EP1179083A1 - Triple hybrid amplicon vector systems to generate retroviral packaging lines - Google Patents
Triple hybrid amplicon vector systems to generate retroviral packaging linesInfo
- Publication number
- EP1179083A1 EP1179083A1 EP00923545A EP00923545A EP1179083A1 EP 1179083 A1 EP1179083 A1 EP 1179083A1 EP 00923545 A EP00923545 A EP 00923545A EP 00923545 A EP00923545 A EP 00923545A EP 1179083 A1 EP1179083 A1 EP 1179083A1
- Authority
- EP
- European Patent Office
- Prior art keywords
- cells
- retrovirus
- vector
- gene
- amplicon
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13041—Use of virus, viral particle or viral elements as a vector
- C12N2740/13043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/13011—Gammaretrovirus, e.g. murine leukeamia virus
- C12N2740/13051—Methods of production or purification of viral material
- C12N2740/13052—Methods of production or purification of viral material relating to complementing cells and packaging systems for producing virus or viral particles
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
Definitions
- the present invention relates to triple hybrid amplicon vector constructs comprising elements from Herpes Simplex virus (HSV), Epstein-Barr virus (EBV) or Adeno-Associated Virus (AAV), and retrovirus.
- the hybrid amplicon vectors of the present invention are capable of transforming dividing and non-dividing cells into retroviral packaging cells in a single step, which can be mediated in vitro or in vivo. Because the vector system of the present invention can convert cells in vivo to packaging cells, it creates, in vivo, a self-sustained gene delivery system.
- gene transfer and "gene therapy” have been used to describe a variety of methods for delivering genetic material to a cell using viral or non- viral based vector systems. Substantial attention has been given to human gene therapy. The transfer of genetic material to a cell may one day become one of the most important forms of medicine. A variety of public and private institutions now participate in research and development related to the use of genetic material in therapeutic applications. Hundreds of human gene transfer protocols are being conducted at any given time with the approval of the Recombinant DNA Advisory Committee (RAC) and the National Institutes of Health (NIH). Most of these protocols focus on therapy, while others involve marking and non-therapeutic applications. The therapeutic protocols are primarily concerned with infectious diseases, monogenic diseases, and cancer.
- Gene-based therapies are now expanding into fields such as cardiovascular disease, autoimmune disease, and neurodegenerative disease.
- the availability of an efficient gene delivery and expression system is.essential to the success and efficacy of gene-based therapy.
- One method of delivering a gene of interest to a target cell of interest is by using a viral-based vector.
- Techniques for the formation of vectors or virions are generally described in "Working Toward Human Gene Therapy," Chapter 28 in Recombinant DNA, 2nd Ed., Watson, J.D. et al, eds., New York: Scientific American Books, pp. 567-581 (1992).
- An overview of viral vectors or virions that have been used in gene therapy can be found in Wilson, J.M.. Clin. Exp.
- Such vectors may be derived from viruses that contain RNA (Vile, R.G., et al. , Br. Med
- viral vector systems include: retroviruses (Vile, R.G., supra; U.S. Patent Nos. 5,741,486 and 5,763,242); adenoviruses (Brody, S.L., etal. Ann. N. Y. Acad. Sci. 716: 90-101 (1994); Heise, C. etal, Nat. Med. 5:639-645 (1997)); adenoviral/retroviral chimeras (Bilbao, G., et al, FASEB J. 77:624-634 (1997); Feng, M., et al, Nat.
- retroviruses Vile, R.G., supra; U.S. Patent Nos. 5,741,486 and 5,763,242
- adenoviruses Brody, S.L., etal. Ann. N. Y. Acad. Sci. 716: 90-101 (1994); Heise, C. etal, Nat. Med
- Biotechnol 75:866- 870 (1997)); adeno-associated viruses (Flotte, T.R. and Carter, B.J., Gene Ther. 2:357-362 (1995); U.S. Patent No. 5,756,283); herpes simplex virus I or II (Latchman, D.S., o/. Biotechnol. 2:179-195 (1994); U.S. Patent No. 5,763,217; Chase, M., et al, Nature Biotechnol. 7(5:444-448 (1998)); parvovirus (Shaughnessy, E., etal, Semin Oncol. 25:159-171 (1996)); reticuloendotheliosis virus (Donburg, R., Gene Therap.
- viruses that can be used as vectors for gene delivery include poliovirus, papillomavirus, vaccinia virus, lentivirus, as well as hybrid or chimeric vectors incorporating favorable aspects of two or more viruses (Nakanishi, M., Crit. Rev. Therapeu. Drug Carrier Systems 72:263-310 (1995); Zhang, J., et ⁇ /., Cancer Metastasis Rev. 75:385-401 (1996); Jacoby, D.R., et al, Gene Therapy 4:1281-1283 (1997)).
- Guidance in the construction of gene therapy vectors and the introduction thereof into affected animals for therapeutic purposes may be obtained in the above-referenced publications, as well as U.S. Patent Nos. 5,631,236, 5,688,773, 5,691,177, 5,670,488, 5,529,774, 5,601,818, and WO 95/06486.
- retroviruses have the ability to infect cells and have their genetic material integrated into the host cell with high efficiency.
- the development of a helper virus free packaging system for retrovirus vectors was a key innovation in the development of this vector system for human gene therapy.
- Retroviral helper virus free packaging systems generally employ the creation of a stable producer cell line that expresses a selected vector.
- the relatively small size of the retroviral genome (approximately 11 kb), and the ability to express viral genes without killing cells, allows for the production of a packaging cell line that synthesizes all the proteins required for viral assembly.
- Producer lines are made by introducing the retroviral vector into such a packaging cell line.
- retroviral vectors are not capable of gene transfer to postmitotic (nondividing) cells and thus are not applicable to the nervous system because most of the cells in the adult nervous system, especially neurons, are quiescent or postmitotic.
- outbreaks of wild-type virus from recombinant virus-producing cell lines have also been reported, with the vector itself causing a disease.
- Adenovirus vectors can only support limited long-term (2 months) gene expression, they appear to be gradually lost from neural cells, and moreover, they can cause both cytopathic effects and an immune response (Le Gal La Salle, G., et al, Science 259:988-990 (1993); Davidson et al, Nat. Genet. 5:219-223 (1993); Yang, Y., et al, J. Virol. (59:2004-2015 (1995)).
- Adeno-associated virus vectors cause minimal cytopathic effects and can support at least some gene expression for up to 4 months, but gene transfer is inefficient and these vectors can accept only about 4 kb of foreign DNA (Kaplitt, M.G., et al. , Nat. Genet. 8: 148-154 (1994)).
- HSV herpes simplex virus
- HSV-1 herpes simplex virus
- the virus has a very large genome and thus can accommodate large amounts of foreign DNA (greater than 30 kb)
- the virus can persist long-term in cells, and can efficiently infect many different cell types, including post-mitotic neural cells (Breakefield, X.O., et al. "Herpes Simplex Virus Vectors for Tumor Therapy," in The Internet Book of Gene Therapy: Cancer Gene Therapeutics, R.E. Sobol and K.J. Scanlon, eds., Appleton and Lange. Stamford, CT, pp. 41-56 (1995); Glorioso, J.C., et al, "Herpes Simplex Virus as a Gene-Delivery Vector for the
- HSV-1 vector systems Two types are known: recombinant and amplicon. Recombinant HSV-1 vectors (Wolfe, J. H. et al, Nat. Genet. 7:379-
- HSV- 1 amplicons are bacterial plasmids containing only about 1% of the 152 kb HSV-1 genome. They are packaged into HSV-1 particles (virions) using HSV-1 helper virus. HSV-1 amplicons contain: (i) a transgene cassette with a gene of interest; (ii) sequences that allow plasmid propagation in E.
- HSV amplicon vectors are one of the most versatile, most efficient, and least toxic, and have the largest transgene capacity of the currently available virus vectors. HSV- 1 amplicon vectors can support some gene expression for up to one year in non-dividing cells (During. M.J., et al, Science 2(5(5: 1399-1403 (1994)).
- HSV-1 encodes many toxic functions
- improvements on the amplicon system have been targeted at reducing the risk associated with the helper virus.
- replication-competent HSV-1 initially used as helper virus, was replaced by a temperature-sensitive (ts) mutant of HSV-1 (HSV-1 tsK; Preston, C, J. Virol. 29:257-284 (1979)).
- This mutant encodes a temperature-sensitive form of the essential HSV-1 infected cell protein (ICP) 4, allowing HSV-1 replication to proceed at 31 °C, but not at 37 °C.
- Amplicons packaged at 31 °C in the presence of HSV-1 tsK were successfully used to transfer the E coli lacZ gene into primary cultures of rat neural cells (Geller, A.I.
- HSV-1 tsK helper virus present in the vector stock was blocked and cell damage was limited.
- replication of HSV-1 tsK was inhibited at the restrictive temperature, the expression of other viral genes caused cytopathic effects.
- reversion to wild type (wt) HSV-1 occurred at a relatively high frequency, due to remaining functionality and reversion of the point mutation in tsICP4.
- replication-defective mutants of HSV-1 were then used as helper viruses (Geller, A.I. et al , Proc. Natl. Acad. Sci.
- helper virus in amplicon stocks many problems associated with the presence of helper virus in amplicon stocks still remained, including: (i) pronounced cytopathic effects and immune responses caused by gene expression from the helper virus; (ii) interactions between the helper virus and endogenous viruses; (iii) reversion of the helper virus to wt HSV-1 ; and (iv) disregulation of transgene expression by virus proteins.
- Patent Publication WO 97/05263, published February 13, 1997) utilizes transient co-transfection of amplicon DNA with a set of five cosmids that overlap and represent the entire HSV-1 genome, but which are mutated to delete the DNA cleavage/packaging (pac) signals.
- pac DNA cleavage/packaging
- HSV- 1 genomes that are potentially reconstituted from the cosmids via homologous recombination are not packageable, but can still provide all the helper functions required for the replication and packaging of the co-transfected amplicon DNA.
- the resulting vector stocks are, therefore, virtually free of detectable helper virus and have titers of 10 6 - 10 7 tu./ml of culture medium. Because of minimal sequence homology between the cosmids and the amplicon DNA (ori s ; 0.2 - 1 kb), the formation of a packageable and replication-competent HSV- 1 genome is possible but requires 6 recombination events, and is therefore very rare.
- Amplicon vector stocks produced by using the helper virus-free packaging system, can efficiently transduce many different cell types, including neural cells and hepatocytes in culture and in vivo, while causing minimal to no cytopathic effects (Fraefel, C, et al, J. Virol 70:7190-7197 (1996); Fraefel, C, et al, Mol Med. 5:813-825 (1997); Fraefel. C, et al, "HSV-1 Amplicon" in Gene Therapy or Neurological Disorders and Brain Tumors, E.A. Chiocca and X.O. Breakefield, eds., Humana Press. Totowa, pp.
- helper virus-free packaging has also been achieved using an oversized pac minus HSV genome, defective in an essential gene encoding ICP27, cloned into a B AC plasmid (Saeki, Y., et al, Hum Gene Ther 9:2787-2794 (1998).
- One of the main objectives of gene therapy is to achieve stable genetic modification of target cells. This means that their progeny, or themselves in the case of non-dividing cells, should retain and express the newly introduced genetic material until the end of their lifespan, ideally in a regulated manner. This principle is equally valid when transgenes are introduced to correct genetic deficiencies or for treatment of non-hereditary diseases.
- the viral vector systems discussed above can achieve retention of the transgene through different mechanisms. For example, retrovirus and AAV vectors can integrate genes into the genome of infected cells, while EBV- derived vectors are maintained by episomal replication.
- Moloney murine leukemia virus (MoMLV) derived retrovirus vectors are among the most commonly used vectors in gene therapy because of their ability to stably integrate transgenes in the genome of target cells, as well as their relative safety, simplicity, and easy production.
- their use for direct gene delivery in vivo has been limited due to several factors which result in low efficiency of gene transfer. These properties include: low titer, inability to infect non-dividing cells, limited tropism, and relatively short half-life.
- MoMLV-based retrovirus vectors are still mostly used for ex vivo protocols. These strategies involve removal of the target cells from the experimental subject or use of donor cells, genetic modification in culture by infection with retrovirus vectors carrying the transgene of interest, selection and characterization of transduced cells, and implantation of these cells in vivo.
- retrovirus packaging cells remain localized near the injection site, resulting in a very low efficiency of gene delivery to tumor cells, limited to areas in the immediate vicinity of the packaging cells (Ram, Z., et al, Nature Med. 752: 1354-1361 (1997)).
- retrovirus packaging cells used are derived from mouse fibroblasts has several disadvantages and potential risks (Isacson, O. and X. O.
- the retrovirus particles produced are extremely sensitive to inactivation by human serum via complement activation. This occurs because non- primate packaging cells add a Gal( ⁇ l-3)galactosyl group to the retroviral envelope and human serum has pre-existing antibodies against that sugar group
- Noguiez-Hellin et al. generated retrovirus producing cells in situ by transfection with a plasmid carrying all necessary functions for retrovirus packaging and vector generation (Noguiez-Hellin, P., et al, Proc. Natl. Acad. Sci. USA 95:4175-4180 (1996)).
- retroviral vectors take advantage of the efficient gene delivery and expression mediated by other types of viral vectors, such as those derived from herpes simplex virus (HSV) (Savard, N., et al, J.
- HSV herpes simplex virus
- gag-pol and env genes are encoded in the same vector (Feng, M., et al, Nature Biotechnol. 75:866-870 (1997); Lin, X., Gene Ther. 5:1251-1258 (1998); Savard, N., et al, J. Virol. 77:41 11-4117 (1997)), or the env gene is delivered by a separate vector
- HSV amplicons are plasmid-based vectors that, in addition to a transgene of interest and corresponding expression elements, only need two non-coding HSV sequences, the origin of DNA replication (ori ) and a packaging signal (a sequence), to be packaged in HSV virions in the presence of helper functions (Spaete, R. R. and N. Frenkel, Cell 50:295-304 (1982)). These virions can infect a wide range of dividing and non-dividing cells, and with the development of the HSV helper virus-free packaging systems, discussed above, have essentially no toxicity. HSV virions package about 150 kb of DNA.
- the amplicon DNA is packaged as a concatamer approximately that size, containing multiple copies of the plasmid repeated in tandem, due to a rolling circle mode of viral DNA replication.
- HSV amplicon vectors has been the loss of amplicon DNA from the host cell nucleus over time, and therefore of gene expression. This is especially true in dividing cells (Johnston, K. M, et al, Hum. Gene Ther. 5:359-370 (1997)).
- the first is an HSV/EBV hybrid amplicon, which includes two EBV elements in its backbone:(l) the latent origin of DNA replication (oriP); and (2) the gene encoding the Epstein-Barr nuclear antigen (EBNA-1), which supports nuclear replication of the amplicon DNA in dividing cells (Wang, S. and J. M. Vos, J. Virol. 70:8422-8430 (1996)).
- the second is an HSV/AAV hybrid amplicon which incorporates the AAV ITR element and rep gene.
- HSV amplicons in combination with elements from other viruses, are utilized to generate retrovirus packaging cells. More specifically, the present invention relates to the development and characterization of a gene delivery system based on an HSV/EBV or an HSV/AAV hybrid amplicon vector, each of which have been modified to contain retroviral packaging functions and a retrovirus vector cassette. The ability of these hybrid amplicon vectors to induce retrovirus vector production was assessed in a number of different cells, as well as in vivo in a nude mouse model. High titer recombinant retrovirus vectors were obtained both by transfection and infection of different cell lines.
- hybrid amplicon vectors can also mediate cumulative transgene delivery in cell populations starting from a small fraction of amplicon-infected cells.
- generation of packaging cell lines is a process which requires several rounds of transfection, selection, and screening. Due to its time consuming nature, most of the cell lines that have been generated have very limited biological interest beyond packaging recombinant retrovirus vectors. Most of the cells are derived from mouse fibroblasts and more recently human cell lines.
- the vector system of the present invention will be able to shift the burden of work from generating packaging cell lines per se, to using the biologic properties of different cell types for specific applications.
- generation of packaging cells in vivo will allow direct access to a variety of endogenous cells.
- retroviral vectors for cancer gene therapy, which is currently in human clinical trials.
- the rationale behind these trials is that the retrovirus vectors generated by a packaging cell line, which is injected into a tumor, will infect neighboring dividing tumor cells, rendering them more sensitive to a prodrug, radiation, or conventional chemotherapy.
- brain tumors namely glioblastomas
- the main tumor mass is frequently accessible to the neurosurgeon for removal.
- death in most cases results from tumor recurrences which develop close to the original tumor mass, as well as in other places in the central nervous system, sometimes as far away as the opposite hemisphere from where the initial tumor mass was located.
- the immune response to the packaging cells is limited, since most brain tumor patients undergo treatment with immune suppressants, the CNS is a somewhat immune-privileged site, and brain tumors themselves may also suppress the immune system. Even if these arguments have some biologic significance, the fact that the packaging cells lack the ability to migrate, limits the therapeutic strategy from the beginning, since it does not address one of the basic properties of brain tumors— invasiveness.
- This ex vivo strategy of transforming cells into packaging cells according to the present invention has much broader applications than just tumor therapy, and could be used to transform other primary cells into packaging cells.
- one could use the vector system of the present invention which takes advantage of migratory and organ homing properties of different cells, for gene delivery to tissues or organs where cell proliferation occurs in the adult or during development.
- the most exciting property of the vector system of the present invention is the ability to transform cells into packaging cells in vivo. This can be achieved in a single transduction step, which can be accomplished using liposomes, electroporation, molecular conjugates and DNA guns, or any other method to introduce DNA into cells in vivo or by infection using the vector's ability to be packaged into HSV virions.
- retrovirus vectors have been long recognized as useful tools for gene transfer in cell culture, but with limited applicability in vivo due to their characteristic low titers, i. e. , infectious units/ml of virus stock, inability to transduce non-dividing cells, and finally their fragility, which precludes efficient concentration of viral stocks.
- retrovirus present a tremendous advantage in relation to other vectors with their ability to stably integrate into the host genome.
- retrovirus vectors have been used mostly in ex vivo protocols where target cells are grown in culture, and after being infected with the desired vector and selected, they are transplanted back into the individual. What the vector system of the present invention can accomplish is to transform cells in vivo into packaging cells which will deliver retrovirus vectors over an extended period of time, without being destroyed by the process of packaging, as occurs during production of most other vectors used for gene delivery.
- the present invention overcomes the disadvantages of the prior art because the present hybrid amplicon vector systems take advantage of the migratory and organ or tissue homing properties of certain cells to deliver retrovirus vectors in situ by transforming those cells into retrovirus packaging cells. Furthermore, once the retrovirus vectors integrate into the genome of the target cells, this genetic element should be stable and transmitted to the progeny of those cells. Another property of this system is that it can be used both as an HSV-amplicon vector or as a plasmid to achieve the same goals.
- the present invention provides hybrid amplicon vectors comprising genetic elements derived from several viruses: Herpes Simplex Virus (HSV), Epstein-Barr Virus (EBV) or Adeno-Associated Virus (AAV), and a retrovirus.
- HSV Herpes Simplex Virus
- EBV Epstein-Barr Virus
- AAV Adeno-Associated Virus
- the hybrid amplicon vector comprises elements from HSV, EBV, and a retrovirus.
- the hybrid amplicon vector comprises: (a) an HSV origin of replication (ori S); (b) an HSV packaging signal (pac); (c) an EBV origin of replication (ori P); (d) an expression cassette of the EBNA-1 protein of EBV; (e) gag, pol, and env genes of a retrovirus; and (f) a retroviral vector, containing at least one transgene of interest.
- additional regulatory i. e. , promoter
- the hybrid vectors are HERE and HERA.
- the amplicon vector comprises elements from HSV, AAV, and a retrovirus.
- the hybrid amplicon vector comprises: (a) an HSV origin of replication (ori S); (b) an HSV packaging signal (pac); (c) an AAV rep gene; (d) an AAV ITR element; (e) gag, pol, and env genes of a retrovirus; and (f) a retroviral vector, containing at least one transgene of interest.
- additional regulatory i. e. , promoter
- the hybrid vectors are HyRMOVAmpho and HyBPlacZ. Both vector system embodiments are capable of generating retroviral packaging cells.
- the retroviral vector will have at least one transgene inserted therein.
- the transgene(s) may be a reporter or marker gene, and/or a therapeutic gene.
- reporter genes include: ⁇ -galactosidase, green fluorescent protein (GFP), galactokinase, alkaline phosphatase, chloramphenicol acetly transferase, luciferase, and ⁇ -lactamase.
- suitable selectable marker genes include gene sequences capable of conferring host resistance to antibiotics (such as ampicillin, tetracycline, kanamycin, etc.), amino acid analogs, or genes permitting growth of bacteria on additional carbon sources or under otherwise impermissible culturing conditions.
- the therapeutic transgene sequence may be a gene sequence associated with diseases and disorders including, but not limited to, inherited metabolic disorders, including, lysosomal storage disease. Lesch-Nyhan syndrome, inherited neurological diseases, including, amyloid polyneuropathy , Alzheimer' s Disease,
- Duchenne's muscular dystrophy, ALS, Parkinson's Disease and brain tumors diseases of the blood, such as, sickle-cell anemia, clotting disorders and thalassemias, cystic fibrosis, diabetes, disorders of the liver and lung, heart and vascular disease, diseases associated with hormone deficiencies, movement disorders, pain, stroke, cancer, and HIV.
- the invention further provides a method for expressing a transgene in a proliferating cell population, in vitro or in vivo using the hybrid vectors of the invention.
- Some exemplary in vivo applications for the gene delivery system of the invention include gene delivery to the central nervous system during neurogenesis and gliogenesis, gene delivery to the bone marrow for the correction of genetic disorders as well as to protect the bone marrow from infection (as in HIV-infected individuals or other immune deficient individuals), gene delivery to the developing liver, and gene delivery to the lung during development.
- the invention also provides a method of treating diseases and disorders using the hybrid vectors of the invention.
- Non-limiting examples of the diseases and disorders that can be treated using the present hybrid vectors include: inherited metabolic disorders, including, lysosomal storage disease, Lesch-Nyhan syndrome, inherited neurological diseases, including, amyloid polyneuropathy,
- Alzheimer's Disease Duchenne's muscular dystrophy, ALS, Parkinson's Disease, diseases of the blood, such as, sickle-cell anemia, clotting disorders and thalassemias, cystic fibrosis, diabetes, disorders of the liver and lung, heart and vascular disease, diseases associated with hormone deficiencies, movement disorders, pain, stroke, HIV, tumors, neoplasms, carcinomas, sarcomas, leukemias, lymphoma, astrocytomas, oligodendrogliomas, meningiomas, neurofibromas, ependymomas, Schwannomas, neurofibrosarcomas, and glioblastomas.
- diseases of the blood such as, sickle-cell anemia, clotting disorders and thalassemias, cystic fibrosis, diabetes, disorders of the liver and lung, heart and vascular disease, diseases associated with hormone deficiencies, movement disorders, pain, stroke, HIV, tumors, neoplasms, carcinomas, sarcom
- the invention provides a method of selectively killing neoplastic cells using the hybrid vectors of the invention.
- the invention also provides a preferred embodiment of the foregoing vector wherein any of the above mentioned hybrid amplicon vectors are capable of generating retrovirus packaging cells in a single step.
- One or two hybrid amplicons can be used to deliver the retroviral vector components.
- FIGURES 1 A and IB depict the amplicon constructs of the invention that contain EBV elements.
- Figure 1 A is a schematic representation of the
- HSV/EBV/Retrovirus HER
- HSV/EBV/Retrovirus HER
- HER HSV/EBV/Retrovirus
- Amplicon clones A7, B3, and C5 bear the retrovirus lacZ cassette in opposite orientation to the GPE cassette, whereas clones Al, B7, and Cl have it in the same orientation.
- LTR long terminal repeat
- ⁇ retrovirus packaging signal
- lacZ E. coli beta-galactosidase
- SV40 simian virus 40 promoter
- a HSV packaging signal
- Col El E. coli origin of plasmid replication
- Amp R ampicillin resistance gene RSV, Rous sarcoma virus promoter
- EBNA-1 El
- Epstein-Barr nuclear associated antigen 1 with most of the internal Gly-Ala repetitive sequence deleted
- EBV latent origin of replication which contains two elements, the family of repeats (FR) and dyad symmetry (DS) element; ori v HSV origin of DNA replication; IE 4/5; HSV immediate/early 4/5 promoter; EGFP, enhanced green fluorescent protein gene; SV40pA, simian virus 40 polyadenylation signal.
- FR family of repeats
- DS dyad symmetry
- FIGURE 2 is abar graph depicting retrovirus production in 293T/17 cells after transfection with amplicon constructs. Two million cells were transfected by calcium phosphate co-precipitation with HERE lacZ Al and A7 amplicons, HERA lacZ B3 and B7 amplicons, and HER lacZ Cl and C5 amplicons. Cells were also co-transfected with BABE lacZ and MOV 12 plasmids, and BABE lacZ and MOVAmpho plasmids. Retrovirus titers assessed 48 hours post-transfection represent the average of two experiments repeated in triplicate and the error bars represent standard deviations. FIGURES 3A and 3B depict retrovirus vector production in 293T/17 cells 48 hours after infection with amplicon vectors.
- Figure 3 A To test if the orientation of the retrovirus vector cassette in relation to the CMV-GPE cassette had any effect on retrovirus titers, cells were infected at MOI of 2 with amplicon vectors HERE lacZ Al (1), HERE lacZ A7 (2), HERA lacZ B3 (3), and HERA lacZ B7 (4), and 48 hours later the supernatants were harvested for titering. A neutralization experiment was performed to demonstrate that retrovirus production is dependent on amplicon transduction. HERA lacZ B7 amplicon vector stocks (MOI of 2) were incubated for 10 minutes with a rabbit anti-HSV-1 antibody (5), normal rabbit serum (6), and an unrelated rabbit antibody (7), before infecting 293T/17 cells. Media were harvested 48 hours later for titering.
- Figure 3B depicts the relation between multiplicity of infection and retrovirus titers generated 48 hours post-infection.
- Cells were infected at different MOIs with HERE lacZ Al (open squares) and HERA lacZ B7 (solid diamonds). The relation between MOI and transduction efficiency was also evaluated (open triangles).
- supernatants were harvested for retrovirus titering, cells were analyzed by FACS to determine the percentage of cells expressing GFP as a measure of the amplicon transduction efficiency.
- FIGURES 4A, 4B, and 4C depict retrovirus production over time for J3T and Gli-36 cells infected with HERA lacZ B7 amplicon vector at different MOIs.
- J3T cells were infected at MOI of 1 (open square), 2 (solid diamond) and 5
- FIG 4B Gli-36 cells were infected at MOI of 1 (open square ), 2 (solid diamond) and 5 (solid square). Media were harvested at 2, 5 and 8 days post-infection and used for retrovirus titering. At 2 and 5 days post-infection, cells were counted and replated at the same density as on day 0.
- Figure 4C the percentage of GFP-positive cells was determined at 2, 5 and 8 days post- infection for J3T (MOI 2 - open squares; MOI 5 - open circles) and Gli-36 cells (MOI 2 - solid circle; MOI 5 - solid triangle).
- FIGURES 5A and 5B depict Western blot analyses of Pr65 ea and gp70 expression in J3T and Gli-36 cells at 2 and 8 days post-infection with HERA lacZ
- Figure 5 A depicts Pr65gag expression
- Figure 5B depicts gp70 expression.
- Lanes 1 and 4 lysates of naive J3T cells at 2 and 8 days; lanes 2 and 5, lysates of J3T cells at 2 and 8 days post-infection with HERA lacZ B7; lane 3 and 6, lysates of J3T cells at 2 and 8 days post-infection with HER lacZ Cl; lanes 7 and 10, lysates of naive Gli-36 cells at 2 and 8 days; lanes 8 and 1 1, lysates of Gli- 36 cells at 2 and 8 days post-infection with HERA lacZ B7; lanes 9 and 12, lysates of Gli-36 cells at 2 and 8 days post-infection with HER lacZ Cl .
- Goat anti-p30 and anti-gp70 antibodies were used at 1 :3000 dilution.
- Anti-goat IgG peroxidase conjugated was used as secondary antibody at 1 :5000 dilution.
- Blots were developed with ECL reagents and exposed to film for 1 minute.
- FIGURES 6A, 6B, and 6C depict beta-galactosidase activity in amplicon infected J3T and Gli-36 cell populations over time.
- J3T open squares
- Gli-36 cells solid diamonds
- lacZ activity in the population was measured at different timepoints up to 1 month.
- LacZ activities at 48 hours for J3T and Gli-36 cells were 317.2 and 79.7 mU/mg protein, respectively.
- FIGURE 7 depicts a model of cumulative increase in transgene expression in cell populations infected with the triple hybrid vector (also known as a "tribrid" vector).
- the hypothesized dynamics of transgene expression are shown for two different transduction efficiencies immediately after infection with the tribrid amplicon vector and 2 weeks later, assuming a dividing cell population.
- uninfected cells indicated as open circles
- cells infected with the amplicon vector filled circles with "lollipop” express lacZ and retroviral proteins, which interfere with their ability to be infected with retrovirus vectors.
- lollipop lacZ and retroviral proteins
- Some initially uninfected cells are now infected once by a retrovirus vector (lacZ+, filled circles) or multiple times with retrovirus vectors (higher lacZ expression, filled circles with halo). Over the same period, some cells initially infected with the amplicon vector have lost the episomal amplicon and hence their ability to produce lacZ or retroviral proteins (open circle with x), while some of these have subsequently become infected by retrovirus vectors produced by amplicon infected cells that retain the episomal tribrid (lacZ+, filled circles with x).
- FIGURES 8A and 8B depict the HSV/AAV/Retrovirus hybrid amplicon constructs ("HAR") of the invention.
- Figure 8A is a schematic representation of the HyRMOVAmpho hybrid amplicon which codes for Moloney murine leukemia virus (MoMLV) gag-pol and env genes (GPE).
- gag-pol genes were derived from the MOV ⁇ vector (Mann, R., etal, Cell 33: 153- 159 (1983)), while the env gene was derived from the 4070A amphotropic genome (Chattopadhyay, S. K., et al. J. Virol. 39:111-191 (1981)). These genes are expressed under the control of the cytomegalovirus immediate-early promoter (CMV) and the bovine growth hormone polyadenylation signal (BGHpA). An expression cassette conferring G418 resistance (neo) is present, under the control of the simian virus 40 origin of replication/promoter (SV40) and polyadenylation signal (SV40pA).
- CMV cytomegalovirus immediate-early promoter
- BGHpA bovine growth hormone polyadenylation signal
- An expression cassette conferring G418 resistance (neo) is present, under the control of the simian virus 40 origin of replication/promoter (SV
- AAV adeno-associated virus
- ITR inverted terminal repeats
- HSV herpes simplex virus
- ori s origin of DNA replication
- pac cleavage/packaging signal
- Figure 8B is a schematic representation of the HyBPlacZ hybrid amplicon.
- the GPE and neo expression cassettes were replaced by a MoMLV derived retrovirus vector expressing the E. coli beta-galactosidase gene (lacZ).
- S.D. splicing donor
- S.A. splicing acceptor
- LTR retroviral long terminal repeat
- ⁇ retrovirus packaging signal
- puro puromycin resistance gene
- Col El E. coli origin of plasmid replication
- Amp R ampicillin resistance gene.
- Stipled bar represents the 1.2 kb lacZ probe used for Northern blot.
- FIGURES 9A and 9B depict the effect of the Rep gene cassette on the activity of the downstream 5' LTR promoter.
- Figure 9A Hybrid retrovirus vectors designed to test this effect: (a) HyBPlacZ; (b) HSHyBPlacZ #2.2; (c) HSHyBPlacZ #2.1 ; (d) HSTVBPlacZ #3.2; (e) HSTVBPlacZ #1.2; (f) HSRepTVBPlacZ #1.1; (g) HSRepTVBPlacZ #3.5.
- lacZ and luciferase activities were determined for each sample.
- the activity of the LTR promoter in each vector for each experimental condition was expressed as a ratio between lacZ activity and luciferase activity (internal control for transfection efficiency) and compared to the average of ratios obtained for TVBP lacZ transfected cells (Relative LTR activity). Experiment was repeated twice in triplicate.
- FIGURE 10 is a bar graph depicting retrovirus titers after simultaneous infection with HSHyBPlacZ #2.2 and HyRMOVAmpho amplicon vectors.
- Cells were infected at the same MOI for each vector and two days later the medium was harvested for retrovirus titering. Infected cells were placed under double drug selection (G418 + puromycin) and retrovirus titers were determined at 30 and 55 days post-infection.
- Gli-36 cells (1) MOI 1, 48 hours; (2) MOI 5, 48 hours; (3) MOI 5, 30 days; (4) MOI 5, 55 days.
- J3T cells (5) MOI 2, 48 hours; (6) MOI 2, 30 days; (7) MOI 2, 55 days; (8) MOI 5, 48 hours; (9) MOI 5, 30 days; (10) MOI 5, 55 days. 293T/17: (1 1) MOI 1, 48 hours; (12) MOI 5, 48 hours.
- FIGURE 11 depicts retrovirus titers produced by stable cell lines obtained by a double step strategy.
- Gli-36 and J3T cells were first infected with two different retrovirus vectors, BabelacZ and HSHyBPlacZ, and selected for a population 100% puromycin resistant. Cells were then infected with HyRMOVAmpho amplicon at different MOIs and selected in G418. Retrovirus titers were determined at 48 hours and 86 days post-infection.
- Gli-36 infected with BabelacZ vector (1) MOI 1, 48 hours; (2) MOI 1, no long term G418 resistant population was obtained; (3) MOI 5, 48 hours; (4) MOI 5, 86 days.
- J3T cells infected with BabelacZ (5) MOI 2, 48 hours; (6) MOI 2, 86 days; (7) MOI 5, 48 hours; (8) MOI 5, 86 days.
- Gli-36 cells infected with HSHyBPlacZ (9) MOI 1, 48 hours; (10) MOI 1, 86 days; (1 1) MOI 5, 48 hours; (12) MOI 5, 86 days.
- FIGURES 12A and 12B are Western blots depicting the expression of retroviral proteins in stable vector producer cell lines.
- Figure 12A depicts expression of gag-pol gene products;
- Figure 12B depicts gp70 expression.
- Lane 1 lysates of naive Gli-36 cells; lane 2, lysates of naive J3T cells; lane
- J3T cells infected at MOI of 2 and 5 with HyRMOVAmpho amplicon vector, respectively, after 86 days of selection lanes 8 and 9, lysates of HSHyBPlacZ modified J3T cells infected at MOI of 2 and 5 with HyRMOVAmpho amplicon vector, respectively, after 86 days of selection; lane 10, lysates of BabelacZ modified Gli-36 infected at MOI 5 with HyRMOVAmpho amplicon vector, respectively, after 86 days of selection; lanes 11 and 12, lysates of HSHyBPlacZ modified Gli-36 cells, infected at MOI 1 and 5 HyRMOVAmpho amplicon vector, respectively, after 86 days of selection.
- Goat anti-p30 and anti-gp70 antibodies were used at 1 :3000 dilution.
- Anti-goat IgG peroxidase conjugated was used as secondary antibody at 1 :5000 dilution. Blots were developed with ECL reagents and exposed to film for 5 minutes.
- FIGURES 13A, 13B, and 13C depict levels of packageable vector RNA.
- Total RNA was extracted from cell lines using TrizolTM reagent: Lane 1 , naive Gli-
- HyRMOVAmpho amplicon vector was separated by electrophoresis in a 1.1% agarose-formaldehyde gel at 4V/cm for 3 hours.
- RNA was transferred to nitrocellulose and the blot was probed with a 1.2 kb lacZ DNA fragment labeled with 32 P.
- FIGURE 14 is a graph depicting the effect of Epstein-Barr virus elements on the duration of retrovirus vector production by tumor cells.
- FIGURE 15 depicts the structure of HERAC vectors.
- the retrovirus vector component was modified by replacing the 5' LTR with a CMV-LTR hybrid promoter. This modified retrovirus vector was inserted in the HER backbone in two different orientations (K16 and K19).
- FIGURE 16 depicts the structure of BiHERA vectors. Expression of the retrovirus structural genes and vector element were placed under the control of a bidirectional CMV promoter. This cassette was cloned in the HSV/EBV amplicon backbone in two different orientations (Clones Q4 and Q8).
- FIGURE 17 is a bar graph depicting the relative retrovirus vector titers for new versions of the HERA tribrid vector.
- the retrovirus component of the HERA vector (B7) was modified to incorporate a hybrid CMV-LTR promoter at the 5'-end, and inserted in the HER backbone in two different orientations
- FIGURE 18 is a graph depicting the percentage of green fluorescent protein (GFP)-positive cells measured by fluorescence-activated cell sorting (FACS) analysis at day 2 and day 7 following the infection of 5 x 10 5 human neural progenitor cells (HI ) with the tribrid amplicon B7 at a MOI of 1 , 5, and 10. The graph shows an expected loss of the amplicon DNA mediated GFP expression from cells over 5 days.
- GFP green fluorescent protein
- FACS fluorescence-activated cell sorting
- FIGURE 19 is a graph depicting the high titer production of retrovirus vectors (10 6 tu/ml) by neural progenitor cells infected with the tribrid amplicon vector B7.
- NIH 3T3 cells were infected with supernatant from amplicon-infected HI cells.
- Forty-eight hours after infection, NIH 3T3 cells were stained with X-Gal solution and retroviral titers were determined. Although the retroviral titer decreased over time, it was still significant after 7 days (10 5 tu/ml) at MOI initial amplicon infection of 10.
- FIGURES 20A-20E are photographs depicting dog glioma cells (J3T I) infected with the B7 or Cl hybrid amplicons at a MOI of 2. Twenty-four hours post-infection, the transduction efficiency was determined by FACS analysis (GFP positive cells). Subsequently B7-infected and non-infected glioma cells were mixed in a ratio of 5%/95%, 10%/90%, 20%/80% and 40%/60%. As a control. Cl- infected cells were mixed with non-infected cells in a ratio of 40%/60%. Subsequently, 5 x 10 6 cells were injected subcutaneously into nude mice.
- FIG. 20A is a photograph depicting tumor derived from a mixture of tribrid amplicon Cl- infected J3T I cells with non-infected J3T I cells, in a ratio of 40%/60%. Only a few 7 ⁇ cZ positive cells could be detected in the center of the tumor. The loss of transgene expression (40% to less than 10% of tumor) is expected as 7 ⁇ cZ is carried only in the amplicon backbone, which is lost over time.
- Figure 20B is a photograph depicting tumor derived from a mixture of tribrid amplicon B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 5%/95%.
- lac Z positive cells were abundant, and equally distributed throughout the tumor. Since even fewer lacZ -positive cells were initially injected here in comparison to the Cl experiment above (5%/95% vs. 40%/60%), the large number of lacZ cells observed in Figure 20B indicated retrovirus mediated transfer of lacZ and transmission to daughter cells.
- Figure 20C is a photograph depicting tumor derived from a mixture of tribrid amplicon B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 10%/90%. With the increased concentration of amplicon cells, the abundance of transgene positive cells increased dramatically. The inventors estimate that at least 50% of tumor cells are transgene positive with long-term expression.
- Figure 20D is a photograph depicting tumor derived from a mixture of B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 20%/80%.
- Figure 20E is a photograph depicting tumor derived from a mixture of B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 40%/60%.
- FIGURES 21A-21B are photographs depicting the results of injecting tribrid amplicons B7 and C 1 (control) into subcutaneous gliomas (5x 10 6 cells in
- Figure 21 A is a photograph depicting tumor injection with B7 amplicons. Numerous lacZ positive cells are concentrated around the needle tract. In comparison to the control injection with C 1 ( Figure 21 B), this indicated successful secondary retroviral infection of tumor cells.
- Figure 2 IB is a photograph depicting tumor injection with the control Cl amplicons. Only a few lacZ positive cells are visible around the needle tract.
- the triple hybrid amplicon vector systems of the present invention were designed to combine the advantages of four different viruses that have previously been used for gene transfer and gene therapy: HSV, EBV or AAV, and retrovirus.
- Each of the amplicon vector systems of the invention are capable of converting both dividing and non-dividing cells into retrovirus packaging cells in one or two steps.
- the hybrid amplicon vector comprises elements from HSV, EBV, and a retrovirus.
- the hybrid amplicon vector comprises: (a) an HSV origin of replication (ori S); (b) an HSV packaging signal (pac); (c) an EBV origin of replication (ori P); (d) an expression cassette of the EBNA-1 protein of EBV; (e) gag, pol, and env genes of a retrovirus; and (f) retroviral vector sequences, containing at least one transgene of interest.
- the hybrid amplicon packaging vector (HSV/EBV/retrovirus) can bear multiple transgenes both in the retrovirus vector element and in the amplicon backbone.
- Genes particularly suited for inclusion in the amplicon backbone include: 1) marker genes to follow the fate of the packaging cells; 2) therapeutic genes to enhance the efficacy of those incorporated in the retrovirus vector or as an independent cache of additional therapeutic genes which would might be effective or best expressed over a limited period; 3) regulatory elements or genes, for example encoding drug/hormone inducible systems, such as the tetracycline transactivator and silencing proteins (Freundling, S., et al, Methods Enzymol.283: ⁇ 59- ⁇ 13 (1997)) or dimerizing system (Amara, J.F., et al, Proc. Natl. Acad. Sc/.USA 94: 10618-10623 (1997)); and 4) genes for proteins which can reduce the immunogenicity of the packaging cell line.
- immune-modulatory molecules such as those that tumors use to evade the immune system, e.g., CD95 ligand, transforming growth factor- ⁇ , interleukin-10 (Hahne, M., et al. Science 274:1363-1366 (1996)).
- the genetic elements in the HSV amplicon comprise at least: ( 1 ) the HSV origin of DNA replication (ori S); and (2) the virion packaging signal (pac). These elements permit the system to be packaged as an amplicon vector in HSV virions.
- the cell tropism of this system is then determined by the surface glycoproteins present in all HSV virions.
- all amplicons they are able to enter and mediate gene expression both in dividing and non-dividing cells. This property is determined by the tegument and capsid proteins of HSV, which mediate transport to the nucleus and subsequent transfer of the encapsidated DNA into the nucleus.
- the elements from EBV comprise at least: (1) the EBV origin of DNA replication (ori P); and (2) the expression cassette of the EBNA-1 protein of EBV.
- HSV amplicon vectors can be very useful for gene transfer experiments, since they infect efficiently both dividing and non-dividing cells, and even more so after the advent of systems to package them without helper virus, they have a serious limitation which is their transient nature.
- Several systems have been devised to address this issue and the present system takes advantage of one of them: to combine HSV amplicons with the EBV oris P and EBNA-1 protein.
- the genetic elements from retrovirus comprise at least: (1) the gag, pol, and env genes, which provide the retroviral packaging functions; and (2) retroviral vector sequences, which carry at least one transgene of interest and the psi packaging signal for inco ⁇ oration in a retrovirus vector.
- retroviral gag gene codes for core proteins
- the pol gene codes for reverse transcriptase
- the env gene codes for the viral envelope protein.
- the retrovirus is Moloney Murine Leukemia Virus (MoMLV), which is a retrovirus that can only integrate genes into dividing cells.
- MoMLV Moloney Murine Leukemia Virus
- the ability of MoMLV to integrate only dividing cells may be an advantage in some situations, such as tumors, by restricting gene delivery to dividing cells. For many other applications, however, it reduces the spectrum of applications to developmental stages or organs and tissues where cell division takes place in the adult.
- the present vector system can be modified to use lentivirus components (a subclass of retroviruses), in lieu of MoMLV components. Since lentiviral vectors are capable of infecting non- dividing cells as well as dividing cells, the use of lentiviral components in the vectors of the invention can therefore expand the applications of this gene delivery system.
- the lentiviral components may be derived from the human immunodeficiency virus (HIV), with safety considerations being addressed by the elimination of some or all of the viral sequences non-essential for transduction.
- HIV human immunodeficiency virus
- lentiviruses as gene therapy vectors, see, Naldini, L., Curr. Opin. Biotechnol. 9:457-463 (1998); Kafri, T., et al, Nat. Genet. 77:314- 317 (1997); and Naldini, L., et al, Science 272:263-267 (1996)).
- retroviruses known to the skilled artisan can also be utilized in the hybrid vectors of the invention.
- retroviruses Due to its non-lytic manner of replication, retroviruses are the most suitable viruses to be part of a self-sustained in vivo gene delivery system.
- the retrovirus elements were all modified to reduce the overlapping sequences between the retrovirus gag, pol, and env genes, and the retrovirus vector, in order to avoid any recombination events that could generate wild-type virus.
- the gag, pol, and envelope cassette was modified to terminate at the TGA codon of the envelope gene. The 5' untranslated region of this cassette was kept intact so that the delicate balance of the splicing mechanism that originates the message that codes for the envelope gene was not affected.
- the retrovirus packaging signal is deleted in this cassette, which was derived from the MOV ⁇ (-) vector (Mann, R., et al, Cell 33: 153-159 (1983)).
- the retrovirus vector was also modified so that it only includes retrovirus sequences near the 3' LTR that are essential and do not overlap with the envelope gene. This way there are no sequences at the 3' end of the vector that overlap with any part of the expression cassette.
- the area around the packaging signal was also modified to minimize overlap with the gag-pol-env cassette.
- Most retrovirus nowadays not only include the packaging signal but they also extend into the 5' area of the gag region since it has been shown that it increases retrovirus titers.
- this gag extension was deleted with no apparent effect on retrovirus titers when compared to the parental vector. This was done so that there are no overlapping sequences on both sides of the packaging signal which could mediate recombination. In this way, the homology between the gag-pol-env expression cassette and the retrovirus vector was reduced to a small 100 bp region at the 5' end.
- the hybrid vectors are HERE and HERA. These vectors are depicted in Figure 1.
- the HERE system carries an ecotropic envelope (env) gene which can only efficiently infect rodent cells.
- the HERA system carries the amphotropic envelope gene derived from the 4070A
- MoMLV virus is able to infect a wide spectrum of mammalian cells.
- the hybrid amplicon vector of the invention comprises elements from HSV, AAV, and a retrovirus.
- the hybrid amplicon vector comprises: (a) an HSV origin of replication (ori S); (b) an HSV packaging signal (pac); (c) an AAV rep gene; (d) an AAV ITR element; (e) gag, pol, and env genes of a retrovirus; and (f) retroviral vector sequences, containing at least one transgene of interest.
- the hybrid amplicon packaging vector (HSV/AAV/retrovirus) can bear multiple transgenes both in the retrovirus vector element and in the amplicon backbone.
- Genes particularly suited for inclusion in the amplicon backbone include: 1) marker genes to follow the fate of the packaging cells; 2) therapeutic genes to enhance the efficacy of those incorporated in the retrovirus vector or as an independent cache of additional therapeutic genes which would might be effective or best expressed over a limited period; 3) regulatory elements or genes, for example, encoding drug/hormone inducible systems, such as the tetracycline transactivator and silencing proteins (Freund Kunststoff, S., et al, Methods Enzymol.255:159-173 (1997)) or dimerizing system (Amara, J.F., et al, Proc. Natl. Acad.
- EBV and AAV viruses have elements known to sustain or bind the DNA elements in the host cell nucleus.
- the EBV elements (ori P and EBNA-1) mediate episomal replication and chromosomal retention at mitosis;
- the AAV elements (ITRs and rep gene) mediate replicative amplification of ITR flanked elements and chromosomal integration.
- the genetic elements from AAV comprise at least: (1) the terminal repeats, ITRs, which are sufficient for replication and packaging of AAV virions; and (2) the rep gene, which encodes Rep isozymes involved in replication and chromosomal integration of the ITR- flanked sequences. These elements have the potential to mediate transgene amplification and stabilization, as well as chromosomal integration of the transgene with viruses that normally do not possess this property.
- the ITRs plus the Rep isozymes are thought to mediate site-specific integration into human chromosome 19q as well as random integration; the ITRs alone can mediate random integration.
- AAV has a broad host range and until recently, all human cells were thought to be infectable. The host range for integration is believed to be equally broad and includes non-human species.
- AAV is a single-stranded DNA parvovirus endogenous to the human population, making it a suitable gene therapy vector candidate. AAV is not associated with any disease, therefore making it safe for gene transfer applications (Cukor et al, The Parvoviruses, ed., K. I. Berns, Plenum, N.Y., pp. 33-36 (1984); Ostrove, J.M., et al, Virology 113: 521-533 (1981)).
- AAV integrates into the host genome upon infection so that transgenes can be expressed indefinitely (Kotin, R.M., et al. Proc. Natl. Acad. Sci. USA 87:
- the hybrid vectors are HyRMOVAmpho and HyBPlacZ. These vectors are depicted in Figures 8A and 8B, respectively.
- the inserted transgene in the retroviral vector of either triple hybrid amplicon vector may be a reporter or marker gene, and/or a therapeutic gene.
- a "triple hybrid amplicon vector”, as used herein, is a nucleic acid molecule (preferably DNA) in which a gene sequence, or a transgene, is fused to a subset of viral sequences from (1) Herpes Simplex Virus (HSV); (2) Epstein-Barr Virus (EBV) or Adeno-Associated Virus (AAV); and (3) retrovirus, such that the amplicon vector is capable of generating retrovirus packaging cells.
- HSV Herpes Simplex Virus
- ESV Epstein-Barr Virus
- AAV Adeno-Associated Virus
- retrovirus such that the amplicon vector is capable of generating retrovirus packaging cells.
- retrovirus packaging cells refers to mammalian cells which are capable of producing retrovirus vectors.
- transgene is intended to refer to a gene sequence, and is a nucleic acid molecule. Such transgenes, or gene sequences, may be derived form a variety of sources including DNA, cDNA, synthetic DNA,
- transgenes may comprise genomic DNA, which may or may not include naturally occurring introns. Moreover, such genomic DNA may be obtained in association with promoter regions or poly A sequences.
- the transgenes of the present invention are preferably genomic DNA or cDNA. Genomic DNA or cDNA may be obtained by means well known in the art. One or more transgenes may be present in the vector constructs of the invention.
- the transgene may be any gene sequence whose expression produces a gene product that is to be expressed in a cell.
- the gene product may affect the physiology of the host cell, and/or may be therapeutic.
- gene sequences that can be used as therapeutic trangenes include, but are not limited to, a gene sequence associated with diseases and disorders such as inherited metabolic disorders, including, lysosomal storage disease, Lesch-Nyhan syndrome, inherited neurological diseases, including, amyloid polyneuropathy, Alzheimer' s Disease, Duchenne's muscular dystrophy, ALS, Parkinson's Disease and brain tumors, diseases of the blood, such as, sickle-cell anemia, clotting disorders and thalassemias, cystic fibrosis, diabetes, disorders of the liver and lung, heart and vascular disease, diseases associated with hormone deficiencies, movement disorders, pain, stroke, HIV and cancer.
- the invention also provides for a hybrid amplicon vector wherein the inserted transgene sequence is a gene sequence associated with diseases and disorders.
- diseases and disorders are listed above.
- transgene cassette is intended to refer to a transgene operably linked to a promoter or other regulatory sequence sufficient to direct transcription of the transgene.
- Suitable promoters include, for example, a human CMV IEI promoter or an SV40 promoter, or mammalian or prokaryotic promoters well known to those skilled in the art.
- the transgene cassette may also optionally have termination signals, processing signals, or introns. It is of course possible to use as a transgene a gene sequence that already possesses a promoter, initiation sequence, introns, processing sequence or termination sequence in the transgene cassette.
- the vectors may also contain one or more non-therapeutic transgenes, such as reporter genes or selectable marker genes.
- reporter gene is any gene sequence which, when expressed, results in the production of a protein whose presence or activity can be easily monitored.
- suitable reporter genes can include the gene for ⁇ - galactosidase, green fluorescent protein, galactokinase, alkaline phosphatase, chloramphenicol acetlytransferase, luciferase, and ⁇ -lactamase.
- a "selectable marker gene,” as used herein, is any gene sequence capable of expressing a protein whose presence permits selective propagation of a cell which contains it.
- selectable markers include gene sequence capable of conferring host resistance to antibiotics (such as ampicillin, tetracycline, kanamycin, etc.), amino acid analogs, or permitting growth of bacteria on additional carbon sources or under otherwise impermissible culturing conditions.
- host cell is intended to refer to any cell that can be infected with the hybrid amplicon vectors of the present invention.
- Mammalian cells are preferred host cells.
- operably linked is intended to describe a linkage between a gene sequence and a promoter or other regulatory or processing sequence such that the transcription of the gene sequence is capable of being directed by an operably linked promoter sequence, the translation of the gene sequence is capable of being directed by an operably linked translational regulatory sequence and the post-translational processing of the gene sequence is capable of being directed by an operably linked processing sequence.
- the invention further provides a method for expressing a transgene in a proliferating cell population, in vitro or in vivo, using the hybrid vectors of the invention.
- Some exemplary in vivo applications for the gene delivery system of the invention include gene delivery to the central nervous system during neurogenesis and gliogenesis, gene delivery to the bone marrow for the correction of genetic disorders as well as to protect the bone marrow from infection (as in HIV-infected individuals or other immune deficient individuals), gene delivery to the developing liver, and gene delivery to the lung during development.
- the invention also provides a method of treating diseases and disorders using the hybrid vectors of the invention.
- diseases and disorders that can be treated using the present hybrid vectors include: inherited metabolic disorders, including, lysosomal storage disease, Lesch-Nyhan syndrome, inherited neurological diseases, including, amyloid polyneuropathy,
- Alzheimer's Disease Duchenne's muscular dystrophy, ALS, Parkinson's Disease, diseases of the blood, such as, sickle-cell anemia, clotting disorders and thalassemias, cystic fibrosis, diabetes, disorders of the liver and lung, heart and vascular disease, diseases associated with hormone deficiencies, movement disorders, pain, stroke, HIV, tumors, neoplasms, carcinomas, sarcomas, leukemias, lymphoma, astrocytomas, oligodendrogliomas, meningiomas, neurofibromas, ependymomas, Schwannomas, neurofibrosarcomas. and glioblastomas.
- diseases of the blood such as, sickle-cell anemia, clotting disorders and thalassemias, cystic fibrosis, diabetes, disorders of the liver and lung, heart and vascular disease, diseases associated with hormone deficiencies, movement disorders, pain, stroke, HIV, tumors, neoplasms, carcinomas, sarcom
- the invention provides a method of selectively killing neoplastic cells using the hybrid vectors of the invention.
- Gene therapy can be used to introduce a gene into the tumor cells that expresses a protein which is toxic or can trigger a toxic effect against tumor cells.
- Genes for transfer into the neoplastic cells by the hybrid vectors are selected from those which target host cell usually by expression of a gene product in the host neoplastic cells.
- Gene product broadly refers to proteins encoded by the particular gene.
- gene product also includes transcription products of the gene, particularly for use as antisense RNA.
- Genes are selected whose gene products serve to identify host cells, slow down or temporarily stimulate host cell growth in order to render the host cell more sensitive to chemotherapeutic agents and/or whose products target the host cell for cell death.
- Cell death can be accomplished by contacting the host cells, containing the gene product, with a subsequent treatment, either physical or chemical treatment.
- the gene products themselves may serve to kill the host cells or slow down cell growth.
- the host cells targeted by the present hybrid vectors are those cells into which the hybrid vector infects and expresses the desired gene product and thus can constitute neoplastic cells infected by the hybrid vectors.
- Useful gene products comprise: tumor suppressor genes, which encode transcription factors which suppress cell growth, such as the Rb gene for retinoblastoma or the p53 gene in colon cancer (Huang, H.J., et al, Science 242:
- toxic proteins that are released by cells such as a fusion protein comprising a toxin coupled to EGF ligand (Heimbrook, D.C., et al, Proc. Natl. Acad. Sci.
- TK HSV thymidine kinase
- CD cytosine deaminase
- Huber, B.E. et al, Cancer Res. 55:4619-4626 (1993); Mullen, C.A., et al, Cancer Res. 54: 1503-1506 (1994)
- cytochrome P450 Choxman, D.J., Cancer
- a triple hybrid amplicon vector which inco ⁇ orates the HS V- 1 thymidine kinase gene offers such a conditional killing mechanism for dividing cells.
- the thymidine kinase enzyme can convert certain nucleoside analogues, such as, acyclovir, ganciclovir, and FIAU. These drugs are converted to nucleotide-like precursors and inco ⁇ orated into the DNA of the replicating cells, thus disrupting the integrity of the genome and ultimately leading to cell death. (See, Boviatsis, E.J., et al, Cancer Res. 54:5145-5151 (1994).
- the hybrid vector administered in combination with a less toxic drug could be highly effective treatment for tumors.
- the hybrid vector can also inco ⁇ orate the gene for cytochrome P450.
- the cytochrome P450 gene offers a conditional killing mechanism independent of the cell cycle of the tumor cell. This gene is used to sensitize neoplastic cells to the cytotoxic effects of a chemotherapeutic agent that is activated by one or more cytochrome P450 genes.
- the term "cytochrome P450 gene,” as used herein, means a mammalian cytochrome P450 gene such as, P450, 2B 1 , P4502B6, P4502A6, P4502C8, P4502C9, P4502C 11 , or P4503 A4.
- the cytochrome P450 2B1 gene is utilized to sensitize central nervous tumor cells to the cytotoxic effects of cyclophosphamide (CPA).
- CPA cyclophosphamide
- Expression of cytochrome P450 2B1 gene in C6 glioma cells was found to lead to tumor cell destruction following CPA treatment in culture, in subcutaneous tumors in athymic mice, in MCF-7 human breast carcinoma cells and in experimental brain tumors in mice.
- the P450 2B1 gene has been successfully utilized to sensitize tumors cells such as 9L gliosarcoma cells to oxazaphosphorine treatment.
- more than one prodrug-activating gene may be inserted in the hybrid amplicon vector systems of the invention, in order to achieve synergistic effects.
- the HSV-TK gene coupled with the bacterial cytosine deaminase(CD) gene may be used together, as may the HSV-TK gene with a cytochrome P450 gene.
- Other combinations of prodrug-activating genes known to those skilled in the art, may also be used in the vectors and methods of the invention.
- prodrug-activating genes also called "suicide genes” for cancer gene therapy may be found in Freeman, S.M., et al, Semin. Oncol. 25:31-45 (1996).
- the hybrid vector can be administered to the tumors in a mammal by multiple routes, including, e.g., direct injection into the tumor mass, through the blood vessels, via cerebrospinal fluid, or via an infected packaging cell.
- the gene product may also encode a chemical or protein which renders the host cells radiosensitive and thus more susceptible to killing by radiation. Thus, upon subsequent subjection to radiation, the host cells are selectively killed.
- neoplasms neoplasms, carcinomas, sarcomas, leukemias, lymphoma, and the like.
- central nervous system tumors which include astrocytomas, oligodendrogliomas, meningiomas, neurofibromas, ependymomas, Schwannomas. neurofibrosarcomas, glioblastomas, etc.
- the invention further provides a method for expressing a transgene in a cell, which comprises:
- the invention provides a method for expressing a transgene in a cell, which comprises:
- the invention also provides a method of selectively killing neoplastic cells comprising:
- the invention also provides the foregoing method, wherein the HSV/EBV/retrovirus or HSV/AAV/retrovirus hybrid amplicon vector additionally expresses a second prodrug-activating gene, in addition to HSV-TK.
- the invention further provides for a method of selectively killing neoplastic cells comprising:
- the chemotherapeutic agent is cyclophosphamide or ifosphamide.
- the invention also provides the foregoing method, wherein the
- HSV/EBV/retrovirus or HSV/AAV/retrovirus hybrid amplicon vector additionally expresses a second prodrug-activating gene, in addition to cytochrome P450.
- the invention also provides a preferred embodiment of the foregoing vector wherein any of the above mentioned hybrid amplicon vectors are capable of generating retrovirus packaging cells in a single step. According to the invention, one or two hybrid amplicons can be used to deliver the retroviral vector components.
- NIH 3T3 cells (CRL 1658) were obtained from the American Type Culture Collection (ATCC) (Manassas, VA). 293T/17 cells (Pear, W. S., et al,
- the SNB- 19 human glioma cell line (Gross, J. L., et al, Cancer Res. 48:291-296 (1988)) was obtained from the ATCC. T98 were obtained from Dr. F. S. Prado at MGH, Boston, MA. U87. ⁇ EGFR (Nagane, M., et al, Cancer Res. 56:5079-5086 (1996)). was provided by Dr. Webster Cavenee at the University of California, San Diego. Gli-
- CNS-1 rat glioma cells (Kruse, C. A., et al. J. Neurooncol. 22: 191-200 (1994)) were obtained from Drs. Kruse and Hickey (University of Colorado).
- NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% calf serum (Sigma, St. Louis, MO). 293T/17,
- Plasmids All DNA sequences amplified by PCR were cloned in pCR2.1 vector using the TA cloning kit (Invitrogen, Carlsbad, CA) and sequenced.
- MOV- 1 GCTAGCCCTCTTGCAGTTGCATCCGAC (SEQ ID NO: 1 ) Nhe l
- MOV-2 AGGAGCAACTGGCGATAGTGGAC (SEQ ID ⁇ O:2)
- Xba l ENVP4 CTGTTTAACAGATCCCCTTGG (SEQ ID NO:4)
- the pMOV ⁇ " plasmid (Mann, R., et al, Cell 55: 153-159 (1983)), was used as a template for all PCR reactions.
- Primers ENV-P3 and ENV-P4 were used to amplify a 209 bp fragment which was cloned in pCR2.1 generating the plasmid, TVENVP34.
- a 61 14 bp Xho I - Cla I fragment from pMOV ⁇ " was then cloned into TVENVP34 generating the plasmid, TVMOV.
- a 6226 bp Xho I - Eco RI fragment from this plasmid was then cloned in pcDNA3.
- BAB-1 GCGGCCGCTGATCATTCCGCGCACATTTCCCCGAAAAG
- BAB-4 ATGCATGCGGCCGCTGATCAAAATGAAAGACCCCCGCTGAC Nsi l Not ⁇ (SEQ ID NO: 7)
- the retrovirus vector elements were derived from the vector pBabe Puro (Morgenstern, J. P., and J. Land, Nucleic Acid Res. 75:3587-3596 (1990)).
- BAB- 1 and BAB-2 primers were used to amplify a 933 bp fragment spanning the
- This PCR product was cloned into pCR2.1, originating the plasmid TVBAB 12.
- BAB-4 and BAB-5 primers were used to amplify a 654 bp fragment spanning the 3' LTR which was cloned in pCR2.1 generating the plasmid TVBAB45.
- the Nsi I to Sal I fragment from this plasmid containing the BAB45 sequence was cloned in TVBAB 12 generating the plasmid TVB.
- the 1075 bp Sal I to Nhe I fragment from pBabe Puro containing the SV40 early promoter and puromycin selection marker gene were cloned in TVB generating the plasmid TVBP.
- the Escherichia coli lac Z gene was cloned in the
- IMOVAmpho encompassing the coding sequences for the retrovirus proteins were cloned in the M12Y HSV/EBV hybrid amplicon generating the vectors pHERE and pHERA, respectively.
- the retrovirus vector element was derived from the TVBPlacZ plasmid after digestion with Not I and cloned into the unique Not I site of pHERE and pHERA.
- HBS HEPES-buffered saline
- 10 mM KC1, 12 mM dextrose, 280 mM NaCl, 1.5 mM Na 2 HPO 4 - final pH 7.05 50 mM HEPES, 10 mM KC1, 12 mM dextrose, 280 mM NaCl, 1.5 mM Na 2 HPO 4 - final pH 7.05
- the resulting suspension was immediately added to the cells and the plate gently rocked to achieve a uniform distribution of the precipitates.
- Cells were returned to the 37 °C incubator for 8 hours.
- the medium containing chloroquine was then replaced with 4 ml of growth medium. The following day, the medium was changed to 3 ml of fresh medium and the cells were incubated at 37 °C for 24 hours before harvesting.
- Retrovirus titer determination For all retrovirus titers determined in this study, the media from retrovirus vector producing cells was centrifuged at 500 x g for 5 minutes and supernatants were stored at -80 °C. One day prior to infection, NIH 3T3 cells were plated in 12 well dishes at a density of 5x10 4 cells/well. Cells were infected in a total volume of 0.5 ml containing different volumes of supernatant in the presence of 4 ⁇ g/ml polybrene (Sigma). Each vector stock was titered in triplicate.
- 2-2 cells were transfected using lipofectamine (GIBCO-BRL) with a mixture of plasmid to be packaged and a set of 5 cosmids which spans the entire HSV genome (Cunningham, C. and A. J. Davison, Virol. 797:1 16-124 (1993)) with the packaging sequences (pac) deleted
- Amplicon stocks were harvested 60 hours later and purified by brief centrifugation at 1000 x g for 10 minutes. Amplicon titers (transducing units per ml; tu/ml) were determined by infecting 293T/17 cells and counting GFP positive cells at lOOx magnification 18 hours post-infection.
- Retrovirus production after infection with amplicons Retrovirus production in 293T17 cells.
- 2x10 6 cells were plated on 60 mm dishes. Cells were infected at different multiplicities of infection (MOI - number of transducing units per cell) in a maximum volume of 3 ml. The following day, the medium was replaced with 3 ml of fresh medium and the cells incubated for 24 hours before harvesting the medium for retrovirus titering. Each MOI was repeated in triplicate. Retrovirus titers were determined as above. Amplicon neutralization experiment. For this pu ⁇ ose, 293T/17 cells were plated as before.
- Retrovirus production in glioma cells One day prior to infection, 5x10 5 cells were plated on 60 mm plates. The following day, cells were infected at different MOI, as above, prior to harvesting the supernatant for retrovirus titering. Each MOI was repeated in triplicate. Retrovirus titers were determined as above. For retrovirus production kinetics, on the day of harvesting, the total number of cells per plate was determined using a cell counter (Coulter, Miami, FL), and 5x10 5 cells were replated on 60 mm plates. Two days later, medium was replaced with 3 ml of fresh medium and the following day the supernatant was harvested for titering. The same process was repeated at each time point. Stability of transgene expression.
- J3T and Gli-36 cells were plated in 6 well dishes at a density of lxl 0 5 cells per well. The following day, cells were infected with amplicon vectors at MOI of 2 in a total volume of 1 ml in growth medium and returned to the 37 °C incubator for 24 hours after which the medium was replaced by 1.5 ml fresh medium. Cells were kept in 6 well dishes until day 4 after which they were transferred to 60 mm plates. Cells were then split 1 :5 every three days. The experiment was repeated twice in triplicate for each cell line.
- Beta-galactosidase activity measurement Cells were harvested at different timepoints, in cell lysis buffer (Promega, Madison, WI) and stored at -
- membranes were washed twice for 15 minutes and twice for 5 minutes in TBST and then incubated for 1 hour at room temperature with 1:3000 dilution of the primary antibodies in 2% non-fat dry milk powder in TBST.
- Anti-p30 and anti-p70 antibodies were developed in goat against Rauscher murine virus p30 (CA protein) and p69/71 (SU protein) proteins, respectively (Quality Biotech Inc).
- the membranes were washed as before and incubated for 30 minutes with a 1 :5000 dilution of anti-goat IgG peroxidase conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz, CA) in TBST with 5% milk.
- FACS Fluorescent activated cell sorting
- the vector design takes advantage of the host range and retention properties of an HSV/EBV hybrid amplicon to develop a single vector system which enables cells to produce recombinant retrovirus vectors after transduction.
- Retrovirus genes, gag-pol and env (GPE), and retroviral vector sequences were cloned into an HSV/EBV hybrid amplicon (Fig. 1 ).
- This amplicon has in its backbone the EBV origin of replication (Oris P) and a mutant version of the Epstein-Barr nuclear associated antigen 1 (EBNA-1) coding region (Yates, J.
- HSV/EBV/Retrovirus hybrid vectors HERE and HERA, which code for the ecotropic (E) and the amphotropic (A) envelopes, respectively.
- Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit in two different orientations to evaluate potential interference between the CMV and 5 'LTR (long terminal repeat) promoters (Fig. IA).
- Vectors HERE 1 acZ Al and HERA lacZ B7 have the 5' LTR promoter placed so that transcription from this promoter occurs in the same direction as the CMV-GPE cassette with vectors HERE lacZ A7 and HERA lacZ B3 in the opposite orientation.
- a major concern in developing retrovirus packaging cell lines is the risk of recombination events generating replication competent retroviruses.
- the MoMLV gag-pol-env genes and vector elements were modified to reduce overlap between them.
- the gag-pol-env genes derived from the plasmid MOV ⁇ " have a 350 bp deletion that removes the retrovirus packaging signal (Mann, R., et al, Cell 55:153-159 (1983)).
- the promoter elements were removed from the 5 ' LTR, leaving the 5 ' untranslated region intact to avoid altering the splicing mechanism that generates the message encoding the envelope glycoproteins (SU protein-gp70 and TM protein - pl5E).
- the 3' end was modified to remove all non-coding sequences after the stop codon of the env gene.
- Two different gag-pol-env (GPE) cassettes were constructed, one conferring an ecotropic (MOV 12), and another an amphotropic (MOVAmpho) host range. These cassettes were cloned into pcDNA3. 1 Neo(-) vector under the control of the CMV promoter, flanked at the 3' end with the BGH polyadenylation signal (BGHpolyA).
- the retrovirus vector component of this amplicon vector was derived from the retrovirus vector, BabePuro.
- the packaging signal was reduced to its minimal sequence, removing the gag gene region, which in some constructs has been shown to increase the efficiency of packaging (Bender, M. A., et al, J. Virol 67: 1639-1646 (1987); Morgenstern, J. P. and H. Land, Nucleic Acids Research 75:3587-3596 (1990)).
- the 3' end of the vector contains the 3' LTR and the 35 bp sequence that separates the stop codon of the env gene from the 3' LTR and thus it has no sequence overlap with the modified retrovirus genes. With these two sequence alterations, the homology between the vector element and the GPE cassette was reduced to 164 bp at the 5' end.
- Co-transfections of the pcDNA3.1MOV12 plasmid produced titers of 5.9xl0 6 ⁇ 1.6xl0 6 tu/ml (titer ⁇ standard deviation), while the plasmid pcDNA3.1 MOVAmpho generated retrovirus titers of 1.8xl0 6 ⁇ 4.5xl0 5 tu ml.
- co-transfection of the original MOV- ⁇ plasmid (ecotropic) with BabePuro 7 ⁇ cZ plasmid yielded titers of 1.3x10 6 ⁇ 2.9xl 0 5 tu/ml in 293T/17 cells.
- Phoenix-E cells derived from 293 cells, are an established packaging cell line for transient production of retrovirus vectors with ecotropic host range. Transfection of these cells with BabePuro lacZ plasmid resulted in retrovirus titers of 1.2xl0 6 ⁇ 3.3xl0 5 tu/ml. These results indicate that the GPE expression cassettes generated in this study are fully functional and at least as efficient as the original MOV- ⁇ plasmid or an established packaging cell line in generating retrovirus vectors.
- the HERE, HERA, and HERlacZ amplicons were packaged in HSV virion particles in 2.2 cells using the helper virus-free packaging system developed by Fraefel, C., etal, J. Virol 70:7190-7197 (1996)).
- Typical amplicon vector titers assessed on 293T/17 cells varied between 2x10 6 and lxl 0 7 tu/ml HERE and HERAlacZ amplicon vectors were used to infect naive 293T/17 cells at a multiplicity of infection (MOI) of 2.
- MOI multiplicity of infection
- the HERElacZ amplicon vectors yielded retrovirus titers of 4.2xl0 5 ⁇ 6.2xl0 4 tu ml for HERElacZ Al and 3.7xl0 5 ⁇ 4.7xl0 4 tu ml for HERElacZ A7, about 2-fold higher than those obtained for the HERAlacZ amplicon vectors (HERA 7 ⁇ cZ B3: 1.7xl0 5 ⁇ 4.3x10 4 tu/ml;. HERElacZ B7: 1.8x 10 5 ⁇ 2.5xl0 4 tu/ml), with no significant difference between the two orientations in either set.
- HERAlacZ B7 amplicon vector stocks were treated with a rabbit antibody directed against HSV-1 envelope glycoproteins, normal rabbit serum or an unrelated rabbit antibody.
- Treatment of the amplicon stocks with the anti-HSV-1 antibody reduced the transduction efficiency of the amplicon vector from 50% to 0.2% and resulting retrovirus vector titers decreased by more than 10,000 fold to less than 10 tu/ml.
- Treatment of amplicon vector stocks with normal rabbit serum or an unrelated rabbit antibody did not have any effect on transduction efficiency or retrovirus titers (Fig 3 A).
- retrovirus vectors produced after infection of 293T/17 cells with amplicon vectors are not the result of transfer of retrovirus packaging functions from 2-2 cells, but through amplicon transduction.
- Retrovirus production in Gliomas A number of glioma lines derived from humans (T98, U87. ⁇ EFGR, SNB-19, Gli-36), rat (9L, CNS-1) and dog (J3T) tumors were tested for their ability to produce retroviruses upon infection with the HERAlac Z B7 amplicon vector at MOI of 2. Two days after infection, the medium was harvested to determine retrovirus titers, and the transduction efficiency for each glioma line was also evaluated (Table 1).
- Table 1 Transduction efficiency and production of retrovirus vectors by glioma lines two days after infection with HERA lacZ B7 amplicon vector
- retrovirus titers 1.0-1.2xl0 5 , 400-1000 and 200-300 tu ml, respectively were roughly proportional to transduction efficiencies of 80-90% for Gli-36, 15-21% for SNB-19 and 5-8% for U87. ⁇ EGFR cells. T98 was an exception to this trend, with less than 10 tu/ml detectable in the supernatant, while the percentage of transduced cells was 13%.
- the rodent glioma models, 9L and CNS-1 showed low infectability with the amplicon vector and very low production of retrovirus vectors.
- the dog glioma line J3T generated retroviral titers of 6-8 xl 0 4 tu/ml with 20-25% transduced cells.
- Gli-36 and J3T glioma cells which yielded the highest retroviral titers, were chosen to analyze the kinetics of retrovirus production.
- One day after plating cells were infected at different MOIs with HERA lacZ B7 amplicon vector and two days later the supernatants were harvested for titering retrovirus vectors. Cells were then passaged at the same density as on day 0 and this procedure was repeated on day 5 and 8 post-infection. Production of retrovirus vectors overtime was different between these two cell lines.
- J3T cells showed an increase in retroviral titer between day 2 and day 5 followed by a decay between day 5 and day 8 (Fig. 4A).
- the retention of amplicon sequences over time in infected J3T and Gli-36 cells was determined for MOI of 2 and 5 by evaluating the percentage of GFP- positive cells by FACS analysis.
- the percentage of GFP-positive cells decreased overtime from 22% and 44%, respectively, at day 2 to 8. 1 % and 19.9% at day 5. and 2.4% and 8.9% at day 8 (Fig.4C).
- the percentage of amplicon transduced cells decreased from 80.2% and 92%, respectively, at 2 days to 69.4% and 83.4% at day 5 and 31.8% and 44.3% at day 8 (Fig. 4C).
- the ratio of retrovirus particles produced/producer cell can be used as a measure to estimate the efficiency of a packaging cell line. To calculate this ratio, the assumption was made that all GFP-positive cells produced retrovirus vectors. Taking into account the total number of GFP-positive cells and retrovirus titers for each timepoint, for Gli-36 cells infected at MOI of 2 or 5, this packaging ratio was between 0.13 and 0.15 retroviral particles/producer cell at 48 hours, decreasing at later timepoints to about 0.04 to 0.05. For J3T cells infected at MOI of 2, this ratio was 0.5 at day 2, 0.94 at day 5. and 1.2 at day 8 post-infection, while for MOI of 5, the ratio remained the same at 0.5 from day 2 to day 8.
- J3T and Gli-36 cells also grew at different rates during the course of the experiment.
- Gli-36 cells increased in average 6 fold for each 3 day time interval and MOI analyzed, corresponding to a generation time of 29 hours, similar to uninfected cells under the same culture conditions.
- J3T cells showed an average generation time of 24 hours for all three MOIs tested, similar to uninfected cells.
- MOIs of 1 and 2 the doubling time was 36 hours, while for MOI of 5 it was 48 hours, possibly indicating some initial vector toxicity.
- Stability of transgene expression Stability of amplicon-mediated gene expression in cells transduced by these HERA hybrid amplicon vectors was analyzed above by the percentage of GFP-positive cells, retrovirus vector titers, and expression of retrovirus proteins over time. The question remaining was whether the presence of the retroviral elements, the gag-pol-env cassette and retrovirus vector, have any effect on retention of the transgene (lacZ) carried by the retrovirus vector, i.e., whether retrovirus vectors produced by amplicon transduced cells were able to infect and confer stable transgene expression on other cells in the population.
- Gli-36 cells was dependent on the initial percentage of amplicon infected cells. Gli-36 cells were infected with HERAlacZ B7 amplicon vector at MOI of 0.1, 0.5, 1 and 2 achieving a range of transduction efficiencies (% of GFP-positive cells) at 2 days post-infection of 16.6, 49.3. 65.9, and 80.2%, respectively. An inverse correlation between increase in lacZ activity and MOI was observed over 2 weeks (Fig. 6C). For the population infected at an MOI of 0.1, lacZ activity increased by 7 fold, while for MOI of 2, lacZ activity increased only by about 2 fold. Absolute lacZ activity levels were 15 fold higher for MOI of 2 than for MOI of 0.
- Retrovirus genes and vector element can both be delivered by adenoviral vectors (Duisit, G., etal, Human Gene Ther. 70: 189-200 (1999); Feng, M., etal, Nature Biotech. 75:866-870 (1997)). Some of these adenovirus based systems can generate relatively high retrovirus titers (10 0 6 cfu/ml) in cultured cells (Duisit, G., et al, Human Gene Ther. 70: 189-200 (1999); Yoshida, Y., Biochem. Biophys. Res. Comm. 252:379-382 (1997)).
- the present invention demonstrates that the principle can work, but conceptually the process should be more efficient if a single adenovirus vector contained all necessary elements to generate retrovirus vectors. Although the size limitation of conventional adenovirus vectors precludes the construction of such vector, "gutless" adenovirus vectors could easily accommodate all the components.
- the hybrid amplicon vector system described in this Example has several advantages over existing vector systems for generating retroviral vectors: (1) all elements necessary for production of replication-deficient retrovirus vectors are present or can be placed in the same construct. In theory, the conversion efficiency per transduced cell is 100%, independently of whether amplicon DNA is introduced into cells by transfection or infection; (2) not only do HSV virions have a wide host range,stability and high infectability, but due to their large DNA capacity and the mode of viral DNA replication, each amplicon vector carries multiple copies of the amplicon plasmid. This means that for each transduction event, multiple copies of the transgenes are delivered to the cell nucleus.
- the efficiency of gene delivery mediated by this hybrid amplicon vector system is dependent on a number of factors, including infectability with HSV and retrovirus virions, capacity to produce retrovirus vectors and retention of amplicon elements. Infectability of target cells by HSV virions is a primary determinant of the levels of retrovirus vectors produced by a cell population, while the transduction efficiency by retrovirus vectors is ultimately responsible for long term transgene retention.
- infection of a variety of cell lines with the same number of hybrid amplicon virions resulted in a large spectrum of transduction efficiencies (Table 1). This could result from different levels of promoter activity in different cell lines or an intrinsic property of each cell line. Entry of both types of virus is dependent on the expression levels of certain cell surface receptors (Kurre, P., et al, J. Virol. 75:495-500 (1999); Montgomery, R.
- HSV virions this could be achieved by using helper functions from different strains of HSV and/or modifying the virion envelope to enhance binding of the vector to receptors abundant on the target cells (Laquerre, S., et al, J. Virol. 72:9683-9697 (1998)).
- helper functions from different strains of HSV and/or modifying the virion envelope to enhance binding of the vector to receptors abundant on the target cells
- VSV-G vesicular stomatitis virus envelope glycoprotein
- expression of this protein can be toxic and thus limit the length of time that transduced cells can produce vectors.
- GLV gibbon ape leukemia virus
- the amount of packageable retrovirus vector RNA can be estimated from the level oflacZ activity per GFP-positive cell early in the course of infection
- lacZ activity / GFP-positive cell is 15 fold higher in J3T than in Gli-36 cells indicating that the level of vector RNA generated from the 5' LTR promoter is lower in Gli-36 than in J3T cells.
- MoMLV LTR promoter is intrinsically weaker in Gli-36 cells, due to low or absent levels of some transcription factors necessary for efficient promoter activation or that the activity of the LTR promoter in Gli-36 cells is inhibited to a greater extent than in J3T cells by the upstream CMV promoter via a deficient transcription termination mechanism mediated by the BGHpolyA sequence.
- retrovirus proteins could also be a limiting factor in some cells, this does not appear to be a factor in Gli-36 and J3T cells as Pr65 gag and gp70 levels are higher in Gli-36 than J3T cells by about the same magnitude as the percentage of transduced cells, which is the inverse of their retrovirus vector production efficiencies.
- overexpression of the HIV-1 Gag-Pol polyprotein can lead to intracellular activation of the viral protease, mainly resulting in the production of capsid and matrix proteins, with inhibition of assembly and budding of virus-like particles (Karacostas, V., et al, Virol. 795:661-671 (1993)).
- the presence of processed HIV-1 Gag-Pol polyprotein can lead to intracellular activation of the viral protease, mainly resulting in the production of capsid and matrix proteins, with inhibition of assembly and budding of virus-like particles.
- MoMLV virion proteins e.g., p30(CA) has also been reported following infection with adenoviral vectors (Duisit, G.. etal, Human Gene Ther. 70: 189-200 (1999); Lin, X., Gene Ther. 5:1251-1258 (1998)) or Semliki Forest virus-derived expression vectors (Li, K.J. and H. Garoff, Proc. Natl. Acad. Sci. USA 95:1 1658- 1 1663 (1996)).
- the presence of mature virion proteins, such as p30(CA) suggests that the viral protease is being prematurely activated and may result, by comparison with HIV, in inhibition of virion formation.
- the cellular ratio of Pr65 gag and p30(CA) may be a useful indicator for the efficiency of virion assembly and retrovirus production. Based on the density of the bands on the western blot in this study, the ratio of Pr65 as /p30(CA) for Gli-36 cells decreased from 0.9 to
- This tribrid vector system provides a means to stably deliver a transgene to a large percentage of cells in a dividing population starting with transduction of a small percentage of cells.
- activity levels of a retrovirally encoded transgene when 20% of cells were initially transduced, activity levels of a retrovirally encoded transgene
- lacZ rose 5 to 6-fold over time, despite the decline in amplicon-mediated transgene expression (Fig. 6).
- amplicon-transduced cells express GFP and LacZ encoded by the episomal amplicon, and produce retrovirus vectors carrying the lacZ gene, while at the same time they are themselves resistant to infection by those same retrovirus vectors due to the presence of the envelope proteins on the cell surface (Coffin, J. M., in B. N. Fields et al, (ed.) Fields Virology, Raven Publishers, Philadelphia (1996)).
- each episome carries 6 copies of each transgene.
- the second genotype represents uninfected cells which do not express any transgenes, but are susceptible to infection by retrovirus vectors produced by amplicon-transduced cells. With time, a third cell type appears in the population which expresses lacZ from retrovirus vector sequences stably integrated in their genome, and is receptive to multiple retroviral infections.
- the third cell type becomes more prominent with time, until it is the sole contributor to lacZ activity in the population, and essentially no more retrovirus vectors are produced.
- Total lacZ activity in the population at any time is the sum oflacZ expressed from the episomes (6 copies/episome x number of episomes per cell) and from the retrovirus vectors stably integrated in the cell genome (1 copy /infection x number of infections). Absolute levels of lacZ activity will depend on the relative activity of the LTR promoter in the context of the episome or at different sites of integration in different cell types.
- the HERA triple hybrid gene delivery system of the present invention could be used in vivo to directly modify specific cell populations, which by their position, migratory or tissue/organ targeting properties, could secondarily deliver retrovirus vectors to progenitor/stem cells or to a larger population of dividing cells, resulting in expanded spatial distribution of transgene expression.
- Several applications for this gene delivery amplification mechanism include tumor therapy and genetic modification of the developing central nervous system, hematopoietic system, lung epithelium, and other proliferating cell populations.
- the vector system of the invention may also be used for two modalities of therapeutic gene delivery to tumors.
- the retrovirus producer cells would be derived from the tumor cells themselves and thus presumably share the same growth and migratory patterns; in the other mode, normal cells with migratory or tumor targeting properties could be used as gene delivery vehicles, e.g., neuronal progenitor cells (Aboody-Guterman, K.S., "Neural stem cells migrate throughout and express foreign genes within experimental gliomas — a potential gene therapy approach to brain tumors" (submitted for publication,
- endothelial cells Lai, B., etal, Proc. Natl. Acad. Sci. USA 97:9695-9699 (1994)
- tumor infiltrating lymphocytes Kasid, A., et al, Proc. Natl. Acad. Sci. USA 57:473-477 (1990)
- packaging cell lines currently in use which are derived from mouse fibroblasts, do not display migratory properties in the context of brain tumors (Ram, Z., et al, Nature Med.
- the packaging cells tend to form clusters around the injection site, and given the limited diffusion of retroviruses through cell layers, only those packaging cells close to the cluster surface release retrovirus vectors which can infect tumor cells. As a result, the number of vector particles that reach tumor cells is much lower than what would be expected from the number of packaging cells implanted. Furthermore, these retrovirus vectors have a relatively short half-life and can only infect dividing cells.
- Tamura et al. have shown that if the same type of glioma cells are implanted in the tumor mass, they tend to migrate along the same routes as the initial tumor cells and eventually reach them (Tamura, M., et al, Human Gene Ther. 5:381-391 (1997)). Using tumor cells themselves as retrovirus producers could possibly bypass the current restrictions to gene delivery by retrovirus vectors by spreading vector production over larger areas. Although some tissues, like the CNS, are relatively immune privileged sites, an immune response to expressed retroviral proteins or transgene products would limit the survival of amplicon-derived packaging cells.
- immune-modulatory molecules such as those that tumors use to evade the immune system, e.g. , CD95 ligand, transforming growth factor- ⁇ , interleukin- 10
- transgene delivery amplification mechanism could also be used to expand the range of gene delivery in the developing CNS.
- Several studies performed with replication competent retrovirus vectors during development have shown that transgenes can be delivered to a large number of cells throughout the entire CNS (Fekete, D. M. and C. L. Cepko, Mol. Cell Biol. 75:2604-2613
- the HERA system of the present invention could be used in a similar, but safer, manner to achieve widespread gene delivery in the CNS. Genetic modification of cells in the subventricular zone would create two amplifying effects: first, production of retrovirus vector in that area could result in genetic modification of neuronal progenitors that would later migrate out into the brain and differentiate into neurons. Second, amplicon- transduced cells could themselves migrate to other regions of the brain where they can come in close contact with populations of dividing glia during gliogenesis. Such spatial expansion mechanisms would be useful for gene delivery in disease states where the entire CNS is involved and can be corrected by diffusible factors, as is the case for some lysosomal storage disorders.
- This same principle can be used for genetic modification of the hematopoietic system. This could be achieved by transducing CD34-positive cells in culture followed by re-implantation and migration of these cells to the bone marrow where they would come in close contact with dividing hematopoietic stem cells.
- the amplicon vector could be directly inj ected into the bone marrow. These strategies could be used for gene delivery to normal bone marrow, and also in the context of leukemia.
- retrovirus vectors produced in situ would preferentially infect leukemic cells.
- prodrug activating enzymes that result in the production of metabolites whose cytotoxic effects are cell cycle dependent, such as the HSV-tA: /ganciclovir system.
- Adenovirus vectors and liposomes are capable of transducing the lung epithelium with varying degrees of efficiency. Due to the non-integrative nature of these delivery modalities and the turnover of cells in the lung epithelium, these strategies only achieve transient expression of transgenes. Repeated administration of some of these agents results in strong inflammatory immune responses.
- An alternative approach using integrating vectors, such as lentivirus vectors Goldman, M. J., et al, Human Gene Ther. 5:2261-2268 (1997)), would also require repeated administration of the viral vector due to turnover of transduced cells.
- type I pneumocytes terminalally differentiated
- type II pneumocytes stem cells
- direct vector will most likely transduce type I cells.
- type I cells are derived from type II cells
- the latter dividing cells are the appropriate targets to achieve stable genetic modification of the lung epithelium.
- infection of the lung epithelium with HERA amplicons should convert type I cells into retrovirus producer cells, which can deliver vectors to type II cells in the vicinity when they divide and they, in turn, would give rise to genetically modified type I cells.
- This novel triple hybrid amplicon delivery system provides a means to extend retrovirus gene delivery to larger numbers of cells over a wider distribution in the body, as compared to current retrovirus producer cells. It also potentially allows the direct conversion of endogenous cells to packaging cells and thus should have wide application in methods of gene therapy.
- NIH 3T3 cells NIH 3T3 cells, 2-2 cells, Gli-36 human primary glioma cells, and J3T dog glioma cells were obtained as described in Example 1.
- Naive Mus dunni cells MD
- Mus dunni cells expressing lacZ MDZ
- ⁇ CRIPlacZ Danos, O., and
- NIH 3T3 and ⁇ CRIPlacZ cells were grown in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% calf serum (Sigma, St. Louis, MO). 293T/17, Gli-36, J3T, and 2-2 cells were grown in DMEM with 10% fetal bovine serum
- MD and MDZ cells were grown in DMEM/F12 and 5% fetal bovine serum. All medium was supplemented with 100 U/ml penicillin and 0.1 mg/ml streptomycin (Sigma). 2-2 cells growth medium was further supplemented with 0.5 mg/ml G418 (GIBCO BRL, Gaithersburg, MD). Cells were grown at 37°C and 5% CO2 in a humidified atmosphere. Transduced J3T and Gli-36 cells were selected in growth medium supplemented with 1 mg/ml G418 and/or 1 ⁇ g/ml puromycin (Sigma).
- the retrovirus gag-pol and env genes were obtained from pcDNA3.1 MOVAmpho, which is described in Example 1. Briefly, the GPE cassette was modified to remove all non-coding regions after the stop codon of the envelope gene and promoter regions from the 5' LTR.
- the gag-pol genes were derived from the plasmid pMOV ⁇ " , which has a 350 bp deletion that removes the retroviral packaging signal (Mann, R.. et al, Cell 55: 153-159 (1983)), while the env gene was derived from the 4070A amphotropic genome (Chattopadhyay, S. K., et al, J. Virol. 39:111-191 (1981)).
- the GPE cassette was removed by digestion with Nbe I and Pme I and the resulting 7390 bp fragment was cloned into the same restriction sites in HyRGFP
- the retrovirus vector element was derived from the plasmid TVBPlacZ, which is described in Example 1. This plasmid was constructed from the retrovirus vector Babepuro (Morgenstern, J.P., and Land., H., Nucleic Acids Res. 75:3587-3596 (1990)), obtained from Dr.
- This plasmid was in turn digested with Not I and the resulting fragment, carrying the retrovirus element flanked by the AAV ITRs, was cloned into the Not I site of the plasmid HSRepN I (Id.) generating the plasmid, HyBPlacZ.
- This fragment derived from pITRBPlacZ was also cloned into the Not I site of the plasmid HSvec2 (similar structure to HSRepN 1 , but missing the Rep expression cassette) (Id.) originating the plasmids, HSHyBPlacZ #2.2 and HSHyBPlacZ #2. 1.
- the Not I fragment derived from TVBPlacZ was also cloned into HSvec2, generating the plasmids, HSTVBPlacZ #3.2 and HSTVBPlacZ #1.2; and into HSRepN 1, originating the plasmids, HSRepTVBPlacZ # 1.1 and HSRepTVBPlacZ #3.5.
- the plasmid pcDNA3.1 luc was constructed by removing the firefly luciferase gene from the pGem®-/wc vector (Promega, Madison. WI) with Bam HI and Xho I and cloning into the same sites of pcDN A3.1 Neo (Invitrogen, Carlsbad, CA).
- Retrovirus packaging 293T/17 were transfected by DNA/calcium phosphate co-precipitation essentially as described in Example 1, using 2xl0 6 cells per 60 mm dish and 15 ⁇ g of each plasmid. Supernatants were isolated for retrovirus titering 48 hours post- trasnfection.
- Retrovirus titer determination For all retrovirus titers determined in this example, the media from retrovirus vector producing cells was centrifuged at 500 x g for 5 minutes before use. Titers were determined by infecting NIH3T3 cells overnight with different dilutions of retrovirus stocks in the presence of 4 ⁇ g/ml polybrene (Sigma). Two days later, cells were fixed in 4% paraformaldehyde in phosphate buffered saline (PBS) and stained with X-gal (5-bromo-4-chloro- indolyl- ⁇ -D-galactopyranoside, Fisher, PA) solution (1 mg/ml X-gal, 2 mM
- Retroviral stocks were assayed for replication competent retrovirus by a lacZ mobilization assay via Mus dunni cells as previously described in Example 1. To determine the sensitivity of the assay, titered wild type 4070A virus amphotropic virus stocks, obtained from Dr. Richard Mulligan, were used and the assay was shown to be able to detect one particle of 4070A virus per ml of infectious medium. All retrovirus stocks produced in the present Example were negative for RCR by this assay. Amplicon packaging. Plasmids were packaged as HSV amplicons using the helper virus-free packaging system developed by Fraefel et al, discussed above.
- 2-2 cells were transfected using lipofectamine (GIBCO BRL) with a mixture of plasmid to be packaged and a set of 5 linearized cosmids.
- Amplicon stocks were harvested 60 hours later by scraping the, cells into the medium, followed by two freeze/thaw cycles, and purification by centrifugation at 1000 x g for 10 minutes.
- Amplicon titers were determined in triplicate by infecting 3x 10 5 293T/17 cells/well in 24 well plates with different dilutions. For amplicons carrying lacZ, cells were fixed and stained with X-gal at 18 to 24 hours post-infection.
- the total number of positive cells (blue cells) per well was determined by counting 3 random fields/well at 1 OOx magnification. Titers were calculated using that number and amplicon stock dilution, and were expressed as transducing units per ml (tu/ml).
- HyRMOV Ampho amplicon cells were fixed with 4% paraformaldehyde at 37°C for 30 minutes at 18 to 24 hours post- infection. Transduced cells were detected by immunocytochemistry using a goat antibody developed against Rauscher murine virus p30 (Quality Biotech Inc.), which cross-reacts with the MoMLV p30(CA) protein.
- Detection was performed for 2 to 5 minutes in DAB solution prepared by dissolving SIGMAE STTM' DAB tablets (Cat. #: D-4168, Sigma) inH 2 O (0.7 mg/ml 3,3'-diaminobenzidine [DAB], 10 mg/ml Urea hydrogen peroxide, and 60 mM Tris buffer). All incubations were performed at room temperature and between each step, cells were washed 4 times with PBS. Total number of positive cells (brown cells) per well was determined and amplicon titers were calculated as above.
- DAB solution prepared by dissolving SIGMAE STTM' DAB tablets (Cat. #: D-4168, Sigma) inH 2 O (0.7 mg/ml 3,3'-diaminobenzidine [DAB], 10 mg/ml Urea hydrogen peroxide, and 60 mM Tris buffer). All incubations were performed at room temperature and between each step, cells were washed 4 times with PBS. Total number of positive cells (brown cells) per well was determined and
- Beta-galactosidase and luciferase activity measurements Two days post- transfection, cells were washed twice with PBS and lysed in 300 ⁇ l of IX Reporter lysis buffer (Promega) for 15 minutes at room temperature. The lysate was centrifuged at 17,000 x g for 2 minutes at 4°C and the supernatant was used to measure beta-galactosidase and luciferase activities. LacZ activity in each sample (10 ⁇ l of lysate) was measured using a beta-glactosidase assay kit (Promega). Samples and standards were incubated for 30 minutes at 37°C.
- luciferase activity 100 ⁇ l of lysate was mixed with 370 ⁇ l of luciferase buffer (25 mM glycylglycine, 15 mM MgSO 4 , 4 mM EGTA-pH 7.8) containing 2 mM ATP, 1 mM dithiothreitol, and 15 mM potasssium phosphate (pH 7.8), and assayed using a 1251 luminometer in integral mode (Wallac, Gaithersburg, MD) in the presence of 0.2 mM D-Luciferin (Sigma) in luciferase buffer.
- luciferase buffer 25 mM glycylglycine, 15 mM MgSO 4 , 4 mM EGTA-pH 7.8 containing 2 mM ATP, 1 mM dithiothreitol, and 15 mM potasssium phosphate (pH 7.8)
- the activity of the LTR promoter in each vector for each experimental condition was expressed as a ratio between lacZ activity and luciferase activity (internal control for transfection efficiency), and compared to the average of ratios obtained for TVBPlacZ transfected cells (Relative LTR activity). This experiment was repeated twice in triplicate.
- Retrovirus vectors Retrovirus vector stocks were produced by co-transfection of 293T/17 cells with retrovirus vector plasmids and pcDNA3.1 MOVAmpho. J3T and Gli-36 cells were infected overnight in the presence of 4 ⁇ g/ml polybrene and 2 days later placed in selective growth medium containing 1 ⁇ g/ml puromycin.
- Amplicon vectors Cells (5x10 5 cells/60 mm plate) were infected with amplicon stocks at different MOIs in a total volume of 3 ml. The following day, medium was replaced with fresh growth medium and incubated for 24 hours before harvesting the supernatant for retrovirus titering. Transduced Gli-36 and J3T cells were then selected in growth medium containing 1 mg/ml G418 and
- Proteins were transferred to nitrocellulose membrane (BioRad Trans- Blot Transfer Medium Pure 0.45 ⁇ m) in transfer buffer (25 mM Tris, 192 mM Glycine, pH 8.3) using a BioRad Transblot Cells for 3 hours at 0.5 mA at 4°C. Membranes were stained with 0.2% Ponceau S (Sigma) to ensure equal loading of samples and proper transfer. After staining, the membranes were blocked overnight in 10% non-fat dry milk powder in TBST ( 150 mM NaCl, 50 mM Tris, pH7.9, 0.05% Tween 20).
- membranes were washed twice for 15 minutes and twice for 5 minutes in TBST and then incubated for 1 hour at room temperature with 1 :3000 dilution of the primary antibodies in 2% non-fat dry milk powder in
- Anti-p30 and anti-p70 antibodies were developed in goat against Rauscher murine virus p30 (Ca protein) and p69/71 (SU protein) proteins, respectively (Quality Biotech Inc.). The membranes were washed as before and incubated for 30 minutes with a 1 :5000 dilution of anti-goat IgG peroxidase conjugated secondary antibody (Santa Cruz Biotechnology, Santa Cruz. CA) in TBST with
- the blot was UV cross-linked with a Stratalinker (Strategene, La Jolla, CA) in automatic mode.
- the membrane was prehybridized for 4 hours at 42°C in hybridization solution (0.75 M NaCl, 50 mM NaH 2 PO 4 , 5 mM EDTA, pH 7.4.
- lOx Denhardt's solution 100 ⁇ g/ml freshly denatured sheared salmon sperm DNA, 50% formamide (v/v) and 2% SDS).
- the probe (30 ng - 1.2 kb fragment of lacZ gene from Sac I site to stop codon) was labeled with 32 P using a DEC AprimeTMII kit (Ambion, Austin, TX) with a final specific activity of 1.8x 10 9 cpm/ ⁇ g and purified with MicroSpinTM
- HSV/AA Retrovirus (HAR) hybrid amplicons and effect of Rep expression cassette on downstream promoters Modified retrovirus gag-pol and env genes and vector elements were cloned in a HSV/AAV hybrid amplicon, generating the amplicon plasmids, HyRMOVAmpho and HyBPlacZ, respectively (Fig. 8). Co-transfection of these plasmids into 293 T/l 7 cells originated retrovirus titers of 4. lxl 0 5 ⁇ 1.6x10 5 tu/ml ( ⁇ standard deviation).
- LacZ(+) retroviruses by infecting NIH3T3 cells. Presence of the Rep expression cassette resulted in a significant decrease in retrovirus titers for both HyRMOVAmpho and HyBPlacZ hybrid amplicons.* R ⁇ 0.001
- Activity of the LTR promoter in each vector was expressed as the ratio between lacZ and luciferase activities to normalize for transfection efficiency. These ratios were all compared to the average activity of the LTR promoter in TVBPlacZ - relative LTR activity (Fig. 9B). For amplicons where the Rep expression cassette is present, HyBPlacZ (a), HSRepTVBPlacZ #1.1 (f), and HSRepTVBPlacZ #3.5 (g), relative LTR activities were below 15% (Fig. 9B -2, 3, 13, 14, 15, and 16). Presence of Rep in trans resulted in small decreases in promoter activity for these amplicons (Fig. 9B - 4, 14, 16).
- HSHyBPlacZ #2.2 (b), HSHyBPlacZ #2.1 (c), showed relative promoter activities of 65 and 70%, respectively, and presence of Rep in trans had no effect on promoter activity (Fig. 9B - 9, 10, 1 1, 12).
- the HSHyBPlacZ #2.2 hybrid amplicon plasmid was choosen for further experiments since it has the AAV ITR elements and the activity of the LTR promoter is not severely compromised.
- the plasmid was co-transfected into 293T/17 cells with pcDNA3.1MOV and HyRMOVAmpho, resulting in retrovirus titers of 6.2x10 6 ⁇ l .lxlO 6 tu/ml and 4.8xl0 5 ⁇ 2.7 x 10 5 tu/ml, respectively, comparable to titers obtained with TVBPlacZ (Table 2).
- HyRMOVAmpho and HSHyBPlacZ #2.2 amplicons were packaged in HSV virions using a helper virus-free packaging system (Fraefel, C, et al, J. Virol. 70:7190-7197 (1996)). Amplicon vector stocks were consistently produced with titers between 10 6 and 5xl0 6 tu/ml for both vectors. Gli-36, J3T, and 293T/17 cells were infected with both vectors simultaneously at the same multiplicity of infection (MOI).
- MOI multiplicity of infection
- Gli-36 and 293T/17 cells were infected at MOIs of 1 and 5, while J3T cells were infected at MOIs of 2 and 5 (Fig. 10).
- retrovirus titers in the medium were 1.6xl0 4 ⁇ 9.3xl0 3 (MOI 1) and 2.2xl0 4 ⁇ 1.3xl0 4 tu ml (MOI 5) for Gli-36 cells (Fig. 10 - 1, 2), and 273+49 (MOI 1 ) and 3.4xl0 3 ⁇ 3.2xl0 3 tu ml (MOI 5) for 293T/17 cells (Fig. 10 - 11, 12).
- MOI of 1 and 5 was 82 and 100%, while for J3T cells infected at MOI of 1 and 5, that was 33 and 85%, respectively, as evaluated by the percentage of lacZ positive cells (blue cells after X-gal staining) at 48 hours post-infection. Infected cells were selected in medium containing puromycin and G418, and retrovirus titers were determined again at 30 and 55 days post-infection for non-clonal populations (Fig. 10).
- 293T/17 cells by co-transfection with pcDNA3.1 MOV Ampho. After infection, cells were selected in puromycin and non-clonal resistant populations were generated (Gli-36BabelacZ, J3TBabelacZ, Gli-36HSHyBPlacZ, and J3THSHyBPlacZ). X-gal staining of these populations showed that all cells were lacZ positive. Retrovirus modified Gli-36 and J3T cell populations were then infected with HyRMOVAmpho amplicon at MOI at 1 and 5 and MOI of 2 and 5, respectively (Fig. 11).
- retrovirus titers in the supernatants were: 3.5xl0 4 ⁇ 1.4xl0 4 (MOI 1) and 1.3xl0 5 ⁇ 2.1xl0 4 tu/ml (MOI 5) for Gli-
- retrovirus titers were: 2.2x10 5 ⁇ 4.9x10 4 tu/ml (MOI 5) for Gli- 36BabelacZ (Fig. 11 - 4); 2.5xl0 5 ⁇ 4.9xl0 4 (MOI 2) and 5.1xl0 5 ⁇ 3.3xl0 4 tu/ml (MOI 5) for J3TBabelacZ (Fig. 11 - 6,8); 1.3xl0 5 ⁇ 3.3xl0 4 (MOI I) and 2.0xl0 5
- retrovirus titers were determined again and found to be similar to the titers obtained at day 86.
- retrovirus titers produced by an established packaging cell line, ⁇ CRIPlacZ (Danos, O., and Mulligan, R.C., Proc. Natl. Acad. Sci. USA 55:6460-6464 (1988)), were determined using the same culture conditions and found to be 4.5xl0 5 ⁇ 6.7xl0 4 tu/ml (Fig. 1 1 - 17).
- the efficiency of retrovirus vector production was evaluated by calculating the average number of retrovirus transducing units produced per cell. This ratio was determined to be 0.29 to 0.64 for Gli-36 derived packaging cells, 0.57 to 1.36 for J3T derived packaging cells, and 2.1 for ⁇ CRIPlacZ cells (Table 3).
- J3THSHyBPlacZ 5 1.11 ⁇ 0.22 ⁇ CRIPlacZ - 2.1 ⁇ 0.7
- HyRMOVAmpho amplicon at different MOIs and G418 selection.
- b R Average number of retroviral transducing units produced per cell.
- retrovirus proteins in stable packaging cell lines were 2 to 4-fold less efficient thatn ⁇ CRIP cells in producing retrovirus vectors.
- expression of retrovirus proteins in these cells was analyzed by western blot, using antibodies that recognize MoMLV p30(CA) (capsid protein) and gp70(SU) (surface envelope protein) (Figs. 12 A and B). Pr200 ga /po1 and Pr65 gag precursor polyproteins were present in all cell lines as well as p30(CA) (Fig. 12A).
- Pr200 ga po1 and Pr65 gag , in J3T derived packaging cells were 10 and 1.7-fold higher, respectively, than in Gli-36 derived packaging cells (Figs. 12A, lanes 5, 10-12).
- Expression of gp70(SU) was 2-fold higher in J3T derived cell lines (Figs. 12B, lanes 4, 6-9) when compared to Gli-36 derived packaging cells (Figs. 12B, lanes 5, 10-12).
- Fig. 12B (asterisk in Fig. 12B) could be a non-glycosylated form of gp70(SU) protein.
- retrovirus titers (10 to 100-fold)
- Figs. 10 and 1 1 no significant difference in expression of retroviral proteins was observed between the two methods of generating stable packaging cell lines: simultaneous infection with both amplicon vectors (Figs. 12A and B, lanes 4 and 5) or double vector- double step strategy (Figs. 12A and B, lanes 6-12).
- Expression of retrovirus proteins, Pr65 gag and gp70(SU), Gli-36 and J3T derived packaging cell lines was 2 to 4-fold and 18 to 36-fold higher than in ⁇ CRIPlacZ cells (Fig.
- Retrovirus genes and vector element can both be delivered by adenoviral vectors
- Adenovirus vectors can be produced at very high titers (>10'° pfu/ml) and can achieve remarkable gene transfer efficiencies in some circumstances in vivo.
- the present invention demonstrates that the principle can work, but conceptually the process should be more efficient if a single adenovirus vector contained all necessary elements to generate retrovirus vectors. Although the size limitation of conventional adenovirus vectors precludes the construction of such vector, "gutless" adenovirus vectors could easily accommodate all the components.
- the hybrid amplicon vector system described in this Example has several advantages over existing vector systems for generating retroviral vectors: (1) all elements necessary for production of replication-deficient retrovirus vectors are present or can be placed in the same construct. In theory, the conversion efficiency per transduced cell is 100%, independently of whether amplicon DNA is introduced into cells by transfection or infection; (2) not only do HSV virions have a wide host range,stability and high infectability, but due to their large DNA capacity and the mode of viral DNA replication, each amplicon vector carries multiple copies of the amplicon plasmid. This means that for each transduction event, multiple copies of the transgenes are delivered to the cell nucleus.
- the mode of retention contributed by the AAV elements is complex and cell type dependent, as it is for AAV vectors.
- the retention process itself can occur through replicative amplification of the ITR-flanked sequencs, thus creating hundreds to thousands of copies in the cell nucleus, or by integration via a circularized intermediate either randomly or site-specifically in human chromosome 19ql3.3 (Duan, D., et al, J Virol 75:161-169 (1999); Flotte,T.R. and BJ. Carter, Gene Therapy 2:357-362 (1995)).
- These retention properties occur to different extents in different cell types as a function of species of origin and state of cell, including dividing/non-dividing state (Russell, D.
- Infectability of target cells by HSV virions is a primary determinant of the levels of retrovirus vectors produced by a cell population, while the transduction efficiency by retrovirus vectors is ultimately responsible for long term transgene retention. It is believed that the same factors affecting retrovirus titers in the HSV/EBV/retrovirus system (Example 1) may have a role in the HSV/AAV/retrovirus sytem.
- the remarkable feature of the HSV/AAV/RV packaging system is that following infection with the amplicon vectors, stable, packaging cell lines were generated, which produced high titer retrovirus vectors without being maintained on drug selection for both J4T and Gli36 cells. This occurred for up to 100 days after infection with continuous division of cells, thus, supporting a mechanism of genomic intergration.
- This feature should allow generation of stable packaging cell lines in culture, as well as in vivo following a single infection with the amplicon vector. Assuming immune rejection of the packaging cells can be avoided by temporary repression of expression of gag-pol-env genes or by other means of inhibition of immune recognition, these cells should have an extended timespan of retrovirus vector gene delivery in vivo.
- This tribrid vector system provides a means to stably deliver a transgene to a large percentage of cells in a dividing population starting with transduction of a small percentage of cells.
- the first genotype, amplicon-transduced cells express GFP and lacZ encoded by the episomal amplicon, and produce retrovirus vectors carrying the lacZ gene, while at the same time they are themselves resistant to infection by those same retrovirus vectors due to the presence of the envelope proteins on the cell surface (Coffin, J. M., in B. N. Fields et al, (ed.) Fields Virology, Raven
- the second genotype represents uninfected cells which do not express any transgenes, but are susceptible to infection by retrovirus vectors produced by amplicon-transduced cells.
- a third cell type appears in the population which expresses lacZ from retrovirus vector sequences stably integrated in their genome, and is receptive to multiple retroviral infections.
- the extent of loss of the HSV/AAV amplicon elements will vary from cell to cell, but in general, some portion of the amplicon infected cells will stably retain the packaging elements and continue to produce retrovirus vectors and resist infection by them for long to indefinite periods; another portion will lose the amplicon sequences and thus stop making retrovirus vectors, but become infectable by them.
- the triple hybrid gene delivery system of the present invention could be used in vivo to directly modify specific cell populations, which by their position, migratory or tissue/organ targeting properties, could secondarily deliver retrovirus vectors to progenitor/stem cells or to a larger population of dividing cells, resulting in expanded spatial distribution of transgene expression.
- Several applications for this gene delivery amplification mechanism include tumor therapy and genetic modification of the developing central nervous system, hematopoietic system, lung epithelium, and other proliferating cell populations.
- the retrovirus components in this tribrid system are derived from MoMLV, which can only infect dividing cells, this could be su ⁇ assed by replacing those components with lentivirus elements, thus allowing for production of retroviral vectors that can infect both dividing and non-dividing cells.
- the vector system of the invention may also be used for two modalities of therapeutic gene delivery to tumors.
- the retrovirus producer cells would be derived from the tumor cells themselves and thus presumably share the same growth and migratory patterns; in the other mode, normal cells with migratory or tumor targeting properties could be used as gene delivery vehicles, e.g., neuronal progenitor cells (Aboody-Guterman, K.S., "Neural stem cells migrate throughout and express foreign genes within experimental gliomas ⁇ a potential gene therapy approach to brain tumors" (submitted for publication, 1999), endothelial cells (Lai, B., etal, Proc. Natl. Acad. Sci. USA 97:9695-9699 (1994)), and tumor infiltrating lymphocytes (Kasid, A., et al, Proc. Natl. Acad.
- packaging cell lines currently in use which are derived from mouse fibroblasts, do not display migratory properties in the context of brain tumors (Ram, Z., et al, Nature Med. 5:1354-1361 (1997); Tamiya, T., et al, Gene Ther. 2:531-538 (1995); Tamura, M., et al, Human Gene Ther. 5:381-391 (1997)).
- the packaging cells tend to form clusters around the injection site, and given the limited diffusion of retroviruses through cell layers, only those packaging cells close to the cluster surface release retrovirus vectors which can infect tumor cells.
- Tamura et al. have shown that if the same type of glioma cells are implanted in the tumor mass, they tend to migrate along the same routes as the initial tumor cells and eventually reach them (Tamura, M., et al, Human Gene Ther. 5:381-391 (1997)). Using tumor cells themselves as retrovirus producers could possibly bypass the current restrictions to gene delivery by retrovirus vectors by spreading vector production over larger areas.
- an immune response to expressed retroviral proteins or transgene products would limit the survival of amplicon-derived packaging cells.
- immune-modulatory molecules such as those that tumors use to evade the immune system, e.g. , CD95 ligand, transforming growth factor- ⁇ , interleukin- 10 (Hahne, M., et al, Science 274:1363-1366 (1996)).
- the main advantage of this triple hybrid amplicon gene delivery system is that it should mediate retrovirus vector production in situ after direct injection of amplicon vector stocks into the tumor mass, without the need for any tissue culture manipulation or implantation of exogenous cells.
- This transgene delivery amplification mechanism could also be used to expand the range of gene delivery in the developing CNS.
- Several studies performed with replication competent retrovirus vectors during development have shown that transgenes can be delivered to a large number of cells throughout the entire CNS (Fekete, D. M. and C. L. Cepko, Mol. Cell Biol. 75:2604-2613 (1993)).
- RCRs carry with them not only the transgene of interest but also a high risk of insertional oncogenesis.
- the triple hybrid system of the present invention could be used in a similar, but safer, manner to achieve widespread gene delivery in the CNS.
- telomeres in the subventricular zone Genetic modification of cells in the subventricular zone would create two amplifying effects: first, production of retrovirus vector in that area could result in genetic modification of neuronal progenitors that would later migrate out into the brain and differentiate into neurons. Second, amplicon- transduced cells could themselves migrate to other regions of the brain where they can come in close contact with populations of dividing glia during gliogenesis. Such spatial expansion mechanisms would be useful for gene delivery in disease states where the entire CNS is involved and can be corrected by diffusible factors, as is the case for some lysosomal storage disorders.
- This same principle can be used for genetic modification of the hematopoietic system. This could be achieved by transducing CD34-positive cells in culture followed by re-implantation and migration of these cells to the bone marrow where they would come in close contact with dividing hematopoietic stem cells.
- the amplicon vector could be directly injected into the bone marrow.
- These strategies could be used for gene delivery to normal bone marrow, and also in the context of leukemia. Since bone marrow stem cells divide very slowly, it is possible that retrovirus vectors produced in situ would preferentially infect leukemic cells.
- prodrug activating enzymes that result in the production of metabolites whose cytotoxic effects are cell cycle dependent, such as the HSV-t /ganciclovir system.
- Adenovirus vectors and liposomes are capable of transducing the lung epithelium with varying degrees of efficiency. Due to the non-integrative nature of these delivery modalities and the turnover of cells in the lung epithelium, these strategies only achieve transient expression of transgenes. Repeated administration of some of these agents results in strong inflammatory immune responses.
- An alternative approach using integrating vectors, such as lentivirus vectors Goldman, M. J., et al, Human Gene Ther. 5:2261-2268 (1997)), would also require repeated administration of the viral vector due to turnover of transduced cells.
- type I pneumocytes terminalally differentiated
- type II pneumocytes stem cells
- direct vector will most likely transduce type I cells.
- type I cells are derived from type II cells
- the latter dividing cells are the appropriate targets to achieve stable genetic modification of the lung epithelium.
- infection of the lung epithelium with the amplicons of the invention should convert type I cells into retrovirus producer cells, which can deliver vectors to type II cells in the vicinity when they divide and they, in turn, would give rise to genetically modified type I cells.
- This novel triple hybrid amplicon delivery system provides a means to extend retrovirus gene delivery to larger numbers of cells over a wider distribution in the body, as compared to current retrovirus producer cells. It also potentially allows the direct conversion of endogenous cells to packaging cells and thus should have wide application in methods of gene therapy.
- Fig. 14 is a graph depicting the effect of Epstein-Barr virus elements on the duration of retrovirus vector production by tumor cells.
- Human Gli-36 glioma cells (triangles) and J3T dog glioma cells (circles) were infected at MOI of 2 with the HSV/EBV/Retrovirus tribrid amplicon (B7; closed triangle and circle) and an
- HSV amplicon with identical structure but missing the EBV oriP and EBNA-1 gene (HRA; open triangle and circle). Retrovirus production was analyzed over a period of 8 days. Titers were normalized for vector titers at 3 days post-infection
- Fig. 15 depicts the structure of "HERAC" vectors.
- the retrovirus vector component was modified by replacing the 5' LTR with a CMV-LTR hybrid promoter. This modified retrovirus vector was inserted in the HER backbone in two different orientations (K16 and K19).
- Fig. 16 depicts the structure of "BiHERA” vectors. Expression of the retrovirus structural genes and vector element were placed under the control of a bidirectional CMV promoter. This cassette was cloned in the HSV/EBV amplicon backbone in two different orientations (Clones Q4 and Q8).
- Fig. 17 is a bar graph depicting the relative retrovirus vector titers for new versions of the HERA tribrid vector.
- the retrovirus component of the HERA vector (B7) was modified to inco ⁇ orate a hybrid CMV-LTR promoter at the 5 '-end, and inserted in the HER backbone in two different orientations (HERAC K16, K19).
- a bidirectional cassette designed for expression of the retrovirus structural genes and vector component from the same promoter was also inserted in two directions in the hybrid HSV/EBV amplicon (BiHERA Q4, Q8).
- Retrovirus titers were determined at 48 hours post-transfection of 293T/17 cells.
- the percentage of green fluorescent protein (GFP)-positive cells was measured by fluorescence-activated cell sorting (FACS) analysis at day 2 and day 7.
- FACS fluorescence-activated cell sorting
- NIH 3T3 cells were infected with supernatant from amplicon-infected HI cells. Forty-eight hours after infection, NIH 3 T3 cells were stained with X-Gal solution and retroviral titers were determined.
- the results in Figure 19 show high titer production of retrovirus vectors (10 6 tu/ml) by neural progenitor cells infected with the tribrid amplicon vector, decreasing over time, but still significant after 7 days (10 5 tu/ml) at a MOI initial amplicon infection of 10.
- Example 5 Subcutaneous Injection of Glioma Cells Infected in Culture with the Tribrid Amplicon Mixed With Non-Infected Glioma Cells in a Mouse Tumor Model
- Dog glioma cells (J3T I) were infected with the B7 or C 1 hybrid amplicons (described above) at a MOI of 2. Twenty-four hours post-infection, the transduction efficiency was determined by FACS analysis (GFP positive cells). Subsequently B7-infected and non-infected glioma cells were mixed in a ratio of 5%/95%, 10% 90%, 20%/80% and 40%/60%. As a control, Cl -infected cells were mixed with non-infected cells in a ratio of 40%/60%. Subsequently, 5 x 10 6 cells were injected subcutaneously into nude mice. The animals were sacrificed 10 days later (tumor volume ranged from 90 - 145 mm 3 ). Using a cryostat, the tumor was cut into 50 ⁇ m sections and stained with X-gal.
- Figure 20A is a photograph depicting tumor derived from a mixture of tribrid amplicon C 1 - infected J3T I cells with non-infected J3T I cells, in a ratio of 40%/60%. Only a few lacZ positive cells could be detected in the center of the tumor. The loss of transgene expression (40% to less than 10% of tumor) is expected as lacZ is carried only in the amplicon backbone, which is lost over time.
- Figure 20B is a photograph depicting tumor derived from a mixture of tribrid amplicon B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 5%/95%.
- Figure 20A lac Z positive cells were abundant, and equally distributed throughout the tumor. Since even fewer 7 ⁇ cZ-positive cells were initially injected here in comparison to the Cl experiment above (5%/95% vs. 40%/60%), the large number of lacZ cells observed in Figure 20B indicated retrovirus mediated transfer of lacZ and transmission to daughter cells.
- Figure 20C is a photograph depicting tumor derived from a mixture of tribrid amplicon B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 10%/90%. With the increased concentration of amplicon cells, the abundance of transgene positive cells increased dramatically. The inventors estimate that at least 50% of tumor cells are transgene positive with long-term expression.
- Figure 20D is a photograph depicting tumor derived from a mixture of B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 20%/80%.
- 20% of the initial tumor population bears the retrovirus-producing amplicon, virtually the whole tumor becomes positive over 10 days of growth in vivo.
- Figure 20E is a photograph depicting tumor derived from a mixture of B7- infected J3T I cells with non-infected J3T I cells, in a ratio of 40%/60%.
- dog-derived J3T I glioma cells (5x 10 6 cells in 100 ⁇ l) were injected subcutaneously into the flank. After the tumor reached a size of about 100 mm 3 , either 10 ml of B7 (Tribrid Amplicon, Titer 3.14 x 10 8 tu/ml) or 10 ⁇ l of Cl (Control Amplicon, Titer 2.18 x 10 8 tu/ml) were infused into the tumor over a 10 minute period as a single injection. The animals were sacrificed
- the tumors were cut into 20 mm sections and stained with X-gal.
- Figure 21 A is a photograph depicting tumor injection with B7 amplicons. Numerous lacZ positive cells are concentrated around the needle tract. In comparison to the control injection with C 1 ( Figure 21 B), this indicated successful secondary retroviral infection of tumor cells.
- Figure 21 B is a photograph depicting tumor inj ection with the control C 1 amplicons. Only a few lacZ positive cells are visible around the needle tract.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Virology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13055199P | 1999-04-22 | 1999-04-22 | |
| US130551P | 1999-04-22 | ||
| PCT/US2000/010669 WO2000065077A1 (en) | 1999-04-22 | 2000-04-21 | Triple hybrid amplicon vector systems to generate retroviral packaging lines |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1179083A1 true EP1179083A1 (en) | 2002-02-13 |
| EP1179083A4 EP1179083A4 (en) | 2003-04-23 |
Family
ID=22445216
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00923545A Withdrawn EP1179083A4 (en) | 1999-04-22 | 2000-04-21 | VECTOR SYSTEM OF TRIPLIC HYBRID AMPLICONS FOR THE GENERATION OF PACKAGING LINES |
Country Status (3)
| Country | Link |
|---|---|
| EP (1) | EP1179083A4 (en) |
| AU (1) | AU4364700A (en) |
| WO (1) | WO2000065077A1 (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| BR112018010639A2 (en) | 2015-11-24 | 2019-01-22 | Glaxosmithkline Ip Dev Ltd | transient transfection method for retroviral production. |
| EP3380604B1 (en) * | 2015-11-24 | 2022-12-28 | GlaxoSmithKline Intellectual Property Development Limited | Stable cell lines for retroviral production |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5830725A (en) * | 1995-04-28 | 1998-11-03 | The Board Of Trustees For The Leland Stanford Junior University | Rapid, stable high-titre production of recombing retrovirus |
| US5830727A (en) * | 1995-11-18 | 1998-11-03 | Human Gene Therapy Research Institute | Herpes simplex virus amplicon mini-vector gene transfer system |
| AU734063B2 (en) * | 1996-11-12 | 2001-05-31 | Eunice Kennedy Shriver Center For Mental Retardation, Inc. | HSV/AAV hybrid amplicon vectors |
-
2000
- 2000-04-21 EP EP00923545A patent/EP1179083A4/en not_active Withdrawn
- 2000-04-21 AU AU43647/00A patent/AU4364700A/en not_active Abandoned
- 2000-04-21 WO PCT/US2000/010669 patent/WO2000065077A1/en not_active Ceased
Also Published As
| Publication number | Publication date |
|---|---|
| AU4364700A (en) | 2000-11-10 |
| WO2000065077A8 (en) | 2001-10-11 |
| WO2000065077A1 (en) | 2000-11-02 |
| EP1179083A4 (en) | 2003-04-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sena-Esteves et al. | Single-step conversion of cells to retrovirus vector producers with herpes simplex virus–Epstein-Barr virus hybrid amplicons | |
| Seth | Vector-mediated cancer gene therapy: an overview | |
| US7226780B2 (en) | Lentivirus vector system | |
| Gardlík et al. | Vectors and delivery systems in gene therapy | |
| EP0454781B1 (en) | Recombinant cells for therapies of infection and hyperproliferative disorders and preparation thereof | |
| US5837510A (en) | Methods and polynucleotide constructs for treating host cells for infection or hyperproliferative disorders | |
| Walther et al. | Viral vectors for gene transfer: a review of their use in the treatment of human diseases | |
| Rainov et al. | Clinical trials with retrovirus mediated gene therapy–what have we learned? | |
| EP0572401B2 (en) | Viral particles having altered host range | |
| CA2328404C (en) | Novel lentiviral packaging cells | |
| US20020131961A1 (en) | Method for gene transfer using Bcl2 and compositions useful therein | |
| JP5807236B2 (en) | Improved gene delivery system of tumor specific expression with recombined gene expression regulatory sequences | |
| EP0476953A2 (en) | Viral targeted destruction of neoplastic cells | |
| US20080124308A1 (en) | Gene Therapy of Solid Tumours by Means of Retroviral Vectors Pseudotyped With Arenavirus Glycoproteins | |
| US6677155B1 (en) | Triple hybrid amplicon vector systems to generate retroviral packaging lines | |
| Strayer | Viral gene delivery | |
| Howard et al. | Transduction of human pancreatic tumor cells with vesicular stomatitis virus G-pseudotyped retroviral vectors containing a herpes simplex virus thymidine kinase mutant gene enhances bystander effects and sensitivity to ganciclovir | |
| Painter et al. | Conditional expression of a suicide gene by the telomere reverse transcriptase promoter for potential post‐therapeutic deletion of tumorigenesis | |
| Lin | Construction of new retroviral producer cells from adenoviral and retroviral vectors | |
| Hampl et al. | Potentiated gene delivery to tumors using herpes simplex virus/Epstein-Barr virus/RV tribrid amplicon vectors | |
| AU758155B2 (en) | Construction of retroviral producer cells from adenoviral and retroviral vectors | |
| WO1997035994A2 (en) | Cytochrome p450 transducing retroviral vectors | |
| Sena‐Esteves et al. | Generation of stable retrovirus packaging cell lines after transduction with herpes simplex virus hybrid amplicon vectors | |
| US6743631B1 (en) | Use of human serum resistant vector particles and cell lines for human gene therapy | |
| WO2000065077A1 (en) | Triple hybrid amplicon vector systems to generate retroviral packaging lines |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20011122 |
|
| AK | Designated contracting states |
Kind code of ref document: A1 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20030306 |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 12N 15/867 B Ipc: 7C 12N 5/10 B Ipc: 7C 12N 15/38 B Ipc: 7C 12N 15/63 B Ipc: 7C 12N 15/869 B Ipc: 7A 61K 48/00 B Ipc: 7C 12N 15/864 A Ipc: 7C 12N 15/64 B Ipc: 7C 12N 15/86 B |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20030521 |