EP1194576A1

EP1194576A1 - Delivery system

Info

Publication number: EP1194576A1
Application number: EP00942323A
Authority: EP
Inventors: Mariagrazia Pizza
Original assignee: Chiron SRL
Current assignee: GSK Vaccines SRL
Priority date: 1999-06-25
Filing date: 2000-06-23
Publication date: 2002-04-10
Also published as: GB9914960D0; CA2377534A1; WO2001000857A1; JP2003503066A

Abstract

The invention relates to delivery systems for heterologous antigens. Chromosomal loci within rRNA operons such as those of the 16S or the 23S genes have been identified as useful sites for the integration of nucleic acids into the chromosome of Vibrio cholerae bacteria. A particularly useful regulatory sequence for the direction of high level expression of heterologous antigens in this bacterium has been identified as the OmpU promoter.

Description

DELIVERY SYSTEM

This invention relates to delivery systems for heterologous antigens. One aspect of the invention relates to the identification of chromosomal loci that are useful for the integration of nucleic acids into the chromosome of Vibrio cholerae. Another aspect of the invention relates to the use of the OmpU promoter to direct high level expression of heterologous antigens in Vibrio cholerae.

Vaccination as a deliberate attempt to protect humans against disease has a long history. However, only in the latter half of the 20th century has technology allowed the development of sophisticated vaccination techniques. The advent of the new procedures of molecular genetics has greatly expanded the number of techniques that can be used for designing vaccines.

The general approach to vaccination has historically been to administer biological material from the organism responsible for the particular disease to a human subject. Such material was normally attenuated in some way so that it did not actually cause disease. The humoral response mounted by the immune system against the attenuated foreign proteins primed the body against a subsequent "real" infection, so reducing the incidence of serious disease.

Recent advances in genetic engineering have facilitated the generation of mutant proteins that can be screened for suitability as candidates for vaccines. In view of the potential significance of a successful vaccine, many groups have attempted to detoxify the pathogenic agents responsible for causing these diseases.

For example, in the case of enteropathogenic disease, attenuated non-toxic mutant enterotoxins were developed that no longer induce pathogenic effects in the mammalian body, yet structurally are largely unmodified. Thus, on recognising these proteins as foreign bodies, the immune system directs specific antibodies to the attenuated toxins. These antibodies are then effective against wild type toxins on the occurrence of a genuine infection by live bacteria. Kaslow et al, (1992) separately mutated Asp9 and His44 of cholera toxin protein (CT) and truncated the protein after residue 180. These mutations attenuated the enzymatic activity of the toxin. Similar studies have been performed on the heat labile toxin protein (LT; Sixma et al, (1991) Nature 351(6325): 371-377; Tsuji et al, (1990), J. Biol. Chem. 265(36) pp22520- 22525; Harford e/ α/., (1989), Eur J Biochem 183(2) pp31 1 -316). Detoxified mutants of pertussis toxin have been reported to be useful both for direct intranasal vaccination and as a mucosal adjuvant for other vaccines (Roberts et al, (1995) Infect Immun 63(6) pp2100-2108). A known detoxifying mutation in the A subunit of Bordetella pertussis was found to have an analogous effect in CT (Burnette et al, (1991) Infect Immun 59(1 1) pp4266-4270).

A number of attempts have utilised the ability to directly alter the function of bacterial or viral proteins so as to generate live strains that possess attenuated pathogenicity. Such "live" vaccines can only undergo limited replication in a host, or they encode detoxified proteins. Commonly, a broad spectrum of immunity can result following a single inoculation; this immunity can last for a lifetime. Such methods of vaccination have obvious advantages over multistage inoculation regimes using purified attenuated proteins that are expensive and usually require re-administration in order to guarantee efficacy over long periods of time. In particular, the process of antigen purification for delivery to the body is expensive and in many cases may lead to denaturation of the protein.

There are also various problems associated with the use of attenuated "live" vaccines. Typically, these vaccines are viral-based and genetically plastic. Accordingly, a replicating virus may revert to a more pathogenic form and cause adverse reactions in a vaccinated patient or in a person having had contact with that patient.

Attenuated bacteria have recently been investigated as candidates for the delivery of antigens. A strain of Salmonella typhi (CVD908) appears to be a promising candidate for the delivery of antigens and has the added advantage that mucosal immunisation with such strains elicits both mucosal and cell-mediated immune responses, in addition to stimulating serum antibodies.

Genetic manipulation of such strains should allow the concurrent administration of multiple antigens, so providing broad spectrum protection. Several groups have investigated this approach with the aim of generating a safe and effective multivalent oral diptheria-tetanus- pertussis (DTP) vaccine. To date, researchers have demonstrated the successful expression and protective ability of the non-toxic, immunogenic fragment C (FragC) of tetanus toxin in S. typhimurium (Chatfield et al, (1992) Vaccine 10(1) pp53-60; Fairweather et al, (1990) Infect Immun 58(5) pp 1323-1326; Galen et al, (1997) Vaccine 15(7) pp700-708). The Vibrio cholerae bacterium has previously been investigated for suitability as a carrier for the Shiga toxin of the enteropathogens E. coli (Butterton et al, 1995; Acheson et al, 1996) and Shigella sonnei (Viret et al., 1996; Favre et al, 1996).

One problem with these live oral vaccines is that there are presently no good vectors for the effective high level expression of attenuated antigens in the human intestine.

Bacterial and viral-induced diseases therefore continue to be a major cause of suffering and death, particularly in the developing world. The poor health care in these areas and general poverty means that there is a desperate need for cheap, effective vaccines that do not need repeated administration in order to be continuously effective. Such vaccines would also significantly increase the efficacy of preventive medicine and reduce the costs of healthcare in the developed world.

The level of expression of heterologous antigens attainable in bacterial "live" vaccine strains is clearly of great importance to optimise vaccination regimes and to ensure effective vaccination. The inventors have now developed systems to facilitate the creation of attenuated bacterial vaccines and to improve the level of expression of heterologous antigens in those strains.

Summary of the invention

According to the present invention there is provided a recombinant Vibrio cholerae bacterium comprising a nucleic acid encoding an heterologous protein or protein fragment inserted at a locus within a 16S or 23S gene in the chromosome.

This system relies on stable chromosomal integration of nucleic acid, that allows expression of proteins heterologous to Vibrio cholerae, in a site that has been found to be dispensable for the survival of the bacterium. A phenomenon that has until now proven problematic is that when genes are inserted randomly into a bacterial chromosome, this more often than not causes the bacteria to become compromised to some extent, either in its rate of growth or in its general viability. This has led to the widespread use of plasmid or bacteriophage vectors that are in many cases not suitable for the stable high level expression of heterologous proteins.

It has been found, surprisingly, that rRNA operons such as the 16S and 23 S operons are particularly suitable targets for chromosomal integration of foreign nucleic acid fragments. Insertion of a foreign nucleic acid at these sites has been found to allow effective high level expression of heterologous protein without compromising the growth rates or viability characteristics of the Vibrio cholerae bacteria.

This method of gene targeting involves the replacement of part of the wild type rRNA gene with a disrupted copy of the gene, in which a nucleic acid encoding an heterologous protein has been inserted. This integration event may most suitably be carried out by homologous recombination, whereby the foreign gene is introduced into the V. cholerae bacteria, flanked by sequence corresponding to that of the targeted rRNA gene, so allowing recombination to take place. Techniques of homologous recombination are well known in the art and are described, for example in Sambrook et al. ( 1989).

An advantage of using rRNA genes is that these genes are present in more than one copy across the genome of V. cholerae, so that disruption of one copy does not influence the vitality of the strain or its ability to adhere, colonise and multiply in an infected host. The advantage of using site-specific recombination for insertion is that the site of insertion of well known and can be easily characterised.

Preferably, the nucleic acid encoding heterologous antigen is inserted into a 23 S rRNA operon in the bacterial chromosome.

According to a further aspect of the invention, there is provided a recombinant bacterium in which a nucleic acid encoding an heterologous protein or protein fragment is cloned under the control of an OmpU promoter, preferably the V. cholerae OmpU promoter. This promoter has been identified as an ideal promoter for the induction of high level expression of foreign antigens in Vibrio cholerae, since high level expression can be attained without compromising the growth rate or viability of the strain.

In its natural context in V. cholerae, the OmpU promoter drives expression of a 38kDa outer membrane protein, that is shown herein to be expressed at very high levels in the cell. Preferably, the OmpU promoter used is the natural promoter found in Vibrio cholerae, although it is envisaged that improvements in the efficacy of this promoter may be achieved by iterative rounds of mutagenesis and selection. Such methods are known to those of skill in the art (see. for example, Ling and Robinson, 1997, Anal Biochem, 254:157-178; Gorb et al, 1997, J. Bacteriol., 179: 5398-5406). According to a further aspect of the present invention there is provided a recombinant bacterium in which a nucleic acid encoding an heterologous protein or protein fragment is cloned under the control of an OmpU promoter and is inserted at a locus within an rRNA operon in the Vibrio cholerae chromosome. This combination of selective targeting for gene insertion and the use of the OmpU promoter has been found to provide a particularly high level of heterologous protein expression, yet without compromising the growth rate or general viability of the bacterial strain. Preferably, the nucleic acid is inserted at a locus within a 16S or 23S gene, more preferably a 23S gene, in the Vibrio cholerae chromosome.

By "heterologous protein or protein fragment" is meant any protein or fragment that is not endogenous to V. cholera. The protein may be thus be derived from any source and may even be a protein endogenous to the host subject to be immunised, for example human tumour antigens or adhesins such as filamentary haemaglutinin (FHA), pertactin or fimbriae. Suitable proteins are immunogenic and thus invoke an immune response when expressed in a mammalian host that has intentionally been infected with Vibrio cholerae bacteria according to the invention. Most suitable, therefore, are proteins known to be particularly immunogenic. The immune response may be a cellular, or a humoral response.

Preferably, heterologous proteins produced according to the present invention are derived from known pathogens, such as viruses and bacteria.

It is also envisaged that more than one heterologous protein or protein fragment may be targeted to a rRNA locus in the chromosome and/or may be cloned under the control of the OmpU promoter. Expression of multiple antigens in this fashion may thus provide broad spectrum protection against a number of different diseases.

According to a further aspect of the invention there is provided a recombinant bacterium according to any one of the above-described aspects of the invention which expresses at least one heterologous protein that is effective in the host as an adjuvant and at least one heterologous protein that is effective in the host as an antigen.

In particular, it is envisaged that two, three, four or more heterologous proteins may be co- expressed in the recombinant bacteria of the invention. One or more of these proteins may act as an adjuvant, whilst the other proteins may act as antigens. For example, the LTK63 and CTK63 antigens (which contain serine-to-lysine substitutions at position 63 of the A subunit) and LTR72 antigen (which contains an alanine-to-arginine substitution in position 72 of the A subunit) function well as mucosal adjuvants in animal models. Accordingly, it is envisaged that heterologous proteins such as the LTK63 gene, CTK63 gene and/or the LTR72 gene may be inserted into the V. cholerae chromosome into an rRNA gene target site, preferably operably linked to the OmpU promoter. The V. cholerae chromosome may already contain at other rRNA operon insertion sites, a gene or genes encoding one or more heterologous proteins such as NAP and/or CagA, again, preferably operably linked to the OmpU promoter to maximise protein expression. In this fashion, the recombinant "live" bacteria will not only possess immunological potential, but will act as effective adjuvants to increase their potency as vaccine agents.

In many cases, the heterologous protein may be harmful to the host if unmodified and therefore derivatives of the wild type protein should be used. As used herein, the term "derivatives" includes, for example, mutants containing amino acid substitutions, insertions or deletions that do not significantly alter the immunogenicity of the protein. In particular, conservative amino acid substitutions generally have little effect on the activity of protein molecules and are especially suitable. Derivatives of proteins that are endogenous to Vibrio cholerae such as the cholera toxin protein (CT) are also considered suitable for use according to the present invention.

Protein fragments are also suitable for expression in bacteria according to the present invention. The advantage of these molecules is that generally they exhibit significantly- reduced toxicity, yet retain their immunogenicity. Most suitable are fragments containing epitopes known to be most immunogenic, such as, for example, the fragment C of tetanus toxin from Clostridium tetani. The term "fragments" includes antigenic peptides that encompass or define antigenic epitopes.

The heterologous proteins or protein fragments suitable for use in the present invention also include proteins such as the heat labile toxin protein from strains of E. coli, tetanus toxin, tracheal colonisation factor and pertussis toxin from B. pertussis, NAP, VacA and CagA from H. pylori, E6 and E7 from papilloma virus, gD2 from Herpes virus, El or E2 core antigens from HCV, gpl20 from HIV menigococcus and gonococcus antigens, antigens from rotavirus, influenza virus and malaria parasites. Other suitable toxins will be known to those of skill in the art. Of particular suitability to the present invention as an heterologous antigen is the neutrophil activating protein (NAP). NAP is a homodecamer of 15kDa subunits, and promotes activation and adhesion of neutrophils to endothelial cells. Whilst it is has been suggested that this function is unlikely to be related to its intracellular function, the proadhesive activity can be neutralised by antiserum. Since neutrophil activation and adhesion to endothelial cells constitute inflammation mechanisms, and since H.pylori is responsible for stomach inflammation, it seems likely that NAP represents the factor, or a factor, of H.pylori responsible for inflammation, probably at an early stage of gastric ulcer disease when an abundant accumulation of neutrophils in the superficial gastric mucosa is observed. For this reason, NAP is an ideal candidate for use in a live bacterial vaccine.

The heterologous protein expressed according to the present invention may be a toxin or toxin derivative. As used herein, the term "toxin" refers to any protein produced by a pathogen that is toxic to a host animal and may be synthetic, or naturally-derived, for example from bacteria or viruses. Preferably, toxins derived from bacterial pathogens are used in accordance with the present invention.

Toxins are particularly suitable for use according to the present invention, since any immune response invoked against the toxin will not only eradicate bacteria expressing toxins with recognised epitopes, but will also titrate out any copies of the toxin protein that are secreted from the bacteria before the bacteria themselves have been killed by the immune system.

Toxin proteins of enterobacteria have been studied in great detail and it is known how to produce detoxified mutants of many known toxins (toxoids) from diverse pathogenic species. The term "toxoid" as used herein refers to a detoxified mutated toxin protein.

The term "detoxified" means that the mutant molecule exhibits a lowered toxicity in a host relative to the wild type protein. Toxicity need not be completely abrogated, but must be sufficiently low to be used in an effective immunogenic composition without causing significant side-effects in the infected subject.

Toxicity may be measured using one of several methods. Such methods include testing toxicity in mouse cells, or CHO cells, or by evaluation of the morphological changes induced in Yl cells. Preferably, toxicity is assessed by the rabbit ileal loop assay. Preferably, the toxicity of the toxoid is reduced 10,000- fold relative to its wild type counterpart as measured in Yl cells or greater than 10-fold as measured by the ileal loop assay.

The now conventional techniques of recombinant DNA methodology can be used to introduce randomly or rationally-directed mutations into the amino acid sequence of a toxin molecule to produce toxoid molecules. Preferably, mutations are introduced by site-directed mutagenesis (SDM). There are many techniques of SDM now known to the man of skill in the art, including oligonucleotide-directed mutagenesis using PCR as set out, for example by Sambrook et al, (Molecular cloning, A laboratory manual. (1989) 2nd edition. Cold Spring Harbor Laboratory Press) or using commercially available kits.

The encoding genes of many toxins suitable for use in this aspect of the present invention are known in the art. Of particular note is the definitive reference by Domenighini et al, (1995) Mol microbiol 15(6) ppl 165-1167) that reviews the sequences of toxin A and B subunits from various enterotoxic strains of E. coli.

For example, any alteration in amino acid sequence in any subunit of toxins such as the LT and CT toxins (herein referred to as LT-A and CT-A), that has a detoxifying effect without significantly reducing immunogenicity, is suitable for use in the present invention. The immunogenic detoxified protein may adopt substantially the same structural conformation as the wild type naturally-occurring toxin. It is immunologically active and may cross-react with antibodies to the wild type toxins.

With respect to CT-A and LT-A, any insertion, substitution or deletion mutation at, or in positions corresponding to Val-53, Ser-63, Val-97, Ala-72, Tyr-104 or Pro-106 will have the desired effect. Preferably, the mutation is a substitution for a different amino acid. Preferred substitutions include Val-53-Asp, Ser-63-Lys, Ala-72-Arg, Tyr-104-Lys or Pro-106-Ser.

Optionally, the CT or LT toxoid may contain other mutations such as, for example, substitutions at one or more of Arg-7, Asp-9, Arg-1 1, His-44, Arg-54, Ser-61, His-70, His- 107, Glu-110, Glu-1 12, Ser-114, Trp-127, Arg-146 or Arg-192. These mutations have been measured as being completely non-toxic or with a low residual toxicity as measured by the assays described above.

Of particular suitability are mutants of the heat-labile enterotoxin (LT) of E. coli, particularly the mutant that contains the substitution Ser-63-Lys (LTK63). The amino acid residue or residues that replace the wild type in the protein sequence may be naturally-occurring or synthetic. Preferred substitutions are those that alter the amphotericity and/or hydrophilicity of the toxin whilst retaining as far as possible the structural integrity of the protein. Such amino acids have a similar steric effect to the wild type residue.

Preferably, with reference to CT, the mutation used is Ser-63-Lys (herein CTK63) and with reference to LT, the mutation used is Ser-63-Lys (herein LTK63).

The choice of bacterial Vibrio cholerae strains for use in the present invention include any strain that may be cultured with ease in vitro, and will depend on what goal is desired. For example, if high level expression is needed for purposes of protein purification, then a high level producer strain will be used. More usually, the aim will be to produce a live vaccine that is effective in humans to prevent infection from a particular pathogen. In this scenario, an attenuated Vibrio cholerae strain should be used.

Attenuated strains of Vibrio cholerae colonise the human intestine efficiently, yet safely, and generate antibodies with high bactericidal or anti-viral activity. Such "live" strains possess attenuated pathogenicity and can either only undergo limited replication in a host or encode detoxified proteins. Commonly, a broad spectrum of immunity can result following a single inoculation. This immunity can last for a lifetime.

As used herein, the term "attenuated" means that the toxicity of the bacterial strain is diminished to negligible levels in mammals. Such strains are live, undergo a normal life cycle, yet secrete non-toxic mutant proteins or protein fragments. The host thus suffers none of the pathogenic symptoms that are associated with wild type (non-attenuated) strains, yet the immune system of the host is still exposed to the foreign proteins expressed by the bacterial agent. Preferably, the bacterial strain suitable for use in the present invention is a naturally attenuated bacterium.

A particularly suitable strain for use as a live vector for the presentation of antigens in this context is the IEM 101 strain, the subject of co-owned co-pending European patent application 98305060.0, entitled "Attenuated cholerae strains". This strain reaches and colonises the small intestine in large numbers. The bacteria are able to penetrate the mucus layer and adhere to the mucosal epithelia, meaning that they successfully invoke an immune response. According to a further aspect of the present invention there is provided an immunogenic composition comprising a recombinant strain of V. cholerae of the above-described aspects of the invention in conjunction with a pharmaceutically-acceptable carrier.

Pharmaceutically-acceptable carriers include any carrier that does not itself induce the production of antibodies harmful to the individual receiving the composition. Suitable carriers are typically large, slowly metabolised macromolecules such as proteins, polysaccharides, polylactic acids, polyglycolic acids, polymeric amino acids, amino acid copolymers, lipid aggregates (such as oil droplets or liposomes) and inactive virus particles. Such carriers are well known to those of skill in the art. Additionally, these carriers may function as immunostimulating agents (adjuvants).

The composition may be used as a vaccine and may thus optionally comprise an adjuvant.

Suitable additional adjuvants to enhance effectiveness of the immunogenic compositions according to the present invention include, but are not limited to: (1) non-toxic mutants of heat labile toxin protein or pertussis toxin protein, such as described, for example in Tsuji et al, (1990); Harford et al, (1989) and Roberts et al, (1995); (2) oil-in-water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components), such as for example (a) those formulations described in PCT Publ. No. WO 90/14837, including but not limited to MF59 (containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below), although not required) formulated into submicron particles using a microfiuidizer such as Model 1 10Y micro fluidizer (Microfluidics, Newton, MA)), (b) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr- MDP (see below) either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and (c) Ribi adjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox™); (3) saponin adjuvants, such as Stimulon (Cambridge Bioscience, Worcester, MA) may be used or particles generated therefrom such as ISCOMs (immunostimulating complexes); (4) Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IFA); (5) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc; and (6) other substances that act as immunostimulating agents to enhance the effectiveness of the composition.

As mentioned above, muramyl peptides include, but are not limited to, N-acetyl-muramyl-L- threonyl-D-isoglutamine (thr-MDP), N-acetyl-normuramyl-1-alanyl-d-isoglutamine (nor- MDP), N-acetylmuramyl-l-alanyl-d-isoglutaminyl-l-alanine-2-( 1 '-2'-dipalmitoyl-.s77-glycero-3- hydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.

According to a further aspect of the invention, there is provided a process for the formulation of a vaccine composition comprising bringing recombinant bacteria according to the above- described aspects of the invention into association with a pharmaceutically-acceptable carrier, optionally with an adjuvant.

According to a still further aspect of the present invention, there is provided a method of vaccinating a mammal against a disease, comprising administering a preparation of bacteria according to the above-described aspects of the invention, that expresses an antigen associated with a pathogen responsible for the disease.

According to a further aspect of the present invention, there is provided a nucleic acid comprising sequence derived from the 5' and 3' regions of a rRNA operon flanking sequence encoding a protein or protein fragment that is heterologous to Vibrio cholerae. Such a nucleic acid is useful for the generation of recombinant Vibrio cholerae bacteria according to the above-described aspects of the invention. The sequence derived from the rRNA operon enables an homologous recombination event to occur that results in the replacement of the endogenous rRNA operon for the disrupted version in which the nucleic acid encoding an heterologous protein or protein fragment is flanked by rRNA sequence. Preferably, the rRNA operon is either the 16S or the 23S gene. In a most preferred embodiment of this aspect of the invention, the nucleic acid encoding the heterologous protein or protein fragment is cloned under the control of the OmpU promoter.

According to a still further aspect of the present invention there is provided a nucleic acid comprising the OmpU promoter operably linked to a nucleic acid encoding a protein or protein fragment that is heterologous to Vibrio cholerae. By the term "operably linked" is meant that the promoter contains the requisite regulatory sequences necessary to drive the expression of the nucleic acid encoding heterologous protein that is cloned downstream of the promoter.

According to a still further aspect of the invention, there is provided a nucleic acid comprising the OmpU promoter operably linked to a nucleic acid encoding a protein or protein fragment that is heterologous to Vibrio cholerae, which nucleic acid is flanked by sequence derived from the 5' and 3' regions of a Vibrio cholerae rRNA gene, preferably a 16S or 23S gene.

The nucleic acid of these aspects of the invention may be incorporated in a vector, such as a plasmid or bacteriophage. Any suitable vector can be used for transformation of Vibrio cholerae bacteria, as will be clear to those of skill in the art. Particularly suitable vectors include that used in the present study. CVD422, which is unable to replicate in the host cell.

According to a further aspect of the present invention there is provided the use of an rRNA operon as a locus for insertion of a nucleic acid encoding an heterologous protein or protein fragment into the chromosome of a Vibrio cholerae bacterium. Preferably, the rRNA operon is either the 16S or the 23 S gene.

The invention also provides the use of the OmpU promoter for expression of an heterologous antigen in a Vibrio cholerae bacterium.

According to a further aspect of the present invention, there is provided a method of expression of an heterologous protein or protein fragment in a Vibrio cholerae bacterium comprising targeting a nucleic acid encoding the protein or protein fragment to a chromosomal locus in a rRNA operon, preferably a 16S or 23S RNA gene in the Vibrio cholerae bacterium.

The invention also provides a method of expression of an heterologous protein or protein fragment in a Vibrio cholerae bacterium comprising cloning a nucleic acid encoding the heterologous protein or protein fragment under the control of an OmpU promoter.

According to a still further aspect of the invention, there is provided a method of expression of an heterologous protein or protein fragment in a Vibrio cholerae bacterium comprising targeting a nucleic acid encoding the protein or protein fragment to a chromosomal locus in a rRNA operon, preferably a 16S or 23S RNA gene in the Vibrio cholerae bacterium and expressing a nucleic acid encoding the heterologous protein or protein fragment under the control of an OmpU promoter.

According to a further aspect of the invention, there is provided a method of vaccinating a mammal against a disease, comprising administering a preparation of recombinant bacteria according to the above-described aspects of the invention, that expresses an heterologous protein or protein fragment that is associated with a pathogen responsible for the disease.

The host for infection by the bacteria of the present invention is the human; humans are the only organisms that are susceptible to infection by V. cholerae.

All documents mentioned in the text are incorporated herein by reference.

Various aspects and embodiments of the present invention will now be described in more detail by way of example. It will be appreciated that modification of detail may be made without departing from the scope of the invention.

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 : Knocking out a copy of the 23S rRNA gene does not influence the rate of bacterial growth.

Figure 2: Insertion of the kanamycin resistance gene in IEM23SKm^r la and lb and IEM23SKm^r 2a and 2b occurred in two different copies of rRNA 23S gene.

Figure 3: a) Growth curve of IEM 101 Vibrio cholerae strain.

b) Protein expression at various time points of IEM 101 growth.

Figure 4: Comparison of rates of growth for the two strains IEM 101 and IEM-ompNAP.

Figure 5: Level of expression of NAP in strain IEM-ompNAP.

Figure 6: Western blot showing that NAP is expressed in V. cholerae in the decameric form.

Figure 7. Comparison of levels of NAP when expression is driven by OmpU or nirB promoter. Western blot of total cell extract loaded on 15% SDS PAGE. Lane 1, purified NAP. Lane 2. IEMo pNAP. Lane 3, IEMwrNAP. Figure 8. Serum Ig titres anti-NAP. Ig anti-NAP mean titre in serum of mice immunized with purified NAP, purified NAP in combination with purified CTK63, lEMompNAP and IEMmVNAP live bacteria.

Figure 9. Serum IgA titres anti-NAP. IgA anti-NAP mean titre in serum of mice immunized with purified NAP, purified NAP in combination with purified CTK63, IEMom NAP and IEMm^'rNAP live bacteria.

Figure 10. Mucosal IgA anti-NAP. a) Individual titres of IgA anti-NAP in bile of mice immunized with purified NAP, purified NAP plus CTK63, lEMompNA? and IEMwVNAP strains, b) Individual titres of IgA anti-NAP in nasal washes of mice immunized with purified NAP, purified NAP and purified CTK63, IEMo pNAP and IEMn/rNAP. The dark bars in a and b indicate the mean titres.

EXAMPLES

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature eg. Molecular Cloning; A Laboratory Manual, Second Edition (Sambrook, 1989); DNA Cloning, Volumes I and ii (ed. Glover 1985); Oligonucleotide Synthesis (ed. Gait 1984); Nucleic Acid Hybridization (ed. Hames & Higgins 1984); Transcription and Translation (ed. Hames & Higgins 1984); Animal Cell Culture (ed. Freshney 1986); Immobilized Cells and Enzymes (IRL Press, 1986); A Practical Guide to Molecular Cloning (Perbal, 1984); the Methods in Enzymology series (Academic Press, Inc.), especially volumes 154 & 155; Gene Transfer Vectors for Mammalian Cells (ed. Miller & Calos 1987, Cold Spring Harbor Laboratory); lmmuno chemical Methods in Cell and Molecular Biology (ed. Mayer & Walker, 1987); Protein Purification: Principles and Practice (Scopes, 1987); Handbook of Experimental Immunology, Volumes I-IV (ed. Weir & Blackwell 1986).

Example 1: Amplification and cloning of genes coding for the ribosomal RNA (rRNA) 16S and 23S of Vibrio cholerae.

The ribosomal RNA 16S and 23S genes (rRNA 16S and rRNA 23S) are present in nine copies along the chromosome of V. cholera. We have identified them as chromosomal locus for insertion of genes coding for heterologous antigens. Using the database from the GeneBank the nucleotide sequences of the 16S rRNA and 23S rRNA genes were identified using the accession numbers X74696 and U 10956 respectively. Two fragments, comprising the 5'end and the 3' ends, respectively, of each of the two genes were generated by PCR. In the case of 16S rRNA gene, the fragment comprising nucleotides from 1 to 434 was amplified using the following oligonucleotides: 5'-

GCTCTAGAATTGAAGAGTTTGATCCTGGCTCAG-3' (forward) including the Xbal restriction site and 5'-CGCGGATCCGTTAACGTACTTTACAACCCGAAGGCC-3' (reverse) including the BamHI and Hpal restriction sites. The fragment comprising nucleotides from 1 1 16 to 1455 was amplified using the oligonucleotides: 5'- CGGGATCCGGGGTACCAACTGCAGCCTTGTTTGCCAGCACGT-3' (forward) including BamHI, Kpnl and Pstl restriction sites and 5'- CCGGAATTCTCCCGAAGGTTAAACTACTGCTTC-3' (reverse) containing the EcoRI restriction site. In the case of 23S rRNA gene, the fragment comprising nucleotides from 33 to 370 was amplified using the oligonucleotides 5'- GCTCTAGAGGGCAGTCAGAGGCGATGAG-3' (forward) including the Xbal restriction site and 5'-CGGGATCCCAAGCTTCCGCCCTACTCGATTTCAG-3' (reverse) including the BamHI and Hindlll restriction sites. The fragment comprising from nucleotide 708 to 1077 was amplified using the following oligonucleotides: 5'- CGCGGATCCCAGCTGCAGCAACTGGAGGACCGAACC-3' (forward) including BamHI, PvuII and Pstl restriction sites and 5'-

CCGGAATTCTTTCTTTAAATGATGGCTGCTTCTAAG-3' (reverse) including EcoRI restriction site.

The DNA fragments containing the 5' and 3' regions of the rRNA 16S gene were cloned together into the Blue Script KS vector, using the following strategy: the amplified fragment of 434 bp was digested with Xbal and BamHI, ligated with the amplified fragment of 339 bp digested with BamHI and EcoRI and cloned into Bluescript KS digested with Xbal-EcoRI, generating BS-16S.

The 5' and 3' regions of the rRNA 23S were cloned together into the Blue Script KS vector, using the following strategy: the 337 bp amplified fragment was digested with Xbal and BamHI, ligated with the amplified fragment of 369 bp digested with BamHI and EcoRI and cloned into Bluescript KS digested with Xbal-EcoRI, generating BS-23S.

Example 2: Strategy used to construct a Vibrio strain knock-out in the rRNA 23S gene. The CVD422 suicide plasmid was used for the knock-out of the 23S gene by insertion of the kanamycin resistant gene, into the Vibrio chromosome. CVD422 contains the β- lactamase and the SacB genes that are useful markers for selection. The Kanamycin resistance gene was isolated as BamHI fragment of about 1.2 kb from pUC4K plasmid and cloned in BS-23S digested with BamHI, generating the recombinant BS-23SKmr plasmid. The BS-23SKm' plasmid was digested with the restriction enzymes Sad and EcoRV, the fragment of about 2.0 kb was cloned into CVD442 Sacl-Smal digested, to generate CVD- 23Skm'. This plasmid was transformed into the E. coli SM10 (pir donor strain and this recombinant strain used for conjugation of the IEM 101 recipient strain (polimixin B, gentamicin resistant). The first recombination event was selected by plating the bacteria, recovered from the conjugation, on LB agar containing 100 μg/ml of ampicillin, 0.75 μg/ml of polimixin B and 0.75 μg/ml of gentamicin. The second recombination event, in which the suicide vector (CVD422, Amp^r, Sucrose^s) has deleted from the chromosome, was selected by growing bacteria at 28° C on a medium containing 10% sucrose. The sucrose resistant bacteria have re-plated on L.B. agar supplemented with 15 ug/ml of Kanamycin. The recombinant IEM101 strains, (Amp^s, Sucr', Km¹) having the kanamycin resistance gene integrated onto the chromosome into the rRNA 23 S gene were named IEM-23SKmr.

Example 3: Characterisation of the IEM101 strain knock-out in the rRNA 23S gene.

It has been evaluated whether the interruption of a copy of the ribosomal gene 23S affects bacterial survival and growth of the two strains IEM101 and IEM23SKm^r. To do this, IEM 101 and four IEM23SKm^r recombinant strains (la, lb, 2a and 2b) were growth in 20 ml LB at 37° C starting from a dilution 1 :50 of an overnight culture. Samples were collected at initial time of growth (T₀) and after 3 and 6 hours of growth. The optical density at 600 nm(O.D.₆₀o) were assessed, the cultures diluted and the bacterial dilutions plated on LB agar.

The results of this experiment were plotted in the graphic shown in Figure 1. These results show that the knock-out of a copy of the rRNA gene does not influence the rate of growth.

The chromosomal sites of insertion of the Kanamycin resistance gene in the four

IEM23SKm^r recombinant strains were characterised by Southern Blot analysis. To do this, chromosomal DNAs deriving from IEM101 and recombinant IEM23SKmr l a, lb, 2a and

2b strains were digested with PvuII restriction enzyme and loaded on a 0,8 % agarose gel. After transfer on nitrocellulose membrane the chromosomal DNAs were probed with a labelled 520 bp Xhol/Hindlll fragment of Km¹ gene. The results of this experiment, show that the IEM23SKm' l a and lb strains had the same hybridisation pattern, and that it was different from that of IEM23SKm' 2a and 2b strains (Figure 2) indicating that the insertion of the kanamycin resistance gene in IEM23SKm' la and lb and IEM23SKm' 2a and 2b occurred in two different copies of rRNA 23 S gene.

Example 4: Identification, in total cell extract of V. cholerae, of OmpU outer membrane protein as a highly expressed protein.

The OmpU promoter was identified as follows: The IEM101 strain was grown at 37° C in 50 ml of L.B. medium, starting from a dilution 1 :50 of an overnight culture. 1 ml samples were collected every 30 min for a period of 6.5 hours. The O.D.₆₀o of the samples was evaluated and the relative curve is reported in Figure 3a. The bacterial samples were centrifuged, and the pellets resuspended in PBS to obtain an O.D.₆oo of 28. 10 ul of each sample were loaded on a 10% polyacrylamide gel.

The results, reported in Figure 3b, showed that a protein of approximately 38 kDa was expressed in higher amount respect to the other proteins present in the total cell extract. The protein was expressed at high level, preferentially, in the late exponential phase of growth, reaching the maximum after 3 hours of growth, and at an O.D.₆₀o = 2 of bacterial culture.

To identify the protein, the sample corresponding at 6 hours of growth was loaded on 10% SDS-PAGE and transferred on Sequi-blot PVDF membrane (Biorad, Hercules, California). The amino-terminal was determined by automated sequence analysis on a Beckman sequencer (LF 3000) equipped with an on line phenyl hiohydantoin-amino acid analyser (system gold) according to the manufacturer. The deduced amino-terminal sequence was used to screen NCBI Basic BLAST proteins database and identified as the amino terminal portion (residues 22-41 ) of V. cholerae OmpU outer membrane protein.

Example 5: Amplification of the OmpU outer membrane protein promoter region and cloning in pGEM3 vector.

The nucleotide sequence related to the OmpU gene was obtained from the GeneBank database using the accession number U73751. The promoter and the upstream regulatory regions were identified by sequence analysis and the fragment from the nucleotide 600 to 824 (just before ATG codon) was amplified. The following oligonucleotide: 5'- CGCGGATCCGTTAACTCGCGACAATAAAACAGTGTTCATAAGTTG-3' (forward) containing the restriction sites BamHI, Hpal and Nrul, and oligonucleotide 5'- CGCGGATCCGTTAACGATATCCTCGAGCTTATTAAGTCCTAATTTATTGTC-3' (reverse) containing the restriction sites BamHI, Hpal, EcoRV and Xhol were used for the amplification. The amplified fragment of about 280 bp was digested with BamHI. This fragment was cloned in the pGEM3 vector (Promega, WI. USA) digested with BamHI, to generate the pGEM-omp plasmid.

Example 6: Cloning of the gene coding for the NAP protein derived from Helicobacter pylori under the control of the OmpU promoter.

The gene coding for NAP protein was amplified from the plasmid pSM214G (provided by Roberto Petracca, IRIS, Chiron S.p.A., Siena) using the oligonucleotides 5'- AACTGCAGCTCGAGATGAAAACATTTGAAATT-3' (forward) including the restriction sites Pstl and Xhol and 5'-CGGGGTACCGATATCTTAAGACAAATGAGC-3' (reverse) including the restriction sites Kpnl and EcoRV The amplified fragment of about 470 bp containing the coding sequence for NAP, was digested with the enzymes Xhol and EcoRV and cloned in pGEM-omp digested XhoI/EcoRV, to generate the p-ompNAP plasmid.

Example 7: Construction of the IEM-ompNAP recombinant strain

To insert the NAP gene under the control of the OmpU promoter into the rRNA 23 S chromosomal sequences of IEM 101 , the OmpU-^'NAF DNA sequence was cloned within the 5' and 3' regions of 23S gene. To do this, the p-ompNAP plasmid was digested with BamHI and cloned into pBS-23S, digested with BamHI, generating the BS-23SompNAP plasmid. This plasmid was digested with Sacl-Sall, and the resulting fragment of 1.5 kb, containing the NAP gene under the control of OmpU promoter flanked by the 5' and 3' ends of the rRNA 23 S gene, was cloned in the CVD 422 vector digested with Sacl-Sall to generate the CVD-23SompNAP plasmid. This plasmid was introduced by transformation in SM10 (pir donor strain, and the recombinant strain used for conjugation of the IEM-23SKm^r recipient strain (gentamicin, polimixin and Kanamycin resistant).

Following conjugation, the recombinant strains, resulting from a single recombination event and containing the entire recombinant plasmid integrated onto the chromosome in the rRNA 23S gene locus, were selected by plating on L.B. agar supplemented with 100 ug/ml ampicillin, 0.75 ug/ml gentamicin and 0.75 ug/ml polimixin and 15 ug/ml kanamycin.

To select for the loss of the plasmid sequences and therefore for the second recombination event, the recombinant colonies Amp, Gm, Pol, Kan resistant were grown overnight at 28 degrees in a medium containing 10% sucrose. To select for those bacteria in which the gene coding for kanamycin resistance were substituted by the gene coding for the NAP, the sucrose resistant colonies were plated on both L.B. agar and L.B. agar supplemented with 15 ug/ml Kanamycin. The kanamycin sensitive colonies, containing the OmpU-NAP gene integrated into the 23S gene, were named IEM23S-ompNAP and used for further analysis.

Example 8: Expression of the NAP protein by the IEM-ompNAP strain

The IEM23S-ompNAP strain was analysed for viability, growth and NAP expression in a time- course experiment in which the IEM101 wild-type strain was used as control.

To do this, an overnight culture of both strains was diluted in LB medium to 1 :25 and incubated at 37°C for 6 hours. 1 ml samples were collected every 30 min. Bacterial viability was analysed by plating different dilutions of the samples on LB. Levels of NAP expression were evaluated by western blot analysis of 10 μl of the cellular soluble fraction, obtained by sonication (7 impulse for 4 times each 30 sec) of the bacterial pellet from 0.5 ml of culture, using anti-NAP rabbit polyclonal antisera.

The results of this experiment are reported in Figure 4 and 5. As shown in Figure 4 the rate of growth was identical for the two strains (IEM101 and IEM-ompNAP) indicating that the insertion of the NAP gene under the control of the OmpU promoter do not influence the viability of the strain. Furthermore, as shown in Figure 5, levels of expression of NAP were very high during the first two hours of growth with a decrease at 5 hours followed by an increase at six hours.

It has previously been shown that Vibrio cholerae is able to produce the NAP protein in its decameric form (see co-pending International patent application PCT/IB99/00695). It is also known that NAP is produced in H. pylori as a decamer (Doyce and Evans (1995) Infect Immun, 63: 2213-2220). To verify whether the NAP, expressed by Vibrio, is still able to form decamers, even when the expression is regulated by the OmpU promoter, the soluble fraction was analysed by Western blot in non-reduced and non-denaturing condition.

To do this, the bacterial pellet deriving from 50 ml of overnight culture was resuspended in 1 ml of PBS and sonicated. 10 μl of sonicated material was loaded on a 8 % SDS-PAGE both in non-reducing (without Dithiothreitol) and non-denaturing (without heating) conditions and analysed by western blot. The results reported in Figure 6 show that under these conditions, the NAP antigen migrates in the SDS polyacrylamide gel as a 150 kD protein, corresponding to the decameric form.

Example 9: Construction of the IEM/i rNAP strain

The recombinant IEMmVNAP strain, expressing the NAP antigen under the control of the E. coli nirB promoter, inducible by anaerobiosis has been obtained as described. The nirB promoter was amplified by PCR from pnirlOO plasmid using the following oligonucleotides: 5 '-CGCGGATCCGTTAACTCGCGAGAATTCAGGTAAATT-3 '

(forward) including BamHI, Hpal, Nrul and EcoRI restriction sites and 5'- CGCGGATCCGTTAACGATATCCTCGAGCAGAAAGTCTCCTGT-3' (reverse) including BamHI, Hpal, EcoRV and Xhol restriction sites. The amplified DNA fragment of 140 bp was digested with BamHI and cloned into the pGEM3 vector to obtain the pGEMw^'r plasmid. This plasmid was digested with Xhol and EcoRV and ligated to the Xhol/ EcoRV fragment containing the NAP gene (previously described) generating the pmVNAP plasmid. This plasmid was digested with BamHI and the resulting DNA fragment of 610 bp, containing the NAP gene under the control of the nirB promoter, was ligated with the BS-23S (previously described) digested with BamHI generating the BS- 23S >NAP plasmid. This plasmid was digested with Sad and Sail and the DNA fragment of 1500 bp generated, containing the mVNAP gene flanked by 5' and 3' ends of the rRNA 23S gene, was ligated into the CVD442 vector digested with Sad and Sail, to generate CVD23S-m>NAP. This plasmid was transformed into the SMIOλpir strain and introduced by conjugation into the IEM23SKm^r strain. The recombinant strain resulting from homologous recombination was isolated using the above described selections. The kanamycin sensitive strain, containing the nirB-NAP gene integrated into the 23 S rRNA gene, was named IEM23S- >NAP. Example 10: Comparison of levels of NAP when expression is driven by two different promoters: OmpU and nirB.

Previous work has shown that the nirB promoter is a strong promoter in V. cholerae. We compared the activity of the nirB promoter with that of the OmpU promoter by analysing the amount of NAP produced by the two strains IEMom/ NAP and IEM VNAP containing the gene encoding NAP under the control of the OmpU or the nirB promoter respectively. These strains were grown overnight at 37°C with aeration. The cultures were diluted 50 fold and left to grow 2 hours at 37° C in aerobic conditions for the lEMomp^'NA? strain or 4 hours at 37°C in low aeration for the IEM rNAP strain. The cultures were centrifuged and bacteria] pellet resuspended in PBS to obtain about 10¹⁰ cells/ml. 15 μl of each preparation was loaded on a 15% SDS-polyacrylamide gel and analysed for the presence of NAP by western blot analysis, using anti-NAP rabbit polyclonal antisera. The results, reported in Figure 7, show that the levels of expression of the NAP antigen were significantly higher when expression was driven by the Omp U promoter, compared to the nirB promoter.

Example 10: Immunisation of mice.

To evaluate the anti-NAP immune response induced by lΕMompNA? and IEM VNAP strains respectively, BalbC mice, eight mice each group, were immunised intranasally on days 0, 28, 42 and 56 with 10 live bacteria. Control animals were immunised with 10 μg of purified NAP alone or in combination with 1 μg of CTK63 as adjuvants, in this case each group contained five mice. Animals were bled on days 0, 27, 41 , 55 and bled out on day 70. Further, at day 70, bile was recovered and nasal washes performed.

Example 11: ELISA to determinate the anti-NAP antibodies.

Anti-NAP Ig antibody responses in the serum of mice following each immunisation or IgA antibody response in nasal washes and bile after the four immunisations were evaluated by ELISA. The ELISA tests were performed as follows. To each well of a 96-well plate were added 100 ng of purified NAP (50 μl /well) and plates incubate overnight at 4°C. Wells were then washed three times with PBS, 0.05% Tween-20 (PBT) and saturated with 100 μl/well of 1% BSA in PBS for 1 hour at 37°C. 100 μl of a 1 :50 dilution of sera or bile and 100 μl of undiluted nasal washes were added and serially diluted. Plates were incubated 2 hours at 37°C and washed as above described. For detection of total Ig, wells were incubated with 50 μl of a 1 : 1000 dilution of rabbit anti-mouse Ig horseradish peroxidase (HRP) conjugated for 1 hour and half at 37°C. For detection of IgA, wells were incubated with 50 μl of a 1 :1000 dilution of biotin conjugated goat anti-mouse IgA α chain specific for 1 hour and half at 37°C, and after washes with PBT, 50 μl of 1 : 1000 dilution of HRP- conjugated streptavidin were added to each well and plates incubated for 1 hour at 37°C. Antigen-bound antibodies were visualised by adding o-phenylenediamine (OPD) as substrate. After 15 minutes the reaction was blocked by the addition of 50 μl/well of 12.5% H₂SO₄ at final concentration of 1 M and the absorbance was read at 490 nm. ELISA titres in the sera were determined arbitrarily as the reciprocal of the last dilution which gave a OD_490nm ≥ 0.3 above the preimmune sera, whereas for mucosal washes and bile IgA titres were expressed as the reciprocal of the last dilution which gave a OD₄ o_mτ, ≥ 0.2 above the preimmune sera. The values were normalised using positive control sera in each plate.

As shown in Figure 8, Ig anti-NAP antibodies were detectable only in mice immunised with the lEMompNAp strain or with purified NAP in presence of CTK63 as adjuvant. No Ig immune response was detected in sera of mice immunised with the IEMw^'rNAP strain or with the purified NAP alone. Interestingly, the levels of anti-NAP immune response induced when the NAP antigen was delivered in vivo by the recombinant IEM101 strain were higher than that induced when the purified protein was administered in presence of a mucosal adjuvant.

Furthermore, after the fourth immunisation the IgA immune response was detected only in sera of mice immunised with the IEMom/ NAP strain or with the purified NAP in combination with CTK63 (Figure 9), whereas this was not detectable in mice immunised with IEMπ/rNAP or with the purified NAP. The IgA immune response was detected also in the bile and nasal washes (Figures 10a and 10b) of each group of mice, also in this case the levels were significantly higher when mice were immunised with the IEMomjpNAP or with NAP and CTK63.

DISCUSSION

In the present work we have shown that IEM101 is able to express high levels of the

H.pylori NAP protein in soluble and decameric form and, interestingly, a detectable amount of NAP is also present in culture supernatant. In addition we have identified the OmpU promoter of V. cholerae as useful promoter for high level expression of foreign antigens and we have compared the activity of this promoter to the previously described. E.coli nirB promoter

The NAP gene was integrated into the rRNA 23S chromosomal locus of IEM101 under the control of the two different promoters and the results show that both the nirB promoter and the OmpU promoter work in IEM101 , but the amount of protein is higher when the expression is driven by the OmpU promoter. We can conclude that we have identified an ideal promoter for the induction of high level expression of foreign antigens in Vibrio, since high level expression can be attained without comprising the growth rate or viability of the strain.

In addition has been found, surprisingly, that rRNA operons are particularly suitable targets for chromosomal integration of foreign genes in V. cholerae. In fact, the insertion of foreign nucleic sequences at this site, with consequent partial deletion of one of the nine copies of rRNA present into the chromosome, allows an effective high level expression of heterologous antigen without compromising the growth rates or viability characteristics of the V. cholerae.

The immunological response of the recombinant strain YEMompNAV has been evaluated in a mouse model of intranasal immunisation. The IEMom/ NAp strain elicits highest antibody titres in terms of serum Ig and mucosal IgA. The immuno-response stimulate by NAP protein when expressed in vivo at high level by IEMompNAP strain is better than the immuno-response induced by purified NAP antigen in combination with CTK63 as adjuvant. This finding indicates that the amount of protein expressed affects the antibody response. In fact, IEMσm NAP strain is more immunogenic than IEMmVNAP strain, that express the antigen in a lower amount.

In conclusion, the live attenuated IEM 101 V. cholerae strain is considered a good carrier for antigen delivery at mucosal surface being able to stimulate high titres of systemic Ig and secretory IgA. The IEMompNAP recombinant strain represents an ideal vaccine candidate against V. cholera and H. pylori.

Claims

1. A recombinant Vibrio cholerae bacterium comprising a nucleic acid encoding an heterologous protein or protein fragment inserted at a locus within a rRNA operon in the chromosome of said bacterium.

2. A recombinant Vibrio cholerae bacterium comprising a nucleic acid encoding an heterologous protein or protein fragment that is cloned under the control of an OmpU promoter.

3. A recombinant Vibrio cholerae bacterium comprising a nucleic acid encoding an heterologous protein or protein fragment that is cloned under the control of an OmpU promoter and that is inserted at a locus within a rRNA operon in the chromosome of said bacterium.

4. A recombinant bacterium according to claim 1 or 3, wherein said rRNA operon is either the 16S or the 23S gene.

5. A recombinant bacterium according to claim 4, wherein said nucleic acid is inserted at a locus within the 23 S gene in the Vibrio cholerae chromosome.

6. A recombinant bacterium according to any one of the preceding claims, wherein said Vibrio cholerae bacterium is an attenuated bacterium.

7. A recombinant bacterium according to claim 6, wherein said Vibrio cholerae bacterium is naturally attenuated.

8. A recombinant bacterium according to claim 7 wherein said Vibrio cholerae bacterium is ofthe lEMlOl strain.

9. A recombinant bacterium according to any one of the preceding claims wherein said heterologous protein or protein fragment is, or is part of a membrane protein.

10. A recombinant bacterium according to any one of the preceding claims, wherein said heterologous protein or protein fragment is, or is part of the NAP protein, a human tumour antigen or adhesin such as filamentary haemaglutinin (FHA), pertactin or fimbriae, fragment C of tetanus toxin from Clostridium tetani, the heat labile toxin protein from strains of E. coli and genetically-detoxified derivatives thereof, menigococcus antigens, gonococcus antigens, influenza antigens, malaria antigens, tetanus toxin, tracheal colonisation factor or pertussis toxin from B. pertussis, VacA and CagA from H. pylori, E6 and E7 from papilloma virus, gD2 from Herpes virus, El or E2 core proteins from HCV, gpl20 from HIV, LT-A and CT-A, the LT mutants LTK63 or LTR72, the CT mutant CTK63, or other variants thereof.

1 1. A recombinant bacterium according to any one of the preceding claims comprising nucleic acid encoding two or more heterologous proteins, at least one of said proteins being capable of acting as an adjuvant and at least one heterologous proteins being capable of acting as an antigen.

12. An immunogenic composition comprising recombinant bacteria according to any one of the preceding claims, in conjunction with a pharmaceutically-acceptable carrier.

13. A vaccine composition comprising recombinant bacteria according to any one of claims 1 to 1 1, in conjunction with a pharmaceutically-acceptable carrier.

14. A vaccine composition according to claim 13, further comprising an adjuvant.

15. A process for the formulation of a vaccine composition according to claim 13 comprising bringing recombinant bacteria according to any one of claims 1 to 1 1 into association with a pharmaceutically-acceptable carrier.

16. A process for the formulation of a vaccine composition according to claim 14 comprising bringing recombinant bacteria according to any one of claims 1 to 1 1 into association with an adjuvant.

17. A recombinant bacterium according to any one of claims 1 to 1 1 for use as a pharmaceutical.

18. A recombinant bacterium according to any one of claims 1 to 1 1 for use as an adjuvant.

19. Use of a recombinant bacterium according to any one of claims 1 to 11 in a vaccine composition.

20. A method for the prevention or treatment of a disease in a subject, comprising administering to said subject an immunologically effective dose of a composition according to claim 12 or claim 13.

21. A nucleic acid comprising a sequence encoding a protein or protein fragment that is 5 heterologous to Vibrio cholerae inserted in between sequence derived from the 5' and 3' regions of a rRNA operon so that said rRNA sequence flanks the sequence coding for heterologous protein.

22. A nucleic acid comprising the OmpU promoter operably linked to a nucleic acid that encodes a protein or protein fragment that is heterologous to Vibrio cholerae.

0 23. A nucleic acid comprising the OmpU promoter operably linked to a nucleic acid sequence that encodes a protein or protein fragment that is heterologous to Vibrio cholerae, said nucleic acid being flanked by sequence derived from the 5' and 3' regions of a Vibrio cholerae rRNA gene.

24. A nucleic acid according to any one of claims 21-23, wherein said rRNA operon is 5 either the 16S or the 23 S gene.

25. A vector comprising a nucleic acid according to any one of claims 21-24.

26. Use of an rRNA operon as a locus for insertion of a nucleic acid encoding an heterologous protein or protein fragment into the chromosome of a Vibrio cholerae bacterium.

0 27. Use of the OmpU promoter for expression of an heterologous antigen in a Vibrio cholerae bacterium.

28. A method of expression of an heterologous protein or protein fragment in a Vibrio cholerae bacterium comprising targeting a nucleic acid encoding the protein or protein fragment to a chromosomal locus in a rRNA operon in the Vibrio cholerae bacterium.

25 29. A method of expression of an heterologous protein or protein fragment in a Vibrio cholerae bacterium comprising cloning a nucleic acid encoding the heterologous protein or protein fragment under the control of an OmpU promoter.

30. A method of expression of an heterologous protein or protein fragment in a Vibrio cholerae bacterium comprising targeting a nucleic acid encoding the protein or protein fragment to a chromosomal locus in a rRNA operon in the Vibrio cholerae bacterium and expressing a nucleic acid encoding the heterologous protein or protein fragment under the control of an Omp U promoter.

31. Use according to claim 26 or a method according to either of claims 28 or 30, wherein said rRNA operon is either the 16S or the 23S gene.

32. A method of vaccinating a mammal against a disease, comprising administering a preparation of recombinant bacteria according to the any one of claims 1 to 1 1, that expresses an heterologous protein or protein fragment that is associated with a pathogen responsible for the disease.