EP1190089A2 - Methods of treatment using lig 72a and variants thereof - Google Patents

Methods of treatment using lig 72a and variants thereof

Info

Publication number
EP1190089A2
EP1190089A2 EP00946845A EP00946845A EP1190089A2 EP 1190089 A2 EP1190089 A2 EP 1190089A2 EP 00946845 A EP00946845 A EP 00946845A EP 00946845 A EP00946845 A EP 00946845A EP 1190089 A2 EP1190089 A2 EP 1190089A2
Authority
EP
European Patent Office
Prior art keywords
polypeptide
lig
seq
pain
variant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00946845A
Other languages
German (de)
French (fr)
Other versions
EP1190089A4 (en
Inventor
Sharon Bingham
John Darker
Wu-Schyong Liu
John D. Martin
Andrew A. Parsons
Saraswati R. Patel
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SmithKline Beecham Ltd
SmithKline Beecham Corp
Original Assignee
SmithKline Beecham Ltd
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SmithKline Beecham Ltd, SmithKline Beecham Corp filed Critical SmithKline Beecham Ltd
Publication of EP1190089A2 publication Critical patent/EP1190089A2/en
Publication of EP1190089A4 publication Critical patent/EP1190089A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • This invention relates to newly identified polypeptides and polynucleotides encoding the polypeptides; variants and derivatives of the polypeptides and polynucleotides; agonists and antagonists of the polypeptides; and uses of the polypeptides, polynucleotides, variants, derivatives, agonists and antagonists.
  • the invention relates to polypeptides and polynucleotides encoding polypeptides that are ligands for neuropeptide receptor HFGAN72, hereinafter referred to as "HFGAN72 receptor ligands".
  • HFGAN72 receptor is alternatively referred to as "Orexin-1 receptor”.
  • a particularly preferred embodiment of the invention relates to methods for the treatment of a patient having need of Lig 72A, or a variant thereof, comprising administering to the patient a therapeutically effective amount of Lig 72A or a variant thereof.
  • Lig 72A is also referred to herein as "Orexin-A".
  • methods of treatment of a patient having need of either an agonist or an antagonist of the interaction between of Lig 72A and HFGAN72 receptor comprising administering to the patient a therapeutically effective amount of either an agonist or antagonist of Lig 72A or a variant thereof.
  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are ligands for a human 7-transmembrane receptor. The invention also relates to inhibiting or activating the action of such polypeptides.
  • proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 1991, 351:353-354).
  • these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins.
  • Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al, Proc. Natl Acad.
  • G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al, Science, 1991, 252:802-8).
  • effector proteins e.g., phospholipase C, adenyl cyclase, and phosphodiesterase
  • actuator proteins e.g., protein kinase A and protein kinase C (Simon, M.I., et al, Science, 1991, 252:802-8).
  • the effect of hormone binding is activation of the enzyme, adenylate cyclase, inside the cell.
  • Enzyme activation by hormones is dependent on the presence of the nucleotide GTP.
  • GTP also influences hormone binding.
  • a G-protein connects the hormone receptor to adenylate cyclase.
  • G-protein was shown to exchange GTP for bound GDP when activated by a hormone receptor.
  • the GTP-carrying form then binds to activated adenylate cyclase.
  • Hydrolysis of GTP to GDP catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form.
  • the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
  • G-protein coupled receptors The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane '-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuro-receptors.
  • G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops.
  • the G-protein family of coupled receptors includes dopamine receptors that bind to neuroleptic drugs used for treating psychotic and neurological disorders.
  • members of this family include, but are not limited to, calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorant, and cytomegalovirus receptors.
  • TM1 Most G-protein coupled receptors have single conserved cysteine residues in each of the first two extracellular loops that form disulfide bonds that are believed to stabilize functional protein structure.
  • the 7 transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7.
  • TM3 has been implicated in signal transduction.
  • G-protein coupled receptors Most G-protein coupled receptors contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several G-protein coupled receptors, such as the b- adrenoreceptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization. For some receptors, the ligand binding sites of G-protein coupled receptors are believed to comprise hydrophilic sockets formed by several G-protein coupled receptor transmembrane domains, said socket being surrounded by hydrophobic residues of the G-protein coupled receptors.
  • each G-protein coupled receptor transmembrane helix is postulated to face inward and form a polar ligand binding site.
  • TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as the TM3 aspartate residue.
  • TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.
  • G-protein coupled receptors can be intracellularly coupled by heterotrimeric G- proteins to various intracellular enzymes, ion channels and transporters. See Johnson, et al, Endoc. Rev., 1989, 10:317-331. Different G-protein a-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors. G- protein coupled receptors are found in numerous sites within a mammalian host.
  • the present invention provides polypeptides and polynucleotides encoding Lig 72A polypeptides and variants thereof. Summary of the Invention
  • polypeptides inter alia, that have been identified as ligands for HFGAN72 receptor or variants thereof, including truncation mutants thereof.
  • HFGAN72 receptor ligand polypeptides and nucleic acid molecules encoding these receptor ligand polypeptides, including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically, diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including truncation mutants and fragments of the variants, analogs and derivatives.
  • Another object of the invention is to provide an antibody against the interaction of the Lig 72A variants and HFGAN72 receptor.
  • a further object of the invention is an antagonist that inhibits the interaction of the Lig 72A variants and HFGAN72 receptor.
  • It is yet another object of the invention to provide a method for identifying compounds that bind to and activate or inhibit the interaction of Lig 72 or a variant thereof and HFGAN72 receptor comprising contacting a cell expressing on the surface thereof an HFGAN72 receptor, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of Lig 72A or a variant thereof to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound binds to and activates or inhibits the interaction of Lig 72A or a variant thereof and HFGAN72 receptor by detecting the level of a signal generated from this interaction.
  • the ligand can be labeled, for example with 1251, and used in receptor binding assays to identify antagonists or agonists that block binding.
  • Figure 1 shows a genomic sequence (SEQ ID NO: l) encoding human HFGAN72 receptor ligands.
  • Capital letters show exons (cDNA) (SEQ ID NO:2).
  • Figure 2 shows a deduced amino acid sequence (SEQ ID NO:3) comprising two different human HFGAN72 receptor ligands, Lig 72A (SEQ ID NO:4, shown by dashes) and Lig 72B (SEQ ID NO:5, shown by asterisks).
  • Figure 3 shows a cDNA sequence (SEQ ID NO:6) encoding rat HFGAN72 receptor ligands.
  • Figure 4 shows a deduced amino acid sequence of rat HFGAN72 receptor ligands (SEQ ID NO:7) comprising an N-terminal signal and leader sequence predicted with von Heijin's algorithm (SEQ ID NO:8). Also shown in Figure 4 are two ligands, Lig 72A (SEQ ID NO:4, shown by dashes) and Lig 72B (SEQ ID NO:9, shown by asterisks).
  • Figure 5 shows a prepro region of an amino acid sequence of mouse HFGAN72 receptor ligands lacking a portion of the N-terminal signal sequence (SEQ ID NO: 10).
  • This amino acid sequence comprises two ligands, Lig 72A (SEQ ID NO:4, shown by dashes) and Lig 72B (SEQ ID NO: l 1, shown by asterisks).
  • Figure 6 shows a cDNA encoding the human HFGAN72 receptor (SEQ ID NO: 12).
  • Figure 7 shows a deduced amino acid sequence of the human HFGAN72 receptor (SEQ ID NO: 13).
  • Figure 8 shows a cDNA encoding human Lig72A (SEQ ID NO: 14).
  • Isolated means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide or a polypeptide naturally present in a living organism is not “isolated,” but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is “isolated”, as the term is employed herein.
  • a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated” even if it is still present in said organism, which organism may be living or non-living.
  • polynucleotides can be joined to other polynucleotides such as DNAs, for mutagenesis, to form fusion proteins, and for propagation or expression in a host, for instance.
  • the isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment.
  • polynucleotides and polypeptides may occur in a composition, such as a media, formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.
  • a composition such as a media, formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.
  • Oligonucleotide(s) refers to relatively short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can refer as well to single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others.
  • Polynucleotide(s) generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • polynucleotides as used herein refers to, among others, single- and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the strands in such regions may be from the same molecule or from different molecules.
  • the regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules.
  • One of the molecules of a triple- helical region often is an oligonucleotide.
  • polynucleotide also includes DNAs or RNAs as described above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are polynucleotides, as that term is intended herein.
  • DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples are polynucleotides, as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art.
  • polynucleotide as it is employed herein, embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia simple and complex cells.
  • Polypeptides includes all polypeptides as described below. The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art. In this context, the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
  • polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal amino acids, may be modified in a given polypeptide, either by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques that are well known to the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and thus are well known to those of skill in the art.
  • polypeptides of the present invention include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation,
  • polypeptides are not always entirely linear.
  • polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing event and events brought about by human manipulation that do not occur naturally.
  • Circular, branched and branched circular polypeptides may be synthesized by non-translation natural processes and by entirely synthetic methods, as well.
  • Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well.
  • the amino terminal residue of polypeptides made in E. coli, prior to processing almost invariably will be N- f ormy lmethionine .
  • polypeptides made by expressing a cloned gene in a host for instance, the nature and extent of the modifications in large part will be determined by the host cell' s posttranslational modification capacity and the modification signals present in the polypeptide amino acid sequence.
  • glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell.
  • Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to express efficiently mammalian proteins having the native patterns of glycosylation, inter alia. Similar considerations apply to other modifications.
  • polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.
  • Subject refters to a mammal, especially a human being.
  • Variants of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this sense are described below and elsewhere in the present disclosure in greater detail.
  • Variants include polynucleotides that differ in nucleotide sequence from another, reference polynucleotide. Generally, differences are limited so that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical.
  • changes in the nucleotide sequence of the variant may be silent. That is, they may not alter the amino acids encoded by the polynucleotide. Where alterations are limited to silent changes of this type, a variant will encode a polypeptide with the same amino acid sequence as the reference. As also noted below, changes in the nucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
  • Variants also include polypeptides that differ in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical.
  • a variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
  • Fusion protein as the term is used herein, is a protein encoded by two, often unrelated, fused genes or fragments thereof.
  • EP-A0464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof.
  • employing an immunoglobulin Fc region as a part of a fusion protein is advantageous for use in therapy and diagnosis resulting in, for example, improved pharmacokinetic properties (EP-A 0232 262).
  • fusion protein it may be desirable to link the components of the fusion protein with a chemically or enzymatically cleavable linking region.
  • Fc portion proves to be a hindrance to use in therapy and diagnosis, for example, when the fusion protein is to be used as an antigen for immunizations.
  • human proteins such as, shIL5-cc have been fused with Fc portions for use in high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett, et al, Journal of Molecular Recognition, 1995, 8:52-58; and K. Johanson, et al, The Journal of Biological Chemistry, 1995, 270(16):9459-9471.
  • this invention also relates to genetically engineered soluble fusion proteins comprised of an HFGAN72 receptor ligand, or a portion thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE).
  • an immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgGl, where fusion takes place at the hinge region.
  • the Fc part can be removed simply by incorporation of a cleavage sequence that can be cleaved with blood clotting factor Xa.
  • This invention further relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for diagnosis and therapy.
  • Yet a further aspect of the invention relates to polynucleotides encoding such fusion proteins.
  • Binding molecules refer to molecules, including receptors, that specifically bind to or interact with polypeptides of the present invention. Such binding molecules are a part of the present invention. Binding molecules may also be non-naturally occurring, such as antibodies and antibody-derived reagents that bind specifically to polypeptides of the invention.
  • Identity reflects a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, determined by comparing the sequences.
  • identity refers to an exact nucleotide to nucleotide or amino acid to amino acid correspondence of the two polynucleotide or two polypeptide sequences, respectively, over the length of the sequences being compared.
  • a "% identity” may be determined.
  • the two sequences to be compared are aligned to give a maximum correlation between the sequences. This may include inserting "gaps" in either one or both sequences, to enhance the degree of alignment.
  • a % identity may be determined over the whole length of each of the sequences being compared (so-called global alignment), that is particularly suitable for sequences of the same or very similar length, or over shorter, defined lengths (so-called local alignment), that is more suitable for sequences of unequal length.
  • Similarity is a further, more sophisticated measure of the relationship between two polypeptide sequences.
  • similarity means a comparison between the amino acids of two polypeptide chains, on a residue by residue basis, taking into account not only exact correspondences between a between pairs of residues, one from each of the sequences being compared (as for identity) but also, where there is not an exact correspondence, whether, on an evolutionary basis, one residue is a likely substitute for the other. This likelihood has an associated 'score' from which the "% similarity" of the two sequences can then be determined.
  • BESTFIT is more suited to comparing two polynucleotide or two polypeptide sequences that are dissimilar in length, the program assuming that the shorter sequence represents a portion of the longer.
  • GAP aligns two sequences, finding a "maximum similarity", according to the algorithm of Neddleman and Wunsch (J. Mo.l Biol, 48, 443-453, 1970).
  • GAP is more suited to comparing sequences that are approximately the same length and an alignment is expected over the entire length.
  • the parameters "Gap Weight” and "Length Weight” used in each program are 50 and 3, for polynucleotide sequences and 12 and 4 for polypeptide sequences, respectively.
  • % identities and similarities are determined when the two sequences being compared are optimally aligned.
  • the BLOSUM62 amino acid substitution matrix (Henikoff S. and Henikoff J.G., Proc. Nat. Acad Sci. USA, 89: 10915-10919 (1992)) is used in polypeptide sequence comparisons including where nucleotide sequences are first translated into amino acid sequences before comparison.
  • the program BESTFIT is used to determine the % identity of a query polynucleotide or a polypeptide sequence with respect to a polynucleotide or a polypeptide sequence of the present invention, the query and the reference sequence being optimally aligned and the parameters of the program set at the default value, as hereinbefore described.
  • a polynucleotide sequence having, for example, at least 95% identity to a reference polynucleotide sequence is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference sequence.
  • Such point mutations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion.
  • point mutations may occur at the 5' or 3' terminal positions of the reference polynucleotide sequence or anywhere between these terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • a polynucleotide sequence having at least 95% identity to a reference polynucleotide sequence up to 5% of the nucleotides of the in the reference sequence may be deleted, substituted or inserted, or any combination thereof, as hereinbefore described.
  • % identities such as 96%, 97%, 98%, 99% and 100%.
  • a polypeptide sequence having, for example, at least 95% identity to a reference polypeptide sequence is identical to the reference sequence except that the polypeptide sequence may include up to five point mutations per each 100 amino acids of the reference sequence.
  • Such point mutations are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non- conservative substitution, or insertion. These point mutations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between these terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence.
  • a sequence polypeptide sequence having at least 95% identity to a reference polypeptide sequence up to 5% of the amino acids of the in the reference sequence may be deleted, substituted or inserted, or any combination thereof, as hereinbefore described.
  • % identities such as 96%, 97%, 98%, 99%, and 100%.
  • Polynucleotide embodiments further include an isolated polynucleotide comprising a polynucleotide sequence having at least a 95, 97 or 100% identity to the reference sequence of SEQ ID NO: 14, wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO: 14 or may include up to a certain integer number of nucleotide alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5 ' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides of SEQ ID NO: 14 by the integer defining the percent identity divided by 100 and then subtracting
  • SEQ ID NO: 14 y is 0.95 for 95%, 0.97 for 97% or 1.00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-integer product of ⁇ n and y is rounded down to the nearest integer prior to subtracting it from x n .
  • Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:4 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations.
  • Polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO:4, wherein said polypeptide sequence may be identical to the reference sequence of SEQ ID NO:4 or may include up to a certain integer number of amino acid alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherein said alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of amino acid alterations is determined by multiplying the total number of amino acids in SEQ ID NO:4 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids in SEQ ID NO:4, or: n a ⁇ x
  • SEQ ID NO:4 y is 0.95 for 95%, 0.97 for 97% or 1.00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-integer product of x a and y is rounded down to the nearest integer prior to subtracting it from x a .
  • the present invention relates to polypeptides and polynucleotides of Lig 72A.
  • These polypeptides include the polypeptides of a Lig 72A from human, rat, and mouse (SEQ ID NO:4).
  • the invention also relates to polypeptides comprising an amino acid sequence having at least a 95% identity to the amino acid sequence set forth in SEQ ID NO:4 over its entire length, and still more preferably at least a 96-99% identity, and most preferably, at least a 100% identity, to this amino acid sequence.
  • Novel polypeptides of identical mass which are ligands for HFGAN72 receptor, were isolated from rat brain and bovine hypothalamus.
  • the amino acid sequence of the mature rat polypeptide, Lig 72A was determined and is shown in Figure 4 as SEQ ID NO:4.
  • An accurate mass of the peptide MH+ ion was measured using delayed extraction MALDI and found to be 1286.6125 daltons (herein "Da") (predicted, 1286.6237 Da).
  • the Gin residue at position 9 was distinguished from Lys (both amino acids have the same residue mass) by acetylation of the peptide and re-measurement of the molecular weight.
  • HFGAN72 receptor ligands are strongly expressed in both the hypothalamus and in the hypothalamal neurons.
  • Data provided herein such as the localizion of HFGAN72 receptor ligands in the hypothalamus, indicates that HFGAN72 receptor ligands are involved in a number of neurological (e.g., epiliepsy, stroke), psychiatric (e.g., anziety, depression), and/or eating disorders.
  • Lig 72A the amino acid sequences for Lig 72A are identical in the human, rat , and mouse (SEQ ID NO:4). It was found that Lig 72B of the human (SEQ ID NO:5), rat (SEQ ID NO: 9), and mouse (SEQ ID NO: 11) interact with HFGAN72 receptor (SEQ ID NO: 13), and this indicates that they have certain of the same properties as Lig 72A.
  • Lig 72A and Lig 72B for HFGAN72 receptor were confirmed experimentally.
  • Fura-loaded 293 cells were transfected with HFGAN72 receptor.
  • Intracellular calcium levels were measured in the cells in response to increasing concentrations of polypeptides of the HFGAN72 receptor ligands, Lig 72A and Lig 72B.
  • the EC 50 of the polypeptide was estimated to be 50 ng/ml.
  • Activation of HFGAN72 receptor by both Lig 72A and Lig 72B was determined to be specific, as no stimulation was observed with either 293pCDN vector transfected cells or with an alternative clone.
  • the invention provides HFGAN72 receptor ligands, or fragments, analogs and derivatives of these ligand polypeptides, that are useful in modulating HFGAN72 receptor activities.
  • the present invention also relates to fragments, analogs and derivatives of these polypeptides.
  • fragment when referring to the polypeptide ofmean a polypeptide retaining essentially the same biological function or activity, i.e., functions as HFGAN72 receptor ligands, or retaining the ability to bind any receptors or binding molecules even though the polypeptide may not activate the receptor in the same manner.
  • an analog includes, for example, a proprotein that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide or a portion of the HFGAN72 ligands.
  • Biological properties of Lig 72A are hereinafter referred to as "biological activity of Lig 72A” or "Lig 72A activity”.
  • a polypeptide of the present invention exhibits at least one biological activity of Lig 72A.
  • Polypeptides of the present invention also include variants of the aforementioned polypeptides, including all allelic forms and splice variants. Such polypeptides vary from the reference polypeptide by insertions, deletions, and substitutions that may be conservative or non-conservative, or any combination thereof. Particularly preferred variants are those in which several, for instance from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acids are inserted, substituted, or deleted, in any combination.
  • Preferred fragments of polypeptides of the present invention include an isolated polypeptide comprising an amino acid sequence having at least 30 contiguous amino acids from the amino acid sequence of SEQ ID NO:4, or an isolated polypeptide comprising an amino acid sequence having at least 30 contiguous amino acids truncated or deleted from the amino acid sequence of SEQ ID NO:4.
  • Preferred fragments are biologically active fragments that mediate the biological activity of Lig 72A, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also preferred are those fragments that are antigenic or immunogenic in an animal, especially in a human.
  • polypeptides of the invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, these variants may be employed as intermediates for producing the full-length polypeptides of the invention.
  • the polypeptides of the present invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence that contains secretory or leader sequences, pro- sequences, sequences that aid in purification, for instance multiple histidine residues, or an additional sequence for stability during recombinant production.
  • Polypeptides of the present invention can be prepared in any suitable manner, for instance by isolation form naturally occuring sources, from genetically engineered host cells comprising expression systems (vide infra) or by chemical synthesis, using for instance automated peptide synthesizers, or a combination of such methods. Means for preparing such polypeptides are well understood in the art.
  • the polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain preferred embodiments, it is a recombinant polypeptide.
  • the fragment, derivative or analog of the polypeptide may be: (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code; (ii) one in which one or more of the amino acid residues includes a substituent group; (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol); or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence that is employed for purification of the mature polypeptide or a proprotein sequence.
  • a conserved or non-conserved amino acid residue preferably a conserved amino acid residue
  • substituted amino acid residue may or may not be one encoded by the genetic code
  • polypeptides having the amino acid sequence of Lig 72A set forth by dashes in Figures 2, 4, and 5 (SEQ ID NO:4), variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments.
  • polypeptides, variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments that retain the activity or function of Lig 72A SEQ ID NO:4.
  • substitutions are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe and Tyr.
  • variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments having the amino acid sequence set forth in SEQ ID NO:4, in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination.
  • silent substitutions, additions and deletions which do not alter the properties and activities of the ligand.
  • conservative substitutions are especially preferred.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • polypeptides of the present invention include a polypeptide having the amino acid sequence selected from the group consisting of: the amino acid sequences set forth in SEQ ID NOs:4 and 22-50, as well as polypeptides having at least a 95% identity to these polypeptides, and more preferably at least a 96-99% identity to these polypeptides, and most preferred at polypeptides having a 100% identity to these polypeptides.
  • Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides.
  • Fragments may be "free-standing," i.e., not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region. When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region. However, several fragments may be comprised within a single larger polypeptide.
  • fragments of polypeptides of Lig 72A of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre- and pro- polypeptide regions fused to the amino terminus of the polypeptide fragments of Lig 72A and an additional region fused to the carboxyl terminus of the fragment. Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fusion polypeptide or fusion protein derived from Lig 72A. Among especially preferred fragments of the invention are truncation mutants of Lig 72A (SEQ ID NO:4).
  • Truncation mutants include polypeptides of Lig 72A having the amino acid sequence shown by dashes in Figures 2, 4, and 5 (SEQ ID NO:4), or of variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus.
  • Particuarly preferred Lig 72 truncation mutants and variants of the invention are the polypeptides comprising the amino acid sequences set forth in Table 2 of Example 12 (SEQ ID NOs:23-38), as well as the polynucleotides encoding such polypeptides, which are set forth in Table 3 of Example 12 (SEQ ID NOs:39-54). These variants were shown to be biologically active, as reflected by the designated EC 5() values of each variant in Table 2 (SEQ ID NOs:22- 38).
  • the present invention relates to polynucleotides encoding Lig 72A and variants thereof.
  • polynucleotides include:
  • an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to a polypeptide sequence selected from the group consisting of: SEQ ID NOs:4 and 22-38;
  • polynucleotide having or comprising a polynucleotide sequence encoding a polypeptide sequence that has an Identity Index of 0.95, 0.96, 0.97, 0.98, or 0.99 compared to a polypeptide sequence selected from the group of: SEQ ID NOs:4 and 22-38; and polynucleotides that are fragments and variants of the above mentioned polynucleotides or that are complementary to above mentioned polynucleotides, over the entire length thereof.
  • Preferred fragments of polynucleotides of the present invention include an isolated polynucleotide comprising a nucleotide sequence having at least 15, 30, 50 or 100 contiguous nucleotides from a sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, or an isolated polynucleotide comprising an sequence having at least 30, 50 or 100 contiguous nucleotides truncated or deleted from a sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54.
  • Preferred variants of polynucleotides of the present invention include splice variants, allelic variants, and polymorphisms, including polynucleotides having one or more single nucleotide polymorphisms (SNPs).
  • SNPs single nucleotide polymorphisms
  • Polynucleotides of the present invention also include polynucleotides encoding polypeptide variants that comprise an amino acid sequence selected from the group consisting of: SEQ ID NOs:4 and 22-38 and in which several, for instance from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acid residues are substituted, deleted or added, in any combination.
  • the present invention provides polynucleotides that are RNA transcripts of the DNA sequences of the present invention. Accordingly, there is provided an RNA polynucleotide that:
  • (a) comprises an RNA transcript of the DNA sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38;
  • (b) is the RNA transcript of the DNA sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38;
  • the polynucleotide sequences of SEQ ID NOs: 14 and 39-54 are a cDNA sequences that encodes the polypeptides of SEQ ID NOs:4 and 22-38, respectively.
  • the polynucleotide sequences encoding the polypeptide of SEQ ID NOs:4 and 22-38 may be identical to the polypeptide encoding sequences of SEQ ID NOs: 14 and 39-54 or they may be sequences other than SEQ ID NOs: 14 and 39-54, which, as a result of the redundancy (degeneracy) of the genetic code, also encodes the polypeptide of SEQ ID NO:2.
  • Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polypeptides and polynucleotides of the present invention have at least one Lig 72 A activity.
  • Polynucleotides of the present invention may be obtained using standard cloning and screening techniques from a cDNA library derived from rnRNA in cells of human hypothalamus, (see for instance, Sambrook, et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
  • the polynucleotide may include the coding sequence for the mature polypeptide, by itself, or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions.
  • a marker sequence that facilitates purification of the fused polypeptide can be encoded.
  • the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz, et al, Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag.
  • the polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non- translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA.
  • Polynucleotides that are identical, or have sufficient identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, may be used as hybridization probes for cDNA and genomic DNA or as primers for a nucleic acid amplification reaction (for instance, PCR).
  • probes and primers may be used to isolate full-length cDNAs and genomic clones encoding polypeptides of the present invention and to isolate cDNA and genomic clones of other genes (including genes encoding paralogs from human sources and orthologs and paralogs from species other than human) that have a high sequence similarity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, typically at least 95% identity.
  • Preferred probes and primers will generally comprise at least 15 nucleotides, preferably, at least 30 nucleotides and may have at least 50, if not at least 100 nucleotides. Particularly preferred probes will have between 30 and 50 nucleotides. Particularly preferred primers will have between 20 and 25 nucleotides.
  • a polynucleotide encoding a polypeptide of the present invention may be obtained by a process comprising the steps of screening a library under stringent hybridization conditions with a labeled probe having a sequence selected from consisting of: SEQ ID NOs: 14 and 39-54 or a fragment thereof, preferably of at least 15 nucleotides; and isolating full-length cDNA and genomic clones containing said polynucleotide sequence.
  • Such hybridization techniques are well known to the skilled artisan.
  • Preferred stringent hybridization conditions include overnight incubation at 42°C in a solution comprising: 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5x Denhardt's solution, 10 % dextran sulfate, and 20 microgram/ml denatured, sheared salmon sperm DNA; followed by washing the filters in
  • the present invention also includes isolated polynucleotides, preferably with a nucleotide sequence of at least 100, obtained by screening a library under stringent hybridization conditions with a labeled probe having a sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54 or a fragment thereof, preferably of at least 15 nucleotides.
  • an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide does not extend all the way through to the 5' terminus. This is a consequence of reverse transcriptase, an enzyme with inherently low "processivity" (a measure of the ability of the enzyme to remain attached to the template during the polymerisation reaction), failing to complete a DNA copy of the mRNA template during first strand cDNA synthesis.
  • PCR Nucleic acid amplification
  • PCR Nucleic acid amplification
  • the PCR reaction is then repeated using 'nested' primers, that is, primers designed to anneal within the amplified product (typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence).
  • the products of this reaction can then be analysed by DNA sequencing and a full-length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full-length PCR using the new sequence information for the design of the 5' primer.
  • Recombinant polypeptides of the present invention may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, in a further aspect, the present invention relates to expression systems comprising a polynucleotide or polynucleotides of the present invention, to host cells that are genetically engineered with such expression sytems and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
  • host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention.
  • Polynucleotides may be introduced into host cells by methods described in many standard laboratory manuals, such as Davis, et al, BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al. (ibid).
  • Preferred methods of introducing polynucleotides into host cells include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection.
  • bacterial cells such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Asperglllus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells
  • plant cells include bacterial cells, such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells
  • fungal cells such as yeast cells and Asperglllus cells
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells
  • plant cells include bacterial cells, such as Streptococci, Staphylococci, E.
  • expression systems can be used, for instance, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids.
  • the expression systems may contain control regions that regulate as well as engender expression.
  • any system or vector that is able to maintain, propagate or express a polynucleotide to produce a polypeptide in a host may be used.
  • the appropriate polynucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook, et al., (ibid).
  • Appropriate secretion signals may be incorporated into the desired polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the polypeptide or they may be heterologous signals.
  • a polypeptide of the present invention is to be expressed for use in screening assays, it is generally preferred that the polypeptide be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If the polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide. If produced intracellularly, the cells must first be lysed before the polypeptide is recovered.
  • Polypeptides of the present invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during intracellular synthesis, isolation and/or purification.
  • Polynucleotides of the present invention may be used as diagnostic reagents, through detecting mutations in the associated gene. Detection of a mutated form of a gene characterized by a polynucleotide selected from the group consisting of: SEQ ID NOs: 14 and 39-54 in the cDNA or genomic sequence associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to a disease, resulting from under-expression, over-expression or altered spatial or temporal expression of the gene. Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques well known in the art.
  • Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material.
  • the genomic DNA may be used directly for detection or it may be amplified enzymatically by using PCR, preferably RT-PCR, or other amplification techniques prior to analysis.
  • RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled nucleotide sequences of Lig 72A or a variant thereof. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures.
  • DNA sequence difference may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (see, for instance, Myers, et al, Science (1985) 230:1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (see Cotton, et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401).
  • An array of oligonucleotides probes comprising a Lig 72A polynucleotide sequence or a variant thereof can be constructed to conduct efficient screening of, e.g., genetic mutations.
  • Such arrays are preferably high density arrays or grids.
  • Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability, see, for example, M.Chee, et al, Science, 274, 610-613 (1996) and other references cited therein.
  • Detection of abnormally decreased or increased levels of polypeptide or mRNA expression may also be used for diagnosing or determining susceptibility of a subject to at least one of the Diseases. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods. Assay techniques that can be used to determine levels of a protein, such as a polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
  • the present invention relates to a diagonostic kit comprising:
  • a polynucleotide of the present invention preferably a nucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, or a fragment or an RNA transcript thereof;
  • polypeptide of the present invention preferably a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38 or a fragment thereof; or
  • an antibody to a polypeptide of the present invention preferably to a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38.
  • kits may comprise a substantial component.
  • a kit will be of use in diagnosing a disease or susceptibility to a disease, particularly diseases of the invention, among others.
  • the polynucleotide sequences of the present invention are valuable for chromosome localization studies.
  • the sequence is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome.
  • the mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene-associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library).
  • RH panels are available from Research Genetics (Huntsville, AL, USA), e.g., the GeneBridge4 RH panel (Hum Mol Genet 1996 Mar;5(3):339-46, A radiation hybrid map of the human genome. Gyapay G, Schmitt K, Fizames C, Jones H, Vega-Czarny N, Spillett D, Muselet D, PrudHomme JF, Dib C, Auffray C, Morissette J, Weissenbach J, Goodfellow PN). To determine the chromosomal location of a gene using this panel, 93 PCRs are performed using primers designed from the gene of interest on RH DNAs.
  • Each of these DNAs contains random human genomic fragments maintained in a hamster background (human / hamster hybrid cell lines). These PCRs result in 93 scores indicating the presence or absence of the PCR product of the gene of interest. These scores are compared with scores created using PCR products from genomic sequences of known location. This comparison is conducted at http://www.genome.wi.mit.edu/. Example 10 shows that the gene of the present invention maps to human chromosome 17q21.
  • the polynucleotide sequences of the present invention are also valuable tools for tissue expression studies. Such studies allow the determination of expression patterns of polynucleotides of the present invention that may give an indication as to the expression patterns of the encoded polypeptides in tissues, by detecting the mRNAs that encode them.
  • the techniques used are well known in the art and include in situ hydridization techniques to clones arrayed on a grid, such as cDNA microarray hybridisation (Schena, et al, Science, 270, 467-470, 1995 and Shalon, etal, Genome Res, 6, 639-645, 1996) and nucleotide amplification techniques such as PCR.
  • a preferred method uses the TAQMAN (Trade mark) technology available from Perkin Elmer. Results from these studies can provide an indication of the normal function of the polypeptide in the organism. In addition, comparative studies of the normal expression pattern of mRNAs with that of mRNAs encoded by an alternative form of the same gene (for example, one having an alteration in polypeptide coding potential or a regulatory mutation) can provide valuable insights into the role of the polypeptides of the present invention, or that of inappropriate expression thereof in disease. Such inappropriate expression may be of a temporal, spatial or simply quantitative nature.
  • the tissue localization data disclosed in Example 5 show that Lig 72A polypeptides of the present invention are expressed in the hypothalamus (cell bodies and nerve terminals), as well as the following areas of the whole brain: Raphe (nerve terminals), Locus Coeruleus (nerve terminals), Mesencephalic Trigeminal Nucleus (nerve terminals), Amygdala (cell bodies), Retrosplenial Cortex (cell bodies), Occipital Cortex (cell bodies), and the Temporal Cortex (cell bodies). Furthermore, preliminary dot blot analysis for Lig 72A on various rat tissue RNAs showed expression of the ligand in dorsal root spinal cord and dorsal root ganglia.
  • Assay techniques that can be used to determine levels of a protein, such as Lig 72 of the present invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and enzyme linked immunosorbent assays (ELISA). Among these, ELISAs are frequently preferred.
  • An ELISA assay initially comprises preparing an antibody specific to an HFGAN72 receptor ligand, preferably a monoclonal antibody.
  • a reporter antibody generally is prepared that binds to the monoclonal antibody.
  • the reporter antibody is attached to a detectable reagent such as radioactive, fluorescent or enzymatic reagent.
  • a sample is removed from a host and incubated on a solid support, e.g., a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin.
  • a non-specific protein such as bovine serum albumin.
  • the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any Lig 72A or a variant thereof attached to the polystyrene dish. Unbound monoclonal antibody is washed out with buffer.
  • the reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to Lig 72A or a variant thereof.
  • Unattached reporter antibody is then washed out.
  • Reagents for peroxidase activity including a colorimetric substrate are then added to the dish.
  • the amount of color developed in a given time period indicates the amount of ligand present in the sample.
  • Quantitative results typically are obtained by reference to a standard curve.
  • a competition assay may be employed wherein antibodies specific to Lig 72A or a variant thereof attached to a solid support and labeled Lig 72A of a variant thereof and a sample derived from the host are passed over the solid support.
  • the amount of detected label attached to the solid support can be correlated to a quantity of Lig 72A of a variant thereof in the sample.
  • Polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto.
  • These antibodies can be, for example, polyclonal or monoclonal antibodies.
  • the present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of a Fab expression library.
  • Various procedures known in the art may be used for the production of such antibodies and fragments.
  • Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
  • any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature, 1975, 256: 495-497, the trioma technique, the human B-cell hybridoma technique (Kozbor, et al, Immunology Today, 1983, 4: 72 (1983) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al, pages 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985)).
  • the above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromatography.
  • antibodies against Lig 72A or a variant thereof may be employed to inhibit interaction of such a ligand with HFGAN72 receptor and may be useful in the treatment of at least one of the Diseases.
  • polypeptides and polynucleotides of the present invention may also be used as vaccines. Accordingly, in a further aspect, the present invention relates to a method for inducing an immunological response in a mammal that comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response, including, for example, cytokine-producing T cells or cytotoxic T cells, to protect said animal from disease, whether that disease is already established within the individual or not.
  • An immunological response in a mammal may also be induced by a method comprises delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal the Diseases.
  • a method comprises delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal the Diseases.
  • One way of administering the vector is by accelerating it into the desired cells as a coating on particles or otherwise.
  • Such nucleic acid vector may comprise DNA, RNA, a modified nucleic acid, or a DNA/RNA hybrid.
  • a polypeptide or a nucleic acid vector will be normally provided as a vaccine formulation (composition).
  • the formulation may further comprise a suitable carrier.
  • a polypeptide may be broken down in the stomach, it is preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection).
  • parenteral administration include aqueous and non-aqueous sterile injection solutions that may contain anti-oxidants, buffers, bacteriostats and solutes that render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions that may include suspending agents or thickening agents.
  • the formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use.
  • the vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
  • Lig 72A or variant thereof could be used to isolate proteins which interact with it and, this interaction could be a target for interference. Inhibitors of protein-protein interactions between Lig 72A or a variant thereof and other factors could lead to the development of pharmaceutical agents for the modulation of Lig 72A activity. As used herein, the term “modulate” refers to affecting the Lig 72A function.
  • this invention also provides a method for identification of binding molecules to Lig 72A or a variant thereof.
  • Genes encoding proteins for binding molecules to Lig 72A can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan, et al, Current Protocols in Immunology 1 (Rivett, A.J., Biochem. J. 291:1-10 (1993)): Chapter 5 (1991).
  • the yeast two-hybrid system provides methods for detecting the interaction between a first test protein and a second test protein, in vivo, using reconstitution of the activity of a transcriptional activator.
  • the method is disclosed in U.S. Patent No. 5,283,173; reagents are available from Clontech and Stratagene. Briefly, cDNA of Lig 72A is fused to a Gal4 transcription factor DNA binding domain and expressed in yeast cells. cDNA library members obtained from cells of interest are fused to a transactivation domain of Gal4. cDNA clones that express proteins which can interact with Lig 72A will lead to reconstitution of Gal4 activity and transactivation of expression of a reporter gene such as Gall-lacZ.
  • the cDNA of the Lig 72A which is fused to the Gal4 transcription factor DNA binding domain, may be mutated in one or more amino acids, the method of which is described above, to enhance interaction of kinase with substrate.
  • An alternative method is screening of ⁇ gtl 1, ⁇ ZAP (Stratagene) or equivalent cDNA expression libraries with recombinant Lig 72A or a recombinant variant thereof.
  • Recombinant Lig 72A protein, variants thereof or fragments thereof are fused to small peptide tags such as FLAG, HSV or GST.
  • the peptide tags can possess convenient phosphorylation sites for a kinase such as heart muscle creatine kinase or they can be biotinylated.
  • Recombinant Lig 72A or a variant thereof can be phosphorylated with 32[P] or used unlabeled and detected with streptavidin or antibodies against the tags, ⁇ gtl lcDNA expression libraries are made from cells of interest and are incubated with the recombinant Lig 72A or a variant thereof, washed and cDNA clones isolated that interact with the HFGAN72 receptor ligands. See, e.g., T. Maniatis, et al, supra.
  • Another method is the screening of a mammalian expression library in which the cDNAs are cloned into a vector between a mammalian promoter and polyadenylation site and transiently transfected in COS or 293 cells followed by detection of the binding protein 48 hours later by incubation of fixed and washed cells with labeled Lig 72A or a variant thereof, preferably iodinated, and detection of bound Lig 72A or a variant thereof by autoradiography.
  • pools of cDNAs containing the cDNA encoding the binding protein of interest can be selected and the cDNA of interest can be isolated by further subdivision of each pool followed by cycles of transient transfection, binding and autoradiography.
  • the cDNA of interest can be isolated by transfecting the entire cDNA library into mammalian cells and panning the cells on a dish containing Lig 72A or a variant thereof bound to the plate. Cells that attach after washing are lysed and the plasmid DNA isolated, amplified in bacteria, and the cycle of transfection and panning repeated until a single cDNA clone is obtained. See Seed, et al, Proc. Natl. Acad. Sci. USA 84:3365 (1987) and Aruffo, et al, EMBO J. 6:3313 (1987).
  • binding protein If the binding protein is secreted, its cDNA can be obtained by a similar pooling strategy once a binding or neutralizing assay has been established for assaying supernatants from transiently transfected cells.
  • General methods for screening supernatants are disclosed in Wong, et al, Science 228:810-815 (1985).
  • Another alternative method is isolation of proteins interacting with Lig 72A or a variant thereof directly from cells. Fusion proteins of Lig 72A or a variant thereof with GST or small peptide tags are made and immobilized on beads. Biosynthetically labeled or unlabeled protein extracts from the cells of interest are prepared, incubated with the beads and washed with buffer.
  • Proteins interacting with Lig 72A or a variant thereof are eluted specifically from the beads and analyzed by SDS-PAGE. Binding partner primary amino acid sequence data are obtained by microsequencing.
  • the cells can be treated with agents that induce a functional response such as tyrosine phosphorylation of cellular proteins.
  • agents that induce a functional response such as tyrosine phosphorylation of cellular proteins.
  • An example of such an agent would be a growth factor or cytokine such as interleukin-2.
  • Another alternative method is immunoaffinity purification.
  • Recombinant Lig 72A or a variant thereof is incubated with labeled or unlabeled cell extracts and immunoprecipitated with anti-Lig 72A antibodies.
  • the immunoprecipitate is recovered with protein A-Sepharose and analyzed by SDS-PAGE. Unlabelled proteins are labeled by biotinylation and detected on SDS gels with streptavidin. Binding partner proteins are analyzed by microsequencing. Further, standard biochemical purification steps known to those skilled in the art may be used prior to microsequencing.
  • Yet another alternative method is screening of peptide libraries for binding partners.
  • Recombinant tagged or labeled Lig 72A or a variant thereof is used to select peptides from a peptide or phosphopeptide library that interact with Lig 72A or a variant thereof. Sequencing of the peptides leads to identification of consensus peptide sequences that might be found in interacting proteins.
  • Lig 72A binding partners identified by any of these methods or other methods that would be known to those of ordinary skill in the art, as well as those putative binding partners discussed above, can be used in the assay method of the invention. Assaying for the presence of a Lig 72A/binding partner complex are accomplished by, for example, the yeast two-hybrid system, ELISA or immunoassays using antibodies specific for the complex. In the presence of test substances (i.e., inhibitors or antagonists) that interrupt or inhibit formation of Lig 72A/binding partner interaction, a decreased amount of complex will be determined relative to a control lacking the test substance.
  • test substances i.e., inhibitors or antagonists
  • Polypeptides of the invention also can be used to assess Lig 72A binding capacity of Lig 72A binding molecules in cells or in cell-free preparations.
  • Lig 72A or a variant thereof of the present invention can also be employed in a process for screening for compounds that activate (agonists) or inhibit (antagonists) the activation of HFGAN72 receptor by Lig 72A or a variant thereof.
  • screening procedures involve providing appropriate cells that express HFGAN72 receptor on the surface thereof.
  • Such cells include cells from mammals, yeast, Drosophila or E. coli.
  • a polynucleotide encoding HFGAN72 receptor is employed to transfect cells to thereby express the receptor.
  • the expressed receptor is then contacted with a test compound Lig 72A or a variant thereof of the present invention to observe binding, stimulation or inhibition of a functional response.
  • such assay may be employed for screening for a compound that inhibits interaction of Lig 72A or a variant thereof with HFGAN72 receptor by contacting melanophore cells that encode the receptor with both an HFGAN72 receptor ligand of the present invention and a compound to be screened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of HFGAN72 receptor.
  • the screen may be employed for determining a compound that activates the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor, resulting in a second messenger response such as, but not limited to, cAMP inhibition or stimulation, calcium mobilization, and GTP ⁇ S binding.
  • Another such screening technique involves introducing RNA encoding HFGAN72 receptor into Xenopus oocytes to transiently express the receptor.
  • the receptor oocytes may then be contacted with a receptor ligand of the present invention and a compound to be screened, followed by detection of inhibition or activation of a signal in the case of screening for compounds that are thought to inhibit activation of the receptor by the ligand.
  • Another method involves screening for compounds that inhibit activation of the receptor by determining inhibition of binding of labeled Lig 72A or a variant thereof of the present invention to cells that have the receptor on the surface thereof.
  • Such a method involves transfecting a eukaryotic cell with DNA encoding HFGAN72 receptor such that the cell expresses the receptor on its surface and contacting the cell or cell membrane preparation with a compound in the presence of a labeled form of Lig 72A or a variant thereof.
  • the ligand can be labeled, e.g., by radioactivity.
  • the amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand that binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
  • Yet another screening technique involves the use of FLIPR equipment for high throughput screening of test compounds that inhibit mobilization of intracellular calcium ions, or other ions, by affecting the interaction of Lig 72A or a variant thereof with HFGAN72 receptor.
  • HFGAN72 receptors are found in the mammalian host and are responsible for many biological functions, including pathologies. Accordingly, it is desirous to find compounds that stimulate HFGAN72 receptor or the interaction of Lig 72A or a variant thereof and HFGAN72 receptor, on the one hand, and which can inhibit the function of HFGAN72 receptor, on the other hand.
  • HFGAN72 receptor has been preliminary demonstrated to be upregulated in vascular smooth muscle cells treated with serum, down-regulated in macrophages treated with oxidized LDL and has also been found in stented arteries. Accordingly, modulation of the activity of this receptor with polypeptides or fragments, derivatives or variants of the polypeptides of the instant invention may be useful in treating cardiovascular disorders. Isolation of this ligand from the brain and hypothalamus is also indicative of CNS relevance.
  • the present invention also relates to methods of using Lig 72A or a variant thereof or compounds that modulate the interaction of such a ligand with HFGAN72 receptor in the treatment of patients suffering from at least one of the Diseases.
  • Example 13 demonstrate the powerful analgesic activity of Lig 72A in three different types of in vivo pain studies that are well known and accepted in the art.
  • the data generated by the mouse carrageenan-induced hyperalgesia tests demonstrate that in a model of inflammation-induced hyperalgesia, Orexin- A, demonstrated an anti-hyperalgesic effect that is similar in efficacy to that of morphine.
  • Efficacy in this model indicates that Orexin-A would be effective in treating conditions in humans, such as arthritis, chronic back pain, sports injuries, where hyperalgesia is present as a consequence of inflammation and may be of chronic duration.
  • Orexin-A would be effective in treating hyperalgesia in humans due to other factors, such as metabolic damage (e.g., painful diabetic neuropathy), viral infection (e.g., post herpetic neuralgia), traumatic nerve injury (e.g., causalgia), and cancer pain.
  • metabolic damage e.g., painful diabetic neuropathy
  • viral infection e.g., post herpetic neuralgia
  • traumatic nerve injury e.g., causalgia
  • cancer pain e.g., cancer pain.
  • the data generated from the mouse hot-plate tests (Example 13b), a model of thermal nociception demonstrate an anti-nociceptive effect of Orexin-A. This effect is not blocked by the opiate antagonist, naloxone, indicating no involvement of opiate receptors in the stromsic effect of Orexin-A.
  • Orexin-A is analgesic against higher noxious temperatures in mice and is also effective when given by the intracerebroventricular (herein “i.c.v”) route in rats (see Tables 16 and 17), demonstrating that its effects are not confined to one species.
  • i.c.v intracerebroventricular
  • Orexin-A would be an effective analgesic in humans in conditions where acute injury is present, such as post-operatively and reinforces its potential for use in conditions such as arthritis, chronic back pain, sports injuries.
  • the present invention also relates to compositions comprising the polypeptides discussed above or the agonists or antagonists.
  • the polypeptides of the present invention, or agonists or antagonists thereto may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to a subject.
  • a pharmaceutical carrier suitable for administration to a subject such as a pharmaceutical carrier suitable for administration to a subject.
  • Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a polypeptide of the invention and a pharmaceutically acceptable carrier or excipient.
  • Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration.
  • the invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention.
  • Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.
  • Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
  • compositions may be administered in any effective, convenient manner including, for instance, administration by topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
  • compositions generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications.
  • the compositions are administered in an amount of at least about 10 ⁇ g/kg body weight. In most cases they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most cases, dose is from about 10 ⁇ g/kg to about 1 mg/kg body weight, daily. It will be appreciated that optimum dosage will be determined by standard methods for each treatment modality and indication, taking into account the indication, its severity, route of administration, complicating conditions and the like. EXAMPLES: BIOLOGICAL METHODS
  • Intrapeptide degenerate RT-PCR method was used to obtain the full-length sequence for the rat HFGAN72 receptor ligand (SEQ ID NO:7).
  • the peptide sequence QPLPDCCRQKTCSCRLYELLHGAGNHAGI was chosen to design highly degenerate oligonucleotide primers encoding its ends.
  • the sequences of primers were: CAACCNCTNCCNGACTGCTG (SEQ ID NO: 15) and ATNCCNGCNGCATGATT (SEQ ID NO: 16).
  • A can be substituted with G.
  • C can be substituted with T.
  • T At position 15 of the primer of SEQ ID NO: 15, C can be substituted with T.
  • C can be substituted with T.
  • A At position 12 of the primer of SEQ ID NO: 16, A can be sunstituted with G. At position 15 of the primer of SEQ ID NO: 16, A can be substituted with G. Any of all of these substitutions may be present in the primers of SEQ ID NOs: 15 and 16.
  • the symbol "N" can be an A, C, G or T.
  • the cDNA fragment encoding the peptide was obtained by RT-PCR from rat brain RNA and confirmed by nucleotide sequencing. 5'-RACE:
  • a non-degenerate oligonucleotide primer was designed (#1 ; GTTGCCAGCTCCGTGCAACAGTTCGTAGAGACGG) (SEQ ID NO: 17), based on the sequence of the above RT-PCR product, and used in a 5 '-RACE reaction: Double stranded cDNA was synthesized from rat brain polyA+ RNA, ligated to the Marathon adaptor (Clontech), and used as template for the initial 5 -RACE reaction with the adaptor primer 1 (Clontech) and #1 as primers. A nested PCR reaction was performed with an oligonucleotide CGGCAGGAACACGTCTTCTGGCG (#2) (SEQ ID NO: 18) and adaptor primer 2. An approx 250-bp 5' cDNA product, which correctly encodes the peptide, was obtained. 3'-RACE:
  • TCCTTGGGTATTTGGACCACTGCACCGAAG (#3) (SEQ ID NO: 19) and ATACCATCTCTCCGGATTGCCTCTCCCTGA (#4) (SEQ ID NO:20), which corresponded to a part of the putative 5'-noncoding region of the cDNA sequence obtained by the 5 -RACE reaction above.
  • Single stranded rat brain cDNA was synthesized using an oligonucleotide CCTCTGAAGGTTCCAGAATCGATAGTAN (SEQ ID NO:21) as a specific primer for the reverse transcription, and used as template for a 3 -RACE reaction using #3 and an anchor primer (CCTCTGAAGGTTCCAGAATCGATAG) (SEQ ID NO:22).
  • A can be substituted with either C or G.
  • the symbol "N" can be an A, C, G or T.
  • Hybridization-positive phages were plaque-purified, and genomic DNA fragments containing exons of HFGAN72 receptor ligands were identified by Southern blotting and subcloned into plasmid vectors for further analyses.
  • the complete nucleotide sequence of the genomic fragment was assembled from sequences of the overlapping subclones and sequences obtained by primer walking.
  • the homogenates were centrifuged at 20,000 x g for 30 minutes at 4°C. The centrifugation was repeated until all visible insoluble materials were removed from the supernatant. The supernatant was then aliquoted into several large glass bottles, and an equal volume of diethyl ether was added to each bottle. The mixture was vigorously shaken for 1 -2 minutes, and the two phases were allowed to separate for 30 minutes at room temperature. The lower aqueous phase (which appears turbid) was transferred to fresh bottles, and the ether extraction was repeated two more times to remove any acetone. Following the extractions, the aqueous phase was centrifuged at 20,000 x g for 30 minutes at 4°C.
  • the supernatant was spun again to remove all insoluble materials.
  • the final supernatant (approximately 500-600 ml) was then filtered through a mesh filter (Falcon Cell Strainer, Becton Dickinson, Co., Oxnard, CA) into a glass bottle.
  • the filtrate was then diluted with an equal volume of H,0 at room temperature and directly loaded onto two 10-gram cartridges of SepPak C18 (total of 20 gram bed), that were pre-equilibrated with 0.1% (volume/volume) trifluoroacetic acid (TFA).
  • TFA trifluoroacetic acid
  • Each cartridge was washed with 100 ml of 5% CH 3 CN/0.1% TFA, and then eluted with 30 ml of 50% CH,CN/0.1 % TFA . The first 6 milliliters of eluate was discarded as void. The remaining eluate was lyophilized in siliconized glass flask overnight.
  • the lyophilized material was dissolved in 24 milliliters of 1 M acetic acid by sonicating for 10-20 minutes or until there was no visible insoluble materials.
  • the extract was then filtered through a 20-micron Mirex GV syringe filter (Millipore, Bedford, MA).
  • Half (12 milliliters) of the filtered extract was directly loaded onto a C18 reverse-phase HPLC column (Vydac 218TP510; 5 micron; 10 mm x 250 mm semiprep; Hesperia, CA), pre-equilibrated with 3% CH,CN/0.1% TFA at a flow rate of 3 milliliters/minute at room temperature.
  • Sample was loaded in four 3-milliliter boluses via a large (5 milliliter or greater) sample loop. A 10%-40% gradient of CH 3 CN in 0.1 % TFA was then applied over 100 minutes. Three milliliter (or 1 minute) fractions were collected into siliconized 5 milliliter glass tubes. The identical HPLC was repeated once more for the remaining half of the extract. Sixty microliters (1/50) from each fraction were set aside and assayed for the Ca transients as described in Example 2, on 293/HFGAN72 cells.
  • the active fractions were pooled, and directly applied to a cation-exchange HPLC column (TosoHaas SP-5PW; 7.5 mm x 75 mm; Montgomeryville, PA), pre-equilibrated with 20 mM Na-phosphate (pH 3.0)/30% CH 3 CN at room temperature.
  • a 0-0.5 M gradient of NaCl in 20 mM Na-phosphate (pH 3.0)/30% CH 3 CN was applied over 60 minutes at a flow rate of 1 milliliter/minute.
  • One milliliter fractions were collected, and 30 microliters from each fraction were used for the Ca assay.
  • the active fractions (2-3 fractions; 2-3 milliliter) were pooled, and diluted 4-fold with 0.1% TFA.
  • the diluted sample was directly loaded onto an analytical C18 reverse- phase column (Vydac 218TP54; 4.6 mm x 250 mm), pre-equilibrated with 3% CH 3 CN/0.1% TFA at a flow rate of 1 milliliter/minute.
  • the column was maintained at 40°C with a column heater.
  • a 21%-36% gradient of CH 3 CN in 0.1% TFA was applied over 75 minutes.
  • Individual peaks (monitored at 210-nm absorption) were collected manually into siliconized 5 milliliter glass tubes, and 30 microliters from each fraction were assayed. At this point, the active peak was already >70-80% pure.
  • the active peak (about 1 milliliter) was diluted 4-fold with 0.1% TFA, and directly loaded onto the same C18 column, but this time pre-equilibrated with 3% CH 3 CN/20 mM Tris-HCl (pH 7.0 at 40°C). A 3%-40% gradient of CH 3 CN in 20 mM Tris-HCl (pH 7.0) was applied over 74 minutes at 40°C. The major 210-nm peak was collected manually. At this point, the sample should already be pure.
  • the active peak (about 800 microliters) was diluted 4-fold with 0.1 % TFA, and directly loaded onto a C8 reverse-phase column (Vydac 228TP104;pH- stable coated C8; 4.6 mm x 250 ml), pre-equilibrated with 3% CH 3 CN/0.1% TFA at a flow rate of 1 milliliter/minute. A 3%-36% gradient of CH 3 CN in 0.1% TFA was applied over 66 minutes at 40°C. The single 210-nm peak was collected manually. The biological activity was confirmed. The above process that was used to purify Lig 72A.
  • Lig 72B (SEQ ID NO:9) was found and purified by sythesizing the peptide based on the cDNA sequence and testing the synthesized product.
  • Example 3 Ca Assay for Lig 72A and Lig 72B:
  • the Ca assay was performed in accordance with procedures described by Sakuri, et al, Nature, 348:732-735 (1990). For the assay, a small portion of each HPLC fraction was transferred to a siliconized 1.5 milliliter Eppendorf tube and evaporated to dryness under vacuum. Dried material was reconstituted in 20 microliters of the Ca assay buffer (140 mM NaCl, 4 mM KC1, 1 mM Na 2 HP0 4 /l mM MgCl 2 , 1.25 mM CaCl 2 , 1 1 mM glucose, 5 mM HEPES (pH 7.4) and 0.2% bovine serum albumin) by vortexing for 3 minutes.
  • the Ca assay buffer 140 mM NaCl, 4 mM KC1, 1 mM Na 2 HP0 4 /l mM MgCl 2 , 1.25 mM CaCl 2 , 1 1 mM glucose, 5 mM HEPES (pH 7.4) and 0.2% bovine serum
  • the peptides were eluted with 2 microliters of 70% methanol, 5% formic acid and transferred to a nanoelectrospray needle.
  • the sample was analyzed using nanoelectrospray ionization on a PE-Sciex triple quadrupole mass spectrometer. A single peptide with a molecular weight of 1286.6 was observed.
  • This peptide was sequenced using collision induced dissociation (CID) tandem mass spectrometry (MS/MS).
  • CID tandem mass spectrometry a technique referred to as MS 3 .
  • the fragment-ions produced in the ion source that were generated differed from one another by the loss of successive N-terminal amino acids beginning with the "des 3 peptide fragment” and continuing through the "des 5 fragment”.
  • the "des 3 peptide fragment” refers to a fragment ion corresponding to the loss of the N-terminal 3 amino acids, with a charge retained on the amino acids 4-10.
  • the “des 3" product has the same molecular mass, composition, and presumably, structure, as the M+H of the peptide 4-10.
  • the “des 5 fragment” refers to a fragment ion corresponding to te loss of the N-terminal 5 amino acids, with a charge retained on the amino acids 6-10.
  • the “des 5" product has the same molecular mass, composition, and presumably, structure, as the M+H of the peptide 6-10.
  • Lig 72B was identified by direct Edman sequencing using an Hewlett Packard G1000A protein sequencer equipped with on-line Pth (phenylthiohydantoin) amino acid analysis. The molecular weight of the peptide was determined as 2935.9 Da by matrix- assisted laser desorption ionization mass spectrometry (MALDI-MS), indicating that the processed peptide was full-length and amidated at the C-terminal residue.
  • MALDI-MS matrix- assisted laser desorption ionization mass spectrometry
  • Example 5 Tissue Localization Data for Lig 72A: a. Immunohistochemistry method:
  • Lig 72A peptide was carried out using standand indirect immunofluorescence techniques.
  • rats were perfuse-fixed transcardially with 500 ml of 4% paraformaldehyde (Sigma) in 0.1 M sodium phosphate buffer (pH 7.4).
  • the rat brains were dissected out and stored in the same fixative overnight.
  • Coronal sections 50 ⁇ m were taken from the fore-, mid- and hind-brain regions at intervals of 1 mm and collected in phosphate-buffered saline (herein "PBS") (pH 7.4).
  • PBS phosphate-buffered saline
  • Sections were incubated with rabbit polyclonal antibodies raised against a 33-amino acid Lig 72A peptide (SEQ ID NO:4) for 5 hours at room temperature (1 :100 dilution in PBS containing 0.1% Triton X- 100 (Sigma)). Controls for the specificity of localization were generated by incubating serial sections with either buffer or normal rabbit serum ( 1 : 100 dilution) or antiserum preadsorbed with excess Lig 72A peptide or excess Lig 72B peptide.
  • Sections were washed 3 times in PBS and then incubated with Texas-Red conjugated goat anti-rabbit secondary antibody (Vector Labs., 30 ug/ml in PBS containing 0.1% Triton X-100). Sections were washed 3 times in PBS, floated on to gelatin-coated slides, mounted using Vectashield mounting medium (Vector Labs.) and examined under a Fluorescence microscope (Leica DMRB, 596 nm excitation, 615 nm emmision) fitted with an Ultrapix 400 CCD camera system (Astrocam) using DataCell image capture facilities and Optimas software.
  • b. Lig 72A Tissue Localization Data and Potential Therapeutic Implications Lig 72A Tissue Localization Data and Potential Therapeutic Implications:
  • Lig 72A (SEQ ID NO:4) in the brain.
  • Lig 72A is expressed in the hypothalamus (cell bodies and nerve terminals), which is associated with hormonal control, feeding, sexual behavior, and temperature control. It is understood in the art that the hypothalamus interacts with the following neurotransmitter systems: 5-HT, DA, and neuropeptides.
  • Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: depression; anxiety; obsessive compulsive disorder; affective neurosis/disorder; depressive neurosis/disorder; anxiety neurosis; dysthymic disorder; behavior disorder; mood disorder; psychosexual dysfunction; sex disorder; sexual disorder; disturbed biological and circadian rhythms; feeding disorders,such as anorexia, bulimia, cachexia, and obesity; Cushing's syndrome / disease; basophil adenoma; prolactinoma; hyperprolactinemia; hypopituitarism; hypophysis tumor / adenoma; hypothalamic diseases; Froehlich's syndrome; adenohypophysis disease; hypophysis disease; hypophysis tumor / adenoma; pituitary growth hormone; adenohypo
  • Lig 72A is also expressed in the Central Gray (nerve terminals), which is associated with nociception and wakefulness. It is understood in the art that the Central Gray (nerve terminals) interacts with the following neurotransmitter systems: 5-HT, NA, Adr, and Ach.
  • Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, migraine; hyperalgesia; enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia; acute pain; burn pain; atypical facial pain; neuropathic pain; back pain; complex regional pain syndromes I and II; arthritic pain; sports injury pain; pain related to infection, e.g., HIV, post-polio syndrome, and post- herpetic neuralgia; phantom limb pain; labor pain; cancer pain; post-chemotherapy pain; post-stroke pain; post-operative pain; neuralgia; and tolerance to narcotics or withdrawal from narcotics, among others.
  • migraine migraine
  • hyperalgesia enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia
  • acute pain such as hyperalgesia, causalgia and allodyni
  • Lig 72A is also expressed in the Locus Coeruleus (nerve terminals), which is associated with sleep/awake patterns. It is understood in the art that the Locus Coeruleus (nerve terminals), interacts with the NA and GABA neurotransmitter systems.
  • the localization of Lig 72A in the Locus Coeruleus (nerve terminals) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, sleep disorders; sleep apnea; narcolepsy; insomnia; parasomnia; jet-lag syndrome; fatigue; disturbed biological and circadian rhythms; and sleep disturbances associated with such diseases as neurological disorders, heart and lung diseases, mental illness, and addictions, among others.
  • Lig 72A is also expressed in the Mesencephalic Trigeminal Nucleus (nerve terminals), which is associated with nociception. It is understood in the art that the Mesencephalic Trigeminal Nucleus (nerve terminals), interacts with the NA and GABA neurotransmitter systems.
  • Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: migraine; hyperalgesia; enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia; acute pain; burn pain; atypical facial pain; trigeminal neuralgia; neuropathic pain; back pain; complex regional pain syndromes I and II; arthritic pain; sports injury pain; pain related to infection, e.g., HIV, post-polio syndrome, and post-herpetic neuralgia; phantom limb pain; labor pain; cancer pain; post-chemotherapy pain; post-stroke pain; postoperative pain; physiological pain; inflammatory pain; neuropathic pain; neuralgia; and tolerance to narcotics or withdrawal from narcotics, among others.
  • migraine migraine
  • hyperalgesia enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia
  • Lig 72A is also expressed in the Amygdala (cell bodies), which is associated with aggression and anxiety. It is understood in the art that the Amygdala (cell bodies) interacts with the following neurotransmitter systems: 5-HT and neuropeptides._The localization of Lig 72A in the Amygdala (cell bodies) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: depression; anxiety; affective neurosis/disorder; depressive neurosis/disorder; anxiety neurosis; dysthymic disorder; behavior disorder; mood disorder; epilepsy; and seizure disorders.
  • Lig 72A is expressed in the Retrosplenial Cortex (cell bodies), which is associated with sensory/thalamic functions. It is understood in the art that the Retrosplenial Cortex (cell bodies) interacts with the Glu, Gly, Ach, and GABA neurotransmitter systems.
  • Lig 72A is also expressed in the Occipital Cortex (cell bodies), which is associated with sensory/IC/geniculate functions. It is understood in the art that the Occipital Cortex (cell bodies) interacts with the Glu, Gly, Ach, and GABA neurotransmitter systems.
  • Lig 72A is expressed in the Temporal Cortex (cell bodies), which is associated with the primary visual cortex.
  • the Temporal Cortex (cell bodies) is understood in the art to interact with the Glu, Gly, Ach, and GABA neurotransmitter systems.
  • Example 6 Lig 72 Feeding Studies: a. Acute effects of i.c.v. administration of Lig 72A on feeding in satiated rats:
  • mice Male Sprague-Dawley rats (260-290g on arrival) were obtained from Charles River Breeding Laboratories. They were housed in groups of 5 for at least 5 days under controlled lighting (12 hour light-dark cycle) and temperature (21°C ⁇ 2°C) conditions. Food (chow pellets) and water were available ad libitum.
  • mice All rats (300g) were pre-treated with Synulox (0.1 ml/lOOg subcutaneous (herein “s.c.”)) approximately 1 hour before being anaesthetized with Domitor (0.04 ml/lOOg intramuscular (herein “i.m.”) or s.c.) and Sublimase (0.9 ml/lOOg intraperitoneal (herein “i.p.”)).
  • the rats were positioned in a stereotaxic frame and implanted with a guide cannula into the lateral brain ventricle under sterile conditions.
  • the co-ordinates used to map the correct positioning of the implants were: 0.8mm posterior to the bregma, 1.6mm lateral from the midline and 4.5mm ventral to the skull surface, with the incisor bar set 3.2mm below the interauricular line.
  • Zenecarp was given as an analgesic (0.03 ml/lOOg s.c), and anaesthesia was reversed using Antisedan and Nubain (50 : 50% v/v 0.02 ml/lOOg i.p.). Rats were then housed singly under the same conditions as above for a recovery period of at least 5 days, and body weights were monitored daily for the duration of the study.
  • rats were transferred to grid-floor cages so that food intake measurements could be made.
  • the position of the cannula was then verified by central administration of porcine NPY (2.3 nmol); for a positive test, at least 5.8g of food was eaten over a 4 hour period.
  • Lig 72A was dissolved in sterile water to make the highest dose, and individual doses were made up from this stock solution. Both porcine and rat NPY were dissolved in sterile water to a concentration of 2.3 nmol; the former was used as a positive control, whilst the latter was used to verify the position of the cannula. Water alone was used for the vehicle control.
  • mice Male Sprague-Dawley rats (270-280g on arrival) were obtained from Charles River Breeding Laboratories. They were housed in groups of 5 for at least 5 days under controlled lighting (12hour light-dark cycle) and temperature (21 °C ⁇ 2°C) conditions. Food (chow pellets) and water were available ad libitum.
  • All rats were anaesthetized with Domitor (0.04 ml/lOOg i.m. or s.c.) and Sublimase (0.9 ml/lOOg i.p.) prior to positioning in a stereotaxic frame.
  • An "L-shaped" guide cannula was implanted into the lateral brain ventricle under sterile conditions. The co-ordinates used to map the correct positioning of the implants were: 0.8mm posterior to the bregma, 1.6mm lateral from the midline and 4.5mm ventral to the skull surface, with the incisor bar set 3.2mm below the interauricular line.
  • a temperature probe was then implanted in the brown adipose tissue (BAT) between the shoulder blades. Following surgery, anaesthesia was reversed using Antisedan and Nubain (50 : 50% v/v 0.02 ml/lOOg i.p.). Rats were then housed singly under the same conditions as above for a recovery period of 3 days.
  • Both Lig 72A and Lig 72B were dissolved in sterile water to a concentration of 18nmol/24 ⁇ l. Water alone was used to fill the first pumps, and for the vehicle control in the second. At least 4 hours prior to implanting, all pumps were attached to catheters and primed at 37 °C, to ensure continuous pumping, and minimize the chance of clotting within the tubing or occlusion by surrounding tissue.
  • Rats were housed overnight in the operating room.
  • Anesthesia consisted of Domitor (i.m.)/sublimaze (i.p.) with intra-epicaine used locally where appropriate.
  • the eyes were treated with lacrilube to avoid excessive drying.
  • Surgery was carried out using standard stereotaxic techniques and under aseptic conditions. Following anesthesia and skull preparation, holes were drilled at the appropriate locations on the surface to allow for the implantation of unilateral cannulae and to allow placement of anchor screws (one on each skull plate) for a dental acrylic headcap to hold the guide cannulae in position.
  • the injection procedure outlined below is followed for all subsequent studies:
  • the injection unit (previously stored in absolute ethanol) was rinsed in sterile saline and attached to a length of sterile Portex tubing. The unit was then wiped with a Vetwipe to sterilize post handling. This tubing was flushed with sterile saline, filled and attached to a glass Hamilton syringe microsyringe. 1 ⁇ l of air was taken up to provide an air bubble to separate drug solution from saline. An appropriate volume of drug solution was drawn up into the tubing, and the syringe was fixed into a microinfusion pump programmed to pump at 5 ⁇ l/min. The rat was gently restrained and the dummy cannula removed.
  • the injection unit was inserted into the guide cannula until completely flush with the top of the guide cannula. 5 ⁇ l of drug was injected over a 60 second period and the injection unit was left in place for up to 90 seconds to allow complete diffusion of the drug. The injection unit was removed and the dummy cannula replaced.
  • Lig 72A 3.97 mgs of Lig 72A was dissolved in 0.66 mis of sterile water (Arnolds Lot No 022 - Exp. date 09/98) to give a solution of 6 mgs/ml (c.f. 30 ⁇ g in 5 ⁇ l). Serial dilutions were made from this solution as required.
  • Rectal temperature was monitored using an electric thermometer (COMARK, model 9001) coupled to a rectal probe (COMARK, model BS4937K), which was inserted approximately 5 cms into the rectum and left until a steady reading was obtained. Temperature measurements were taken at 30 min (-30), and immediately prior to administration of Lig 72A. Further measurements were taken at 15, 30, 45 and 60 minutes post injection. a. Data Analysis:
  • the X-maze is constructed of black perspex and consists of two enclosed arms 42 cm long x 15 cm wide x 11 cm high and two open arms of the same length and width but with a wall only 1 cm high.
  • the arms are arranged in the shape of a X such as they lie directly opposite each other.
  • mice 40 rats from JH i.c.v./Gp03 were used. Animals were assigned into one of three treatment groups;
  • the results of these grooming data support the results of the tissue localization data above (see Example 5), which show that because Lig 72A is expressed in the hypothalamus (cell bodies and nerve terminals), Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, obsessive compulsive disorder.
  • obsessive compulsive disorder is associated with the hypothalamus (cell bodies and nerve terminals).
  • the resultant data generated by the above methods reveal that Lig 72 elevates locomotor activity in a statistically significant amount when injected in doses of 3 and 10 ⁇ g/rat i.c.v. in adult rats.
  • Lig 72A, Lig 72B or an agonist or antagonist of the interaction between Lig 72A and HFGAN72 receptor or between Lig 72B and HFGAN72 receptor plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, sleep disorders; sleep apnea; narcolepsy; insomnia; parasomnia; jet-lag syndrome; disturbed biological and circadian rhythms; and sleep disturbances associated with such diseases as neurological disorders, heart and lung diseases, mental illness, and addictions, among others.
  • Example 5 shows that because Lig 72A is expressed in the hypothalamus (cell bodies and nerve terminals), Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, obsessive compulsive disorder.
  • the Locus Coeruleus (nerve terminals) is associated with sleep/awake patterns.
  • Example 10 Chromosome localization data for Lig 72:
  • chromosome 17-linked dementia which includes nosological entities such as disinhibition-dementia-parkinsonism-amyotrophy complex (DDPAC: MIM No. *600274) and pallido-ponto-nigral degeneration (PPND; MIM No. * 168610), which may be allelic.
  • Anaesthesia was induced with Domitor (0.4mg/kg i.m.) and Sublimase (0.45mg/kg i.p.). Following anaesthesia, rats were secured in a stereotaxic frame with the incisor bar positioned 3.2mm below the intrauricular line. Under aseptic conditions a guide cannula with keeper cannula was implanted into the lateral brain ventricle using the following coordinates: 0.8mm posterior to bregma, -1.6mm lateral of midline and 4.5mm ventral of the skull surface. Silver chloride ball electrodes for EEG recordings were implanted through bore holes in the skull over the left / right frontal cortex and the left / right occipital cortex.
  • Silver electrodes were also placed in the left / right musculature of the neck for EMG recordings. All electrodes were soldered to a six pin connecting block and secured in place with dental cement and three cortical screws. After suture of the incision anaesthesia was reversed with Antisedan (lmg/kg s.c.) and Nubain (2mg/kg s.c). Animals were allowed to recover in a heated incubator until righting reflex returned, and feeding began.
  • Lig 72A dissolves at a very low pH (2-3) in water. This pH was buffered back to pH 5-6 by addition of sodium hydroxide. EEG and EMG signals were captured to PC via leads attached to the six pin connecting block. A swivel mechanism allowed free movement of the animal. At the end of the recording period, rats were returned to their home cages. d. Data Analysis:
  • the Lig 72A truncation mutants and variant peptides shown in Table 2 were synthesized.
  • the amino acid sequence of SEQ ID NO:23 is a truncation mutant containing amino acids 15-33 of Lig 72A (SEQ ID NO:4).
  • the remaining amino acid sequences in Table 2 (SEQ ID NOs:24-38) are variants of the truncation mutant of SEQ ID NO:23.
  • the polynucleotide sequences that encode each of these variant polypeptides are shown in their respective order in Table 3 (SEQ ID NOs:39-54).
  • Lig 72A variants and truncations mutants of amino acid residues 15-33 of Lig 72A (SEQ ID NO:4).
  • All of the Lig72A variant peptides shown in Table 3 were synthesized by the solid phase technique using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry.
  • C-terminal amides were prepared on Fmoc-PAL-PEG-PS resin (Perseptive Biosystems) and C-terminal acids on Fmoc-L-Leu-PAC-PS resin (Perseptive Biosystems). Fmoc deprotection was carried out using a solution of piperidine in DMF (20% v/v).
  • Fmoc amino acid derivatives were activated in situ with either (N-[(dimethylamino ⁇ -lH-l,2,3-triazol[4,5-b]pyridin-l- ylmethylene-N-methylmethamirnium hexafluorophosphate-N-oxide (HATU; previously named 2-(lH-azatriazole-l-yl)-l,l,3,3-tetramethyl uronium hexafluorophosphate) or 2- (lH-benzotriazole-l-yl)-l,l,3,3-tetramethyl uronium hexafluorophosphate (HBTU) in the presence of N,N-diisopropylethylamine (DIEA).
  • DIEA N,N-diisopropylethylamine
  • the side chain protection used was as follows: 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulphonyl (Pbf) for arginine, trityl for asparagine, glutamine and histidine, and tert-butyl for threonine, tyrosine and glutamic acid.
  • CGCCTCTAC [CG (TCAG) or AG (AG) ] CTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
  • Example 13 Orexin-A in vivo Pain Studies: a. Mouse Carrageenan Induced Hyperalgesia Tests:
  • the objective of these experiments was to determine the effect of known and putative analgesics against carrageenan induced inflammation and hyperalgesia in the mouse hind paw, using a model of thermal hyperalgesia.
  • Lambda carrageenan extracted from seaweed, when injected sub-plantar into the hind paw causes an inflammatory reaction and consequent swelling of the paw. This induces hyperalgesia, which can be determined using both thermal and mechanical procedures. The former was currently performed here. It is understood in the art that this condition mimics the effects of inflammatory states such as acute joint injury and arthritis. Coderre, et al, R. Brain Res 404:95-106 (1987); Hargreaves, et al, Pain 32:77-88 (1988).
  • mice 20-30g Female trtete ICR mice 20-30g (supplied by Harlan Olac)
  • mice were habituated to plantar apparatus for 4 days prior to first baseline reading. At least 1 day prior to carrageenan injection, second baseline latencies were obtained for the ipsilateral hind paw. The mice were sorted into groups of 15, giving approximately equal mean latencies. Only the second baseline latencies were used in experimental data analysis. On the day of the experiment, 25 ⁇ l of 2% carrageenan was injected sub plantar into the left hind paw. 4 hours post-carrageenan, the animals were tested for thermal hyperalgesia in the ipsilateral paw. Experimental Design:
  • mice 15 mice were used per test group. Baseline data was used to randomize mice into groups of approximately equal latencies prior to dosing. Animals were dosed in cage order, blind to the operator. Data Acquisition & Analysis:
  • the drugs were suspended in 1 % methyl Cellulose.
  • s.c i.p., i.m.
  • intravenous (herein "i.v.") dosing the drugs were normally dissolved in sterile 0.9% saline or another suitable solvent E.G. ethanol & tween 80 1-10% in saline.
  • the dose volume is 1ml / lOOg.
  • the drugs were encoded to enable 'blind' administration.
  • Orexin-A (i.v., 5 min pre-test) vehicle lOmg/kg 30mg/kg
  • Table 6 shows the effect of Orexin-A (3, 10 and 30 mg/kg i.v., 5 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model.
  • Table 8 shows the effect of morphine (2.5, 5 and 10 mg/kg s.c, 30 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model.
  • the objective of these tests was to determine the effect of putative anti- nociceptives on thermal nociception in the mouse and rat.
  • the animals were initially placed in groups of ten in 15 x 32 cm divided 'shoebox' type cages and were then left for 30 min. to acclimatize. The animals were then tail-marked and weighed. The drugs are then dosed blind and randomized throughout the groups.
  • the animals were dosed in groups of ten every ten minutes.
  • the pre-treatment time varied normally between 15 and 180 min.
  • the animals were confined individually within a perspex cylinder placed on the hot-plate normally set at 50- 55°C.
  • Each animal was then observed for signs of nociception, i.e., fanning or licking of paws.
  • each animal was removed from the hot-plate.
  • the latency to this response was recorded for analysis. Any animal failing to react by 40 seconds (for temperatures above 50°C) was removed from the hot-plate. For temperatures of 50°C and below, a cut-off time of 60 seconds was used.
  • Rat Intracerebral Drug Administration was used for the rat hot-plate tests. Otherwise, the rat hot-plate tests were conducted in the same way as the mouse hot-plate tests.
  • the obective of this procedure is to allow administration of substances directly into the cerebrospinal fluid (herein "csf ”) of discrete brain areas of the rat via a chronically indwelling cannula.
  • csf cerebrospinal fluid
  • the sterotaxic co-ordinates for the lateral ventricles are (from intersection of bregma and midline):
  • Incisor bar set at -3.2mm Anterior-Posterior: -0.8mm
  • the coordinates from other brain areas were determined from literature/atlas values and then confirmed via ink injection in at least two cadavers.
  • An obturator (dummy cannula) was placed in the cannula to prevent blockages from occurring and to prevent loss of ventricular fluid.
  • Anaethesia was reversed and analgesia provided by Antisedan/nubain. Animals were monitored throughout post-op recovary in a warm cage until the righting reflex was returned, whereupon they were singly housed. Animals received 5 days of postoperative care provided by LAS veterinary section. All surgical work conformed to LAS SOP 25 (Veterinary Procedures). Injection procedure:
  • the injection unit (previously stored in absolute ethanol) was rinsed in sterile saline and attached to a length of sterile Portex tubing. The injection unit was wiped with a Vetwipe to sterilize post handling. This tubing was flushed with sterile saline, filled and attached to a 10 ⁇ l Hamilton syringe. 1 ⁇ l of air was taken up to provide an air bubble to separate drug solution from saline. An appropriate volume of drug solution was drawn up into the tubing and the syringe is fixed into the Harvard 22 microinfusion pump programmed to pump at 5 ⁇ l/min for i.c.v. injections and between 0.25-1 ⁇ l/min for intracerebral injections.
  • the rat was gently restrained and the dummy cannula removed.
  • the injection unit was inserted into the guide cannula until it was completly flush with the top of the guide cannula and the rat was released.
  • typically 5 ⁇ l of drug was injected over a 60 second period, and the injection unit was left in place for up to 90 seconds to allow complete diffusion of the drug.
  • the injection unit was removed and the dummy cannula replaced. Any remaining drug solution is discarded and the tubing was flushed with sterile saline and the injection unit cleaned with a Vetwipe.
  • the volume was no greater than 2 ⁇ l and prefereably ⁇ l ⁇ l.
  • drug vehicle was sterile saline or PBS (pH 7.4), although when necessary, distilled water was used.
  • Angiotensin II human octapeptide 100 ng i.c.v. in 5 ⁇ l sterile saline (Bachem, UK) Data Acquisition and Analysis:
  • % MPE (T - C)/(CT-C)xl00.
  • T test latency(s)
  • C control mean (s)
  • CT cut off time (40 or 60 s)
  • the drugs were suspended in 1% methylcellulose.
  • s.c i.p., i.m., or i.v. dosing
  • the drugs were normally dissolved in sterile 0.9% saline or another suitable solvent, e.g., ethanol & tween 80 1-10% in saline.
  • the dose volume was 1 ml / lOOg.
  • the drugs were coded to enable 'blind' administration. Doses are expressed as free base.
  • Table 10 shows the effect of Orexin-A (0.1, 0.3, 1, 3, 10 and 30 mg/kg i.v., 5 min pre-test) in the mouse 50°C hotplate. Data are expressed as mean latency + sem, . p ⁇ 0.05, Kruskal-Wallis followed by post hoc mann-Whitney U test compared to vehicle. Table 10
  • Table 12 shows the effect of naloxone (10 mg/kg i.p., 30 min pre-test) vs. Orexin-A (30 mg/kg i.v., 5 min pre-test) in the mouse 50°C hotplate. Data are expressed as mean latency ⁇ sem. p ⁇ 0.05, Kruskal-Wallis followed by post hoc Mann- Whitney U test compared to vehicle. Table 12
  • Table 14 shows the effect of Orexin-A (1 , 3, 10 and 30 mg/kg i.v., 5 min pre-test in the mouse 55°C hotplate. Data are expressed as mean latency + sem. p ⁇ 0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 14
  • Table 16 shows the effect of Orexin-A (3, 10 and 30 ⁇ g) i.c.v., 5 min pre-test in the rat 50°C hotplate. Data are expressed as mean latency + sem. p ⁇ 0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 16
  • Table 18 shows the effect of Orexin-A (15-33) truncate (SEQ ID NO:23) (1, 3, 10 and 30 mg/kg i.v., 5 min pre-test in the mouse 50°C hotplate. Data are expressed as mean latency + sem. p ⁇ 0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 18
  • Orexin-A In a mouse model of thermal nociception, Orexin-A consistently increases the latency to response, indicating an anti-nociceptive effect. This effect is not blocked by the opiate antagonist, naloxone, indicating that the stromsic effect of Orexin-A has no involvement with opiate receptors. Orexin-A is also analgesic against higher noxious temperatures in mice and is also effective when given by the i.c.v. route in rats (see Tables 16 and 17), demonstrating that its effects are not confined to one species. These data indicate that Orexin-A would be an effective analgesic in humans in conditions where acute injury is present, such as post-operatively, and reinforces its potential for use in conditions such as arthritis, chronic back pain, sports injuries.
  • the objective of the MAC test is to determine the effect of putative anti- nociceptives in a model of chemically induced nociception in the mouse.
  • mice with a solution of P.P.Q. elicits a response (abdominal constriction) that is antagonized by the weaker anti-nociceptive agents.
  • the abdominal constriction is characterized by repeated contraction of the abdominal musculature accompanied by extension of the hind legs.
  • Interest in the model is based on the idea that it may help to relieve the lack of reliable tests for weak anti-nociceptives.
  • the test that we utilized is a modified version of the standard mouse abdominal constriction model, whereby we record the latency to first constriction, rather than the number of constrictions.
  • mice were initially placed in groups of five in 15 x 32 cm divided 'shoebox' type cages and are then left for 30 min. to acclimatize. The mice were then tail-marked and weighed. The drugs were then dosed blind and randomized throughout the groups. The mice were dosed in groups of five every fifteen minutes. The pre-treatment time varied normally between 15 and 180 min. The mice were then dosed with P.P.Q. 2.5mg/kg i.p. prepared as follows. 12.5 mg of phenyl-p-quinone was weighed into an econoglass 25 ml vial and dissolved in 2.5 ml of ethanol. The vial was placed inside a 100ml brown glass sample bottle and left in a water bath set at 37.5 °C.
  • mice 47.5 ml of sterile distilled water was put into another 100 ml brown glass sample bottle and placed in the water bath. When the distilled water reached 37.5°C ,and the p.p.q. was fully dissolved, the two were mixed. To prevent the solution from turning milky, the p.p.q. was added to the water. The mice were dosed with the p.p.q. 10 seconds apart and placed in numbered compartments of the observation box. A stopwatch was started when the first mouse of each group of five was dosed. The mice were then observed, and the time to first abdominal contraction for each mouse was recorded. After its first contraction, each mouse was euthanized.
  • mice had staggered dosing times, a number of seconds was subtracted from the time recorded from the stopwatch for mice 2 to 5 in each group 10 s from number 2 , 20 from 3, 30 from 4 and 40 from 5. The final latencies were then converted into seconds. Any mouse not reacting within 10 minutes was euthanized and assigned a time of 600 seconds.
  • % MPE (T - C)/(CT-C)x 100.
  • T test latency(s)
  • C control mean (s)
  • CT cut off time (600s)
  • P.P.Q. was obtained from Sigma (Poole, UK).
  • the drugs were suspended in 1% methyl cellulose.
  • the drugs were normally dissolved in sterile 0.9% saline or another suitable solvent E.G. ethanol & tween 80 1-10% in saline.
  • the dose volume was 1ml / lOOg.
  • the drugs were coded to enable "blind' administration. Doses are expressed as free base. Activity Of Standard Drugs:
  • Orexin-A In a model of acute inflammation/visceral pain, Orexin-A increased the latency to response towards cut-off levels, effectively abolishing the response to P.P.Q. These data indicate that Orexin-A would be an effective treatment in humans for acute inflammatory conditions, as well as for pain arising from the viscera, e.g.,: angina, irritable bowel syndrome (IBS), and inflammatory bowel disease. All publications including, but not limited to, patents and patent applications, cited in this specification, are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Polypeptides of Lig 72A and variants thereof, as well as polynucleotides encoding the polypeptides are provided. Methods of using these polypeptides to diagnose or treat diseases relating to the under- or over-expression of Lig 72A or a variant thereof are also provided. In addition, methods of identifying agonists or antagonists of the interaction between Lig 72A or a variant thereof with HFGAN72 receptor are provided. Methods of treatment by administering the polypeptides of the invention or the identified agonists or antagonists to patients in need thereof are further disclosed.

Description

METHODS OF TREATMENT USING LIG 72A AND VARIANTS THEREOF Field of the Invention
This invention relates to newly identified polypeptides and polynucleotides encoding the polypeptides; variants and derivatives of the polypeptides and polynucleotides; agonists and antagonists of the polypeptides; and uses of the polypeptides, polynucleotides, variants, derivatives, agonists and antagonists. In particular, in these and in other regards, the invention relates to polypeptides and polynucleotides encoding polypeptides that are ligands for neuropeptide receptor HFGAN72, hereinafter referred to as "HFGAN72 receptor ligands". HFGAN72 receptor is alternatively referred to as "Orexin-1 receptor".
A particularly preferred embodiment of the invention relates to methods for the treatment of a patient having need of Lig 72A, or a variant thereof, comprising administering to the patient a therapeutically effective amount of Lig 72A or a variant thereof. Lig 72A is also referred to herein as "Orexin-A". Also contemplated within the scope of the invention are methods of treatment of a patient having need of either an agonist or an antagonist of the interaction between of Lig 72A and HFGAN72 receptor comprising administering to the patient a therapeutically effective amount of either an agonist or antagonist of Lig 72A or a variant thereof. Background of the Invention
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are ligands for a human 7-transmembrane receptor. The invention also relates to inhibiting or activating the action of such polypeptides.
It is well established that many medically significant biological processes are mediated by proteins participating in signal transduction pathways that involve G-proteins and/or second messengers, e.g., cAMP (Lefkowitz, Nature, 1991, 351:353-354). Herein, these proteins are referred to as proteins participating in pathways with G-proteins or PPG proteins. Some examples of these proteins include the GPC receptors, such as those for adrenergic agents and dopamine (Kobilka, B.K., et al, Proc. Natl Acad. Sci., USA, 1987, 84:46-50; Kobilka, B.K., et al, Science, 1987, 238:650-656; Bunzow, J.R., et al, Nature, 1988, 336:783-787), G-proteins themselves, effector proteins, e.g., phospholipase C, adenyl cyclase, and phosphodiesterase, and actuator proteins, e.g., protein kinase A and protein kinase C (Simon, M.I., et al, Science, 1991, 252:802-8). For example, in one form of signal transduction, the effect of hormone binding is activation of the enzyme, adenylate cyclase, inside the cell. Enzyme activation by hormones is dependent on the presence of the nucleotide GTP. GTP also influences hormone binding. A G-protein connects the hormone receptor to adenylate cyclase. G-protein was shown to exchange GTP for bound GDP when activated by a hormone receptor. The GTP-carrying form then binds to activated adenylate cyclase. Hydrolysis of GTP to GDP, catalyzed by the G-protein itself, returns the G-protein to its basal, inactive form. Thus, the G-protein serves a dual role, as an intermediate that relays the signal from receptor to effector, and as a clock that controls the duration of the signal.
The membrane protein gene superfamily of G-protein coupled receptors has been characterized as having seven putative transmembrane domains. The domains are believed to represent transmembrane '-helices connected by extracellular or cytoplasmic loops. G-protein coupled receptors include a wide range of biologically active receptors, such as hormone, viral, growth factor and neuro-receptors.
G-protein coupled receptors have been characterized as including these seven conserved hydrophobic stretches of about 20 to 30 amino acids, connecting at least eight divergent hydrophilic loops. The G-protein family of coupled receptors includes dopamine receptors that bind to neuroleptic drugs used for treating psychotic and neurological disorders. Other examples of members of this family include, but are not limited to, calcitonin, adrenergic, endothelin, cAMP, adenosine, muscarinic, acetylcholine, serotonin, histamine, thrombin, kinin, follicle stimulating hormone, opsins, endothelial differentiation gene-1, rhodopsins, odorant, and cytomegalovirus receptors.
Most G-protein coupled receptors have single conserved cysteine residues in each of the first two extracellular loops that form disulfide bonds that are believed to stabilize functional protein structure. The 7 transmembrane regions are designated as TM1, TM2, TM3, TM4, TM5, TM6, and TM7. TM3 has been implicated in signal transduction.
Phosphorylation and lipidation (palmitylation or farnesylation) of cysteine residues can influence signal transduction of some G-protein coupled receptors. Most G-protein coupled receptors contain potential phosphorylation sites within the third cytoplasmic loop and/or the carboxy terminus. For several G-protein coupled receptors, such as the b- adrenoreceptor, phosphorylation by protein kinase A and/or specific receptor kinases mediates receptor desensitization. For some receptors, the ligand binding sites of G-protein coupled receptors are believed to comprise hydrophilic sockets formed by several G-protein coupled receptor transmembrane domains, said socket being surrounded by hydrophobic residues of the G-protein coupled receptors. The hydrophilic side of each G-protein coupled receptor transmembrane helix is postulated to face inward and form a polar ligand binding site. TM3 has been implicated in several G-protein coupled receptors as having a ligand binding site, such as the TM3 aspartate residue. TM5 serines, a TM6 asparagine and TM6 or TM7 phenylalanines or tyrosines are also implicated in ligand binding.
G-protein coupled receptors can be intracellularly coupled by heterotrimeric G- proteins to various intracellular enzymes, ion channels and transporters. See Johnson, et al, Endoc. Rev., 1989, 10:317-331. Different G-protein a-subunits preferentially stimulate particular effectors to modulate various biological functions in a cell. Phosphorylation of cytoplasmic residues of G-protein coupled receptors have been identified as an important mechanism for the regulation of G-protein coupling of some G-protein coupled receptors. G- protein coupled receptors are found in numerous sites within a mammalian host.
Over the past 15 years, nearly 350 therapeutic agents targeting 7 transmembrane (7 TM) receptors or their ligands have been successfully introduced onto the market. This indicates that these receptors and their ligands have an established, proven history as therapeutic targets. Clearly, there is a need for identification and characterization of further receptors and ligands that can play a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: depression; anxiety; obsessive compulsive disorder; affective neurosis/disorder; depressive neurosis/disorder; anxiety neurosis; dysthymic disorder; behavior disorder; epilepsy; seizure disorder; mood disorder; psychosexual dysfunction; sex disorder; sexual disorder; disturbed biological and circadian rhythms; feeding disorders, such as anorexia, bulimia, cachexia, and obesity; Cushing's syndrome / disease; basophil adenoma; prolactinoma; hyperprolactinemia; hypopituitarism; hypophysis tumor / adenoma; hypothalamic diseases; Froehlich's syndrome; adenohypophysis disease; hypophysis disease; hypophysis tumor / adenoma; pituitary growth hormone; adenohypophysis hypofunction; adrenohpophysis hyperfunction; hypothalamic hypogonadism; Kallman's syndrome (anosmia, hyposmia); functional or psychogenic amenorrhea; hypopituitarism; hypothalamic hypothyroidism; hypothalamic- adrenal dysfunction; idiopathic hyperprolactinemia; hypothalamic disorders of growth hormone deficiency; idiopathic growth hormone deficiency; dwarfism; gigantism; acromegaly; disturbed biological and circadian rhythms; and sleep disturbances associated with such diseases as neurological disorders, heart and lung diseases, mental illness, and addictions; migraine; enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia; acute pain; burn pain; atypical facial pain; neuropathic pain; back pain; complex regional pain syndromes I and II; arthritic pain; sports injury pain; pain related to viral infection, e.g., HIV, post-polio syndrome, and post-herpetic neuralgia; phantom limb pain; labor pain; cancer pain; post-chemotherapy pain; post-stroke pain; post-operative pain; physiological pain; inflammatory pain; acute inflammatory conditions/visceral pain, e.g., angina, irritable bowel syndrome (IBS), and inflammatory bowel disease; neuropathic pain; neuralgia; painful diabetic neuropathy; traumatic nerve injury; and tolerance to narcotics or withdrawal from narcotics; sleep disorders; sleep apnea; fatigue; narcolepsy; insomnia; parasomnia; jet-lag syndrome; and other neurodegenerative disorders including , for example, nosological entities such as disinhibition-dementia-parkinsonism-amyotrophy complex; pallido-ponto-nigral degeneration, among others (hereinafter collectively referred to as "the Diseases").
Polypeptides and polynucleotides encoding the human 7-transmembrane G-protein coupled neuropeptide receptor, HFGAN72, have been identified and are disclosed in PCT Application WO 96/34877, published on November 7, 1996.
The present invention provides polypeptides and polynucleotides encoding Lig 72A polypeptides and variants thereof. Summary of the Invention
Toward these ends, and others, it is an object of the present invention to provide polypeptides, inter alia, that have been identified as ligands for HFGAN72 receptor or variants thereof, including truncation mutants thereof.
It is a further object of the invention, moreover, to provide polynucleotides encoding HFGAN72 receptor ligands or variants thereof, including truncation mutants thereof.
In accordance with this aspect of the invention, there are provided methods using isolated HFGAN72 receptor ligand polypeptides and nucleic acid molecules encoding these receptor ligand polypeptides, including mRNAs, cDNAs, genomic DNAs and, in further embodiments of this aspect of the invention, biologically, diagnostically, clinically or therapeutically useful variants, analogs or derivatives thereof, or fragments thereof, including truncation mutants and fragments of the variants, analogs and derivatives.
Another object of the invention is to provide an antibody against the interaction of the Lig 72A variants and HFGAN72 receptor.
It is also an object of the invention to provide an agonist of the interaction of the Lig 72A variants and HFGAN72 receptor. A further object of the invention is an antagonist that inhibits the interaction of the Lig 72A variants and HFGAN72 receptor.
It is also an object of the invention to provide a method for the treatment of a patient having need of Lig 72A, or a variant thereof, comprising administering to the patient a therapeutically effective amount of the ligand or a variant thereof, wherein said patient is suffering from at least one of the Diseases.
It is further object of the invention to provide: (1) a method for the treatment of a subject having need to promote the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor comprising administering to the subject a therapeutically effective amount of an agonist that activates the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, wherein said Lig 72A, or a variant thereof, is a polypeptide comprising an amino acid sequence having at least a 95% identity to the amino acid set sequence set forth in SEQ ID NO:4; (2) a method for the treatment of a subject having need to inhibit interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor comprising administering to the subject a therapeutically effective amount of an antibody against the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, wherein said Lig 72A, or a variant thereof, is a polypeptide comprising an amino acid sequence having at least a 95% identity to the amino acid sequence set forth in SEQ ID NO:4; (3) a method for the treatment of a subject having need to inhibit interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, comprising administering to the subject a therapeutically effective amount of an antagonist that inhibits the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, wherein said Lig 72A, or a variant thereof, is a polypeptide comprising an amino acid sequence having at least a 95% identity to the amino acid sequence set forth in SEQ ID NO:4; and (4) a method for the treatment of a subject in need of a polypeptide comprising administering to the subject a therapeutically effective amount of a polypeptide comprising an amino acid sequence having at least a 95% identity to the amino acid sequence set forth in SEQ ID NO:4, wherein said subject is suffering from at least one of the diseases.
It is another object of the invention to provide a diagnostic process comprising analyzing for the presence of Lig 72A or a variant thereof in a sample derived from a host suspected of at least one of the Diseases.
It is yet another object of the invention to provide a method for identifying compounds that bind to and activate or inhibit the interaction of Lig 72 or a variant thereof and HFGAN72 receptor comprising contacting a cell expressing on the surface thereof an HFGAN72 receptor, said receptor being associated with a second component capable of providing a detectable signal in response to the binding of Lig 72A or a variant thereof to said receptor, with a compound to be screened under conditions to permit binding to the receptor; and determining whether the compound binds to and activates or inhibits the interaction of Lig 72A or a variant thereof and HFGAN72 receptor by detecting the level of a signal generated from this interaction. In addition, the ligand can be labeled, for example with 1251, and used in receptor binding assays to identify antagonists or agonists that block binding.
Other objects, features, advantages and aspects of the present invention will become apparent to those of skill in the art from the following description. It should be understood, however, that the following description and the specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only. Various changes and modifications within the spirit and scope of the disclosed invention will become readily apparent to those skilled in the art from reading the following description and from reading the other parts of the present disclosure. Brief Description of the Drawings
Figure 1 shows a genomic sequence (SEQ ID NO: l) encoding human HFGAN72 receptor ligands. Capital letters show exons (cDNA) (SEQ ID NO:2).
Figure 2 shows a deduced amino acid sequence (SEQ ID NO:3) comprising two different human HFGAN72 receptor ligands, Lig 72A (SEQ ID NO:4, shown by dashes) and Lig 72B (SEQ ID NO:5, shown by asterisks).
Figure 3 shows a cDNA sequence (SEQ ID NO:6) encoding rat HFGAN72 receptor ligands.
Figure 4 shows a deduced amino acid sequence of rat HFGAN72 receptor ligands (SEQ ID NO:7) comprising an N-terminal signal and leader sequence predicted with von Heijin's algorithm (SEQ ID NO:8). Also shown in Figure 4 are two ligands, Lig 72A (SEQ ID NO:4, shown by dashes) and Lig 72B (SEQ ID NO:9, shown by asterisks).
Figure 5 shows a prepro region of an amino acid sequence of mouse HFGAN72 receptor ligands lacking a portion of the N-terminal signal sequence (SEQ ID NO: 10). This amino acid sequence comprises two ligands, Lig 72A (SEQ ID NO:4, shown by dashes) and Lig 72B (SEQ ID NO: l 1, shown by asterisks).
Figure 6 shows a cDNA encoding the human HFGAN72 receptor (SEQ ID NO: 12).
Figure 7 shows a deduced amino acid sequence of the human HFGAN72 receptor (SEQ ID NO: 13).
Figure 8 shows a cDNA encoding human Lig72A (SEQ ID NO: 14). Glossary
The following illustrative explanations are provided to facilitate understanding of certain terms used frequently herein, particularly in the examples. The explanations are provided as a convenience and are not meant to limit the invention.
"Isolated" means altered "by the hand of man" from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both. For example, a polynucleotide or a polypeptide naturally present in a living organism is not "isolated," but the same polynucleotide or polypeptide separated from the coexisting materials of its natural state is "isolated", as the term is employed herein. Moreover, a polynucleotide or polypeptide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated" even if it is still present in said organism, which organism may be living or non-living.
As part of or following isolation, such polynucleotides can be joined to other polynucleotides such as DNAs, for mutagenesis, to form fusion proteins, and for propagation or expression in a host, for instance. The isolated polynucleotides, alone or joined to other polynucleotides such as vectors, can be introduced into host cells, in culture or in whole organisms. Introduced into host cells in culture or in whole organisms, such DNAs still would be isolated, as the term is used herein, because they would not be in their naturally occurring form or environment. Similarly, the polynucleotides and polypeptides may occur in a composition, such as a media, formulations, solutions for introduction of polynucleotides or polypeptides, for example, into cells, compositions or solutions for chemical or enzymatic reactions, for instance, which are not naturally occurring compositions, and, therein remain isolated polynucleotides or polypeptides within the meaning of that term as it is employed herein.
"Oligonucleotide(s)" refers to relatively short polynucleotides. Often the term refers to single-stranded deoxyribonucleotides, but it can refer as well to single- or double-stranded ribonucleotides, RNA:DNA hybrids and double-stranded DNAs, among others.
"Polynucleotide(s)" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. Thus, for instance, polynucleotides as used herein refers to, among others, single- and double- stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, polynucleotide, as used herein, refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The strands in such regions may be from the same molecule or from different molecules. The regions may include all of one or more of the molecules, but more typically involve only a region of some of the molecules. One of the molecules of a triple- helical region often is an oligonucleotide. As used herein, the term polynucleotide also includes DNAs or RNAs as described above that contain one or more modified bases. Thus, DNAs or RNAs with backbones modified for stability or for other reasons are polynucleotides, as that term is intended herein. Moreover, DNAs or RNAs comprising unusual bases, such as inosine, or modified bases, such as tritylated bases, to name just two examples, are polynucleotides, as the term is used herein. It will be appreciated that a great variety of modifications have been made to DNA and RNA that serve many useful purposes known to those of skill in the art. The term polynucleotide, as it is employed herein, embraces such chemically, enzymatically or metabolically modified forms of polynucleotides, as well as the chemical forms of DNA and RNA characteristic of viruses and cells, including inter alia simple and complex cells.
"Polypeptides", as used herein, includes all polypeptides as described below. The basic structure of polypeptides is well known and has been described in innumerable textbooks and other publications in the art. In this context, the term is used herein to refer to any peptide or protein comprising two or more amino acids joined to each other in a linear chain by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types.
It will be appreciated that polypeptides often contain amino acids other than the 20 amino acids commonly referred to as the 20 naturally occurring amino acids, and that many amino acids, including the terminal amino acids, may be modified in a given polypeptide, either by natural processes, such as processing and other post-translational modifications, or by chemical modification techniques that are well known to the art. Even the common modifications that occur naturally in polypeptides are too numerous to list exhaustively here, but they are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature, and thus are well known to those of skill in the art. Known modifications that may be present in polypeptides of the present invention include, but are not limited to, acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cystine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. Such modifications are well known to those of skill and have been described in great detail in the scientific literature. Several particularly common modifications including glycosylation, lipid attachment, sulfation, gamma-carboxylation of glutamic acid residues, hydroxylation and ADP-ribosylation are described in most basic texts such as PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York, 1993. Detailed reviews are also available on this subject. See e.g., Wold, F., Posttranslational Protein Modifications: Perspectives and Prospects, pages 1-12 in POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, 1983; Seifter, et al, "Analysis for protein modifications and nonprotein cofactors", Meth. Enzymol, 1990, 182:626-646 and Rattan, et al, "Protein Synthesis: Posttranslational Modifications and Aging", Ann. NY. Acad. Sci., 1992, 663: 48-62.
It will be appreciated, as is well known and as noted above, that polypeptides are not always entirely linear. For instance, polypeptides may be branched as a result of ubiquitination, and they may be circular, with or without branching, generally as a result of posttranslation events, including natural processing event and events brought about by human manipulation that do not occur naturally. Circular, branched and branched circular polypeptides may be synthesized by non-translation natural processes and by entirely synthetic methods, as well.
Modifications can occur anywhere in a polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. In fact, blockage of the amino or carboxyl group in a polypeptide, or both, by a covalent modification, is common in naturally occurring and synthetic polypeptides and such modifications may be present in polypeptides of the present invention, as well. For instance, the amino terminal residue of polypeptides made in E. coli, prior to processing, almost invariably will be N- f ormy lmethionine .
The modifications that occur in a polypeptide often will be a function of how it is made. For polypeptides made by expressing a cloned gene in a host, for instance, the nature and extent of the modifications in large part will be determined by the host cell' s posttranslational modification capacity and the modification signals present in the polypeptide amino acid sequence. For instance, as is well known, glycosylation often does not occur in bacterial hosts such as E. coli. Accordingly, when glycosylation is desired, a polypeptide should be expressed in a glycosylating host, generally a eukaryotic cell. Insect cells often carry out the same posttranslational glycosylations as mammalian cells and, for this reason, insect cell expression systems have been developed to express efficiently mammalian proteins having the native patterns of glycosylation, inter alia. Similar considerations apply to other modifications.
It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given polypeptide. Also, a given polypeptide may contain many types of modifications.
In general, as used herein, the term polypeptide encompasses all such modifications, particularly those that are present in polypeptides synthesized by expressing a polynucleotide in a host cell.
"Subject," as the term is used herein, refters to a mammal, especially a human being.
"Variant(s)" of polynucleotides or polypeptides, as the term is used herein, are polynucleotides or polypeptides that differ from a reference polynucleotide or polypeptide, respectively. Variants in this sense are described below and elsewhere in the present disclosure in greater detail.
Variants include polynucleotides that differ in nucleotide sequence from another, reference polynucleotide. Generally, differences are limited so that the nucleotide sequences of the reference and the variant are closely similar overall and, in many regions, identical.
As noted below, changes in the nucleotide sequence of the variant may be silent. That is, they may not alter the amino acids encoded by the polynucleotide. Where alterations are limited to silent changes of this type, a variant will encode a polypeptide with the same amino acid sequence as the reference. As also noted below, changes in the nucleotide sequence of the variant may alter the amino acid sequence of a polypeptide encoded by the reference polynucleotide. Such nucleotide changes may result in amino acid substitutions, additions, deletions, fusions and truncations in the polypeptide encoded by the reference sequence, as discussed below.
Variants also include polypeptides that differ in amino acid sequence from another, reference polypeptide. Generally, differences are limited so that the sequences of the reference and the variant are closely similar overall and, in many regions, identical.
A variant and reference polypeptide may differ in amino acid sequence by one or more substitutions, additions, deletions, fusions and truncations, which may be present in any combination.
"Fusion protein" as the term is used herein, is a protein encoded by two, often unrelated, fused genes or fragments thereof. EP-A0464 533 (Canadian counterpart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobin molecules together with another human protein or part thereof. In many cases, employing an immunoglobulin Fc region as a part of a fusion protein is advantageous for use in therapy and diagnosis resulting in, for example, improved pharmacokinetic properties (EP-A 0232 262). On the other hand, for some uses it would be desirable to be able to delete the Fc part after the fusion protein has been expressed, detected and purified. Accordingly, it may be desirable to link the components of the fusion protein with a chemically or enzymatically cleavable linking region. This is the case when the Fc portion proves to be a hindrance to use in therapy and diagnosis, for example, when the fusion protein is to be used as an antigen for immunizations. In drug discovery, for example, human proteins, such as, shIL5-cc have been fused with Fc portions for use in high-throughput screening assays to identify antagonists of hIL-5. See, D. Bennett, et al, Journal of Molecular Recognition, 1995, 8:52-58; and K. Johanson, et al, The Journal of Biological Chemistry, 1995, 270(16):9459-9471.
Thus, this invention also relates to genetically engineered soluble fusion proteins comprised of an HFGAN72 receptor ligand, or a portion thereof, and of various portions of the constant regions of heavy or light chains of immunoglobulins of various subclasses (IgG, IgM, IgA, IgE). Preferred as an immunoglobulin is the constant part of the heavy chain of human IgG, particularly IgGl, where fusion takes place at the hinge region. In one embodiment, the Fc part can be removed simply by incorporation of a cleavage sequence that can be cleaved with blood clotting factor Xa. This invention further relates to processes for the preparation of these fusion proteins by genetic engineering, and to the use thereof for diagnosis and therapy. Yet a further aspect of the invention relates to polynucleotides encoding such fusion proteins.
"Binding molecules" (or otherwise called "interaction molecules" or "receptor component factors") refer to molecules, including receptors, that specifically bind to or interact with polypeptides of the present invention. Such binding molecules are a part of the present invention. Binding molecules may also be non-naturally occurring, such as antibodies and antibody-derived reagents that bind specifically to polypeptides of the invention.
"Identity" reflects a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, determined by comparing the sequences. In general, identity refers to an exact nucleotide to nucleotide or amino acid to amino acid correspondence of the two polynucleotide or two polypeptide sequences, respectively, over the length of the sequences being compared. For sequences where there is not an exact correspondence, a "% identity" may be determined. In general, the two sequences to be compared are aligned to give a maximum correlation between the sequences. This may include inserting "gaps" in either one or both sequences, to enhance the degree of alignment. A % identity may be determined over the whole length of each of the sequences being compared (so-called global alignment), that is particularly suitable for sequences of the same or very similar length, or over shorter, defined lengths (so-called local alignment), that is more suitable for sequences of unequal length.
"Similarity" is a further, more sophisticated measure of the relationship between two polypeptide sequences. In general, "similarity" means a comparison between the amino acids of two polypeptide chains, on a residue by residue basis, taking into account not only exact correspondences between a between pairs of residues, one from each of the sequences being compared (as for identity) but also, where there is not an exact correspondence, whether, on an evolutionary basis, one residue is a likely substitute for the other. This likelihood has an associated 'score' from which the "% similarity" of the two sequences can then be determined.
Methods for comparing the identity and similarity of two or more sequences are well known in the art. Thus for instance, programs available in the Wisconsin Sequence Analysis Package, version 9.1 (Devereux J., et al, Nucleic Acids Res, 12, 387-395, 1984, available from Genetics Computer Group, Madison, Wisconsin, USA), for example the programs BESTFIT and GAP, may be used to determine the % identity between two polynucleotides and the % identity and the % similarity between two polypeptide sequences. BESTFIT uses the "local homology" algorithm of Smith and Waterman (J. Mol. BioL, 147: 195-197, 1981, Advances in Applied Mathematics, 2, 482-489, 1981) and finds the best single region of similarity between two sequences. BESTFIT is more suited to comparing two polynucleotide or two polypeptide sequences that are dissimilar in length, the program assuming that the shorter sequence represents a portion of the longer. In comparison, GAP aligns two sequences, finding a "maximum similarity", according to the algorithm of Neddleman and Wunsch (J. Mo.l Biol, 48, 443-453, 1970). GAP is more suited to comparing sequences that are approximately the same length and an alignment is expected over the entire length. Preferably, the parameters "Gap Weight" and "Length Weight" used in each program are 50 and 3, for polynucleotide sequences and 12 and 4 for polypeptide sequences, respectively. Preferably, % identities and similarities are determined when the two sequences being compared are optimally aligned.
Other programs for determining identity and/or similarity between sequences are also known in the art, for instance the BLAST family of programs (Altschul S.F., et al, J. Mol. Biol, 215, 403-410, 1990, Altschul S.F., et al, Nucleic Acids Res., 25:389-3402, 1997, available from the National Center for Biotechnology Information (NCBI), Bethesda, Maryland, USA and accessible through the home page of the NCBI at www.ncbi.nlm.nih. gov) and FASTA (Pearson, W R, Methods in Enzymology, 183: 63-99 (1990); Pearson, W R and Lipman D.J., Proc Nat Acad Sci USA, 85: 2444-2448 (1988) (available as part of the Wisconsin Sequence Analysis Package).
Preferably, the BLOSUM62 amino acid substitution matrix (Henikoff S. and Henikoff J.G., Proc. Nat. Acad Sci. USA, 89: 10915-10919 (1992)) is used in polypeptide sequence comparisons including where nucleotide sequences are first translated into amino acid sequences before comparison.
Preferably, the program BESTFIT is used to determine the % identity of a query polynucleotide or a polypeptide sequence with respect to a polynucleotide or a polypeptide sequence of the present invention, the query and the reference sequence being optimally aligned and the parameters of the program set at the default value, as hereinbefore described.
Alternatively, for instance, for the purposes of interpreting the scope of a claim including mention of a "% identity" to a reference polynucleotide, a polynucleotide sequence having, for example, at least 95% identity to a reference polynucleotide sequence is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference sequence. Such point mutations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion. These point mutations may occur at the 5' or 3' terminal positions of the reference polynucleotide sequence or anywhere between these terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. In other words, to obtain a polynucleotide sequence having at least 95% identity to a reference polynucleotide sequence, up to 5% of the nucleotides of the in the reference sequence may be deleted, substituted or inserted, or any combination thereof, as hereinbefore described. The same applies mutatis mutandis for other % identities such as 96%, 97%, 98%, 99% and 100%.
For the purposes of interpreting the scope of a claim including mention of a "% identity" to a reference polypeptide, a polypeptide sequence having, for example, at least 95% identity to a reference polypeptide sequence is identical to the reference sequence except that the polypeptide sequence may include up to five point mutations per each 100 amino acids of the reference sequence. Such point mutations are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non- conservative substitution, or insertion. These point mutations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between these terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence. In other words, to obtain a sequence polypeptide sequence having at least 95% identity to a reference polypeptide sequence, up to 5% of the amino acids of the in the reference sequence may be deleted, substituted or inserted, or any combination thereof, as hereinbefore described. The same applies mutatis mutandis for other % identities such as 96%, 97%, 98%, 99%, and 100%.
A preferred meaning for "identity" for polynucleotides and polypeptides, as the case may be, are provided in (1) and (2) below.
(1) Polynucleotide embodiments further include an isolated polynucleotide comprising a polynucleotide sequence having at least a 95, 97 or 100% identity to the reference sequence of SEQ ID NO: 14, wherein said polynucleotide sequence may be identical to the reference sequence of SEQ ID NO: 14 or may include up to a certain integer number of nucleotide alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one nucleotide deletion, substitution, including transition and transversion, or insertion, and wherein said alterations may occur at the 5 ' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among the nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of nucleotide alterations is determined by multiplying the total number of nucleotides of SEQ ID NO: 14 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of nucleotides of SEQ ID NO: 14, or: nn < xn - (xn • y), wherein nn is the number of nucleotide alterations, xn is the total number of nucleotides of
SEQ ID NO: 14, y is 0.95 for 95%, 0.97 for 97% or 1.00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-integer product of χn and y is rounded down to the nearest integer prior to subtracting it from xn. Alterations of a polynucleotide sequence encoding the polypeptide of SEQ ID NO:4 may create nonsense, missense or frameshift mutations in this coding sequence and thereby alter the polypeptide encoded by the polynucleotide following such alterations.
(2) Polypeptide embodiments further include an isolated polypeptide comprising a polypeptide having at least a 95, 97 or 100% identity to a polypeptide reference sequence of SEQ ID NO:4, wherein said polypeptide sequence may be identical to the reference sequence of SEQ ID NO:4 or may include up to a certain integer number of amino acid alterations as compared to the reference sequence, wherein said alterations are selected from the group consisting of at least one amino acid deletion, substitution, including conservative and non- conservative substitution, or insertion, and wherein said alterations may occur at the amino- or carboxy-terminal positions of the reference polypeptide sequence or anywhere between those terminal positions, interspersed either individually among the amino acids in the reference sequence or in one or more contiguous groups within the reference sequence, and wherein said number of amino acid alterations is determined by multiplying the total number of amino acids in SEQ ID NO:4 by the integer defining the percent identity divided by 100 and then subtracting that product from said total number of amino acids in SEQ ID NO:4, or: na ≤ xa - ( a * ). wherein na is the number of amino acid alterations, xa is the total number of amino acids in
SEQ ID NO:4, y is 0.95 for 95%, 0.97 for 97% or 1.00 for 100%, and • is the symbol for the multiplication operator, and wherein any non-integer product of xa and y is rounded down to the nearest integer prior to subtracting it from xa.
Detailed Description of the Invention
In one aspect, the present invention relates to polypeptides and polynucleotides of Lig 72A. These polypeptides include the polypeptides of a Lig 72A from human, rat, and mouse (SEQ ID NO:4). The invention also relates to polypeptides comprising an amino acid sequence having at least a 95% identity to the amino acid sequence set forth in SEQ ID NO:4 over its entire length, and still more preferably at least a 96-99% identity, and most preferably, at least a 100% identity, to this amino acid sequence.
Novel polypeptides of identical mass, which are ligands for HFGAN72 receptor, were isolated from rat brain and bovine hypothalamus. The amino acid sequence of the mature rat polypeptide, Lig 72A, was determined and is shown in Figure 4 as SEQ ID NO:4. An accurate mass of the peptide MH+ ion was measured using delayed extraction MALDI and found to be 1286.6125 daltons (herein "Da") (predicted, 1286.6237 Da). The Gin residue at position 9 (see Figure 3) was distinguished from Lys (both amino acids have the same residue mass) by acetylation of the peptide and re-measurement of the molecular weight. The molecular weight shifted by 42 Da from 1286.6 Da to 1328.6 Da, thus indicating the addition of only one acetate group. Because Gin residues cannot be acetylated, and the N- terminus is blocked, the addition of only one acetate group indicates that the C-terminal sequence of a digested molecule is QK. In an alternative embodiment of the invention, the C-terminal sequence of a digested molecule is KK. Molecular weight measurement data, indicate that the rat polypeptide has the same sequence.
Results from in situ hybridizations on adult rat brain slices show that HFGAN72 receptor ligands are strongly expressed in both the hypothalamus and in the hypothalamal neurons. Data provided herein, such as the localizion of HFGAN72 receptor ligands in the hypothalamus, indicates that HFGAN72 receptor ligands are involved in a number of neurological (e.g., epiliepsy, stroke), psychiatric (e.g., anziety, depression), and/or eating disorders.
Interestingly, the amino acid sequences for Lig 72A are identical in the human, rat , and mouse (SEQ ID NO:4). It was found that Lig 72B of the human (SEQ ID NO:5), rat (SEQ ID NO: 9), and mouse (SEQ ID NO: 11) interact with HFGAN72 receptor (SEQ ID NO: 13), and this indicates that they have certain of the same properties as Lig 72A.
The activity of the Lig 72A and Lig 72B for HFGAN72 receptor were confirmed experimentally. Fura-loaded 293 cells were transfected with HFGAN72 receptor. Intracellular calcium levels were measured in the cells in response to increasing concentrations of polypeptides of the HFGAN72 receptor ligands, Lig 72A and Lig 72B. The EC50 of the polypeptide was estimated to be 50 ng/ml. Activation of HFGAN72 receptor by both Lig 72A and Lig 72B was determined to be specific, as no stimulation was observed with either 293pCDN vector transfected cells or with an alternative clone. The invention provides HFGAN72 receptor ligands, or fragments, analogs and derivatives of these ligand polypeptides, that are useful in modulating HFGAN72 receptor activities. Thus, the present invention also relates to fragments, analogs and derivatives of these polypeptides. The terms "fragment," "derivative" and "analog" when referring to the polypeptide ofmean a polypeptide retaining essentially the same biological function or activity, i.e., functions as HFGAN72 receptor ligands, or retaining the ability to bind any receptors or binding molecules even though the polypeptide may not activate the receptor in the same manner. Thus, an analog includes, for example, a proprotein that can be activated by cleavage of the proprotein portion to produce an active mature polypeptide or a portion of the HFGAN72 ligands.
Biological properties of Lig 72A are hereinafter referred to as "biological activity of Lig 72A" or "Lig 72A activity". Preferably, a polypeptide of the present invention exhibits at least one biological activity of Lig 72A.
Polypeptides of the present invention also include variants of the aforementioned polypeptides, including all allelic forms and splice variants. Such polypeptides vary from the reference polypeptide by insertions, deletions, and substitutions that may be conservative or non-conservative, or any combination thereof. Particularly preferred variants are those in which several, for instance from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acids are inserted, substituted, or deleted, in any combination.
Preferred fragments of polypeptides of the present invention include an isolated polypeptide comprising an amino acid sequence having at least 30 contiguous amino acids from the amino acid sequence of SEQ ID NO:4, or an isolated polypeptide comprising an amino acid sequence having at least 30 contiguous amino acids truncated or deleted from the amino acid sequence of SEQ ID NO:4. Preferred fragments are biologically active fragments that mediate the biological activity of Lig 72A, including those with a similar activity or an improved activity, or with a decreased undesirable activity. Also preferred are those fragments that are antigenic or immunogenic in an animal, especially in a human.
Fragments of the polypeptides of the invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, these variants may be employed as intermediates for producing the full-length polypeptides of the invention.The polypeptides of the present invention may be in the form of the "mature" protein or may be a part of a larger protein such as a precursor or a fusion protein. It is often advantageous to include an additional amino acid sequence that contains secretory or leader sequences, pro- sequences, sequences that aid in purification, for instance multiple histidine residues, or an additional sequence for stability during recombinant production. Polypeptides of the present invention can be prepared in any suitable manner, for instance by isolation form naturally occuring sources, from genetically engineered host cells comprising expression systems (vide infra) or by chemical synthesis, using for instance automated peptide synthesizers, or a combination of such methods. Means for preparing such polypeptides are well understood in the art.
The polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide or a synthetic polypeptide. In certain preferred embodiments, it is a recombinant polypeptide.
The fragment, derivative or analog of the polypeptide may be: (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code; (ii) one in which one or more of the amino acid residues includes a substituent group; (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol); or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence that is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
Among preferred embodiments of the invention in this regard are polypeptides having the amino acid sequence of Lig 72A, set forth by dashes in Figures 2, 4, and 5 (SEQ ID NO:4), variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments. Further particularly preferred embodiments of the invention in this regard are polypeptides, variants, analogs, derivatives and fragments thereof, and variants, analogs and derivatives of the fragments that retain the activity or function of Lig 72A (SEQ ID NO:4).
Among preferred variants are those that vary from a reference by conservative amino acid substitutions. Such substitutions are those that substitute a given amino acid in a polypeptide by another amino acid of like characteristics. Typically seen as conservative substitutions are the replacements, one for another, among the aliphatic amino acids Ala, Val, Leu and He; interchange of the hydroxyl residues Ser and Thr, exchange of the acidic residues Asp and Glu, substitution between the amide residues Asn and Gin, exchange of the basic residues Lys and Arg and replacements among the aromatic residues Phe and Tyr. Further particularly preferred in this regard are variants, analogs, derivatives and fragments, and variants, analogs and derivatives of the fragments, having the amino acid sequence set forth in SEQ ID NO:4, in which several, a few, 5 to 10, 1 to 5, 1 to 3, 2, 1 or no amino acid residues are substituted, deleted or added, in any combination. Especially preferred among these are silent substitutions, additions and deletions, which do not alter the properties and activities of the ligand. Also especially preferred in this regard are conservative substitutions. Most highly preferred are polypeptides having the amino acid sequence selected set forth in SEQ ID NO:4, without substitutions.
The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The polypeptides of the present invention include a polypeptide having the amino acid sequence selected from the group consisting of: the amino acid sequences set forth in SEQ ID NOs:4 and 22-50, as well as polypeptides having at least a 95% identity to these polypeptides, and more preferably at least a 96-99% identity to these polypeptides, and most preferred at polypeptides having a 100% identity to these polypeptides.
Fragments or portions of the polypeptides of the present invention may be employed for producing the corresponding full-length polypeptide by peptide synthesis; therefore, the fragments may be employed as intermediates for producing the full-length polypeptides. Fragments may be "free-standing," i.e., not part of or fused to other amino acids or polypeptides, or they may be comprised within a larger polypeptide of which they form a part or region. When comprised within a larger polypeptide, the presently discussed fragments most preferably form a single continuous region. However, several fragments may be comprised within a single larger polypeptide. For instance, certain preferred embodiments relate to a fragments of polypeptides of Lig 72A of the present invention comprised within a precursor polypeptide designed for expression in a host and having heterologous pre- and pro- polypeptide regions fused to the amino terminus of the polypeptide fragments of Lig 72A and an additional region fused to the carboxyl terminus of the fragment. Therefore, fragments in one aspect of the meaning intended herein, refers to the portion or portions of a fusion polypeptide or fusion protein derived from Lig 72A. Among especially preferred fragments of the invention are truncation mutants of Lig 72A (SEQ ID NO:4). Truncation mutants include polypeptides of Lig 72A having the amino acid sequence shown by dashes in Figures 2, 4, and 5 (SEQ ID NO:4), or of variants or derivatives thereof, except for deletion of a continuous series of residues (that is, a continuous region, part or portion) that includes the amino terminus, or a continuous series of residues that includes the carboxyl terminus or, as in double truncation mutants, deletion of two continuous series of residues, one including the amino terminus and one including the carboxyl terminus.
Particuarly preferred Lig 72 truncation mutants and variants of the invention are the polypeptides comprising the amino acid sequences set forth in Table 2 of Example 12 (SEQ ID NOs:23-38), as well as the polynucleotides encoding such polypeptides, which are set forth in Table 3 of Example 12 (SEQ ID NOs:39-54). These variants were shown to be biologically active, as reflected by the designated EC5() values of each variant in Table 2 (SEQ ID NOs:22- 38).
In a further aspect, the present invention relates to polynucleotides encoding Lig 72A and variants thereof. Such polynucleotides include:
(a) an isolated polynucleotide comprising a polynucleotide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to a polynucleotide squence selected from the group consisting of: SEQ ID NOs: 14 and 39-54;
(b) an isolated polynucleotide comprising a polynucleotide selected from the group consisting of: SEQ ID NOs: 14 and 39-54;
(c) an isolated polynucleotide having at least 95%, 96%, 97%, 98%, or 99% identity to a polynucleotide selected from the group consisting of: SEQ ID NOs: 14 and 39-54;
(d) an isolated polynucleotide selected from the group consisting of: SEQ ID NOs: 14 and 39-54;
(e) an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to a polypeptide sequence selected from the group consisting of: SEQ ID NOs:4 and 22-38;
(f) an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38;
(g) an isolated polynucleotide having a polynucleotide sequence encoding a polypeptide sequence having at least 95%, 96%, 97%, 98%, or 99% identity to a polypeptide sequence selected from the group consisting of: SEQ ID NOs:4 and 22-38; (h) an isolated polynucleotide encoding a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38;
(i) an isolated polynucleotide having or comprising a polynucleotide sequence that has an Identity Index of 0.95, 0.96, 0.97, 0.98, or 0.99 compared to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54;
(j) an isolated polynucleotide having or comprising a polynucleotide sequence encoding a polypeptide sequence that has an Identity Index of 0.95, 0.96, 0.97, 0.98, or 0.99 compared to a polypeptide sequence selected from the group of: SEQ ID NOs:4 and 22-38; and polynucleotides that are fragments and variants of the above mentioned polynucleotides or that are complementary to above mentioned polynucleotides, over the entire length thereof.
Preferred fragments of polynucleotides of the present invention include an isolated polynucleotide comprising a nucleotide sequence having at least 15, 30, 50 or 100 contiguous nucleotides from a sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, or an isolated polynucleotide comprising an sequence having at least 30, 50 or 100 contiguous nucleotides truncated or deleted from a sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54.
Preferred variants of polynucleotides of the present invention include splice variants, allelic variants, and polymorphisms, including polynucleotides having one or more single nucleotide polymorphisms (SNPs).
Polynucleotides of the present invention also include polynucleotides encoding polypeptide variants that comprise an amino acid sequence selected from the group consisting of: SEQ ID NOs:4 and 22-38 and in which several, for instance from 30 to 20, from 20 to 10, from 10 to 5, from 5 to 3, from 3 to 2, from 2 to 1 or 1 amino acid residues are substituted, deleted or added, in any combination.
In a further aspect, the present invention provides polynucleotides that are RNA transcripts of the DNA sequences of the present invention. Accordingly, there is provided an RNA polynucleotide that:
(a) comprises an RNA transcript of the DNA sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38;
(b) is the RNA transcript of the DNA sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38;
(c) comprises an RNA transcript of a DNA sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54; or (d) is the RNA transcript of a DNA sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54; and RNA polynucleotides that are complementary thereto.
The polynucleotide sequences of SEQ ID NOs: 14 and 39-54 are a cDNA sequences that encodes the polypeptides of SEQ ID NOs:4 and 22-38, respectively. The polynucleotide sequences encoding the polypeptide of SEQ ID NOs:4 and 22-38 may be identical to the polypeptide encoding sequences of SEQ ID NOs: 14 and 39-54 or they may be sequences other than SEQ ID NOs: 14 and 39-54, which, as a result of the redundancy (degeneracy) of the genetic code, also encodes the polypeptide of SEQ ID NO:2.
Preferred polypeptides and polynucleotides of the present invention are expected to have, inter alia, similar biological functions/properties to their homologous polypeptides and polynucleotides. Furthermore, preferred polypeptides and polynucleotides of the present invention have at least one Lig 72 A activity.
Polynucleotides of the present invention may be obtained using standard cloning and screening techniques from a cDNA library derived from rnRNA in cells of human hypothalamus, (see for instance, Sambrook, et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). Polynucleotides of the invention can also be obtained from natural sources such as genomic DNA libraries or can be synthesized using well known and commercially available techniques.
When polynucleotides of the present invention are used for the recombinant production of polypeptides of the present invention, the polynucleotide may include the coding sequence for the mature polypeptide, by itself, or the coding sequence for the mature polypeptide in reading frame with other coding sequences, such as those encoding a leader or secretory sequence, a pre-, or pro- or prepro- protein sequence, or other fusion peptide portions. For example, a marker sequence that facilitates purification of the fused polypeptide can be encoded. In certain preferred embodiments of this aspect of the invention, the marker sequence is a hexa-histidine peptide, as provided in the pQE vector (Qiagen, Inc.) and described in Gentz, et al, Proc Natl Acad Sci USA (1989) 86:821-824, or is an HA tag. The polynucleotide may also contain non-coding 5' and 3' sequences, such as transcribed, non- translated sequences, splicing and polyadenylation signals, ribosome binding sites and sequences that stabilize mRNA. Polynucleotides that are identical, or have sufficient identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, may be used as hybridization probes for cDNA and genomic DNA or as primers for a nucleic acid amplification reaction (for instance, PCR). Such probes and primers may be used to isolate full-length cDNAs and genomic clones encoding polypeptides of the present invention and to isolate cDNA and genomic clones of other genes (including genes encoding paralogs from human sources and orthologs and paralogs from species other than human) that have a high sequence similarity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, typically at least 95% identity. Preferred probes and primers will generally comprise at least 15 nucleotides, preferably, at least 30 nucleotides and may have at least 50, if not at least 100 nucleotides. Particularly preferred probes will have between 30 and 50 nucleotides. Particularly preferred primers will have between 20 and 25 nucleotides.
A polynucleotide encoding a polypeptide of the present invention, including homologs from species other than human, may be obtained by a process comprising the steps of screening a library under stringent hybridization conditions with a labeled probe having a sequence selected from consisting of: SEQ ID NOs: 14 and 39-54 or a fragment thereof, preferably of at least 15 nucleotides; and isolating full-length cDNA and genomic clones containing said polynucleotide sequence. Such hybridization techniques are well known to the skilled artisan. Preferred stringent hybridization conditions include overnight incubation at 42°C in a solution comprising: 50% formamide, 5xSSC (150mM NaCl, 15mM trisodium citrate), 50 mM sodium phosphate (pH7.6), 5x Denhardt's solution, 10 % dextran sulfate, and 20 microgram/ml denatured, sheared salmon sperm DNA; followed by washing the filters in
O.lx SSC at about 65°C. Thus the present invention also includes isolated polynucleotides, preferably with a nucleotide sequence of at least 100, obtained by screening a library under stringent hybridization conditions with a labeled probe having a sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54 or a fragment thereof, preferably of at least 15 nucleotides.
The skilled artisan will appreciate that, in many cases, an isolated cDNA sequence will be incomplete, in that the region coding for the polypeptide does not extend all the way through to the 5' terminus. This is a consequence of reverse transcriptase, an enzyme with inherently low "processivity" (a measure of the ability of the enzyme to remain attached to the template during the polymerisation reaction), failing to complete a DNA copy of the mRNA template during first strand cDNA synthesis. There are several methods available and well known to those skilled in the art to obtain full-length cDNAs, or extend short cDNAs, for example those based on the method of Rapid Amplification of cDNA ends (RACE) (see, for example, Frohman, et al, Proc Nat Acad Sci USA 85, 8998-9002, 1988). Recent modifications of the technique, exemplified by the Marathon (trade mark) technology (Clontech Laboratories Inc.) for example, have significantly simplified the search for longer cDNAs. In the Marathon (trademark) technology, cDNAs have been prepared from mRNA extracted from a chosen tissue and an 'adaptor' sequence ligated onto each end. Nucleic acid amplification (PCR) is then carried out to amplify the "missing" 5' end of the cDNA using a combination of gene specific and adaptor specific oligonucleotide primers. The PCR reaction is then repeated using 'nested' primers, that is, primers designed to anneal within the amplified product (typically an adaptor specific primer that anneals further 3' in the adaptor sequence and a gene specific primer that anneals further 5' in the known gene sequence). The products of this reaction can then be analysed by DNA sequencing and a full-length cDNA constructed either by joining the product directly to the existing cDNA to give a complete sequence, or carrying out a separate full-length PCR using the new sequence information for the design of the 5' primer.
Recombinant polypeptides of the present invention may be prepared by processes well known in the art from genetically engineered host cells comprising expression systems. Accordingly, in a further aspect, the present invention relates to expression systems comprising a polynucleotide or polynucleotides of the present invention, to host cells that are genetically engineered with such expression sytems and to the production of polypeptides of the invention by recombinant techniques. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention.
For recombinant production, host cells can be genetically engineered to incorporate expression systems or portions thereof for polynucleotides of the present invention. Polynucleotides may be introduced into host cells by methods described in many standard laboratory manuals, such as Davis, et al, BASIC METHODS IN MOLECULAR BIOLOGY (1986) and Sambrook et al. (ibid). Preferred methods of introducing polynucleotides into host cells include, for instance, calcium phosphate transfection, DEAE-dextran mediated transfection, transvection, microinjection, cationic lipid-mediated transfection, electroporation, transduction, scrape loading, ballistic introduction or infection. Representative examples of appropriate hosts include bacterial cells, such as Streptococci, Staphylococci, E. coli, Streptomyces and Bacillus subtilis cells; fungal cells, such as yeast cells and Asperglllus cells; insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, HeLa, C127, 3T3, BHK, HEK 293 and Bowes melanoma cells; and plant cells.
A great variety of expression systems can be used, for instance, chromosomal, episomal and virus-derived systems, e.g., vectors derived from bacterial plasmids, from bacteriophage, from transposons, from yeast episomes, from insertion elements, from yeast chromosomal elements, from viruses such as baculoviruses, papova viruses, such as SV40, vaccinia viruses, adenoviruses, fowl pox viruses, pseudorabies viruses and retroviruses, and vectors derived from combinations thereof, such as those derived from plasmid and bacteriophage genetic elements, such as cosmids and phagemids. The expression systems may contain control regions that regulate as well as engender expression. Generally, any system or vector that is able to maintain, propagate or express a polynucleotide to produce a polypeptide in a host may be used. The appropriate polynucleotide sequence may be inserted into an expression system by any of a variety of well-known and routine techniques, such as, for example, those set forth in Sambrook, et al., (ibid). Appropriate secretion signals may be incorporated into the desired polypeptide to allow secretion of the translated protein into the lumen of the endoplasmic reticulum, the periplasmic space or the extracellular environment. These signals may be endogenous to the polypeptide or they may be heterologous signals. If a polypeptide of the present invention is to be expressed for use in screening assays, it is generally preferred that the polypeptide be produced at the surface of the cell. In this event, the cells may be harvested prior to use in the screening assay. If the polypeptide is secreted into the medium, the medium can be recovered in order to recover and purify the polypeptide. If produced intracellularly, the cells must first be lysed before the polypeptide is recovered.
Polypeptides of the present invention can be recovered and purified from recombinant cell cultures by well-known methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxylapatite chromatography and lectin chromatography. Most preferably, high performance liquid chromatography is employed for purification. Well known techniques for refolding proteins may be employed to regenerate active conformation when the polypeptide is denatured during intracellular synthesis, isolation and/or purification.
Polynucleotides of the present invention may be used as diagnostic reagents, through detecting mutations in the associated gene. Detection of a mutated form of a gene characterized by a polynucleotide selected from the group consisting of: SEQ ID NOs: 14 and 39-54 in the cDNA or genomic sequence associated with a dysfunction will provide a diagnostic tool that can add to, or define, a diagnosis of a disease, or susceptibility to a disease, resulting from under-expression, over-expression or altered spatial or temporal expression of the gene. Individuals carrying mutations in the gene may be detected at the DNA level by a variety of techniques well known in the art.
Nucleic acids for diagnosis may be obtained from a subject's cells, such as from blood, urine, saliva, tissue biopsy or autopsy material. The genomic DNA may be used directly for detection or it may be amplified enzymatically by using PCR, preferably RT-PCR, or other amplification techniques prior to analysis. RNA or cDNA may also be used in similar fashion. Deletions and insertions can be detected by a change in size of the amplified product in comparison to the normal genotype. Point mutations can be identified by hybridizing amplified DNA to labeled nucleotide sequences of Lig 72A or a variant thereof. Perfectly matched sequences can be distinguished from mismatched duplexes by RNase digestion or by differences in melting temperatures. DNA sequence difference may also be detected by alterations in the electrophoretic mobility of DNA fragments in gels, with or without denaturing agents, or by direct DNA sequencing (see, for instance, Myers, et al, Science (1985) 230:1242). Sequence changes at specific locations may also be revealed by nuclease protection assays, such as RNase and S 1 protection or the chemical cleavage method (see Cotton, et al, Proc Natl Acad Sci USA (1985) 85: 4397-4401).
An array of oligonucleotides probes comprising a Lig 72A polynucleotide sequence or a variant thereof can be constructed to conduct efficient screening of, e.g., genetic mutations. Such arrays are preferably high density arrays or grids. Array technology methods are well known and have general applicability and can be used to address a variety of questions in molecular genetics including gene expression, genetic linkage, and genetic variability, see, for example, M.Chee, et al, Science, 274, 610-613 (1996) and other references cited therein.
Detection of abnormally decreased or increased levels of polypeptide or mRNA expression may also be used for diagnosing or determining susceptibility of a subject to at least one of the Diseases. Decreased or increased expression can be measured at the RNA level using any of the methods well known in the art for the quantitation of polynucleotides, such as, for example, nucleic acid amplification, for instance PCR, RT-PCR, RNase protection, Northern blotting and other hybridization methods. Assay techniques that can be used to determine levels of a protein, such as a polypeptide of the present invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and ELISA assays.
Thus in another aspect, the present invention relates to a diagonostic kit comprising:
(a) a polynucleotide of the present invention, preferably a nucleotide sequence selected from the group consisting of: SEQ ID NOs: 14 and 39-54, or a fragment or an RNA transcript thereof;
(b) a nucleotide sequence complementary to that of (a);
(c) a polypeptide of the present invention, preferably a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38 or a fragment thereof; or
(d) an antibody to a polypeptide of the present invention, preferably to a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38.
It will be appreciated that in any such kit, (a), (b), (c) or (d) may comprise a substantial component. Such a kit will be of use in diagnosing a disease or susceptibility to a disease, particularly diseases of the invention, among others.
The polynucleotide sequences of the present invention are valuable for chromosome localization studies. The sequence is specifically targeted to, and can hybridize with, a particular location on an individual human chromosome. The mapping of relevant sequences to chromosomes according to the present invention is an important first step in correlating those sequences with gene-associated disease. Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found in, for example, V. McKusick, Mendelian Inheritance in Man (available on-line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (co-inheritance of physically adjacent genes). Precise human chromosomal localisations for a genomic sequence (gene fragment, etc.) can be determined using Radiation Hybrid (RH) Mapping (Walter, M. Spillett, D., Thomas, P., Weissenbach, J., and Goodfellow, P., (1994) A method for constructing radiation hybrid maps of whole genomes, Nature Genetics 7, 22-28). A number of RH panels are available from Research Genetics (Huntsville, AL, USA), e.g., the GeneBridge4 RH panel (Hum Mol Genet 1996 Mar;5(3):339-46, A radiation hybrid map of the human genome. Gyapay G, Schmitt K, Fizames C, Jones H, Vega-Czarny N, Spillett D, Muselet D, PrudHomme JF, Dib C, Auffray C, Morissette J, Weissenbach J, Goodfellow PN). To determine the chromosomal location of a gene using this panel, 93 PCRs are performed using primers designed from the gene of interest on RH DNAs. Each of these DNAs contains random human genomic fragments maintained in a hamster background (human / hamster hybrid cell lines). These PCRs result in 93 scores indicating the presence or absence of the PCR product of the gene of interest. These scores are compared with scores created using PCR products from genomic sequences of known location. This comparison is conducted at http://www.genome.wi.mit.edu/. Example 10 shows that the gene of the present invention maps to human chromosome 17q21.
The polynucleotide sequences of the present invention are also valuable tools for tissue expression studies. Such studies allow the determination of expression patterns of polynucleotides of the present invention that may give an indication as to the expression patterns of the encoded polypeptides in tissues, by detecting the mRNAs that encode them. The techniques used are well known in the art and include in situ hydridization techniques to clones arrayed on a grid, such as cDNA microarray hybridisation (Schena, et al, Science, 270, 467-470, 1995 and Shalon, etal, Genome Res, 6, 639-645, 1996) and nucleotide amplification techniques such as PCR. A preferred method uses the TAQMAN (Trade mark) technology available from Perkin Elmer. Results from these studies can provide an indication of the normal function of the polypeptide in the organism. In addition, comparative studies of the normal expression pattern of mRNAs with that of mRNAs encoded by an alternative form of the same gene (for example, one having an alteration in polypeptide coding potential or a regulatory mutation) can provide valuable insights into the role of the polypeptides of the present invention, or that of inappropriate expression thereof in disease. Such inappropriate expression may be of a temporal, spatial or simply quantitative nature. The tissue localization data disclosed in Example 5 show that Lig 72A polypeptides of the present invention are expressed in the hypothalamus (cell bodies and nerve terminals), as well as the following areas of the whole brain: Raphe (nerve terminals), Locus Coeruleus (nerve terminals), Mesencephalic Trigeminal Nucleus (nerve terminals), Amygdala (cell bodies), Retrosplenial Cortex (cell bodies), Occipital Cortex (cell bodies), and the Temporal Cortex (cell bodies). Furthermore, preliminary dot blot analysis for Lig 72A on various rat tissue RNAs showed expression of the ligand in dorsal root spinal cord and dorsal root ganglia.
It is further object of the invention to provide: (1) a method for the treatment of a subject having need to promote the interaction of Lig 72A (SEQ ID NO:4) or a variant thereof, including the variant polypeptides set forth in Table 2 of Example 12, and HFGAN72 receptor (SEQ ID NO: 13), comprising administering to the subject a therapeutically effective amount of an agonist that activates the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, wherein said Lig 72A, or a variant thereof, is a polypeptide comprising an amino acid sequence having at least a 95% identity to an amino acid set sequence selected from the group consisting of SEQ ID NOs:4 and 22-50; (2) a method for the treatment of a subject having need to inhibit interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor comprising administering to the subject a therapeutically effective amount of an antibody against the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, wherein said Lig 72A, or a variant thereof, is a polypeptide comprising an amino acid sequence having at least a 95% identity to the amino acid sequence selected from the group consisting of SEQ ID NOs:4 and 22-50; (3) a method for the treatment of a subject having need to inhibit interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, comprising administering to the subject a therapeutically effective amount of an antagonist that inhibits the interaction of Lig 72A, or a variant thereof, and HFGAN72 receptor, wherein said Lig 72A, or a variant thereof, is a polypeptide comprising an amino acid sequence having at least a 95% identity to an amino acid sequence selected from the group consisting of: SEQ ID NOs:4 and 22-50; and (4) a method for the treatment of a subject in need of a polypeptide comprising administering to the subject a therapeutically effective amount of a polypeptide comprising an amino acid sequence having at least a 95% identity to an amino acid sequence selected from the group consisting of: SEQ ID NOs:4 and 22-50, wherein said subject is suffering from at least one of the Diseases.
Assay techniques that can be used to determine levels of a protein, such as Lig 72 of the present invention, in a sample derived from a host are well-known to those of skill in the art. Such assay methods include radioimmunoassays, competitive-binding assays, Western Blot analysis and enzyme linked immunosorbent assays (ELISA). Among these, ELISAs are frequently preferred. An ELISA assay initially comprises preparing an antibody specific to an HFGAN72 receptor ligand, preferably a monoclonal antibody. In addition a reporter antibody generally is prepared that binds to the monoclonal antibody. The reporter antibody is attached to a detectable reagent such as radioactive, fluorescent or enzymatic reagent.
To carry out an ELISA, a sample is removed from a host and incubated on a solid support, e.g., a polystyrene dish, that binds the proteins in the sample. Any free protein binding sites on the dish are then covered by incubating with a non-specific protein such as bovine serum albumin. Next, the monoclonal antibody is incubated in the dish during which time the monoclonal antibodies attach to any Lig 72A or a variant thereof attached to the polystyrene dish. Unbound monoclonal antibody is washed out with buffer. The reporter antibody linked to horseradish peroxidase is placed in the dish resulting in binding of the reporter antibody to any monoclonal antibody bound to Lig 72A or a variant thereof. Unattached reporter antibody is then washed out. Reagents for peroxidase activity, including a colorimetric substrate are then added to the dish. Immobilized peroxidase, linked to Lig 72A or a variant thereof through the primary and secondary antibodies, produces a colored reaction product. The amount of color developed in a given time period indicates the amount of ligand present in the sample. Quantitative results typically are obtained by reference to a standard curve.
A competition assay may be employed wherein antibodies specific to Lig 72A or a variant thereof attached to a solid support and labeled Lig 72A of a variant thereof and a sample derived from the host are passed over the solid support. The amount of detected label attached to the solid support can be correlated to a quantity of Lig 72A of a variant thereof in the sample.
Methods of producing antibodies useful in these assays are well known to those skilled in the art. Polypeptides, their fragments or other derivatives, or analogs thereof, or cells expressing them can be used as an immunogen to produce antibodies thereto. These antibodies can be, for example, polyclonal or monoclonal antibodies. The present invention also includes chimeric, single chain, and humanized antibodies, as well as Fab fragments, or the product of a Fab expression library. Various procedures known in the art may be used for the production of such antibodies and fragments. Antibodies generated against the polypeptides corresponding to a sequence of the present invention can be obtained by direct injection of the polypeptides into an animal, preferably a nonhuman. The antibody so obtained will then bind the polypeptides itself. In this manner, even a sequence encoding only a fragment of the polypeptides can be used to generate antibodies binding the whole native polypeptides. Such antibodies can then be used to isolate the polypeptide from tissue expressing that polypeptide.
For preparation of monoclonal antibodies, any technique which provides antibodies produced by continuous cell line cultures can be used. Examples include the hybridoma technique (Kohler, G. and Milstein, C, Nature, 1975, 256: 495-497, the trioma technique, the human B-cell hybridoma technique (Kozbor, et al, Immunology Today, 1983, 4: 72 (1983) and the EBV-hybridoma technique to produce human monoclonal antibodies (Cole, et al, pages 77-96 in MONOCLONAL ANTIBODIES AND CANCER THERAPY, Alan R. Liss, Inc. (1985)).
Techniques described for the production of single chain antibodies (U.S. Patent No. 4,946,778) can be adapted to produce single chain antibodies to immunogenic polypeptide products of this invention. Also, transgenic mice, or other organisms such as other mammals, may be used to express humanized antibodies to immunogenic polypeptide products of this invention.
The above-described antibodies may be employed to isolate or to identify clones expressing the polypeptide or purify the polypeptide of the present invention by attachment of the antibody to a solid support for isolation and/or purification by affinity chromatography.
In addition, antibodies against Lig 72A or a variant thereof may be employed to inhibit interaction of such a ligand with HFGAN72 receptor and may be useful in the treatment of at least one of the Diseases.
Polypeptides and polynucleotides of the present invention may also be used as vaccines. Accordingly, in a further aspect, the present invention relates to a method for inducing an immunological response in a mammal that comprises inoculating the mammal with a polypeptide of the present invention, adequate to produce antibody and/or T cell immune response, including, for example, cytokine-producing T cells or cytotoxic T cells, to protect said animal from disease, whether that disease is already established within the individual or not. An immunological response in a mammal may also be induced by a method comprises delivering a polypeptide of the present invention via a vector directing expression of the polynucleotide and coding for the polypeptide in vivo in order to induce such an immunological response to produce antibody to protect said animal the Diseases. One way of administering the vector is by accelerating it into the desired cells as a coating on particles or otherwise. Such nucleic acid vector may comprise DNA, RNA, a modified nucleic acid, or a DNA/RNA hybrid. For use a vaccine, a polypeptide or a nucleic acid vector will be normally provided as a vaccine formulation (composition). The formulation may further comprise a suitable carrier. Since a polypeptide may be broken down in the stomach, it is preferably administered parenterally (for instance, subcutaneous, intramuscular, intravenous, or intradermal injection). Formulations suitable for parenteral administration include aqueous and non-aqueous sterile injection solutions that may contain anti-oxidants, buffers, bacteriostats and solutes that render the formulation instonic with the blood of the recipient; and aqueous and non-aqueous sterile suspensions that may include suspending agents or thickening agents. The formulations may be presented in unit-dose or multi-dose containers, for example, sealed ampoules and vials and may be stored in a freeze-dried condition requiring only the addition of the sterile liquid carrier immediately prior to use. The vaccine formulation may also include adjuvant systems for enhancing the immunogenicity of the formulation, such as oil-in water systems and other systems known in the art. The dosage will depend on the specific activity of the vaccine and can be readily determined by routine experimentation.
Lig 72A or variant thereof could be used to isolate proteins which interact with it and, this interaction could be a target for interference. Inhibitors of protein-protein interactions between Lig 72A or a variant thereof and other factors could lead to the development of pharmaceutical agents for the modulation of Lig 72A activity. As used herein, the term "modulate" refers to affecting the Lig 72A function.
Thus, this invention also provides a method for identification of binding molecules to Lig 72A or a variant thereof. Genes encoding proteins for binding molecules to Lig 72A can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting. Such methods are described in many laboratory manuals such as, for instance, Coligan, et al, Current Protocols in Immunology 1 (Rivett, A.J., Biochem. J. 291:1-10 (1993)): Chapter 5 (1991).
For example, the yeast two-hybrid system provides methods for detecting the interaction between a first test protein and a second test protein, in vivo, using reconstitution of the activity of a transcriptional activator. The method is disclosed in U.S. Patent No. 5,283,173; reagents are available from Clontech and Stratagene. Briefly, cDNA of Lig 72A is fused to a Gal4 transcription factor DNA binding domain and expressed in yeast cells. cDNA library members obtained from cells of interest are fused to a transactivation domain of Gal4. cDNA clones that express proteins which can interact with Lig 72A will lead to reconstitution of Gal4 activity and transactivation of expression of a reporter gene such as Gall-lacZ. The cDNA of the Lig 72A, which is fused to the Gal4 transcription factor DNA binding domain, may be mutated in one or more amino acids, the method of which is described above, to enhance interaction of kinase with substrate.
An alternative method is screening of λgtl 1, λZAP (Stratagene) or equivalent cDNA expression libraries with recombinant Lig 72A or a recombinant variant thereof. Recombinant Lig 72A protein, variants thereof or fragments thereof are fused to small peptide tags such as FLAG, HSV or GST. The peptide tags can possess convenient phosphorylation sites for a kinase such as heart muscle creatine kinase or they can be biotinylated. Recombinant Lig 72A or a variant thereof can be phosphorylated with 32[P] or used unlabeled and detected with streptavidin or antibodies against the tags, λgtl lcDNA expression libraries are made from cells of interest and are incubated with the recombinant Lig 72A or a variant thereof, washed and cDNA clones isolated that interact with the HFGAN72 receptor ligands. See, e.g., T. Maniatis, et al, supra.
Another method is the screening of a mammalian expression library in which the cDNAs are cloned into a vector between a mammalian promoter and polyadenylation site and transiently transfected in COS or 293 cells followed by detection of the binding protein 48 hours later by incubation of fixed and washed cells with labeled Lig 72A or a variant thereof, preferably iodinated, and detection of bound Lig 72A or a variant thereof by autoradiography. See Sims, et al. Science 241 :585-589 (1988) and McMahan, et al, EMBO J. 10:2821-2832 (1991). In this manner, pools of cDNAs containing the cDNA encoding the binding protein of interest can be selected and the cDNA of interest can be isolated by further subdivision of each pool followed by cycles of transient transfection, binding and autoradiography.
Alternatively, the cDNA of interest can be isolated by transfecting the entire cDNA library into mammalian cells and panning the cells on a dish containing Lig 72A or a variant thereof bound to the plate. Cells that attach after washing are lysed and the plasmid DNA isolated, amplified in bacteria, and the cycle of transfection and panning repeated until a single cDNA clone is obtained. See Seed, et al, Proc. Natl. Acad. Sci. USA 84:3365 (1987) and Aruffo, et al, EMBO J. 6:3313 (1987). If the binding protein is secreted, its cDNA can be obtained by a similar pooling strategy once a binding or neutralizing assay has been established for assaying supernatants from transiently transfected cells. General methods for screening supernatants are disclosed in Wong, et al, Science 228:810-815 (1985). Another alternative method is isolation of proteins interacting with Lig 72A or a variant thereof directly from cells. Fusion proteins of Lig 72A or a variant thereof with GST or small peptide tags are made and immobilized on beads. Biosynthetically labeled or unlabeled protein extracts from the cells of interest are prepared, incubated with the beads and washed with buffer. Proteins interacting with Lig 72A or a variant thereof are eluted specifically from the beads and analyzed by SDS-PAGE. Binding partner primary amino acid sequence data are obtained by microsequencing. Optionally, the cells can be treated with agents that induce a functional response such as tyrosine phosphorylation of cellular proteins. An example of such an agent would be a growth factor or cytokine such as interleukin-2.
Another alternative method is immunoaffinity purification. Recombinant Lig 72A or a variant thereof is incubated with labeled or unlabeled cell extracts and immunoprecipitated with anti-Lig 72A antibodies. The immunoprecipitate is recovered with protein A-Sepharose and analyzed by SDS-PAGE. Unlabelled proteins are labeled by biotinylation and detected on SDS gels with streptavidin. Binding partner proteins are analyzed by microsequencing. Further, standard biochemical purification steps known to those skilled in the art may be used prior to microsequencing.
Yet another alternative method is screening of peptide libraries for binding partners. Recombinant tagged or labeled Lig 72A or a variant thereof is used to select peptides from a peptide or phosphopeptide library that interact with Lig 72A or a variant thereof. Sequencing of the peptides leads to identification of consensus peptide sequences that might be found in interacting proteins.
Lig 72A binding partners identified by any of these methods or other methods that would be known to those of ordinary skill in the art, as well as those putative binding partners discussed above, can be used in the assay method of the invention. Assaying for the presence of a Lig 72A/binding partner complex are accomplished by, for example, the yeast two-hybrid system, ELISA or immunoassays using antibodies specific for the complex. In the presence of test substances (i.e., inhibitors or antagonists) that interrupt or inhibit formation of Lig 72A/binding partner interaction, a decreased amount of complex will be determined relative to a control lacking the test substance.
Polypeptides of the invention also can be used to assess Lig 72A binding capacity of Lig 72A binding molecules in cells or in cell-free preparations.
Lig 72A or a variant thereof of the present invention can also be employed in a process for screening for compounds that activate (agonists) or inhibit (antagonists) the activation of HFGAN72 receptor by Lig 72A or a variant thereof. In general, such screening procedures involve providing appropriate cells that express HFGAN72 receptor on the surface thereof. Such cells include cells from mammals, yeast, Drosophila or E. coli. In particular, a polynucleotide encoding HFGAN72 receptor is employed to transfect cells to thereby express the receptor. The expressed receptor is then contacted with a test compound Lig 72A or a variant thereof of the present invention to observe binding, stimulation or inhibition of a functional response.
One such screening procedure involves the use of melanophores that are transfected to express HFGAN72 receptor. Such a screening technique is described in PCT Application WO 92/01810, published February 6, 1992.
Thus, for example, such assay may be employed for screening for a compound that inhibits interaction of Lig 72A or a variant thereof with HFGAN72 receptor by contacting melanophore cells that encode the receptor with both an HFGAN72 receptor ligand of the present invention and a compound to be screened. Inhibition of the signal generated by the ligand indicates that a compound is a potential antagonist for the receptor, i.e., inhibits activation of HFGAN72 receptor.
The screen may be employed for determining a compound that activates the receptor by contacting such cells with compounds to be screened and determining whether such compound generates a signal, i.e., activates the receptor, resulting in a second messenger response such as, but not limited to, cAMP inhibition or stimulation, calcium mobilization, and GTPγS binding.
Another such screening technique involves introducing RNA encoding HFGAN72 receptor into Xenopus oocytes to transiently express the receptor. The receptor oocytes may then be contacted with a receptor ligand of the present invention and a compound to be screened, followed by detection of inhibition or activation of a signal in the case of screening for compounds that are thought to inhibit activation of the receptor by the ligand.
Another method involves screening for compounds that inhibit activation of the receptor by determining inhibition of binding of labeled Lig 72A or a variant thereof of the present invention to cells that have the receptor on the surface thereof. Such a method involves transfecting a eukaryotic cell with DNA encoding HFGAN72 receptor such that the cell expresses the receptor on its surface and contacting the cell or cell membrane preparation with a compound in the presence of a labeled form of Lig 72A or a variant thereof. The ligand can be labeled, e.g., by radioactivity. The amount of labeled ligand bound to the receptors is measured, e.g., by measuring radioactivity of the receptors. If the compound binds to the receptor as determined by a reduction of labeled ligand that binds to the receptors, the binding of labeled ligand to the receptor is inhibited.
Yet another screening technique involves the use of FLIPR equipment for high throughput screening of test compounds that inhibit mobilization of intracellular calcium ions, or other ions, by affecting the interaction of Lig 72A or a variant thereof with HFGAN72 receptor.
HFGAN72 receptors are found in the mammalian host and are responsible for many biological functions, including pathologies. Accordingly, it is desirous to find compounds that stimulate HFGAN72 receptor or the interaction of Lig 72A or a variant thereof and HFGAN72 receptor, on the one hand, and which can inhibit the function of HFGAN72 receptor, on the other hand.
For example, HFGAN72 receptor has been preliminary demonstrated to be upregulated in vascular smooth muscle cells treated with serum, down-regulated in macrophages treated with oxidized LDL and has also been found in stented arteries. Accordingly, modulation of the activity of this receptor with polypeptides or fragments, derivatives or variants of the polypeptides of the instant invention may be useful in treating cardiovascular disorders. Isolation of this ligand from the brain and hypothalamus is also indicative of CNS relevance. Thus, the present invention also relates to methods of using Lig 72A or a variant thereof or compounds that modulate the interaction of such a ligand with HFGAN72 receptor in the treatment of patients suffering from at least one of the Diseases.
The data set forth in Example 13 demonstrate the powerful analgesic activity of Lig 72A in three different types of in vivo pain studies that are well known and accepted in the art. First, the data generated by the mouse carrageenan-induced hyperalgesia tests (Example 13a), demonstrate that in a model of inflammation-induced hyperalgesia, Orexin- A, demonstrated an anti-hyperalgesic effect that is similar in efficacy to that of morphine. Efficacy in this model indicates that Orexin-A would be effective in treating conditions in humans, such as arthritis, chronic back pain, sports injuries, where hyperalgesia is present as a consequence of inflammation and may be of chronic duration. These data also indicate that Orexin-A would be effective in treating hyperalgesia in humans due to other factors, such as metabolic damage (e.g., painful diabetic neuropathy), viral infection (e.g., post herpetic neuralgia), traumatic nerve injury (e.g., causalgia), and cancer pain. Second, the data generated from the mouse hot-plate tests (Example 13b), a model of thermal nociception, demonstrate an anti-nociceptive effect of Orexin-A. This effect is not blocked by the opiate antagonist, naloxone, indicating no involvement of opiate receptors in the anlagesic effect of Orexin-A. Furthermore, Orexin-A is analgesic against higher noxious temperatures in mice and is also effective when given by the intracerebroventricular (herein "i.c.v") route in rats (see Tables 16 and 17), demonstrating that its effects are not confined to one species. These data indicate that Orexin-A would be an effective analgesic in humans in conditions where acute injury is present, such as post-operatively and reinforces its potential for use in conditions such as arthritis, chronic back pain, sports injuries. Third, the data generated from the mouse abdominal constriction (MAC) test, a model of acute inflammation visceral pain, demonstrate the ability of Orexin-A to increase the latency to response towards cut-off levels, effectively abolishing the response to phenyl-p-quinone (herein "p.p.q."). These data indicate that Orexin-A would be an effective treatment in man for acute inflammatory conditions, as well as for pain arising from the viscera, e.g., angina, irritable bowel syndrome (IBS), and inflammatory bowel disease.
Furthermore, the data set forth in Table 18 shows that the Orexin-A (15-33) truncate (SEQ ID NO:23) demonstrates an anti-nociceptive effect in the mouse hot-plate test. These data indicate that the Orexin-A (15-33) truncate (SEQ ID NO:23) would be an effective analgesic in humans in conditions where acute injury is present, such as post- operatively, and for use in conditions such as arthritis, chronic back pain, sports injuries. These data showing the anti-nociceptive effects of the Orexin-A (15-33) truncate (SEQ ID NO:23) in this model of thermal nociception indicate that other Orexin-A truncates and variants, such as those set forth in Table 2 (SEQ ID NOs:24-38) would have similar activity and therapeutic utility.
The present invention also relates to compositions comprising the polypeptides discussed above or the agonists or antagonists. The polypeptides of the present invention, or agonists or antagonists thereto, may be employed in combination with a non-sterile or sterile carrier or carriers for use with cells, tissues or organisms, such as a pharmaceutical carrier suitable for administration to a subject. Such compositions comprise, for instance, a media additive or a therapeutically effective amount of a polypeptide of the invention and a pharmaceutically acceptable carrier or excipient. Such carriers may include, but are not limited to, saline, buffered saline, dextrose, water, glycerol, ethanol and combinations thereof. The formulation should suit the mode of administration.
The invention further relates to pharmaceutical packs and kits comprising one or more containers filled with one or more of the ingredients of the aforementioned compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, reflecting approval by the agency of the manufacture, use or sale of the product for human administration.
Polypeptides and other compounds of the present invention may be employed alone or in conjunction with other compounds, such as therapeutic compounds.
The pharmaceutical compositions may be administered in any effective, convenient manner including, for instance, administration by topical, oral, anal, vaginal, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal or intradermal routes among others.
The pharmaceutical compositions generally are administered in an amount effective for treatment or prophylaxis of a specific indication or indications. In general, the compositions are administered in an amount of at least about 10 μg/kg body weight. In most cases they will be administered in an amount not in excess of about 8 mg/kg body weight per day. Preferably, in most cases, dose is from about 10 μg/kg to about 1 mg/kg body weight, daily. It will be appreciated that optimum dosage will be determined by standard methods for each treatment modality and indication, taking into account the indication, its severity, route of administration, complicating conditions and the like. EXAMPLES: BIOLOGICAL METHODS
Certain terms used herein are explained in the foregoing glossary.
All examples were carried out using standard techniques, which are well known and routine to those of skill in the art, except where otherwise described in detail. Routine molecular biology techniques of the following examples can be carried out as described in standard laboratory manuals, such as Sambrook, et al, MOLECULAR CLONING: A LABORATORY MANUAL, 2nd Ed.; Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), herein referred to as "Sambrook." Example 1 : Cloning Method for the HFGAN72 Receptor Ligands: a. Cloning Method for the Rat HFGAN72 Receptor Ligands:
Intrapeptide degenerate RT-PCR method was used to obtain the full-length sequence for the rat HFGAN72 receptor ligand (SEQ ID NO:7).
The peptide sequence QPLPDCCRQKTCSCRLYELLHGAGNHAGI (amino acids 1-29 of SEQ ID NO:7) was chosen to design highly degenerate oligonucleotide primers encoding its ends. The sequences of primers were: CAACCNCTNCCNGACTGCTG (SEQ ID NO: 15) and ATNCCNGCNGCATGATT (SEQ ID NO: 16). At position 3 of the primer of SEQ ID NO: 15, A can be substituted with G. At position 7 of the primer of SEQ ID NO: 15, C can be substituted with T. At position 15 of the primer of SEQ ID NO: 15, C can be substituted with T. At position 18 of SEQ ID NO: 15, C can be substituted with T. At position 12 of the primer of SEQ ID NO: 16, A can be sunstituted with G. At position 15 of the primer of SEQ ID NO: 16, A can be substituted with G. Any of all of these substitutions may be present in the primers of SEQ ID NOs: 15 and 16. In the nucleotide sequences of the above primers, the symbol "N" can be an A, C, G or T. The cDNA fragment encoding the peptide was obtained by RT-PCR from rat brain RNA and confirmed by nucleotide sequencing. 5'-RACE:
A non-degenerate oligonucleotide primer was designed (#1 ; GTTGCCAGCTCCGTGCAACAGTTCGTAGAGACGG) (SEQ ID NO: 17), based on the sequence of the above RT-PCR product, and used in a 5 '-RACE reaction: Double stranded cDNA was synthesized from rat brain polyA+ RNA, ligated to the Marathon adaptor (Clontech), and used as template for the initial 5 -RACE reaction with the adaptor primer 1 (Clontech) and #1 as primers. A nested PCR reaction was performed with an oligonucleotide CGGCAGGAACACGTCTTCTGGCG (#2) (SEQ ID NO: 18) and adaptor primer 2. An approx 250-bp 5' cDNA product, which correctly encodes the peptide, was obtained. 3'-RACE:
Two additional oligonucleotides were designed, TCCTTGGGTATTTGGACCACTGCACCGAAG (#3) (SEQ ID NO: 19) and ATACCATCTCTCCGGATTGCCTCTCCCTGA (#4) (SEQ ID NO:20), which corresponded to a part of the putative 5'-noncoding region of the cDNA sequence obtained by the 5 -RACE reaction above. Single stranded rat brain cDNA was synthesized using an oligonucleotide CCTCTGAAGGTTCCAGAATCGATAGTAN (SEQ ID NO:21) as a specific primer for the reverse transcription, and used as template for a 3 -RACE reaction using #3 and an anchor primer (CCTCTGAAGGTTCCAGAATCGATAG) (SEQ ID NO:22). At position 27 of the oligonucleotide of SEQ ID NO:21, A can be substituted with either C or G. In the nucleotide sequence of the oligonucleotide of SEQ ID NO:21, the symbol "N" can be an A, C, G or T. The product was subjected to nested PCR reaction using #4 and the same anchor primer. A discrete 0.6-kb product containing the correct 5 ' cDNA sequence was obtained. The full-length sequence was confirmed on cDNA products obtained from three independent initial 3 -RACE reactions. b. Cloning Method for the Human and Mouse HFGAN72 Receptor Ligands: Approximately 1.2 million plaques each from human (Clontech) and mouse (Stratagene) genomic libraries were screened by standard plaque hybridization. A full- length (about 0.5 kb) rat cDNA insert encoding both HFGAN72 receptor ligands, Lig 72A and Lig 72B, was 32P-labeled by the random priming method and was used as a probe. Hybridization-positive phages were plaque-purified, and genomic DNA fragments containing exons of HFGAN72 receptor ligands were identified by Southern blotting and subcloned into plasmid vectors for further analyses. The complete nucleotide sequence of the genomic fragment was assembled from sequences of the overlapping subclones and sequences obtained by primer walking.
Example 2: Purification of HFGAN72 receptor ligands:
About 220 grams of frozen bovine hypothalamus tissue or frozen rat brain tissue, purchased from Pel-Freez (Rogers, AR), were homogenized by Polytron (15-mm diameter) in 10 x volume of 70% (volume/volume) acetone/ 1M acetic acid/20 mM HC1 at room temperature. Homogenates were stored at 4°C overnight to precipitate large proteins.
On the following day, the homogenates were centrifuged at 20,000 x g for 30 minutes at 4°C. The centrifugation was repeated until all visible insoluble materials were removed from the supernatant. The supernatant was then aliquoted into several large glass bottles, and an equal volume of diethyl ether was added to each bottle. The mixture was vigorously shaken for 1 -2 minutes, and the two phases were allowed to separate for 30 minutes at room temperature. The lower aqueous phase (which appears turbid) was transferred to fresh bottles, and the ether extraction was repeated two more times to remove any acetone. Following the extractions, the aqueous phase was centrifuged at 20,000 x g for 30 minutes at 4°C. The supernatant was spun again to remove all insoluble materials. The final supernatant (approximately 500-600 ml) was then filtered through a mesh filter (Falcon Cell Strainer, Becton Dickinson, Co., Oxnard, CA) into a glass bottle. The filtrate was then diluted with an equal volume of H,0 at room temperature and directly loaded onto two 10-gram cartridges of SepPak C18 (total of 20 gram bed), that were pre-equilibrated with 0.1% (volume/volume) trifluoroacetic acid (TFA). By applying a gentle vacuum to the cartridges, flow rate was maintained so that the individual droplets from the cartridge outlet were still visible. Each cartridge was washed with 100 ml of 5% CH3CN/0.1% TFA, and then eluted with 30 ml of 50% CH,CN/0.1 % TFA . The first 6 milliliters of eluate was discarded as void. The remaining eluate was lyophilized in siliconized glass flask overnight.
The lyophilized material was dissolved in 24 milliliters of 1 M acetic acid by sonicating for 10-20 minutes or until there was no visible insoluble materials. The extract was then filtered through a 20-micron Mirex GV syringe filter (Millipore, Bedford, MA). Half (12 milliliters) of the filtered extract was directly loaded onto a C18 reverse-phase HPLC column (Vydac 218TP510; 5 micron; 10 mm x 250 mm semiprep; Hesperia, CA), pre-equilibrated with 3% CH,CN/0.1% TFA at a flow rate of 3 milliliters/minute at room temperature. Sample was loaded in four 3-milliliter boluses via a large (5 milliliter or greater) sample loop. A 10%-40% gradient of CH3CN in 0.1 % TFA was then applied over 100 minutes. Three milliliter (or 1 minute) fractions were collected into siliconized 5 milliliter glass tubes. The identical HPLC was repeated once more for the remaining half of the extract. Sixty microliters (1/50) from each fraction were set aside and assayed for the Ca transients as described in Example 2, on 293/HFGAN72 cells.
The active fractions were pooled, and directly applied to a cation-exchange HPLC column (TosoHaas SP-5PW; 7.5 mm x 75 mm; Montgomeryville, PA), pre-equilibrated with 20 mM Na-phosphate (pH 3.0)/30% CH3CN at room temperature. A 0-0.5 M gradient of NaCl in 20 mM Na-phosphate (pH 3.0)/30% CH3CN was applied over 60 minutes at a flow rate of 1 milliliter/minute. One milliliter fractions were collected, and 30 microliters from each fraction were used for the Ca assay.
The active fractions (2-3 fractions; 2-3 milliliter) were pooled, and diluted 4-fold with 0.1% TFA. The diluted sample was directly loaded onto an analytical C18 reverse- phase column (Vydac 218TP54; 4.6 mm x 250 mm), pre-equilibrated with 3% CH3CN/0.1% TFA at a flow rate of 1 milliliter/minute. The column was maintained at 40°C with a column heater. A 21%-36% gradient of CH3CN in 0.1% TFA was applied over 75 minutes. Individual peaks (monitored at 210-nm absorption) were collected manually into siliconized 5 milliliter glass tubes, and 30 microliters from each fraction were assayed. At this point, the active peak was already >70-80% pure.
The active peak (about 1 milliliter) was diluted 4-fold with 0.1% TFA, and directly loaded onto the same C18 column, but this time pre-equilibrated with 3% CH3CN/20 mM Tris-HCl (pH 7.0 at 40°C). A 3%-40% gradient of CH3CN in 20 mM Tris-HCl (pH 7.0) was applied over 74 minutes at 40°C. The major 210-nm peak was collected manually. At this point, the sample should already be pure. In order to confirm purity, as well as to desalt the material, the active peak (about 800 microliters) was diluted 4-fold with 0.1 % TFA, and directly loaded onto a C8 reverse-phase column (Vydac 228TP104;pH- stable coated C8; 4.6 mm x 250 ml), pre-equilibrated with 3% CH3CN/0.1% TFA at a flow rate of 1 milliliter/minute. A 3%-36% gradient of CH3CN in 0.1% TFA was applied over 66 minutes at 40°C. The single 210-nm peak was collected manually. The biological activity was confirmed. The above process that was used to purify Lig 72A.
Lig 72B (SEQ ID NO:9) was found and purified by sythesizing the peptide based on the cDNA sequence and testing the synthesized product. Example 3: Ca Assay for Lig 72A and Lig 72B:
The Ca assay was performed in accordance with procedures described by Sakuri, et al, Nature, 348:732-735 (1990). For the assay, a small portion of each HPLC fraction was transferred to a siliconized 1.5 milliliter Eppendorf tube and evaporated to dryness under vacuum. Dried material was reconstituted in 20 microliters of the Ca assay buffer (140 mM NaCl, 4 mM KC1, 1 mM Na2HP04/l mM MgCl2, 1.25 mM CaCl2, 1 1 mM glucose, 5 mM HEPES (pH 7.4) and 0.2% bovine serum albumin) by vortexing for 3 minutes. For each assay point, 10 microliters of the reconstituted solution was used. Cells were loaded with Fura-2/AM in accordance with standard procedures. A Jasco CAF-110 intracellular ion analyzer (Easton, MD) with 0.5 ml assay cuvettes was used. The 293/HFGAN72 cells and non-transfected 293 cells were used in parallel to ensure the specificity of the response. Endothelin-1 (final concentration of 1-100 nM) was used as positive-control ligand. Example 4: Determination of Amino Acid Sequences of Lig 72A and Lig 72B:
A Lys-C digest of the reduced and alkylated Lig 72A in 50 mM Tris buffer, pH 9.0, was used for sequence analysis. One half of the sample (approximately 25 microliters) was purified and concentrated on a microcolumn packed with Poros RII resin. The peptides were eluted with 2 microliters of 70% methanol, 5% formic acid and transferred to a nanoelectrospray needle. The sample was analyzed using nanoelectrospray ionization on a PE-Sciex triple quadrupole mass spectrometer. A single peptide with a molecular weight of 1286.6 was observed. This peptide was sequenced using collision induced dissociation (CID) tandem mass spectrometry (MS/MS). In order to facilitate interpretation of the data, fragments of the peptide were also generated in the electrospray source that were subsequently sequenced by CID tandem MS (a technique referred to as MS3). The fragment-ions produced in the ion source that were generated differed from one another by the loss of successive N-terminal amino acids beginning with the "des 3 peptide fragment" and continuing through the "des 5 fragment". The "des 3 peptide fragment" refers to a fragment ion corresponding to the loss of the N-terminal 3 amino acids, with a charge retained on the amino acids 4-10. The "des 3" product has the same molecular mass, composition, and presumably, structure, as the M+H of the peptide 4-10. The "des 5 fragment" refers to a fragment ion corresponding to te loss of the N-terminal 5 amino acids, with a charge retained on the amino acids 6-10. The "des 5" product has the same molecular mass, composition, and presumably, structure, as the M+H of the peptide 6-10.
Lig 72B was identified by direct Edman sequencing using an Hewlett Packard G1000A protein sequencer equipped with on-line Pth (phenylthiohydantoin) amino acid analysis. The molecular weight of the peptide was determined as 2935.9 Da by matrix- assisted laser desorption ionization mass spectrometry (MALDI-MS), indicating that the processed peptide was full-length and amidated at the C-terminal residue.
Example 5: Tissue Localization Data for Lig 72A: a. Immunohistochemistry method:
Localization of Lig 72A peptide was carried out using standand indirect immunofluorescence techniques. In brief, rats were perfuse-fixed transcardially with 500 ml of 4% paraformaldehyde (Sigma) in 0.1 M sodium phosphate buffer (pH 7.4). The rat brains were dissected out and stored in the same fixative overnight. Coronal sections (50 μm) were taken from the fore-, mid- and hind-brain regions at intervals of 1 mm and collected in phosphate-buffered saline (herein "PBS") (pH 7.4). Sections were incubated with rabbit polyclonal antibodies raised against a 33-amino acid Lig 72A peptide (SEQ ID NO:4) for 5 hours at room temperature (1 :100 dilution in PBS containing 0.1% Triton X- 100 (Sigma)). Controls for the specificity of localization were generated by incubating serial sections with either buffer or normal rabbit serum ( 1 : 100 dilution) or antiserum preadsorbed with excess Lig 72A peptide or excess Lig 72B peptide. Sections were washed 3 times in PBS and then incubated with Texas-Red conjugated goat anti-rabbit secondary antibody (Vector Labs., 30 ug/ml in PBS containing 0.1% Triton X-100). Sections were washed 3 times in PBS, floated on to gelatin-coated slides, mounted using Vectashield mounting medium (Vector Labs.) and examined under a Fluorescence microscope (Leica DMRB, 596 nm excitation, 615 nm emmision) fitted with an Ultrapix 400 CCD camera system (Astrocam) using DataCell image capture facilities and Optimas software. b. Lig 72A Tissue Localization Data and Potential Therapeutic Implications:
Utilization of the above immunohistochemistry method, yielded information on the localization of Lig 72A (SEQ ID NO:4) in the brain. Lig 72A is expressed in the hypothalamus (cell bodies and nerve terminals), which is associated with hormonal control, feeding, sexual behavior, and temperature control. It is understood in the art that the hypothalamus interacts with the following neurotransmitter systems: 5-HT, DA, and neuropeptides. The localization of Lig 72A in the Hypothalamus (cell bodies and nerve terminals) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: depression; anxiety; obsessive compulsive disorder; affective neurosis/disorder; depressive neurosis/disorder; anxiety neurosis; dysthymic disorder; behavior disorder; mood disorder; psychosexual dysfunction; sex disorder; sexual disorder; disturbed biological and circadian rhythms; feeding disorders,such as anorexia, bulimia, cachexia, and obesity; Cushing's syndrome / disease; basophil adenoma; prolactinoma; hyperprolactinemia; hypopituitarism; hypophysis tumor / adenoma; hypothalamic diseases; Froehlich's syndrome; adenohypophysis disease; hypophysis disease; hypophysis tumor / adenoma; pituitary growth hormone; adenohypophysis hypofunction; adrenohpophysis hyperfunction; hypothalamic hypogonadism; Kallman's syndrome (anosmia, hyposmia); functional or psychogenic amenorrhea; hypopituitarism; hypothalamic hypothyroidism; hypothalamic-adrenal dysfunction; idiopathic hyperprolactinemia; hypothalamic disorders of growth hormone deficiency; idiopathic growth hormone deficiency; dwarfism; gigantism; and acromegaly, among others.
Lig 72A is also expressed in the Central Gray (nerve terminals), which is associated with nociception and wakefulness. It is understood in the art that the Central Gray (nerve terminals) interacts with the following neurotransmitter systems: 5-HT, NA, Adr, and Ach. The localization of Lig 72A in the Central Gray (nerve terminals) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, migraine; hyperalgesia; enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia; acute pain; burn pain; atypical facial pain; neuropathic pain; back pain; complex regional pain syndromes I and II; arthritic pain; sports injury pain; pain related to infection, e.g., HIV, post-polio syndrome, and post- herpetic neuralgia; phantom limb pain; labor pain; cancer pain; post-chemotherapy pain; post-stroke pain; post-operative pain; neuralgia; and tolerance to narcotics or withdrawal from narcotics, among others.
Lig 72A is also expressed in the Locus Coeruleus (nerve terminals), which is associated with sleep/awake patterns. It is understood in the art that the Locus Coeruleus (nerve terminals), interacts with the NA and GABA neurotransmitter systems. The localization of Lig 72A in the Locus Coeruleus (nerve terminals) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, sleep disorders; sleep apnea; narcolepsy; insomnia; parasomnia; jet-lag syndrome; fatigue; disturbed biological and circadian rhythms; and sleep disturbances associated with such diseases as neurological disorders, heart and lung diseases, mental illness, and addictions, among others.
Lig 72A is also expressed in the Mesencephalic Trigeminal Nucleus (nerve terminals), which is associated with nociception. It is understood in the art that the Mesencephalic Trigeminal Nucleus (nerve terminals), interacts with the NA and GABA neurotransmitter systems. The localization of Lig 72A in the Mesencephalic Trigeminal Nucleus (nerve terminals) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: migraine; hyperalgesia; enhanced or exaggerated sensitivity to pain, such as hyperalgesia, causalgia and allodynia; acute pain; burn pain; atypical facial pain; trigeminal neuralgia; neuropathic pain; back pain; complex regional pain syndromes I and II; arthritic pain; sports injury pain; pain related to infection, e.g., HIV, post-polio syndrome, and post-herpetic neuralgia; phantom limb pain; labor pain; cancer pain; post-chemotherapy pain; post-stroke pain; postoperative pain; physiological pain; inflammatory pain; neuropathic pain; neuralgia; and tolerance to narcotics or withdrawal from narcotics, among others.
Lig 72A is also expressed in the Amygdala (cell bodies), which is associated with aggression and anxiety. It is understood in the art that the Amygdala (cell bodies) interacts with the following neurotransmitter systems: 5-HT and neuropeptides._The localization of Lig 72A in the Amygdala (cell bodies) indicates that Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to: depression; anxiety; affective neurosis/disorder; depressive neurosis/disorder; anxiety neurosis; dysthymic disorder; behavior disorder; mood disorder; epilepsy; and seizure disorders.
Furthermore, Lig 72A is expressed in the Retrosplenial Cortex (cell bodies), which is associated with sensory/thalamic functions. It is understood in the art that the Retrosplenial Cortex (cell bodies) interacts with the Glu, Gly, Ach, and GABA neurotransmitter systems.
Lig 72A is also expressed in the Occipital Cortex (cell bodies), which is associated with sensory/IC/geniculate functions. It is understood in the art that the Occipital Cortex (cell bodies) interacts with the Glu, Gly, Ach, and GABA neurotransmitter systems.
Furthermore, Lig 72A is expressed in the Temporal Cortex (cell bodies), which is associated with the primary visual cortex. The Temporal Cortex (cell bodies) is understood in the art to interact with the Glu, Gly, Ach, and GABA neurotransmitter systems.
Example 6: Lig 72 Feeding Studies: a. Acute effects of i.c.v. administration of Lig 72A on feeding in satiated rats:
1. Animals:
Male Sprague-Dawley rats (260-290g on arrival) were obtained from Charles River Breeding Laboratories. They were housed in groups of 5 for at least 5 days under controlled lighting (12 hour light-dark cycle) and temperature (21°C ±2°C) conditions. Food (chow pellets) and water were available ad libitum.
2. Surgical preparation:
All rats (300g) were pre-treated with Synulox (0.1 ml/lOOg subcutaneous (herein "s.c.")) approximately 1 hour before being anaesthetized with Domitor (0.04 ml/lOOg intramuscular (herein "i.m.") or s.c.) and Sublimase (0.9 ml/lOOg intraperitoneal (herein "i.p.")). The rats were positioned in a stereotaxic frame and implanted with a guide cannula into the lateral brain ventricle under sterile conditions. The co-ordinates used to map the correct positioning of the implants were: 0.8mm posterior to the bregma, 1.6mm lateral from the midline and 4.5mm ventral to the skull surface, with the incisor bar set 3.2mm below the interauricular line. Following surgery, Zenecarp was given as an analgesic (0.03 ml/lOOg s.c), and anaesthesia was reversed using Antisedan and Nubain (50 : 50% v/v 0.02 ml/lOOg i.p.). Rats were then housed singly under the same conditions as above for a recovery period of at least 5 days, and body weights were monitored daily for the duration of the study.
After recovery from surgery, rats were transferred to grid-floor cages so that food intake measurements could be made. The position of the cannula was then verified by central administration of porcine NPY (2.3 nmol); for a positive test, at least 5.8g of food was eaten over a 4 hour period.
3. Administration of compounds: Only positive testing animals (n = 9-10) were utilized in these experiments. The studies were conducted according to a multi-dose, cross-over design, with the order of dosing determined using the Latin square principle, leaving at least one rest day between administrations. All doses were delivered in a volume of 5 ml over 10 seconds, and the injector remained in position for a further 60 seconds to ensure complete dispersal of the peptide. All i.c.v. administrations began at 9am, and food intake was initially measured at 1, 2, and 4 hour intervals in the first study, with additional measurements at 6 and 24 hours in the second.
4. Compound preparation:
Lig 72A was dissolved in sterile water to make the highest dose, and individual doses were made up from this stock solution. Both porcine and rat NPY were dissolved in sterile water to a concentration of 2.3 nmol; the former was used as a positive control, whilst the latter was used to verify the position of the cannula. Water alone was used for the vehicle control. b. Chronic effects of i.c.v. infusion of Lig 72A and Lig 72B on feeding, water consumption and BAT temperature in satiated rats:
1. Animals:
Male Sprague-Dawley rats (270-280g on arrival) were obtained from Charles River Breeding Laboratories. They were housed in groups of 5 for at least 5 days under controlled lighting (12hour light-dark cycle) and temperature (21 °C ±2°C) conditions. Food (chow pellets) and water were available ad libitum.
2. Surgical preparation:
All rats (300g) were anaesthetized with Domitor (0.04 ml/lOOg i.m. or s.c.) and Sublimase (0.9 ml/lOOg i.p.) prior to positioning in a stereotaxic frame. An "L-shaped" guide cannula was implanted into the lateral brain ventricle under sterile conditions. The co-ordinates used to map the correct positioning of the implants were: 0.8mm posterior to the bregma, 1.6mm lateral from the midline and 4.5mm ventral to the skull surface, with the incisor bar set 3.2mm below the interauricular line. Each rat then had an Alzet osmotic mini-pump (model 2001 ; flow rate = lμl/hr) containing sterile water implanted subcutaneously; this was connected to the i.c.v. cannula via a catheter, also containing sterile water. A temperature probe was then implanted in the brown adipose tissue (BAT) between the shoulder blades. Following surgery, anaesthesia was reversed using Antisedan and Nubain (50 : 50% v/v 0.02 ml/lOOg i.p.). Rats were then housed singly under the same conditions as above for a recovery period of 3 days.
Seven days after surgery the pumps were removed under isofluorane gas, and replaced with a fresh pump containing either Lig 72A (18 nmol/day), Lig 72B (18 nmol/day) or water. The position of the cannula was verified at the end of the experiment by i.c.v. administration of Evans Blue dye, followed by dissection of the brain to check for staining of the ventricles.
3. Compound preparation:
Both Lig 72A and Lig 72B were dissolved in sterile water to a concentration of 18nmol/24μl. Water alone was used to fill the first pumps, and for the vehicle control in the second. At least 4 hours prior to implanting, all pumps were attached to catheters and primed at 37 °C, to ensure continuous pumping, and minimize the chance of clotting within the tubing or occlusion by surrounding tissue.
4. Food and water intakes, and BAT temperature measurements: After recovery from surgery, rats were transferred to grid-floor cages so that food intake measurements could be made. Both food and water consumption were measured at various intervals on 3 days during the study; i.e.: 8am-lpm, lpm-6pm and 6pm-8am; BAT temperature was measured at 1pm on these days, and body weights were monitored daily for the duration of the study. The 3 days were as follows: day 6 of vehicle infusion (first Pump); day 3 of treatment/vehicle infusion (second Pump); day 7 of treatment/vehicle infusion (second pump).
Example 7: Locomotor Activity and Grooming Studies: a. Surgery:
Rats were housed overnight in the operating room. Anesthesia consisted of Domitor (i.m.)/sublimaze (i.p.) with intra-epicaine used locally where appropriate. The eyes were treated with lacrilube to avoid excessive drying. Surgery was carried out using standard stereotaxic techniques and under aseptic conditions. Following anesthesia and skull preparation, holes were drilled at the appropriate locations on the surface to allow for the implantation of unilateral cannulae and to allow placement of anchor screws (one on each skull plate) for a dental acrylic headcap to hold the guide cannulae in position.
Sterotaxic co-ordinates were (from intersection of bregma and midline)
Incisor bar set at -3.2mm
Anterior-Posterior: -0.8mm
Lateral: +/- 1.5mm (i.e. cannulae on left or right of the midline) Dorsal- ventral: -4.1mm (from skull surface) An obturator (dummy cannula) was placed in the cannula to prevent blockages from occurring and to prevent loss of ventricular fluid. Anesthesia was reversed and analgesia provided by Antisedan/nubain. Animals were monitored throughout post-op recovery in a warm cage until the righting reflex returned, whereupon they were singly housed. Animals received 5 days of post-op care provided by LAS veterinary section. All surgical work conformed to LAS SOP 25 (Veterinary Procedures). b. Injection procedure:
The injection procedure outlined below is followed for all subsequent studies: The injection unit (previously stored in absolute ethanol) was rinsed in sterile saline and attached to a length of sterile Portex tubing. The unit was then wiped with a Vetwipe to sterilize post handling. This tubing was flushed with sterile saline, filled and attached to a glass Hamilton syringe microsyringe. 1 μl of air was taken up to provide an air bubble to separate drug solution from saline. An appropriate volume of drug solution was drawn up into the tubing, and the syringe was fixed into a microinfusion pump programmed to pump at 5μl/min. The rat was gently restrained and the dummy cannula removed. The injection unit was inserted into the guide cannula until completely flush with the top of the guide cannula. 5μl of drug was injected over a 60 second period and the injection unit was left in place for up to 90 seconds to allow complete diffusion of the drug. The injection unit was removed and the dummy cannula replaced.
Any remaining drug solution was discarded, the tubing flushed with sterile saline and the injection unit cleaned with a Vetwipe. Typically drug vehicle is sterile saline, although when necessary distilled water may be used. A maximum of 10 injections may be made in each rat, with no more than 2 per week. c. Cannula Placement Verification:
This part of the experiment was carried out 7 days post surgery. An appropriate cannula placement is indicated by an intense dipsogenic response to lOOng i.c.v. angiotensin II (All). To induce a dipsogenic effect, access is required to the All receptors located on cicurmventricular organs around the third ventricle. The time spent drinking for a 5 minute period post-All is recorded. This tends to be an all-or-nothing effect , but rats spend on average 150s drinking. Failure to drink (<50s) on at least two separate occasions indicates an incorrectly placed cannula. This may be verified by injection of cresyl violet and sectioning of the brain. d. Grooming Methods:
17 animals from JH/i.c.v./GpOl were used. Animals were randomly assigned into one of three treatment groups;
A - Distilled water vehicle 5μl i.c.v.
B - Lig72A 30μg in 5 μl i.c.v.
C - Lig 72A lOμg in 5μl i.c.v.
Day 1 - 6.15 mgs of Lig 72A was dissolved in 1.025 mis of sterile water (Fresenius Lot No 23174) to give a solution of 6mgs/ml (c.f. 30 μg in 5μl). Serial dilutions were made from this solution as required. Stock solution was frozen for future use.
Day 2 - 6.26 mgs of Lig72a was dissolved in 1.04mls of sterile water (Fresenius Lot No 23174) to give a solution of 6mgs/ml (c.f. 30 μg in 5μl). Serial dilutions were made from this solution as required.
Animals were acclimatised for a period of 15 minutes to test cages. After this time, animals were injected using the procedure outlined on page 02 of this LNB (LNB 96978) and observed for a total period of one hour in periods of two minutes. Any behaviors observed were noted. Rectal temperature was taken from each animal immediately prior to dosing and at one hour post dose. e. LMA Methods:
12 animals from JH/i.c.v./GpOl (see page 01 of this LNB (LNB 96978)) were used. Animals were randomly assigned into one of three treatment groups;
A - Distilled water vehicle 5 μl i.c.v.
B - Lig 72A lO.Oμg in 5 μl i.c.v.
C - Lig 72A 30.0μg in 5 μl i.c.v.
3.97 mgs of Lig 72A was dissolved in 0.66 mis of sterile water (Arnolds Lot No 022 - Exp. date 09/98) to give a solution of 6 mgs/ml (c.f. 30μg in 5μl). Serial dilutions were made from this solution as required.
Animals were injected using the procedure outlined on page 02 of this LNB (LNB 96978) and placed immediately in the locomotor activity chambers. Activity was measured for one hour in five minute intervals. Activity was monitored in AM 1052 activity chambers (Linton Instruments). f. Data Analysis:
Data was recorded and results were expressed as log 10 total mean number of counts for each treatment group +/- SEM. Changes were assessed using a one way analysis of variance with post hoc analysis carried out using Dunnett's t-test.
A separate analysis was performed on each of the following data segments:
1. Total activity over one hour (periods 1 - 12).
2. Total activity from 0 to 30 minutes (periods 1 - 6)
3. Total activity from 30 to 60 minutes (periods 6 - 12)
4. Total transits over one hour (peri ods 1 - 12)
Example 8: Hypothermia Method:
24 rats from JH/i.c.v./Gp02 were used. Animals were assigned into one of four treatment groups;
A - Distilled water vehicle 5 μl i.c.v.
B - Lig 72A l.Oμg in 5 μl i.c.v.
C - Lig 72A 3.0μg in 5 μl i.c.v.
D - Lig 72A lO.Oμg in 5 μl i.c.v.
2.80r gs of Lig 72A was dissolved in 1.40mls of sterile water (Arnolds Lot No 022 - Exp date 09/98) to give a solution of 2mgs/ml (c.f. lOμg in 5μl). Serial dilutions were made from this solution as required. Stock solution was frozen for future use.
Rectal temperature was monitored using an electric thermometer (COMARK, model 9001) coupled to a rectal probe (COMARK, model BS4937K), which was inserted approximately 5 cms into the rectum and left until a steady reading was obtained. Temperature measurements were taken at 30 min (-30), and immediately prior to administration of Lig 72A. Further measurements were taken at 15, 30, 45 and 60 minutes post injection. a. Data Analysis:
Data generated by the above method was recorded. Temperature at each time point was expressed against the temperature at time 0. The peak drop was calculated for each animal (irrespective of time) and expressed graphically. Changes in temperature were assessed using a one way analysis of variance with post hoc analysis carried out using a Dunnett's t-test. Example 9: X-MAZE Method: a. Apparatus:
The X-maze is constructed of black perspex and consists of two enclosed arms 42 cm long x 15 cm wide x 11 cm high and two open arms of the same length and width but with a wall only 1 cm high. The arms are arranged in the shape of a X such as they lie directly opposite each other. b. Procedure:
Performance of rats has been found to be highly dependant on a number of external factors, i.e., light levels and spatial position of the arms of the maze. An excess of light on arm may elicit anxiety in the rat and thus may favour the rat to enter the opposite arm and so light levels need to be balanced as much as possible. Therefore, prior to testing Lig 72A, an experiment was performed in order to check that the parameters of the experiment, i.e, light levels, spatial position were acceptable. c. Experiment 1 :
10 male SD rats (Charles River UK) were used (Date of Arrival 4th September 1997). Light levels were measured using an IsoTech IS350 light meter. Measurements were as follows:
Centre - 315
Open Arm End 1 - 296 Closed Arm End 1 - 250
Open Arm End 2 - 314 Closed Arm End 2 - 261
Activity was measured automatically using a Videotrack Data Acquisition system (CPL systems - UK). d. Experiment 2:
40 rats from JH i.c.v./Gp03 were used. Animals were assigned into one of three treatment groups;
A - Distilled water vehicle 5μl i.c.v. (N=10)
B - Lig 72A l.Oμg in 5μl i.c.v. (N=10)
C - Lig 72A lO.Oμg in 5μl i.c.v. (N=10) 2.72 mgs of Lig 72A was dissolved in 1.36 mis of sterile water (Arnolds Lot No 022 - Exp date 09/98) to give a solution of 2mgs/ml (c.f. lOμg in 5μl). Serial dilutions were made from this solution as required. Stock solution was frozen for future use.
Animals were dosed with test compound and five minutes later placed on the central portion of the X-maze. Activity of the animal was tracked over a five minute period using a Videotrack data logger system (CPL systems - UK). Data was also recorded on video tape to enable post test experimental analysis, if required.
The following parameters were automatically measured by the system; Total time in open arms (sees) Total number of open arm entries
Total time in closed arms (sees)
Total number of closed arm entries
Total distance travelled (metres)
Average speed (m/sec) The following was also calculated by the Videotrack system;
% time in open arms
% open arm entries
% open end time
% open end entries Additional behaviors were logged. These behaviors are shown below:
Total grooming time (seconds)
Number of rears
Number of stretch attends
Number of head dips e. Data Analysis:
Data was logged automatically by the Videotrack system and the means (+/- SEM) were calculated for each parameter above. Data was analysed using one way analysis of variance.
The resultant data generated by the above methods reveal that, upon injection i.c.v. in adult rats by the above methods, Lig 72A induces excessive grooming in an amount that is statistically significant over the control rats. Excessive grooming in rodents has been used in the art as an animal model of obsessive compulsive disorder. See, e.g., Altemus, et al, Brain Research, 593:311-313 (1992). Therefore, these results indicate that either Lig 72A or an agonist or antagonist of the interaction between Lig 72A and HFGAN72 receptor plays a role in treating a subject suffering from obsessive compulsive disorder. Furthermore, the results of these grooming data support the results of the tissue localization data above (see Example 5), which show that because Lig 72A is expressed in the hypothalamus (cell bodies and nerve terminals), Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, obsessive compulsive disorder. As explained above in Example 5 with respect to the tissue localization data, obsessive compulsive disorder is associated with the hypothalamus (cell bodies and nerve terminals). Moreover, the resultant data generated by the above methods reveal that Lig 72 elevates locomotor activity in a statistically significant amount when injected in doses of 3 and 10 μg/rat i.c.v. in adult rats. These results indicate that either Lig 72A, Lig 72B or an agonist or antagonist of the interaction between Lig 72A and HFGAN72 receptor or between Lig 72B and HFGAN72 receptor plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, sleep disorders; sleep apnea; narcolepsy; insomnia; parasomnia; jet-lag syndrome; disturbed biological and circadian rhythms; and sleep disturbances associated with such diseases as neurological disorders, heart and lung diseases, mental illness, and addictions, among others. Furthermore, the results of these locomotor data support the tissue localization data above (see Example 5), which show that because Lig 72A is expressed in the hypothalamus (cell bodies and nerve terminals), Lig 72A plays a role in preventing, ameliorating or correcting dysfunctions or diseases, including, but not limited to, obsessive compulsive disorder. As explained above in Example 5 with respect to the tissue localization data, the Locus Coeruleus (nerve terminals) is associated with sleep/awake patterns. Example 10: Chromosome localization data for Lig 72:
Radiation hybrid mapping showed that the human prepro-Lig 72 gene is most tightly linked to the MIT STS marker WI-6595 and UTR9641. The inferred cytogenetic location between these markers is 17q21. Interestingly, the localization at chromosome 17q21 indicates that the prepro-Lig 72 gene represents a candidate gene for a group of neurodegenerative disorders collectively called "chromosome 17-linked dementia", which includes nosological entities such as disinhibition-dementia-parkinsonism-amyotrophy complex (DDPAC: MIM No. *600274) and pallido-ponto-nigral degeneration (PPND; MIM No. * 168610), which may be allelic. Both DDPAC and PPND has been mapped to 17q21-22 (Wijker, et. al, Hum. Mol. Genet. 5, 151-154 (1996); Wilhelmsen, et. al, MAPtau. Ann. Neurol 41, 139-140 (1997)). Example 11 : Sleep Studies for Lig 72A: a. Animals:
Male hooded lister rats (Charles River, 150-200g on arrival) were housed in groups of 4 on reverse 12 hr light-dark cycle (6am-6pm dark, 6pm-6am light) for at least 21 days prior to the study commencing. Access to food and water was allowed ad libitum. b. Surgical Preparation:
Anaesthesia was induced with Domitor (0.4mg/kg i.m.) and Sublimase (0.45mg/kg i.p.). Following anaesthesia, rats were secured in a stereotaxic frame with the incisor bar positioned 3.2mm below the intrauricular line. Under aseptic conditions a guide cannula with keeper cannula was implanted into the lateral brain ventricle using the following coordinates: 0.8mm posterior to bregma, -1.6mm lateral of midline and 4.5mm ventral of the skull surface. Silver chloride ball electrodes for EEG recordings were implanted through bore holes in the skull over the left / right frontal cortex and the left / right occipital cortex. Silver electrodes were also placed in the left / right musculature of the neck for EMG recordings. All electrodes were soldered to a six pin connecting block and secured in place with dental cement and three cortical screws. After suture of the incision anaesthesia was reversed with Antisedan (lmg/kg s.c.) and Nubain (2mg/kg s.c). Animals were allowed to recover in a heated incubator until righting reflex returned, and feeding began.
After recovery, rats were housed in pairs. No procedures were performed within 7 days or until body weight returned to pre-operative values.
The position of the cannula was verified by an intense dipsogenic response to lOOng angiotensin II infused into the lateral ventricle. c Sleep Study Method:
During sleep studies, rats were housed singly and allowed at least 6 hours to acclimatize to the new environment. The study was designed on a randomixed crossover basis with each animal receiving both vehicle and a single dose of Lig 72A seven days apart. Vehicle (sterile water) or Lig 72A 1 (n=6), 10 (n=9) or 30ug (n=6) was dosed in a volume of 2.5μl i.c.v. at the beginning of the rats normal sleep cycle (6pm). The numbers of rats in the vehicle groups was equal to the corresponding treatment group. Lig 72A dissolves at a very low pH (2-3) in water. This pH was buffered back to pH 5-6 by addition of sodium hydroxide. EEG and EMG signals were captured to PC via leads attached to the six pin connecting block. A swivel mechanism allowed free movement of the animal. At the end of the recording period, rats were returned to their home cages. d. Data Analysis:
Ten second epochs of EEG and EMG signals were captured (sleep stage capture v3.03, written in house) continuously during the 12 hour sleep period. Percentage time in each of four sleep stages (arousal, slow wave sleep (SWS) 1 & 2 and paradoxical sleep (PS)) was calculated over 1 hour periods (sleep stage analysis v3.03, written in house). Data is presented as area under the curve (AUC) over the time 2-3 hrs post dose for each of the four sleep stages. e. Results:
Table 1 contains data showing that Lig 72A produces a dose-dependent increase in arousal up to 3 hours post-dose. This increase in arousal appears mainly attributable to a decrease in paradoxical sleep and also SWS 2 at the highest dose (30μg). Distribution of SWS 1 remained unchanged in all treatment groups. No significant change from vehicle sleep stage distribution was observed 4-12 hours post dose. AUC (mean + sem) for each sleep stage during the second and third hour post-dose. Statistical significance (* = p<0.05, ** = p<0.01, *** = p<0.001) was assessed by one-way ANOVA comparing Lig 72A treated groups to corresponding vehicle group. Values in brackets represent % change from corresponding vehicle control (+ represents an increase and - represents a decrease). Table 1
Example 12: Preparation of Lig72a Truncation Mutants and Variants: a. Synthesis:
The Lig 72A truncation mutants and variant peptides shown in Table 2 (SEQ ID NOs:23-38), were synthesized. The amino acid sequence of SEQ ID NO:23 is a truncation mutant containing amino acids 15-33 of Lig 72A (SEQ ID NO:4). The remaining amino acid sequences in Table 2 (SEQ ID NOs:24-38) are variants of the truncation mutant of SEQ ID NO:23. The polynucleotide sequences that encode each of these variant polypeptides are shown in their respective order in Table 3 (SEQ ID NOs:39-54). These peptides are variants and truncations mutants of amino acid residues 15-33 of Lig 72A (SEQ ID NO:4). All of the Lig72A variant peptides shown in Table 3 were synthesized by the solid phase technique using 9-fluorenylmethoxycarbonyl (Fmoc) chemistry. C-terminal amides were prepared on Fmoc-PAL-PEG-PS resin (Perseptive Biosystems) and C-terminal acids on Fmoc-L-Leu-PAC-PS resin (Perseptive Biosystems). Fmoc deprotection was carried out using a solution of piperidine in DMF (20% v/v). Fmoc amino acid derivatives were activated in situ with either (N-[(dimethylamino}-lH-l,2,3-triazol[4,5-b]pyridin-l- ylmethylene-N-methylmethamirnium hexafluorophosphate-N-oxide (HATU; previously named 2-(lH-azatriazole-l-yl)-l,l,3,3-tetramethyl uronium hexafluorophosphate) or 2- (lH-benzotriazole-l-yl)-l,l,3,3-tetramethyl uronium hexafluorophosphate (HBTU) in the presence of N,N-diisopropylethylamine (DIEA). The side chain protection used was as follows: 2,2,4,6,7-pentamethyldihydrobenzofuran-5-sulphonyl (Pbf) for arginine, trityl for asparagine, glutamine and histidine, and tert-butyl for threonine, tyrosine and glutamic acid.
Deprotection and cleavage from the resin was carried out with TFA/water/thioanisole/l,2-ethanedithiol (EDT)/phenol (88.9 : 4.4 : 4.4 : 2.2 : 6.7 v/v/v/v/w), except for SB-277904 for which TFA water (95 : 5 v/v) was used. In each case, lyophilisation afforded a crude product, which consisted of one major component by analytical HPLC. b. Purification:
Purification of the crude products was carried out by reverse- phase preparative HPLC. Preparative HPLC separations were carried out on using a gradient system on a Spherisorb C-18 column (25 cm x 10 mm id) eluted at 4 ml/min, with detection at 214 nm and with eluents A = water/trifluoroacetic acid (TFA) (100 : 0.1 v/v) and B = acetonitrile/water/TFA (90 : 10 : 0.1 v/v). A linear gradient over 60 minutes from 1 % B to either 40, 50 or 60%B was used. All crude products were purified to >95% as shown by analytical HPLC. c. Analysis:
Peptide identities were confirmed by electrospray MS and purity by analytical HPLC. Analytical HPLC separations were carried out using a gradient system on a Spherisorb C-18 column (25 cm x 4.6 mm id) eluted at 1 ml/min, with detection at 214 nm and with eluents A = water/trifluoroacetic acid (TFA) (100 : 0.1 v/v) and B = acetonitrile/water/TFA (90 : 10 : 0.1 v/v).
P50946
Table 3
SEQ ID NO: Polynucleotide Sequence
SEQ ID NO:39 CGCCTCTACGAGCTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:40 GC (TCAG) CTCTACGAGCTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID N0:4 I CGCGC (TCAGTACGAGCTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:42 CGCCTCGC (TCAG) GAGCTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:43 CGCCTCTACGC (TCAG) CTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:44 CGCCTCTACGAGGC (TCAG) CTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:45 CGCCTCTACGAGCTGGC (TCAG) CACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:46 CGCCTCTACGAGCTGCTGGC (TCAG) GGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:47 CGCCTCTACGAGCTGCTGCACGC (TCAG) GCGGGCAATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:48 CGCCTCTACGAGCTGCTGCACGGCGCGGC (TCAG) AATCACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:49 CGCCTCTACGAGCTGCTGCACGGCGCGGGCGC (TCAG) CACGCGGCCGGCATCCTCACGCTG
SEQ ID NO:50 CGCCTCTACGAGCTGCTGCACGGCGCGGGCAATGC (TCAG) GCGGCCGGCATCCTCACGCTG
SEQ ID N0:51 CGCCTCTACGAGCTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCGC (TCAG) CTG
SEQ ID NO:52 CGCCTCTACGAGCTGCTGCACGGCGCGGGCAATCACGCGXXXGGCATCCTCACGCTG
SEQ ID NO:53 CGCCTCTACGAGCTGCTGCACGGCGCGGGCAATCACXXXGCCGGCATCCTCACGCTG
SEQ ID NO:54 CGCCTCCA (AG) GAGCTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
CGCCTCTAC [CG (TCAG) or AG (AG) ] CTGCTGCACGGCGCGGGCAATCACGCGGCCGGCATCCTCACGCTG
Example 13: Orexin-A in vivo Pain Studies: a. Mouse Carrageenan Induced Hyperalgesia Tests:
The objective of these experiments was to determine the effect of known and putative analgesics against carrageenan induced inflammation and hyperalgesia in the mouse hind paw, using a model of thermal hyperalgesia.
1. Background:
Lambda carrageenan, extracted from seaweed, when injected sub-plantar into the hind paw causes an inflammatory reaction and consequent swelling of the paw. This induces hyperalgesia, which can be determined using both thermal and mechanical procedures. The former was currently performed here. It is understood in the art that this condition mimics the effects of inflammatory states such as acute joint injury and arthritis. Coderre, et al, R. Brain Res 404:95-106 (1987); Hargreaves, et al, Pain 32:77-88 (1988).
2. Method/Procedure : Animals:
Female trtete ICR mice 20-30g (supplied by Harlan Olac)
Apparatus:
Ugo Basile Plantar Test (Milan, Italy) for assessment of thermal hyperalgesia -(Hargreaves method). Tolerated latencies of contact between foot and heat source were digitally recorded by apparatus in seconds.
Experimental Procedure or Surgery:
Behavioral test:
Animals were habituated to plantar apparatus for 4 days prior to first baseline reading. At least 1 day prior to carrageenan injection, second baseline latencies were obtained for the ipsilateral hind paw. The mice were sorted into groups of 15, giving approximately equal mean latencies. Only the second baseline latencies were used in experimental data analysis. On the day of the experiment, 25μl of 2% carrageenan was injected sub plantar into the left hind paw. 4 hours post-carrageenan, the animals were tested for thermal hyperalgesia in the ipsilateral paw. Experimental Design:
15 mice were used per test group. Baseline data was used to randomize mice into groups of approximately equal latencies prior to dosing. Animals were dosed in cage order, blind to the operator. Data Acquisition & Analysis:
The latencies were recorded in a LNB. The data were transferred to Excel. The data were transferred to Statistica, logged and tested for normality and ANOVA performed followed by post hoc Duncan's test (for normally distributed data) or Kruskal-Wallis followed by Mann-Whitney U test (for non-normal data). Drugs:
For PO dosing, the drugs were suspended in 1 % methyl Cellulose. For s.c, i.p., i.m., or intravenous (herein "i.v.") dosing, the drugs were normally dissolved in sterile 0.9% saline or another suitable solvent E.G. ethanol & tween 80 1-10% in saline. The dose volume is 1ml / lOOg. The drugs were encoded to enable 'blind' administration.
Activity Of Standard Drugs: Morphine active lOmg/kg s.c. Sumatriptan active 300ug/kg i.p. 3. Results: Table 4 shows the effect of Orexin-A (10 and 30 mg/kg i.v., 5 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model. Base=baseline latency, pre carrageenan, Test=latency 4 hours post carrageenan. Data are expressed as mean latency + sem. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 4
Orexin-A (i.v., 5 min pre-test) vehicle lOmg/kg 30mg/kg
Latency (s)
Base Test Base Test Base Test
14.00 4.80 8.10 3.50 10.20 9.10
5.60 5.00 12.10 2.30 15.60 6.30
13.30 2.30 4.70 9.90 11.90 22.30
10.50 10.10 13.80 6.70 8.30 5.90
8.60 4.30 14.90 7.70 7.70 7.50
16.10 2.50 10.10 11.30 15.00 22.30
7.30 3.10 9.80 5.60 6.70 22.30
13.10 1.40 10.40 17.10 12.20 12.20
7.90 2.50 8.40 4.80 16.20 18.00
8.10 2.70 17.30 15.80 10.00 8.20
6.00 2.30 6.80 4.60 8.50 13.10
10.20 2.80 10.80 9.30 8.90 4.50
9.50 5.50 5.50 10.60 10.20 13.70
17.20 2.40 15.40 5.40 7.30 8.90
10.40 2.20 6.70 5.00 5.60 22.30
9.10 1.60 9.30 1 1.10 13.20 8.00
Table 5 shows the effect of Orexin-A (10 and 30 mg/kg i.v., 5 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model. Data are expressed as mean % baseline + sem, where % baseline=latency post-test/latency pre-carrageenan for each mouse.
*p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test test compared to vehicle.
Table 5
Table 6 shows the effect of Orexin-A (3, 10 and 30 mg/kg i.v., 5 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model. Base=baseline latency, pre carrageenan, Test=latency 4 hours post carrageenan. Data are expressed as mean latency + sem. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 6
Table 7 shows the effect of Orexin-A (3, 10 and 30 mg/kg i.v., 5 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model. Data are expressed as mean % baseline + sem, where % baseline=latency post-test/latency pre-carrageenan for each mouse. p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test compared to vehicle.
Table 7
Table 8 shows the effect of morphine (2.5, 5 and 10 mg/kg s.c, 30 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model. Base=baseline latency, pre carrageenan, Test=latency 4hrs post carrageenan. Data are expressed as mean latency + sem. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 8
Morphine s.c, 30 min pre-test vehicle 2.5mg kg 5mg kg lOmg/kg
Latency (s)
Base Test Base Test Base Test Base Test
4.80 0.90 7.40 4.00 8.20 3.20 5.90 14.90
7.90 15.40 6.70 2.20 7.30 1.40 13.60 5.00
16.80 5.10 12.90 1.80 4.50 2.30 8.10 7.10
9.90 6.30 7.20 2.00 9.50 2.10 7.70 17.00
6.60 2.30 5.50 8.50 1 1.40 7.20 8.30 22.70
8.30 2.70 8.90 6.50 8.40 8.90 7.30 17.30
6.00 2.30 8.30 3.40 14.00 7.00 6.80 1 1.20
8.90 3.40 9.90 10.50 6.50 8.70 11.00 22.60
10.30 11.10 6.20 3.60 7.90 11.80 10.20 5.20
7.20 4.10 10.90 1.90 6.00 5.00 12.50 22.50
8.20 12.50 10.20 9.90 5.60 19.40 4.90 12.00
10.00 1.20 9.70 5.70 7.10 5.80 6.80 7.10
6.40 3.40 6.40 1 1.00 6.40 8.60 9.40 5.90
9.60 11.10 7.10 3.50 9.90 7.20 8.00 18.30
6.90 1.80 9.40 6.80 6.50 3.90 6.30 6.00
7.80 5.90 6.90 3.90 12.90 5.80 10.90 8.50
6.60 3.40 12.40 13.10 9.50 4.00 16.70 12.10
6.00 2.50 6.60 9.00 7.60 13.90 7.20 6.50
11.00 13.80 6.10 5.10 15.20 7.20 7.00 8.00
16.10 2.00 13.30 20.30 8.20 4.30 14.40 22.70 mean 8.38 5.75 8.60 6.64 8.63 6.89 9.15 12.63* sem 0.61 1.06 0.54 1.05 0.64 0.97 0.70 1.47
Table 9 shows the effect of morphine (2.5, 5 and 10 mg/kg s.c, 30 min pre-test) in the mouse carrageenan-induced thermal hyperalgesia model. Data are expressed as mean % baseline + sem, where % baseline=latency post-test/latency pre-carrageenan for each mouse. p<0.05, Kruskal-Wallis followed by post hoc Mann- Whitney U test compared to vehicle.
Table 9
4. Conclusions: These data demonstrate that in a model of inflammation-induced hyperalgesia, Orexin-A, given i.v., 5 min pre-test, consistently returns the latency to response to normal levels, indicating an anti-hyperalgesic effect of the peptide that is similar in efficacy to that of morphine. Efficacy in this model indicates that Orexin-A would be effective in treating conditions in humans, such as arthritis, chronic back pain, sports injuries, where hyperalgesia is present as a consequence of inflammation and may be of chronic duration. These data also indicate that Orexin-A would be effective in treating hyperalgesia in human due to other factors such as metabolic damage (e.g., painful diabetic neuropathy), viral infection (e.g., post herpetic neuralgia), traumatic nerve injury (e.g., causalgia), and cancer pain. b. Mouse and rat hot-plate tests:
The objective of these tests was to determine the effect of putative anti- nociceptives on thermal nociception in the mouse and rat.
1. Background:
This procedure, first developed by Woolfe & MacDonald in 1944(Woolfe, et al, J. Pharmacol. Exp. Ther. 120:52-57 (1944)), has generally been shown to be robust and reproducible in determining relative potencies of narcotic analgesics at doses approximately ten times higher than those used in humans. Nonsteroidal anti-inflammatory drugs (NSAIDs) prolong hot-plate latency only at toxic levels, and partial narcotic agonists or antagonists are inactive in the standard test, although O'Callaghan & Holzman were able to detect activity with pentazocine by dropping the hot-plate temperature to 49.5°C. O'Callaghan, et al, J. Pharmacol. Exp. Ther. 192(3):497-505 (1975).
2. Method/Procedure: Animals:
Male ICR mice 20-35g, Male Sprague-Dawley rats 250-350g (supplied by Charles River). Apparatus:
The animals were tested for anti-nociception on a Harvard analgesia meter calibrated by the following method: Initial Calibration:
Connect the hot-plate to the power supply. Plug the foots witch into the socket at the rear of the hot-plate and switch the hot-plate on. The green power indicator on the front panel will light up and the timer will start running. Stop the timer using the start/stop button and then reset it. Adjust the temperature set control to minimum and lock it in position. The hot-plare will now start to heat up. Leave the unit to stabilize for 15 min. and then note the temperature on the display (Fmin). Now, adjust the temperature set control to maximum, and lock it in position. Again allow the hot-plate to stabilize for 15 min. and then note the temperature on the display (Fmax). Now, substitute those figures into the following formula: Temperature = Fmin + ( Fmax - Fmin ) x Temp set.
Some fine adjustment may be required dependent on environmental conditions. This procedure is carried out at least once a month or if the hot-plate is moved to another part of the procedures room. Experimental Procedure or Surgery:
The animals were initially placed in groups of ten in 15 x 32 cm divided 'shoebox' type cages and were then left for 30 min. to acclimatize. The animals were then tail-marked and weighed. The drugs are then dosed blind and randomized throughout the groups.
The animals were dosed in groups of ten every ten minutes. The pre-treatment time varied normally between 15 and 180 min. After the pre-treatment time, the animals were confined individually within a perspex cylinder placed on the hot-plate normally set at 50- 55°C. Each animal was then observed for signs of nociception, i.e., fanning or licking of paws. When a response was observed, each animal was removed from the hot-plate. The latency to this response was recorded for analysis. Any animal failing to react by 40 seconds (for temperatures above 50°C) was removed from the hot-plate. For temperatures of 50°C and below, a cut-off time of 60 seconds was used.
The following i.c.v. procedure was used for the rat hot-plate tests. Otherwise, the rat hot-plate tests were conducted in the same way as the mouse hot-plate tests. Rat Intracerebral Drug Administration:
The obective of this procedure is to allow administration of substances directly into the cerebrospinal fluid (herein "csf ") of discrete brain areas of the rat via a chronically indwelling cannula. Method/Procedure : Animals:
Male, Sprague Dawley (250-350g, Charles River). Apparatus:
Guide cannula (22 GA, Cat. no. C313G, custom cut to 5mm below pedestal or purchased as standard and cutdown in-house), Dummy cannula (Cat no. C313DC, standard length and cut down in-house), internal cannula ("injection unit", 28 GA, Cat. no. C313I, custom cut to fit 5mm guide cannula with 1 mm projection or bought as standard and cut down in house) are obtained from Plastics One Inc., via Agents, SEMAT, 1 Executive Park, Hatfield Rd., St Albans, Herts, ALl 4TA. Portex polythene tubing (0.4mm ID, 0.8mm OD) was obtained from Fisons, UK. Screws and dental cement, are obtained through Vet. Section, Harlow. lOμl Hamilton syringes are obtained through Sigma, Poole, UK.
Guide cannulae, dummy cannulae and tubing were sterilized by exposure to ethylene oxide, while screws and surgical instruments were autoclaved. Surgery: Rats are housed overnight in the operating room. Anaesthesia consists of Domitor (i.m.)/sublimaze (i.p.) with intraepicaine used locally where appropriate. The eyes were treated with lacrilube to avoid excessive drying. Surgery was carried out using standard stereotaxic techniques and under aseptic conditions. Following anaesthesia and skull preparation, holes were drilled at the appropriate locations on the surface to allow the cannulae (unilateral) to be implanted and to allow placement of anchor screws (one on each skull plate) for a dental acrylic headcap to hold the guide cannula in position.
The sterotaxic co-ordinates for the lateral ventricles are (from intersection of bregma and midline):
(based on Paxinos, G and Watson, C. THE RAT BRAIN IN STEREOTAXIC COORDINATES. 2nd Edition, Academic Press, 1986.) Incisor bar set at -3.2mm Anterior-Posterior: -0.8mm
Lateral: +/- 1.5mm (i.e., cannula on left or right of the midline) Dorsal- ventral: -4.1mm (from skull surface).
The coordinates from other brain areas were determined from literature/atlas values and then confirmed via ink injection in at least two cadavers. An obturator (dummy cannula) was placed in the cannula to prevent blockages from occurring and to prevent loss of ventricular fluid. Anaethesia was reversed and analgesia provided by Antisedan/nubain. Animals were monitored throughout post-op recovary in a warm cage until the righting reflex was returned, whereupon they were singly housed. Animals received 5 days of postoperative care provided by LAS veterinary section. All surgical work conformed to LAS SOP 25 (Veterinary Procedures). Injection procedure:
The injection unit (previously stored in absolute ethanol) was rinsed in sterile saline and attached to a length of sterile Portex tubing. The injection unit was wiped with a Vetwipe to sterilize post handling. This tubing was flushed with sterile saline, filled and attached to a 10 μl Hamilton syringe. 1 μl of air was taken up to provide an air bubble to separate drug solution from saline. An appropriate volume of drug solution was drawn up into the tubing and the syringe is fixed into the Harvard 22 microinfusion pump programmed to pump at 5 μl/min for i.c.v. injections and between 0.25-1 μl/min for intracerebral injections. The rat was gently restrained and the dummy cannula removed. The injection unit was inserted into the guide cannula until it was completly flush with the top of the guide cannula and the rat was released. For i.c.v. injections, typically 5μl of drug was injected over a 60 second period, and the injection unit was left in place for up to 90 seconds to allow complete diffusion of the drug. The injection unit was removed and the dummy cannula replaced. Any remaining drug solution is discarded and the tubing was flushed with sterile saline and the injection unit cleaned with a Vetwipe. For intracerebral injections, the volume was no greater than 2 μl and prefereably <lμl. Typically, drug vehicle was sterile saline or PBS (pH 7.4), although when necessary, distilled water was used. Cannula Placement Verification:
An appropriate i.c.v. cannula placement was indicated by an intense dipsogenic response to 100 ng i.c.v. angiotensin II (All). To induce a dipsogenic effect, access was required to the All receptors located on cicurmventricular organs around the third ventricle (Simpson, et al., J. Comp. Phys. Psych. 92(4):581 (1978)). The time spent drinking for a 5 minute period post-All was recorded. This tends to be an all-or-nothing effect , but rats spend on average 150 seconds drinking. Failure to drink (<10s) on at least two separate occasions suggests an incorrectly placed cannula. Verification of other cannula placements may require injection of cresyl violet under terminal anaesthesia and sectioning of the brain. Drugs:
Angiotensin II human octapeptide 100 ng i.c.v. in 5 μl sterile saline (Bachem, UK) Data Acquisition and Analysis:
The latencies were recorded on a results sheet. The data were transferred to Excel and the following formula were used to obtain % maximum possible effect:
% MPE= (T - C)/(CT-C)xl00. where T = test latency(s), C = control mean (s), CT=cut off time (40 or 60 s)
The data were transferred to Statistica, logged and tested for normality and ANOVA performed followed by post hoc Duncan's test (for normally distributed data) or Kruskal-Wallis followed by Mann-Whitney U test (for non-normal data). Drugs:
For PO dosing, the drugs were suspended in 1% methylcellulose. For s.c, i.p., i.m., or i.v. dosing, the drugs were normally dissolved in sterile 0.9% saline or another suitable solvent, e.g., ethanol & tween 80 1-10% in saline. The dose volume was 1 ml / lOOg. The drugs were coded to enable 'blind' administration. Doses are expressed as free base. Activity Of Standard Drugs: Morphine HC1
ED50 = 4.83 mg/kg s.c. pre-treatment time 30 min. 3. Results: Table 10 shows the effect of Orexin-A (0.1, 0.3, 1, 3, 10 and 30 mg/kg i.v., 5 min pre-test) in the mouse 50°C hotplate. Data are expressed as mean latency + sem, . p<0.05, Kruskal-Wallis followed by post hoc mann-Whitney U test compared to vehicle. Table 10
Table 11 shows the effect of Orexin-A (0.3, 1, 3, 10 and 30 mg/kg i.v., 5 min pretest) in the mouse 50°C hotplate. Data are expressed as mean % Maximum Possible Effect (%MPE) + sem, where %MPE=((test latency-mean vehicle latency)/(cut off time (60 s)- mean vehicle latency))x 100. p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test compared to vehicle. Table 11
Table 12 shows the effect of naloxone (10 mg/kg i.p., 30 min pre-test) vs. Orexin-A (30 mg/kg i.v., 5 min pre-test) in the mouse 50°C hotplate. Data are expressed as mean latency ± sem. p<0.05, Kruskal-Wallis followed by post hoc Mann- Whitney U test compared to vehicle. Table 12
Table 13 shows the effect of naloxone (10 mg/kg i.p., 30 min pre-test) vs. Orexin-A (30 mg/kg i.v., 5 min pre-test) in the mouse 50°C hotplate. Data are expressed as mean % Maximum Possible Effect (%MPE) + sem, where %MPE=((test latency-mean vehicle latency )/(cut off time (60 s)-mean vehicle latency ))x 100. p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test compared to vehicle. Table 13
Table 14 shows the effect of Orexin-A (1 , 3, 10 and 30 mg/kg i.v., 5 min pre-test in the mouse 55°C hotplate. Data are expressed as mean latency + sem. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 14
Table 15 shows the effect of Orexin-A (1, 3, 10 and 30 mg/kg i.v., 5 min pre-test in the mouse 55°C hotplate. Data are expressed as mean % Maximum Possible Effect (%MPE) + sem, where %MPE=((test latency-mean vehicle latency)/(cut off time (40 s)- mean vehicle latency))x 100. p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test compared to vehicle. Table 15
Table 16 shows the effect of Orexin-A (3, 10 and 30 μg) i.c.v., 5 min pre-test in the rat 50°C hotplate. Data are expressed as mean latency + sem. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 16
Table 17 shows the effect of Orexin-A (3, 10 and 30 μg) i.c.v., 5 min pre-test in the rat 50°C hotplate. Data are expressed as mean % Maximum Possible Effect (%MPE) + sem, where % MPE=((test latency-mean vehicle latency )/(cut-off time (60 s)-mean vehicle latency))x 100. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 17
Table 18 shows the effect of Orexin-A (15-33) truncate (SEQ ID NO:23) (1, 3, 10 and 30 mg/kg i.v., 5 min pre-test in the mouse 50°C hotplate. Data are expressed as mean latency + sem. p<0.05, ANOVA followed by post hoc Duncan's test compared to vehicle. Table 18
iv. Conclusions:
In a mouse model of thermal nociception, Orexin-A consistently increases the latency to response, indicating an anti-nociceptive effect. This effect is not blocked by the opiate antagonist, naloxone, indicating that the anlagesic effect of Orexin-A has no involvement with opiate receptors. Orexin-A is also analgesic against higher noxious temperatures in mice and is also effective when given by the i.c.v. route in rats (see Tables 16 and 17), demonstrating that its effects are not confined to one species. These data indicate that Orexin-A would be an effective analgesic in humans in conditions where acute injury is present, such as post-operatively, and reinforces its potential for use in conditions such as arthritis, chronic back pain, sports injuries.
Furthermore, the data set forth in Table 18 shows that the Orexin-A (15-33) truncate (SEQ ID NO:23) demonstrates an anti-nociceptive effect in the mouse hot-plate test. These data indicate that the Orexin-A (15-33) truncate (SEQ ID NO:23) would be an effective analgesic in humans in conditions where acute injury is present, such as post- operatively, and for use in conditions such as arthritis, chronic back pain, sports injuries. These data showing the anti-nociceptive effects of the Orexin-A (15-33) truncate in this model of thermal nociception indicate that other Orexin-A truncates and variants, such as those set forth in Table 2 (SEQ ID NOs:24-38) would have similar activity and therapeutic utility. c. Nociception: Abdominal Constriction in the Mouse (MAC):
The objective of the MAC test is to determine the effect of putative anti- nociceptives in a model of chemically induced nociception in the mouse. 1. Background:
The i.p injection of mice with a solution of P.P.Q. elicits a response (abdominal constriction) that is antagonized by the weaker anti-nociceptive agents. Siegmund, et al, Proc. Soc. Exp. Biol, NY. 95:729 (1957); Eckhardt, et al, Proc. Soc. Exp. Biol N.Y. 98:186 (1958); Carroll, et al, Fed. Proc. 17:357 (1958). The abdominal constriction is characterized by repeated contraction of the abdominal musculature accompanied by extension of the hind legs. Interest in the model is based on the idea that it may help to relieve the lack of reliable tests for weak anti-nociceptives. The test that we utilized is a modified version of the standard mouse abdominal constriction model, whereby we record the latency to first constriction, rather than the number of constrictions.
2. Method/Procedure : Animals:
Male Olac ICR mice 20-35g (supplied by Harlan Olac) Apparatus:
One perspex observation box was divided into 5 compartments. The back of the observation box and the divisions between compartments were coated with a red plastic film, the box was lit from above by an angle poise lamp and the room was darkened. These measures were taken to minimise visual disturbance. All procedures were to be carried out in a 'quiet' procedures room. Experimental Procedure or Surgery:
The mice were initially placed in groups of five in 15 x 32 cm divided 'shoebox' type cages and are then left for 30 min. to acclimatize. The mice were then tail-marked and weighed. The drugs were then dosed blind and randomized throughout the groups. The mice were dosed in groups of five every fifteen minutes. The pre-treatment time varied normally between 15 and 180 min. The mice were then dosed with P.P.Q. 2.5mg/kg i.p. prepared as follows. 12.5 mg of phenyl-p-quinone was weighed into an econoglass 25 ml vial and dissolved in 2.5 ml of ethanol. The vial was placed inside a 100ml brown glass sample bottle and left in a water bath set at 37.5 °C. 47.5 ml of sterile distilled water was put into another 100 ml brown glass sample bottle and placed in the water bath. When the distilled water reached 37.5°C ,and the p.p.q. was fully dissolved, the two were mixed. To prevent the solution from turning milky, the p.p.q. was added to the water. The mice were dosed with the p.p.q. 10 seconds apart and placed in numbered compartments of the observation box. A stopwatch was started when the first mouse of each group of five was dosed. The mice were then observed, and the time to first abdominal contraction for each mouse was recorded. After its first contraction, each mouse was euthanized. As the mice had staggered dosing times, a number of seconds was subtracted from the time recorded from the stopwatch for mice 2 to 5 in each group 10 s from number 2 , 20 from 3, 30 from 4 and 40 from 5. The final latencies were then converted into seconds. Any mouse not reacting within 10 minutes was euthanized and assigned a time of 600 seconds. Experimental Design: Data Acquisition and Analysis:
The latencies were recorded on a results sheet. The data were transferred to Excel and the following formula was used to obtain % maximum possible effect (%MPE):
% MPE= (T - C)/(CT-C)x 100. where T = test latency(s), C = control mean (s), CT=cut off time (600s)
The data were transferred to Statistica, logged and tested for normality and ANOVA performed followed by post hoc Duncan's test (for normally distributed data) or Kruskal- Wallis followed by Mann- Whitney U test (for non-normal data). Drugs:
P.P.Q. was obtained from Sigma (Poole, UK). For PO dosing, the drugs were suspended in 1% methyl cellulose. For s.c, i.p., i.m., or i.v. dosing, the drugs were normally dissolved in sterile 0.9% saline or another suitable solvent E.G. ethanol & tween 80 1-10% in saline. The dose volume was 1ml / lOOg. The drugs were coded to enable "blind' administration. Doses are expressed as free base. Activity Of Standard Drugs:
Morphine HC1 0.53 mg/kg s.c. pre-treatment time 30 min. 3. Results: Table 19 shows the effect of Orexin-A (3, 10 and 30 mg/kg i.v., 5 min pre-test) in the MACmodel. Data are expressed as mean latency + sem. p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test test compared to vehicle. Table 19
Table 20 shows the effect of Orexin-A (3, 10 and 30 mg/kg i.v., 5 min pre-test) in the MAC model. Data are expressed as mean % Maximum Possible Effect (% MPE) + sem, where %MPE=((test latency-mean vehicle latency)/(cut off time (600 s)-mean vehicle latency))x 100. p<0.05, Kruskal-Wallis followed by post hoc Mann-Whitney U test compared to vehicle. Table 20
iv. Conclusions: In a model of acute inflammation/visceral pain, Orexin-A increased the latency to response towards cut-off levels, effectively abolishing the response to P.P.Q. These data indicate that Orexin-A would be an effective treatment in humans for acute inflammatory conditions, as well as for pain arising from the viscera, e.g.,: angina, irritable bowel syndrome (IBS), and inflammatory bowel disease. All publications including, but not limited to, patents and patent applications, cited in this specification, are herein incorporated by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein as though fully set forth.
The above description fully discloses the invention, including preferred embodiments thereof. Modifications and improvements of the embodiments specifically disclosed herein are within the scope of the following claims. Without further elaboration, one skilled in the art can, using the preceding description, utilize the present invention to its fullest extent. Therefore, the examples provided herein are to be construed as merely illustrative and are not a limitation of the scope of the present invention in any way. The embodiments of the invention in which an exclusive property or privilege is claimed are defined as follows.

Claims

What is claimed is:
1. An isolated polynucleotide selected from the group consisting of:
(i) an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide having at least a 95% identity to an amino acid sequence selected from the group consisting of: SEQ ID NOs:22-38, over the entire length of said amino acid sequence;
(ii) an isolated polynucleotide comprising a polynucleotide sequence having at least a 95% identity over its entire length to a nucleotide sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:22-38; (iii) an isolated polynucleotide comprising a polynucleotide sequence having at least a 95% identity to a polynucleotide sequence selected from the group consisting of: SEQ ID NOs: 39-54 over the entire length of said polynucleotide sequence; (iv) an isolated polynucleotide comprising a polynucleotide sequence encoding a polypeptide selected from the group consisting of: SEQ ID NOs:22-38; (vi) an isolated polynucleotide that is a polynucleotide selected from the group consisting of: SEQ ID NOs:39-54; or
(vi) an isolated polynucleotide with a nucleotide sequence of at least 100 nucleotides in length obtained by screening an appropriate library under stringent hybridization conditions with a labeled probe having a sequence selected from the group consisting of: SEQ ID NOs:39-54 or a fragment thereof of at least 15 nucleotides; or a nucleotide sequence complementary to said isolated polynucleotide.
2. An isolated polypeptide selected from the group consisting of:
(i) an isolated polypeptide having at least a 95% identity to an amino acid sequence selected from the group consisting of: SEQ ID NOs:22-38 over the entire length of said amino acid sequence;
(ii) an isolated polypeptide comprising an amino acid sequence selected from the group consisting of: SEQ ID NOs:22-38; or
(iii) an isolated polypeptide that is an amino acid sequence selected from the group consisting of: SEQ ID NOs:22-38.
3. An expression system comprising a polynucleotide capable of producing a polypeptide of Claim 2 when said expression system is present in a compatible host cell.
4. A process for producing a recombinant host cell comprising the step of introducing the expression vector of Claim 3 into a cell, such that the host cell, under appropriate culture conditions, produces a polypeptide of Claim 2.
5. A recombinant host cell produced by the process of Claim 4.
6. A membrane of a recombinant host cell of Claim 5 expressing a polypeptide of Claim 2.
7. A process for producing a polypeptide comprising culturing a host cell of Claim 5 under conditions sufficient for the production of said polypeptide and recovering the polypeptide from the culture.
8. A method for identifying an agonist or antagonist of the interaction between a human HFGAN72 receptor polypeptide and a Lig 72A variant polypeptide, said method comprising the steps of:
(a) in the presence of a labeled or unlabeled Lig 72A variant polypeptide selected from the group consisting of: SEQ ID NOs:22-38, contacting a cell expressing on the surface thereof a human HFGAN72 receptor polypeptide (preferably that of SEQ BO NO: 13), said human HFGAN72 receptor polypeptide being associated with a second component capable of providing a detectable signal in response to the binding of said ligand, with a compound to be screened under conditions to permit binding to said human HFGAN72 receptor polypeptide; and
(b) determining whether the compound binds to and activates or inhibits the human HFGAN72 receptor polypeptide by measuring the level of a signal generated from the interaction of the compound with the Lig 72A variant polypeptide.
9. An agonist identified by the method of Claim 8.
10. An antagonist identified by the method of Claim 8.
11. A method for the treatment of a subject in need of enhanced activity of Lig 72A or a variant thereof comprising administering to the subject a therapeutically effective amount of a polypeptide selected from the group consisting of: SEQ ID NOs:4 and 22-38 in combination with a carrier.
12. The method of Claim 11, wherein the subject is suffering from a disease or disorder associated with pain selected from the group consisting of: enhanced or exaggerated sensitivity to pain; hyperalgesia; causalgia; allodynia; acute pain; bum pain; atypical facial pain; neuropathic pain; back pain; complex regional pain syndromes I and II; arthritic pain; sports injury pain; pain related to viral infection; post-polio syndrome; post-herpetic neuralgia; phantom limb pain; labor pain; cancer pain; post-chemotherapy pain; post-stroke pain; post-operative pain; physiological pain; inflammatory pain; acute inflammatory conditions; viseral pain; angina; irritable bowel syndrome; inflammatory bowel disease; neuropathic pain; painful diabetic neuropathy; neuralgia; traumatic nerve injury; and tolerance to narcotics or withdrawal from narcotics.
13. A method for the treatment of a subject in need of enhanced activity of Lig 72A or a variant thereof, comprising administering to the subject a therapeutically effective amount of an antagonist of Claim 10 in combination with a carrier.
14. A method for the treatment of a subject in need of reduced activity of Lig72A or a variant thereof, comprising administering to the subject a therapeutically effective amount of an agonist of Claim 9 in combination with a carrier.
15. An antibody against the interaction of a Lig 72A variant and a human HFGAN72 receptor, wherein said Lig 72A variant is a polypeptide of Claim 2.
16. A method for the treatment of a subject having need to inhibit interaction of a Lig 72A variant and a human HFGAN72 receptor, comprising administering to the patient a therapeutically effective amount of an antibody of Claim 15.
EP00946845A 1999-06-25 2000-06-22 Methods of treatment using lig 72a and variants thereof Withdrawn EP1190089A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US14115699P 1999-06-25 1999-06-25
US141156P 1999-06-25
PCT/US2000/017251 WO2001000787A2 (en) 1999-06-25 2000-06-22 Methods of treatment using lig 72a and variants thereof

Publications (2)

Publication Number Publication Date
EP1190089A2 true EP1190089A2 (en) 2002-03-27
EP1190089A4 EP1190089A4 (en) 2002-10-16

Family

ID=22494432

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00946845A Withdrawn EP1190089A4 (en) 1999-06-25 2000-06-22 Methods of treatment using lig 72a and variants thereof

Country Status (2)

Country Link
EP (1) EP1190089A4 (en)
WO (1) WO2001000787A2 (en)

Families Citing this family (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20030022277A1 (en) * 1995-05-05 2003-01-30 Daniel R. Soppet Human neuropeptide receptor
WO2004071395A2 (en) * 2003-02-17 2004-08-26 Bayer Healthcare Ag Diagnostics and therapeutics for diseases associated with g protein-coupled receptor ox1r (ox1r)
JP6697403B2 (en) * 2014-06-24 2020-05-20 アンスティチュ ナショナル ドゥ ラ サンテ エ ドゥ ラ ルシェルシュ メディカル Methods and pharmaceutical compositions for the treatment of inflammatory bowel disease
WO2017194548A1 (en) 2016-05-10 2017-11-16 INSERM (Institut National de la Santé et de la Recherche Médicale) Methods and pharmaceutical compositions for the treatment of autoimmune inflammatory diseases
WO2019209800A1 (en) * 2018-04-23 2019-10-31 The Trustees Of Columbia University In The City Of New York Fluid responsive devices and methods
JPWO2023199893A1 (en) * 2022-04-11 2023-10-19

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6309854B1 (en) * 1996-12-17 2001-10-30 Smithkline Beecham Corporation Polynucleotides encoding ligands of the neuropeptide receptor HFGAN72
JP2003527302A (en) * 1997-12-15 2003-09-16 スミスクライン ビーチャム パブリック リミテッド カンパニー Novel neuropeptide receptor HFGAN72 ligand and therapeutic method using agonist or antagonist thereof

Also Published As

Publication number Publication date
WO2001000787A3 (en) 2002-01-24
WO2001000787A2 (en) 2001-01-04
EP1190089A4 (en) 2002-10-16

Similar Documents

Publication Publication Date Title
JP2003024085A (en) Tumor necrosis-related receptor tr7
JPH10201492A (en) CDNA clone HE8CS41 encoding a novel 7-transmembrane receptor
JP2000078995A (en) Tumor necrosis factor receptor-associated protein tr5
WO2001000787A2 (en) Methods of treatment using lig 72a and variants thereof
EP1037655B1 (en) use of novel ligands of the neuropeptide receptor hfgan72 and antagonists thereof in therapy
JPH10337189A (en) New compound
WO2000064928A2 (en) Transmembrane (7tm) receptor r35)
JP2002223780A (en) Human 7 tm receptor similar to mouse frizzled-6 gene
JPH10210993A (en) CDNA clone HE8CH90 encoding a novel 7-transmembrane receptor
GB2373501A (en) GPR58a
US20020143149A1 (en) Seven trans-membrane receptor-Fitz2
WO2000064942A1 (en) Axor-27, a g-protein coupled receptor
JPH11206391A (en) Human lig-1 homologue (hlig-1)
WO2002088355A1 (en) Novel guanosine triphosphate-binding protein-coupled recepotr place 6002312 and its gene and production and use of the same
EP1226247A1 (en) Human gpr27-like g-protein coupled receptor polypeptide and polynucleotide sequences
AU2001283930B2 (en) Novel g-protein coupled receptor
GB2371301A (en) G protein coupled receptors
GB2367295A (en) AXOR69 polypeptides and polynucleotides
GB2371546A (en) G protein coupled receptor AXOR 109
GB2367822A (en) CD97 polypeptides
WO2001061003A1 (en) The human homologue of flamingo
GB2368065A (en) AXOR52, a NPY-like G protein coupled receptor
CA2412521A1 (en) Thyrotropin-releasing hormone receptor-like gpcr (gprfwki)
WO2001025280A1 (en) Paul, a g-protein coupled receptor
WO2001068665A1 (en) Human histamine h3 gene variant-1

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20011214

AK Designated contracting states

Kind code of ref document: A2

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: SMITHKLINE BEECHAM PLC

Owner name: SMITHKLINE BEECHAM CORPORATION

A4 Supplementary search report drawn up and despatched

Effective date: 20020829

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20070205

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20070817