EP1165752A2 - An engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system - Google Patents
An engineered recombinant molecule that regulates humoral and cellular effector functions of the immune systemInfo
- Publication number
- EP1165752A2 EP1165752A2 EP00975335A EP00975335A EP1165752A2 EP 1165752 A2 EP1165752 A2 EP 1165752A2 EP 00975335 A EP00975335 A EP 00975335A EP 00975335 A EP00975335 A EP 00975335A EP 1165752 A2 EP1165752 A2 EP 1165752A2
- Authority
- EP
- European Patent Office
- Prior art keywords
- cell
- cells
- human
- domain
- ctla4
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Withdrawn
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70596—Molecules with a "CD"-designation not provided for elsewhere
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
- C07K14/70503—Immunoglobulin superfamily
- C07K14/70521—CD28, CD152
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- Chimenc proteins capable of confe ⁇ ng resistance to humoral and cellular mechanisms of immune attack and more particularly chimeric proteins having at least a domain derived from a complement inhibitor protein and a domain derived from a T-Cell inhibitor protein are provided DNA constructs encoding such chimeric proteins and methods of preparing such chimeric proteins are disclosed Methods of using such chimeric proteins, including in the prevention or treatment of rejection of xenotransplants are described
- Chimeric proteins also reterred to in the art as fusion proteins, are hybrid proteins which combine at least parts of two or more precursor proteins or peptides Chimeric proteins may be produced by recombinant technology, 1 e by fusing at least a part of the coding sequence of one gene to at least a part of the coding sequence of another gene The fused gene may then be used to transform a suitable organism which then expresses the fusion protein
- T cells also called T lymphocytes
- T cells recognize foreign pathogens (such as bacteria, viruses, or parasites), tissues, and or organs, and help the immune system process them (causing what is referred to in the art as a cellular immune response), generally clearing the pathogens from the body T cell activation is not only dependent on antigen recognition, but also on engagement of costimulatory molecules found on antigen presenting cells (APCs)
- APCs antigen presenting cells
- the costimulatory signal that determines whether antigen recognition leads to full T cell activation or to T cell unresponsiveness, 1 e anergy, is that generated by the interaction of CD28 on the T cells with B7 on the APCs.
- the complement system (known in the art to be part of the humoral immune system) is an interaction of at least 25 plasma proteins and membrane cofactors which act in a multistep, multiprotein cascade sequence in conjunction with other lmmunological systems of the body tc -efend against intrusion of foreign cells and vin . mars.
- Complement components achieve their immune defensive functions by interacting in a series of intricate but precise enzymatic cleavage and membrane binding events.
- the resulting complement cascade leads to the production of products with opsonic, immunoregulatory, and lytic functions.
- CD59 is known to be the archetypical inhibitor of part of the complement system known as the C5b-9 membrane attack complex (MAC). When activated and not inhibited the C5b-9 MAC can cause potentially deleterious cell activation including cell lysis.
- CD59 is a human glycoprotein, the nucleotide and amino acid sequences for which are set forth in Figure 2E1.
- CD59 is found associated with the membranes of cells including human erythrocytes, lymphocytes, and vascular endothelial cells. It serves to prevent assembly of functional MACs and thus protects cells from complement-mediated activation and/or lysis and is tethered to the outside of the cell membrane by a glycosyl-phosphatidylinositol (GPI) anchor. See, for example, Sims et al.. U.S. Pat. No. 5, 135,916.
- GPI glycosyl-phosphatidylinositol
- Bi-functional complement inhibitor s including fusion proteins constructed from the C3 family of inhibitor proteins (such DAF or CD55) and the C5b-9 family of inhibitor proteins (such as CD59) are known. See U.S. Patents 5,847,082, 5,624,837, and 5,627,264. It has been demonstrated that the CD59 moiety in a DAF-CD59 chimeric molecule functions to inhibit MAC when expressed membrane proximal and anchored through its endogenous GPI linkage. See Fodor et al, (J. Immunol., 155:4135, 1995).
- CTLA4 is a T-cell surface receptor that associates with the B7-1 (CD80) and B7-2 (CD86) molecules which are expressed on antigen- presenting cells. See for example Hancock et al. "Comparative Analysis of B7-1 and B7-2 Co- Stimulatory Ligands: Expression and Function" J. Exp. Med., 180:631, 1994. It is further known that this association establishes the molecular basis for an important T Cell co-stimulatory pathway, the primary function of which is to induce T-cell cytokine production and proliferation following exposure to antigen. See for example Linsley et al., J. Exp. Med.
- U.S. Patent 5,434,131 identifies the CTLA4 receptor as a ligand for the B7 antigen and discloses methods for using soluble fusion proteins to regulate immune responses, including T-cell interactions.
- U.S. Patent 5,773,253 provides CTLA4 mutant molecules as ligands for the B7 antigen and methods for expressing the mutant molecules as soluble functional molecules which regulate T-cell interactions.
- Patents 5,844,095 and 5,851,795 describe methods of expressing CTLA4 as an immunoglobulin fusion protein, methods of preparing hybrid CTLA4 fusion proteins, and memods of using the soluble fusion proteins, fragments and derivatives thereof, to regulate cellular immune responses and T-cell interactions
- U S Patent 5,869,050 discloses methods of blocking T-cell activation using ant ⁇ -B7 monoclonal antibodies to overcome allograft transplant rejection and or graft versus host disease, as well as to prevent or treat rheumatoid arthntis.
- CTLA4 soluble form of CTLA4 or CTLA4IG fusion proteins are used to regulate cellular immune responses and T-cell interactions Therefore, it would be of additional advantage if the CTLA4 moiety could bind endogenously expressed B7-1 and B7-2 molecules in cis and block the co-stimulation necessary for engagement of human CD28 expressed on T-cells. thereby protecting the xenotransplanted porcine cell from the human cellular immune response by rendering the human T-cells unresponsive to the porcine target cell.
- Suitable domains capable of regulating the humoral effector functions of the immune system include complement inhibitory domains, such as a C5b-9 and/or C3 inhibitory domains
- Suitable domains capable of regulating the cellular effector functions of the immune system include T Cell inhibitory domains.
- a membrane bound chimeric molecule which includes functional domains derived from CTLA4 and CD59 is provided.
- a membrane bound chimeric molecule which includes functional domains denved from CTLA4 and DAF is provided
- Cloning vectors incorporating the above DNA constructs and cells transformed with the vectors and host cells containing such vectors are also provided.
- Transgenic cells, tissues, organs, anu animals incorporating the above-mentioned cruuie ⁇ c molecules are provided.
- Methods for preparing a DNA construct including a DNA sequence encoding a CD59 inhibitory domain operably linked to a DNA sequence encoding a T Cell inhibitory domain are provided. Also provided are methods of manufacturing the above described chimeric proteins by transforming a cell with a suitable cloning vector including a DNA construct encoding the chimeric protein, and expressing the gene such that the resulting protein on the cell membrane
- Fig 1 depicts a diagramatic representation of the recombinant chimeric molecules
- Fig. 2A(1) depicts the DNA used in the cloning of porcine CTLA4 - human CD59 chimeric molecules.
- Fig. 2A(2) depicts the amino acid sequence of porcine CTLA4 - human CD59 chimeric molecules
- Fig. 2B(1) depicts the DNA used in the cloning of human CTLA4 - human CD59 chimeric molecules.
- Fig. 2B(2) depicts the amino acid sequence of human CTLA4 - human CD59 chimeric molecules
- Fig. 2C (1) depicts the DNA sequence of porcine CTLA4.
- Fig. 2C(2) depicts the amino acid sequence of porcine CTLA4
- Fig. 2D(1) depicts the DNA sequence of human CTLA4
- Fig. 2D(2) depicts the amino acid sequence of human CTLA4
- Fig. 2E (1) depicts the DNA sequence of human CD59
- Fig. 2E(2) depicts the amino acid sequence of human CD59
- Fig. 3 are florescence activated cell sorting (FACS) profiles that demonstrate the expression of the CTLA4 and CD59 domains of the chimenc molecules on the cell surface of transduced PAECs.
- FACS fluorescence activated cell sorting
- cells were incubated with lOug/ml anti CTLA4, ANC152.2 (Ancell, Bayport, MN) or with lOug/ml of either of the anti-CD59 antibodies, BRA10G or MEM43 (Biodesign, Kennebunk, ME) , for 30 mm., at 4C, in 0.1 m l of Dulbecco's PBS (DPBS) containing 1% Fetal Bovine Serum (FBS) or Bovine Serum Albumin (BSA). Cells were washed with DPBS before incubation with FITC conjugated antibodies to mouse IgG (Zymed, So. San Francisco, CA).
- DPBS Dulbecco's PBS
- FBS Fetal Bovine Serum
- BSA Bovine Serum Albumin
- PI-PLC Phosphatidyl inositol phospho pase C
- PECs porcine aortic endothehal cells
- pBABEhCTLA4-hCD59 or pBABEpCTLA4-hCD59 or pBABE vector alone were assayed for expression of CD59
- cells were incubated with lOug/ml of either of the ant ⁇ -CD59 antibodies, BRA10G or MEM43 (Biodesign, Kennebunk, ME) , for 30 mm., at 4C, in 0.1 ml of Dulbecco's PBS (DPBS) containing 1% Fetal Bovine Serum (FBS) or Bovine Serum Albumin (BSA).
- DPBS Dulbecco's PBS
- FBS Fetal Bovine Serum
- BSA Bovine Serum Albumin
- Fig 5 depicts the results of cell killing experiments in which porcine aortic endothe a cells (PAECs) that express the chimeric molecules are protected from human serum-induced complement-mediated cell lysis.
- PAECs porcine aortic endothe a cells
- 5 x 10 3 vector control or hCTLA4hCD59 cells were seeded into the wells of a flat bottom 96 well plate 24 hours ahead of time
- Adherent cells were washed twice using HBSS containing 1% BSA Cells were sensitized by incubating with a polyclonal anti-PAEC antibody (Cocalico, Reamstown, PA), followed by incubation with the intracellular dye, Calcem AM(Molecular Probes, Eugene, OR) in HBSS /BSA for 30 minutes at 37°C.
- a polyclonal anti-PAEC antibody Cocalico, Reamstown, PA
- Fig 6 depicts a FACS analysis that proves that the CTLA4 domain of the chimeric molecules interacts with B7 found on the same PAECs Co-Stimulation Assays
- the costimulatory capacity of the PAEC was assayed using a modified endothehal cell costimulation assay (S. E. Maher. K Karmann, W Min, C C W Hughes, J. S Pober. A. L. M Bothwell. 1996. J Immunol. 157:3838).
- PAECs were seeded of a 96 well plates (Becton Dickenson, Franklin Lakes, NJ) 24 hours prior to co-cultu ⁇ ng with T cells
- the following reagents were added to final concentrations of 5ug/ml ant ⁇ CD28, or ant ⁇ B7.2; lOug/ml ant ⁇ CTLA4: or 5ug/well sCTLA4Ig.
- monolayers were washed gently with DPBS three times, followed by the addition of 1 x 10 5 Jurkats or T cells as responder cells in 0.09ml of RPMI 1640 +FBS.
- Fig 7 depicts the human amino acid sequence of DAF
- chimeric protein can be expressed on a porcine cell surface and can aid in the protection of the porcine cell, after xenotransplantation into a human, from both the human cellular immune response and human complement
- C5b-9 inhibitory activity ' is used herein to describe the effects of C5b-9 inhibitor molecules of the foregoing types on the complement system and thus includes activities that lead to inhibition of the cell activating and/or lytic function of the membrane attack complex (MAC).
- MAC membrane attack complex
- Suitable domains which exhibit C5b-9 inhibitory activity can include the entire amino acid sequence for a naturally occurring C5b-9 inhibitor protein or a portion thereof
- the C5b-9 sequence can be the mature CD59 molecule (1 e . amino acids 1 through 103 of Fig 2E(2) )
- the C5b-9 sequence can be a portion of a naturally occurring C5b-9 inhibitor protein, such as CD59 Active portions suitable for use herein can be identified using a variety of assays for C5b-9 inhibitory activity known in the art See for example Rollins, et al . J Immunol 144 3478. 1990, Rollins, et al .
- the portion used should have at least about 25% and preferably at least about 50% of the activity of the parent molecule
- Suitable C3 inhibitory domains include the entire amino acid sequence for a naturally occurnng C3 inhibtor or a portion thereof, such as one or more SCRs of the C3 inhibitory domain
- the C3 sequence can be the mature DAF molecule (factor H, membrane cofactor protein or complement recepor 1)
- the C3 inhibitory domain can be a portion of a naturally occurring C3 inhibitor protein Following the procedures used to identify functional domains of DAF (Adams, et al.. 1991. J. Immunol 147.3005-301 1), functional domains of other C3 inhibitors can be identified and used herein.
- the portion used should have at least about 25% and preferably at least about 50% of the activity of the parent C3 inhibitory molecule
- Particularly useful portions of mature C3 inhibitor proteins include one or more of the mature molecule's SCRs. These SCRs are normally approximately 60 amino acids in length and have four conserved cysteine residues which form disulfide bonds, as well as conserved tryptophan, glvcine. and phenylalanme/tyrc . ⁇ e residues.
- the C3 inh ⁇ b y domain includes SCRs 2 through 4 of DAF (i.e. amino acids 97 through 286 shown in figure 7)
- Suitable domains which exhibits T Cell inhibitory activity can include either at least a portion of the amino acid sequence for naturally occurring porcine CTLA4 or at least a portion of the entire amino acid sequence for naturally occurring human CTLA4.
- the amino acid sequence which exhibits T Cell inhibitory activity can be amino acids 38 to 162 of the porcine CTLA4 sequence shown in Fig. 2C(2) or amino acids 38 to 161 of the human CTLA4 sequence shown in Fig. 2D(2)
- the portion used should have at least about 25% and preferably at least about 50% of the activity of the parent molecule.
- the amino acid sequence having C5b-9 inhibitory activity and the amino acid secquence having T Cell inhibitory activity do not have to be directly attached to one another.
- a linker sequence can separate these two sequences.
- the linker preferably comprises between about one and at least about 6 amino. Suitable linker sequences can include glycines. Other amino acids, as well as combinations of amino acids, can be used in the linker region if desired.
- amino acids 153 to 158 of Fig. 2A(2) (GGGGGG in pCC) are the linker sequence
- amino acids 152 to 157 of Fig. 2B(2) are the linker sequence
- Another embodiment provides recombinant cDNA that encodes an exon of the human homologue of CTLA4 is inserted into the coding region of human CD59, bisecting CD59 between the leader peptide and the mature peptide post-translational processing site, see Fig. 2A( 1 ).
- a further embodiment provides recombinant cDNA which that encodes an exon of the porcine homologue of CTLA4 is inserted into the coding region of human CD59, bisecting CD59 between the leader peptide and the mature peptide post-translational processing site, see Fig. 2B(1).
- the cDNA may include a coding sequence for a GPI anchor linkage site corresponding to amino acid 210 of CC and amino acid 77 of native CD59, see Fig.'s 2A( 1 ) and 2B( 1 )
- Molecules composing nucleotide sequences encoding the CTLA4 and CD59 or DAF domains can be prepared using a variety of techniques known in the art.
- the nucleotide sequences encoding the CTLA4 nucleotide # 1 12-483 and CD59 leader peptide region nucleotide 1-75 and mature peptide nucleotide 76-384 domains can be produced using PCR generation and/or restriction digestion of cloned genes to generate fragments encoding amino acid sequences having T Cell and C5b-9 inhibitory activities. These fragments can be assembled using PCR fusion or enzymatic ligation of the restriction digestion products (Sambrook, et al.. Molecular Cloning: A laboratory manual.
- nucleic acid fragments used to assemble the chimeric genes can be synthesized by chemical means.
- nuc ,.de sequences encoding the CTLA4 and DAF »_ mains can be produced using PCR generation and/or restriction digestion of cloned genes to generate fragments encoding ammo acid sequences having T Cell and C3 inhibitory activities. These fragments also can be assembled using PCR fusion or enzymatic ligation of the restriction digestion products (Sambrook. et al., Molecular Cloning: A laboratory manual. 2 nd edition Cold Spring Harbor Press. 1989, Ausubel et al, Current Protocols in Molecular Biology 1991). Any or all of the nucleic acid fragments used to assemble these chimeric genes can be synthesized by chemical means as well
- recombinant expression vectors which include nucleic acid fragments the chimenc protein are provided.
- the nucleic acid molecule coding for such a chimeric protein can be inserted into an appropriate expression vector, 1 e., a vector that contains the necessary elements for the transcription and translation of the inserted protein-encoding sequence
- Suitable host vector systems include, but are not limited to. mammalian cell systems infected with virus (e g , vaccinia virus, adenovirus, retroviruses, etc ); mammalian cell systems transfected with plasmids; insect cell systems infected with virus (e g .
- baculovirus microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with bacte ⁇ ophage DNA, plasmid DNA, or cosmid DNA
- yeast containing yeast expression vectors or bacteria transformed with bacte ⁇ ophage DNA, plasmid DNA, or cosmid DNA
- cosmid DNA see. for example, Goeddel. 1990
- Commonly used promoters and enhancers derived from Polyoma virus, Adenovirus, Simian Virus 40 (SV40), the Molony u ⁇ ne leukemia virus (MMLV), including the long terminal repeat (MMLV-LTR), and human cytomegalovirus (CMV), including the cytomegalovirus immediate-early gene 1 promoter and enhancer are suitable Eukaryotic promotors-BetaActin (Ng et al.) & H2Kb (Fodor et al PNAS 1994)
- the cDNA of interest is cloned into a retroviral vector that is subsequently transfected into a mouse cell line called a "packaging line"
- a retroviral vector that is subsequently transfected into a mouse cell line called a "packaging line"
- the manipulation of retroviral nucleic acids to construct retroviral vectors and packaging cells is accomplished using techniques known in the art. See for example Ausubel, et al.. 1992. Volume 1 , Section III (units 9 10 1-9 14.3); Sambrook. et al., Molecular Cloning- A laboratory manual. 2 nd edition Cold Spring Harbor Press, 1989; Miller, et al.. Molecular and Cellular Biology 6.2895. 1986, Eghtis. et al., Biotechniques. 6:608-614 1988; U.S. Pat Nos.
- the retroviral vector contains a gene that allows for selection via resistance to drugs such as puromyacm. It also contains nucleic acid sequence that allows for random or directed integration of the vector into a eukaryotic genome. Drug resistant cell lines are selected.
- Porcine aortic endotheha cells are infected with the viruses by a process called viral transduction.
- the transduced PAECs are selected for by drug resistance.
- Drug resistant cells contain integrated cop ⁇ _,f the viral vector DNA.
- the retroviral vectors of the invention can be prepared and used as follows First, a retroviral vector containing nucleic acid encoding for the chimeric protein described herein above is constructed and packaged into non-infectious transducing viral particles (virions) using an amphotropic packaging system, preferably one suitable for use in gene therapy applications. Examples of such packaging systems are found in, for example, Miller, et al.. Molecular and Cellular Biology 6:2895, 1986; Markowitz, et al consume J. Virol. 62.1 120-1 124 1988, Cosset, et al . J Virol. 64.1070- 1078. 1999 U.S. Pat. Nos 4.650,764, 4,861 ,719.
- a preferred packaging cell is the PA317 packaging cell line (ATCC CRL 9078. Rockville, MD)
- the generation of "producer cells” is accomplished by introducing retroviral vectors into the packaging cells.
- the producer cells generated by the foregoing procedures are used to produce the retroviral vector particles (virions). This is accomplished by cultu ⁇ ng of the cells in a suitable growth medium.
- the virions are harvested from the culture and administered to the target cells which are to be transduced.
- retroviral vectors are found in. for example, Korman. et al., Proc. Natl. Acad. Sci. USA. 84.2150-2154 1987: Morgenstern, et al.. Nucleic Acid Research 18.3587. 1990; U.S. Pat. Nos. 4,405,712. 4,980,289, and 5,1 12,767. and PCT Patent Publications Nos. WO 85/05629.
- WO 90/02797. and WO 92/07943 A preferred retroviral vector is the MMLV derived expression vector pLXSN (See Miller, et al , Biotechniques 7 981 1989).
- DNA can be introduce into cells by any standard method of transfection such as polybrene, DEAE, calcium phosphate, pofection. electroporation (See Sambrook. et al , Molecular cloning a laboratory manual. Second Edition Cold Spring Harbor Laboratory Press. Cold Spring Harbor. N.Y 1989 )
- Engineered transgenic animals for example, rodent, e.g , mouse, rat. capybara, and the like, lagomorph, e.g., rabbit, hare, and the like, ungulate, e.g., pig, cow, goat, sheep, and the like, etc.
- rodent e.g , mouse, rat. capybara, and the like
- lagomorph e.g., rabbit, hare, and the like
- ungulate e.g., pig, cow, goat, sheep, and the like, etc.
- chimenc protein described herein on the surfaces of their cells are provided using any suitable techniques known in the art. These techniques include, but are not limited to, microinjection, e.g., of pronuclei, electroporation of ova or zygotes. nuclear transplantation, and/or the stable transfection or transduction of embryonic stem cells derived from the animal of choice.
- a common element of these techniques involves the preparation of a transgene transcnption unit.
- a transgene transcnption unit includes a DNA molecule which generally includes. 1) a promoter, 2) the nucleic acid sequence, and 3) a polyadenylation signal sequence Other sequences, such as, enhancer and intron sequences, can optionally be included
- the unit can be conveniently prepared by isolating a restriction fragment of a plasmid vector which expresses the CTLA4-CD59 protein in, for example, mammalian ,s preferably, the restriction fragment is free o acte ⁇ ally denved sequences that are known to have deleterious effects on embryo viability and gene expression
- transgenic animals The most well known method for making transgenic animals is that used to produce transgenic mice by superovulation of a donor female, surgical removal of the egg, injection of the transgene transcription unit into the pro-nuclei of the embryo, and introduction ot the transgenic embryo into the reproductive tract of a pseudopregnant host mother, usually of the same species See for example U S Pat No 4,873, 191, B ⁇ nster. et al . 1985 Proc Natl Acad Sci USA 82 4438-4442 . Hogan, et al . in 'Manipulating the Mouse Embryo A Laboratory Manual' Cold Spring Harbor Laboratory, Cold Spring Harbor. N Y , 1986 .
- transgenic swine are routinely produced by the microinjection of a transgene transcription unit into pig embryos See, for example, PCT Publication No WO92/1 1757
- this procedure may, for example, be performed as follows
- the transgene transc ⁇ ption unit is gel isolated and extensively purified through, for example, an ELUTIP column (Schleicher & Schuell, Keene, N H ), dialyzed against pyrogen free injection buffer ( 10 mM T ⁇ s, pH 7 4+0 1 mM EDTA in pyrogen free water) and used for embryo injection Embryos are recovered from the oviduct of a hormonally synchronized, ovulation induced sow, preferably at the pronuclear stage They are placed into a 1 5 ml microfuge tube containing approximately 0 5 ml of embryo transfer media (phosphate buffered saline with 10%
- Si cone oil is used to cover this drop and to fill the lid to prevent the medium from evaporating
- the pet ⁇ dish lid containing the embryos is set onto an inverted microscope equipped with both a heated stage (37 5 degree -38 degree C ) and Hoffman modulation contrast optics (200 times final magnification)
- a finely drawn and polished micropipette is used to stabilize the embryos while about 1-2 picohters of injection buffer containing approximately 200- 500 copies of the purified transgene transc ⁇ ption unit is delivered into the nucleus, preferably the male pronucleus, with another finely drawn and polished micropipette.
- transgenic animals are produced according to the methods disclosed in PCT Publicaton No WO/9907829, the contents of which are incorporated herein by reference
- ES cells embryonic stem cells
- PCT Patent Publication No WO 93/02188 and Robertson in Robertson ed 'Teratocarcinomas and Embryonic Stem Cells a Practical Approach ' IRL Press, Eynsham, Oxford. England 1987
- ES cells are grown as described in, for example, Robertson, in Robertson ed Teratocarcinomas and Embryonic Stem Cells a Practical Approach” IRL Press Eynsham Oxford. England; 1987. and in U S Pat No 5,166,065 to Williams et al Genetic material is introduced into the embryonic stem cells by.
- a full length human CTLA4 cDNA was isolated from human peripheral blood leukocytes (PBLs) that were activated with 3ng/ml phorbol 12 my ⁇ state 13 acetate (PMA) and 0.4ug/ml lonomycin (commercially available from Sigma. St. Louis. MO).
- PBLs peripheral blood leukocytes
- PMA phorbol 12 my ⁇ state 13 acetate
- lonomycin commercially available from Sigma. St. Louis. MO
- PCR polymerase chain reaction
- 5'GGCTGCAGGGAGGCGGAGGCGGAGGCGTCAGAATCTGG3' which contained homologous nucleotides and nucleotide encoding linker sequence, were used in the following PCR reaction mixture to amplify a 406 base pair CTLA4 DNA fragment.
- Five microliters of a first strand synthesis of cDNA made from activated PBLs was amplified in the presence of lOmM magnesium chloride, 500mM dNTPs, 2uM oligonucleotides, 2.5 Units Taq polymerase (Perkin Elmer, Norwalk, CT) for forty cycles.
- Each cycle consisted of denaturing for one minute at 95°C, annealing at 55°C for one minute, and polymerizing at 72 n C for one minute.
- One cycle of polymerization at 72°C for ten minutes insured the addition of thymidine overhang for TA cloning.
- the CTLA4 exon 2 fragment was ligated into the pCRII.1TOPO vector using the TOPO TA cloning kit (commercially available from lnvitrogen, Carlsbad, CA) and used to transform the TOP 10 strain of E. Coli (commercially available from lnvitrogen, Carlsbad. CA).
- Plasmids containing the appropriately sized fragment were isolated and the inserts were subjected to DNA sequencing to confirm the integrity and identity of the DNA ( Wm. Keck Foundation Biotechnology Resource Laboratory Yale University, New Haven, CT). Plasmids that contained the verified CTLA4 exon 2 insert were digested with Pstl and the 406bp CTLA4 exon 2 fragment was isolated.
- a GEM7Z plasmid (commercially available from Clontech, Palo Alto, CA) that contained the human CD59 sequence (gift from Dr. A. Bothwell, Yale University) that has a unique Pstl site located between the human CD59 signal sequence and mature protein coding sequence was digested with Pstl.
- the Pstl fragment that contained CTLA4 exon 2 was ligated into the corresponding Pstl site on GEM7Z and plasmids that contained the correct insert were selected.
- a BamHI-EcoRI fragment containing the entire chimeric human CTLA-human CD59 (hCTLA4hCD59) gene was excised from the plasmid and then subcloned into the amphitropic retroviral expression vector pBABEpuro (Morganstem. et al) to generate the expression vector hCTLA4hCD59BABEpuro.
- Porcine cDNA was prepared from porcine PBLs that were activated with 3ng/ml PMA and 0.4ug/ml lonomycin (commercially available from Sigma. St Louis. MO) The cDNA was used as a template in a PCR using redundant primers designed trom a comparison of human ( Genbank accession # NM005214), mouse (X05719), rabbit (D49844). and bovine (X93305) CTLA4 nucleotide sequences.
- the 5' foreward oligonucleotide is designed trom a comparison of human ( Genbank accession # NM005214), mouse (X05719), rabbit (D49844). and bovine (X93305) CTLA4 nucleotide sequences.
- the 5' foreward oligonucleotide is the following primers designed trom a comparison of human ( Genbank accession # NM005214), mouse (X05719), rabbit (D49844). and bovine (
- 5'CCTCARTTRATRGGA4AAAATAAGGTG3' were used in PCR conditions as described in Example I, except annealing occurred at 45C, and twenty cycles of amplification were used
- the PCR produced a 672 base pair fragment that was cloned into the TOPO vector using the TOPO TA cloning kit (commercially available trom lnvitrogen. Carlsbad. CA) DNA sequence analysis confirmed that the insert was the full-length porcine CTLA4 clone
- the extracellular domain of porcine CTLA4 encoded by exon 2 was PCR amplified from the TOPO plasmid prepared in Example II using a 5' foreward oligonucleotide
- the plasmid was digested with Nsi I and the fragment that contained the CTLA4 exon 2 was isolated and ligated into the Pstl site of the GEM7Z plasmid that contained human CD59 as described in Example I.
- the BamEl-EcoRl fragment containing the chimeric pig CTLA4- human CD59 molecule (pCTLA4hCD59) was excised from the plasmid and then subcloned into the amphitropic retroviral expression vector pBABEpuro (See Morgenstern, et al., Nucleic Acids Res. 18:3587 1990.) to generate the expression vector pCTLA4hCD59BABEpuro
- a cell line that expresses the human CTLA4-humanCD59 chimeric molecule a cell line must be created that produces retroviral vectors that contain the necessary gene. Another cell line must then be transduced with the virus to create a population of cells that express the protein.
- the mu ⁇ ne amphitropic packaging cell line PA317 (ATCC, Rochville, MD) was transfected with the expression vector prepared in Example I
- hCTLA4hCD59BABEpuro example 3 or BABEpuro (vector control DNA) by the polybrene method
- DMEM Dulbecco minimum essential medium
- FBS heat inactivated fetal bovine serum
- DMSO dimethylsufoxide
- the cells were washed and incubated in DMEM with 10% FBS and 48 hours post transfection. the cells were treated with 3mg/ml puromycin to select drug resistant transfectants.
- the transfected PA317 cells produced retrovirus and viral supernatents which were harvested as described by Morgenstern, et al. Land.
- the hCTLA4hCD59 cell line was also treated with PI-PLC and then assayed for expression of the chimeric molecule to further demonstrate that the chimeric molecules were anchored to the cell surface with a CD59 GPI anchor linkage, by enzymatically cleaving the CD59 GPI membrane attachment
- Figure 4 illustrates the loss of cell surface expression following PIPLC treatment, as indicated by reduced antibody reactivity following enzymatic digestion.
- Example V Cell surface expressiou X pC TLA4-hCD59 chimeric molecules
- the pCTLA4hCD59 cell line was also treated with PI-PLC and then assayed for expression of the chimeric molecule to demonstrate that the chimeric molecules were anchored to the cell surface with a CD59 GPI anchor linkage by cleaving the CD59 GPI membrane attachment.
- Fig. 4 illustrates the loss of cell surface expression following PI-PLC treatment. Both moieties could not be detected post digestion.
- complement-mediated killing assays were performed using normal human serum as a source of complement.
- PAECs (5 x 103) transduced with vector control or hCTLA4hCD59 were seeded into the wells of a flat bottom 96 well plates. After 24 hours adherent cells were washed twice using Hanks balanced salt solution (HBSS) containing 1 % BSA (HBSS/BSA). Cells were sensitized by incubating with a polyclonal anti- PAEC antibody ( Cocalico, Reamstown, PA), followed by incubation with the intracellular dye, Calcein AM (commercially available from Molecular Probes, Eugene, OR) in HBSS/BSA for 30 minutes at 37°C.
- HBSS Hanks balanced salt solution
- Calcein AM commercially available from Molecular Probes, Eugene, OR
- the percent cell death is determined by comparing the OD obtained from untreated cells to that obtained from treated cells.
- Figure 5 illustrates the percentage of cell death due to increasing concentrations of human serum
- Vector transdu ⁇ d PAECS were susceptible to human serum in c aose dependent manner
- hCTLA4hCD59 PAECs were 2-3 fold more resistant to human serum induced cell lysis at all concentrations of serum tested as compared to control PAECs.
- APC antigen presenting cells
- a human T-cell line ATCC TEB 152 or human T cells (responder cells) a costimulatory signal results that elicits mterleukin 2 (IL-2) production from the responder cells Therefore, to test the function of the hCTLA4 molecule in the context of the chimeric molecule, costimulation assays were performed using Jurkat cells as responder cells and vector control, hCTLA4hCD59 PAECs or pCTLA4-CD59 as APCs, respectively The costimulatory capacity of the va ⁇ ous PAECs was assayed using a modified endothehal cell costimulation assay (as described in Maher.
- PAECs transduced with pBABE vector control, hCTLA4hCD59, or pCTLA4-hCD59 were seeded at 5 x 104 cells per well in 96 well plates (commercially available from Becton Dickenson, Franklin Lakes, NJ) 24 hours prior to cocultu ⁇ ng with T cells
- the following reagents were added to final concentrations of 5ug/ml for ant ⁇ CD28, or ant ⁇ B72(see for example); lOug/ml ant ⁇ CTLA4 (Ancell, Bayport.
- phytohemaglutinin (Sigma L7019) was added in a 0 1ml volume to a final concentration of lOmg/ml for 20hrs, at 37°C Cell free supernatants were collected 20 hours post treatment and assayed for IL-2 by enzyme linked immunosorbant assay (ELISA) (commercially available from R&D Systems, Minneapolis, MN)
- ELISA enzyme linked immunosorbant assay
- Optical density (OD) at 485nm was determined using a Microplate Reader 3550 (commercially available from Biorad, Hercules, CA) and the OD is proportional to IL-2 production and determined by comparison to a calibration curve generated with known amounts of EL-2 Jurkat supenatents were tested undiluted
- IL-2 release from stimulated Jurkat cells is depicted in Figure 6
- the amount of IL-2 elicited from Junket cells in the presence or absence of pig aortic endothehal cells as antigen presenting cells requires primary and secondary stimulatory signals Without the secondary co-stimulatory signal provided by an APC or anti CD28, Jurkats remain unactivated, and secrete little to no IL2
- the assay utilizes the lectin, phytohemaglutinin (PHA) to cross-link the T cell receptor complex and stimulate the p ⁇ mary signal
- PHA phytohemaglutinin
- 446pg/ml of IL-2 is secreted
- the secondary signal is provided by vector control PAEC as APC instead of anti CD28, 406pg/ml EL-2 is secreted
- An antibody to pig B7.2 blocks the secondary signal and therefore EL-2 production by specifically binding to the B7.2 molecules on the APC thereby blocking the co-stimulatory second signal
- CTLA4 is an alternate lig
- a blocking antibody to hCTLA4 specifically binds the CTLA4 mioety of the hCTLA4-hCD59 molecule and prevents it from binding to pB7.2 on the CCPAEC surface. B7.2 is therefore available to bind CD28 on Jurkat cells leading to activation and EL-2 secretion.
- HCTLA4-hCD59 is a gpi linked molecule and. can be cleaved off the cell surface of the cells by phosphotidyl inositol phospholipase C. When hCTLA4-hCD59 is removed the secondary signal is restored, and the Junket cells become activated and secret IL-2.
- CD28 activation pathway regulates the production of multiple T-cell- derived lymphokines/cytokines.
- PNAS 84: 1333. (IL-2 secretion due to CD28)
- Cowan,, P. J., Chen. C. G., Shinkel. T. A.. Fisicaro. N.. Salvaris, E., Aminian, A., Romanella, M., Pearse, M. J., and D'Apice. A. J. F. ( 1998) Knock-out of al.3-galactosyltransferase or expression of ccl,2-fucosyltransferase further protects CD55- and CD59-express ⁇ ng mouse hearts in an ex vivo model of xenograft rejection. Transplantation 65, 1599-1604 Coyne et al., 199 ⁇ Mapping of epitopes, glycosylation sites, and implement regulatory domains in human decay accelerating factor," Journal of Immunology 149'2906-2913
- CTLA-4 is a second receptor for the B cell activation antigen B7 J Exp. Med 174-561
- CTLA4 and CD28 activated lymphocyte molecules are closely related in both mouse and human as to sequence, message expression, gene structure, and chromosomal location. J. hmmmol 147: 1037.
- T90/44 (9 3 Antigen), A Cell Surface Molecule with a Function in Human T Cell Activation", Eur. J. Immunol. 16: 1289- 1296 ( 1986)
- MCP membrane cofactor protein
- CTLA41g treatment ameliorates the lethality of mu ⁇ ne graft- versus-host disease across major histocomatibility complex barriers Transpl 58 602 (ms is better on ms than hu CTLA41 g)
- CD59 antigen is a structural homologue of mu ⁇ ne Ly-6 antigens but lacks interferon lnducibi ty" Eur. J. Immunol. 20:87-92.
- Porcine endothehal CD86 is a major costimulator of xenogeneic human T cells. J. Immunol. 157:3838.
- CD59 a molecule involved in antigen presentation as well as downregulation of membrane attack complex
- CTLA-4 can function as a negative regulator of T cell activation. Immunity 1 :405.
- the C5b-9 inhibitory domain and/or the T Cell inhibitory domain may be modified by creating amino acid substitutions or nucleic acid mutations provided at least some complement regulatory activity and some T Cell inhibitory activity remains after such modifications.
- nucleotide sequences of the chimeric protein protein may be modified by creating nucleic acid mutations which do not significantly change the encoded amino acid sequences, including third nucleotide changes in degenerate codons (and other "silent" mutations that do not change the encoded amino acid sequence) Mutations which result in a highly conservative or silent amino acid substitution for an encoded amino acid while leaving the characte ⁇ stics of the chime ⁇ c proteins essentially unchanged are also within the scope of disclosure. Also included are sequences comprising changes that are found as naturally occurring allelic variants of the genes for the T Cell inhibitory molecules and the C5b-9 inhibitory molecules used to create chime ⁇ c molecules described herein.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Biochemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Cell Biology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US16118699P | 1999-10-22 | 1999-10-22 | |
| US161186P | 1999-10-22 | ||
| PCT/US2000/029151 WO2001030966A2 (en) | 1999-10-22 | 2000-10-21 | An engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| EP1165752A2 true EP1165752A2 (en) | 2002-01-02 |
| EP1165752A4 EP1165752A4 (en) | 2003-02-05 |
Family
ID=22580195
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| EP00975335A Withdrawn EP1165752A4 (en) | 1999-10-22 | 2000-10-21 | An engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system |
Country Status (4)
| Country | Link |
|---|---|
| EP (1) | EP1165752A4 (en) |
| AU (1) | AU1340101A (en) |
| CA (1) | CA2361646A1 (en) |
| WO (1) | WO2001030966A2 (en) |
Families Citing this family (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3138403A1 (en) | 2005-08-09 | 2017-03-08 | Revivicor, Inc. | Transgenic ungulates expressing ctla4-ig and uses thereof |
| ES2767881T3 (en) | 2009-08-14 | 2020-06-18 | Revivicor Inc | Multi-transgenic pigs for the treatment of diabetes |
| CN106432474A (en) | 2010-03-12 | 2017-02-22 | 艾伯维生物医疗股份有限公司 | CTLA4 proteins and their uses |
| ES2680636T3 (en) | 2011-02-14 | 2018-09-10 | Revivicor Inc. | Genetically modified pigs for xenotransplantation of vascularized xenografts and derivatives thereof |
| US20220211018A1 (en) | 2020-11-20 | 2022-07-07 | Revivicor, Inc. | Multi-transgenic pigs with growth hormone receptor knockout for xenotransplantation |
| CA3232376A1 (en) | 2021-09-20 | 2023-03-23 | Maria KOKKINAKI | Multitransgenic pigs comprising ten genetic modifications for xenotransplantation |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5637481A (en) * | 1993-02-01 | 1997-06-10 | Bristol-Myers Squibb Company | Expression vectors encoding bispecific fusion proteins and methods of producing biologically active bispecific fusion proteins in a mammalian cell |
| US5844095A (en) * | 1991-06-27 | 1998-12-01 | Bristol-Myers Squibb Company | CTLA4 Ig fusion proteins |
| US6090914A (en) * | 1991-06-27 | 2000-07-18 | Bristol-Myers Squibb Company | CTLA4/CD28Ig hybrid fusion proteins and uses thereof |
| US5627264A (en) * | 1994-03-03 | 1997-05-06 | Alexion Pharmaceuticals, Inc. | Chimeric complement inhibitor proteins |
-
2000
- 2000-10-21 WO PCT/US2000/029151 patent/WO2001030966A2/en not_active Ceased
- 2000-10-21 EP EP00975335A patent/EP1165752A4/en not_active Withdrawn
- 2000-10-21 AU AU13401/01A patent/AU1340101A/en not_active Abandoned
- 2000-10-21 CA CA002361646A patent/CA2361646A1/en not_active Abandoned
Also Published As
| Publication number | Publication date |
|---|---|
| WO2001030966A3 (en) | 2001-10-18 |
| CA2361646A1 (en) | 2001-05-03 |
| EP1165752A4 (en) | 2003-02-05 |
| WO2001030966A2 (en) | 2001-05-03 |
| AU1340101A (en) | 2001-05-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5706225B2 (en) | Immunosuppression by blocking T cell costimulatory signal 2 (B7 / CD28 interaction) | |
| EP0750458B1 (en) | Terminal complement inhibitor fusion genes and proteins | |
| EP0833906B1 (en) | Novel ctla4/cd28 ligands and uses therefor | |
| EP0754227B1 (en) | Chimeric complement inhibitor proteins | |
| US8309083B2 (en) | Polypeptides involved in immune response | |
| WO1995003408A1 (en) | B7-2: ctl a4/cd 28 counter receptor | |
| JP4236925B2 (en) | Novel polypeptides involved in immune responses | |
| US6824779B1 (en) | Methods for inhibiting the interaction of B7-2 with its natural ligand | |
| EP1165752A2 (en) | An engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system | |
| AU2002217969A1 (en) | Polypeptides involved in immune response | |
| US20030157705A1 (en) | Engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system | |
| US20030086940A1 (en) | Engineered recombinant molecule that regulates humoral and cellular effector functions of the immune system | |
| WO1994000560A1 (en) | Matrix for universal donor microvascular endothelial cells | |
| AU5339500A (en) | Novel CTLA4/CD28 ligands and uses therefor | |
| Smith | Expression, function and ligands for the Ly-49H NK cell activation receptor | |
| NZ535708A (en) | Immunosuppression by blocking T cell co-stimulation signal 2 (B7/CD28 interaction) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PUAI | Public reference made under article 153(3) epc to a published international application that has entered the european phase |
Free format text: ORIGINAL CODE: 0009012 |
|
| 17P | Request for examination filed |
Effective date: 20010802 |
|
| AK | Designated contracting states |
Kind code of ref document: A2 Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE |
|
| AX | Request for extension of the european patent |
Free format text: AL;LT;LV;MK;RO;SI |
|
| RIC1 | Information provided on ipc code assigned before grant |
Ipc: 7C 07K 14/47 B Ipc: 7C 12N 15/00 B Ipc: 7C 12N 5/00 A Ipc: 7C 12N 15/63 B Ipc: 7C 07K 1/00 B Ipc: 7C 07K 17/00 B Ipc: 7C 12N 15/62 B Ipc: 7C 12N 15/09 B Ipc: 7C 07K 14/00 B |
|
| A4 | Supplementary search report drawn up and despatched |
Effective date: 20021220 |
|
| 17Q | First examination report despatched |
Effective date: 20050503 |
|
| STAA | Information on the status of an ep patent application or granted ep patent |
Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN |
|
| 18D | Application deemed to be withdrawn |
Effective date: 20050914 |