptidases e.g., carboxypeptidase E/H, carboxypeptidase D and carboxypeptidase Z
- Aminopeptidases e.g., arginine aminopeptidase, lysine aminopeptidase, aminopeptidase B
- Angiotensin converting enzyme secretase secretase
- Thrombin BMP-1 procollagen C-peptidase
- ADAM 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and 11 Granzymes A, B, C, D, E, F, G, and H
- An alternative to relying on cell-associated proteases is to use a sequence encoding a self- or auto-cleaving linker.
- An example of such a sequence is that of the foot and mouth disease virus (FMDV) 2A protease.
- FMDV foot and mouth disease virus
- This is a short polypeptide of 17 amino acids that cleaves the polyprotein of FMDV at the 2A/2B junction.
- the sequence of the FMDV 2 A propeptide is NFDLLKLAGDVESNPGP (SEQ ID NO: 5), which can be encoded by a nucleic acid sequence comprising ttgaagctgaataatttttaatcgtcctctgcatctttcgttgggtcctggt (SEQ ID NO: 6).
- the cleavage occurs at the C-terminus of the peptide at the final glycine-proline amino acid pair.
- Cleavage of FMDV 2A propeptide is independent of the presence of other FMDV sequences and can generate cleavage in the presence of heterologous sequences. Insertion of this sequence between two protein coding regions results in the formation of a self-cleaving chimera which cleaves itself into a C-terminal fragment which carries the C-terminal proline of the 2 A protease on its N-terminal end, and an N-terminal fragment that carries the rest of the 2 A protease peptide on its C-terminus (P. deFelipe et al., Gene Therapy 6: 198-208 (1999)).
- the self-cleaving FMDV 2A protease sequence can be employed to link the marker polypeptide and/or NIS to the therapeutic polypeptide, resulting in spontaneous release of the marker polypeptide and/or NIS from the therapeutic protein.
- the above disclosure describes a method of determining transgene localization and/or expression whereby the transgene is expressed as a fusion protein comprising the transgene product together with a NIS and/or marker polypeptide and a protease-cleavable linker peptide, or where the transgene is operably associated with a first promoter, while the sequence encoding the NIS and/or marker polypeptide is operably associated with a second promoter, or where the transgene and the sequence encoding the NIS and/or marker polypeptide are separated by a sequence encoding an IRES.
- the disclosure further describes methods of determining the location and/or expression of a transgene whereby a first promoter is operably associated with a transgene, and a second promoter is operable associated with a chimeric gene comprising a sequence encoding NIS and a sequence encoding a marker polypeptide, wherein the sequences of the transgene and chimeric gene are separated by a sequence encoding a protease cleavable linker, or where a transgene is separated from a chimeric gene comprising a sequence encoding NIS and a sequence encoding a marker polypeptide, wherein the sequences of the transgene and the chimeric gene are separated by a sequence encoding an IRES.
- the nucleic acid is used to transfect the cell, tissue, organ, or organism that is the target of gene therapy.
- the same nucleic acids can also be utilized in another fashion, whereby cells previously transfected with the nucleic acid (host cells; Figures 15 and 16) are transferred to a mammal, followed by detection of the marker polypeptide and/or administration of labeled iodine to visualize transgene localization.
- the host cell selected to receive the nucleic acid according to the invention may be found in situ within the mammalian recipient of the therapy, or the host cell can be a cell isolated from the mammal or from another source, and transfection with the nucleic acid can take place in vitro using standard techniques (e.g., the addition of calcium phosphate solutions or lipids known to induce transfection).
- the construct itself or a cell transfected in vitro with the construct can be introduced into the mammal by any suitable means known in the art, such as by injection, ingestion, or implantation.
- one or more cells that have been transfected with the nucleic acid construct described above is introduced to a mammal as a "marker cell" along with one or more cells which have been transfected with a nucleic acid construct comprising a nucleotide sequence which encodes the transgene, but not the NIS.
- the marker cell accordingly, is used merely for monitoring the localization of the transgene and is present only in sufficient amount to transport iodine and detect the transported iodine.
- cells administered for therapeutic purposes i.e., containing a transgene
- a large proportion of cells i.e., 60%, 75%, 90%, 100% may contain both the transgene and the NIS gene, with the remaining cells (e.g. 40%, 25%, 10%) containing only the transgene.
- the transfected marker cell(s) is introduced into the mammal concurrently with the introduction of cells transfected with a nucleic acid construct that encodes the transgene alone.
- the marker cells carrying the construct of this invention are targeted to the same tissue or organ as cells carrying the therapeutic transgene for optimal localization of the therapeutic transgene.
- Expression of the NIS and subsequent sequestration of administered labeled iodine is used to determine the location of the transgene as described above
- the marker cells can alternatively be transfected with a construct that does not encode a protease-cleavable linker, but instead includes a second promoter which is associated with the sequence encoding the NIS.
- Another alternative is to transfect the marker cells with a construct that is transcribed to a polycistronic mRNA which comprises an internal ribosome entry site between the transgene and the sequence encoding the NIS. Because of the position of the ribosome entry site, both the transgene product and the NIS may be expressed separately without the need for protease cleavage.
- the same nucleic acid construct can also be utilized in another fashion, whereby cells previously transfected with the construct (marker cells) are transferred to a mammal to monitor transgene expression.
- the actual transgenic therapy may or may not be accomplished using a separate vector that encodes only the transgene product and not the marker polypeptide or protease-cleavable linker fusion protein of the present invention. In this way, it is unnecessary to burden the bulk of the target cells with the additional genetic material, the synthesis of the marker and linker peptides, and the possible undesired side effects of the marker.
- a cell of the mammal or from another source is transfected in vitro using the construct of this invention.
- the transfected cell is introduced into the mammal either concurrently with the introduction of a gene therapy vector, or shortly before or after the introduction of a gene therapy vector.
- the cell carrying the construct of this invention is targeted to the same tissue or organ as the therapeutic vector for optimal monitoring of the therapeutic transgene. Release of the marker polypeptide from the marker cells is used to monitor the expression level of the transgene as described above.
- the cell can alternatively be transfected with a construct that does not encode a protease-cleavable linker, but instead includes a second promoter which regulates the expression of the marker peptide.
- Another alternative is to transfect the cell with a construct that is transcribed to a polycistronic mRNA which comprises an internal ribosome entry site between the transgene and the sequence encoding the marker peptide. Because of the position of the ribosome entry site, both the transgene product and the marker peptide are expressed separately without the need for protease cleavage.
- a nucleic acid according to the invention or a host cell containing the nucleic acid according to the invention may be administered in a pharmaceutical formulation, which comprises the nucleic acid or host cell mixed in a physiologically acceptable diluent such as water, phosphate buffered saline, or saline, and will exclude cell culture medium, particularly culture serum such as bovine serum or fetal calf serum, ⁇ 0.5%. Administration may be intravenous, intraperitoneally, nasally, etc.
- the dosage of nucleic acid according to the invention or cells containing the nucleic acid according to the invention will depend upon the disease indication and the route of administration, but should be generally between 1-1000 ⁇ g of DN A/kg of body weight/day or 10 3 -10 9 transfected cells/day.
- the cells may comprise a small number (i.e., 1%, 2%, 5%, 10%) containing both the transgene and the NIS and/or marker polypeptide, or alternatively a large proportion of cells (i.e., 60%, 75%, 90%, 100%) containing both the transgene and the NIS and/or marker polypeptide.
- the dosage of nucleic acid, or cells containing nucleic acid encoding an NIS and/or marker polypeptide will be according to the same numerical guidelines provided above for a therapeutic nucleic acid or cell containing a therapeutic nucleic acid
- the duration of treatment will extend through the course of the disease symptoms and signs (clinical features), possibly continuously. Monitoring of NIS and/or marker polypeptide is performed at any time during the course of treatment. The number of doses will depend upon disease delivery vehicle and efficacy data from clinical trials. Symptoms for a given disease are indicated by the conventional clinical description of the disease, and will be selected for monitoring by the physician treating the disease. For example, the symptoms of cancer are well- known for each type of cancer. One clinical sign for cancer assessment, for example, is tumor size, which can be measured as an indicator of disease response to treatment. When clinical symptoms are assessed, the physician monitors the symptoms and evaluates whether the symptoms are getting worse or better as the disease progresses or recedes, respectively. One such example is monitoring the destruction of certain cell types that are malignant as an indicator of the success of treatment.
- kits containing a nucleic acid construct according to the invention and one or more reagents for the localization of the NIS, wherein the tissue distribution of the NIS is indicative of the distribution of the polypeptide encoded by the transgene.
- Reagents for detecting the NIS can include any detectable moiety complexed with iodine, such as radiolabeled iodine, wherein the use and distribution of the radiolabeled iodine complies with Federal radiation safety guidelines.
- An alternative kit would contain a cell according to the invention that has previously been transfected with the construct according to the invention together with one or more reagents for detection of the NIS.
- Either kit can include a set of instructions for using the construct or cell and for quantifying the NIS, for example, by SPECT or PET scanning.
- kits containing a nucleic acid construct according to the invention and one or more reagents for the detection of the marker polypeptide.
- Reagents for detecting the marker peptide can include, for example, a monoclonal antibody which binds the marker peptide and radiolabelled marker peptide suitable for radioimmunoassay, or a set of chemicals and appropriate antibodies to perform ELISA.
- An alternative kit would contain a marker cell that has previously been transfected with the construct together with one or more reagents for detection of the marker polypeptide.
- Either kit can include a set of instructions for using the construct or cell and for quantifying the marker polypeptide in a biological fluid sample.
- the release of the peptide marker can be monitored to determine whether and how much expression of the transgene is occurring.
- a sample of an appropriate biological fluid or secretion is obtained from the mammal and the concentration of the marker polypeptide in the fluid or secretion is determined. Any biological fluid or secretion known to the art can be employed, e.g., blood, urine, saliva, cerebrospinal fluid, mucous, or feces, but the choice of sample is likely to be determined by the target location of the construct within the body and the expected route of release and excretion of the marker polypeptide. Samples of the biological fluid can be obtained at any desired time interval following administration of the nucleic acid construct in order to monitor the effectiveness of transfection, the regulation of transgene expression, or the progress of therapy.
- the presence of the marker polypeptide in the biological fluid sample can be evaluated by any qualitative or quantitative method known in the art.
- Immunologic assays such as ELISA or radioimmunoassay are preferred because of their specificity, sensitivity, quantitative results, and suitability for automation.
- Such assays are readily available in most medical facilities for a number of possible marker polypeptides such as insulin C-peptide and beta-HCG.
- Chromatographic methods such as HPLC, optionally combined with mass spectrometry, can also be employed.
- Other analytic methods are possible, including the use of specific color reagents, thin layer chromatography, electrophoresis, spectroscopy, nuclear magnetic resonance, and the like.
- the marker polypeptide itself be non-functional, i.e., that it not possess any significant biological activity which might interfere with the mammal's physiology or therapy, it is conceivable that the marker polypeptide can possess an enzyme activity which can itself be quantified and used as a means of detecting the marker in a biological fluid sample.
- the marker polypeptide is a naturally occurring peptide, such as a cleavage fragment of a peptide hormone precursor, then a significant background level of the marker polypeptide would probably be encountered even in the absence of any expression of the fusion protein encoded by the nucleic acid construct.
- the background level can be determined in a mammal prior to administration of the construct and simply subtracted from the value determined after transfection. The difference is referable to marker polypeptide released through expression of the transgene.
- a more complicated situation occurs if the marker polypeptide is naturally present in the mammal and fluctuates with physiological or pathological circumstances. In that case, the background rhythm or cycle of the marker must be known with sufficient certainty to permit its estimation and subtraction from the values determined post transfection.
- the level of expression of the transgene product can either be infe ⁇ ed from the concentration of marker polypeptide determined in a biological fluid sample or can be determined more accurately by calibration.
- the level of expression of transgene product is expressed as the amount of such product, in moles or mg, synthesized by the cell, tissue, organ, or entire organism which was the target of the gene therapy per unit time.
- the level of expression can be quantified as the number of nanomoles of transgene polypeptide produced per gram of tissue per hour.
- Calibration of the marker polypeptide can be accomplished by quantifying both the marker polypeptide and the transgene product itself (e.g., by extracting the tissue making the transgene product and measuring the product directly using HPLC, ELISA, radioimmunoassay, Western blot, or other suitable method) over a sufficient time period to permit extrapolation or determination of the stoichiometry between measured marker polypeptide in a given biological fluid sample and actual tissue level of transgene product. Without calibration, a stoichiometry must be estimated or assumed in order to accurately determine expression of transgene product. Even if an assumed stoichiometry is not accurate, it should allow at least qualitative or semi-quantitative tracking of transgene expression.
- the mammals are maintained on a low iodine diet for two weeks prior to the introduction of the nucleic acid construct by any of the methods described herein.
- a tracer dose of about 5-10 mCi, preferably about 1-5 mCi, and more preferably about 0.1-1 mCi of 131 1, 124 I, or I23 I is administered by the intraperitoneal, or intravenous route at 24 hours, 48 hours, 96 hours, and 8 days following administration of the vector according to the invention.
- the syringe used to deliver the radioiodine is counted prior to and following iodine injection to verify the dose of radiation administered to the mammal.
- One hour after radioiodine injection, anterior and posterior images are taken using SPECT, or PET scans.
- Images according to the invention may be taken of the whole body, or of specific regions, or organs. Image acquisition may be repeated at 2, 6 and 24 hours post-injection. Regions of uptake are mapped, and quantified (if using the PET method) and expressed as a fraction of the total amount of the administered radioiodine.
- detection of transported iodine as indicative of the presence of a transgene is that detection which the radiologist or physician determines qualitatively to be an image indicating transport of labeled iodine.
- the qualitative indication may be an area of the host body which is darker or denser in the scan, indicating sequestration of labeled iodine.
- Quantitative detection of transported labeled iodine indicative of the presence of a transgene is that percentage of the total labeled iodine administered that is above 1% and preferably about 10%.
- Imaging with 124 I PET will offer higher resolution imaging, higher sensitivity, attenuation correction, more accurate tumor localization and more accurate quantitation of uptake than is currently possible with conventional gamma cameras (Pentlow et al., Medical Physics 18: 357-366 (1991); Pentlow et al., J. Nuc. Med. 37: 1557-1562 (1996))
- the physical characteristics of 124 I including a half life of 4.2 days make it highly suitable for direct imaging of tissues capable of concentrating iodide, such as thyroid.
- 124 I is well suited for imaging of tissues which sequester iodine due to the expression of an exogenous NIS.
- 124 I PET imaging will allow improved assessment of NIS activity and transgene distribution in mammals following aciministration of the nucleic acid construct bearing the transgene and a sequence encoding the NIS.
- 124 I PET imaging permits more accurate dosimetry, which will allow optimization of the therapeutic responses.
- the techniques of both SPECT and PET are well described in the art, and are exemplified in the following references: Pentlow et al., Medical Physics. 18:357-66 (1991); Pentlow et al., JNuc Med. 37:1557-62 (1996); Biegon, U.S. Pat. No. 5,304,367.The studies will also provide models of this technology for use in other tumor types and in other gene transfer experiments in which NIS is used as a therapeutic gene.
- nucleic acids comprising (a) a first promoter operably associated with a transgene and a second promoter operably associated with a chimeric gene comprising a sequence encoding a marker polypeptide and a sequence encoding NIS, and wherein the sequences of the chimeric gene are separated by a sequence encoding a protease cleavable linker; or (b) a transgene and a chimeric gene comprising a sequence encoding a marker polypeptide and a sequence encoding NIS wherein the sequences of the chimeric gene are separated by a sequence encoding a protease cleavable linker, and wherein the transgene and chimeric gene are separated by an IRES.
- nucleic acid comprising a transgene and both sequence encoding a marker polypeptide and a sequence encoding NIS, permit both the measurement of transgene expression and transgene localization using any of the methods for evaluating transgene expression and/or localization described herein.
- Example 1 Construction of fusogenic membrane glycoproteins (FMG linked to C-peptide expression plasmids.
- Expression plasmids were prepared with insulin C-peptide linked to two different FMGs: gibbon ape leukemia virus (GALV) hyperfusogenic envelope lacking the cytoplasmic R-peptide and measles virus H glycoprotein.
- GALV gibbon ape leukemia virus
- Expression constructs were made using furin-cleavable or non-cleavable linkers to connect the 33 amino acid C-peptide to either the N-terminus of GALV (Fig. 1) or the C-terminus of Measles H glycoprotein (Fig.2).
- the plasmid DNA of the various expression constructs were generated using a Qiagen Endofree Maxiprep Kit and the DNA was resuspended to a concentration of 1 ⁇ g/ ⁇ l DNA in endotoxin-free Tris-EDTA buffer.
- the cell lines used in the transfection assays were TELCeB ⁇ (for transfection with GALV constructs) or HT1080 cells (for transfection with measles H glycoprotein constructs).
- the cells were plated at a density of 5 x 10 5 cells/well in a six-well plate and grown overnight. The next day, the cells were washed once in PBS and then transfected with different amounts of plasmid DNA using Superfect transfection agent (Qiagen). After 2h at 37°C, the transfection media was removed, the cells were washed once in PBS and then incubated overnight in 1 ml/well of 6% FCS-DMEM.
- Superfect transfection agent Qiagen
- the supernatants were harvested the next day from the respective wells, centrifuged briefly to remove cell debris, and frozen at -20°C.
- the samples were analyzed using ELISA by Mayo Medical Laboratories. The limit of detection of C-peptide in the assay was 33 pM.
- the target cells were plated at a density of 5 x 10 5 cells/well in a six- well plate as described above. The next day, the cells were transfected with 2.5 ⁇ g of plasmid DNA (Superfect, Qiagen) for 2h at 37°C. The cells were washed once in PBS and incubated in 1 ml of 6% FCS-DMEM. At the respective time points, the supernatant was harvested from the respective wells, centrifuged briefly to remove cell debris, and the amount of C-peptide in the supernatant was analyzed. As shown in Fig. 5, the amount of C-peptide released into the supernatant increased with time.
- plasmid DNA Superfect, Qiagen
- Nude mice are challenged with 5 x 10 6 A431 cells or HT1080 cells in 100 ⁇ l PBS administered subcutaneously into each flank.
- A431 is a human epithelial carcinoma cell line and HT1080 is a human fibrosarcoma cell line. Both form xenografts in nude mice. Tumor diameters are monitored daily after cell implantation, and when tumor diameter reaches 0.5 cm x 0.5cm the tumors are injected with 50 ⁇ g of plasmid (CPIGALV or pHR'CMVLacZ or PBS as a control) complexed with 10 ⁇ g DMRIE:DOPE in a final volume of 80 ⁇ l PBS.
- plasmid CPIGALV or pHR'CMVLacZ or PBS as a control
- Tumors are measured daily using calipers, and blood is drawn for C-peptide level determination at various intervals. Animals are monitored daily for signs of distress and are euthanized before tumor diameter reaches 2 cm or if they show signs of distress. At the time of euthanasia, tumors are excised for histological analysis. The concentration of C-peptide in the blood (a measure of the expression of GALV) is correlated with the size and histology of the tumors.
- Example 5 Intratumoral expression of measles F and measles H glycoproteins linked to C- peptide.
- Nude mice are challenged with 5 x 10 6 HT1080 cells in lOO ⁇ l PBS administered subcutaneously into each flank. Tumor diameters are monitored daily after cell implantation, and when tumor diameter reaches 0.5 cm x 0.5 cm the tumors are injected with 50 ⁇ l of 1 x 10 6 HT1080 cells that were previously transfected with plasmids expressing measles F (pFQI) and measles H protein (pCGH Fur CP). F-expressing HT1080 cells transfected with pHR'CMVLac Z are used as controls. Tumors are measured daily using calipers and blood is drawn for C-peptide level determination at various intervals.
- pFQI measles F
- pCGH Fur CP measles H protein
- CMT93 murine colorectal carcinoma cells are transfected with CP1GALV plasmid and selected in 50 ⁇ g per ml phleomycin. Stable transfectants are pooled and tested for release of C-peptide in the tissue culture medium. C-peptide accumulates rapidly. 2 x 10 6 of the transfected CMT93 (washed x 3 in PBS and resuspended in 100 ⁇ l saline) are injected subcutaneously into each flank of 6 nude mice. C-peptide secreting CMT93 tumors grow at the sites of challenge. Tumor diameters are monitored daily and blood is sampled at regular intervals by tail vein bleeds for C-peptide level determination. C-peptide levels are plotted against tumor size/ tumor cell number.
- Example 7 C-peptide expression as a C-terminal fusion to the H glycoprotein of a replicating measles virus.
- the chimeric H glycoprotein was introduced into a full-length measles virus genome and the recombinant measles virus was rescued (Radecke et al., EMBO Journal 14: 5733-5784 (1995)).
- C- peptide was detectable in the supernatant of cultures infected with this recombinant measles virus, and by monitoring the concentration of C-peptide in culture supernatant, it was possible to follow the propagation of this virus in measles virus-infected cultures.
- Vero cell monolayers were infected at low (0.01) multiplicity of infection, and supernatant was harvested at varying time points thereafter for determination of C-peptide concentration and measles virus titer ( Figure 6).
- Example 8 Appearance of C-peptide in urine as an indirect measure of in vivo viral gene expression.
- C-peptide was not detectable in serum or urine of control animals, but was readily detected (43 pM-454 pM) in the urine of mice that had received intratumoral injections of the C-peptide expressing measles virus.
- the present invention provides a nucleic acid construct comprising sequences encoding a transgene, a marker polypeptide, and optionally a proteast cleavable linker, which, in one embodiment, can be contained within an engineered viral vector, such as lentiviral vectors.
- an engineered viral vector such as lentiviral vectors.
- Strategies for manipulating the host/range properties of lentiviral vectors have been developed and tested in ex vivo tissue culture systems.
- VSVG pseudotyped lentiviral vector particles that were concentrated by ultracentrifugation were considered unsuitable for studies of systemic gene delivery because the clumping of pelleted viruses can significantly impact their biodistribution.
- high-speed centrifugation destroys the integrity of lentiviral vectors pseudotyped with MLV envelopes.
- lentiviral vectors are produced without high-speed centrifugation, by a three plasmid co-transfection of 293 T cells and the vectors are harvested into serum-free DMEM, which is subsequently adjusted to pH7.7 by the addition of sodium hydroxide. Calcium chloride is then added to the vector containing supernatant (60 ⁇ M final concentration) and the fine precipitate of
- luciferase is a suitable marker gene according to the present invention
- concentrated stocks of luciferase lentiviral vectors were made, pseudotyped either with the VSVG envelope glycoprotein or with the 4070A MLV envelope glycoprotein.
- the concentrated vector was administered intravenously to nude mice at a dose of 500 ⁇ L of vector (10 8 RLU/ml) on three successive days.
- Mouse organs were harvested one week, two weeks and three weeks following vector administration, and luciferase activity in each of these organs was assayed using standard methods. The results of these experiments are shown in Table 2 and provide a clear demonstration that luciferase can be detected in the organs of these mice after systemic administration of concentrated lentiviral vectors.
- Example 10 Construction of fusogenic membrane glycoproteins (FMG linked to NIS expression plasmids.
- Expression plasmids were prepared with the nucleotide sequence encoding NIS linked to two different FMGs: gibbon ape leukemia virus (GALV; Delassus et al., Virology 173: 205-213, 1989) hyperfusogenic envelope lacking the cytoplasmic R-peptide and measles virus H glycoprotein (deStuart et al., Lancet 355: 201-202, 2000).
- GALV gibbon ape leukemia virus
- Virology 173: 205-213, 1989 hyperfusogenic envelope lacking the cytoplasmic R-peptide and measles virus H glycoprotein
- Expression constructs were made using furin-cleavable or non-cleavable linkers to connect the 644 amino acid NIS to either the N-terminus of GALV ( Figure 13) or the C-terminus of Measles H glycoprotein ( Figure 14).
- Example 11 In vivo gene transfection using adenovirus.
- Ad5-CMV-NIS human prostate cancer cell line
- Ad5-CMV-NIS human prostate cancer cell line
- CMV-NIS right flank
- control virus left flank
- mice were injected intraperitoneally with of 500 ⁇ Ci 123 I and radioiodine imaging was performed using a gamma camera. Regions of uptake were quantified and expressed as a fraction of the total amount of the applied radioiodine. Iodide retention time within the tumor was determined by serial scanning following radioiodine injection, and dosimetric calculations were performed. Tumors were removed and evaluated for NIS expression by western blotting and by immunohistochemistry. In a second group of mice a single injection of 3 ⁇ Ci 13, I was given IP and the mice observed over time for therapeutic responses as described in section 10 above.
- Ad5-CMV-NIS transfected tumors readily trapped iodide and could be imaged with a gamma camera.
- the average uptake in 5 mice was 22.5 ⁇ 10.0% of the injected radioiodine dose.
- tumors transfected with control virus constructs demonstrated no uptake of radioiodine and no image on the gamma camera.
- NIS protein expression was confirmed by western blotting and by immunohistochemistry.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Biochemistry (AREA)
- Genetics & Genomics (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US640198 | 1991-01-11 | ||
| US14916899P | 1999-08-17 | 1999-08-17 | |
| US149168P | 1999-08-17 | ||
| US639667 | 2000-08-16 | ||
| US09/640,198 US6586411B1 (en) | 2000-08-16 | 2000-08-16 | System for monitoring the location of transgenes |
| US09/639,667 US6632800B1 (en) | 1999-08-17 | 2000-08-16 | System for monitoring the expression of transgenes |
| PCT/US2000/022566 WO2001013106A1 (en) | 1999-08-17 | 2000-08-17 | System for monitoring the expression and/or location of transgenes |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1210595A1 true EP1210595A1 (en) | 2002-06-05 |
| EP1210595A4 EP1210595A4 (en) | 2003-12-17 |
Family
ID=27386799
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00957513A Withdrawn EP1210595A4 (en) | 1999-08-17 | 2000-08-17 | SYSTEM FOR MONITORING THE EXPRESSION AND / OR LOCATION OF TRANSGENES |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1210595A4 (en) |
| AU (1) | AU774510B2 (en) |
| CA (1) | CA2381941A1 (en) |
| WO (1) | WO2001013106A1 (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7015027B1 (en) | 2001-11-20 | 2006-03-21 | Mds (Canada) Inc. | Radiation therapy by accumulation of therapeutic radionuclides in tumor-targeting bacteria |
| EP1907537A4 (en) | 2005-07-14 | 2010-11-10 | Mayo Foundation | PREPARATIONS BASED ON PARAMYXOVIRIDAE VIRUS |
| KR101911964B1 (en) | 2010-09-02 | 2018-10-25 | 메이오 파운데이션 포 메디칼 에쥬케이션 앤드 리써치 | Vesicular stomatitis viruses |
| US9951117B2 (en) | 2010-09-02 | 2018-04-24 | Mayo Foundation For Medical Education And Research | Vesicular stomatitis viruses |
| JP2022552265A (en) * | 2019-10-11 | 2022-12-15 | ザ ボード オブ トラスティーズ オブ ザ レランド スタンフォード ジュニア ユニバーシティー | Recombinant Polypeptides for Regulatable Cellular Localization |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5631237A (en) * | 1992-12-22 | 1997-05-20 | Dzau; Victor J. | Method for producing in vivo delivery of therapeutic agents via liposomes |
| US5661032A (en) * | 1994-03-18 | 1997-08-26 | Mcgill University | Tα1 α-tubulin promoter and expression vectors |
-
2000
- 2000-08-17 AU AU69119/00A patent/AU774510B2/en not_active Ceased
- 2000-08-17 CA CA002381941A patent/CA2381941A1/en not_active Abandoned
- 2000-08-17 WO PCT/US2000/022566 patent/WO2001013106A1/en not_active Ceased
- 2000-08-17 EP EP00957513A patent/EP1210595A4/en not_active Withdrawn
Non-Patent Citations (2)
| Title |
|---|
| See also references of WO0113106A1 * |
| VEELKEN H ET AL: "SYSTEMATIC EVALUATION OF CHIMERIC MARKER GENES ON DICISTRONIC TRANSCRIPTION UNITS FOR REGULATED EXPRESSION OF TRANSGENES IN VITRO AND IN VIVO" HUMAN GENE THERAPY, XX, XX, vol. 7, no. 15, 1 October 1996 (1996-10-01), pages 1827-1836, XP009006379 ISSN: 1043-0342 * |
Also Published As
| Publication number | Publication date |
|---|---|
| EP1210595A4 (en) | 2003-12-17 |
| CA2381941A1 (en) | 2001-02-22 |
| AU774510B2 (en) | 2004-07-01 |
| AU6911900A (en) | 2001-03-13 |
| WO2001013106A1 (en) | 2001-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6632800B1 (en) | System for monitoring the expression of transgenes | |
| US7982022B2 (en) | System for monitoring the location of transgenes | |
| Mizejewski | Biological role of α-fetoprotein in cancer: prospects for anticancer therapy | |
| JP6997267B2 (en) | Anti-human papillomavirus 16 E7 T cell receptor | |
| EP1217891B1 (en) | Therapeutic methods and compositions using viruses of the recombinant paramyxoviridae family | |
| CN116444666A (en) | Preparation method and application of CDH17 specific diagnosis and treatment integrated molecular imaging probe | |
| AU774510B2 (en) | System for monitoring the expression and/or location of transgenes | |
| Quadros et al. | Functional human transcobalamin II isoproteins are secreted by insect cells using the baculovirus expression system | |
| US10024854B2 (en) | Method for detecting and purifying pancreatic beta cells | |
| EP3922646A1 (en) | Detection of malignant tumor cells antibodies and uses thereof | |
| US20110064651A1 (en) | Recombinant nucleotide sequence, cell or vector containing the same and method for using cell containing the same to encode anti-polyethylene glycol monoclonal antibodies | |
| US20030017468A1 (en) | Compositions and methods relating to lung specific genes | |
| US6352857B1 (en) | Treatment of diabetes with synthetic beta cells | |
| JP2001517445A (en) | Mutants of thyroid stimulating hormone and methods based thereon | |
| AU2003287452A1 (en) | CALCIUM-SENSING RECEPTOR 2 (CaR2) AND METHODS FOR USING | |
| Bogdanov Jr et al. | Engineering membrane proteins for nuclear medicine: applications for gene therapy and cell tracking | |
| Simonova et al. | Engineering of technetium‐99m‐binding artificial receptors for imaging gene expression | |
| JPH11506921A (en) | Human G-protein receptor HCEGH45 | |
| AU784660B2 (en) | Genes associated with obesity and methods for using the same | |
| CN119462841B (en) | Covalent amino acid modified peptide of affinity PD-1 and application thereof | |
| JP4496321B2 (en) | Process for the preparation of purified and optionally labeled TSH receptor preparations, novel radioiodine labeled TSH receptor preparations and the use of such preparations in diagnosis and therapy | |
| Ghinea | A novel role for FSH receptor as a tumor endothelial cell marker | |
| JP4473730B2 (en) | Antibodies that recognize hyperproliferative cells and methods of making and using the same | |
| WO2006078892A2 (en) | Use of a novel prostate specific membrane antigen for cancer diagnosis and therapy | |
| Lin | Regulation of sodium iodide symporter expression/function and tissue-targeted gene transfer of sodium iodide symporter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20020318 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7G 01N 33/00 A Ipc: 7C 07K 14/705 B Ipc: 7A 61K 31/70 B Ipc: 7C 12P 21/00 B |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20031028 |
|
| 17Q | First examination report despatched |
Effective date: 20050427 |
|
| 17Q | First examination report despatched |
Effective date: 20050427 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20110622 |