EP1141295A1 - Human chemokine beta-10 mutant polypeptides - Google Patents

Human chemokine beta-10 mutant polypeptides

Info

Publication number
EP1141295A1
EP1141295A1 EP00903142A EP00903142A EP1141295A1 EP 1141295 A1 EP1141295 A1 EP 1141295A1 EP 00903142 A EP00903142 A EP 00903142A EP 00903142 A EP00903142 A EP 00903142A EP 1141295 A1 EP1141295 A1 EP 1141295A1
Authority
EP
European Patent Office
Prior art keywords
amino acid
polypeptide
seq
ckβ
acid residues
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00903142A
Other languages
German (de)
French (fr)
Other versions
EP1141295A4 (en
Inventor
Henrik S. Olsen
Haodong Li
Mark D. Adams
Solange H. L. Gentz
Ralph Alderson
Yuling Li
David Parmelee
John R. White
Edward R. Appelbaum
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Human Genome Sciences Inc
SmithKline Beecham Corp
Original Assignee
Human Genome Sciences Inc
SmithKline Beecham Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Human Genome Sciences Inc, SmithKline Beecham Corp filed Critical Human Genome Sciences Inc
Publication of EP1141295A1 publication Critical patent/EP1141295A1/en
Publication of EP1141295A4 publication Critical patent/EP1141295A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52Cytokines; Lymphokines; Interferons
    • C07K14/521Chemokines
    • C07K14/523Beta-chemokines, e.g. RANTES, I-309/TCA-3, MIP-1alpha, MIP-1beta/ACT-2/LD78/SCIF, MCP-1/MCAF, MCP-2, MCP-3, LDCF-1, LDCF-2
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • the present invention relates to deletion and substitution mutant polypeptides of human chemokine beta- 10 (Ck ⁇ -10), as well as nucleic acid molecules encoding such polypeptides and processes for producing such polypeptides using recombinant techniques.
  • the invention also relates to uses of the full-length and mature forms of
  • Ck ⁇ -10 as well as deletion and substitution mutants, in medical treatment regimens.
  • the Ck ⁇ - 10 polypeptides described herein may be employed to treat a variety of conditions, including rheumatoid arthritis, inflammation, respiratory diseases, allergy, and IgE-mediated allergic reactions.
  • Ck ⁇ -10 is also known as MCP-4.
  • Chemokines also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-14 kd in size. In general chemokines exhibit 20% to 75% homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C— X— C" subfamily. In the beta subfamily, the two cysteines are in an adjacent position and are, therefore, referred to as the — C— C— subfamily. Thus far, at least eight different members of this family have been identified in humans.
  • the intercrine cytokines exhibit a wide variety of functions.
  • a hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils and fibroblasts.
  • Many chemokines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflammation, certain chemokines have been shown to exhibit other activities.
  • macrophage inflammatory protein I (MIP- 1) is able to suppress hematopoietic stem cell proliferation
  • platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell growth
  • Interleukin-8 (IL-8) promotes proliferation of keratinocytes
  • GRO is an autocrine growth factor for melanoma cells.
  • chemokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis.
  • An example of a hematopoietic lineage regulator is MIP-1.
  • MIP-1 was originally identified as an endotoxin-induced proinflammatory cytokine produced from macrophages. Subsequent studies have shown that MIP-1 is composed of two different, but related, proteins MlP-l ⁇ and MlP-l ⁇ . Both MlP-l ⁇ and MIP- l ⁇ are chemo-attractants for macrophages, monocytes and T lymphocytes. Interestingly, biochemical purification and subsequent sequence analysis of a multipotent stem cell inhibitor (SCI) revealed that SCI is identical to MlP-l ⁇ . Furthermore, it has been shown that MlP-l ⁇ can counteract the ability of MlP-l ⁇ to suppress hematopoietic stem cell proliferation.
  • SCI multipotent stem cell inhibitor
  • MlP-l ⁇ as a stem cell inhibitor relates to its ability to block the cell cycle at the G 2 S interphase. Furthermore, the inhibitory effect of MlP-l ⁇ seems to be restricted to immature progenitor cells and it is actually stimulatory to late progenitors in the presence of granulocyte macrophage-colony stimulating factor (GM-CSF).
  • GM-CSF granulocyte macrophage-colony stimulating factor
  • Murine MIP-1 is a major secreted protein from lipopolysaccharide stimulated RAW 264.7, a murine macrophage tumor cell line. It has been purified and found to consist of two related proteins, MlP-l ⁇ and MIP- 1 ⁇ . Several groups have cloned what are likely to be the human homologs of MlP-l ⁇ and
  • MIP-1 proteins can be detected in early wound inflammation cells and have been shown to induce production of IL-1 and IL-6 from wound fibroblast cells.
  • purified native MIP-1 (comprising MIP-1, MlP-l ⁇ and MlP-l ⁇ polypeptides) causes acute inflammation when injected either subcutaneously into the footpads of mice or intracistemally into the cerebrospinal fluid of rabbits (Wolpe and Cerami, FASEB J . 3:2565-73 (1989)).
  • MIP-1 has been recovered during the early inflammatory phases of wound healing in an experimental mouse model employing sterile wound chambers (Fahey, et al.
  • Cytokine 2:92 (1990)).
  • Intemational Patent Application Serial No. PCT/US92/05198 filed by Chiron Corporation discloses a DNA molecule which is active as a template for producing mammalian macrophage inflammatory proteins (MIPs) in yeast.
  • MIPs mammalian macrophage inflammatory proteins
  • the murine MlP-l ⁇ and MlP-l ⁇ are distinct but closely related cytokines. Partially purified mixtures of the two proteins affect neutrophil function and cause local inflammation and fever. MlP-l ⁇ has been expressed in yeast cells and purified to homogeneity.
  • MlP-l ⁇ has a very similar secondary and tertiary structure to platelet factor 4 (PF-4) and interleukin 8 (IL-8) with which it shares limited sequence homology. It has also been demonstrated that MlP-l ⁇ is active in vivo to protect mouse stem cells from subsequent in vitro killing by tritiated thymidine. MlP-l ⁇ was also shown to enhance the proliferation of more committed progenitor granulocyte macrophage colony-forming cells in response to granulocyte macrophage colony-stimulating factor. (Clemens, J.M. et al., Cytokine 4:76-82 (1992)).
  • MCP-1 monocyte chemotactic protein
  • MCP-2 monocytes, and leukocytes
  • MCP-3 also attracts eosinophils and T lymphocytes (Dahinderi, E., et al., J. Exp. Med. 179:751-756 (1994)).
  • Human MCP-1 is a basic peptide of 76 amino acids with a predicted molecular mass of 8,700 daltons.
  • MCP-1 is inducibly expressed mainly in monocytes, endothelial cells and fibroblasts. Leonard, E.J. and Yoshimura, T., Immunol. Today 11:97-101 (1990).
  • the factors which induce this expression is IL-1, TNF or lipopolysaccharide treatment.
  • MCP-1 has been modified to form a cytokine capable of directly inducing histamine release by basophils, (Bischoff, S.C., et al., J. Exp. Med. 175:1271-1275 (1992)). Furthermore, MCP-1 promotes the formation of leukotriene C4 by basophils pretreated with Interleukin 3, Interleukin 5, or granulocyte/macrophage colony-stimulating factor. MCP-1 induced basophil mediator release may play an important role in allergic inflammation and other pathologies expressing MCP-1.
  • Clones having a nucleotide sequence encoding a human monocyte chemotactic and activating factor reveal the primary structure of the MCAF polypeptide to be composed of a putative signal peptide sequence of 23 amino acid residues and a mature MCAF of 76 amino acid residues. Furutani, Y.H., et al., Biochem. Biophys. Res. Commu. 159:249-55 (1989).
  • the complete amino acid sequence of human glioma-derived monocyte chemotactic factor (GDCF-2) has also been determined. This peptide attracts human monocytes but not neutrophils. It was established that GDCF-2 comprises 76 amino acid residues.
  • the peptide chain contains 4 half-cysteines, at positions 11, 12, 36 and 52, which create a pair of loops, clustered at the disulfide bridges. Further, the MCP-1 gene has been designated to human chromosome 17. Mehrabian, M.R., et al., Genomics 9:200-3 (1991).
  • MCP-1 monocytic infiltration of the artery wall.
  • Monocytes appear to be central to atherogenesis both as the progenitors of foam cells and as a potential source of growth factors mediating intimal hyperplasia. Nelken, N.A., et al., J. Clin. Invest. 88: 1 121-7 (1991). It has also been found that synovial production of MCP-1 may play an important role in the recruitment of mononuclear phagocytes during inflammation associated with rheumatoid arthritis and that synovial tissue macrophages are the dominant source of this cytokine.
  • MCP-1 levels were found to be significantly higher in synovial fluid from rheumatoid arthritis patients compared to synovial fluid from osteoarthritis patients or from patients with other arthritides. Koch, A.E., et al., J. Clin. Invest. 90:772-9 (1992).
  • MCP-2 and MCP-3 are classified in a subfamily of proinflammatory proteins and are functionally related to MCP-1 because they specifically attract monocytes, but not neutrophils. Van Damme, J., et al., J. Exp. Med. 176:59-65 (1992). MCP-3 shows 71 % and 58% amino acid homology to MCP-1 and MCP-2 respectively. MCP-3 is an inflammatory cytokine that regulates macrophage functions.
  • IL-1 and IL-8 demonstrate proinflammatory activity that may be dangerous for good engrafting.
  • IL-7 must be administered at high doses over a long duration and
  • MlP-l ⁇ is not very active as a single agent and shows best activity when in combination with G-CSF.
  • This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human chemokine beta-4 (also referred to as “Ck ⁇ -4") and human chemokine monocyte chemotactic protein (referred to as "MCP-4,” and also known and referred to as human chemokine beta-10 and “Ck ⁇ -10”), which, collectively, are referred to as "the chemokine polypeptides". The invention also relates to inhibiting the action of such polypeptides.
  • the immune cells which are responsive to the chemokines have a vast number of in vivo functions and therefore their regulation by such chemokines is an important area in the treatment of disease.
  • eosinophils destroy parasites to lessen parasitic infection.
  • Eosinophils are also responsible for chronic inflammation in the airways of the respiratory system. Macrophages are responsible for suppressing tumor formation in vertebrates. Further, basophils release histamine which may play an important role in allergic inflammation.
  • novel polypeptides which are Ck ⁇ -4, and MCP-4 (also referred to as Ck ⁇ -10), as well as fragments, analogs and derivatives thereof.
  • the polypeptides of the present invention are of human origin.
  • polynucleotides (DNA or RNA) which encode such polypeptides.
  • the present invention provides deletion and substitution mutants of human chemokine Ck ⁇ -10, as well as biologically active and diagnostically or therapeutically useful derivatives thereof.
  • nucleic acid molecules encoding polypeptides of the present invention including mRNAs, DNAs, cDNAs, genomic DNAs, as well as analogs and biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
  • the present invention further provides isolated nucleic acid molecules comprising polynucleotides which encode mutants of the Ck ⁇ -10 polypeptide having the amino acid sequence shown in Figure 2 (SEQ ID NO:4) or the amino acid sequence encoded by the cDNA clone deposited as ATCC Deposit Number 75849 on July 29, 1994.
  • one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding an N-terminal deletion mutant of the Ck ⁇ -10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the N-terminus; (b) a nucleotide sequence encoding an C-terminal deletion mutant of the Ck ⁇ -10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the C-terminus; (c) a nucleotide sequence encoding a deletion mutant of the Ck ⁇ -10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the N and C-termini; (d) a nucleotide sequence encoding
  • deletion mutant has one or more deletions at the N-terminus; (e) a nucleotide sequence encoding a C-terminal deletion mutant of the Ck ⁇ -10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the
  • nucleotide sequence encoding a deletion mutant of the Ck ⁇ -10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the N- and C-termini; and (g) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f) above.
  • nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% homologous or identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f) or (g), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f) or (g), above.
  • These polynucleotides which hybridize do not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
  • the Ck ⁇ -10 deletion mutant polypeptides encoded by each of the above nucleic acid molecules may have an N-terminal methionine residue.
  • the present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells.
  • a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
  • the invention further provides an isolated Ck ⁇ -10 polypeptide having an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of an N-terminal deletion mutant of the Ck ⁇ -10 polypeptide having the complete amino acid sequence in
  • Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the N-terminus; (b) the amino acid sequence of an C-terminal deletion mutant of the Ck ⁇ -10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the C-terminus; (c) the amino acid sequence of a deletion mutant of the Ck ⁇ -10 polypeptide having the complete amino acid sequence in
  • Figure 2 SEQ ID NO: 4
  • said deletion mutant has one or more deletions at the N- and C-termini
  • deletion mutant has one or more deletions at the C-terminus; and (f) the amino acid sequence of the Ck ⁇ -10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the N- and C-termini.
  • Polypeptides of the present invention also include homologous polypeptides and substitution mutants having an amino acid sequence with at least 90% identity, and more preferably at least 95% identity to those described in (a), (b), (c), (d), (e) or (f) above, as well as polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those above.
  • An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which has the amino acid sequence of an epitope bearing portion of a Ck ⁇ -10 polypeptide having an amino acid sequence described in (a), (b), (c), (d), (e) or (f) above.
  • An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a Ck ⁇ -10 polypeptide having an amino acid sequence in (a), (b),
  • each of the above Ck ⁇ -10 polypeptide deletion mutants may have an
  • compositions comprising a Ck ⁇ -10 polynucleotide, probe, vector, host cell, polypeptide, fragment, variant, derivative, epitope bearing portion, antibody, antagonist or agonist.
  • An additional aspect of the invention is related to a method for treating an individual in need of an increased level of Ck ⁇ -10 activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated Ck ⁇ -10 polypeptide.
  • a still further aspect of the invention is related to a method for treating an individual in need of a decreased level of Ck ⁇ -10 activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of a Ck ⁇ -10 antagonist of the invention.
  • Such antagonists include the full-length and mature Ck ⁇ -10 polypeptides shown in Figure 2 (SEQ LD NO:4), as well as Ck ⁇ -10 fragments (e.g., a
  • antibodies against Ck ⁇ -10 polypeptides there are provided antibodies against Ck ⁇ -10 polypeptides.
  • the invention provides an isolated antibody that binds specifically to a Ck ⁇ -10 polypeptide having an amino acid sequence described in (a), (b), (c), (d), (e) or (f) above.
  • the invention further provides methods for isolating antibodies that bind specifically to a Ck ⁇ -10 polypeptide having an amino acid sequence as described herein.
  • agonists of Ck ⁇ -10 polypeptide activities which mimic the polypeptide of the present invention and thus have one or more Ck ⁇ -10 polypeptide activity.
  • chemokine antagonists are provided. These chemokine antagonists may be used to inhibit the action of chemokines, for example, in the treatment of rheumatoid arthritis, inflammation, respiratory diseases, allergy, and IgE-mediated allergic reactions.
  • nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.
  • the present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by a chemokine polypeptide.
  • This method involves contacting cells which express a receptor to which a chemokine polypeptide binds with the candidate compound, assaying a cellular response induced by the chemokine polypeptide, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist.
  • the above referenced receptor will generally be one which binds a chemokine other than Ck ⁇ -10, wherein the activity induced by this other chemokine is inhibited by the candidate compound. Often this candidate compound will be a Ck ⁇ -10 polypeptide.
  • this candidate compound will be a Ck ⁇ -10 polypeptide.
  • a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes for example, to treat solid tumors, chronic infections, auto-immune diseases, psoriasis, asthma, allergy, to regulate hematopoiesis, and to promote wound healing.
  • antibodies against such polypeptides there are provided.
  • antagonist/inhibitors to such polypeptides which may be used to inhibit the action of such polypeptides, for example, in the treatment of auto-immune diseases, chronic inflammatory and infective diseases, histamine-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosis, hyper-eosinophilic syndrome and lung inflammation.
  • FIGURE 1 displays the cDNA sequence (SEQ LD NO: l) and corresponding deduced amino acid sequence (SEQ LD NO:2) of Ck ⁇ -4.
  • the initial 24 amino acids represent the deduced leader sequence of Ck ⁇ -4 such that the putative mature polypeptide comprises 70 amino acids.
  • the standard one-letter abbreviation for amino acids is used.
  • FIGURE 2 displays the cDNA sequence (SEQ LD NO:3) and corresponding deduced amino acid sequence (SEQ ID NO:4) of MCP-4 (also referred to as Ck ⁇ -10).
  • the initial 23 amino acids represent the putative leader sequence of MCP-4 (Ck ⁇ -10) such that the putative mature polypeptide comprises 75 amino acids.
  • FIG. 5 there are several amino terminal ends of MCP-4 produced in cells, represented by arrows in Figure 1 , as shown in Figure 5 and as discussed herein.
  • carboxyl termini have been observed in certain forms of MCP-4 and produced in cells; shown in Figure 5 and discussed herein.
  • the standard one-letter abbreviation for amino acids is used.
  • FIGURE 3 displays the amino acid sequence homology between Ck ⁇ -4 and the mature peptide of eotaxin (SEQ ID NO: 17) (bottom).
  • the standard one-letter abbreviation for amino acids is used.
  • FIGURE 4 displays the amino acid sequence homology between human MCP-4 (Ck ⁇ -10) (top) and human MCP-3 (SEQ ID NO: 18) (bottom).
  • the standard one-letter abbreviation for amino acids is used.
  • FIGURE 5 shows the amino acid sequences of several different forms of MCP-4 (Ck ⁇ -10)
  • SEQ LD NO:4 isolated by expression in vitro.
  • Bacl, 2 and 3 show sequences of three NH 2 -terminal variants of MCP-4 expressed using baculovirus.
  • Drol, 2 and 3+ show sequences of MCP-4 isolated by expression of MCP-4 cDNA in Drosophila cells in vitro.
  • the figure also shows an homology comparison of the full length MCP-4 sequence with sequences of MCP-3 (SEQ ID NO: 19) and eotaxin (SEQ LD NO:20). Identical residues are indicated by vertical lines.
  • FIGURE 6 is a pair of graphs showing (A) release of N-acetyl- ⁇ -D-glucosaminidase from cytochalasin B-treated human blood monocytes in response to MCP-4 (Ck ⁇ -10), Eotaxin, MCP-1, MCP-2, MCP-3 and RANTES, and (B) migration index of cytochalasin B-treated monocytes in response to MCP-4 (Ck ⁇ -10), MCP-1, MCP-3 and a negative control.
  • Enzyme activity is presented on a linear scale of arbitrary fluorescence units along the vertical axis in (A).
  • Relative migration index is presented on a linear scale on the vertical axis in (B)
  • Chemokine concentration in nM is presented in both graphs on a log scale along the horizontal axis.
  • FIGURE 7 is a set of graphs showing migration of CD4 + and CD8 + T-lymphocytes in response to various concentrations of MCP-4 (Ck ⁇ -10), Eotaxin, MCP-1, MlP-l ⁇ and a negative control.
  • Upper graphs show migration of CD4 + T-lymphocytes.
  • Lower graphs show migration of CD8 + T-lymphocytes.
  • the left graph shows migration in response to MCP-1, MlP-l ⁇ and a negative control
  • the right graph shows migration in response to MCP-4 (Ck ⁇ -10), Eotaxin.
  • Number of migrating cells is indicted on a linear scale along the vertical axis. Chemokine concentrations in the attractant media are indicated in nM on a log scale along the horizontal axis.
  • cell migration was measured in 48 well chemotaxis chambers.
  • the migrating cells were counted in five high power fields.
  • the migration is expressed as migration index (mean of migrated cells/mean of migrated cells in absence of added chemokine). Each point is the average of three replicate cultures. The bar shows the standard deviation about the average for the three cultures.
  • FIGURE 8 provides a pair of graphs showing the migration of human eosinophils in response to a negative control, 100 nM MCP-1, 100 nM MCP-3 and several concentration of
  • MCP-4 Ck ⁇ -10
  • Eotaxin Eotaxin.
  • Migration index is indicted on a linear scale along the vertical axis.
  • Chemokine concentrations in the attractant media are indicated in nM on a log scale along the horizontal axis.
  • cell migration was measured in 48 well chemotaxis chambers.
  • the migrating cells were counted in five high power fields.
  • the migration is expressed as migration index (mean of migrated cells/mean of migrated cells in absence of added chemokine). Each point is the average of three replicate cultures. The bar shows the standard deviation about the average for the three cultures.
  • FIGURE 9 is a graph showing survival of cortical neuronal cells cultured in the presence of various concentrations of Ck ⁇ -4, Basic FGF and HG0100.
  • the number of viable cell counts are indicted on a linear scale along the vertical axis, in terms of calcein emission. Concentrations of the factors in the growth medium are indicated in ng/ml on a log scale along the horizontal axis. Each point is the average of six replicate cultures. The bar shows the standard error of the mean about the average for the six cultures.
  • FIGURE 10 is a graph showing neurite outgrowth of cortical neurons cultured in the presence of various concentrations of Ck ⁇ -4, Basic FGF and HG0100. Neurite outgrowth is indicted on a linear scale along the vertical axis, in terms of neurofilament protein measured optical density at 490 nm (OD 490 ). Concentrations of the factors in the growth medium are indicated in ng/ml on a log scale along the horizontal axis. Each point is the average of six replicate cultures. The bar shows the standard error of the mean about the average for the six cultures.
  • FIGURE 1 1 is a graph showing chemotaxis of peripheral blood lymphocytes in response to cultured in the presence of various concentrations of Ck ⁇ -4 and MCP- 1.
  • chemotaxis is indicted on a linear scale along the vertical axis, in terms of ratio of fluorescence emission at 530 nm stimulated by 485 nm excitation. Concentrations of the factors in the growth medium are indicated in ng/ml on a log scale along the horizontal axis. Each point is the average of several; replicate cultures. The bar shows the standard error of the mean about the average for the cultures.
  • FIGURE 12 shows the N-terminal deletion variants of Ck ⁇ -10 (SEQ ID
  • FIGURE 13 shows an analysis of the Ck ⁇ -10 amino acid sequence (SEQ ID NO:4).
  • Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings.
  • the positive peaks indicate locations of the highly antigenic regions of the Ck ⁇ -10 protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained.
  • the domains defined by these graphs are contemplated by the present invention.
  • FIGURE 14 shows the effect of wild type and ⁇ -terminal deletion mutants of Ck ⁇ -10 on calcium mobilization in eosinophils.
  • FIGURE 15 shows the effect of wild type and ⁇ -terminal deletion mutants of Ck ⁇ -10 on eosinophil chemotaxis.
  • polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
  • isolated means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered "by the hand of man” from its natural state.
  • a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated.
  • Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, or could be contained within a cell, and still be isolated in that such vector or composition, or particular cell is not part of its original natural environment.
  • isolated does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
  • a "secreted" Ck ⁇ -4 or Ck ⁇ -10 protein refers to a protein capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a signal sequence, as well as a Ck ⁇ -4 or Ck ⁇ -10 protein released into the extracellular space without necessarily containing a signal sequence. If the Ck ⁇ -4 or Ck ⁇ -10 secreted protein is released into the extracellular space, the Ck ⁇ -4 or Ck ⁇ -10 secreted protein can undergo extracellular processing to produce a "mature" Ck ⁇ -4 or Ck ⁇ -10 protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage.
  • a Ck ⁇ -4 "polynucleotide” refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: 1 or the cDNA contained within the clone deposited with the ATCC.
  • a Ck ⁇ -10 "polynucleotide” refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: 3 or the cDNA contained within the clone deposited with the ATCC.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence.
  • a Ck ⁇ -4 or Ck ⁇ -10 "polypeptide" refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
  • the polynucleotides of the invention are at least 15, at least 30, at least 50, at least 100, at least 125, at least 500, or at least 1000 continuous nucleotides but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb, 7.5kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length.
  • polynucleotides of the invention comprise a portion of the coding sequences, as disclosed herein, but do not comprise all or a portion of any intron.
  • the polynucleotides comprising coding sequences do not contain coding sequences of a genomic flanking gene (i.e., 5' or 3' to the
  • the polynucleotides of the invention do not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s).
  • the full length Ck ⁇ -4 sequence identified as SEQ ID NO:l was generated by overlapping sequences of the deposited clone (contig analysis). A representative clone containing all or most of the sequence for SEQ LD NO: 1 was deposited with the American Type Culture Collection ("ATCC”) on July 29, 1994, and was given the
  • ATCC Deposit Number 75848 accession Number 75848. Additionally, the full length Ck ⁇ -10 sequence identified as SEQ ID NO:3 was generated by overlapping sequences of the deposited clone (contig analysis). A representative clone containing all or most of the sequence for SEQ LD NO: 3 was deposited with the American Type Culture Collection ("ATCC") on July 29, 1994, and was given the ATCC Deposit Number 75849. The ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, USA. The ATCC deposit was made pursuant to the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for purposes of patent procedure.
  • ATCC American Type Culture Collection
  • a Ck ⁇ -4 or Ck ⁇ -10 "polynucleotide” also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ JD NO:l or SEQ ID NO:3, the complement thereof, or the cDNA within the deposited clones.
  • “Stringent hybridization conditions” refers to an overnight incubation at 42 degree C in a solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 ⁇ g/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65 degree C. Also contemplated are nucleic acid molecules that hybridize to the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides under lower stringency hybridization conditions.
  • Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature.
  • washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
  • blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations.
  • the inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility.
  • a polynucleotide which hybridizes only to polyA+ sequences such as any
  • polynucleotide 3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide,” since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone generated using digo dT as a primer).
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can be composed of triple-stranded regions comprising RNA or
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids.
  • the Ck ⁇ -4 or Ck ⁇ -10 polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a Ck ⁇ -4 or Ck ⁇ -10 polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides may contain many types of modifications.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides may be branched , for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic Ck ⁇ -4 or Ck ⁇ -10 polypeptides may result from posttranslation natural processes or may be made by synthetic methods.
  • Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer- RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination.
  • Ck ⁇ -4 or Ck ⁇ -10 Polynucleotides and Polypeptides there are provided isolated nucleic acids (polynucleotides) which encode for the mature Ck ⁇ -4 polypeptide having the deduced amino acid sequence of Figure 1 (SEQ LD NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75848 on July 29, 1994 and for the mature MCP-4 (also known as Ck ⁇ -10) polypeptide having the deduced amino acid sequence of Figures 2, 5 or 12 (SEQ LD NO:4), or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No.
  • SEQ LD NO:2 the deduced amino acid sequence of Figure 1
  • MCP-4 also known as Ck ⁇ -10 polypeptide having the deduced amino acid sequence of Figures 2, 5 or 12
  • polynucleotides encoding MCP- 4 polypeptides comprising in sequence residues 28-93 set out in Figures 2, 5, and 12 (SEQ ID NO:4), and, among these, particularly polynucleotides encoding a polypeptide having an amino acid sequence selected from the group consisting of residues 1-98. 17-98, 20-98, 22- 98, 24-98, 28-98, 28-95 and 28-93 set out in Figures 2, 5, and 12 (SEQ LD NO:4), and fragments, analogs and derivatives thereof.
  • Ck ⁇ -4 is structurally related to the chemokine family. It contains an open reading frame encoding a protein of 96 amino acid residues of which the first 26 amino acids residues are the putative leader sequence such that the mature protein comprises 70 amino acids.
  • the protein exhibits the highest degree of homology to eotaxin with 20% identity and 37% similarity over the entire coding sequence as shown in Figure 3. It is also important that the four spatially conserved cysteine residues in chemokines are found in the polypeptides of the present invention.
  • MCP-4 also known as Ck ⁇ -10
  • clone HE9DR66 was discovered in a cDNA library derived from nine week early human tissue.
  • MCP-4 is structurally related to the chemokine family. It contains an open reading frame encoding a protein of 98 amino acid residues of which approximately the first 20 amino acid residues are putative or actual leader sequences as shown in Figures 2 and 5 (SEQ LD NO:4) and discussed elsewhere herein, and the mature protein comprises around 75 amino acids depending on the cleavage site, or sites, also as shown in Figure 5.
  • the protein has a marked sequence similarity to MCP- 1 , MCP-2, MCP-3 and Eotoxin and exhibits the highest degree of homology to MCP-3 with 65% identity and 77% similarity over the entire coding sequence (See, e.g. Figures 4 and 5).
  • MCP-4 polypeptides also referred to herein as Ck ⁇ -10 of the present invention, described herein below in greater detail, include polypeptides having the amino acid sequences set out in Figure 2, Figure 5 or Figure 12 (SEQ ID NO:4). It will be appreciated that such preferred polypeptides include those with free amino and blocked amino termini, particular those noted in Figure 5, in which the terminal glutamine is a blocked pyroglutamine residue.
  • MCP-4 polypeptides comprising in sequence residues 28-93 set out in Figures 2, 5 or 12 (SEQ ID NO:4), and, among these, particularly polypeptides having an amino acid sequence selected from the group consisting of residues 1-98, 17-98, 20-98, 22-98, 24-98, 28-98, 28-95 and 28-93 set out in Figures 2, 5 or 12 (SEQ LD NO:4), and fragments, analogs and derivatives thereof.
  • the present invention also encompasses mature forms of the polypeptide having the polypeptide sequence of SEQ ID NO: 2 or SEQ LD NO:4 and/or the polypeptide sequence encoded by the cDNA in a deposited clone.
  • Polynucleotides encoding the mature forms are also encompassed by the invention.
  • proteins secreted by mammalian cells have a signal or secretary leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated.
  • Most mammalian cells and even insect cells cleave secreted proteins with the same specificity.
  • cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein.
  • cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.
  • the deduced amino acid sequence of the secreted chemokine polypeptide was analyzed by a computer program called SignalP (Henrik Nielsen et al., Protein Engineering 10: 1-6 (1997)), which predicts the cellular location of a protein based on the amino acid sequence.
  • SignalP Harik Nielsen et al., Protein Engineering 10: 1-6 (1997)
  • the present invention provides secreted polypeptides having a sequence shown in SEQ ID NO:2 or SEQ ID NO:4 which have an N-terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point.
  • SEQ ID NO:2 or SEQ ID NO:4 which have an N-terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point.
  • cleavage of the signal sequence from a secreted protein is not entirely uniform, resulting in more than one secreted species.
  • the signal sequence identified by the above analysis may not necessarily predict the naturally occurring signal sequence.
  • the naturally occurring signal sequence may be further upstream from the predicted signal sequence.
  • the predicted signal sequence will be capable of directing the secreted protein to the ER.
  • the present invention provides the mature protein produced by expression of the polynucleotide sequence of SEQ LD NO: l or SEQ ID NO: 3 and/or the polynucleotide sequence contained in the cDNA of a deposited clone, in a mammalian cell (e.g., COS cells, as desribed below).
  • a mammalian cell e.g., COS cells, as desribed below.
  • the present invention is directed to variants of the polynucleotide sequence disclosed in SEQ LD NO:l or SEQ LD NO: 3, the complementary strand thereto, and/or the cDNA sequence contained in a deposited clone.
  • the present invention also encompasses variants of the polypeptide sequence disclosed in SEQ ID NO:2 or SEQ ID NO:4 and/or encoded by a deposited clone.
  • Variant refers to a polynucleotide or polypeptide differing from the Ck ⁇ -4 or Ck ⁇ - 10 polynucleotide or polypeptide, but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide or polypeptide.
  • the present invention is also directed to nucleic acid molecules which comprise, or alternatively consist of, a nucleotide sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide coding sequence in SEQ ID NO:l or SEQ ID NO:3 or the complementary strand thereto, the nucleotide coding sequence contained in a deposited cDNA clone or the complementary strand thereto, a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or SEQ ID NO:4, a nucleotide sequence encoding the polypeptide encoded by the cDNA contained in a deposited clone, and/or polynucleotide fragments of any of these nucleic acid molecules (e.g., those fragments described herein).
  • Polynucleotides which hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by
  • the present invention is also directed to polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide sequence shown in SEQ ID NO:2 or SEQ JD NO:4, the polypeptide sequence encoded by the cDNA contained in a deposited clone, and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein).
  • nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the Ck ⁇ -4 or Ck ⁇ -10 polypeptide.
  • nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • the query sequence may be an entire sequence shown of SEQ JD NO:l or SEQ JD NO:3, the ORF (open reading frame), or any fragment specified as described herein.
  • nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs.
  • a preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.)
  • a sequence alignment the query and subject sequences are both DNA sequences.
  • An RNA sequence can be compared by converting U's to T's.
  • the result of said global sequence alignment is in percent identity.
  • the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment.
  • This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
  • a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity.
  • the deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end.
  • the 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%.
  • a 90 base subject sequence is compared with a 100 base query sequence.
  • deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query.
  • percent identity calculated by FASTDB is not manually corrected.
  • bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
  • a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • the amino acid sequence of the subject polypeptide may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence.
  • up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid.
  • These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
  • any particular polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences of SEQ ID NO:2 or SEQ ID NO:4 or to the amino acid sequence encoded by the cDNA contained in a deposited clone can be determined conventionally using known computer programs.
  • a preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245(1990)).
  • the query and subject sequences are either both nucleotide sequences or both amino acid sequences.
  • the result of said global sequence alignment is in percent identity.
  • the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity.
  • the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C- terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score.
  • This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus.
  • the 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%.
  • a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected.
  • the Ck ⁇ -4 and Ck ⁇ -10 variants may contain alterations in the coding regions, non- coding regions, or both. Especially preferred are polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred.
  • Ck ⁇ -4 and Ck ⁇ -10 polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as E. coli).
  • Naturally occurring Ck ⁇ -4 and Ck ⁇ -10 variants are called "allelic variants," and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic variants can vary at either the polynucleotide and/or polypeptide level and are included in the present invention. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.
  • variants may be generated to improve or alter the characteristics of the Ck ⁇ -4 and Ck ⁇ -10 polypeptides. For instance, one or more amino acids can be deleted from the N-terminus or C-terminus of the secreted protein without substantial loss of biological function.
  • Interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli et al., J. Biotechnology 7: 199-216 (1988).)
  • the invention further includes Ck ⁇ -4 and Ck ⁇ -10 polypeptide variants which show substantial biological activity.
  • Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.
  • the present application is directed to nucleic acid molecules at least 90%, 95%, 96%,
  • nucleic acid sequences disclosed herein e.g., encoding a polypeptide having the amino acid sequence of an N and/or C terminal deletion disclosed below as the general formula n-m of SEQ LD NO:4 (e.g., n-m, n-m 1 , n-m 2 , n'-m 1 , and n'- m 2 ) where n and m are integers as described below), irrespective of whether they encode a polypeptide having Ck ⁇ -10 functional activity.
  • SEQ LD NO:4 e.g., n-m, n-m 1 , n-m 2 , n'-m 1 , and n'- m 2
  • nucleic acid molecule does not encode a polypeptide having Ck ⁇ -10 functional activity
  • PCR polymerase chain reaction
  • nucleic acid molecules of the present invention that do not encode a polypeptide having Ck ⁇ -10 functional activity include, inter alia, (1) isolating a Ck ⁇ -10 gene or allelic or splice variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the Ck ⁇ -10 gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon
  • nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences disclosed herein, which do, in fact, encode a polypeptide having Ck ⁇ -10 functional activity.
  • a polypeptide having Ck ⁇ -10 functional activity is intended polypeptides exhibiting activity similar, but not necessarily identical, to a functional activity of the Ck ⁇ -10 polypeptides of the present invention (e.g., complete (full-length) Ck ⁇ -10, mature Ck ⁇ -10 and soluble Ck ⁇ -10 (e.g., having sequences contained in the extracellular domain of Ck ⁇ -10) as measured, for example, in a particular immunoassay or biological assay.
  • a Ck ⁇ -10 functional activity can routinely be measured by determining the ability of a Ck ⁇ -10 polypeptide to bind a Ck ⁇ -10 ligand.
  • Ck ⁇ -10 functional activity may also be measured by determining the ability of a polypeptide, such as cognate ligand which is free or expressed on a cell surface, to induce cells expressing the polypeptide.
  • nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA, the nucleic acid sequence shown in Figure 2 (SEQ JD NO: 3), or fragments thereof, will encode polypeptides "having Ck ⁇ -10 functional activity.”
  • SEQ JD NO: 3 the nucleic acid sequence shown in Figure 2
  • degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many instances, this will be clear to the skilled artisan even without performing the above described comparison assay.
  • nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having Ck ⁇ -10 functional activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.
  • the first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.
  • the second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.
  • tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and lie; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
  • site directed changes at the amino acid level of Ck ⁇ -10 can be made by replacing a particular amino acid with a conservative amino acid.
  • Preferred conservative mutations include:
  • preferred complementary mutations include: Ml replaced with A, G, I, L, S, T, or V; K2 replaced with H, or R; V3 replaced with A, G, I, L, S, T, or M; S4 replaced with A, G, I, L, T, M, or V; A5 replaced with G, I, L, S, T, M, or V; V6 replaced with A, G, I, L, S, T, or M; L7 replaced with A, G, I, S, T, M, or V; L8 replaced with A, G, I, S, T, M, or V; L10 replaced with A, G, I, S, T, M, or V; Ll l replaced with A, G, I, S, T, M, or V; L12 replaced with A, G, I, S, T, M, or V; M13 replaced with A,
  • the resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art.
  • the resulting constructs have an increased and/or a decreased Ck ⁇ -10 activity or function, while the remaining Ck ⁇ -10 activities or functions are maintained. More preferably, the resulting constructs have more than one increased and/or decreased Ck ⁇ -10 activity or function, while the remaining Ck ⁇ -10 activities or functions are maintained.
  • variants of Ck ⁇ -10 include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification.
  • Ck ⁇ -10 polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity.
  • preferred non-conservative substitutions of Ck ⁇ -10 include: Ml replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K2 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V3 replaced with D, E, H, K, R, N, Q, F, W.
  • D, E, H, K, R, N, Q, F, W, Y, P, or C A23 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q24 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; P25 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; D26 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A27 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L28 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N29 replaced with D, E, H, K
  • E, H, K, R, N, Q, F, W, Y, P, or C S40 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S40 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K41 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K42 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; 143 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S44 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L45 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q
  • E72 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C
  • 173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • C74 replaced with D, E, H , K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P
  • A75 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C
  • D76 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C
  • P77 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C
  • K78 replaced with D, E, A, A, G
  • E, H, K, R, N, Q, F, W, Y, P, or C G90 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G90 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R91 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K92 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A93 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H94 replaced with D, E, A, G, I, L, S, T, M, V, N , Q, F, W, Y, P, or C; T95 replaced with D, E, H, K, R, N, Q, F,
  • the resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art.
  • the resulting constructs have an increased and/or decreased Ck ⁇ -10 activity or function, while the remaining Ck ⁇ -10 activities or functions are maintained.
  • the resulting constructs have more than one increased and/or decreased Ck ⁇ -10 activity or function, while the remaining Ck ⁇ -10 activities or functions are maintained.
  • more than one amino acid e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10 can be replaced with the substituted amino acids as described above (either conservative or nonconservative).
  • the substituted amino acids can occur in the full length, mature, or proprotein form of Ck ⁇ -10 protein, as well as the N- and C- terminal deletion mutants, having the general formula n-m of SEQ ID NO:4 (e.g., n-m, n-m 1 , n-m 2 , n'-m 1 , and n'-m 2 ) where n and m are integers as described below.
  • a further embodiment of the invention relates to a polypeptide which comprises the amino acid sequence of a Ck ⁇ -10 polypeptide having an amino acid sequence which contains at least one amino acid substitution, but not more than 50 amino acid substitutions, even more preferably, not more than 40 amino acid substitutions, still more preferably, not more than 30 amino acid substitutions, and still even more preferably, not more than 20 amino acid substitutions.
  • a polypeptide it is highly preferable for a polypeptide to have an amino acid sequence which comprises the amino acid sequence of a Ck ⁇ -10 polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4,
  • the number of additions, substitutions, and/or deletions in the amino acid sequence of Figure 2 (SEQ LD NO:4) or fragments thereof (e.g., the mature form and/or other fragments described herein), is 1-5, 5- 10, 5-25, 5-50, 10-50 or 50-150, conservative amino acid substitutions are preferable.
  • polynucleotide fragment refers to a short polynucleotide having a nucleic acid sequence which: is a portion of that contained in a deposited clone, or encoding the polypeptide encoded by the cDNA in a deposited clone; is a portion of that shown in SEQ LD NO:l or SEQ ED NO:3 or the complementary strand thereto, or is a portion of a polynucleotide sequence encoding the polypeptide of SEQ ED NO:2 or SEQ ED NO:4.
  • the nucleotide fragments of the invention are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length.
  • a fragment "at least 20 nt in length,” for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in a deposited clone or the nucleotide sequence shown in SEQ LD NO: 1 or SEQ ED NO:3.
  • nucleotide fragments include, but are not limited to, as diagnostic probes and primers as discussed herein. Of course, larger fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred.
  • polynucleotide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, a sequence from about nucleotide number 1-69, 70-120, 121-171, 172-222, 223-273, or 274 to the end of SEQ ID NO: 3, or the complementary strand thereto, or the cDNA contained in the deposited clone.
  • “about” includes the particularly recited ranges, and ranges larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini.
  • these fragments encode a polypeptide which has biological activity. More preferably, these polynucleotides can be used as probes or primers as discussed herein.
  • polypeptide fragments refers to an amino acid sequence which is a portion of that contained in SEQ ID NO:2 or SEQ ID NO:4 or encoded by the cDNA contained in a deposited clone.
  • Protein (polypeptide) fragments may be "free-standing,” or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
  • polypeptide fragments of the invention include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-23, 24-40, 41-60, 61-80, or 81 to the end of the coding region of Ck ⁇ -10 shown in Figure 2 (SEQ ID NO:4).
  • polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, or 150 amino acids in length.
  • “about” includes the particularly recited ranges or values, and ranges or values larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • polypeptide fragments include the secreted protein as well as the mature form. Further preferred polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both.
  • polypeptide fragments include the secreted Ck ⁇ -10 protein as well as the mature form. Further preferred polypeptide fragments include the secreted Ck ⁇ -10 protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both.
  • the present invention further provides polynucleotides which encode Ck ⁇ -10 polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence shown in SEQ ED NO:4, up to the cysteine residue at position number 34, and polynucleotides encoding such polypeptides.
  • the present invention provides polynucleotides which encode polypeptides comprising the amino acid sequence of residues n-98 of SEQ ID NO:4, where n is an integer in the range of 1 to 30, and preferably n is in the range of 20 to 35, and most preferrably n is in the range 29 to 35, where Cys-35 is the position of the first residue from the N-terminus the Ck ⁇ -10 polypeptide (shown in SEQ ED NO:4) believed to be required for receptor binding activity. Further, n may be in the range of 29-35, 30-35, 31-35, 32-35, 33-35, 34-35, or n may equal 35.
  • the invention provides polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ ID NO:4 as residues 1-98, 2-98, 3-98, 4-98, 5-98, 6-98, 7-98, 8-98, 9-98, 10-98, 11-98, 12-98, 13-98, 14-98, 15-98, 16-98, 17-98, 18-98, 19-98, 20-98, 21-98, 22-98, 23-98, 24-98, 25-98, 26-98, 27-98, 28-98, 29-98, 30-98, 31-98, 32-98, 33-98, 34-98, or 35-98.
  • polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ JD NO:4 as residues 18-98, 19-98, 21-98, 23-98, 25-98, 26-98, 27-98, 29-98, 30-98, 31-98, 32-98, 33-98, 34-98 or 35-98, with the most preferred within this group being 25-98, 26-98, 27-98, 28-98, 29-98 and 30-98.
  • the present invention further provides polynucleotides which encode polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the Ck ⁇ -10 polypeptide up to the cysteine residue at position 74 of SEQ ED NO: 4.
  • the present invention provides polynucleotides which encode polypeptides having the amino acid sequence of residues 17-m of the amino acid sequence in SEQ ED
  • polypeptide comprises residues 23-m where m is in the range of 74-98 since residue cysteine-74 is the first residue from the C-terminus of the complete Ck ⁇ -10 polypeptide (shown in SEQ ID NO: 4) believed to be required for receptor binding and target cell modulation activities.
  • n may be in the range of 74-98, 75-98, 76-98, 77-98, 78-98, 79-98, 80-98, 81-98, 82-98, 83-98, 84-98, 85-98, 86-98, 87-98, 88-98, 90-98, 91-98, 92-98, 93-98, 94-98, 95-98, 96-98, 97-98 or n may equal 98.
  • the invention provides polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ ID NO:4 as residues 17-74, 17-75, 17-76, 17-77, 17-78, 17-79, 17-80, 17-81, 17-82, 17-83, 17-84, 17-85, 17-86, 17-87, 17-88, 17-89, 17-90, 17-91, 17-92, 17-93, 17-94, 17-95, 17-96, 17-97, or 17-98.
  • polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ ED NO:4 as residues 23-74, 23-75, 23-76, 23-77, 23-78, 23-79, 23-80, 23-81, 23-82, 23-83, 23-84, 23-85, 23-86, 23-87, 23-88, 23-89, 23-90, 23-91, 23-92, 23-93, 23-94, 23-95, 23-96, 23-97, 23-98 23-74, 23-75, 23-76, 23-77, 23-78, 23-79, 23-80, 23-81, 23-82, 23-83, 23-84, 23-85, 23-86, 23-87, 23-88, 23-89, 23-90, 23-91, 23-92, 23-93, 23-94, 23-95, 23-96, and 23-97.
  • N-terminal deletions of the Ck ⁇ -10 polypeptide can be described by the general formula n'-98, where n ' is an integer from 2 to 93, where n ' corresponds to the position of the amino acid residue identified in SEQ ED NO:4.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of: K-2 to T-98; V-3 to T-98; S-4 to T-98; A-5 to T-98; V-6 to T-98; L-7 to T-98; L-8 to T-98; C-9 to T-98; L-10 to T-98; L-11 to T-98; L-12 to T-98; M-13 to T-98; T-14 to T-98; A-15 to T-98; A-16 to T-98; F-17 to T-98; N-18 to T-98; P-19 to T-98; Q-20 to T-98; G-21 to T-98; L-22 to T-98; A-23 to T-98; Q-24 to T- 98; P-25 to T-98; D-26 to T-98; A-27 to T-98; L-28 to T-98; N-29 to T-98; V-30 to T-98; P- 31 to T-
  • nucleic acid molecules comprising, or alternatively, consisting of, a polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%,
  • the present invention also encompasses the above polynucleotide sequences fused to a heterologous polynucleotide sequence.
  • Ck ⁇ -10 mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that an Ck ⁇ -10 mutein with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities.
  • the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the Ck ⁇ -10 polypeptide shown in Figure 2 (SEQ ID NO:4), as described by the general formula 1-m', where m' is an integer from 7 to 97, where m 1 corresponds to the position of amino acid residue identified in SEQ ED NO:4.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of M-l to K-97; M-l to L-96; M-l to T-95; M-l to H-94; M-l to A-93; M-l to K-92; M-l to R-91; M-l to G-90; M-l to L-89; M-l to H-88; M-l to K-87; M-l to M-86; M-l to Y-85; M-l to N-84; M-l to Q-83; M-l to V-82; M-l to W-81; M-l to K-80; M-l to E-79; M-l to K-78; M-l to P-77; M-l to D-76; M-l to A-75; M-l to C-74; M-l to 1-73; M-l to E-72; M-l to K-71;
  • polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the mature Ck ⁇ -10 polypeptide shown in Figure 2 (SEQ ID NO:4), as described by the general formula 24-m 2 , where m 2 is an integer from 30 to 97, where m 2 corresponds to the position of amino acid residue identified in SEQ ED NO:4.
  • the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of Q-24 to K-97; Q-24 to L-96; Q-24 to T-95; Q-24 to H-94; Q- 24 to A-93; Q-24 to K-92; Q-24 to R-91; Q-24 to G-90; Q-24 to L-89; Q-24 to H-88; Q-24 to K-87; Q-24 to M-86; Q-24 to Y-85; Q-24 to N-84; Q-24 to Q-83; Q-24 to V-82; Q-24 to W-81 ; Q-24 to K-80; Q-24 to E-79; Q-24 to K-78; Q-24 to P-77; Q-24 to D-76; Q-24 to A- 75; Q-24 to C-74; Q-24 to 1-73; Q-24 to E-72; Q-24 to K-71 ; Q-24 to G-70; Q-24 to L-69; Q-24 to K-68; Q-24 to to
  • a signal sequence may be added to these C-terminal contracts.
  • any of the above listed constucts may include an N- terminal methionine.
  • Polynucleotides encoding these polypeptides are also encompassed.
  • nucleic acid molecules comprising, or alternatively, consisting of, a polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%,
  • the present invention also encompasses the above polynucleotide sequences fused to a heterologous polynucleotide sequence.
  • any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted Ck ⁇ -10 polypeptide.
  • the invention also provides polynucleotides which encode polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini of the full-length Ck ⁇ -10 polypeptide comprising or alternatively consisting of, amino acid residues described by the general formula n-m of SEQ ED NO:4, (e.g., n-m, n-m', n-m 2 , n'-m, n'-m', or n'-m 2 ) where n, n', m, m' and m 2 are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • N and C-terminal deletions include the polypeptides comprising amino acid residues: 17-74, 17-75, 17-76, 17-77, 17-78, 17-79, 17-80, 17-81, 17-82, 17-83, 17-84, 17-85,
  • polypeptides are also encompassed by the invention. Also included are a nucleotide sequence encoding a polypeptide consisting of a portion of the complete Ck ⁇ -10 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 75849, where this portion excludes any integer of amino acid residues from 1 to about 88 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No.
  • n-m of SEQ ED NO:4 (e.g., n-m, n-m', n- m 2 , n'-m, n'-m 1 , or n'-m 2 ) where n, n', m, m' and m 2 are integers as described above.
  • the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific Ck ⁇ -10 N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • Additional preferred polypeptide fragments comprise, or alternatively consist of, the amino acid sequence of residues: M-l to A-15; K-2 to A-16; V-3 to F-17; S-4 to N-18; A-5 to P-19; V-6 to Q-20; L-7 to G-21; L-8 to L-22; C-9 to A-23; L-10 to Q-24; L-11 to P-25; L- 12 to D-26; M-13 to A-27; T-14 to L-28; A-15 to N-29; A-16 to V-30; F-17 to P-31; N-18 to S-32; P-19 to T-33; Q-20 to C-34; G-21 to C-35; L-22 to F-36; A-23 to T-37; Q-24 to F-38; P-25 to S-39; D-26 to S-40; A-27 to K-41; L-28 to K-42; N-29 to 1-43; V-30 to S-44; P-31 to L-45; S-32 to Q-46; T-33 to R-47; C-34
  • polypeptide fragments may retain the biological activity of Ck ⁇ -10 polypeptides of the invention and/or may be useful to generate or screen for antibodies, as described further below.
  • Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
  • nucleic acid molecules comprising, or alternatively, consisting of, a polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%,
  • the present invention also encompasses the above polynucleotide sequences fused to a heterologous polynucleotide sequence.
  • the present application is also directed to proteins containing polypeptides at least 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the
  • the polynucleotide fragments of the invention encode a polypeptide which demonstrates a Ck ⁇ -10 functional activity.
  • a polypeptide demonstrating a Ck ⁇ -10 "functional activity" is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) Ck ⁇ -10 protein.
  • Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a Ck ⁇ -10 polypeptide for binding) to an anti- Ck ⁇ -10 antibody], immunogenicity (ability to generate antibody which binds to a Ck ⁇ -10 polypeptide), ability to form multimers with Ck ⁇ -10 polypeptides of the invention, and ability to bind to a receptor or ligand for a Ck ⁇ -10 polypeptide.
  • Ck ⁇ -10 polypeptides and fragments, variants derivatives, and analogs thereof, can be assayed by various methods.
  • various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc.
  • competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoradiometric
  • antibody binding is detected by detecting a label on the primary antibody.
  • the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody.
  • the secondary antibody is labeled.
  • binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting. See generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59:94-123.
  • physiological correlates of Ck ⁇ -10 binding to its substrates can be assayed.
  • fragments of the invention are fragments characterized by structural or functional attributes of Ck ⁇ -10.
  • Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta- sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions”), coil and coil-forming regions ("coil-regions”), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) of complete (i.e., full-length) Ck ⁇ -10 (SEQ ED
  • Certain preferred regions are those set out in Figure 13 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in Figure 2 (SEQ ED NO:4), such preferred regions include; Garnier- Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson-Wolf high antigenic index regions, as predicted using the default parameters of these computer programs.
  • polynucleotides encoding these polypeptides are also encompassed by the invention.
  • the polynucleotides of the invention encode functional attributes of Ck ⁇ -10.
  • Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions”), turn and turn-forming regions
  • turn-regions coil and coil-forming regions
  • hydrophilic regions hydrophobic regions
  • alpha amphipathic regions beta amphipathic regions
  • flexible regions surface-forming regions and high antigenic index regions of Ck ⁇ -10.
  • Figure 13 and/or Table I was generated using the various modules and algorithms of the DNA* STAR set on default parameters.
  • the data presented in columns VIII, IX, XIII, and XIV of Table I can be used to determine regions of Ck ⁇ -10 which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, IX, XIII, and/or LV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
  • the above-mentioned preferred regions set out in Figure 13 and in Table I include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1.
  • such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf regions of high antigenic index.
  • Table I
  • fragments in this regard are those that comprise regions of
  • Ck ⁇ -10 that combine several structural features, such as several of the features set out above.
  • Other preferred polypeptide fragments are biologically active Ck ⁇ -10 fragments.
  • Bioly active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the Ck ⁇ -10 polypeptide.
  • the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
  • Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
  • polynucleotide sequences such as EST sequences
  • SEQ JD NO:3 amino acid sequences
  • amino acid sequences are publicly available and accessible through sequence databases. Some of these sequences are related to SEQ JD NO:3 and may have been publicly available prior to conception of the present invention. Preferably, such related polynucleotides are specifically excluded from the scope of the present invention. To list every related sequence would be cumbersome.
  • a-b a nucleotide sequence described by the general formula of a-b, where a is any integer between 1 to 283 of SEQ ID NO:3, b is an integer of 15 to 297, where both a and b correspond to the positions of nucleotide residues shown in SEQ ED NO: 3, and where the b is greater than or equal to a + 14.
  • polypeptides may be produced by expressing a cDNA of the invention, particularly a cDNA having the sequence set out in Figures 1 (SEQ ED NO: l), 2, 5, or 12 (SEQ ID NO:3), or having the sequence of the human cDNA of the deposited clones, using for instance a baculovirus vector in insect host cells.
  • the polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand.
  • the coding sequence which encodes the mature polypeptides may be identical to the coding sequence shown in Figures 1 (SEQ JD NO:l) and 2 (SEQ ID NO:3) or that of the deposited clones or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptides, or the other polypeptides noted herein, as for instance noted herein above, as the amino acid sequences of Figures 1 (SEQ ID NO:2), 2, 5 or 12 (SEQ ID NO:4), or those encoded by the deposited cDNAs.
  • polypeptides of Figures 1 SEQ ED NO:2
  • SEQ ID NO:4 polypeptides of Figures 1
  • additional coding sequence such as a leader or secretory sequence or a proprotein sequence
  • non-coding sequence such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptides.
  • polynucleotide encoding a polypeptide encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
  • the present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figures 1 and 2, and the sequences set out in Figure 5 and 12, or the polypeptides encoded by the cDNA of the deposited clones.
  • the variant of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides.
  • the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures 1 and 2, the polypeptides set out in Figure 5 or 12, or the same mature polypeptides encoded by the cDNA of the deposited clones as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptides of Figures 1 and 2, or the polypeptides set out in Figure 5 or 12, or the polypeptides encoded by the cDNA of the deposited clones.
  • Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
  • the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figures 1 and 2, or the polypeptides set out in Figure 5 or 12, or of the coding sequence of the deposited clones.
  • an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
  • the present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell.
  • the polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide.
  • the polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues.
  • a mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
  • the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
  • the polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention.
  • the marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemaglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used.
  • the HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)).
  • the present invention further relates to polynucleotides which hybridize to the hereinabove -described sequences if there is at least 50% and preferably 70% identity between the sequences.
  • the present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides .
  • stringent conditions means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences.
  • polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figures 1 and 2, or the polypeptides set out in Figure 5 or 12, or the deposited cDNA.
  • the deposit(s) referred to herein will be maintained under the terms of the Budapest
  • the present invention further relates to chemokine polypeptides which have the deduced amino acid sequences of Figures 1 and 2 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptides.
  • fragment when referring to the polypeptides of Figures 1 and 2 or that encoded by the deposited cDNA, means polypeptides which retain essentially the same biological function or activity as such polypeptides.
  • an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
  • chemokine polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or a synthetic polypeptides, preferably recombinant polypeptides.
  • the fragment, derivative or analog of the polypeptides of Figures 1 and 2, or of the polypeptides of Figure 5 or 12, or that encoded by the deposited cDNAs may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence.
  • Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the
  • the present invention encompasses polypeptides comprising, or alternatively consisting of, an epitope of the polypeptide having an amino acid sequence of SEQ ED NO:2 or SEQ ED NO:4, or an epitope of the polypeptide sequence encoded by a polynucleotide sequence contained in ATCC Deposit No: 75848 or 75849 or encoded by a polynucleotide that hybridizes to the complement of the sequence of SEQ JD NO: 1 or SEQ ED NO:3 or contained in ATCC Deposit No: 75848 or 75849 under stringent hybridization conditions or lower stringency hybridization conditions as defined supra.
  • the present invention further encompasses polynucleotide sequences encoding an epitope of a polypeptide sequence of the invention (such as, for example, the sequence disclosed in SEQ ID NO:l or SEQ ED NO:3), polynucleotide sequences of the complementary strand of a polynucleotide sequence encoding an epitope of the invention, and polynucleotide sequences which hybridize to the complementary strand under stringent hybridization conditions or lower stringency hybridization conditions defined supra.
  • epitope of a polypeptide sequence of the invention such as, for example, the sequence disclosed in SEQ ID NO:l or SEQ ED NO:3
  • epitope of the invention such as, for example, the sequence disclosed in SEQ ID NO:l or SEQ ED NO:3
  • polynucleotide sequences of the complementary strand of a polynucleotide sequence encoding an epitope of the invention and polynucleotide sequences which hybridize to the complementary
  • the present invention encompasses a polypeptide comprising an epitope, as well as the polynucleotide encoding this polypeptide.
  • An "immunogenic epitope,” as used herein, is defined as a portion of a protein that elicits an antibody response in an animal, as determined by any method known in the art, for example, by the methods for generating antibodies described infra. (See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81 :3998- 4002 (1983)).
  • antigenic epitope is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art, for example, by the immunoassays described herein. Immunospecific binding excludes nonspecific binding but does not necessarily exclude cross- reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic. Fragments which function as epitopes may be produced by any conventional means.
  • antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and, most preferably, between about 15 to about 30 amino acids.
  • Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length.
  • Additional non-exclusive preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof.
  • Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies, that specifically bind the epitope.
  • Preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these antigenic epitopes.
  • Antigenic epitopes can be used as the target molecules in immunoassays. (See, for instance, Wilson et al., Cell 37:767- 778 (1984); Sutcliffe et al., Science 219:660-666 (1983)).
  • immunogenic epitopes can be used, for example, to induce antibodies according to methods well known in the art. (See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985).
  • Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes.
  • the polypeptides comprising one or more immunogenic epitopes may be presented for eliciting an antibody response together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse), or, if the polypeptide is of sufficient length (at least about 25 amino acids), the polypeptide may be presented without a carrier.
  • a carrier protein such as an albumin
  • immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting).
  • Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle et al., J. Gen. Virol., 66:2347-2354 (1985).
  • animals may be immunized with free peptide; however, anti- peptide antibody titer may be boosted by coupling the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
  • KLH keyhole limpet hemacyanin
  • peptides containing cysteine residues may be coupled to a carrier using a linker such as maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutar aldehyde.
  • Animals such as rabbits, rats and mice are immunized with either free or carrier- coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 ⁇ g of peptide or carrier protein and Freund's adjuvant or any other adjuvant known for stimulating an immune response.
  • booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface.
  • the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
  • polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to other polypeptide sequences.
  • the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, or any combination thereof and portions thereof) resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • CHI constant domain of immunoglobulins
  • CH2, CH3, or any combination thereof and portions thereof resulting in chimeric polypeptides.
  • Such fusion proteins may facilitate purification and may increase half-life in vivo. This has been shown for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins.
  • IgG Fusion proteins that have a disulfide-linked dimeric structure due to the IgG portion desulfide bonds have also been found to be more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone.
  • Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag (e.g., the hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of the expressed polypeptide.
  • an epitope tag e.g., the hemagglutinin ("HA") tag or flag tag
  • HA hemagglutinin
  • a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972- 897).
  • the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues.
  • the tag serves as a matrix binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged proteins can be selectively eluted with imidazole-containing buffers.
  • DNA shuffling may be employed to modulate the activities of polypeptides of the invention, such methods can be used to generate polypeptides with altered activity, as well as agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol.
  • alteration of polynucleotides corresponding to SEQ ID NO:l or SEQ ID NO:3 and the polypeptides encoded by these polynucleotides may be achieved by DNA shuffling.
  • DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence.
  • polynucleotides of the invention, or the encoded polypeptides may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • Antibodies Further polypeptides of the invention relate to antibodies and T-cell antigen receptors
  • TCR which immunospecifically bind a polypeptide, polypeptide fragment, or variant of SEQ ED NO:2 or SED ED NO:4, and/or an epitope, of the present invention (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding).
  • Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope -binding fragments of any of the above.
  • antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen.
  • the immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and LgA2) or subclass of immunoglobulin molecule.
  • the antibodies are human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single- chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain.
  • Antigen-binding antibody fragments, including single-chain antibodies may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CHI, CH2, and CH3 domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CHI, CH2, and CH3 domains.
  • the antibodies of the invention may be from any animal origin including birds and mammals.
  • the antibodies are human, murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken.
  • "human” antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Patent No. 5,939,598 by Kucherlapati et al.
  • the antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Patent Nos. 4,474,893; 4,714,681 ; 4,925,648; 5,573,920; 5,601 ,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
  • Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind.
  • the epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or listed in the Tables and Figures.
  • Preferred epitopes of the invention include: those identified in Table 1 and Figure 13, as well as polynucleotides that encode these epitopes.
  • Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.
  • Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. Antibodies that bind polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In specific embodiments, antibodies of the present invention cross-react with murine, rat and/or rabbit homologs of human proteins and the corresponding epitopes thereof.
  • Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention.
  • the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein.
  • antibodies which bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions are also included in the present invention.
  • Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10 "2 M, 10 "2 M, 5 X 10 "3 M, 10 “3 M, 5 X 10 “ 4 M, 10 “4 M, 5 X 10 "5 M, 10 “5 M, 5 X 10 “6 M, 10 “6 M, 5 X 10 "7 M, 10 7 M, 5 X 10 "8 M, 10 “8 M, 5 X 10 "9 M, 10 “9 M, 5 X 10 '° M, 10 '° M, 5 X 10 ' “ M, 10 “ “ M, 5 X 10 ' 2 M, 10 12 M, 5 X 10-” M, 10 ' 3 M, 5 X lO “ ' 4 M, 10 " ' 4 M, 5 X 10 “15 M, or 10 " ' 5 M.
  • the invention also provides antibodies that competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example, the immunoassays described herein.
  • the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.
  • Antibodies of the present invention may act as agonists or antagonists of the polypeptides of the present invention.
  • the present invention includes antibodies which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully.
  • antibodies of the present invention bind an antigenic epitope disclosed herein, or a portion thereof.
  • the invention features both receptor- specific antibodies and ligand-specific antibodies.
  • the invention also features receptor- specific antibodies which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art.
  • receptor activation can be determined by detecting the phosphorylation (e.g., tyrosine or serine/threonine) of the receptor or its substrate by immunoprecipitation followed by western blot analysis (for example, as described supra).
  • phosphorylation e.g., tyrosine or serine/threonine
  • antibodies are provided that inhibit ligand activity or receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% of the activity in absence of the antibody.
  • the invention also features receptor-specific antibodies which both prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex, and, preferably, do not specifically recognize the unbound receptor or the unbound ligand.
  • receptor-specific antibodies which both prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex, and, preferably, do not specifically recognize the unbound receptor or the unbound ligand.
  • neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor.
  • antibodies which activate the receptor are also act as receptor agonists, i.e., potentiate or activate either all or a subset of the biological activities of the ligand-mediated receptor activation, for example, by inducing dimerization of the receptor.
  • the antibodies may be specified as agonists, antagonists or inverse agonists for biological activities comprising the specific biological activities of the peptides of the invention disclosed herein.
  • the above antibody agonists can be made using methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Patent No. 5,811,097; Deng et al., Blood 92(6)3981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4): 1786-1794 (1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J.
  • Antibodies of the present invention may be used, for example, but not limited to, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods.
  • the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (inco ⁇ orated by reference herein in its entirety).
  • the antibodies of the present invention may be used either alone or in combination with other compositions.
  • the antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions.
  • antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No.
  • the antibodies of the invention include derivatives that are modified, i.e, by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from generating an anti-idiotypic response.
  • the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.
  • the antibodies of the present invention may be generated by any suitable method known in the art.
  • Polyclonal antibodies to an antigen-of- interest can be produced by various procedures well known in the art.
  • a polypeptide of the invention can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen.
  • adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette- Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art.
  • Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof.
  • monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said references inco ⁇ orated by reference in their entireties).
  • the term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology.
  • the term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
  • mice can be immunized with a polypeptide of the invention or a cell expressing such peptide.
  • an immune response e.g., antibodies specific for the antigen are detected in the mouse serum
  • the mouse spleen is harvested and splenocytes isolated.
  • the splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limited dilution.
  • hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention.
  • Ascites fluid which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
  • the present invention provides methods of generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with an antigen of the invention with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind a polypeptide of the invention.
  • Antibody fragments which recognize specific epitopes may be generated by known techniques.
  • Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
  • F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain.
  • the antibodies of the present invention can also be generated using various phage display methods known in the art.
  • phage display methods functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
  • phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine).
  • Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead.
  • Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VLLI protein.
  • Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol.
  • chimeric, humanized, or human antibodies For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized, or human antibodies.
  • a chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art.
  • Humanized antibodies are antibody molecules from non-human species antibody that binds the desired antigen having one or more complementarity determining regions (CDRs) from the non- human species and a framework regions from a human immunoglobulin molecule.
  • CDRs complementarity determining regions
  • framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding.
  • These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Patent No.
  • Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101 ; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska.
  • Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,11 1; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is inco ⁇ orated herein by reference in its entirety.
  • Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes.
  • the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells.
  • the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes.
  • the mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production.
  • the modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice.
  • the chimeric mice are then bred to produce homozygous offspring which express human antibodies.
  • the transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention.
  • Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology.
  • the human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation.
  • Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as "guided selection.”
  • a selected non-human monoclonal antibody e.g., a mouse antibody
  • antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437- 444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)).
  • antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to a ligand can be used to generate anti-idiotypes that "mimic" the polypeptide multimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and or its ligand.
  • Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand.
  • anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligands/receptors, and thereby block its biological activity.
  • the invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof.
  • the invention also encompasses polynucleotides that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, that specifically binds to a polypeptide of the invention, preferably, an antibody that binds to a polypeptide having the amino acid sequence of SEQ ED NO: 2 or SEQ ED NO:4.
  • the polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art.
  • a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
  • chemically synthesized oligonucleotides e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)
  • a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be
  • nucleotide sequence and corresponding amino acid sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc.
  • the amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the complementarity determining regions (CDRs) by methods that are well know in the art, e.g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability.
  • CDRs complementarity determining regions
  • one or more of the CDRs may be inserted within framework regions, e.g., into human framework regions to humanize a non-human antibody, as described supra.
  • the framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., J. Mol. Biol.
  • the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds a polypeptide of the invention.
  • one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds.
  • Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art.
  • a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, e.g., humanized antibodies.
  • Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide.
  • Techniques for the assembly of functional Fv fragments in E. coli may also be used (Skerra et al., Science 242:1038- 1041 (1988)).
  • the antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.
  • an antibody of the invention or fragment, derivative or analog thereof, (e.g., a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires construction of an expression vector containing a polynucleotide that encodes the antibody.
  • a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art.
  • methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein.
  • the invention thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter.
  • Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.
  • the expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention.
  • the invention includes host cells containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter.
  • vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
  • host-expression vector systems may be utilized to express the antibody molecules of the invention.
  • Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ.
  • These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B.
  • subtilis transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mamm
  • bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule.
  • mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
  • a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed.
  • vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable.
  • Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res.
  • pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S- transferase (GST).
  • GST glutathione S- transferase
  • fusion proteins are soluble and can easily be purified from lysed cells by adso ⁇ tion and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione.
  • the pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
  • Autographa califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes.
  • the virus grows in Spodoptera frugiperda cells.
  • the antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).
  • a number of viral-based expression systems may be utilized.
  • the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence.
  • This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non- essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts, (e.g., see Logan & Shenk, Proc. Natl. Acad.
  • Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).
  • a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein.
  • Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed.
  • eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used.
  • Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.
  • cell lines which stably express the antibody molecule may be engineered.
  • host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker.
  • appropriate expression control elements e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.
  • engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media.
  • the selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines.
  • This method may advantageously be used to engineer cell lines which express the antibody molecule.
  • Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.
  • a number of selection systems may be used, including but not limited to the he ⁇ es simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes can be employed in tk-, hgprt- or aprt- cells, respectively.
  • antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci.
  • the expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)).
  • vector amplification for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)).
  • a marker in the vector system expressing antibody is amplifiable
  • increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
  • the host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide.
  • the two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides.
  • a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2197 (1980)).
  • the coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.
  • an antibody molecule of the invention may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins.
  • chromatography e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography
  • centrifugation e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography
  • differential solubility e.g., differential solubility, or by any other standard technique for the purification of proteins.
  • the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.
  • the present invention encompasses antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins.
  • the fusion does not necessarily need to be direct, but may occur through linker sequences.
  • the antibodies may be specific for antigens other than polypeptides (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention.
  • antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors.
  • Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S.
  • Patent 5,474,981 Gillies et al., PNAS 89: 1428-1432 (1992); Fell et al., J. Immunol. 146:2446-2452(1991), which are inco ⁇ orated by reference in their entireties.
  • the present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions.
  • the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof.
  • the antibody portion fused to a polypeptide of the present invention may comprise the constant region, hinge region, CHI domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof.
  • the polypeptides may also be fused or conjugated to the above antibody portions to form multimers.
  • Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fc portions.
  • polypeptides corresponding to a polypeptide, polypeptide fragment, or a variant of SEQ ID NO:2 or SEQ ED NO:4 may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art. Further, the polypeptides corresponding to SEQ ID NO:2 or SEQ ID NO:4 may be fused or conjugated to the above antibody portions to facilitate purification.
  • chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins.
  • polypeptides of the present invention fused or conjugated to an antibody having disulfide- linked dimeric structures may also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone.
  • Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties.
  • the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations.
  • human proteins such as hIL-5
  • Fc portions for the pu ⁇ ose of high-throughput screening assays to identify antagonists of ML- 5.
  • the antibodies or fragments thereof of the present invention can be fused to marker sequences, such as a peptide to facilitate purification.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • peptide tags useful for purification include, but are not limited to, the "HA” tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the "flag" tag.
  • the present invention further encompasses antibodies or fragments thereof conjugated to a diagnostic or therapeutic agent.
  • the antibodies can be used diagnostically to, for example, monitor the development or progression of a tumor as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions.
  • the detectable substance may be coupled or conjugated either directly to the antibody (or fragment thereof) or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention.
  • suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase;
  • suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin;
  • suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin;
  • an example of a luminescent material includes luminol;
  • examples of bioluminescent materials include luciferase, luciferin, and aequorin; and
  • suitable radioactive material include 1251, 1311, 11 lln or 99Tc.
  • an antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213BL
  • a cytotoxin or cytotoxic agent includes any agent that is detrimental to cells.
  • Examples include paclitaxol, cytochalasin B , gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof.
  • Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis- dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g.,
  • the conjugates of the invention can be used for modifying a given biological response, the therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents.
  • the drug moiety may be a protein or polypeptide possessing a desired biological activity.
  • proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, ⁇ -interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See, International Publication No.
  • a thrombotic agent or an anti- angiogenic agent e.g., angiostatin or endostatin
  • biological response modifiers such as, for example, lymphokines, interleukin- 1 ("IL-1"), interleukin-2 (“EL-2”), interleukin-6 (“IL- 6”), granulocyte macrophage colony stimulating factor (“GM-CSF”), granulocyte colony stimulating factor (“G-CSF”), or other growth factors.
  • IL-1 interleukin- 1
  • EL-2 interleukin-2
  • IL-6 interleukin-6
  • GM-CSF granulocyte macrophage colony stimulating factor
  • G-CSF granulocyte colony stimulating factor
  • Antibodies may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen.
  • solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
  • an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is inco ⁇ orated herein by reference in its entirety.
  • An antibody, with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytokine(s) can be used as a therapeutic.
  • the antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples.
  • the translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types.
  • Monoclonal antibodies directed against a specific epitope, or combination of epitopes will allow for the screening of cellular populations expressing the marker.
  • Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, "panning" with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Patent 5,985,660; and Morrison et al, Cell, 96:731-49 (1999)).
  • hematological malignancies i.e. minimal residual disease (MRD) in acute leukemic patients
  • MRD minimal residual disease
  • GVHD Graft- versus-Host Disease
  • these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.
  • the antibodies of the invention may be assayed for immunospecific binding by any method known in the art.
  • the immunoassays which can be used include but are not limited to competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich” immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few.
  • Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X- 100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., 1-4 hours) at 4° C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4° C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer.
  • a lysis buffer such as RIPA buffer (1% NP-40 or Triton X- 100, 1% sodium deoxy
  • the ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis.
  • One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre- clearing the cell lysate with sepharose beads).
  • immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
  • Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-T ween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32P or 1251) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen.
  • ELISAs comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen.
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase)
  • a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well.
  • ELISAs see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1.
  • the binding affinity of an antibody to an antigen and the off-rate of an antibody- antigen interaction can be determined by competitive binding assays.
  • a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3H or 1251) with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen.
  • the affinity of the antibody of interest for a particular antigen and the binding off-rates can be determined from the data by scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassay s.
  • the antigen is incubated with antibody of interest conjugated to a labeled compound (e.g., 3H or 1251) in the presence of increasing amounts of an unlabeled second antibody.
  • a labeled compound e.g., 3H or 1251
  • the present invention is further directed to antibody-based therapies which involve administering antibodies of the invention to an animal, preferably a mammal, and most preferably a human, patient for treating one or more of the disclosed diseases, disorders, or conditions.
  • Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments, analogs and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein).
  • the antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with aberrant expression and/or activity of a polypeptide of the invention, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein.
  • the treatment and/or prevention of diseases, disorders, or conditions associated with aberrant expression and/or activity of a polypeptide of the invention includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions.
  • Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
  • a summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below.
  • the antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to increase the number or activity of effector cells which interact with the antibodies.
  • lymphokines or hematopoietic growth factors such as, e.g., IL-2, IL-3 and IL-7
  • the antibodies of the invention may be administered alone or in combination with other types of treatments (e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents). Generally, administration of products of a species origin or species reactivity (in the case of antibodies) that is the same species as that of the patient is preferred. Thus, in a preferred embodiment, human antibodies, fragments derivatives, analogs, or nucleic acids, are administered to a human patient for therapy or prophylaxis.
  • polypeptides or polynucleotides of the present invention It is preferred to use high affinity and/or potent in vivo inhibiting and/or neutralizing antibodies against polypeptides or polynucleotides of the present invention, fragments or regions thereof, for both immunoassays directed to and therapy of disorders related to polynucleotides or polypeptides, including fragments thereof, of the present invention.
  • Such antibodies, fragments, or regions will preferably have an affinity for polynucleotides or polypeptides of the invention, including fragments thereof.
  • Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10 '2 M, 10 "2 M, 5 X 10 “3 M, 10 “3 M, 5 X 10 “4 M, 10 “4 M, 5 X 10 “5 M, 10 “5 M, 5 X 10 “6 M, 10 “6 M, 5 X 10 “7 M, 10 7 M, 5 X 10 “8 M, 10 “8 M, 5 X 10 "9 M, 10 “9 M, 5 X 10 "10 M, 10 " '° M, 5 X 10 " " “ M, lO “ “ M, 5 X 10 ' 2 M, 10 "12 M, 5 X 10 ' 3 M, 10 " I3 M, 5 X 10 "14 M, 10 '14 M, 5 X 10 ' 5 M, and 10 " ' 5 M.
  • nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to treat, inhibit or prevent a disease or disorder associated with aberrant expression and/or activity of a polypeptide of the invention, by way of gene therapy.
  • Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid.
  • the nucleic acids produce their encoded protein that mediates a therapeutic effect.
  • the compound comprises nucleic acid sequences encoding an antibody, said nucleic acid sequences being part of expression vectors that express the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host.
  • nucleic acid sequences have promoters operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue- specific.
  • nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Koller and Smithies, Proc. Natl. Acad.
  • the expressed antibody molecule is a single chain antibody; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments thereof, of the antibody.
  • Delivery of the nucleic acids into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid- carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
  • the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product.
  • This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retrovirals or other viral vectors (see U.S. Patent No.
  • microparticle bombardment e.g., a gene gun; Biolistic, Dupont
  • coating lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell types specifically expressing the receptors), etc.
  • nucleic acid- ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
  • the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221).
  • the nucleic acid can be introduced intracellularly and inco ⁇ orated within host cell DNA for expression, by homologous recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932- 8935 (1989); Zijlstra et al, Nature 342:435-438 (1989)).
  • viral vectors that contains nucleic acid sequences encoding an antibody of the invention are used.
  • a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA.
  • the nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient.
  • retroviral vectors More detail about retroviral vectors can be found in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy.
  • Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83: 1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993).
  • Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy.
  • adenovirus vectors are used.
  • Adeno-associated virus (AAV) has also been proposed for use in gene therapy
  • Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection.
  • the method of transfer includes the transfer of a selectable marker to the cells.
  • the cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient.
  • the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell.
  • Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc.
  • Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther.
  • the technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.
  • Recombinant blood cells e.g., hematopoietic stem or progenitor cells
  • Recombinant blood cells are preferably administered intravenously.
  • the amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.
  • Cells into which a nucleic acid can be introduced for pu ⁇ oses of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as Tlymphocytes, Blymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.
  • the cell used for gene therapy is autologous to the patient.
  • nucleic acid sequences encoding an antibody are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect.
  • stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g. PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 61:771 (1986)).
  • the nucleic acid to be introduced for pu ⁇ oses of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription.
  • Demonstration of Therapeutic or Prophylactic Activity The compounds or pharmaceutical compositions of the invention are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans.
  • in vitro assays to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include, the effect of a compound on a cell line or a patient tissue sample.
  • in vitro assays which can be used to determine whether administration of a specific compound is indicated, include in vitro cell culture assays in which a patient tissue sample is grown in culture, and exposed to or otherwise administered a compound, and the effect of such compound upon the tissue sample is observed.
  • the invention provides methods of treatment, inhibition and prophylaxis by administration to a subject of an effective amount of a compound or pharmaceutical composition of the invention, preferably an antibody of the invention.
  • the compound is substantially purified (e.g., substantially free from substances that limit its effect or produce undesired side-effects).
  • the subject is preferably an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably human.
  • Formulations and methods of administration that can be employed when the compound comprises a nucleic acid or an immunoglobulin are described above; additional appropriate formulations and routes of administration can be selected from among those described herein below.
  • Various delivery systems are known and can be used to administer a compound of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc.
  • Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes.
  • the compounds or compositions may be administered by any convenient route, for example by infusion or bolus injection, by abso ⁇ tion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local.
  • intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.
  • Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
  • a protein, including an antibody, of the invention care must be taken to use materials to which the protein does not absorb.
  • the compound or composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249: 1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)
  • the compound or composition can be delivered in a controlled release system.
  • a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)).
  • polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228: 190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J.Neurosurg. 71:105 (1989)).
  • a controlled release system can be placed in proximity of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 1 15-138 (1984)).
  • Other controlled release systems are discussed in the review by Langer (Science
  • the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (see
  • a nucleic acid can be introduced intracellularly and inco ⁇ orated within host cell DNA for expression, by homologous recombination.
  • compositions comprise a therapeutically effective amount of a compound, and a pharmaceutically acceptable carrier.
  • pharmaceutically acceptable means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.
  • carrier refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered.
  • Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like.
  • Water is a preferred carrier when the pharmaceutical composition is administered intravenously.
  • Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions.
  • Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like.
  • the composition if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.
  • compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like.
  • the composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.
  • Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin.
  • Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient.
  • the formulation should suit the mode of administration.
  • the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings.
  • compositions for intravenous administration are solutions in sterile isotonic aqueous buffer.
  • the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection.
  • the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent.
  • composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline.
  • an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
  • the compounds of the invention can be formulated as neutral or salt forms.
  • Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
  • the amount of the compound of the invention which will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant expression and or activity of a polypeptide of the invention can be determined by standard clinical techniques.
  • in vitro assays may optionally be employed to help identify optimal dosage ranges.
  • the precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
  • the dosage administered to a patient is typically 0.1 mg/kg to 100 mg/kg of the patient's body weight.
  • the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1 mg/kg to
  • human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. Further, the dosage and frequency of administration of antibodies of the invention may be reduced by enhancing uptake and tissue penetration (e.g., into the brain) of the antibodies by modifications such as, for example, lipidation.
  • the invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention.
  • Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
  • Diagnosis and Imaging Labeled antibodies, and derivatives and analogs thereof, which specifically bind to a polypeptide of interest can be used for diagnostic pu ⁇ oses to detect, diagnose, or monitor diseases, disorders, and/or conditions associated with the aberrant expression and/or activity of a polypeptide of the invention.
  • the invention provides for the detection of aberrant expression of a polypeptide of interest, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of aberrant expression.
  • the invention provides a diagnostic assay for diagnosing a disorder, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a particular disorder.
  • a diagnostic assay for diagnosing a disorder comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a particular disorder.
  • the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior
  • Antibodies of the invention can be used to assay protein levels in a biological sample using classical immunohistological methods known to those of skill in the art (e.g., see Jalkanen, et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell . Biol. 105:3087-3096 (1987)).
  • Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • Suitable antibody assay labels include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as, glucose oxidase
  • radioisotopes such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc)
  • luminescent labels such as luminol
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled molecule which specifically binds to the polypeptide of interest; b) waiting for a time interval following the administering for permitting the labeled molecule to preferentially concentrate at sites in the subject where the polypeptide is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled molecule in the subject, such that detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest.
  • Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system
  • the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images.
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
  • the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.
  • monitoring of the disease or disorder is carried out by repeating the method for diagnosing the disease or disease, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.
  • Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.
  • CT computed tomography
  • PET position emission tomography
  • MRI magnetic resonance imaging
  • sonography sonography
  • the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al., U.S. Patent No. 5,441,050).
  • the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument.
  • the molecule is labeled with a positron emitting metal and is detected in the patent using positron emission-tomography.
  • the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).
  • MRI magnetic resonance imaging
  • kits that can be used in the above methods.
  • a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers.
  • the kits of the present invention contain a substantially isolated polypeptide comprising an epitope which is specifically immunoreactive with an antibody included in the kit.
  • the kits of the present invention further comprise a control antibody which does not react with the polypeptide of interest.
  • kits of the present invention contain a means for detecting the binding of an antibody to a polypeptide of interest (e.g., the antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate).
  • a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate.
  • the kit is a diagnostic kit for use in screening serum containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides.
  • a kit may include a control antibody that does not react with the polypeptide of interest.
  • a kit may include a substantially isolated polypeptide antigen comprising an epitope which is specifically immunoreactive with at least one anti-polypeptide antigen antibody.
  • a kit includes means for detecting the binding of said antibody to the antigen (e.g., the antibody may be conjugated to a fluorescent compound such as fluorescein or rhodamine which can be detected by flow cytometry).
  • the kit may include a recombinantly produced or chemically synthesized polypeptide antigen.
  • the polypeptide antigen of the kit may also be attached to a solid support.
  • the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached.
  • a kit may also include a non-attached reporter-labeled anti-human antibody.
  • binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labeled antibody.
  • the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention.
  • the diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody.
  • the antibody is attached to a solid support.
  • the antibody may be a monoclonal antibody.
  • the detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, competing antigen.
  • test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention.
  • the reagent After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-antigen antibody on the solid support.
  • the reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined.
  • the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
  • the solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96- well plate or filter material. These attachment methods generally include non-specific adso ⁇ tion of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
  • the invention provides an assay system or kit for carrying out this diagnostic method.
  • the kit generally includes a support with surface- bound recombinant antigens, and a reporter-labeled anti-human antibody for detecting surface-bound anti-antigen antibody.
  • any chemokine polypeptide of the invention can be used to generate fusion proteins.
  • a Ck ⁇ -4 or Ck ⁇ -10 polypeptide when fused to a second protein, can be used as an antigenic tag.
  • Antibodies raised against a Ck ⁇ -4 or Ck ⁇ -10 polypeptide can be used to indirectly detect the second protein by binding to a Ck ⁇ -4 or Ck ⁇ -10.
  • the chemokine polypeptides can be used as targeting molecules once fused to other proteins. Examples of domains that can be fused to the chemokine polypeptides include not only heterologous signal sequences, but also other heterologous functional regions. The fusion does not necessarily need to be direct, but may occur through linker sequences.
  • Ck ⁇ -10 proteins of the invention comprise fusion proteins wherein the Ck ⁇ -10 polypeptides are those described above as m-n.
  • the application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences encoding polypeptides having the amino acid sequence of the specific N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
  • fusion proteins may also be engineered to improve characteristics of the chemokine polypeptides. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of a chemokine polypeptide of the invention to improve stability and persistence during purification from the host cell or subsequent handling and storage. Also, peptide moieties may be added to the chemokine polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the chemokine polypeptide. The addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.
  • polypeptides of the present invention and the epitope-bearing fragments thereof described above can be combined with heterologous polypeptide sequences.
  • the polypeptides of the present invention may be fused with heterologous polypeptide sequences, for example, the polypeptides of the present invention may be fused with parts of the constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or portions thereof (CHI , CH2, CH3, and any combination thereof, including both entire domains and portions thereof), resulting in chimeric polypeptides.
  • immunoglobulins IgA, IgE, IgG, IgM
  • CHI constant domain of immunoglobulins
  • CH2, CH3 any combination thereof, including both entire domains and portions thereof
  • EP-A-O 464 533 (Canadian counte ⁇ art 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof.
  • the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties.
  • EP-A 0232 262. Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations.
  • human proteins such as hIL-5
  • Fc portions for the pu ⁇ ose of high-throughput screening assays to identify antagonists of hIL-5.
  • the chemokine polypeptides can be fused to marker sequences, such as a peptide which facilitates purification of the chemokine polypeptide.
  • the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available.
  • hexa-histidine provides for convenient purification of the fusion protein.
  • Another peptide tag useful for purification, the "HA" tag corresponds to an epitope derived from the influenza hemagglutinin protein. (Wilson et al., Cell 37:767 (1984).)
  • any of these above fusions can be engineered using the a Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides.
  • the present invention also relates to vectors which include Ck ⁇ -4 or Ck ⁇ -10 polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques.
  • the vector may be, for example, a phage, plasmid, viral, or retroviral vector.
  • Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector.
  • the vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the Ck ⁇ -4 and
  • MCP-4 genes also referred to as Ck ⁇ -10 genes.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques.
  • the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in the host.
  • the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis.
  • promoter for example: LTR or SV40 promoter, the E. coli. lac or trp . , the phage lambda P L promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. Other suitable promoters will be known to the skilled artisan.
  • the expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation.
  • the coding portion of the transcripts expressed by the constmcts will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated.
  • the vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein.
  • a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
  • the expression vectors will preferably include at least one selectable marker.
  • markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
  • bacterial cells such as E. coli, Streptomyces and Salmonella typhimurium cells
  • fungal cells such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells.
  • yeast cells e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, 293, and Bowes melanoma cells
  • plant cells Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above.
  • the constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation.
  • the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence.
  • a promoter operably linked to the sequence.
  • Bacterial pQE70, pQE60, pQE-9 available from QIAGEN, Inc, pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A available from Stratagene Cloning Systems, Inc.; ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia).
  • Eukaryotic pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL available from Pharmacia Biotech, Inc.
  • preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia.
  • Preferred expression vectors for use in yeast systems include, but are not limited to pYES2, pYDl, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-Sl, pPIC3.5K, pPIC9K, and PAO815 (all available from Invitrogen, Carlbad, CA).
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • Promoter regions can be selected from any desired gene using CAT (chloramphenicol acetyl transferase) vectors or other vectors with selectable markers.
  • Two appropriate vectors are pKK232-8 and pCM7.
  • Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda P R , P L and tip.
  • Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovims, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
  • the present invention relates to host cells containing the above-described constructs.
  • the host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell.
  • Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides of the invention may in fact be expressed by a host cell lacking a recombinant vector.
  • constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
  • the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
  • Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby inco ⁇ orated by reference.
  • Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly- expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), ⁇ -factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter.
  • the vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host.
  • Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice.
  • hosts include, but are not limited to, bacterial cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells.
  • fungal cells such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)
  • insect cells such as Drosophila S2 and Spodoptera Sf9 cells
  • animal cells such as CHO, COS, 293, and Bowes melanoma cells
  • Appropriate culture mediums and conditions for the above-described host cells are known in the art.
  • useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017).
  • cloning vector pBR322 ATCC 37017
  • Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEMl (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
  • the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
  • Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
  • mammalian cell culture systems can also be employed to express recombinant protein.
  • mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines.
  • Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
  • chemokine polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxy lapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps. Most preferably, high performance liquid chromatography (“HPLC”) is employed for purification.
  • HPLC high performance liquid chromatography
  • the chemokine polypeptides of the present invention may be a naturally purified product, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue, in some cases as a result of host-mediated processes.
  • the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked.
  • the yeast Pichia pastoris is used to express the chemokine polypeptides in a eukaryotic system. Pichia pastoris is a methylotrophic yeast which can metabolize methanol as its sole carbon source.
  • a main step in the methanol metabolization pathway is the oxidation of methanol to formaldehyde using O 2 .
  • This reaction is catalyzed by the enzyme alcohol oxidase.
  • Pichia pastoris In order to metabolize methanol as its sole carbon source, Pichia pastoris must generate high levels of alcohol oxidase due, in part, to the relatively low affinity of alcohol oxidase for O 2 . Consequently, in a growth medium depending on methanol as a main carbon source, the promoter region of one of the two alcohol oxidase genes (AOXl) is highly active. In the presence of methanol, alcohol oxidase produced from the AOXl gene comprises up to approximately 30% of the total soluble protein in Pichia pastoris.
  • a heterologous coding sequence such as, for example, a chemokine polynucleotide of the present invention, under the transcriptional regulation of all or part of the AOXl regulatory sequence is expressed at exceptionally high levels in Pichia yeast grown in the presence of methanol.
  • the plasmid vector pPIC9K is used to express DNA encoding a chemokine polypeptide of the invention, as set forth herein, in a Pichea yeast system essentially as described in "Pichia Protocols: Methods in Molecular Biology," D.R. Higgins and J. Cregg, eds. The Humana Press, Totowa, NJ, 1998.
  • This expression vector allows expression and secretion of a Ck ⁇ -4 or Ck ⁇ -10 protein of the invention by virtue of the strong AOXl promoter linked to the Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide (i.e., leader) located upstream of a multiple cloning site.
  • PHO alkaline phosphatase
  • yeast vectors could be used in place of pPIC9K, such as, pYES2, pYDl, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2, pHIL-Sl, pPIC3.5K, and PAO815, as one skilled in the art would readily appreciate, as long as the proposed expression construct provides appropriately located signals for transcription, translation, secretion (if desired), and the like, including an in-frame AUG as required.
  • high-level expression of a heterologous coding sequence such as, for example, a chemokine polynucleotide of the present invention
  • a heterologous coding sequence such as, for example, a chemokine polynucleotide of the present invention
  • an expression vector such as, for example, pGAPZ or pGAPZalpha
  • the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., a chemokine coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with a chemokine polynucleotide of the invention, and which activates, alters, and/or amplifies an endogenous chemokine polynucleotide.
  • endogenous genetic material e.g., a chemokine coding sequence
  • genetic material e.g., heterologous polynucleotide sequences
  • heterologous control regions e.g., promoter and/or enhancer
  • endogenous chemokine polynucleotide sequences via homologous recombination, resulting in the formation of a new transcription unit
  • heterologous control regions e.g., promoter and/or enhancer
  • endogenous chemokine polynucleotide sequences via homologous recombination, resulting in the formation of a new transcription unit
  • polypeptides of the invention can be chemically synthesized using techniques known in the art (e.g.. see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller et al., Nature, 310:105-111 (1984)).
  • a polypeptide corresponding to a fragment of a chemokine polypeptide can be synthesized by use of a peptide synthesizer.
  • nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into a chemokine polypeptide sequence.
  • Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a- amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, omithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t- butylglycine, t-butylalanine, phenyl glycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na- methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid
  • the invention encompasses Ck ⁇ -4 and Ck ⁇ -10 polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH 4 ; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.
  • Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression.
  • the polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
  • the chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like.
  • the polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
  • the polymer may be of any molecular weight, and may be branched or unbranched.
  • the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about” indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing.
  • Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
  • polyethylene glycol molecules should be attached to the protein with consideration of effects on functional or antigenic domains of the protein.
  • attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein inco ⁇ orated by reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride).
  • polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound.
  • the amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues glutamic acid residues and the C-terminal amino acid residue.
  • Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules.
  • Preferred for therapeutic pu ⁇ oses is attachment at an amino group, such as attachment at the N-terminus or lysine group.
  • polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein.
  • the method of obtaining the N-terminally pegylated preparation i.e., separating this moiety from other monopegylated moieties if necessary
  • Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
  • the chemokine polypeptides of the invention may be in monomers or multimers (i.e., dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomers and multimers of the chemokine polypeptides of the invention, their preparation, and compositions (preferably, Therapeutics) containing them. In specific embodiments, the polypeptides of the invention are monomers, dimers, trimers or tetramers.
  • the multimers of the invention are at least dimers, at least trimers, or at least tetramers.
  • Multimers encompassed by the invention may be homomers or heteromers.
  • the term homomer refers to a multimer containing only polypeptides corresponding to the amino acid sequence of SEQ ED NO:2 or SEQ ED NO:4 or encoded by the cDNA contained in the clones deposited as ATCC Deposit Nos. 75848 or 75849 (including fragments, variants, splice variants, and fusion proteins, corresponding to these as described herein).
  • These homomers may contain chemokine polypeptides having identical or different amino acid sequences.
  • a homomer of the invention is a multimer containing only chemokine polypeptides having an identical amino acid sequence.
  • a homomer of the invention is a multimer containing chemokine polypeptides having different amino acid sequences.
  • the multimer of the invention is a homodimer (e.g., containing chemokine polypeptides having identical or different amino acid sequences) or a homotrimer (e.g., containing chemokine polypeptides having identical and/or different amino acid sequences).
  • the homomeric multimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.
  • heteromer refers to a multimer containing one or more heterologous polypeptides (i.e., polypeptides of different proteins) in addition to the chemokine polypeptides of the invention.
  • the multimer of the invention is a heterodimer, a heterotrimer, or a heterotetramer.
  • the heteromeric multimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.
  • Multimers of the invention may be the result of hydrophobic, hydrophilic, ionic and or covalent associations and/or may be indirectly linked, by for example, liposome formation.
  • multimers of the invention such as, for example, homodimers or homotrimers, are formed when polypeptides of the invention contact one another in solution.
  • heteromultimers of the invention such as, for example, heterotrimers or heterotetramers, are formed when polypeptides of the invention contact antibodies to the polypeptides of the invention (including antibodies to the heterologous polypeptide sequence in a fusion protein of the invention) in solution.
  • multimers of the invention are formed by covalent associations with and/or between the chemokine polypeptides of the invention.
  • covalent associations may involve one or more amino acid residues contained in the polypeptide sequence (e.g., that recited in SEQ LD NO: 2 or SEQ ED NO:4, or contained in the polypeptide encoded by the clones deposited as ATCC Deposit Nos. 75848 or 75849).
  • the covalent associations are cross-linking between cysteine residues located within the polypeptide sequences which interact in the native (i.e., naturally occurring) polypeptide.
  • the covalent associations are the consequence of chemical or recombinant manipulation.
  • covalent associations may involve one or more amino acid residues contained in the heterologous polypeptide sequence in a chemokine fusion protein.
  • covalent associations are between the heterologous sequence contained in a fusion protein of the invention (see, e.g., U.S. Patent Number 5,478,925).
  • the covalent associations are between the heterologous sequence contained in a chemokine-Fc fusion protein of the invention (as described herein).
  • covalent associations of fusion proteins of the invention are between heterologous polypeptide sequence from another protein that is capable of forming covalently associated multimers, such as for example, oseteoprotegerin (see, e.g., International Publication No: WO 98/49305, the contents of which are herein inco ⁇ orated by reference in its entirety).
  • two or more polypeptides of the invention are joined through peptide linkers. Examples include those peptide linkers described in U.S. Pat. No. 5,073,627 (hereby inco ⁇ orated by reference). Proteins comprising multiple polypeptides of the invention separated by peptide linkers may be produced using conventional recombinant DNA technology.
  • Leucine zipper and isoleucine zipper domains are polypeptides that promote multimerization of the proteins in which they are found.
  • Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al, Science 240: 1759, (1988)), and have since been found in a variety of different proteins.
  • leucine zippers are naturally occurring peptides and derivatives thereof that dimerize or trimerize.
  • leucine zipper domains suitable for producing soluble multimeric proteins of the invention are those described in PCT application WO 94/10308, hereby inco ⁇ orated by reference.
  • Recombinant fusion proteins comprising a polypeptide of the invention fused to a polypeptide sequence that dimerizes or trimerizes in solution are expressed in suitable host cells, and the resulting soluble multimeric fusion protein is recovered from the culture supernatant using techniques known in the art.
  • Trimeric polypeptides of the invention may offer the advantage of enhanced biological activity.
  • Preferred leucine zipper moieties and isoleucine moieties are those that preferentially form trimers.
  • a leucine zipper derived from lung surfactant protein D SPD
  • SPD lung surfactant protein D
  • Other peptides derived from naturally occurring trimeric proteins may be employed in preparing trimeric polypeptides of the invention.
  • proteins of the invention are associated by interactions between Flag® polypeptide sequence contained in fusion proteins of the invention containing Flag® polypeptide seuqence.
  • associations proteins of the invention are associated by interactions between heterologous polypeptide sequence contained in Flag® fusion proteins of the invention and anti-Flag® antibody.
  • the multimers of the invention may be generated using chemical techniques known in the art.
  • polypeptides desired to be contained in the multimers of the invention may be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • multimers of the invention may be generated using techniques known in the art to form one or more inter-molecule cross-links between the cysteine residues located within the sequence of the polypeptides desired to be contained in the multimer (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • polypeptides of the invention may be routinely modified by the addition of cysteine or biotin to the C terminus or N-terminus of the polypeptide and techniques known in the art may be applied to generate multimers containing one or more of these modified polypeptides (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety). Additionally, techniques known in the art may be applied to generate liposomes containing the polypeptide components desired to be contained in the multimer of the invention (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • multimers of the invention may be generated using genetic engineering techniques known in the art.
  • polypeptides contained in multimers of the invention are produced recombinantly using fusion protein technology described herein or otherwise known in the art (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • polynucleotides coding for a homodimer of the invention are generated by ligating a polynucleotide sequence encoding a polypeptide of the invention to a sequence encoding a linker polypeptide and then further to a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (lacking the leader sequence) (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • recombinant techniques described herein or otherwise known in the art are applied to generate recombinant polypeptides of the invention which contain a transmembrane domain (or hyrophobic or signal peptide) and which can be inco ⁇ orated by membrane reconstitution techniques into liposomes (see, e.g., US Patent Number 5,478,925, which is herein inco ⁇ orated by reference in its entirety).
  • Ck ⁇ -4 and Ck ⁇ -10 polynucleotides identified herein can be used in numerous ways as reagents. The following description should be considered exemplary and utilizes known techniques. The sequences of the present invention are valuable for chromosome identification.
  • the sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymo ⁇ hisms) are presently available for marking chromosomal location.
  • the mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
  • sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA shown in SEQ ID NO:l or SEQ ED NO: 3.
  • PCR primers preferably 15-25 bp
  • Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process.
  • These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
  • PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Three or more clones can be assigned per day using a single thermal cycler. Using the present invention with the same oligonucleotide primers, sublocalization of the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner.
  • Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
  • Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step.
  • This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp, preferrably 2,000-4,000 bp, have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection.
  • FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (for marking multiple sites and/or multiple chromosomes).
  • Preferred polynucleotides correspond to the noncoding regions of the cDNAs because the coding sequences are more likely conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping.
  • a sequence Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). Linkage analysis establishes coinheritance between a chromosomal location and presentation of a particular disease. With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotide and the corresponding gene between affected and unaffected individuals can be examined.
  • visible structural alterations in the chromosomes such as deletions or translocations, are examined in chromosome spreads or by PCR. If no structural alterations exist, the presence of point mutations are ascertained. Mutations observed in some or all affected individuals, but not in normal individuals, indicates that the mutation may cause the disease. However, complete sequencing of the
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotide and the corresponding gene from several normal individuals is required to distinguish the mutation from a polymo ⁇ hism. If a new polymo ⁇ hism is identified, this polymo ⁇ hic polypeptide can be used for further linkage analysis.
  • Any of these alterations can be used as a diagnostic or prognostic marker.
  • the invention also provides a diagnostic method useful during diagnosis of a disorder, involving measuring the expression level of polynucleotides of the present invention in cells or body fluid from an individual and comparing the measured gene expression level with a standard level of polynucleotide expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of a disorder.
  • the invention includes a kit for analyzing samples for the presence of proliferative and/or cancerous polynucleotides derived from a test subject.
  • the kit includes at least one polynucleotide probe containing a nucleotide sequence that will specifically hybridize with a polynucleotide of the present invention and a suitable container.
  • the kit includes two polynucleotide probes defining an internal region of the polynucleotide of the present invention, where each probe has one strand containing a 31'mer-end internal to the region.
  • the probes may be useful as primers for polymerase chain reaction amplification.
  • the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced or depressed polynucleotide of the present invention expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.
  • measuring the expression level of polynucleotide of the present invention is intended qualitatively or quantitatively measuring or estimating the level of the polypeptide of the present invention or the level of the mRNA encoding the polypeptide in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the polypeptide level or mRNA level in a second biological sample).
  • the polypeptide level or mRNA level in the first biological sample is measured or estimated and compared to a standard polypeptide level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder.
  • a standard polypeptide level or mRNA level is known, it can be used repeatedly as a standard for comparison.
  • biological sample any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains the polypeptide of the present invention or mRNA.
  • biological samples include body fluids (such as semen, lymph, sera, plasma, urine, synovial fluid and spinal fluid) which contain the polypeptide of the present invention, and other tissue sources found to express the polypeptide of the present invention. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
  • the method(s) provided above may preferrably be applied in a diagnostic method and/or kits in which polynucleotides and/or polypeptides are attached to a solid support.
  • the support may be a "gene chip” or a "biological chip” as described in US Patents 5,837,832, 5,874,219, and 5,856,174.
  • a gene chip with polynucleotides of the present invention attached may be used to identify polymo ⁇ hisms between the polynucleotide sequences, with polynucleotides isolated from a test subject. The knowledge of such polymo ⁇ hisms (i.e.
  • the present invention encompasses polynucleotides of the present invention that are chemically synthesized, or reproduced as peptide nucleic acids (PNA), or according to other methods known in the art.
  • PNA peptide nucleic acids
  • the use of PNAs would serve as the preferred form if the polynucleotides are inco ⁇ orated onto a solid support, or gene chip.
  • a peptide nucleic acid (PNA) is a polyamide type of DNA analog and the monomeric units for adenine, guanine, thymine and cytosine are available commercially (Perceptive Biosystems).
  • PNAs phosphorus, phosphorus oxides, or deoxyribose derivatives
  • PNAs bind specifically and tightly to complementary DNA strands and are not degraded by nucleases. In fact, PNA binds more strongly to DNA than DNA itself does.
  • PNA/DNA duplexes bind under a wider range of stringency conditions than DNA/DNA duplexes, making it easier to perform multiplex hybridization. Smaller probes can be used than with DNA due to the strong binding.
  • T.sub.m melting point
  • vs. 4°-16° C melting point
  • the absence of charge groups in PNA means that hybridization can be done at low ionic strengths and reduce possible interference by salt during the analysis.
  • the present invention is useful for detecting cancer in mammals.
  • the invention is useful during diagnosis of pathological cell proliferative neoplasias which include, but are not limited to: acute myelogenous leukemias including acute monocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute erythroleukemia, acute megakaryocytic leukemia, and acute undifferentiated leukemia, etc.; and chronic myelogenous leukemias including chronic myelomonocytic leukemia, chronic granulocytic leukemia, etc.
  • Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.
  • Neoplasias are now believed to result from the qualitative alteration of a normal cellular gene product, or from the quantitative modification of gene expression by insertion into the chromosome of a viral sequence, by chromosomal translocation of a gene to a more actively transcribed region, or by some other mechanism.
  • c-myc expression is highly amplified in the non-lymphocytic leukemia cell line HL-60.
  • HL-60 cells When HL-60 cells are chemically induced to stop proliferation, the level of c-myc is found to be downregulated.
  • WO 91/15580 Intemational Publication Number WO 91/15580
  • exposure of HL-60 cells to a DNA construct that is complementary to the 5' end of c-myc or c-myb blocks translation of the corresponding mRNAs which downregulates expression of the c-myc or c-myb proteins and causes arrest of cell proliferation and differentiation of the treated cells.
  • International Publication Number WO 91/15580 Wickstrom et al, Proc. Natl. Acad. Sci.
  • a Ck ⁇ -4 or Ck ⁇ -10 polynucleotide can be used to control gene expression through triple helix formation or antisense DNA or RNA.
  • Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al., Science 251: 1360 (1991).
  • polynucleotide Both methods rely on binding of the polynucleotide to a complementary DNA or RNA.
  • preferred polynucleotides are usually oligonucleotides 20 to 40 bases in length and complementary to either the region of the gene involved in transcription (triple helix - see Lee et al., Nucl. Acids Res. 3:173 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251: 1360 (1991) ) or to the mRNA itself (antisense - Okano, J. Neurochem.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides are also useful in gene therapy.
  • One goal of gene therapy is to insert a normal gene into an organism having a defective gene, in an effort to correct the genetic defect.
  • Ck ⁇ -4 or Ck ⁇ -10 offers a means of targeting such genetic defects in a highly accurate manner.
  • Another goal is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides are also useful for identifying individuals from minute biological samples.
  • the United States military for example, is considering the use of restriction fragment length polymo ⁇ hism (RFLP) for identification of its personnel.
  • RFLP restriction fragment length polymo ⁇ hism
  • an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identifying personnel. This method does not suffer from the current limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can be used as additional DNA markers for RFLP.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can also be used as an alternative to RFLP, by determining the actual base-by-base DNA sequence of selected portions of an individual's genome. These sequences can be used to prepare PCR primers for amplifying and isolating such selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once an unique ED database is established for an individual, positive identification of that individual, living or dead, can be made from extremely small tissue samples. Forensic biology also benefits from using DNA-based identification techniques as disclosed herein.
  • DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine,fecal matter, etc.
  • body fluids e.g., blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine,fecal matter, etc.
  • gene sequences amplified from polymo ⁇ hic loci such as DQa class II HLA gene, are used in forensic biology to identify individuals. (Erlich, H., PCR Technology, Freeman and Co.
  • reagents capable of identifying the source of a particular tissue. Such need arises, for example, in forensics when presented with tissue of unknown origin.
  • Appropriate reagents can comprise, for example, DNA probes or primers specific to particular tissue prepared from Ck ⁇ -4 or Ck ⁇ -10 sequences. Panels of such reagents can identify tissue by species and/or by organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contamination.
  • chemokine polynucleotides are useful as hybridization probes for differential identification of the tissue(s) or cell type(s) present in a biological sample.
  • polypeptides and antibodies directed to the chemokine polypeptides are useful to provide immunological probes for differential identification of the tissue(s) or cell type(s).
  • Ck ⁇ -4 or Ck ⁇ -10 gene expression may be detected in certain tissues (e.g., cancerous and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" Ck ⁇ -4 or Ck ⁇ -10 gene expression level, i.e., the Ck ⁇ -4 or Ck ⁇ -10 expression level in healthy tissue from an individual not having the immune system disorder.
  • tissues e.g., cancerous and wounded tissues
  • bodily fluids e.g., serum, plasma, urine, synovial fluid or spinal fluid
  • the invention provides a diagnostic method of a disorder, which involves: (a) assaying Ck ⁇ -4 or Ck ⁇ -10 gene expression level in cells or body fluid of an individual; (b) comparing the Ck ⁇ -4 or Ck ⁇ -10 gene expression level with a standard Ck ⁇ -4 or Ck ⁇ -10 gene expression level, whereby an increase or decrease in the assayed Ck ⁇ -4 or Ck ⁇ -10 gene expression level compared to the standard expression level is indicative of disorder in the immune system.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotides can be used as molecular weight markers on Southern gels, as diagnostic probes for the presence of a specific mRNA in a particular cell type, as a probe to "subtract-out" known sequences in the process of discovering novel polynucleotides, for selecting and making oligomers for attachment to a "gene chip” or other support, to raise anti-DNA antibodies using DNA immunization techniques, and as an antigen to elicit an immune response.
  • Ck ⁇ -4 and Ck ⁇ -10 Polypeptides Ck ⁇ -4 and/or Ck ⁇ -10 polypeptides can be used in numerous ways. The following description should be considered exemplary and utilizes known techniques.
  • Ck ⁇ -4 and/or Ck ⁇ -10 polypeptides can be used to assay protein levels in a biological sample using antibody-based techniques.
  • protein expression in tissues can be studied with classical immunohistological methods.
  • Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA).
  • ELISA enzyme linked immunosorbent assay
  • RIA radioimmunoassay
  • Suitable antibody assay labels include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
  • enzyme labels such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc)
  • fluorescent labels such as fluorescein and rhodamine, and biotin.
  • proteins can also be detected in vivo by imaging.
  • Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, NMR or ESR.
  • suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject.
  • suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be inco ⁇ orated into the antibody by labeling of nutrients for the relevant hybridoma.
  • a protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety such as a radioisotope (for example, 1311, 112In, 99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously, or intraperitoneally) into the mammal.
  • a radioisotope for example, 1311, 112In, 99mTc
  • a radio-opaque substance for example, parenterally, subcutaneously, or intraperitoneally
  • the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc.
  • the labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein.
  • In vivo tumor imaging is described in S.W. Burchiel et al., "Lmmunopharmacokinetics of Radiolabeled Antibodies and Their Fragments.” (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).)
  • the invention provides a diagnostic method of a disorder, which involves (a) assaying the expression of Ck ⁇ -4 or Ck ⁇ -10 polypeptide in cells or body fluid of an individual; (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed Ck ⁇ -4 or Ck ⁇ -10 polypeptide gene expression level compared to the standard expression level is indicative of a disorder.
  • a diagnostic method of a disorder involves (a) assaying the expression of Ck ⁇ -4 or Ck ⁇ -10 polypeptide in cells or body fluid of an individual; (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed Ck ⁇ -4 or Ck ⁇ -10 polypeptide gene expression level compared to the standard expression level is indicative of a disorder.
  • the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides can be used to treat, prevent, and/or diagnose disease.
  • patients can be administered Ck ⁇ -4 or Ck ⁇ -10 polypeptides in an effort to replace absent or decreased levels of a Ck ⁇ -4 or Ck ⁇ -10 polypeptide (e.g., insulin), to supplement absent or decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the activity of a polypeptide (e.g., an oncogene or tumor supressor), to activate the activity of a polypeptide (e.g., by binding to a receptor), to reduce the activity of a membrane bound receptor by competing with it for free ligand (e.g., soluble TNF receptors used in reducing inflammation), or to bring about a desired response (e.g., blood vessel growth inhibition, enhancement of the immune response to proliferative cells or tissues).
  • a desired response e.g., blood vessel growth inhibition
  • antibodies directed to Ck ⁇ -4 or Ck ⁇ -10 polypeptides can also be used to treat, prevent, and/or diagnose disease.
  • administration of an antibody directed to a Ck ⁇ -4 or Ck ⁇ -10 polypeptide can bind and reduce ove ⁇ roduction of the polypeptide.
  • administration of an antibody can activate the polypeptide, such as by binding to a polypeptide bound to a membrane (receptor).
  • the Ck ⁇ -4 or Ck ⁇ -10 polypeptides can be used as molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides can also be used to raise antibodies, which in turn are used to measure protein expression from a recombinant cell, as a way of assessing transformation of the host cell.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides can be used to test the following biological activities. Examples and Figures identified in the calcium mobilization and chemotactic of the immune anc inflamatory cells is essential to biological activities of antiviral, antibacterial and anticancer and would healing.
  • Another aspect of the present invention is to gene therapy methods for treating or preventing disorders, diseases and conditions.
  • the gene therapy methods relate to the introduction of nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an animal to achieve expression of a Ck ⁇ -4 or Ck ⁇ -10 polypeptide of the present invention.
  • This method requires a polynucleotide which codes for a Ck ⁇ -4 or Ck ⁇ -10 polypeptide operatively linked to a promoter and any other genetic elements necessary for the expression of the polypeptide by the target tissue.
  • gene therapy and delivery techniques are known in the art, see, for example, WO90/11092, which is herein inco ⁇ orated by reference.
  • cells from a patient may be engineered with a polynucleotide
  • DNA or RNA comprising a promoter operably linked to a Ck ⁇ -4 or Ck ⁇ -10 polynucleotide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide.
  • Such methods are well-known in the art. For example, see Belldegrun, A., et al., J. Natl. Cancer Inst. 85: 207-216 (1993); Ferrantini, M. et al., Cancer Research 53: 1107-1112 (1993); Ferrantini, M. et al., J. Immunology 153: 4604-4615 (1994); Kaido, T., et al., Int. J.
  • the cells which are engineered are arterial cells.
  • the arterial cells may be reintroduced into the patient through direct injection to the artery, the tissues surrounding the artery, or through catheter injection.
  • the Ck ⁇ -4 and Ck ⁇ -10 polynucleotide constmcts can be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, and the like).
  • the Ck ⁇ -4 and Ck ⁇ -10 polynucleotide constructs may be delivered in a pharmaceutically acceptable liquid or aqueous carrier.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide is delivered as a naked polynucleotide.
  • naked polynucleotide, DNA or RNA refers to sequences that are free from any delivery vehicle that acts to assist, promote or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like.
  • the Ck ⁇ -4 and Ck ⁇ -10 polynucleotides can also be delivered in liposome formulations and lipofectin formulations and the like can be prepared by methods well known to those skilled in the art. Such methods are described, for example, in U.S. Patent Nos. 5,593,972, 5,589,466, and 5,580,859, which are herein inco ⁇ orated by reference.
  • the Ck ⁇ -4 and Ck ⁇ -10 polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication.
  • Appropriate vectors include pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Pharmacia; and pEFl/V5, pcDNA33, and pRc/CMV2 available from Invitrogen.
  • Other suitable vectors will be readily apparent to the skilled artisan.
  • Suitable promoters include adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial vims (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the He ⁇ es Simplex thymidine kinase promoter; retroviral LTRs; the b-actin promoter; and human growth hormone promoters.
  • CMV cytomegalovirus
  • RSV respiratory syncytial vims
  • inducible promoters such as the MMT promoter, the metallothionein promoter
  • heat shock promoters such as the albumin promoter
  • the ApoAI promoter human
  • the promoter also may be the native promoter for Ck ⁇ -4 or Ck ⁇ -10.
  • one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, utems, rectum, nervous system, eye, gland, and connective tissue.
  • Interstitial space of the tissues comprises the intercellular, fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels. Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells.
  • an effective dosage amount of DNA or RNA will be in the range of from about 0.05 mg/kg body weight to about 50 mg/kg body weight.
  • the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg.
  • this dosage will vary according to the tissue site of injection.
  • the appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration.
  • the preferred route of administration is by the parenteral route of injection into the interstitial space of tissues.
  • other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose.
  • naked Ck ⁇ -4 or Ck ⁇ -10 DNA constructs can be delivered to arteries during angioplasty by the catheter used in the procedure.
  • the naked polynucleotides are delivered by any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, and so-called "gene guns". These delivery methods are known in the art.
  • constructs may also be delivered with delivery vehicles such as viral sequences, viral particles, liposome formulations, lipofectin, precipitating agents, etc. Such methods of delivery are known in the art.
  • the Ck ⁇ -4 and Ck ⁇ -10 polynucleotide constmcts are complexed in a liposome preparation.
  • Liposomal preparations for use in the instant invention include cationic (positively charged), anionic (negatively charged) and neutral preparations.
  • cationic liposomes are particularly preferred because a tight charge complex can be formed between the cationic liposome and the polyanionic nucleic acid.
  • Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al., Proc. Natl. Acad. Sci.
  • N[l-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are particularly useful and are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Feigner et al., Proc. Natl Acad. Sci. USA (1987) 84:7413-7416, which is herein inco ⁇ orated by reference).
  • Other commercially available liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE (Boehringer).
  • cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g. PCT Publication No. WO 90/11092 (which is herein inco ⁇ orated by reference) for a description of the synthesis of DOTAP (1,2- bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes. Preparation of DOTMA liposomes is explained in the literature, see, e.g., P. Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417, which is herein inco ⁇ orated by reference. Similar methods can be used to prepare liposomes from other cationic lipid materials.
  • anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily available materials.
  • Such materials include phosphatidyl, choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl ethanolamine (DOPE), among others.
  • DOPC dioleoylphosphatidyl choline
  • DOPG dioleoylphosphatidyl glycerol
  • DOPE dioleoylphoshatidyl ethanolamine
  • DOPC dioleoylphosphatidyl choline
  • DOPG dioleoylphosphatidyl glycerol
  • DOPE dioleoylphosphatidyl ethanolamine
  • DOPG/DOPC vesicles can be prepared by drying 50 mg each of DOPG and DOPC under a stream of nitrogen gas into a sonication vial. The sample is placed under a vacuum pump overnight and is hydrated the following day with deionized water.
  • the sample is then sonicated for 2 hours in a capped vial, using a Heat Systems model 350 sonicator equipped with an inverted cup (bath type) probe at the maximum setting while the bath is circulated at 15EC.
  • negatively charged vesicles can be prepared without sonication to produce multilamellar vesicles or by extrusion through nucleopore membranes to produce unilamellar vesicles of discrete size.
  • Other methods are known and available to those of skill in the art.
  • the liposomes can comprise multilamellar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs), with SUVs being preferred.
  • MLVs multilamellar vesicles
  • SUVs small unilamellar vesicles
  • LUVs large unilamellar vesicles
  • the various liposome-nucleic acid complexes are prepared using methods well known in the art. See, e.g., Straubinger et al., Methods of Immunology (1983), 101 :512-527, which is herein inco ⁇ orated by reference.
  • MLVs containing nucleic acid can be prepared by depositing a thin film of phospholipid on the walls of a glass tube and subsequently hydrating with a solution of the material to be encapsulated.
  • SUVs are prepared by extended sonication of MLVs to produce a homogeneous population of unilamellar liposomes.
  • the material to be entrapped is added to a suspension of preformed MLVs and then sonicated.
  • liposomes containing cationic lipids the dried lipid film is resuspended in an appropriate solution such as sterile water or an isotonic buffer solution such as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are mixed directly with the DNA.
  • the liposome and DNA form a very stable complex due to binding of the positively charged liposomes to the cationic DNA.
  • SUVs find use with small nucleic acid fragments.
  • LUVs are prepared by a number of methods, well known in the art. Commonly used methods include Ca 2+ -EDTA chelation (Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483; Wilson et al., Cell (1979) 17:77); ether injection (Deamer, D. and Bangham, A., Biochim. Biophys. Acta (1976) 443:629; Ostro et al., Biochem. Biophys. Res. Commun. (1977) 76:836; Fraley et al., Proc. Natl. Acad. Sci. USA (1979) 76:3348); detergent dialysis (Enoch, H.
  • the ratio of DNA to liposomes will be from about 10:1 to about 1: 10.
  • the ratio will be from about 5:1 to about 1 :5. More preferably, the ratio will be about 3: 1 to about 1 :3. Still more preferably, the ratio will be about 1:1.
  • U.S. Patent No. 5,676,954 (which is herein inco ⁇ orated by reference) reports on the injection of genetic material, complexed with cationic liposomes carriers, into mice.
  • WO 94/9469 (which are herein inco ⁇ orated by reference) provide cationic lipids for use in transfecting DNA into cells and mammals.
  • WO 94/9469 (which are herein inco ⁇ orated by reference) provide methods for delivering DNA-cationic lipid complexes to mammals.
  • cells are engineered, ex vivo or in vivo, using a retroviral particle containing RNA which comprises a sequence encoding Ck ⁇ -4 or Ck ⁇ -10.
  • Retrovimses from which the retroviral plasmid vectors may be derived include, but are not limited to, Moloney Murine Leukemia Vims, spleen necrosis virus, Rous sarcoma Virus, Harvey Sarcoma Vims, avian leukosis virus, gibbon ape leukemia vims, human immunodeficiency vims, Myeloproliferative Sarcoma Vims, and mammary tumor vims.
  • the retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines.
  • packaging cells which may be transfected include, but are not limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X, VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy 1:5-14 (1990), which is inco ⁇ orated herein by reference in its entirety.
  • the vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO 4 precipitation.
  • the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
  • the producer cell line generates infectious retroviral vector particles which include polynucleotide encoding Ck ⁇ -4 or Ck ⁇ -10. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express Ck ⁇ -4 or Ck ⁇ - 10.
  • cells are engineered, ex vivo or in vivo, with Ck ⁇ -4 or
  • Adenovims can be manipulated such that it encodes and expresses Ck ⁇ -4 or Ck ⁇ -10, and at the same time is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. Adenovims expression is achieved without integration of the viral DNA into the host cell chromosome, thereby alleviating concerns about insertional mutagenesis. Furthermore, adenovimses have been used as live enteric vaccines for many years with an excellent safety profile (Schwartz, A. R. et al. (1974) Am. Rev. Respir. Dis.109:233-238).
  • adenovims mediated gene transfer has been demonstrated in a number of instances including transfer of alpha- 1-antitrypsin and CFTR to the lungs of cotton rats (Rosenfeld, M. A. et al. (1991) Science 252:431-434; Rosenfeld et al., (1992) Cell 68: 143-155). Furthermore, extensive studies to attempt to establish adenovims as a causative agent in human cancer were uniformly negative (Green, M. et al. (1979) Proc. Natl. Acad. Sci. USA 76:6606).
  • Suitable adenoviral vectors useful in the present invention are described, for example, in Kozarsky and Wilson, Curr. Opin. Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155 (1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993); Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature 365:691-692 (1993); and U.S. Patent No. 5,652,224, which are herein inco ⁇ orated by reference.
  • the adenovims vector Ad2 is useful and can be grown in human 293 cells.
  • adenovims contain the El region of adenovims and constitutively express Ela and Elb, which complement the defective adenovimses by providing the products of the genes deleted from the vector.
  • Ad2 other varieties of adenovims (e.g., Ad3, Ad5, and Ad7) are also useful in the present invention.
  • the adenovimses used in the present invention are replication deficient.
  • Replication deficient adenovimses require the aid of a helper virus and/or packaging cell line to form infectious particles.
  • the resulting vims is capable of infecting cells and can express a polynucleotide of interest which is operably linked to a promoter, but cannot replicate in most cells.
  • Replication deficient adenovimses may be deleted in one or more of all or a portion of the following genes: Ela, Elb, E3, E4, E2a, or LI through L5.
  • the cells are engineered, ex vivo or in vivo, using an adeno-associated vims (AAV).
  • AAVs are naturally occurring defective vimses that require helper viruses to produce infectious particles (Muzyczka, N., Curr. Topics in Microbiol. Immunol. 158:97 (1992)). It is also one of the few vimses that may integrate its DNA into non-dividing cells. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate, but space for exogenous DNA is limited to about 4.5 kb. Methods for producing and using such AAVs are known in the art. See, for example, U.S. Patent Nos. 5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478,745, and 5,589,377.
  • an appropriate AAV vector for use in the present invention will include all the sequences necessary for DNA replication, encapsidation, and host-cell integration.
  • the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide constmct is inserted into the AAV vector using standard cloning methods, such as those found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989).
  • the recombinant AAV vector is then transfected into packaging cells which are infected with a helper virus, using any standard technique, including lipofection, electroporation, calcium phosphate precipitation, etc.
  • Appropriate helper vimses include adenovimses, cytomegaloviruses, vaccinia viruses, or he ⁇ es viruses. Once the packaging cells are transfected and infected, they will produce infectious AAV viral particles which contain the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide construct.
  • viral particles are then used to transduce eukaryotic cells, either ex vivo or in vivo.
  • the transduced cells will contain the Ck ⁇ -4 or Ck ⁇ -10 polynucleotide constmct integrated into its genome, and will express Ck ⁇ -4 or Ck ⁇ -10.
  • Another method of gene therapy involves operably associating heterologous control regions and endogenous polynucleotide sequences (e.g. encoding Ck ⁇ -4 or Ck ⁇ -10) via homologous recombination (see, e.g., U.S. Patent No. 5,641,670, issued June 24, 1997;
  • Polynucleotide constructs are made, using standard techniques known in the art, which contain the promoter with targeting sequences flanking the promoter. Suitable promoters are described herein.
  • the targeting sequence is sufficiently complementary to an endogenous sequence to permit homologous recombination of the promoter-targeting sequence with the endogenous sequence.
  • the targeting sequence will be sufficiently near the
  • the promoter and the targeting sequences can be amplified using PCR.
  • the amplified promoter contains distinct restriction enzyme sites on the 5' and 3' ends.
  • the 3' end of the first targeting sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5' end of the second targeting sequence contains the same restriction site as the 3' end of the amplified promoter.
  • the amplified promoter and targeting sequences are digested and ligated together.
  • the promoter-targeting sequence constmct is delivered to the cells, either as naked polynucleotide, or in conjunction with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, whole viruses, lipofection, precipitating agents, etc., described in more detail above.
  • the P promoter-targeting sequence can be delivered by any method, included direct needle injection, intravenous injection, topical administration, catheter infusion, particle accelerators, etc. The methods are described in more detail below.
  • the promoter-targeting sequence constmct is taken up by cells. Homologous recombination between the constmct and the endogenous sequence takes place, such that an endogenous Ck ⁇ -4 or Ck ⁇ -10 sequence is placed under the control of the promoter.
  • the promoter then drives the expression of the endogenous Ck ⁇ -4 or Ck ⁇ -10 sequence.
  • the polynucleotides encoding Ck ⁇ -4 or Ck ⁇ -10 may be administered along with other polynucleotides encoding an angiogenic protein.
  • angiogenic proteins include, but are not limited to, acidic and basic fibroblast growth factors, VEGF-1, VEGF-2, VEGF-3, epidermal growth factor alpha and beta, platelet-derived endothelial cell growth factor, platelet-derived growth factor, tumor necrosis factor alpha, hepatocyte growth factor, insulin like growth factor, colony stimulating factor, macrophage colony stimulating factor, granulocyte/macrophage colony stimulating factor, and nitric oxide synthase.
  • the polynucleotide encoding Ck ⁇ -4 or Ck ⁇ -10 contains a secretory signal sequence that facilitates secretion of the protein.
  • the signal sequence is positioned in the coding region of the polynucleotide to be expressed towards or at the 5' end of the coding region.
  • the signal sequence may be homologous or heterologous to the polynucleotide of interest and may be homologous or heterologous to the cells to be transfected. Additionally, the signal sequence may be chemically synthesized using methods known in the art.
  • any mode of administration of any of the above-described polynucleotides constmcts can be used so long as the mode results in the expression of one or more molecules in an amount sufficient to provide a therapeutic effect.
  • This includes direct needle injection, systemic injection, catheter infusion, biolistic injectors, particle accelerators (i.e., "gene guns"), gelfoam sponge depots, other commercially available depot materials, osmotic pumps (e.g., Alza minipumps), oral or suppositorial solid (tablet or pill) pharmaceutical formulations, and decanting or topical applications during surgery.
  • a preferred method of local administration is by direct injection.
  • a recombinant molecule of the present invention complexed with a delivery vehicle is administered by direct injection into or locally within the area of arteries.
  • Administration of a composition locally within the area of arteries refers to injecting the composition centimeters and preferably, millimeters within arteries.
  • Another method of local administration is to contact a polynucleotide constmct of the present invention in or around a surgical wound.
  • a patient can undergo surgery and the polynucleotide constmct can be coated on the surface of tissue inside the wound or the constmct can be injected into areas of tissue inside the wound.
  • compositions useful in systemic administration include recombinant molecules of the present invention complexed to a targeted delivery vehicle of the present invention.
  • Suitable delivery vehicles for use with systemic administration comprise liposomes comprising ligands for targeting the vehicle to a particular site.
  • Intravenous injections can be performed using methods standard in the art. Aerosol delivery can also be performed using methods standard in the art (see, for example, Stribling et al., Proc. Natl. Acad. Sci. USA 189: 11277-11281, 1992, which is inco ⁇ orated herein by reference).
  • Oral delivery can be performed by complexing a polynucleotide constmct of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers, include plastic capsules or tablets, such as those known in the art.
  • Topical delivery can be performed by mixing a polynucleotide constmct of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
  • a lipophilic reagent e.g., DMSO
  • Determining an effective amount of substance to be delivered can depend upon a number of factors including, for example, the chemical stmcture and biological activity of the substance, the age and weight of the animal, the precise condition requiring treatment and its severity, and the route of administration.
  • the frequency of treatments depends upon a number of factors, such as the amount of polynucleotide constmcts administered per dose, as well as the health and history of the subject. The precise amount, number of doses, and timing of doses will be determined by the attending physician or veterinarian.
  • compositions of the present invention can be administered to any animal, preferably to mammals and birds.
  • Preferred mammals include humans, dogs, cats, mice, rats, rabbits sheep, cattle, horses and pigs, with humans being particularly preferred.
  • Ck ⁇ -4 or Ck ⁇ -10 can be used in assays to test for one or more biological activities. If Ck ⁇ - 4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ - 10, do exhibit activity in a particular assay, it is likely that Ck ⁇ -4 or Ck ⁇ -10 may be involved in the diseases associated with the biological activity. Therefore, Ck ⁇ -4 or Ck ⁇ -10 could be used to treat, prevent, and/or diagnose the associated disease.
  • chemokine polypeptides of the present invention are also useful for identifying other molecules which have similar biological activity.
  • An example of a screen for this is isolating the coding region of the genes by using the known DNA sequence to synthesize oligonucleotide probes. Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
  • the present invention also relates to a diagnostic assays for detecting altered levels of the polypeptides or the mRNA which provides the message for such polypeptides, both quantitatively and qualitatively.
  • diagnostic assays are well-known in the art and include an ELISA assay, the radioimmunoassay and RT-PCR.
  • the levels of the polypeptides, or their mRNAs, which are detected in the assays may be employed for the elucidation of the significance of the polypeptides in various diseases and for the diagnosis of diseases in which altered levels of the polypeptides may be significant.
  • This invention provides a method for identification of the receptors for the polypeptides.
  • the gene encoding the receptors can be identified by expression cloning.
  • Polyadenylated RNA is prepared from a cell responsive to the polypeptides, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides.
  • Transfected cells which may be cultured on slides are exposed to the labeled polypeptides.
  • the polypeptides can be labeled by a variety of means including iodidation or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis.
  • the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to x-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of generate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may be useful in treating diseases, disorders, and/or conditions of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells.
  • Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells.
  • the etiology of these immune diseases, disorders, and/or conditions may be genetic, somatic, such as cancer or some autoimmune diseases, disorders, and/or conditions, acquired (e.g., by chemotherapy or toxins), or infectious.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 can be used as a marker or detector of a particular immune system disease or disorder.
  • the chemokine polypeptides may be used to inhibit bone marrow stem cell colony formation as adjunct protective treatment during cancer chemotherapy and for leukemia.
  • They may also be used to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells .
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may be useful in treating, preventing, and/or diagnosing diseases, disorders, and/or conditions of hematopoietic cells.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat or prevent those diseases, disorders, and/or conditions associated with a decrease in certain (or many) types hematopoietic cells.
  • immunologic deficiency syndromes include, but are not limited to: blood protein diseases, disorders, and or conditions (e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HLV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
  • blood protein diseases, disorders, and or conditions e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HLV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunode
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity (clot formation).
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 could be used to treat or prevent blood coagulation diseases, disorders, and/or conditions (e.g., afibrinogenemia, factor deficiencies), blood platelet diseases, disorders, and/or conditions (e.g.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment or prevention of heart attacks (infarction), strokes, or scarring.
  • the chemokine polypeptides may also be used to treat auto-immune disease and lymphocytic leukemias by inhibiting T cell proliferation by the inhibition of LL-2 biosynthesis.
  • Ck ⁇ -4 or Ck ⁇ -10 may also be useful in treating, preventing, and/or diagnosing autoimmune diseases, disorders, and/or conditions.
  • Many autoimmune diseases, disorders, and/or conditions result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destmction of the host tissue. Therefore, the administration of Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune diseases, disorders, and/or conditions.
  • autoimmune diseases, disorders, and/or conditions that can be treated, prevented, and/or diagnosed or detected by Ck ⁇ -4 or Ck ⁇ -10 include, but are not limited to:
  • Addison's Disease hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Pu ⁇ ura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
  • allergic reactions and conditions such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated, prevented, and/or diagnosed by
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10.
  • these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
  • Ck ⁇ -4 or Ck ⁇ -10 may also be used to treat, prevent, and/or diagnose organ rejection or graft- versus-host disease (GVHD).
  • Organ rejection occurs by host immune cell destmction of the transplanted tissue through an immune response.
  • an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues.
  • the administration of Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may also be used to modulate inflammation.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may also be used to modulate inflammation.
  • Ck ⁇ -10 may inhibit the proliferation and differentiation of cells involved in an inflammatory response.
  • These molecules can be used to treat, prevent, and/or diagnose inflammatory conditions, both chronic and acute conditions, including chronic prostatitis, granulomatous prostatitis and malacoplakia, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
  • cytokines e.g., TNF or IL-1.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 can be used to treat, prevent, and/or diagnose hype ⁇ roliferative diseases, disorders, and/or conditions, including neoplasms.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may inhibit the proliferation of the disorder through direct or indirect interactions.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may proliferate other cells which can inhibit the hype ⁇ roliferative disorder.
  • hype ⁇ roliferative diseases, disorders, and/or conditions can be treated, prevented, and/or diagnosed.
  • This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • decreasing an immune response may also be a method of treating, preventing, and/or diagnosing hype ⁇ roliferative diseases, disorders, and/or conditions, such as a chemotherapeutic agent.
  • Examples of hype ⁇ roliferative diseases, disorders, and/or conditions that can be treated, prevented, and/or diagnosed by Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 include, but are not limited to neoplasms located in the olon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
  • neoplasms located in the olon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thy
  • the chemokine polypeptides may also be used to inhibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper- proliferation.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides can also be treated, prevented, and/or diagnosed by Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10.
  • hype ⁇ roliferative diseases, disorders, and/or conditions include, but are not limited to: hypergammaglobulinemia, lymphoproliferative diseases, disorders, and/or conditions, paraproteinemias, pu ⁇ ura, sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hype ⁇ roliferative disease, besides neoplasia, located in an organ system listed above.
  • One preferred embodiment utilizes polynucleotides of the present invention to inhibit aberrant cellular division, by gene therapy using the present invention, and/or protein fusions or fragments thereof.
  • the present invention provides a method for treating cell proliferative diseases, disorders, and/or conditions by inserting into an abnormally proliferating cell a polynucleotide of the present invention, wherein said polynucleotide represses said expression.
  • polynucleotides of the present invention is a DNA constmct comprising a recombinant expression vector effective in expressing a DNA sequence encoding said polynucleotides.
  • the DNA constmct encoding the poynucleotides of the present invention is inserted into cells to be treated utilizing a retrovims, or more preferrably an adenoviral vector (See G J. Nabel, et.
  • the viral vector is defective and will not transform non-proliferating cells, only proliferating cells.
  • the polynucleotides of the present invention inserted into proliferating cells either alone, or in combination with or fused to other polynucleotides can then be modulated via an external stimulus (i.e. magnetic, specific small molecule, chemical, or dmg administration, etc.), which acts upon the promoter upstream of said polynucleotides to induce expression of the encoded protein product.
  • an external stimulus i.e. magnetic, specific small molecule, chemical, or dmg administration, etc.
  • Polynucleotides of the present invention may be useful in repressing expression of oncogenic genes or antigens.
  • repressing expression of the oncogenic genes is intended the suppression of the transcription of the gene, the degradation of the gene transcript (pre-message RNA), the inhibition of splicing, the destmction of the messenger RNA, the prevention of the post-translational modifications of the protein, the destmction of the protein, or the inhibition of the normal function of the protein.
  • polynucleotides of the present invention may be administered by any method known to those of skill in the art including, but not limited to transfection, electroporation, microinjection of cells, or in vehicles such as liposomes, lipofectin, or as naked polynucleotides, or any other method described throughout the specification.
  • the polynucleotide of the present invention may be delivered by known gene delivery systems such as, but not limited to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci. U.S.A.
  • retroviral delivery system for polynucleotides of the present invention will target said gene and constmcts to abnormally proliferating cells and will spare the non-dividing normal cells.
  • the polynucleotides of the present invention may be delivered directly to cell proliferative disorder/disease sites in internal organs, body cavities and the like by use of imaging devices used to guide an injecting needle directly to the disease site.
  • the polynucleotides of the present invention may also be administered to disease sites at the time of surgical intervention.
  • cell proliferative disease any human or animal disease or disorder, affecting any one or any combination of organs, cavities, or body parts, which is characterized by single or multiple local abnormal proliferations of cells, groups of cells, or tissues, whether benign or malignant. Any amount of the polynucleotides of the present invention may be administered as long as it has a biologically inhibiting effect on the proliferation of the treated cells. Moreover, it is possible to administer more than one of the polynucleotide of the present invention simultaneously to the same site.
  • biologically inhibiting is meant partial or total growth inhibition as well as decreases in the rate of proliferation or growth of the cells.
  • the biologically inhibitory dose may be determined by assessing the effects of the polynucleotides of the present invention on target malignant or abnormally proliferating cell growth in tissue culture, tumor growth in animals and cell cultures, or any other method known to one of ordinary skill in the art.
  • the present invention is further directed to antibody-based therapies which involve administering of anti-polypeptides and anti-polynucleotide antibodies to a mammalian, preferably human, patient for treating one or more of the described diseases, disorders, and/or conditions.
  • Methods for producing anti-polypeptides and anti-polynucleotide antibodies polyclonal and monoclonal antibodies are described in detail elsewhere herein. Such antibodies may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
  • a summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below.
  • the antibodies, fragments and derivatives of the present invention are useful for treating a subject having or developing cell proliferative and/or differentiation diseases, disorders, and/or conditions as described herein.
  • Such treatment comprises administering a single or multiple doses of the antibody, or a fragment, derivative, or a conjugate thereof.
  • the antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors, for example, which serve to increase the number or activity of effector cells which interact with the antibodies.
  • Preferred binding affinities include those with a dissociation constant or Kd less than 5X10 "6 M, 10 “6 M, 5X10 “ 7 M, 10 “7 M, 5X10 “8 M, 10 “8 M, 5X10 “9 M, 10 “9 M, 5X10 " '°M, l ⁇ '°M, 5X10”M, lO ⁇ 'M, 5X10 " ' 2 M, 10 "12 M, 5X10 " ' 3 M, 10 " ' M, 5X10 " ' M, 10 14 M, 5X10 " ' 5 M, and 10 " ' 5 M.
  • the chemokine polypeptides may also be used to treat solid tumors by stimulating the invasion and activation of host defense cells, e.g., CD8 + , cytotoxic T cells and macrophages. Particularly, Ck ⁇ -4 on peripheral blood lymphocytes and MCP-4 (also referred to as Ck ⁇ - 10) on CD8 + T-cells, eosinophils and monocyctes.
  • polypeptides of the present invention are useful in inhibiting the angiogenesis of proliferative cells or tissues, either alone, as a protein fusion, or in combination with other polypeptides directly or indirectly, as described elsewhere herein.
  • said anti-angiogenesis effect may be achieved indirectly, for example, through the inhibition of hematopoietic, tumor-specific cells, such as tumor- associated macrophages (See Joseph IB, et al. J Natl Cancer Inst, 90(21)3648-53 (1998), which is hereby inco ⁇ orated by reference).
  • Antibodies directed to polypeptides or polynucleotides of the present invention may also result in inhibition of angiogenesis directly, or indirectly (See Witte L, et al., Cancer Metastasis Rev. 17(2)355-61 (1998), which is hereby inco ⁇ orated by reference)).
  • Polypeptides including protein fusions, of the present invention, or fragments thereof may be useful in inhibiting proliferative cells or tissues through the induction of apoptosis.
  • Said polypeptides may act either directly, or indirectly to induce apoptosis of proliferative cells and tissues, for example in the activation of a death-domain receptor, such as tumor necrosis factor (TNF) receptor- 1, CD95 (Fas/APO-1), TNF-receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL) receptor-1 and -2 (See Schulze-Osthoff K, et.al., Eur J Biochem 254(3):439-59 (1998), which is hereby inco ⁇ orated by reference).
  • TNF tumor necrosis factor
  • TRAMP TNF-receptor-related apoptosis-mediated protein
  • TRAIL TNF-related apoptos
  • said polypeptides may induce apoptosis through other mechanisms, such as in the activation of other proteins which will activate apoptosis, or through stimulating the expression of said proteins, either alone or in combination with small molecule dmgs or adjuviants, such as apoptonin, galectins, thioredoxins, antiinflammatory proteins (See for example, Mutat Res 400(1 -2):447-55 (1998), Med Hypotheses.50(5):423- 33 (1998), Chem Biol Interact. Apr 24;111-112:23-34 (1998), J Mol Med.76(6):402-12 (1998), Int J Tissue React;20(l):3-15 (1998), which are all hereby inco ⁇ orated by reference).
  • small dmgs or adjuviants such as apoptonin, galectins, thioredoxins, antiinflammatory proteins
  • Polypeptides, including protein fusions to, or fragments thereof, of the present invention are useful in inhibiting the metastasis of proliferative cells or tissues. Inhibition may occur as a direct result of administering polypeptides, or antibodies directed to said polypeptides as described elsewere herein, or indirectly, such as activating the expression of proteins known to inhibit metastasis, for example alpha 4 integrins, (See, e.g., Curr Top Microbiol Immunol 231:125-41 (1998), which is hereby inco ⁇ orated by reference). Such thereapeutic affects of the present invention may be achieved either alone, or in combination with small molecule dmgs or adjuvants.
  • the invention provides a method of delivering compositions containing the polypeptides of the invention (e.g., compositions containing polypeptides or polypeptide antibodes associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodmgs) to targeted cells expressing the polypeptide of the present invention.
  • compositions containing the polypeptides of the invention e.g., compositions containing polypeptides or polypeptide antibodes associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodmgs
  • Polypeptides or polypeptide antibodes of the invention may be associated with with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
  • Polypeptides, protein fusions to, or fragments thereof, of the present invention are useful in enhancing the immunogenicity and/or antigenicity of proliferating cells or tissues, either directly, such as would occur if the polypeptides of the present invention 'vaccinated' the immune response to respond to proliferative antigens and immunogens, or indirectly, such as in activating the expression of proteins known to enhance the immune response (e.g. chemokines), to said antigens and immunogens.
  • proteins known to enhance the immune response e.g. chemokines
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 can be used to treat, prevent, and/or diagnose infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and or T cells, infectious diseases may be treated, prevented, and/or diagnosed. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, may also directly inhibit the infectious agent, without necessarily eliciting an immune response.
  • Vimses are one example of an infectious agent that can cause disease or symptoms that can be treated, prevented, and/or diagnosed by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention.
  • examples of vimses include, but are not limited to Examples of vimses, include, but are not limited to the following DNA and RNA vimses and viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Bimaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), He ⁇ esviridae (such as, Cytomegalovirus, He ⁇ es Simplex, He ⁇ es Zoster), Mononegavims (e.g., Paramyxoviridae, Morbilli virus, Rhabdoviridae), Orthomyxoviridae (e
  • Vimses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, respiratory syncytial virus, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia.
  • arthritis bronchiollitis
  • respiratory syncytial virus e.g., conjunctivitis, kera
  • polynucleotides or polypeptides, or agonists or antagonists of the invention can be used to treat, prevent, and/or diagnose any of these symptoms or diseases.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B).
  • hepatitis e.g., hepatitis B
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients nonresponsive to one or more other commercially available hepatitis vaccines.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose AIDS.
  • Chemokines may also be used to enhance host defenses against resistant chronic infections, for example, mycobacteria, listeria or leishmania infections, or opportunistic infections such as, for example, cryptococcus infections, via the attraction of microbicidal leukocytes, such as peripheral blood leukocytes ("PBLs”) by CK ⁇ -4 and CD4+ T-cells, monocytes and eosinophils by MCP-4.
  • PBLs peripheral blood leukocytes
  • CK ⁇ -4 and CD4+ T-cells monocytes and eosinophils by MCP-4.
  • Actinomycetales e.g., Corynebacterium, My
  • Enterobacteriaceae Klebsiella, Salmonella (e.g., Salmonella typhi, and Salmonella paratyphi), Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal), Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, Shigella spp.,
  • bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B), Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually
  • Polynucleotides or polypeptides, agonists or antagonists of the invention can be used to treat, prevent, and/or diagnose any of these symptoms or diseases.
  • polynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, Diptheria, botulism, and or meningitis type B.
  • chemokine polypeptides also increase the presence of eosinophils which have the distinctive function of killing the larvae of parasites that invade tissues, as in schistosomiasis, trichinosis and ascariasis.
  • parasitic agents causing disease or symptoms that can be treated, prevented, and/or diagnosed by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, the following families or class: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium malaiiae and Plasmodium ovale).
  • polynucleotides or polypeptides, or agonists or antagonists of the invention can be used to treat, prevent, and/or diagnose any of these symptoms or diseases.
  • polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose malaria.
  • treatment or prevention using a polypeptide or polynucleotide and/or agonist or antagonist of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy).
  • the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
  • Ck ⁇ -4 and MCP-4 may also be used in wound healing, both via the recmitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF ⁇ -mediated fibrosis.
  • Ck ⁇ -10 may also be used in wound healing, both via the recmitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGF ⁇ -mediated fibrosis.
  • Ck ⁇ -4 and MCP-4 may also be used to treat other fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary fibrosis.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, bums resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associted with systemic treatment with steroids, radiation therapy and antineoplastic dmgs and antimetabolites.
  • wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, bums resulting from heat exposure or chemicals, and other abnormal wound healing conditions such
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used to promote dermal reestablishment subsequent to dermal loss
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed.
  • Ck ⁇ -10 could be used to increase adherence to a wound bed: autografts, artificial skin, allografts, autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown grafts, bone graft, brephoplastic grafts, cutis graft, delayed graft, dermic graft, epidermic graft, fascia graft, full thickness graft, heterologous graft, xenograft, homologous graft, hype ⁇ lastic graft, lamellar graft, mesh graft, mucosal graft, Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft, penetrating graft, split skin graft, thick split graft.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, as well as agonists or antagonists of Ck ⁇ -4
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides will also produce changes in hepatocyte proliferation, and epithelial cell proliferation in the lung, breast, pancreas, stomach, small intesting, and large intestine.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could promote proliferation of epithelial cells such as sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells and their progenitors contained within the skin, lung, liver, and gastrointestinal tract.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, as well as agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may have a cytoprotective effect on the small intestine mucosa.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, as well as agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 could further be used in full regeneration of skin in full and partial thickness skin defects, including burns, (i.e., repopulation of hair follicles, sweat glands, and sebaceous glands), treatment of other skin defects such as psoriasis.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used to treat, prevent, and or diagnose epidermolysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating reepithelialization of these lesions.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could also be used to treat, prevent, and/or diagnose gastric and doudenal ulcers and help heal by scar formation of the mucosal lining and regeneration of glandular mucosa and duodenal mucosal lining more rapidly.
  • Inflamamatory bowel diseases such as Crohn's disease and ulcerative colitis, are diseases which result in destmction of the mucosal surface of the small or large intestine, respectively.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used to promote the resurfacing of the mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease.
  • Ck ⁇ -4 or Ck ⁇ -10 is expected to have a significant effect on the production of mucus throughout the gastrointestinal tract and could be used to protect the intestinal mucosa from injurious substances that are ingested or following surgery.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, as well as agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, could be used to treat, prevent, and/or diagnose diseases associate with the under expression of Ck ⁇ -4 or Ck ⁇ -10.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used to prevent and heal damage to the lungs due to various pathological states.
  • a growth factor such as Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, as well as agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, which could stimulate proliferation and differentiation and promote the repair of alveoli and brochiolar epithelium to prevent or treat acute or chronic lung damage.
  • emphysema which results in the progressive loss of aveoli, and inhalation injuries, i.e., resulting from smoke inhalation and bums, that cause necrosis of the bronchiolar epithelium and alveoli could be effectively treated using Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used to stimulate the proliferation of and differentiation of type II pneumocytes, which may help treat, prevent, and/or diagnose disease such as hyaline membrane diseases, such as infant respiratory distress syndrome and bronchopulmonary displasia, in premature infants.
  • Ck ⁇ -4 or Ck ⁇ -10 could stimulate the proliferation and differentiation of hepatocytes and, thus, could be used to alleviate or treat, prevent, and/or diagnose liver diseases and pathologies such as fulminant liver failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
  • liver diseases and pathologies such as fulminant liver failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides could be used treat, prevent, and/or diagnose the onset of diabetes mellitus.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, as well as agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 could be used to maintain the islet function so as to alleviate, delay or prevent permanent manifestation of the disease.
  • Ck ⁇ -4 or Ck ⁇ -10 could be used to maintain the islet function so as to alleviate, delay or prevent permanent manifestation of the disease.
  • Ck ⁇ -10 polynucleotides or polypeptides as well as agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, encoding Ck ⁇ -4 or Ck ⁇ -10 may be used to treat, prevent, and/or diagnose cardiovascular diseases, disorders, and/or conditions, including peripheral artery disease, such as limb ischemia.
  • Cardiovascular diseases, disorders, and/or conditions include cardiovascular abnormalities, such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome.
  • cardiovascular abnormalities such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome.
  • Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent tmncus arteriosus, and heart septal defects, such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal defects.
  • Cardiovascular diseases, disorders, and/or conditions also include heart disease, such as arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), heart aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart mpture, ventricular septal mpture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous), pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.
  • heart disease such as arrhythmias, carcino
  • Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation.
  • Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
  • Heart valve disease include aortic valve insufficiency, aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
  • Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis.
  • Myocardial ischemias include coronary disease, such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.
  • coronary disease such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.
  • Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease, Klippel- Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular diseases, disorders, and/or conditions, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's disease,
  • Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms, mptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
  • Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal artery obstmction, retinal artery occlusion, and thromboangiitis obliterans.
  • Cerebrovascular diseases, disorders, and/or conditions include carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.
  • Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms.
  • Thrombosis include coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis.
  • Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia.
  • Vasculitis includes aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch pu ⁇ ura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 are especially effective for the treatment of critical limb ischemia and coronary disease.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides may be administered as part of a Therapeutic, described in more detail below. Methods of delivering Ck ⁇ -4 or Ck ⁇ -10 polynucleotides are described in more detail herein.
  • Chemokines may also be employed as inhibitors of angiogenesis, therefore, they have anti-tumor effects.
  • the naturally occurring balance between endogenous stimulators and inhibitors of angiogenesis is one in which inhibitory influences predominate. Rastinejad et al, Cell 56:345-355 (1989).
  • angiogenesis is stringently regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis such as that characterizing solid tumor growth, these regulatory controls fail. Unregulated angiogenesis becomes pathologic and sustains progression of many neoplastic and non- neoplastic diseases.
  • a number of serious diseases are dominated by abnormal neovascularization including solid tumor growth and metastases, arthritis, some types of eye diseases, disorders, and/or conditions, and psoriasis. See, e.g., reviews by Moses et al, Biotech. 9:630-634 (1991); Folkman et al, N. Engl. J. Med, 333:1757-1763 (1995); Auerbach et al, J. Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol.
  • the present invention provides for treatment of diseases, disorders, and/or conditions associated with neovascularization by administration of the polynucleotides and/or polypeptides of the invention, as well as agonists or antagonists of the present invention.
  • Malignant and metastatic conditions which can be treated with the polynucleotides and polypeptides, or agonists or antagonists of the invention include, but are not limited to, malignancies, solid tumors, and cancers described herein and otherwise known in the art (for a review of such disorders, see Fishman et al, Medicine, 2d Ed., J. B. Lippincott Co., Philadelphia (1985)).
  • the present invention provides a method of treating an angiogenesis-related disease and/or disorder, comprising administering to an individual in need thereof a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist of the invention.
  • a polynucleotide, polypeptide, antagonists and/or agonist of the invention may be utilized in a variety of additional methods in order to therapeutically treat or prevent a cancer or tumor.
  • Cancers which may be treated with polynucleotides, polypeptides, antagonists and/or agonists include, but are not limited to solid tumors, including prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, utems, endometrium, kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas; glioblastoma; Kaposi's sarcoma; leiomyosarcoma; non- small cell lung cancer; colorectal cancer; advanced malignancies; and blood bom tumors such as leukemias.
  • solid tumors including prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, utems
  • polynucleotides, polypeptides, antagonists and/or agonists may be delivered topically, in order to treat or prevent cancers such as skin cancer, head and neck tumors, breast tumors, and Kaposi's sarcoma.
  • polynucleotides, polypeptides, antagonists and/or agonists may be utilized to treat, prevent, and/or diagnose superficial forms of bladder cancer by, for example, intravesical administration.
  • Polynucleotides, polypeptides, antagonists and/or agonists may be delivered directly into the tumor, or near the tumor site, via injection or a catheter.
  • the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.
  • Polynucleotides, polypeptides, antagonists and/or agonists may be useful in treating other diseases, disorders, and/or conditions, besides cancers, which involve angiogenesis.
  • diseases, disorders, and/or conditions include, but are not limited to: benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; artheroscleric plaques; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, comeal graft rejection, neovascular glaucoma, retrolental fibroplasia, mbeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations;
  • methods for treating hypertrophic scars and keloids comprising the step of administering a polynucleotide, polypeptide, antagonist and or agonist of the invention to a hypertrophic scar or keloid.
  • polynucleotides, polypeptides, antagonists and/or agonists are directly injected into a hypertrophic scar or keloid, in order to prevent the progression of these lesions.
  • This therapy is of particular value in the prophylactic treatment of conditions which are known to result in the development of hypertrophic scars and keloids (e.g., bums), and is preferably initiated after the proliferative phase has had time to progress (approximately 14 days after the initial injury), but before hypertrophic scar or keloid development.
  • the present invention also provides methods for treating neovascular diseases of the eye, including for example, comeal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.
  • neovascular diseases of the eye including for example, comeal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.
  • Ocular diseases, disorders, and/or conditions associated with neovascularization which can be treated with the polynucleotides and polypeptides of the present invention (including agonists and/or antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity macular degeneration, comeal graft neovascularization, as well as other eye inflammatory diseases, ocular tumors and diseases associated with choroidal or iris neovascularization. See, e.g., reviews by Waltman et al, Am. J. Ophthal.
  • neovascular diseases of the eye such as comeal neovascularization (including comeal graft neovascularization)
  • methods for treating neovascular diseases of the eye such as comeal neovascularization (including comeal graft neovascularization) comprising the step of administering to a patient a therapeutically effective amount of a compound (as described above) to the cornea, such that the formation of blood vessels is inhibited.
  • the comea is a tissue which normally lacks blood vessels.
  • capillaries may extend into the comea from the pericorneal vascular plexus of the limbus.
  • comeal infections e.g., trachoma, he ⁇ es simplex keratitis, leishmaniasis and onchocerciasis
  • immunological processes e.g., graft rejection and Stevens-Johnson's syndrome
  • alkali bums trauma, inflammation (of any cause), toxic and nutritional deficiency states, and as a complication of wearing contact lenses.
  • saline may be prepared for topical administration in saline (combined with any of the preservatives and antimicrobial agents commonly used in ocular preparations), and administered in eyedrop form.
  • the solution or suspension may be prepared in its pure form and administered several times daily.
  • anti-angiogenic compositions prepared as described above, may also be administered directly to the cornea.
  • the anti-angiogenic composition is prepared with a muco-adhesive polymer which binds to cornea.
  • the anti-angiogenic factors or anti-angiogenic compositions may be utilized as an adjunct to conventional steroid therapy.
  • Topical therapy may also be useful prophylactically in co eal lesions which are known to have a high probability of inducing an angiogenic response (such as chemical bums). In these instances the treatment, likely in combination with steroids, may be instituted immediately to help prevent subsequent complications.
  • the compounds described above may be injected directly into the comeal stroma by an ophthalmologist under microscopic guidance.
  • the preferred site of injection may vary with the mo ⁇ hology of the individual lesion, but the goal of the administration would be to place the composition at the advancing front of the vasculature (i.e., interspersed between the blood vessels and the normal co ea). In most cases this would involve perilimbic comeal injection to "protect" the comea from the advancing blood vessels. This method may also be utilized shortly after a comeal insult in order to prophylactically prevent comeal neovascularization.
  • the material could be injected in the perilimbic comea interspersed between the comeal lesion and its undesired potential limbic blood supply.
  • Such methods may also be utilized in a similar fashion to prevent capillary invasion of transplanted corneas. In a sustained-release form injections might only be required 2-3 times per year.
  • a steroid could also be added to the injection solution to reduce inflammation resulting from the injection itself.
  • methods for treating neovascular glaucoma, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited.
  • the compound may be administered topically to the eye in order to treat or prevent early forms of neovascular glaucoma.
  • the compound may be implanted by injection into the region of the anterior chamber angle.
  • the compound may also be placed in any location such that the compound is continuously released into the aqueous humor.
  • methods for treating proliferative diabetic retinopathy, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eyes, such that the formation of blood vessels is inhibited.
  • proliferative diabetic retinopathy may be treated by injection into the aqueous humor or the vitreous, in order to increase the local concentration of the polynucleotide, polypeptide, antagonist and/or agonist in the retina.
  • this treatment should be initiated prior to the acquisition of severe disease requiring photocoagulation.
  • methods for treating retrolental fibroplasia comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited.
  • the compound may be administered topically, via intravitreous injection and/or via intraocular implants.
  • diseases, disorders, and/or conditions which can be treated with the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osler- Weber syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular adhesions.
  • diseases, disorders, and/or conditions and/or states, which can be treated with be treated with the the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, solid tumors, blood bom tumors such as leukemias, tumor metastasis, Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, comeal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vascluogenesis, granulations, hypertrophic scar
  • an amount of the compound sufficient to block embryo implantation is administered before or after intercourse and fertilization have occurred, thus providing an effective method of birth control, possibly a "morning after" method.
  • Polynucleotides, polypeptides, agonists and/or agonists may also be used in controlling menstruation or administered as either a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis.
  • Polynucleotides, polypeptides, agonists and/or agonists of the present invention may be inco ⁇ orated into surgical sutures in order to prevent stitch granulomas.
  • compositions in the form of, for example, a spray or film
  • a compositions may be utilized to coat or spray an area prior to removal of a tumor, in order to isolate normal surrounding tissues from malignant tissue, and/or to prevent the spread of disease to surrounding tissues.
  • compositions e.g., in the form of a spray
  • surgical meshes which have been coated with anti- angiogenic compositions of the present invention may be utilized in any procedure wherein a surgical mesh might be utilized.
  • a surgical mesh laden with an anti-angiogenic composition may be utilized during abdominal cancer resection surgery (e.g., subsequent to colon resection) in order to provide support to the structure, and to release an amount of the anti-angiogenic factor.
  • methods for treating tumor excision sites, comprising administering a polynucleotide, polypeptide, agonist and/or agonist to the resection margins of a tumor subsequent to excision, such that the local recurrence of cancer and the formation of new blood vessels at the site is inhibited.
  • the anti-angiogenic compound is administered directly to the tumor excision site (e.g., applied by swabbing, brushing or otherwise coating the resection margins of the tumor with the anti-angiogenic compound).
  • the anti- angiogenic compounds may be inco ⁇ orated into known surgical pastes prior to administration.
  • the anti- angiogenic compounds are applied after hepatic resections for malignancy, and after neurosurgical operations.
  • polynucleotides, polypeptides, agonists and/or agonists may be administered to the resection margin of a wide variety of tumors, including for example, breast, colon, brain and hepatic tumors.
  • anti-angiogenic compounds may be administered to the site of a neurological tumor subsequent to excision, such that the formation of new blood vessels at the site are inhibited.
  • polynucleotides, polypeptides, agonists and/or agonists of the present invention may also be administered along with other anti-angiogenic factors.
  • anti-angiogenic factors include: Anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase- 1, Tissue Inhibitor of Metalloproteinase-2, Plasminogen Activator Inhibitor- 1, Plasminogen Activator Inhibitor-2, and various forms of the lighter "d group" transition metals.
  • Lighter "d group” transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include oxo transition metal complexes. Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate.
  • Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates.
  • Representative examples of tungsten and molybdenum complexes also include oxo complexes.
  • Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes.
  • Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid.
  • Suitable tungsten oxides include tungsten (LV) oxide and tungsten (VI) oxide.
  • Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes.
  • Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates.
  • Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid.
  • Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate.
  • Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.
  • anti-angiogenic factors include platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res.
  • SP- PG Sulphated Polysaccharide Peptidoglycan Complex
  • the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate
  • Staurosporine modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5-(4-pyridinyl)-2(3H)- oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff et al., J.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune diseases, disorders, and/or conditions (such as, multiple cancers, and/or conditions (such as, multiple myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma,
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides, polypeptides, and or antagonists of the invention are used to inhibit growth, progression, and/or metasis of cancers, in particular those listed above.
  • Additional diseases or conditions associated with increased cell survival that could be treated, prevented, and/or diagnosed by Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, include, but are not limited to, progression, and/or metastases of malignancies and related diseases, disorders, and/or conditions such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g..).
  • leukemia including acute leukemias (e.g., acute lymphocytic leukemia, acute my
  • Hodgkin's disease and non-Hodgkin's disease multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma.
  • osteogenic sarcoma chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astro
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides include ALDS; neurodegenerative diseases, disorders, and/or conditions (such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior associated disease); autoimmune diseases, disorders, and/or conditions (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomemlonephritis and rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia), graft v.
  • ALDS neurodegenerative diseases, disorders, and/or conditions
  • autoimmune diseases, disorders, and/or conditions such as, multiple sclerosis, Sjogren's syndrome, Hashimoto
  • ischemic injury such as that caused by myocardial infarction, stroke and reperfusion injury
  • liver injury e.g., hepatitis related liver injury, ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer
  • toxin-induced liver disease such as that caused by alcohol
  • septic shock cachexia and anorexia.
  • Chemokines of the present invention also may be used to enhance neuronal survival and differentiation and they may be employed, where effective in this regard, in the treatment of neurodegenerative diseases.
  • Ck ⁇ -4 or Ck ⁇ -10 may be used, where effective, to enhance neuton survival and neurite outgrowth.
  • Nervous system diseases, disorders, and/or conditions which can be treated with the Ck ⁇ -4 or Ck ⁇ -10 compositions of the invention (e.g., Ck ⁇ -4 or Ck ⁇ -10 polypeptides, polynucleotides, and/or agonists or antagonists), include, but are not limited to, nervous system injuries, and diseases, disorders, and/or conditions which result in either a disconnection of axons, a diminution or degeneration of neurons, or demyelination.
  • Nervous system lesions which may be treated in a patient (including human and non-human mammalian patients) according to the invention, include but are not limited to, the following lesions of either the central (including spinal cord, brain) or peripheral nervous systems: (1) ischemic lesions, in which a lack of oxygen in a portion of the nervous system results in neuronal injury or death, including cerebral infarction or ischemia, or spinal cord infarction or ischemia; (2) traumatic lesions, including lesions caused by physical injury or associated with surgery, for example, lesions which sever a portion of the nervous system, or compression injuries; (3) malignant lesions, in which a portion of the nervous system is destroyed or injured by malignant tissue which is either a nervous system associated malignancy or a malignancy derived from non-nervous system tissue; (4) infectious lesions, in which a portion of the nervous system is destroyed or injured as a result of infection, for example, by an abscess or associated with infection by human immunodeficiency virus, he ⁇ es z
  • the Ck ⁇ -4 or Ck ⁇ -10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to protect neural cells from the damaging effects of cerebral hypoxia.
  • the Ck ⁇ -4 or Ck ⁇ -10 compositions of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with cerebral hypoxia.
  • the Ck ⁇ -4 or Ck ⁇ -10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with cerebral ischemia.
  • the Ck ⁇ -4 or Ck ⁇ -10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with cerebral infarction.
  • the Ck ⁇ -4 or Ck ⁇ - 10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with a stroke.
  • the Ck ⁇ -4 or Ck ⁇ -10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with a heart attack.
  • compositions of the invention which are useful for treating, preventing, and/or diagnosing a nervous system disorder may be selected by testing for biological activity in promoting the survival or differentiation of neurons.
  • Ck ⁇ -4 or Ck ⁇ -10 compositions of the invention which elicit any of the following effects may be useful according to the invention: (1) increased survival time of neurons in culture; (2) increased sprouting of neurons in culture or in vivo; (3) increased production of a neuron-associated molecule in culture or in vivo, e.g. , choline acetyltransferase or acetylcholinesterase with respect to motor neurons; or (4) decreased symptoms of neuron dysfunction in vivo.
  • Such effects may be measured by any method known in the art.
  • increased survival of neurons may routinely be measured using a method set forth herein or otherwise known in the art, such as, for example, the method set forth in Arakawa et al. (J. Neurosci. 10:3507-3515 (1990)); increased sprouting of neurons may be detected by methods known in the art, such as, for example, the methods set forth in Pestronk et al. (Exp. Neurol. 70:65-82 (1980)) or Brown et al. (Ann. Rev. Neurosci.
  • neuron-associated molecules may be measured by bioassay, enzymatic assay, antibody binding, Northern blot assay, etc., using techniques known in the art and depending on the molecule to be measured; and motor neuron dysfunction may be measured by assessing the physical manifestation of motor neuron disorder, e.g., weakness, motor neuron conduction velocity, or functional disability.
  • motor neuron diseases, disorders, and/or conditions that may be treated according to the invention include, but are not limited to, diseases, disorders, and/or conditions such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as diseases, disorders, and/or conditions that selectively affect neurons such as amyotrophic lateral sclerosis, and including, but not limited to, progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and the post polio syndrome, and Hereditary Motorsensory Neuropathy (Charcot-Marie -Tooth Disease).
  • diseases, disorders, and/or conditions such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as diseases, disorders, and/or
  • neurologic diseases which can be treated, prevented, and/or diagnosed with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include brain diseases, such as metabolic brain diseases which includes phenylketonuria such as maternal phenylketonuria, pymvate carboxylase deficiency, pyruvate dehydrogenase complex deficiency, Wemicke's Encephalopathy, brain edema, brain neoplasms such as cerebellar neoplasms which include infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms, supratentorial neoplasms, canavan disease, cerebellar diseases such as cerebellar ataxia which include spinocerebellar degeneration such as ataxia telangiectasia, cerebellar dyssynergia, Friederich'
  • epilepsy such as generalized epilepsy which includes infantile spasms, absence epilepsy, myoclonic epilepsy which includes MERRF Syndrome, tonic- clonic epilepsy, partial epilepsy such as complex partial epilepsy, frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy, status epilepticus such as Epilepsia Partialis Continua, Hallervorden-Spatz Syndrome, hydrocephalus such as Dandy-Walker Syndrome and normal pressure hydrocephalus, hypothalamic diseases such as hypothalamic neoplasms, cerebral malaria,
  • Bacterial meningtitis which includes Haemophilus Meningtitis, Listeria Meningtitis, Meningococcal Meningtitis such as Waterhouse-Friderichsen Syndrome, Pneumococcal Meningtitis and meningeal tuberculosis, fungal meningitis such as Cryptococcal Meningtitis, subdural effusion, meningoencephalitis such as uvemeningoencephalitic syndrome, myelitis such as transverse myelitis, neurosyphilis such as tabes dorsalis, poliomyelitis which includes bulbar poliomyelitis and postpoliomyelitis syndrome, prion diseases (such as Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy, Gerstmann-Straussler Syndrome, Kuru, Scrapie) cerebral toxoplasmosis, central nervous system neoplasms such as brain neoplasms that include cerebellear neoplasms such
  • Ck ⁇ -4 or Ck ⁇ -10 can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues.
  • the regeneration of tissues could be used to repair, replace, or protect tissue damaged by congenital defects, trauma (wounds, burns, incisions, or ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal disease, liver failure), surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or systemic cytokine damage.
  • Tissues that could be regenerated using the present invention include organs (e.g., pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vasculature (including vascular and lymphatics), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, and ligament) tissue.
  • organs e.g., pancreas, liver, intestine, kidney, skin, endothelium
  • muscle smooth, skeletal or cardiac
  • vasculature including vascular and lymphatics
  • nervous hematopoietic
  • hematopoietic skeletal
  • skeletal bone, cartilage, tendon, and ligament
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may increase regeneration of tissues difficult to heal. For example, increased tendon/ligament regeneration would quicken recovery time after damage.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides. or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, of the present invention could also be used prophylactically in an effort to avoid damage.
  • Specific diseases that could be treated, prevented, and/or diagnosed include of tendinitis, ca ⁇ al tunnel syndrome, and other tendon or ligament defects.
  • a further example of tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds.
  • nerve and brain tissue could also be regenerated by using Ck ⁇ -4 or Ck ⁇ - 10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, to proliferate and differentiate nerve cells.
  • Diseases that could be treated, prevented, and/or diagnosed using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic diseases, disorders, and/or conditions (e.g., spinal cord disorders, head trauma, cerebrovascular disease, and stoke).
  • diseases associated with peripheral nerve injuries e.g., resulting from chemotherapy or other medical therapies
  • peripheral neuropathy e.g., resulting from chemotherapy or other medical therapies
  • localized neuropathies e.g., central nervous system diseases
  • central nervous system diseases e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides e.g., agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10.
  • Chemotaxis Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of
  • Ck ⁇ -4 or Ck ⁇ -10 may have chemotaxis activity.
  • a chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hype ⁇ roliferation.
  • the mobilized cells can then fight off and/or heal the particular trauma or abnormality.
  • Ck ⁇ -4 or Ck ⁇ -10 may increase chemotaxic activity of particular cells.
  • These chemotactic molecules can then be used to treat, prevent, and/or diagnose inflammation, infection, hype ⁇ roliferative diseases, disorders, and/or conditions, or any immune system disorder by increasing the number of cells targeted to a particular location in the body.
  • chemotaxic molecules can be used to treat, prevent, and/or diagnose wounds and other trauma to tissues by attracting immune cells to the injured location.
  • Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat, prevent, and/or diagnose wounds.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10 may inhibit chemotactic activity. These molecules could also be used to treat, prevent, and/or diagnose diseases, disorders, and/or conditions. Thus, Ck ⁇ -4 or Ck ⁇ -10 polynucleotides or polypeptides, or agonists or antagonists of Ck ⁇ -4 or Ck ⁇ -10, could be used as an inhibitor of chemotaxis.
  • Ck ⁇ -4 or Ck ⁇ -10 polypeptides may be used to screen for molecules that bind to
  • Ck ⁇ -4 or Ck ⁇ -10 for molecules to which Ck ⁇ -4 or Ck ⁇ -10 binds.
  • the binding of Ck ⁇ - 4 or Ck ⁇ -10 and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the Ck ⁇ -4 or Ck ⁇ -10 or the molecule bound.
  • Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors),or small molecules.
  • the molecule is closely related to the natural ligand of Ck ⁇ -4 or Ck ⁇ -10, e.g., a fragment of the ligand, or a natural substrate, a ligand, a stmctural or functional mimetic.
  • the natural ligand of Ck ⁇ -4 or Ck ⁇ -10 e.g., a fragment of the ligand, or a natural substrate, a ligand, a stmctural or functional mimetic.
  • the molecule can be closely related to the natural receptor to which Ck ⁇ -4 or Ck ⁇ - 10 binds, or at least, a fragment of the receptor capable of being bound by Ck ⁇ -4 or Ck ⁇ -10
  • the molecule can be rationally designed using known techniques.
  • the screening for these molecules involves producing appropriate cells which express Ck ⁇ -4 or Ck ⁇ -10, either as a secreted protein or on the cell membrane.
  • Preferred cells include cells from mammals, yeast, Drosophila, or E. coli. Cells expressing
  • Ck ⁇ -4 or Ck ⁇ -10 are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either Ck ⁇ -4 or Ck ⁇ -10 or the molecule.
  • the assay may simply test binding of a candidate compound to Ck ⁇ -4 or Ck ⁇ -10, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to Ck ⁇ -4 or Ck ⁇ -10.
  • the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures.
  • the assay may also simply comprise the steps of mixing a candidate compound with a solution containing Ck ⁇ -4 or Ck ⁇ -10, measuring Ck ⁇ -4 or Ck ⁇ -10/molecule activity or binding, and comparing the Ck ⁇ -4 or Ck ⁇ -10/molecule activity or binding to a standard.
  • an ELISA assay can measure Ck ⁇ -4 or Ck ⁇ -10 level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody.
  • the antibody can measure Ck ⁇ -4 or Ck ⁇ -10 level or activity by either binding, directly or indirectly, to
  • Ck ⁇ -4 or Ck ⁇ -10 or by competing with Ck ⁇ -4 or Ck ⁇ -10 for a substrate.
  • the receptor to which Ck ⁇ -4 or Ck ⁇ -10 binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)).
  • polyadenylated RNA is prepared from a cell responsive to the polypeptides, for example, NIH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides.
  • Transfected cells which are grown on glass slides are exposed to the polypeptide of the present invention, after they have been labelled.
  • the polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase.
  • the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
  • DNA shuffling may be employed to modulate the activities of Ck ⁇ -4 or Ck ⁇ -10 thereby effectively generating agonists and antagonists of Ck ⁇ -4 or Ck ⁇ -10. See generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721,
  • alteration of Ck ⁇ -4 or Ck ⁇ -10 polynucleotides and corresponding polypeptides may be achieved by DNA shuffling.
  • DNA shuffling involves the assembly of two or more DNA segments into a desired Ck ⁇ -4 or Ck ⁇ -10 molecule by homologous, or site-specific, recombination.
  • Ck ⁇ -4 or Ck ⁇ -10 polynucleotides and corresponding polypeptides may be alterred by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
  • one or more components, motifs, sections, parts, domains, fragments, etc., of Ck ⁇ -4 or Ck ⁇ -10 may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
  • the heterologous molecules are Transforming Growth Factor family members.
  • the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone mo ⁇ hogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dpp), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF-beta 1, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).
  • PDGF platelet-derived growth factor
  • IGF-I insulin-like growth factor
  • TGF transforming growth factor
  • EGF epidermal growth factor
  • FGF fibroblast growth factor
  • TGF-beta
  • Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the Ck ⁇ -4 or Ck ⁇ -10 polypeptide.
  • the biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
  • this invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention.
  • An example of such an assay comprises combining a mammalian fibroblast cell, a the polypeptide of the present invention, the compound to be screened and 3[H] thymidine under cell culture conditions where the fibroblast cell would normally proliferate.
  • a control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3[H] thymidine in each case.
  • the amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the inco ⁇ oration of 3[H] thymidine. Both agonist and antagonist compounds may be identified by this procedure.
  • a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound.
  • the ability of the compound to enhance or block this interaction could then be measured.
  • Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
  • the invention includes a method of identifying compounds which bind to Ck ⁇ -4 or Ck ⁇ -10 comprising the steps of: (a) incubating a candidate binding compound with Ck ⁇ -4 or Ck ⁇ -10; and (b) determining if binding has occurred.
  • the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with
  • Ck ⁇ -4 or Ck ⁇ -10 (b) assaying a biological activity , and (b) determining if a biological activity of Ck ⁇ -4 or Ck ⁇ -10 has been altered.
  • the invention provides a method of delivering compositions to targeted cells expressing a receptor for a polypeptide of the invention, or cells expressing a cell bound form of a polypeptide of the invention.
  • polypeptides or antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
  • the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (including antibodies) that are associated with heterologous polypeptides or nucleic acids.
  • the invention provides a method for delivering a therapeutic protein into the targeted cell.
  • the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.
  • a single stranded nucleic acid e.g., antisense or ribozymes
  • double stranded nucleic acid e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed
  • the invention provides a method for the specific destmction of cells (e.g., the destmction of tumor cells) by administering polypeptides of the invention (e.g., polypeptides of the invention or antibodies of the invention) in association with toxins or cytotoxic prodrugs.
  • polypeptides of the invention e.g., polypeptides of the invention or antibodies of the invention
  • toxin compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death.
  • Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin.
  • radioisotopes known in the art
  • compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseu
  • cytotoxic prodrug is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound.
  • Cytotoxic prodrugs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin.
  • This invention provides a method of screening dmgs to identify those which enhance (agonists) or block (antagonists) interaction of the polypeptides to their identified receptors.
  • An agonist is a compound which increases the natural biological functions of the polypeptides, while antagonists eliminate such functions.
  • Such a method would include contacting the polypeptide of the present invention with a selected compound(s) suspected of having antagonist or agonist activity, and assaying the activity of these polypeptides following binding.
  • a mammalian cell or membrane preparation expressing the receptors of the polypeptides would be incubated with a labeled chemokine polypeptide, eg. radioactivity, in the presence of the dmg. The ability of the dmg to enhance or block this interaction could then be measured.
  • This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of drug screening techniques.
  • the polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly.
  • One method of dmg screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Dmgs are screened against such transformed cells in competitive binding assays. One may measure, for example, the formulation of complexes between the agent being tested and a polypeptide of the present invention.
  • the present invention provides methods of screening for dmgs or any other agents which affect activities mediated by the polypeptides of the present invention. These methods comprise contacting such an agent with a polypeptide of the present invention or a fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art.
  • the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the present invention.
  • Another technique for dmg screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the present invention, and is described in great detail in European Patent Application 84/03564, published on September 13, 1984, which is inco ⁇ orated herein by reference herein.
  • large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface.
  • the peptide test compounds are reacted with polypeptides of the present invention and washed. Bound polypeptides are then detected by methods well known in the art. Purified polypeptides are coated directly onto plates for use in the aforementioned drug screening techniques.
  • non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.
  • This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding polypeptides of the present invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.
  • antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ED NO3 or SEQ LD NO:3, or the complementary strand thereof, and/or to nucleotide sequences contained in the clones deposited as ATCC Nos:75848 or 75849.
  • antisense sequence is generated internally, by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).
  • Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation.
  • Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 10-1573 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
  • a pair of oligonucleotides for a given antisense RNA is produced as follows: A sequence complimentary to the first 15 bases of the open reading frame is flanked by an EcoRI site on the 5' end and a Hindlll site on the 3' end. Next, the pair of oligonucleotides is heated at 90°C for one minute and then annealed in 2X ligation buffer (20mM TRIS HCl pH 7.5, lOmM MgC12, 10MM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the EcoRl Hind III site of the retroviral vector PMV7 (WO 91/15580).
  • 2X ligation buffer 20mM TRIS HCl pH 7.5, lOmM MgC12, 10MM dithiothreitol (DTT) and 0.2 mM ATP
  • the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length.
  • a DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor.
  • the antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
  • the chemokine antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence.
  • a vector or a portion thereof is transcribed, producing an antisense nucleic acid (RNA) of the invention.
  • RNA antisense nucleic acid
  • Such a vector would contain a sequence encoding the chemokine antisense nucleic acid.
  • Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA.
  • Such vectors can be constructed by recombinant DNA technology methods standard in the art.
  • Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding a chemokine of the invention, or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells.
  • Such promoters can be inducible or constitutive.
  • Such promoters include, but are not limited to, the SV40 early promoter region (Bemoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma vims (Yamamoto et al., Cell 22:787-797 (1980), the he ⁇ es thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc.
  • the antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a chemokine gene.
  • absolute complementarity although preferred, is not required.
  • a sequence "complementary to at least a portion of an RNA,” referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded chemokine antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed.
  • the ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid.
  • the larger the hybridizing nucleic acid the more base mismatches with a chemokine RNA it may contain and still form a stable duplex (or triplex as the case may be).
  • One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
  • Oligonucleotides that are complementary to the 5' end of the message should work most efficiently at inhibiting translation.
  • sequences complementary to the 3 ' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335.
  • oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of CK ⁇ -4 or Ck ⁇ -10 shown in Figure 1 (SEQ ED NO3) or Figure 2 (SEQ ED NO:3) respectively could be used in an antisense approach to inhibit translation of endogenous chemokine mRNA.
  • Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon.
  • Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention.
  • antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
  • the polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded.
  • the oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc.
  • the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A.
  • the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc.
  • the antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
  • the antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
  • the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
  • the antisense oligonucleotide is an a-anomeric oligonucleotide.
  • An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641).
  • the oligonucleotide is a 2'-0- methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
  • Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.).
  • an automated DNA synthesizer such as are commercially available from Biosearch, Applied Biosystems, etc.
  • phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209)
  • methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
  • antisense nucleotides complementary to a chemokine coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
  • Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 247: 1222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy chemokine mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG- 3'.
  • hammerhead ribozymes The constmction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of
  • the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the chemokine mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of nonfunctional mRNA transcripts.
  • the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express a chemokine of the invention in vivo.
  • DNA constmcts encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA.
  • a preferred method of delivery involves using a DNA constmct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous chemokine messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
  • Potential antagonists include antibodies, or in some cases, oligonucleotides, which bind to the polypeptides.
  • Another example of a potential antagonist is a negative dominant mutant of the polypeptides. Negative dominant mutants are polypeptides which bind to the receptor of the wild-type polypeptide, but fail to retain biological activity.
  • An assay to detect negative dominant mutants of the polypeptides include an in vitro chemotaxis assay wherein a multiwell chemotaxis chamber equipped with polyvinylpyrrolidone-free polycarbonate membranes is used to measure the chemoattractant ability of the polypeptides for leukocytes in the presence and absence of potential antagonist/inhibitor or agonist molecules.
  • Another potential antagonist is a peptide derivative of the polypeptides which are naturally or synthetically modified analogs of the polypeptides that have lost biological function yet still recognize and bind to the receptors of the polypeptides to thereby effectively block the receptors. Examples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules.
  • Antagonist/agonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor formation or growth.
  • the antagonist agonist may also be employed to prevent hyper-vascular diseases, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the present invention may also be desirous in cases such as restenosis after balloon angioplasty.
  • the antagonist/agonist may also be employed to prevent the growth of scar tissue during wound healing.
  • the antagonist/agonist may also be employed to treat the diseases described herein.
  • the invention provides a method of treating or preventing diseases, disorders, and/or conditions, including but not limited to the diseases, disorders, and/or conditions listed throughout this application, associated with overexpression of a polynucleotide of the present invention by administering to a patient (a) an antisense molecule directed to the polynucleotide of the present invention, and/or (b) a ribozyme directed to the polynucleotide of the present invention.
  • the antagonists may be employed to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and some T cell subsets, e.g., activated and CD8+ cytotoxic T cells and natural killer cells, in auto- immune and chronic inflammatory and infective diseases.
  • auto-immune diseases include rheumatoid arthritis, multiple sclerosis, and insulin-dependent diabetes.
  • Some infectious diseases include silicosis, sarcoidosis, idiopafhic pulmonary fibrosis by preventing the recmitment and activation of mononuclear phagocytes, idiopathic hyper- eosinophilic syndrome by preventing eosinophil production and migration, endotoxic shock by preventing the migration of macrophages and their production of the chemokine polypeptides of the present invention.
  • the antagonists may also be used for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Human chemokine Beta-10 polypeptides and DNA (RNA) encoding such chemokine polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed are methods for utilizing such chemokine polypeptides for the treatment of leukemia, tumors, chronic infections, autoimmune disease, fibrotic disorders, wound healing and psoriasis. Antagonists against such chemokine polypeptides and their use as a therapeutic to treat rheumatoid arthritis, autoimmune and chronic inflammatory and infective diseases, allergic reactions, prostaglandin-independent fever and bone marrow failure are also disclosed.

Description

Human Chemokine Beta-10 Mutant Polypeptides
Field of the Invention
The present invention relates to deletion and substitution mutant polypeptides of human chemokine beta- 10 (Ckβ-10), as well as nucleic acid molecules encoding such polypeptides and processes for producing such polypeptides using recombinant techniques. In one aspect, the invention also relates to uses of the full-length and mature forms of
Ckβ-10, as well as deletion and substitution mutants, in medical treatment regimens. In particular, the Ckβ- 10 polypeptides described herein may be employed to treat a variety of conditions, including rheumatoid arthritis, inflammation, respiratory diseases, allergy, and IgE-mediated allergic reactions. Ckβ-10 is also known as MCP-4.
Background of Invention
Chemokines, also referred to as intercrine cytokines, are a subfamily of structurally and functionally related cytokines. These molecules are 8-14 kd in size. In general chemokines exhibit 20% to 75% homology at the amino acid level and are characterized by four conserved cysteine residues that form two disulfide bonds. Based on the arrangement of the first two cysteine residues, chemokines have been classified into two subfamilies, alpha and beta. In the alpha subfamily, the first two cysteines are separated by one amino acid and hence are referred to as the "C— X— C" subfamily. In the beta subfamily, the two cysteines are in an adjacent position and are, therefore, referred to as the — C— C— subfamily. Thus far, at least eight different members of this family have been identified in humans.
The intercrine cytokines exhibit a wide variety of functions. A hallmark feature is their ability to elicit chemotactic migration of distinct cell types, including monocytes, neutrophils, T lymphocytes, basophils and fibroblasts. Many chemokines have proinflammatory activity and are involved in multiple steps during an inflammatory reaction. These activities include stimulation of histamine release, lysosomal enzyme and leukotriene release, increased adherence of target immune cells to endothelial cells, enhanced binding of complement proteins, induced expression of granulocyte adhesion molecules and complement receptors, and respiratory burst. In addition to their involvement in inflammation, certain chemokines have been shown to exhibit other activities. For example, macrophage inflammatory protein I (MIP- 1) is able to suppress hematopoietic stem cell proliferation, platelet factor-4 (PF-4) is a potent inhibitor of endothelial cell growth, Interleukin-8 (IL-8) promotes proliferation of keratinocytes, and GRO is an autocrine growth factor for melanoma cells. In light of the diverse biological activities, it is not surprising that chemokines have been implicated in a number of physiological and disease conditions, including lymphocyte trafficking, wound healing, hematopoietic regulation and immunological disorders such as allergy, asthma and arthritis. An example of a hematopoietic lineage regulator is MIP-1. MIP-1 was originally identified as an endotoxin-induced proinflammatory cytokine produced from macrophages. Subsequent studies have shown that MIP-1 is composed of two different, but related, proteins MlP-lα and MlP-lβ. Both MlP-lα and MIP- lβ are chemo-attractants for macrophages, monocytes and T lymphocytes. Interestingly, biochemical purification and subsequent sequence analysis of a multipotent stem cell inhibitor (SCI) revealed that SCI is identical to MlP-lβ. Furthermore, it has been shown that MlP-lβ can counteract the ability of MlP-lα to suppress hematopoietic stem cell proliferation. This finding leads to the hypothesis that the primary physiological role of MIP-1 is to regulate hematopoiesis in bone marrow, and that the proposed inflammatory function is secondary. The mode of action of MlP-lα as a stem cell inhibitor relates to its ability to block the cell cycle at the G2S interphase. Furthermore, the inhibitory effect of MlP-lα seems to be restricted to immature progenitor cells and it is actually stimulatory to late progenitors in the presence of granulocyte macrophage-colony stimulating factor (GM-CSF).
Murine MIP-1 is a major secreted protein from lipopolysaccharide stimulated RAW 264.7, a murine macrophage tumor cell line. It has been purified and found to consist of two related proteins, MlP-lα and MIP- 1 β. Several groups have cloned what are likely to be the human homologs of MlP-lα and
MlP-lβ. In all cases, cDNAs were isolated from libraries prepared against activated T-cell
RNA.
MIP-1 proteins can be detected in early wound inflammation cells and have been shown to induce production of IL-1 and IL-6 from wound fibroblast cells. In addition, purified native MIP-1 (comprising MIP-1, MlP-lα and MlP-lβ polypeptides) causes acute inflammation when injected either subcutaneously into the footpads of mice or intracistemally into the cerebrospinal fluid of rabbits (Wolpe and Cerami, FASEB J . 3:2565-73 (1989)). In addition to these proinflammatory properties of MIP-1, which can be direct or indirect, MIP-1 has been recovered during the early inflammatory phases of wound healing in an experimental mouse model employing sterile wound chambers (Fahey, et al. Cytokine, 2:92 (1990)). For example, Intemational Patent Application Serial No. PCT/US92/05198 filed by Chiron Corporation, discloses a DNA molecule which is active as a template for producing mammalian macrophage inflammatory proteins (MIPs) in yeast. The murine MlP-lα and MlP-lβ are distinct but closely related cytokines. Partially purified mixtures of the two proteins affect neutrophil function and cause local inflammation and fever. MlP-lα has been expressed in yeast cells and purified to homogeneity. Structural analysis confirmed that MlP-lα has a very similar secondary and tertiary structure to platelet factor 4 (PF-4) and interleukin 8 (IL-8) with which it shares limited sequence homology. It has also been demonstrated that MlP-lα is active in vivo to protect mouse stem cells from subsequent in vitro killing by tritiated thymidine. MlP-lα was also shown to enhance the proliferation of more committed progenitor granulocyte macrophage colony-forming cells in response to granulocyte macrophage colony-stimulating factor. (Clemens, J.M. et al., Cytokine 4:76-82 (1992)). There are three forms of monocyte chemotactic protein, namely, MCP-1, MCP-2 and MCP-3. All of these proteins have been structurally and functionally characterized and have also been cloned and expressed. MCP-1 and MCP-2 have the ability to attract leukocytes (monocytes, and leukocytes), while MCP-3 also attracts eosinophils and T lymphocytes (Dahinderi, E., et al., J. Exp. Med. 179:751-756 (1994)). Human MCP-1 is a basic peptide of 76 amino acids with a predicted molecular mass of 8,700 daltons. MCP-1 is inducibly expressed mainly in monocytes, endothelial cells and fibroblasts. Leonard, E.J. and Yoshimura, T., Immunol. Today 11:97-101 (1990). The factors which induce this expression is IL-1, TNF or lipopolysaccharide treatment.
Other properties of MCP-1 include the ability to strongly activate mature human basophils in a pertussis toxin-sensitive manner. MCP-1 is a cytokine capable of directly inducing histamine release by basophils, (Bischoff, S.C., et al., J. Exp. Med. 175:1271-1275 (1992)). Furthermore, MCP-1 promotes the formation of leukotriene C4 by basophils pretreated with Interleukin 3, Interleukin 5, or granulocyte/macrophage colony-stimulating factor. MCP-1 induced basophil mediator release may play an important role in allergic inflammation and other pathologies expressing MCP-1.
Clones having a nucleotide sequence encoding a human monocyte chemotactic and activating factor (MCAF) reveal the primary structure of the MCAF polypeptide to be composed of a putative signal peptide sequence of 23 amino acid residues and a mature MCAF of 76 amino acid residues. Furutani, Y.H., et al., Biochem. Biophys. Res. Commu. 159:249-55 (1989). The complete amino acid sequence of human glioma-derived monocyte chemotactic factor (GDCF-2) has also been determined. This peptide attracts human monocytes but not neutrophils. It was established that GDCF-2 comprises 76 amino acid residues. The peptide chain contains 4 half-cysteines, at positions 11, 12, 36 and 52, which create a pair of loops, clustered at the disulfide bridges. Further, the MCP-1 gene has been designated to human chromosome 17. Mehrabian, M.R., et al., Genomics 9:200-3 (1991).
Certain data suggests that a potential role for MCP-1 is mediating monocytic infiltration of the artery wall. Monocytes appear to be central to atherogenesis both as the progenitors of foam cells and as a potential source of growth factors mediating intimal hyperplasia. Nelken, N.A., et al., J. Clin. Invest. 88: 1 121-7 (1991). It has also been found that synovial production of MCP-1 may play an important role in the recruitment of mononuclear phagocytes during inflammation associated with rheumatoid arthritis and that synovial tissue macrophages are the dominant source of this cytokine. MCP-1 levels were found to be significantly higher in synovial fluid from rheumatoid arthritis patients compared to synovial fluid from osteoarthritis patients or from patients with other arthritides. Koch, A.E., et al., J. Clin. Invest. 90:772-9 (1992).
MCP-2 and MCP-3 are classified in a subfamily of proinflammatory proteins and are functionally related to MCP-1 because they specifically attract monocytes, but not neutrophils. Van Damme, J., et al., J. Exp. Med. 176:59-65 (1992). MCP-3 shows 71 % and 58% amino acid homology to MCP-1 and MCP-2 respectively. MCP-3 is an inflammatory cytokine that regulates macrophage functions.
The transplantation of hemolymphopoietic stem cells has been proposed in the treatment of cancer and hematological disorders. Many studies demonstrate that transplantation of hematopoietic stem cells harvested from the peripheral blood has advantages over the transplantation of marrow-derived stem cells. Due to the low number of circulating stem cells, there is a need for induction of pluripotent marrow stem cell mobilization into the peripheral blood. Reducing the amount of blood to be processed to obtain an adequate amount of stem cells would increase the use of autotransplantation procedures and eliminate the risk of graph versus host reaction connected with allotransplantation. Presently, blood mobilization of marrow CD34+ stem cells is obtained by the injection of a combination of agents, including antiblastic drugs and G-CSF or GM-CSF. Drugs which are capable of stem cell mobilization include IL-1, IL-7, IL-8, and
MlP-lα. Both IL-1 and IL-8 demonstrate proinflammatory activity that may be dangerous for good engrafting. IL-7 must be administered at high doses over a long duration and
MlP-lα is not very active as a single agent and shows best activity when in combination with G-CSF.
Summary of the Invention
This invention relates to newly identified polynucleotides, polypeptides encoded by such polynucleotides, the use of such polynucleotides and polypeptides, as well as the production of such polynucleotides and polypeptides. More particularly, the polypeptides of the present invention are human chemokine beta-4 (also referred to as "Ckβ-4") and human chemokine monocyte chemotactic protein (referred to as "MCP-4," and also known and referred to as human chemokine beta-10 and "Ckβ-10"), which, collectively, are referred to as "the chemokine polypeptides". The invention also relates to inhibiting the action of such polypeptides. The immune cells which are responsive to the chemokines have a vast number of in vivo functions and therefore their regulation by such chemokines is an important area in the treatment of disease.
For example, eosinophils destroy parasites to lessen parasitic infection. Eosinophils are also responsible for chronic inflammation in the airways of the respiratory system. Macrophages are responsible for suppressing tumor formation in vertebrates. Further, basophils release histamine which may play an important role in allergic inflammation.
Accordingly, promoting and inhibiting such cells, has wide therapeutic application.
In accordance with one aspect of the present invention, there are provided novel polypeptides which are Ckβ-4, and MCP-4 (also referred to as Ckβ-10), as well as fragments, analogs and derivatives thereof. The polypeptides of the present invention are of human origin.
In accordance with another aspect of the present invention, there are provided polynucleotides (DNA or RNA) which encode such polypeptides.
In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptides by recombinant techniques. In one aspect, the present invention provides deletion and substitution mutants of human chemokine Ckβ-10, as well as biologically active and diagnostically or therapeutically useful derivatives thereof.
In accordance with another aspect of the present invention, there are provided isolated nucleic acid molecules encoding polypeptides of the present invention including mRNAs, DNAs, cDNAs, genomic DNAs, as well as analogs and biologically active and diagnostically or therapeutically useful fragments, analogs and derivatives thereof.
The present invention further provides isolated nucleic acid molecules comprising polynucleotides which encode mutants of the Ckβ-10 polypeptide having the amino acid sequence shown in Figure 2 (SEQ ID NO:4) or the amino acid sequence encoded by the cDNA clone deposited as ATCC Deposit Number 75849 on July 29, 1994. The nucleotide sequence determined by sequencing the deposited Ckβ-10 clone, which is shown in Figure 2
(SEQ ID NO:3), contains an open reading frame encoding a polypeptide of 98 amino acid residues, with a leader sequence of about 23 amino acid residues. The amino acid sequence of full-length and mature forms of the Ckβ-10 protein is also shown in Figure 2 (SEQ ID
NO:4).
Thus, one aspect of the invention provides an isolated nucleic acid molecule comprising a polynucleotide having a nucleotide sequence selected from the group consisting of: (a) a nucleotide sequence encoding an N-terminal deletion mutant of the Ckβ-10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the N-terminus; (b) a nucleotide sequence encoding an C-terminal deletion mutant of the Ckβ-10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the C-terminus; (c) a nucleotide sequence encoding a deletion mutant of the Ckβ-10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the N and C-termini; (d) a nucleotide sequence encoding an N-terminal deletion mutant of the Ckβ-10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the N-terminus; (e) a nucleotide sequence encoding a C-terminal deletion mutant of the Ckβ-10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the
C-terminus; (f) a nucleotide sequence encoding a deletion mutant of the Ckβ-10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the N- and C-termini; and (g) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e) or (f) above.
Further embodiments of the invention include isolated nucleic acid molecules that comprise a polynucleotide having a nucleotide sequence at least 90% homologous or identical, and more preferably at least 95%, 96%, 97%, 98%, or 99% identical, to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f) or (g), above, or a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide in (a), (b), (c), (d), (e), (f) or (g), above. These polynucleotides which hybridize do not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
The Ckβ-10 deletion mutant polypeptides encoded by each of the above nucleic acid molecules may have an N-terminal methionine residue.
The present invention also relates to recombinant vectors, which include the isolated nucleic acid molecules of the present invention, and to host cells containing the recombinant vectors, as well as to methods of making such vectors and host cells.
In accordance with yet a further aspect of the present invention, there is provided a process for producing such polypeptide by recombinant techniques comprising culturing recombinant prokaryotic and/or eukaryotic host cells, containing a nucleic acid sequence encoding a polypeptide of the present invention, under conditions promoting expression of said protein and subsequent recovery of said protein.
The invention further provides an isolated Ckβ-10 polypeptide having an amino acid sequence selected from the group consisting of: (a) the amino acid sequence of an N-terminal deletion mutant of the Ckβ-10 polypeptide having the complete amino acid sequence in
Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the N-terminus; (b) the amino acid sequence of an C-terminal deletion mutant of the Ckβ-10 polypeptide having the complete amino acid sequence in Figure 2 (SEQ LD NO:4), wherein said deletion mutant has one or more deletions at the C-terminus; (c) the amino acid sequence of a deletion mutant of the Ckβ-10 polypeptide having the complete amino acid sequence in
Figure 2 (SEQ ID NO: 4), wherein said deletion mutant has one or more deletions at the N- and C-termini; (d) the amino acid sequence of an N-terminal deletion mutant of the Ckβ-10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the N-terminus; (e) the amino acid sequence of a C-terminal deletion mutant of the Ckβ-10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the C-terminus; and (f) the amino acid sequence of the Ckβ-10 polypeptide encoded by the cDNA clone contained in ATCC Deposit No. 75849, wherein said deletion mutant has one or more deletions at the N- and C-termini.
Polypeptides of the present invention also include homologous polypeptides and substitution mutants having an amino acid sequence with at least 90% identity, and more preferably at least 95% identity to those described in (a), (b), (c), (d), (e) or (f) above, as well as polypeptides having an amino acid sequence at least 80% identical, more preferably at least 90% identical, and still more preferably 95%, 96%, 97%, 98% or 99% identical to those above. An additional embodiment of this aspect of the invention relates to a peptide or polypeptide which has the amino acid sequence of an epitope bearing portion of a Ckβ-10 polypeptide having an amino acid sequence described in (a), (b), (c), (d), (e) or (f) above.
An additional nucleic acid embodiment of the invention relates to an isolated nucleic acid molecule comprising a polynucleotide which encodes the amino acid sequence of an epitope-bearing portion of a Ckβ-10 polypeptide having an amino acid sequence in (a), (b),
(c), (d), (e) or (f), above.
Further, each of the above Ckβ-10 polypeptide deletion mutants may have an
N-terminal methionine which may or may not be encoded by the nucleotide sequence shown in SEQ ID NO:3. The present invention also provides, in another aspect, pharmaceutical compositions comprising a Ckβ-10 polynucleotide, probe, vector, host cell, polypeptide, fragment, variant, derivative, epitope bearing portion, antibody, antagonist or agonist.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptide, or polynucleotide encoding such polypeptide for therapeutic purposes, for example, for treating rheumatoid arthritis, inflammation, respiratory diseases, allergy, and IgE-mediated allergic reactions.
An additional aspect of the invention is related to a method for treating an individual in need of an increased level of Ckβ-10 activity in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an isolated Ckβ-10 polypeptide.
A still further aspect of the invention is related to a method for treating an individual in need of a decreased level of Ckβ-10 activity in the body comprising, administering to such an individual a composition comprising a therapeutically effective amount of a Ckβ-10 antagonist of the invention. Such antagonists include the full-length and mature Ckβ-10 polypeptides shown in Figure 2 (SEQ LD NO:4), as well as Ckβ-10 fragments (e.g., a
Ckβ-10 fragment having amino acids 27 to 98 in SEQ ID NO:4).
In accordance with yet a further aspect of the present invention, there are provided antibodies against Ckβ-10 polypeptides. In another embodiment, the invention provides an isolated antibody that binds specifically to a Ckβ-10 polypeptide having an amino acid sequence described in (a), (b), (c), (d), (e) or (f) above.
The invention further provides methods for isolating antibodies that bind specifically to a Ckβ-10 polypeptide having an amino acid sequence as described herein.
In accordance with another aspect of the present invention, there are provided agonists of Ckβ-10 polypeptide activities which mimic the polypeptide of the present invention and thus have one or more Ckβ-10 polypeptide activity.
In accordance with yet another aspect of the present invention, there are provided chemokine antagonists. These chemokine antagonists may be used to inhibit the action of chemokines, for example, in the treatment of rheumatoid arthritis, inflammation, respiratory diseases, allergy, and IgE-mediated allergic reactions.
In accordance with yet a further aspect of the present invention, there is also provided nucleic acid probes comprising nucleic acid molecules of sufficient length to specifically hybridize to a nucleic acid sequence of the present invention.
The present invention also provides a screening method for identifying compounds capable of enhancing or inhibiting a cellular response induced by a chemokine polypeptide. This method involves contacting cells which express a receptor to which a chemokine polypeptide binds with the candidate compound, assaying a cellular response induced by the chemokine polypeptide, and comparing the cellular response to a standard cellular response, the standard being assayed when contact is made in absence of the candidate compound; whereby, an increased cellular response over the standard indicates that the compound is an agonist and a decreased cellular response over the standard indicates that the compound is an antagonist. The above referenced receptor will generally be one which binds a chemokine other than Ckβ-10, wherein the activity induced by this other chemokine is inhibited by the candidate compound. Often this candidate compound will be a Ckβ-10 polypeptide. In accordance with yet a further aspect of the present invention, there is provided a process for utilizing such polypeptides, or polynucleotides encoding such polypeptides for therapeutic purposes, for example, to treat solid tumors, chronic infections, auto-immune diseases, psoriasis, asthma, allergy, to regulate hematopoiesis, and to promote wound healing. In accordance with yet a further aspect of the present invention, there are provided antibodies against such polypeptides.
In accordance with yet another aspect of the present invention, there are provided antagonist/inhibitors to such polypeptides, which may be used to inhibit the action of such polypeptides, for example, in the treatment of auto-immune diseases, chronic inflammatory and infective diseases, histamine-mediated allergic reactions, prostaglandin-independent fever, bone marrow failure, silicosis, sarcoidosis, hyper-eosinophilic syndrome and lung inflammation.
These and other aspects of the present invention should be apparent to those skilled in the art from the teachings herein.
BRIEF DESCRIPTION OF THE FIGURES
The following drawings are illustrative of embodiments of the invention and are not meant to limit the scope of the invention as encompassed by the claims.
FIGURE 1 displays the cDNA sequence (SEQ LD NO: l) and corresponding deduced amino acid sequence (SEQ LD NO:2) of Ckβ-4. The initial 24 amino acids represent the deduced leader sequence of Ckβ-4 such that the putative mature polypeptide comprises 70 amino acids. The standard one-letter abbreviation for amino acids is used.
FIGURE 2 displays the cDNA sequence (SEQ LD NO:3) and corresponding deduced amino acid sequence (SEQ ID NO:4) of MCP-4 (also referred to as Ckβ-10). The initial 23 amino acids represent the putative leader sequence of MCP-4 (Ckβ-10) such that the putative mature polypeptide comprises 75 amino acids. As noted in Figure 5, however, there are several amino terminal ends of MCP-4 produced in cells, represented by arrows in Figure 1 , as shown in Figure 5 and as discussed herein. In addition several carboxyl termini have been observed in certain forms of MCP-4 and produced in cells; shown in Figure 5 and discussed herein. The standard one-letter abbreviation for amino acids is used.
FIGURE 3 displays the amino acid sequence homology between Ckβ-4 and the mature peptide of eotaxin (SEQ ID NO: 17) (bottom). The standard one-letter abbreviation for amino acids is used.
FIGURE 4 displays the amino acid sequence homology between human MCP-4 (Ckβ-10) (top) and human MCP-3 (SEQ ID NO: 18) (bottom). The standard one-letter abbreviation for amino acids is used.
FIGURE 5 shows the amino acid sequences of several different forms of MCP-4 (Ckβ-10)
(SEQ LD NO:4) isolated by expression in vitro. Bacl, 2 and 3 show sequences of three NH2-terminal variants of MCP-4 expressed using baculovirus. Drol, 2 and 3+ show sequences of MCP-4 isolated by expression of MCP-4 cDNA in Drosophila cells in vitro. The figure also shows an homology comparison of the full length MCP-4 sequence with sequences of MCP-3 (SEQ ID NO: 19) and eotaxin (SEQ LD NO:20). Identical residues are indicated by vertical lines.
FIGURE 6 is a pair of graphs showing (A) release of N-acetyl-β-D-glucosaminidase from cytochalasin B-treated human blood monocytes in response to MCP-4 (Ckβ-10), Eotaxin, MCP-1, MCP-2, MCP-3 and RANTES, and (B) migration index of cytochalasin B-treated monocytes in response to MCP-4 (Ckβ-10), MCP-1, MCP-3 and a negative control. Enzyme activity is presented on a linear scale of arbitrary fluorescence units along the vertical axis in (A). Relative migration index is presented on a linear scale on the vertical axis in (B) Chemokine concentration in nM is presented in both graphs on a log scale along the horizontal axis.
As discussed in the examples below, cell migration was measured in 48 well chemotaxis chambers. The migrating cells were counted in five high power fields. The migration is expressed as migration index (mean of migrated cells/mean of migrated cells in absence of added chemokine). Each point is the average of three replicate cultures. The bar shows the standard deviation about the avera *gCe for the three cultures.
FIGURE 7 is a set of graphs showing migration of CD4+ and CD8+ T-lymphocytes in response to various concentrations of MCP-4 (Ckβ-10), Eotaxin, MCP-1, MlP-lα and a negative control. Upper graphs show migration of CD4+ T-lymphocytes. Lower graphs show migration of CD8+ T-lymphocytes. In both upper and lower pairs the left graph shows migration in response to MCP-1, MlP-lα and a negative control and the right graph shows migration in response to MCP-4 (Ckβ-10), Eotaxin. Number of migrating cells is indicted on a linear scale along the vertical axis. Chemokine concentrations in the attractant media are indicated in nM on a log scale along the horizontal axis.
As discussed in the examples below, cell migration was measured in 48 well chemotaxis chambers. The migrating cells were counted in five high power fields. The migration is expressed as migration index (mean of migrated cells/mean of migrated cells in absence of added chemokine). Each point is the average of three replicate cultures. The bar shows the standard deviation about the average for the three cultures.
FIGURE 8 provides a pair of graphs showing the migration of human eosinophils in response to a negative control, 100 nM MCP-1, 100 nM MCP-3 and several concentration of
MCP-4 (Ckβ-10) and Eotaxin. Migration index is indicted on a linear scale along the vertical axis. Chemokine concentrations in the attractant media are indicated in nM on a log scale along the horizontal axis.
As discussed in the examples below, cell migration was measured in 48 well chemotaxis chambers. The migrating cells were counted in five high power fields. The migration is expressed as migration index (mean of migrated cells/mean of migrated cells in absence of added chemokine). Each point is the average of three replicate cultures. The bar shows the standard deviation about the average for the three cultures.
FIGURE 9 is a graph showing survival of cortical neuronal cells cultured in the presence of various concentrations of Ckβ-4, Basic FGF and HG0100. The number of viable cell counts are indicted on a linear scale along the vertical axis, in terms of calcein emission. Concentrations of the factors in the growth medium are indicated in ng/ml on a log scale along the horizontal axis. Each point is the average of six replicate cultures. The bar shows the standard error of the mean about the average for the six cultures.
FIGURE 10 is a graph showing neurite outgrowth of cortical neurons cultured in the presence of various concentrations of Ckβ-4, Basic FGF and HG0100. Neurite outgrowth is indicted on a linear scale along the vertical axis, in terms of neurofilament protein measured optical density at 490 nm (OD490). Concentrations of the factors in the growth medium are indicated in ng/ml on a log scale along the horizontal axis. Each point is the average of six replicate cultures. The bar shows the standard error of the mean about the average for the six cultures.
FIGURE 1 1 is a graph showing chemotaxis of peripheral blood lymphocytes in response to cultured in the presence of various concentrations of Ckβ-4 and MCP- 1. In each graph chemotaxis is indicted on a linear scale along the vertical axis, in terms of ratio of fluorescence emission at 530 nm stimulated by 485 nm excitation. Concentrations of the factors in the growth medium are indicated in ng/ml on a log scale along the horizontal axis. Each point is the average of several; replicate cultures. The bar shows the standard error of the mean about the average for the cultures. FIGURE 12 shows the N-terminal deletion variants of Ckβ-10 (SEQ ID
NO:4). Constructs 1 through 7 were tested as described in Examples 16 and 17.
FIGURE 13 shows an analysis of the Ckβ-10 amino acid sequence (SEQ ID NO:4).
Alpha, beta, turn and coil regions; hydrophilicity and hydrophobicity; amphipathic regions; flexible regions; antigenic index and surface probability are shown, and all were generated using the default settings. In the "Antigenic Index or Jameson-Wolf graph, the positive peaks indicate locations of the highly antigenic regions of the Ckβ-10 protein, i.e., regions from which epitope-bearing peptides of the invention can be obtained. The domains defined by these graphs are contemplated by the present invention.
The data presented in Figure 13 are also represented in tabular form in Table I. The columns are labeled with the headings "Res", "Position", and Roman Numerals I-XIV. The column headings refer to the following features of the amino acid sequence presented in Figure 13, and Table I: "Res": amino acid residue of SEQ LD NO:4 and Figure 2; "Position": position of the corresponding residue within SEQ LD NO:4 and Figure 2; I: Alpha, Regions - Garnier-Robson; II: Alpha, Regions - Chou-Fasman; III: Beta, Regions - Garnier-Robson; IN: Beta, Regions - Chou-Fasman; V: Turn, Regions - Garnier-Robson; VI: Turn, Regions - Chou-Fasman; VII: Coil, Regions - Garnier-Robson; VLTJ: Hydrophilicity Plot - Kyte-Doolittle; IX: Hydrophobicity Plot - Hopp- Woods; X: Alpha, Amphipathic Regions - Eisenberg; XI: Beta, Amphipathic Regions - Eisenberg; XII: Flexible Regions - Karplus-Schulz; XIII: Antigenic Index - Jameson-Wolf; and XIV: Surface Probability Plot - Emini.
FIGURE 14 shows the effect of wild type and Ν-terminal deletion mutants of Ckβ-10 on calcium mobilization in eosinophils.
FIGURE 15 shows the effect of wild type and Ν-terminal deletion mutants of Ckβ-10 on eosinophil chemotaxis.
Detailed Description
Definitions The following definitions are provided to facilitate understanding of certain terms used throughout this specification. The polypeptides and polynucleotides of the present invention are preferably provided in an isolated form, and preferably are purified to homogeneity.
The term "isolated" means that the material is removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, a naturally-occurring polynucleotide or polypeptide present in a living animal is not isolated, but the same polynucleotide or polypeptide, separated from some or all of the coexisting materials in the natural system, is isolated. Such polynucleotides could be part of a vector and/or such polynucleotides or polypeptides could be part of a composition, or could be contained within a cell, and still be isolated in that such vector or composition, or particular cell is not part of its original natural environment. The term "isolated" does not refer to genomic or cDNA libraries, whole cell total or mRNA preparations, genomic DNA preparations (including those separated by electrophoresis and transferred onto blots), sheared whole cell genomic DNA preparations or other compositions where the art demonstrates no distinguishing features of the polynucleotide/sequences of the present invention.
In the present invention, a "secreted" Ckβ-4 or Ckβ-10 protein refers to a protein capable of being directed to the ER, secretory vesicles, or the extracellular space as a result of a signal sequence, as well as a Ckβ-4 or Ckβ-10 protein released into the extracellular space without necessarily containing a signal sequence. If the Ckβ-4 or Ckβ-10 secreted protein is released into the extracellular space, the Ckβ-4 or Ckβ-10 secreted protein can undergo extracellular processing to produce a "mature" Ckβ-4 or Ckβ-10 protein. Release into the extracellular space can occur by many mechanisms, including exocytosis and proteolytic cleavage.
As used herein, a Ckβ-4 "polynucleotide" refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: 1 or the cDNA contained within the clone deposited with the ATCC. Similarly, a Ckβ-10 "polynucleotide" refers to a molecule having a nucleic acid sequence contained in SEQ ID NO: 3 or the cDNA contained within the clone deposited with the ATCC. For example, the Ckβ-4 or Ckβ-10 polynucleotide can contain the nucleotide sequence of the full length cDNA sequence, including the 5' and 3' untranslated sequences, the coding region, with or without the signal sequence, the secreted protein coding region, as well as fragments, epitopes, domains, and variants of the nucleic acid sequence. Moreover, as used herein, a Ckβ-4 or Ckβ-10 "polypeptide" refers to a molecule having the translated amino acid sequence generated from the polynucleotide as broadly defined.
In specific embodiments, the polynucleotides of the invention are at least 15, at least 30, at least 50, at least 100, at least 125, at least 500, or at least 1000 continuous nucleotides but are less than or equal to 300 kb, 200 kb, 100 kb, 50 kb, 15 kb, 10 kb, 7.5kb, 5 kb, 2.5 kb, 2.0 kb, or 1 kb, in length. In a further embodiment, polynucleotides of the invention comprise a portion of the coding sequences, as disclosed herein, but do not comprise all or a portion of any intron. In another embodiment, the polynucleotides comprising coding sequences do not contain coding sequences of a genomic flanking gene (i.e., 5' or 3' to the
Ckβ-4 or Ckβ-10 gene of interest in the genome). In other embodiments, the polynucleotides of the invention do not contain the coding sequence of more than 1000, 500, 250, 100, 50, 25, 20, 15, 10, 5, 4, 3, 2, or 1 genomic flanking gene(s). In the present invention, the full length Ckβ-4 sequence identified as SEQ ID NO:l was generated by overlapping sequences of the deposited clone (contig analysis). A representative clone containing all or most of the sequence for SEQ LD NO: 1 was deposited with the American Type Culture Collection ("ATCC") on July 29, 1994, and was given the
ATCC Deposit Number 75848. Additionally, the full length Ckβ-10 sequence identified as SEQ ID NO:3 was generated by overlapping sequences of the deposited clone (contig analysis). A representative clone containing all or most of the sequence for SEQ LD NO: 3 was deposited with the American Type Culture Collection ("ATCC") on July 29, 1994, and was given the ATCC Deposit Number 75849. The ATCC is located at 10801 University Boulevard, Manassas, VA 20110-2209, USA. The ATCC deposit was made pursuant to the terms of the Budapest Treaty on the international recognition of the deposit of microorganisms for purposes of patent procedure.
A Ckβ-4 or Ckβ-10 "polynucleotide" also includes those polynucleotides capable of hybridizing, under stringent hybridization conditions, to sequences contained in SEQ JD NO:l or SEQ ID NO:3, the complement thereof, or the cDNA within the deposited clones. "Stringent hybridization conditions" refers to an overnight incubation at 42 degree C in a solution comprising 50% formamide, 5x SSC (750 mM NaCl, 75 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5x Denhardt's solution, 10% dextran sulfate, and 20 μg/ml denatured, sheared salmon sperm DNA, followed by washing the filters in O.lx SSC at about 65 degree C. Also contemplated are nucleic acid molecules that hybridize to the Ckβ-4 or Ckβ-10 polynucleotides under lower stringency hybridization conditions. Changes in the stringency of hybridization and signal detection are primarily accomplished through the manipulation of formamide concentration (lower percentages of formamide result in lowered stringency); salt conditions, or temperature. For example, lower stringency conditions include an overnight incubation at 37 degree C in a solution comprising 6X SSPE (20X SSPE = 3M NaCl; 0.2M NaH2PO4; 0.02M EDTA, pH 7.4), 0.5% SDS, 30% formamide, 100 ug/ml salmon sperm blocking DNA; followed by washes at 50 degree C with 1XSSPE, 0.1% SDS. In addition, to achieve even lower stringency, washes performed following stringent hybridization can be done at higher salt concentrations (e.g. 5X SSC).
Note that variations in the above conditions may be accomplished through the inclusion and/or substitution of alternate blocking reagents used to suppress background in hybridization experiments. Typical blocking reagents include Denhardt's reagent, BLOTTO, heparin, denatured salmon sperm DNA, and commercially available proprietary formulations. The inclusion of specific blocking reagents may require modification of the hybridization conditions described above, due to problems with compatibility. Of course, a polynucleotide which hybridizes only to polyA+ sequences (such as any
3' terminal polyA+ tract of a cDNA shown in the sequence listing), or to a complementary stretch of T (or U) residues, would not be included in the definition of "polynucleotide," since such a polynucleotide would hybridize to any nucleic acid molecule containing a poly (A) stretch or the complement thereof (e.g., practically any double-stranded cDNA clone generated using digo dT as a primer).
The Ckβ-4 or Ckβ-10 polynucleotide can be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or
DNA. For example, Ckβ-4 or Ckβ-10 polynucleotides can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, the Ckβ-4 or Ckβ-10 polynucleotides can be composed of triple-stranded regions comprising RNA or
DNA or both RNA and DNA. Ckβ-4 or Ckβ-10 polynucleotides may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically, or metabolically modified forms.
Ckβ-4 or Ckβ-10 polypeptides can be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, i.e., peptide isosteres, and may contain amino acids other than the 20 gene-encoded amino acids. The Ckβ-4 or Ckβ-10 polypeptides may be modified by either natural processes, such as posttranslational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in a voluminous research literature. Modifications can occur anywhere in a Ckβ-4 or Ckβ-10 polypeptide, including the peptide backbone, the amino acid side-chains and the amino or carboxyl termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given Ckβ-4 or Ckβ-10 polypeptide. Also, a given Ckβ-4 or Ckβ-10 polypeptide may contain many types of modifications. Ckβ-4 or Ckβ-10 polypeptides may be branched , for example, as a result of ubiquitination, and they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic Ckβ-4 or Ckβ-10 polypeptides may result from posttranslation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphotidylinositol, cross-linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, pegylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer- RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance, PROTEINS - STRUCTURE AND MOLECULAR PROPERTIES, 2nd Ed., T. E. Creighton, W. H. Freeman and Company, New York (1993); POSTTRANSLATIONAL COVALENT MODIFICATION OF PROTEINS, B. C. Johnson, Ed., Academic Press, New York, pgs. 1-12 (1983); Seifter et al., Meth Enzymol 182:626-646 (1990); Rattan et al., Ann NY Acad Sci 663:48-62 (1992).)
Ckβ-4 or Ckβ-10 Polynucleotides and Polypeptides In accordance with an aspect of the present invention, there are provided isolated nucleic acids (polynucleotides) which encode for the mature Ckβ-4 polypeptide having the deduced amino acid sequence of Figure 1 (SEQ LD NO:2) or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75848 on July 29, 1994 and for the mature MCP-4 (also known as Ckβ-10) polypeptide having the deduced amino acid sequence of Figures 2, 5 or 12 (SEQ LD NO:4), or for the mature polypeptide encoded by the cDNA of the clone deposited as ATCC Deposit No. 75849 on July 29, 1994. Also provided in accordance with this aspect of the invention are polynucleotides encoding MCP- 4 polypeptides comprising in sequence residues 28-93 set out in Figures 2, 5, and 12 (SEQ ID NO:4), and, among these, particularly polynucleotides encoding a polypeptide having an amino acid sequence selected from the group consisting of residues 1-98. 17-98, 20-98, 22- 98, 24-98, 28-98, 28-95 and 28-93 set out in Figures 2, 5, and 12 (SEQ LD NO:4), and fragments, analogs and derivatives thereof.
The polynucleotide encoding Ckβ-4, clone HGBAN46, was discovered in a cDNA library derived from a human gall bladder. Ckβ-4 is structurally related to the chemokine family. It contains an open reading frame encoding a protein of 96 amino acid residues of which the first 26 amino acids residues are the putative leader sequence such that the mature protein comprises 70 amino acids. The protein exhibits the highest degree of homology to eotaxin with 20% identity and 37% similarity over the entire coding sequence as shown in Figure 3. It is also important that the four spatially conserved cysteine residues in chemokines are found in the polypeptides of the present invention.
The polynucleotide encoding MCP-4 (also known as Ckβ-10), clone HE9DR66, was discovered in a cDNA library derived from nine week early human tissue. MCP-4 is structurally related to the chemokine family. It contains an open reading frame encoding a protein of 98 amino acid residues of which approximately the first 20 amino acid residues are putative or actual leader sequences as shown in Figures 2 and 5 (SEQ LD NO:4) and discussed elsewhere herein, and the mature protein comprises around 75 amino acids depending on the cleavage site, or sites, also as shown in Figure 5. The protein has a marked sequence similarity to MCP- 1 , MCP-2, MCP-3 and Eotoxin and exhibits the highest degree of homology to MCP-3 with 65% identity and 77% similarity over the entire coding sequence (See, e.g. Figures 4 and 5).
Particularly preferred MCP-4 polypeptides (also referred to herein as Ckβ-10) of the present invention, described herein below in greater detail, include polypeptides having the amino acid sequences set out in Figure 2, Figure 5 or Figure 12 (SEQ ID NO:4). It will be appreciated that such preferred polypeptides include those with free amino and blocked amino termini, particular those noted in Figure 5, in which the terminal glutamine is a blocked pyroglutamine residue. In accordance with this aspect of the invention are preferred MCP-4 polypeptides comprising in sequence residues 28-93 set out in Figures 2, 5 or 12 (SEQ ID NO:4), and, among these, particularly polypeptides having an amino acid sequence selected from the group consisting of residues 1-98, 17-98, 20-98, 22-98, 24-98, 28-98, 28-95 and 28-93 set out in Figures 2, 5 or 12 (SEQ LD NO:4), and fragments, analogs and derivatives thereof.
Signal Sequences The present invention also encompasses mature forms of the polypeptide having the polypeptide sequence of SEQ ID NO: 2 or SEQ LD NO:4 and/or the polypeptide sequence encoded by the cDNA in a deposited clone. Polynucleotides encoding the mature forms (such as, for example, the polynucleotide sequence in SEQ ID NO:l or SEQ JD NO:3 and/or the polynucleotide sequence contained in the cDNA of a deposited clone) are also encompassed by the invention. According to the signal hypothesis, proteins secreted by mammalian cells have a signal or secretary leader sequence which is cleaved from the mature protein once export of the growing protein chain across the rough endoplasmic reticulum has been initiated. Most mammalian cells and even insect cells cleave secreted proteins with the same specificity. However, in some cases, cleavage of a secreted protein is not entirely uniform, which results in two or more mature species of the protein. Further, it has long been known that cleavage specificity of a secreted protein is ultimately determined by the primary structure of the complete protein, that is, it is inherent in the amino acid sequence of the polypeptide.
Methods for predicting whether a protein has a signal sequence, as well as the cleavage point for that sequence, are available. For instance, the method of McGeoch, Virus Res. 3:271-286 (1985), uses the information from a short N-terminal charged region and a subsequent uncharged region of the complete (uncleaved) protein. The method of von Heinje, Nucleic Acids Res. 14:4683-4690 (1986) uses the information from the residues surrounding the cleavage site, typically residues -13 to +2, where +1 indicates the amino terminus of the secreted protein. The accuracy of predicting the cleavage points of known mammalian secretory proteins for each of these methods is in the range of 75-80%. (von Heinje, supra.) However, the two methods do not always produce the same predicted cleavage point(s) for a given protein.
In the present case, the deduced amino acid sequence of the secreted chemokine polypeptide was analyzed by a computer program called SignalP (Henrik Nielsen et al., Protein Engineering 10: 1-6 (1997)), which predicts the cellular location of a protein based on the amino acid sequence. As part of this computational prediction of localization, the methods of McGeoch and von Heinje are incorporated.
As one of ordinary skill would appreciate, however, cleavage sites sometimes vary from organism to organism and cannot be predicted with absolute certainty. Accordingly, the present invention provides secreted polypeptides having a sequence shown in SEQ ID NO:2 or SEQ ID NO:4 which have an N-terminus beginning within 5 residues (i.e., + or - 5 residues) of the predicted cleavage point. Similarly, it is also recognized that in some cases, cleavage of the signal sequence from a secreted protein is not entirely uniform, resulting in more than one secreted species. These polypeptides, and the polynucleotides encoding such polypeptides, are contemplated by the present invention. Moreover, the signal sequence identified by the above analysis may not necessarily predict the naturally occurring signal sequence. For example, the naturally occurring signal sequence may be further upstream from the predicted signal sequence. However, it is likely that the predicted signal sequence will be capable of directing the secreted protein to the ER. Nonetheless, the present invention provides the mature protein produced by expression of the polynucleotide sequence of SEQ LD NO: l or SEQ ID NO: 3 and/or the polynucleotide sequence contained in the cDNA of a deposited clone, in a mammalian cell (e.g., COS cells, as desribed below). These polypeptides, and the polynucleotides encoding such polypeptides, are contemplated by the present invention.
Polynucleotide and Polypeptide Variants
The present invention is directed to variants of the polynucleotide sequence disclosed in SEQ LD NO:l or SEQ LD NO: 3, the complementary strand thereto, and/or the cDNA sequence contained in a deposited clone.
The present invention also encompasses variants of the polypeptide sequence disclosed in SEQ ID NO:2 or SEQ ID NO:4 and/or encoded by a deposited clone.
"Variant" refers to a polynucleotide or polypeptide differing from the Ckβ-4 or Ckβ- 10 polynucleotide or polypeptide, but retaining essential properties thereof. Generally, variants are overall closely similar, and, in many regions, identical to the Ckβ-4 or Ckβ-10 polynucleotide or polypeptide.
The present invention is also directed to nucleic acid molecules which comprise, or alternatively consist of, a nucleotide sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for example, the nucleotide coding sequence in SEQ ID NO:l or SEQ ID NO:3 or the complementary strand thereto, the nucleotide coding sequence contained in a deposited cDNA clone or the complementary strand thereto, a nucleotide sequence encoding the polypeptide of SEQ ID NO:2 or SEQ ID NO:4, a nucleotide sequence encoding the polypeptide encoded by the cDNA contained in a deposited clone, and/or polynucleotide fragments of any of these nucleic acid molecules (e.g., those fragments described herein). Polynucleotides which hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides.
The present invention is also directed to polypeptides which comprise, or alternatively consist of, an amino acid sequence which is at least 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% identical to, for example, the polypeptide sequence shown in SEQ ID NO:2 or SEQ JD NO:4, the polypeptide sequence encoded by the cDNA contained in a deposited clone, and/or polypeptide fragments of any of these polypeptides (e.g., those fragments described herein).
By a nucleic acid having a nucleotide sequence at least, for example, 95% "identical" to a reference nucleotide sequence of the present invention, it is intended that the nucleotide sequence of the nucleic acid is identical to the reference sequence except that the nucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence encoding the Ckβ-4 or Ckβ-10 polypeptide. In other words, to obtain a nucleic acid having a nucleotide sequence at least 95% identical to a reference nucleotide sequence, up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence. The query sequence may be an entire sequence shown of SEQ JD NO:l or SEQ JD NO:3, the ORF (open reading frame), or any fragment specified as described herein.
As a practical matter, whether any particular nucleic acid molecule or polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to a nucleotide sequence of the presence invention can be determined conventionally using known computer programs. A preferred method for determining the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. (1990) 6:237-245.) In a sequence alignment the query and subject sequences are both DNA sequences. An RNA sequence can be compared by converting U's to T's. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB alignment of DNA sequences to calculate percent identiy are: Matrix=Unitary, k-tuple=4, Mismatch Penalty=l, Joining Penalty=30, Randomization Group Length=0, Cutoff Score=l, Gap Penalty=5, Gap Size Penalty 0.05, Window Size=500 or the lenght of the subject nucleotide sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence because of 5' or 3' deletions, not because of internal deletions, a manual correction must be made to the results. This is because the FASTDB program does not account for 5' and 3' truncations of the subject sequence when calculating percent identity. For subject sequences truncated at the 5' or 3' ends, relative to the query sequence, the percent identity is corrected by calculating the number of bases of the query sequence that are 5' and 3' of the subject sequence, which are not matched/aligned, as a percent of the total bases of the query sequence. Whether a nucleotide is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This corrected score is what is used for the purposes of the present invention. Only bases outside the 5' and 3' bases of the subject sequence, as displayed by the FASTDB alignment, which are not matched/aligned with the query sequence, are calculated for the purposes of manually adjusting the percent identity score.
For example, a 90 base subject sequence is aligned to a 100 base query sequence to determine percent identity. The deletions occur at the 5' end of the subject sequence and therefore, the FASTDB alignment does not show a matched/alignment of the first 10 bases at 5' end. The 10 unpaired bases represent 10% of the sequence (number of bases at the 5' and 3' ends not matched/total number of bases in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 bases were perfectly matched the final percent identity would be 90%. In another example, a 90 base subject sequence is compared with a 100 base query sequence. This time the deletions are internal deletions so that there are no bases on the 5' or 3' of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected. Once again, only bases 5' and 3' of the subject sequence which are not matched/aligned with the query sequence are manually corrected for. No other manual corrections are to made for the purposes of the present invention.
By a polypeptide having an amino acid sequence at least, for example, 95% "identical" to a query amino acid sequence of the present invention, it is intended that the amino acid sequence of the subject polypeptide is identical to the query sequence except that the subject polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the query amino acid sequence. In other words, to obtain a polypeptide having an amino acid sequence at least 95% identical to a query amino acid sequence, up to 5% of the amino acid residues in the subject sequence may be inserted, deleted, (indels) or substituted with another amino acid. These alterations of the reference sequence may occur at the amino or carboxy terminal positions of the reference amino acid sequence or anywhere between those terminal positions, interspersed either individually among residues in the reference sequence or in one or more contiguous groups within the reference sequence.
As a practical matter, whether any particular polypeptide is at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to, for instance, the amino acid sequences of SEQ ID NO:2 or SEQ ID NO:4 or to the amino acid sequence encoded by the cDNA contained in a deposited clone can be determined conventionally using known computer programs. A preferred method for determing the best overall match between a query sequence (a sequence of the present invention) and a subject sequence, also referred to as a global sequence alignment, can be determined using the FASTDB computer program based on the algorithm of Brutlag et al. (Comp. App. Biosci. 6:237-245(1990)). In a sequence alignment the query and subject sequences are either both nucleotide sequences or both amino acid sequences. The result of said global sequence alignment is in percent identity. Preferred parameters used in a FASTDB amino acid alignment are: Matrix=PAM 0, k-tuple=2, Mismatch Penalty=l, Joining Penalty=20, Randomization Group Length=0, Cutoff Score=l, Window Size=sequence length, Gap Penalty=5, Gap Size Penalty=0.05, Window Size=500 or the length of the subject amino acid sequence, whichever is shorter.
If the subject sequence is shorter than the query sequence due to N- or C-terminal deletions, not because of internal deletions, a manual correction must be made to the results. 23
This is because the FASTDB program does not account for N- and C-terminal truncations of the subject sequence when calculating global percent identity. For subject sequences truncated at the N- and C-termini, relative to the query sequence, the percent identity is corrected by calculating the number of residues of the query sequence that are N- and C- terminal of the subject sequence, which are not matched/aligned with a corresponding subject residue, as a percent of the total bases of the query sequence. Whether a residue is matched/aligned is determined by results of the FASTDB sequence alignment. This percentage is then subtracted from the percent identity, calculated by the above FASTDB program using the specified parameters, to arrive at a final percent identity score. This final percent identity score is what is used for the purposes of the present invention. Only residues to the N- and C-termini of the subject sequence, which are not matched/aligned with the query sequence, are considered for the purposes of manually adjusting the percent identity score. That is, only query residue positions outside the farthest N- and C-terminal residues of the subject sequence. For example, a 90 amino acid residue subject sequence is aligned with a 100 residue query sequence to determine percent identity. The deletion occurs at the N-terminus of the subject sequence and therefore, the FASTDB alignment does not show a matching/alignment of the first 10 residues at the N-terminus. The 10 unpaired residues represent 10% of the sequence (number of residues at the N- and C- termini not matched/total number of residues in the query sequence) so 10% is subtracted from the percent identity score calculated by the FASTDB program. If the remaining 90 residues were perfectly matched the final percent identity would be 90%. In another example, a 90 residue subject sequence is compared with a 100 residue query sequence. This time the deletions are internal deletions so there are no residues at the N- or C-termini of the subject sequence which are not matched/aligned with the query. In this case the percent identity calculated by FASTDB is not manually corrected.
Once again, only residue positions outside the N- and C-terminal ends of the subject sequence, as displayed in the FASTDB alignment, which are not matched/aligned with the query sequnce are manually corrected for. No other manual corrections are to made for the purposes of the present invention. The Ckβ-4 and Ckβ-10 variants may contain alterations in the coding regions, non- coding regions, or both. Especially preferred are polynucleotide variants containing alterations which produce silent substitutions, additions, or deletions, but do not alter the properties or activities of the encoded polypeptide. Nucleotide variants produced by silent substitutions due to the degeneracy of the genetic code are preferred. Moreover, variants in which 5-10, 1-5, or 1-2 amino acids are substituted, deleted, or added in any combination are also preferred. Ckβ-4 and Ckβ-10 polynucleotide variants can be produced for a variety of reasons, e.g., to optimize codon expression for a particular host (change codons in the human mRNA to those preferred by a bacterial host such as E. coli).
Naturally occurring Ckβ-4 and Ckβ-10 variants are called "allelic variants," and refer to one of several alternate forms of a gene occupying a given locus on a chromosome of an organism. (Genes II, Lewin, B., ed., John Wiley & Sons, New York (1985).) These allelic variants can vary at either the polynucleotide and/or polypeptide level and are included in the present invention. Alternatively, non-naturally occurring variants may be produced by mutagenesis techniques or by direct synthesis.
Using known methods of protein engineering and recombinant DNA technology, variants may be generated to improve or alter the characteristics of the Ckβ-4 and Ckβ-10 polypeptides. For instance, one or more amino acids can be deleted from the N-terminus or C-terminus of the secreted protein without substantial loss of biological function. The authors of Ron et al., J. Biol. Chem. 268: 2984-2988 (1993), reported variant KGF proteins having heparin binding activity even after deleting 3, 8, or 27 amino-terminal amino acid residues. Similarly, Interferon gamma exhibited up to ten times higher activity after deleting 8-10 amino acid residues from the carboxy terminus of this protein. (Dobeli et al., J. Biotechnology 7: 199-216 (1988).)
Moreover, ample evidence demonstrates that variants often retain a biological activity similar to that of the naturally occurring protein. For example, Gayle and coworkers (J. Biol. Chem 268:22105-22111 (1993)) conducted extensive mutational analysis of human cytokine IL-1 a. They used random mutagenesis to generate over 3,500 individual LL-la mutants that averaged 2.5 amino acid changes per variant over the entire length of the molecule. Multiple mutations were examined at every possible amino acid position. The investigators found that "[m]ost of the molecule could be altered with little effect on either [binding or biological activity]." (See, Abstract.) In fact, only 23 unique amino acid sequences, out of more than 3,500 nucleotide sequences examined, produced a protein that significantly differed in activity from wild-type.
Furthermore, even if deleting one or more amino acids from the N-terminus or C- terminus of a polypeptide results in modification or loss of one or more biological functions, other biological activities may still be retained. For example, the ability of a deletion variant to induce and/or to bind antibodies which recognize the secreted form will likely be retained when less than the majority of the residues of the secreted form are removed from the N- terminus or C-terminus. Whether a particular polypeptide lacking N- or C-terminal residues of a protein retains such immunogenic activities can readily be determined by routine methods described herein and otherwise known in the art. Thus, the invention further includes Ckβ-4 and Ckβ-10 polypeptide variants which show substantial biological activity. Such variants include deletions, insertions, inversions, repeats, and substitutions selected according to general rules known in the art so as have little effect on activity.
The present application is directed to nucleic acid molecules at least 90%, 95%, 96%,
97%, 98% or 99% identical to the nucleic acid sequences disclosed herein, (e.g., encoding a polypeptide having the amino acid sequence of an N and/or C terminal deletion disclosed below as the general formula n-m of SEQ LD NO:4 (e.g., n-m, n-m1, n-m2, n'-m1, and n'- m2) where n and m are integers as described below), irrespective of whether they encode a polypeptide having Ckβ-10 functional activity. This is because even where a particular nucleic acid molecule does not encode a polypeptide having Ckβ-10 functional activity, one of skill in the art would still know how to use the nucleic acid molecule, for instance, as a hybridization probe or a polymerase chain reaction (PCR) primer. Uses of the nucleic acid molecules of the present invention that do not encode a polypeptide having Ckβ-10 functional activity include, inter alia, (1) isolating a Ckβ-10 gene or allelic or splice variants thereof in a cDNA library; (2) in situ hybridization (e.g., "FISH") to metaphase chromosomal spreads to provide precise chromosomal location of the Ckβ-10 gene, as described in Verma et al., Human Chromosomes: A Manual of Basic Techniques, Pergamon
Press, New York (1988); and (3) Northern Blot analysis for detecting Ckβ-10 mRNA expression in specific tissues.
Preferred, however, are nucleic acid molecules having sequences at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences disclosed herein, which do, in fact, encode a polypeptide having Ckβ-10 functional activity. By "a polypeptide having Ckβ-10 functional activity" is intended polypeptides exhibiting activity similar, but not necessarily identical, to a functional activity of the Ckβ-10 polypeptides of the present invention (e.g., complete (full-length) Ckβ-10, mature Ckβ-10 and soluble Ckβ-10 (e.g., having sequences contained in the extracellular domain of Ckβ-10) as measured, for example, in a particular immunoassay or biological assay. For example, a Ckβ-10 functional activity can routinely be measured by determining the ability of a Ckβ-10 polypeptide to bind a Ckβ-10 ligand. Ckβ-10 functional activity may also be measured by determining the ability of a polypeptide, such as cognate ligand which is free or expressed on a cell surface, to induce cells expressing the polypeptide. Of course, due to the degeneracy of the genetic code, one of ordinary skill in the art will immediately recognize that a large number of the nucleic acid molecules having a sequence at least 90%, 95%, 96%, 97%, 98%, or 99% identical to the nucleic acid sequence of the deposited cDNA, the nucleic acid sequence shown in Figure 2 (SEQ JD NO: 3), or fragments thereof, will encode polypeptides "having Ckβ-10 functional activity." In fact, since degenerate variants of any of these nucleotide sequences all encode the same polypeptide, in many instances, this will be clear to the skilled artisan even without performing the above described comparison assay. It will be further recognized in the art that, for such nucleic acid molecules that are not degenerate variants, a reasonable number will also encode a polypeptide having Ckβ-10 functional activity. This is because the skilled artisan is fully aware of amino acid substitutions that are either less likely or not likely to significantly effect protein function (e.g., replacing one aliphatic amino acid with a second aliphatic amino acid), as further described below.
For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al., "Deciphering the Message in Protein Sequences: Tolerance to Amino Acid Substitutions," Science 247:1306-1310 (1990), wherein the authors indicate that there are two main strategies for studying the tolerance of an amino acid sequence to change.
The first strategy exploits the tolerance of amino acid substitutions by natural selection during the process of evolution. By comparing amino acid sequences in different species, conserved amino acids can be identified. These conserved amino acids are likely important for protein function. In contrast, the amino acid positions where substitutions have been tolerated by natural selection indicates that these positions are not critical for protein function. Thus, positions tolerating amino acid substitution could be modified while still maintaining biological activity of the protein.
The second strategy uses genetic engineering to introduce amino acid changes at specific positions of a cloned gene to identify regions critical for protein function. For example, site directed mutagenesis or alanine-scanning mutagenesis (introduction of single alanine mutations at every residue in the molecule) can be used. (Cunningham and Wells, Science 244:1081-1085 (1989).) The resulting mutant molecules can then be tested for biological activity.
As the authors state, these two strategies have revealed that proteins are surprisingly tolerant of amino acid substitutions. The authors further indicate which amino acid changes are likely to be permissive at certain amino acid positions in the protein. For example, most buried (within the tertiary structure of the protein) amino acid residues require nonpolar side chains, whereas few features of surface side chains are generally conserved. Moreover, tolerated conservative amino acid substitutions involve replacement of the aliphatic or hydrophobic amino acids Ala, Val, Leu and lie; replacement of the hydroxyl residues Ser and Thr; replacement of the acidic residues Asp and Glu; replacement of the amide residues Asn and Gin, replacement of the basic residues Lys, Arg, and His; replacement of the aromatic residues Phe, Tyr, and Trp, and replacement of the small-sized amino acids Ala, Ser, Thr, Met, and Gly.
For example, site directed changes at the amino acid level of Ckβ-10 can be made by replacing a particular amino acid with a conservative amino acid. Preferred conservative mutations include: For example preferred complementary mutations include: Ml replaced with A, G, I, L, S, T, or V; K2 replaced with H, or R; V3 replaced with A, G, I, L, S, T, or M; S4 replaced with A, G, I, L, T, M, or V; A5 replaced with G, I, L, S, T, M, or V; V6 replaced with A, G, I, L, S, T, or M; L7 replaced with A, G, I, S, T, M, or V; L8 replaced with A, G, I, S, T, M, or V; L10 replaced with A, G, I, S, T, M, or V; Ll l replaced with A, G, I, S, T, M, or V; L12 replaced with A, G, I, S, T, M, or V; M13 replaced with A, G, I, L, S, T, or V; T14 replaced with A, G, I, L, S, M, or V; A15 replaced with G, I, L, S, T, M, or V; A16 replaced with G, I, L, S, T, M, or V; F17 replaced with W, or Y; N18 replaced with Q; Q20 replaced with N; G21 replaced with A, I, L, S, T, M, or V; L22 replaced with A, G, I, S, T, M, or V; A23 replaced with G, I, L, S, T, M, or V; Q24 replaced with N; D26 replaced with E; A27 replaced with G, I, L, S, T, M, or V; L28 replaced with A, G, I, S, T, M, or V; N29 replaced with Q; V30 replaced with A, G, I, L, S, T, or M; S32 replaced with A, G, I, L, T, M, or V; T33 replaced with A, G, I, L, S, M, or V; F36 replaced with W, or Y; T37 replaced with A, G, I, L, S, M, or V; F38 replaced with W, or Y; S39 replaced with A, G, I, L, T, M, or V; S40 replaced with A, G, I, L, T, M, or V; K41 replaced with H, or R; K42 replaced with H, or R; 143 replaced with A, G, L, S, T, M, or V; S44 replaced with A, G, I, L, T, M, or V; L45 replaced with A, G, I, S, T, M, or V; Q46 replaced with N; R47 replaced with H, or K; L48 replaced with A, G, I, S, T, M, or V; K49 replaced with H, or R; S50 replaced with A, G, I, L, T, M, or V; Y51 replaced with F, or W; V52 replaced with A, G, I, L, S, T, or M; 153 replaced with A, G, L, S, T, M, or V; T54 replaced with A, G, I, L, S, M, or V; T55 replaced with A, G, I, L, S , M, or V; S56 replaced with A, G, I, L, T, M, or V; R57 replaced with H, or K; Q60 replaced with N; K61 replaced with H, or R; A62 replaced with G, I, L, S, T, M, or V; V63 replaced with A, G, I, L, S, T, or M; 164 replaced with A, G, L, S, T, M, or V; F65 replaced with W, or Y; R66 replaced with H, or K; T67 replaced with A, G, I, L, S, M, or V; K68 replaced with H, or R; L69 replaced with A, G, I, S, T, M, or V; G70 replaced with A, I, L, S, T, M, or V; K71 replaced with H, or R; E72 replaced with D; 173 replaced with A, G, L, S, T, M, or V; A75 replaced with G, I, L. S, T, M, or V; D76 replaced with E; K78 replaced with H, or R; E79 replaced with D; K80 replaced with H, or R; W81 replaced with F, or Y; V82 replaced with A, G, I, L, S, T, or M; Q83 replaced with N; N84 replaced with Q; Y85 replaced with F, or W; M86 replaced with A, G, I, L, S, T, or V; K87 replaced with H, or R; H88 replaced with K, or R; L89 replaced with A, G, I, S, T, M, or V; G90 replaced with A, I, L, S, T, M, or V; R91 replaced with H, or K; K92 replaced with H, or R; A93 replaced with G, I, L, S, T, M, or V; H94 replaced with K, or R; T95 replaced with A, G, I, L, S, M, or V; L96 replaced with A, G, I, S, T, M, or V; K97 replaced with H, or R; and T98 replaced with A, G, I, L, S, M, or V of SEQ ID NO:4.
The resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art. Preferably, the resulting constructs have an increased and/or a decreased Ckβ-10 activity or function, while the remaining Ckβ-10 activities or functions are maintained. More preferably, the resulting constructs have more than one increased and/or decreased Ckβ-10 activity or function, while the remaining Ckβ-10 activities or functions are maintained. Besides conservative amino acid substitution, variants of Ckβ-10 include (i) substitutions with one or more of the non-conserved amino acid residues, where the substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) substitution with one or more of amino acid residues having a substituent group, or (iii) fusion of the mature polypeptide with another compound, such as a compound to increase the stability and/or solubility of the polypeptide (for example, polyethylene glycol), or (iv) fusion of the polypeptide with additional amino acids, such as, for example, an IgG Fc fusion region peptide, or leader or secretory sequence, or a sequence facilitating purification. Such variant polypeptides are deemed to be within the scope of those skilled in the art from the teachings herein. For example, Ckβ-10 polypeptide variants containing amino acid substitutions of charged amino acids with other charged or neutral amino acids may produce proteins with improved characteristics, such as less aggregation. Aggregation of pharmaceutical formulations both reduces activity and increases clearance due to the aggregate's immunogenic activity. (Pinckard et al., Clin. Exp. Immunol. 2:331-340 (1967); Robbins et al., Diabetes 36: 838-845 (1987); Cleland et al., Crit. Rev. Therapeutic Drug Carrier Systems 10:307-377 (1993).)
For example, preferred non-conservative substitutions of Ckβ-10 include: Ml replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K2 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; V3 replaced with D, E, H, K, R, N, Q, F, W. Y, P, or C; S4 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A5 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V6 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L7 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L8 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C9 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; L10 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; LI 1 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L12 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; M13 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T14 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A15 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; A16 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F17 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; N18 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; P19 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Q20 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; G21 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L22 replaced with
D, E, H, K, R, N, Q, F, W, Y, P, or C; A23 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q24 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; P25 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; D26 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A27 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L28 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; N29 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; V30 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; P31 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; S32 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T33 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C34 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; C35 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; F36 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; T37 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F38 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; S39 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; S40 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K41 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K42 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; 143 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S44 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L45 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q46 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; R47 replaced with D, E, A, G, I, L, S , T, M, V, N, Q, F, W, Y, P, or C; L48 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K49 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; S50 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Y51 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V52 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 153 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T54 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; T55 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; S56 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R57 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; C58 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; P59 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; Q60 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; K61 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A62 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; V63 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; 164 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; F65 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; R66 replaced with D,
E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; T67 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K68 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L69 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; G70 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K71 replaced with D, E, A, G, I, L, S, T, M, V, N, Q,
F, W, Y, P, or C; E72 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; 173 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; C74 replaced with D, E, H , K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or P; A75 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; D76 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; P77 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, or C; K78 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; E79 replaced with H, K, R, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K80 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; W81 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; V82 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; Q83 replaced with D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; N84 replaced with
D, E, H, K, R, A, G, I, L, S, T, M, V, F, W, Y, P, or C; Y85 replaced with D, E, H, K, R, N, Q, A, G, I, L, S, T, M, V, P, or C; M86 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K87 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; H88 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; L89 replaced with D,
E, H, K, R, N, Q, F, W, Y, P, or C; G90 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; R91 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; K92 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; A93 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; H94 replaced with D, E, A, G, I, L, S, T, M, V, N , Q, F, W, Y, P, or C; T95 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; L96 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C; K97 replaced with D, E, A, G, I, L, S, T, M, V, N, Q, F, W, Y, P, or C; and T98 replaced with D, E, H, K, R, N, Q, F, W, Y, P, or C of SEQ ID NO:4.
The resulting constructs can be routinely screened for activities or functions described throughout the specification and known in the art. Preferably, the resulting constructs have an increased and/or decreased Ckβ-10 activity or function, while the remaining Ckβ-10 activities or functions are maintained. More preferably, the resulting constructs have more than one increased and/or decreased Ckβ-10 activity or function, while the remaining Ckβ-10 activities or functions are maintained. Additionally, more than one amino acid (e.g., 2, 3, 4, 5, 6, 7, 8, 9 and 10) can be replaced with the substituted amino acids as described above (either conservative or nonconservative). The substituted amino acids can occur in the full length, mature, or proprotein form of Ckβ-10 protein, as well as the N- and C- terminal deletion mutants, having the general formula n-m of SEQ ID NO:4 (e.g., n-m, n-m1, n-m2, n'-m1, and n'-m2) where n and m are integers as described below. A further embodiment of the invention relates to a polypeptide which comprises the amino acid sequence of a Ckβ-10 polypeptide having an amino acid sequence which contains at least one amino acid substitution, but not more than 50 amino acid substitutions, even more preferably, not more than 40 amino acid substitutions, still more preferably, not more than 30 amino acid substitutions, and still even more preferably, not more than 20 amino acid substitutions. Of course, in order of ever-increasing preference, it is highly preferable for a polypeptide to have an amino acid sequence which comprises the amino acid sequence of a Ckβ-10 polypeptide, which contains at least one, but not more than 10, 9, 8, 7, 6, 5, 4,
3, 2 or 1 amino acid substitutions. In specific embodiments, the number of additions, substitutions, and/or deletions in the amino acid sequence of Figure 2 (SEQ LD NO:4) or fragments thereof (e.g., the mature form and/or other fragments described herein), is 1-5, 5- 10, 5-25, 5-50, 10-50 or 50-150, conservative amino acid substitutions are preferable.
Polynucleotide and Polypeptide Fragments
The present invention is also directed to polynucleotide fragments of the polynucleotides of the invention. In the present invention, a "polynucleotide fragment" refers to a short polynucleotide having a nucleic acid sequence which: is a portion of that contained in a deposited clone, or encoding the polypeptide encoded by the cDNA in a deposited clone; is a portion of that shown in SEQ LD NO:l or SEQ ED NO:3 or the complementary strand thereto, or is a portion of a polynucleotide sequence encoding the polypeptide of SEQ ED NO:2 or SEQ ED NO:4. The nucleotide fragments of the invention are preferably at least about 15 nt, and more preferably at least about 20 nt, still more preferably at least about 30 nt, and even more preferably, at least about 40 nt, at least about 50 nt, at least about 75 nt, or at least about 150 nt in length. A fragment "at least 20 nt in length," for example, is intended to include 20 or more contiguous bases from the cDNA sequence contained in a deposited clone or the nucleotide sequence shown in SEQ LD NO: 1 or SEQ ED NO:3. In this context "about" includes the particularly recited value, a value larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. These nucleotide fragments have uses that include, but are not limited to, as diagnostic probes and primers as discussed herein. Of course, larger fragments (e.g., 50, 150, 500, 600, 2000 nucleotides) are preferred.
Moreover, representative examples of polynucleotide fragments of the invention, include, for example, fragments comprising, or alternatively consisting of, a sequence from about nucleotide number 1-69, 70-120, 121-171, 172-222, 223-273, or 274 to the end of SEQ ID NO: 3, or the complementary strand thereto, or the cDNA contained in the deposited clone. In this context "about" includes the particularly recited ranges, and ranges larger or smaller by several (5, 4, 3, 2, or 1) nucleotides, at either terminus or at both termini. Preferably, these fragments encode a polypeptide which has biological activity. More preferably, these polynucleotides can be used as probes or primers as discussed herein. Polynucleotides which hybridize to these nucleic acid molecules under stringent hybridization conditions or lower stringency conditions are also encompassed by the invention, as are polypeptides encoded by these polynucleotides. In the present invention, a "polypeptide fragment" refers to an amino acid sequence which is a portion of that contained in SEQ ID NO:2 or SEQ ID NO:4 or encoded by the cDNA contained in a deposited clone. Protein (polypeptide) fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region. Representative examples of polypeptide fragments of the invention, include, for example, fragments comprising, or alternatively consisting of, from about amino acid number 1-23, 24-40, 41-60, 61-80, or 81 to the end of the coding region of Ckβ-10 shown in Figure 2 (SEQ ID NO:4). Moreover, polypeptide fragments can be about 20, 30, 40, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, or 150 amino acids in length. In this context "about" includes the particularly recited ranges or values, and ranges or values larger or smaller by several (5, 4, 3, 2, or 1) amino acids, at either extreme or at both extremes. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Even if deletion of one or more amino acids from the N-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind Ckβ-10 ligand) may still be retained. For example, the ability of shortened Ckβ-10 muteins to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptides generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the N-terminus. Whether a particular polypeptide lacking N-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that an Ckβ-10 mutein with a large number of deleted N-terminal amino acid residues may retain some biological or immunogenic activities. In fact, peptides composed of as few as six Ckβ-10 amino acid residues may often evoke an immune response. Preferred polypeptide fragments include the secreted protein as well as the mature form. Further preferred polypeptide fragments include the secreted protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both.
Accordingly, polypeptide fragments include the secreted Ckβ-10 protein as well as the mature form. Further preferred polypeptide fragments include the secreted Ckβ-10 protein or the mature form having a continuous series of deleted residues from the amino or the carboxy terminus, or both. For example, the present invention further provides polynucleotides which encode Ckβ-10 polypeptides having one or more residues deleted from the amino terminus of the amino acid sequence shown in SEQ ED NO:4, up to the cysteine residue at position number 34, and polynucleotides encoding such polypeptides. In particular, the present invention provides polynucleotides which encode polypeptides comprising the amino acid sequence of residues n-98 of SEQ ID NO:4, where n is an integer in the range of 1 to 30, and preferably n is in the range of 20 to 35, and most preferrably n is in the range 29 to 35, where Cys-35 is the position of the first residue from the N-terminus the Ckβ-10 polypeptide (shown in SEQ ED NO:4) believed to be required for receptor binding activity. Further, n may be in the range of 29-35, 30-35, 31-35, 32-35, 33-35, 34-35, or n may equal 35.
More in particular, the invention provides polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ ID NO:4 as residues 1-98, 2-98, 3-98, 4-98, 5-98, 6-98, 7-98, 8-98, 9-98, 10-98, 11-98, 12-98, 13-98, 14-98, 15-98, 16-98, 17-98, 18-98, 19-98, 20-98, 21-98, 22-98, 23-98, 24-98, 25-98, 26-98, 27-98, 28-98, 29-98, 30-98, 31-98, 32-98, 33-98, 34-98, or 35-98. Particularly preferred are polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ JD NO:4 as residues 18-98, 19-98, 21-98, 23-98, 25-98, 26-98, 27-98, 29-98, 30-98, 31-98, 32-98, 33-98, 34-98 or 35-98, with the most preferred within this group being 25-98, 26-98, 27-98, 28-98, 29-98 and 30-98.
The present invention further provides polynucleotides which encode polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the Ckβ-10 polypeptide up to the cysteine residue at position 74 of SEQ ED NO: 4. In particular, the present invention provides polynucleotides which encode polypeptides having the amino acid sequence of residues 17-m of the amino acid sequence in SEQ ED
NO:4, where m is any integer in the range of 74 to 98, preferably the polypeptide comprises residues 23-m where m is in the range of 74-98 since residue cysteine-74 is the first residue from the C-terminus of the complete Ckβ-10 polypeptide (shown in SEQ ID NO: 4) believed to be required for receptor binding and target cell modulation activities. Further, m may be in the range of 74-98, 75-98, 76-98, 77-98, 78-98, 79-98, 80-98, 81-98, 82-98, 83-98, 84-98, 85-98, 86-98, 87-98, 88-98, 90-98, 91-98, 92-98, 93-98, 94-98, 95-98, 96-98, 97-98 or n may equal 98.
More in particular, the invention provides polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ ID NO:4 as residues 17-74, 17-75, 17-76, 17-77, 17-78, 17-79, 17-80, 17-81, 17-82, 17-83, 17-84, 17-85, 17-86, 17-87, 17-88, 17-89, 17-90, 17-91, 17-92, 17-93, 17-94, 17-95, 17-96, 17-97, or 17-98. Particularly preferred are polynucleotides which encode polypeptides comprising the amino acid sequence shown in SEQ ED NO:4 as residues 23-74, 23-75, 23-76, 23-77, 23-78, 23-79, 23-80, 23-81, 23-82, 23-83, 23-84, 23-85, 23-86, 23-87, 23-88, 23-89, 23-90, 23-91, 23-92, 23-93, 23-94, 23-95, 23-96, 23-97, 23-98 23-74, 23-75, 23-76, 23-77, 23-78, 23-79, 23-80, 23-81, 23-82, 23-83, 23-84, 23-85, 23-86, 23-87, 23-88, 23-89, 23-90, 23-91, 23-92, 23-93, 23-94, 23-95, 23-96, and 23-97.
Particularly, N-terminal deletions of the Ckβ-10 polypeptide can be described by the general formula n'-98, where n ' is an integer from 2 to 93, where n ' corresponds to the position of the amino acid residue identified in SEQ ED NO:4. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of: K-2 to T-98; V-3 to T-98; S-4 to T-98; A-5 to T-98; V-6 to T-98; L-7 to T-98; L-8 to T-98; C-9 to T-98; L-10 to T-98; L-11 to T-98; L-12 to T-98; M-13 to T-98; T-14 to T-98; A-15 to T-98; A-16 to T-98; F-17 to T-98; N-18 to T-98; P-19 to T-98; Q-20 to T-98; G-21 to T-98; L-22 to T-98; A-23 to T-98; Q-24 to T- 98; P-25 to T-98; D-26 to T-98; A-27 to T-98; L-28 to T-98; N-29 to T-98; V-30 to T-98; P- 31 to T-98; S-32 to T-98; T-33 to T-98; C-34 to T-98; C-35 to T-98; F-36 to T-98; T-37 to T-98; F-38 to T-98; S-39 to T-98; S-40 to T-98; K-41 to T-98; K-42 to T-98; 1-43 to T-98; S-44 to T-98; L-45 to T-98; Q-46 to T-98; R-47 to T-98; L-48 to T-98; K-49 to T-98; S-50 to T-98; Y-51 to T-98; V-52 to T-98; 1-53 to T-98; T-54 to T-98; T-55 to T-98; S-56 to T-98; R-57 to T-98; C-58 to T-98; P-59 to T-98; Q-60 to T-98; K-61 to T-98; A-62 to T-98; V-63 to T-98; 1-64 to T-98; F-65 to T-98; R-66 to T-98; T-67 to T-98; K-68 to T-98; L-69 to T- 98; G-70 to T-98; K-71 to T-98; E-72 to T-98; 1-73 to T-98; C-74 to T-98; A-75 to T-98; D- 76 to T-98; P-77 to T-98; K-78 to T-98; E-79 to T-98; K-80 to T-98; W-81 to T-98; V-82 to T-98; Q-83 to T-98; N-84 to T-98; Y-85 to T-98; M-86 to T-98; K-87 to T-98; H-88 to T-98; L-89 to T-98; G-90 to T-98; R-91 to T-98; K-92 to T-98; and A-93 to T-98 of the full length Ckb-10 polypeptide shown in Figure 2 (SEQ ED NO:4). Polynucleotides encoding these polypeptides are also encompassed by the invention.
The present application is also directed to nucleic acid molecules comprising, or alternatively, consisting of, a polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%,
98%, or 99% identical to the polynucleotide sequence encoding the Ckβ-10 polypeptide described above. The present invention also encompasses the above polynucleotide sequences fused to a heterologous polynucleotide sequence.
Also as mentioned above, even if deletion of one or more amino acids from the C-terminus of a protein results in modification of loss of one or more biological functions of the protein, other functional activities (e.g., biological activities, ability to multimerize, ability to bind Ckβ-10 ligand) may still be retained. For example the ability of the shortened
Ckβ-10 mutein to induce and/or bind to antibodies which recognize the complete or mature forms of the polypeptide generally will be retained when less than the majority of the residues of the complete or mature polypeptide are removed from the C-terminus. Whether a particular polypeptide lacking C-terminal residues of a complete polypeptide retains such immunologic activities can readily be determined by routine methods described herein and otherwise known in the art. It is not unlikely that an Ckβ-10 mutein with a large number of deleted C-terminal amino acid residues may retain some biological or immunogenic activities.
In fact, peptides composed of as few as six Ckβ-10 amino acid residues may often evoke an immune response. Accordingly, the present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the Ckβ-10 polypeptide shown in Figure 2 (SEQ ID NO:4), as described by the general formula 1-m', where m' is an integer from 7 to 97, where m1 corresponds to the position of amino acid residue identified in SEQ ED NO:4. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of M-l to K-97; M-l to L-96; M-l to T-95; M-l to H-94; M-l to A-93; M-l to K-92; M-l to R-91; M-l to G-90; M-l to L-89; M-l to H-88; M-l to K-87; M-l to M-86; M-l to Y-85; M-l to N-84; M-l to Q-83; M-l to V-82; M-l to W-81; M-l to K-80; M-l to E-79; M-l to K-78; M-l to P-77; M-l to D-76; M-l to A-75; M-l to C-74; M-l to 1-73; M-l to E-72; M-l to K-71; M-l to G-70; M-l to L-69; M-l to K-68; M-l to T- 67; M-l to R-66; M-l to F-65; M-l to 1-64; M-l to V-63; M-l to A-62; M-l to K-61; M-l to Q-60; M-l to P-59; M-l to C-58; M-l to R-57; M-l to S-56; M-l to T-55; M-l to T-54; M-l to 1-53; M-l to V-52; M-l to Y-51; M-l to S-50; M-l to K-49; M-l to L-48; M-l to R- 47; M-l to Q-46; M-l to L-45; M-l to S-44; M-l to 1-43; M-l to K-42; M-l to K-41; M-l to S-40; M-l to S-39; M-l to F-38; M-l to T-37; M-l to F-36; M-l to C-35; M-l to C-34; M-l to T-33; M-l to S-32; M-l to P-31; M-l to V-30; M-l to N-29; M-l to L-28; M-l to A-27; M-l to D-26; M-l to P-25; M-l to Q-24; M-l to A-23; M-l to L-22; M-l to G-21; M- 1 to Q-20; M-l to P-19; M-l to N-18; M-l to F-17; M-l to A-16; M-l to A-15; M-l to T- 14; M-l to M-13; M-l to L-12; M-l to L-11; M-l to L-10; M-l to C-9; M-l to L-8; and M- 1 to L-7 of the full length Ckb-10 polypeptide shown in Figure 2 or SEQ ED NO:4. Polynucleotides encoding these polypeptides are also encompassed by the invention. The present invention further provides polypeptides having one or more residues deleted from the carboxy terminus of the amino acid sequence of the mature Ckβ-10 polypeptide shown in Figure 2 (SEQ ID NO:4), as described by the general formula 24-m2, where m2 is an integer from 30 to 97, where m2 corresponds to the position of amino acid residue identified in SEQ ED NO:4. More in particular, the invention provides polynucleotides encoding polypeptides comprising, or alternatively consisting of, the amino acid sequence of residues of Q-24 to K-97; Q-24 to L-96; Q-24 to T-95; Q-24 to H-94; Q- 24 to A-93; Q-24 to K-92; Q-24 to R-91; Q-24 to G-90; Q-24 to L-89; Q-24 to H-88; Q-24 to K-87; Q-24 to M-86; Q-24 to Y-85; Q-24 to N-84; Q-24 to Q-83; Q-24 to V-82; Q-24 to W-81 ; Q-24 to K-80; Q-24 to E-79; Q-24 to K-78; Q-24 to P-77; Q-24 to D-76; Q-24 to A- 75; Q-24 to C-74; Q-24 to 1-73; Q-24 to E-72; Q-24 to K-71 ; Q-24 to G-70; Q-24 to L-69; Q-24 to K-68; Q-24 to T-67; Q-24 to R-66; Q-24 to F-65; Q-24 to 1-64; Q-24 to V-63; Q-24 to A-62; Q-24 to K-61; Q-24 to Q-60; Q-24 to P-59; Q-24 to C-58; Q-24 to R-57; Q-24 to S-56; Q-24 to T-55; Q-24 to T-54; Q-24 to 1-53; Q-24 to V-52; Q-24 to Y-51; Q-24 to S-50; Q-24 to K-49; Q-24 to L-48; Q-24 to R-47; Q-24 to Q-46; Q-24 to L-45; Q-24 to S-44; Q- 24 to 1-43; Q-24 to K-42; Q-24 to K-41; Q-24 to S-40; Q-24 to S-39; Q-24 to F-38; Q-24 to T-37; Q-24 to F-36; Q-24 to C-35; Q-24 to C-34; Q-24 to T-33; Q-24 to S-32; Q-24 to P- 31; Q-24 to V-30; and Q-24 to N-29 of the mature Ckb-10 polypeptide shown in Figure 2 or SEQ JD NO:4. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Moreover, a signal sequence may be added to these C-terminal contracts. For example, amino acids 1-23 of SEQ ED NO:4, amino acids 2-23 of SEQ ED NO:4, amino acids 3-23 of SEQ ID NO:4, amino acids 4-23 of SEQ ED NO:4, amino acids 5-23 of SEQ JD NO:4, amino acids 6-23 of SEQ ED NO:4, amino acids 7-23 of SEQ ED NO:4, amino acids 8-23 of SEQ ID NO:4, amino acids 9-23 of SEQ ED NO:4, amino acids 10-23 of SEQ ID NO:4, amino acids 11-23 of SEQ ED NO:4, amino acids 12-23 of SEQ ED NO:4, amino acids 13-23 of SEQ ED NO:4, amino acids 14-23 of SEQ ED NO:4, amino acids 15-23 of SEQ JD NO:4, amino acids 16-23 of SEQ ED NO:4, amino acids 17-23 of SEQ ED NO:4, amino acids 18-23 of SEQ ID NO:4, amino acids 19-23 of SEQ ID NO:4, amino acids 20-23 of SEQ LD NO:4, amino acids 21-23 of SEQ ED NO:4, or amino acids 22-23 of SEQ LD NO:4 can be added to the N-terminus of each of the C-terminal constructs listed above.
In a preferred embodiment, any of the above listed constucts may include an N- terminal methionine. Polynucleotides encoding these polypeptides are also encompassed.
The present application is also directed to nucleic acid molecules comprising, or alternatively, consisting of, a polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%,
98%, or 99% identical to the polynucleotide sequence encoding the Ckβ-10 polypeptide described above. The present invention also encompasses the above polynucleotide sequences fused to a heterologous polynucleotide sequence.
In addition, any of the above listed N- or C-terminal deletions can be combined to produce a N- and C-terminal deleted Ckβ-10 polypeptide. The invention also provides polynucleotides which encode polypeptides having one or more amino acids deleted from both the amino and the carboxyl termini of the full-length Ckβ-10 polypeptide comprising or alternatively consisting of, amino acid residues described by the general formula n-m of SEQ ED NO:4, (e.g., n-m, n-m', n-m2, n'-m, n'-m', or n'-m2) where n, n', m, m' and m2 are integers as described above. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Particularly preferred are polynucleotides which encode Ckβ-10 polypeptides having
N and C-terminal deletions and include the polypeptides comprising amino acid residues: 17-74, 17-75, 17-76, 17-77, 17-78, 17-79, 17-80, 17-81, 17-82, 17-83, 17-84, 17-85,
17-86 17-87 17-88 17-89 17-90 17-91 17-92 17-93 17-94 17-95 17-96 17-97, 17-98 18-74 18-75 18-76 18-77 18-78 18-79 18-80 18-81 18-82 18-83 18-84, 18-85 18-86 18-87 18-88 18-89 18-90 18-91 18-92 18-93 18-94 18-95 18-96, 18-97 18-98 19-74 19-75 19-76 19-77 19-78 19-79 19-80 19-81 19-82 19-83, 19-84 19-85 19-86 19-87 19-88 19-89 19-90 19-91 19-92 19-93 19-94 19-95, 19-96 19-97 19-98 20-74 20-75 20-76 20-77 20-78 20-79 20-80 20-81 20-82, 20-83 20-84 20-85 20-86 20-87 20-88 20-89 20-90 20-91 20-92 20-93 20-94, 20-95 20-96 20-97 20-98 21-74 21-75 21-76 21-77 21-78 21 -79 21-80 21-81 , 21-82 21-83 21-84 21-85 21-86 21-87 21-88 21-89 21-90 21-91 21-92 21-93, 21-94 21-95 21-96 21-97 21-98 22-74 22-75 22-76 22-77. 22-78 22-79 22-80, 22-81 22-82 22-83 22-84 22-85 22-86 22-87 22-88 22-89 22-90 22-91 22-92, 22-93 22-94 22-95 22-96 22-97 22-98 23-74 23-75 23-76 23-77 23-78 23-79, 23-80 23-81 23-82 23-83 23-84 23-85 23-86 23-87 23-88 23-89 23-90 23-91, 23-92 23-93 23-94 23-95 23-96 23-97 23-98 24-74 24-75. 24-76 24-77 24-78, 24-79 24-80 24-81 24-82 24-83 24-84 24-85 24-86 24-87 24-88 24-89 24-90, 24-91 24-92 24-93 24-94 24-95 24-96 24-97 24-98 25-74 25-75 25-76 25-77, 25-78 25-79 25-80 25-81 25-82 25-83 25-84 25-85 25-86 25-87 25-88 25-89, 25-90 25-91 25-92 25-93 25-94 25-95 25-96 25-97 25-98 26-74 26-75 26-76, 26-77 26-78 26-79 26-80 26-81 26-82 26-83 26-84 26-85 26-86 26-87 26-88, 26-89 26-90 26-91 26-92 26-93 26-94 26-95 26-96 26-97 26-98 27-74 27-75, 27-76 27-77 27-78 27-79 27-80 27-81 27-82 27-83 27-84 27-85 27-86 27-87, 27-88 27-89 27-90 27-91 27-92 27-93 27-94 27-95 27-96 27-97 27-98 28-74, 28-75 28-76 28-77 28-78 28-79 28-80 28-81 28-82 28-83 28-84 28-85 28-86, 28-87 28-88 28-89 28-90 28-91 28-92 28-93 28-94 28-95 28-96 28-97 28-98, 29-74, 29-75, 29-76, 29-77, 29-78, 29-79, 29-80, 29-81, 29-82, 29-83, 29-84, 29-85, 29-86, 29-87, 29-88, 29-89, 29-90, 29-91, 29-92, 29-93, 29-94, 29-95, 29-96, 29-97 and 29-98 of SEQ ID NO:4. Polynucleotides encoding these polypeptides are also encompassed by the invention. Also included are a nucleotide sequence encoding a polypeptide consisting of a portion of the complete Ckβ-10 amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 75849, where this portion excludes any integer of amino acid residues from 1 to about 88 amino acids from the amino terminus of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 75849, or any integer of amino acid residues from 1 to about 88 amino acids from the carboxy terminus, or any combination of the above amino terminal and carboxy terminal deletions, of the complete amino acid sequence encoded by the cDNA clone contained in ATCC Deposit No. 75849. Polynucleotides encoding all of the above deletion mutant polypeptide forms also are provided. The present application is also directed to proteins containing polypeptides at least
90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the Ckβ-10 polypeptide sequence set forth herein by the general formula n-m of SEQ ED NO:4, (e.g., n-m, n-m', n- m2, n'-m, n'-m1, or n'-m2) where n, n', m, m' and m2 are integers as described above. In preferred embodiments, the application is directed to proteins containing polypeptides at least 90%, 95%, 96%, 97%, 98% or 99% identical to polypeptides having the amino acid sequence of the specific Ckβ-10 N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Additional preferred polypeptide fragments comprise, or alternatively consist of, the amino acid sequence of residues: M-l to A-15; K-2 to A-16; V-3 to F-17; S-4 to N-18; A-5 to P-19; V-6 to Q-20; L-7 to G-21; L-8 to L-22; C-9 to A-23; L-10 to Q-24; L-11 to P-25; L- 12 to D-26; M-13 to A-27; T-14 to L-28; A-15 to N-29; A-16 to V-30; F-17 to P-31; N-18 to S-32; P-19 to T-33; Q-20 to C-34; G-21 to C-35; L-22 to F-36; A-23 to T-37; Q-24 to F-38; P-25 to S-39; D-26 to S-40; A-27 to K-41; L-28 to K-42; N-29 to 1-43; V-30 to S-44; P-31 to L-45; S-32 to Q-46; T-33 to R-47; C-34 to L-48; C-35 to K-49; F-36 to S-50; T-37 to Y- 51; F-38 to V-52; S-39 to 1-53; S-40 to T-54; K-41 to T-55; K-42 to S-56; 1-43 to R-57; S- 44 to C-58; L-45 to P-59; Q-46 to Q-60; R-47 to K-61; L-48 to A-62; K-49 to V-63; S-50 to 1-64; Y-51 to F-65; V-52 to R-66; 1-53 to T-67; T-54 to K-68; T-55 to L-69; S-56 to G-70; R-57 to K-71; C-58 to E-72; P-59 to 1-73; Q-60 to C-74; K-61 to A-75; A-62 to D-76; V-63 to P-77; 1-64 to K-78; F-65 to E-79; R-66 to K-80; T-67 to W-81; K-68 to V-82; L-69 to Q- 83; G-70 to N-84; K-71 to Y-85; E-72 to M-86; 1-73 to K-87; C-74 to H-88; A-75 to L-89; D-76 to G-90; P-77 to R-91; K-78 to K-92; E-79 to A-93; K-80 to H-94; W-81 to T-95; V- 82 to L-96; Q-83 to K-97; N-84 to T-98 of SEQ ID NO:4. These polypeptide fragments may retain the biological activity of Ckβ-10 polypeptides of the invention and/or may be useful to generate or screen for antibodies, as described further below. Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
The present application is also directed to nucleic acid molecules comprising, or alternatively, consisting of, a polynucleotide sequence at least 90%, 92%, 95%, 96%, 97%,
98%, or 99% identical to the polynucleotide sequence encoding the Ckβ-10 polypeptide described above. The present invention also encompasses the above polynucleotide sequences fused to a heterologous polynucleotide sequence.
Additionally, the present application is also directed to proteins containing polypeptides at least 90%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the
Ckβ-10 polypeptide fragments set forth above. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Preferably, the polynucleotide fragments of the invention encode a polypeptide which demonstrates a Ckβ-10 functional activity. By a polypeptide demonstrating a Ckβ-10 "functional activity" is meant, a polypeptide capable of displaying one or more known functional activities associated with a full-length (complete) Ckβ-10 protein. Such functional activities include, but are not limited to, biological activity, antigenicity [ability to bind (or compete with a Ckβ-10 polypeptide for binding) to an anti- Ckβ-10 antibody], immunogenicity (ability to generate antibody which binds to a Ckβ-10 polypeptide), ability to form multimers with Ckβ-10 polypeptides of the invention, and ability to bind to a receptor or ligand for a Ckβ-10 polypeptide.
The functional activity of Ckβ-10 polypeptides, and fragments, variants derivatives, and analogs thereof, can be assayed by various methods.
For example, in one embodiment where one is assaying for the ability to bind or compete with full-length Ckβ-10 polypeptide for binding to anti- Ckβ-10 antibody, various immunoassays known in the art can be used, including but not limited to, competitive and non-competitive assay systems using techniques such as radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoradiometric assays, gel diffusion precipitation reactions, immunodiffusion assays, in situ immunoassays (using colloidal gold, enzyme or radioisotope labels, for example), western blots, precipitation reactions, agglutination assays (e.g., gel agglutination assays, hemagglutination assays), complement fixation assays, immunofluorescence assays, protein A assays, and immunoelectrophoresis assays, etc. In one embodiment, antibody binding is detected by detecting a label on the primary antibody. In another embodiment, the primary antibody is detected by detecting binding of a secondary antibody or reagent to the primary antibody. In a further embodiment, the secondary antibody is labeled. Many means are known in the art for detecting binding in an immunoassay and are within the scope of the present invention. In another embodiment, where a Ckβ-10 ligand is identified, or the ability of a polypeptide fragment, variant or derivative of the invention to multimerize is being evaluated, binding can be assayed, e.g., by means well-known in the art, such as, for example, reducing and non-reducing gel chromatography, protein affinity chromatography, and affinity blotting. See generally, Phizicky, E., et al., 1995, Microbiol. Rev. 59:94-123. In another embodiment, physiological correlates of Ckβ-10 binding to its substrates (signal transduction) can be assayed.
In addition, assays described herein (see Examples) and otherwise known in the art may routinely be applied to measure the ability of Ckβ-10 polypeptides and fragments, variants derivatives and analogs thereof to elicit Ckβ-10 related biological activity (either in vitro or in vivo). Other methods will be known to the skilled artisan and are within the scope of the invention.
Among the especially preferred fragments of the invention are fragments characterized by structural or functional attributes of Ckβ-10. Such fragments include amino acid residues that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta- sheet-forming regions ("beta-regions"), turn and turn-forming regions ("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, surface forming regions, and high antigenic index regions (i.e., containing four or more contiguous amino acids having an antigenic index of greater than or equal to 1.5, as identified using the default parameters of the Jameson-Wolf program) of complete (i.e., full-length) Ckβ-10 (SEQ ED
NO:4). Certain preferred regions are those set out in Figure 13 and include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence depicted in Figure 2 (SEQ ED NO:4), such preferred regions include; Garnier- Robson predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Chou-Fasman predicted alpha-regions, beta-regions, turn-regions, and coil-regions; Kyte-Doolittle predicted hydrophilic and hydrophobic regions; Eisenberg alpha and beta amphipathic regions; Emini surface-forming regions; and Jameson-Wolf high antigenic index regions, as predicted using the default parameters of these computer programs. Polynucleotides encoding these polypeptides are also encompassed by the invention. In additional embodiments, the polynucleotides of the invention encode functional attributes of Ckβ-10. Preferred embodiments of the invention in this regard include fragments that comprise alpha-helix and alpha-helix forming regions ("alpha-regions"), beta-sheet and beta-sheet forming regions ("beta-regions"), turn and turn-forming regions
("turn-regions"), coil and coil-forming regions ("coil-regions"), hydrophilic regions, hydrophobic regions, alpha amphipathic regions, beta amphipathic regions, flexible regions, surface-forming regions and high antigenic index regions of Ckβ-10.
The data representing the structural or functional attributes of Ckβ-10 set forth in
Figure 13 and/or Table I, as described above, was generated using the various modules and algorithms of the DNA* STAR set on default parameters. In a preferred embodiment, the data presented in columns VIII, IX, XIII, and XIV of Table I can be used to determine regions of Ckβ-10 which exhibit a high degree of potential for antigenicity. Regions of high antigenicity are determined from the data presented in columns VIII, IX, XIII, and/or LV by choosing values which represent regions of the polypeptide which are likely to be exposed on the surface of the polypeptide in an environment in which antigen recognition may occur in the process of initiation of an immune response.
Certain preferred regions in these regards are set out in Figure 13, but may, as shown in Table I, be represented or identified by using tabular representations of the data presented in Figure 13. The DNA*STAR computer algorithm used to generate Figure 13 (set on the original default parameters) was used to present the data in Figure 13 in a tabular format (See Table I). The tabular format of the data in Figure 13 may be used to easily determine specific boundaries of a preferred region.
The above-mentioned preferred regions set out in Figure 13 and in Table I include, but are not limited to, regions of the aforementioned types identified by analysis of the amino acid sequence set out in Figure 1. As set out in Figure 13 and in Table I, such preferred regions include Garnier-Robson alpha-regions, beta-regions, turn-regions, and coil-regions, Chou-Fasman alpha-regions, beta-regions, and coil-regions, Kyte-Doolittle hydrophilic regions and hydrophobic regions, Eisenberg alpha- and beta-amphipathic regions, Karplus-Schulz flexible regions, Emini surface-forming regions and Jameson-Wolf regions of high antigenic index. Table I
Res : Position I 11 III IV VI A /II VIII DC XI XII XIII XTV
Met 1 A A -0 36 -0 07 * 0 30 0 74
Lys 2 A A -0 82 -0 00 * 0 30 0 58
Val 3 A A - 1 24 0 21 * -0 30 0 34
Ser 4 A A - 1 67 0 47 * -0 60 0 28
Ala 5 A A - 1 94 0 54 * -0 60 0 1 2
Val 6 A A -2 16 1 1 1 * -0 60 0 08
Leu 7 A A -3 01 1 16 * -0 60 0 05
Leu 8 A A -2 97 1 46 -0 60 0 04
Cys 9 A A -3 27 1 64 -0 60 0 05
Leu 1 0 A A -2 99 1 61 -0 60 0 06
Leu 1 1 A A -2 72 1 41 -0 60 0 10
Leu 1 2 A A -2 50 1 23 -0 60 0 1 9
Met 1 3 A A -2 39 1 1 6 -0 60 0 23
Thr 14 A A - 1 72 1 26 -0 60 0 24
Ala 1 5 A A - 1 12 0 97 * -0 60 0 47
Ala 1 6 A A -0 31 0 71 * -0 60 0 73
Phe 1 7 A A 0 1 6 0 50 -0 60 0 87
Asn 1 8 T C -0 06 0 44 * F 0 15 0 85
Pro 19 T C -0 33 0 63 * F 0 15 0 70
Gin 20 T 0 26 0 63 * F 0 35 0 81
Gly 21 T C 0 63 0 24 * F 0 45 0 88
Leu 22 C 1 33 0 27 * F 0 25 0 88
Ala 23 B 0 74 -0 16 * F 0 65 0 85
Gin 24 B T 0 14 -0 06 F 0 85 0 86
Pro 25 B T 0 14 0 20 F 0 25 0 86
Asp 26 B T -0 37 -0 09 F 1 00 1 37
Ala 27 B T 0 23 0 06 0 10 0 59
Leu 28 B 0 52 0 09 -0 03 0 59
Asn 29 B 0 21 0 04 0 04 0 47
Val 30 B -0 24 0 53 F -0 04 0 67
Pro 31 T -0 91 0 60 F 0 43 0 44
Ser 32 T T - 1 02 0 49 * F 0 70 0 15
Thr 33 B T -0 52 0 87 * F 0 23 0 17
Cys 34 B T - 1 22 0 7 1 * 0 01 0 1 6
Cys 35 B T -0 67 1 07 -0 06 0 10
Phe 36 B B -0 76 1 07 * -0 53 0 1 0
Thr 37 B B -0 41 0 97 -0 32 0 24
Phe 38 A B -0 06 0 40 0 26 0 89
Ser 39 A T -0 28 -0 17 F 1 84 2 06
Ser 40 T T 0 09 -0 27 F 2 37 1 00
Lys 41 T T -0 02 -0 37 * F 2 80 1 55
Lys 42 A T 0 29 -0 47 F 1 97 0 95
He 43 A B 1 10 -0 46 F 1 44 1 23
Ser 44 A B 0 59 -0 84 1 3 1 1 20
Leu 45 B B 0 93 -0 16 0 78 0 50
Gin 46 B B 0 59 -0 16 0 85 1 42
Arg 47 B B 0 30 -0 46 * F 1 20 1 42
Leu 48 B T 0 33 -0 09 F 1 80 2 69
Lys 49 B T -0 26 -0 13 F 2 00 1 1 5
Ser 50 B T 0 24 0 16 * 0 90 0 41
Tyr 51 B T -0 07 0 64 * 0 40 0 72
Val 52 B B -0 48 0 44 * -0 20 0 52
He 53 B B 0 44 0 83 * -0 40 0 52
Thr 54 B B -0 27 0 44 F -0 45 0 65
Thr 55 B B -0 18 0 26 F 0 19 0 47
Ser 56 B 0 07 0 04 F 0 88 1 04
Arg 57 0 97 -0 24 * F 2 22 1 25 Table I (continued)
Res ] Position I II III rv v VI VII VIII IX X XI XII XIII XIV
Cys 58 T C 1 27 -0 73 * F 2 86 1 73
Pro 59 T T 0 72 -0 71 ^ * F 3 40 1 30
Gin 60 T T 0 14 -0 46 * * F 2 61 0 49
Lys 61 B T -0 26 0 23 * F 1 27 0 65
Ala 62 B B -0 26 0 44 0 08 0 36
Val 63 B B 0 10 0 01 0 04 0 41
He 64 B B 0 36 0 10 * -0 30 0 29
Phe 65 B B -0 46 0 10 * -0 30 0 58
Arg 66 A B -0 84 0 29 * -0 30 0 65
Thr 67 A B -0 21 0 07 * F -0 1 5 0 92
Lys 68 A B 0 64 -0 61 * F 0 90 2 12
Leu 69 A T 0 64 - 1 40 F 1 30 1 87
Gly 70 A T 0 68 -0 71 F 1 15 0 91
Lys 7 1 A A -0 02 -0 63 * F 0 75 0 24
Glu 72 A A 0 29 -0 13 * 0 30 0 30
He 73 A A 0 03 -0 81 * 0 60 0 50
Cys 74 A A 0 89 -0 81 " * 0 60 0 39
Ala 75 A A 1 23 -0 81 * * 0 60 0 45
Asp 76 A T 1 23 -0 81 * F 1 30 1 1 1
Pro 77 A T 0 94 - 1 50 F 1 30 4 14
Lys 78 A T 0 98 - 1 16 F 1 30 4 31
Glu 79 A T 1 64 - 1 01 F 1 30 1 92
Lys 80 A 2 23 -0 61 * * F 1 10 2 15
Trp 8 1 A 1 99 -0 64 F 1 10 1 73
Val 82 A 1 60 0 1 1 * 0 05 1 56
Gin 83 A 1 60 0 73 -0 40 0 77
Asn 84 A A 1 57 0 73 -0 45 1 47
Tyr 85 A A 0 71 0 31 * -0 15 2 69
Met 86 A A 0 66 0 36 * * -0 15 1 28
Lys 87 A A 1 62 0 39 -0 30 0 79
Leu 89 A A 1 08 -0 77 * 0 75 1 99
Gly 90 A A 1 29 -0 89 * F 0 90 1 01
Arg 91 A A 1 58 -0 39 F 0 60 1 01
Lys 92 A A 0 72 -0 40 * F 0 60 1 76
Ala 93 A A 0 80 -0 40 0 45 1 47
His 94 A A 1 30 -0 83 * 0 75 1 50
Thr 95 A A 1 26 -0 34 * 0 45 1 08
Leu 96 A B 0 76 0 09 * -0 15 1 37
Lys 97 A B 0 32 0 01 -0 15 1 29
Thr 98 A B 0 52 -0 06 0 45 1 14
Among highly preferred fragments in this regard are those that comprise regions of
Ckβ-10 that combine several structural features, such as several of the features set out above. Other preferred polypeptide fragments are biologically active Ckβ-10 fragments.
Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the Ckβ-10 polypeptide. The biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity. Polynucleotides encoding these polypeptide fragments are also encompassed by the invention.
However, many polynucleotide sequences, such as EST sequences, are publicly available and accessible through sequence databases. Some of these sequences are related to SEQ JD NO:3 and may have been publicly available prior to conception of the present invention. Preferably, such related polynucleotides are specifically excluded from the scope of the present invention. To list every related sequence would be cumbersome.
Accordingly, preferably excluded from the present invention are one or more polynucleotides comprising a nucleotide sequence described by the general formula of a-b, where a is any integer between 1 to 283 of SEQ ID NO:3, b is an integer of 15 to 297, where both a and b correspond to the positions of nucleotide residues shown in SEQ ED NO: 3, and where the b is greater than or equal to a + 14.
Such polypeptides may be produced by expressing a cDNA of the invention, particularly a cDNA having the sequence set out in Figures 1 (SEQ ED NO: l), 2, 5, or 12 (SEQ ID NO:3), or having the sequence of the human cDNA of the deposited clones, using for instance a baculovirus vector in insect host cells. The polynucleotides of the present invention may be in the form of RNA or in the form of DNA, which DNA includes cDNA, genomic DNA, and synthetic DNA. The DNA may be double-stranded or single-stranded, and if single stranded may be the coding strand or non-coding (anti-sense) strand. The coding sequence which encodes the mature polypeptides may be identical to the coding sequence shown in Figures 1 (SEQ JD NO:l) and 2 (SEQ ID NO:3) or that of the deposited clones or may be a different coding sequence which coding sequence, as a result of the redundancy or degeneracy of the genetic code, encodes the same mature polypeptides, or the other polypeptides noted herein, as for instance noted herein above, as the amino acid sequences of Figures 1 (SEQ ID NO:2), 2, 5 or 12 (SEQ ID NO:4), or those encoded by the deposited cDNAs. The polynucleotide which encodes polypeptides of Figures 1 (SEQ ED NO:2), 2, 5 , or 12 (SEQ ID NO:4), and as noted elsewhere herein, or for the polypeptides encoded by the deposited cDNAs, may include: only the coding sequence for the mature polypeptide; the coding sequence for the mature polypeptide and additional coding sequence such as a leader or secretory sequence or a proprotein sequence; the coding sequence for the mature polypeptide (and optionally additional coding sequence) and non-coding sequence, such as introns or non-coding sequence 5' and/or 3' of the coding sequence for the mature polypeptides.
Thus, the term "polynucleotide encoding a polypeptide" encompasses a polynucleotide which includes only coding sequence for the polypeptide as well as a polynucleotide which includes additional coding and/or non-coding sequence.
The present invention further relates to variants of the hereinabove described polynucleotides which encode for fragments, analogs and derivatives of the polypeptide having the deduced amino acid sequence of Figures 1 and 2, and the sequences set out in Figure 5 and 12, or the polypeptides encoded by the cDNA of the deposited clones. The variant of the polynucleotides may be a naturally occurring allelic variant of the polynucleotides or a non-naturally occurring variant of the polynucleotides. Thus, the present invention includes polynucleotides encoding the same mature polypeptides as shown in Figures 1 and 2, the polypeptides set out in Figure 5 or 12, or the same mature polypeptides encoded by the cDNA of the deposited clones as well as variants of such polynucleotides which variants encode for a fragment, derivative or analog of the polypeptides of Figures 1 and 2, or the polypeptides set out in Figure 5 or 12, or the polypeptides encoded by the cDNA of the deposited clones. Such nucleotide variants include deletion variants, substitution variants and addition or insertion variants.
As hereinabove indicated, the polynucleotides may have a coding sequence which is a naturally occurring allelic variant of the coding sequence shown in Figures 1 and 2, or the polypeptides set out in Figure 5 or 12, or of the coding sequence of the deposited clones. As known in the art, an allelic variant is an alternate form of a polynucleotide sequence which may have a substitution, deletion or addition of one or more nucleotides, which does not substantially alter the function of the encoded polypeptide.
The present invention also includes polynucleotides, wherein the coding sequence for the mature polypeptides may be fused in the same reading frame to a polynucleotide sequence which aids in expression and secretion of a polypeptide from a host cell, for example, a leader sequence which functions as a secretory sequence for controlling transport of a polypeptide from the cell. The polypeptide having a leader sequence is a preprotein and may have the leader sequence cleaved by the host cell to form the mature form of the polypeptide. The polynucleotides may also encode for a proprotein which is the mature protein plus additional 5' amino acid residues. A mature protein having a prosequence is a proprotein and is an inactive form of the protein. Once the prosequence is cleaved an active mature protein remains.
Thus, for example, the polynucleotide of the present invention may encode for a mature protein, or for a protein having a prosequence or for a protein having both a prosequence and a presequence (leader sequence).
The polynucleotides of the present invention may also have the coding sequence fused in frame to a marker sequence which allows for purification of the polypeptides of the present invention. The marker sequence may be a hexa-histidine tag supplied by a pQE-9 vector to provide for purification of the mature polypeptides fused to the marker in the case of a bacterial host, or, for example, the marker sequence may be a hemaglutinin (HA) tag when a mammalian host, e.g. COS-7 cells, is used. The HA tag corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson, I., et al., Cell, 37:767 (1984)). The present invention further relates to polynucleotides which hybridize to the hereinabove -described sequences if there is at least 50% and preferably 70% identity between the sequences. The present invention particularly relates to polynucleotides which hybridize under stringent conditions to the hereinabove-described polynucleotides . As herein used, the term "stringent conditions" means hybridization will occur only if there is at least 95% and preferably at least 97% identity between the sequences. The polynucleotides which hybridize to the hereinabove described polynucleotides in a preferred embodiment encode polypeptides which retain substantially the same biological function or activity as the mature polypeptide encoded by the cDNA of Figures 1 and 2, or the polypeptides set out in Figure 5 or 12, or the deposited cDNA. The deposit(s) referred to herein will be maintained under the terms of the Budapest
Treaty on the International Recognition of the Deposit of Micro-organisms for purposes of Patent Procedure. These deposits are provided merely as convenience to those of skill in the art and are not an admission that a deposit is required under 35 U.S.C. § 112. The sequence of the polynucleotides contained in the deposited materials, as well as the amino acid sequence of the polypeptides encoded thereby, are incorporated herein by reference and are controlling in the event of any conflict with any description of sequences herein. A license may be required to make, use or sell the deposited materials, and no such license is hereby granted.
The present invention further relates to chemokine polypeptides which have the deduced amino acid sequences of Figures 1 and 2 or which has the amino acid sequence encoded by the deposited cDNA, as well as fragments, analogs and derivatives of such polypeptides.
The terms "fragment," "derivative" and "analog" when referring to the polypeptides of Figures 1 and 2 or that encoded by the deposited cDNA, means polypeptides which retain essentially the same biological function or activity as such polypeptides. Thus, an analog includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
The chemokine polypeptides of the present invention may be recombinant polypeptides, natural polypeptides or a synthetic polypeptides, preferably recombinant polypeptides.
The fragment, derivative or analog of the polypeptides of Figures 1 and 2, or of the polypeptides of Figure 5 or 12, or that encoded by the deposited cDNAs may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non- conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, or (ii) one in which one or more of the amino acid residues includes a substituent group, or (iii) one in which the mature polypeptide is fused with another compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) one in which the additional amino acids are fused to the mature polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.
Epitopes and Antibodies
The present invention encompasses polypeptides comprising, or alternatively consisting of, an epitope of the polypeptide having an amino acid sequence of SEQ ED NO:2 or SEQ ED NO:4, or an epitope of the polypeptide sequence encoded by a polynucleotide sequence contained in ATCC Deposit No: 75848 or 75849 or encoded by a polynucleotide that hybridizes to the complement of the sequence of SEQ JD NO: 1 or SEQ ED NO:3 or contained in ATCC Deposit No: 75848 or 75849 under stringent hybridization conditions or lower stringency hybridization conditions as defined supra. The present invention further encompasses polynucleotide sequences encoding an epitope of a polypeptide sequence of the invention (such as, for example, the sequence disclosed in SEQ ID NO:l or SEQ ED NO:3), polynucleotide sequences of the complementary strand of a polynucleotide sequence encoding an epitope of the invention, and polynucleotide sequences which hybridize to the complementary strand under stringent hybridization conditions or lower stringency hybridization conditions defined supra. The term "epitopes," as used herein, refers to portions of a polypeptide having antigenic or immunogenic activity in an animal, preferably a mammal, and most preferably in a human. In a preferred embodiment, the present invention encompasses a polypeptide comprising an epitope, as well as the polynucleotide encoding this polypeptide. An "immunogenic epitope," as used herein, is defined as a portion of a protein that elicits an antibody response in an animal, as determined by any method known in the art, for example, by the methods for generating antibodies described infra. (See, for example, Geysen et al., Proc. Natl. Acad. Sci. USA 81 :3998- 4002 (1983)). The term "antigenic epitope," as used herein, is defined as a portion of a protein to which an antibody can immunospecifically bind its antigen as determined by any method well known in the art, for example, by the immunoassays described herein. Immunospecific binding excludes nonspecific binding but does not necessarily exclude cross- reactivity with other antigens. Antigenic epitopes need not necessarily be immunogenic. Fragments which function as epitopes may be produced by any conventional means.
(See, e.g., Houghten, Proc. Natl. Acad. Sci. USA 82:5131-5135 (1985), further described in U.S. Patent No. 4,631,211).
In the present invention, antigenic epitopes preferably contain a sequence of at least 4, at least 5, at least 6, at least 7, more preferably at least 8, at least 9, at least 10, at least 11 , at least 12, at least 13, at least 14, at least 15, at least 20, at least 25, at least 30, at least 40, at least 50, and, most preferably, between about 15 to about 30 amino acids. Preferred polypeptides comprising immunogenic or antigenic epitopes are at least 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100 amino acid residues in length. Additional non-exclusive preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as portions thereof. Antigenic epitopes are useful, for example, to raise antibodies, including monoclonal antibodies, that specifically bind the epitope. Preferred antigenic epitopes include the antigenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these antigenic epitopes. Antigenic epitopes can be used as the target molecules in immunoassays. (See, for instance, Wilson et al., Cell 37:767- 778 (1984); Sutcliffe et al., Science 219:660-666 (1983)).
Similarly, immunogenic epitopes can be used, for example, to induce antibodies according to methods well known in the art. (See, for instance, Sutcliffe et al., supra; Wilson et al., supra; Chow et al., Proc. Natl. Acad. Sci. USA 82:910-914; and Bittle et al., J. Gen. Virol. 66:2347-2354 (1985). Preferred immunogenic epitopes include the immunogenic epitopes disclosed herein, as well as any combination of two, three, four, five or more of these immunogenic epitopes. The polypeptides comprising one or more immunogenic epitopes may be presented for eliciting an antibody response together with a carrier protein, such as an albumin, to an animal system (such as rabbit or mouse), or, if the polypeptide is of sufficient length (at least about 25 amino acids), the polypeptide may be presented without a carrier. However, immunogenic epitopes comprising as few as 8 to 10 amino acids have been shown to be sufficient to raise antibodies capable of binding to, at the very least, linear epitopes in a denatured polypeptide (e.g., in Western blotting).
Epitope-bearing polypeptides of the present invention may be used to induce antibodies according to methods well known in the art including, but not limited to, in vivo immunization, in vitro immunization, and phage display methods. See, e.g., Sutcliffe et al., supra; Wilson et al., supra, and Bittle et al., J. Gen. Virol., 66:2347-2354 (1985). If in vivo immunization is used, animals may be immunized with free peptide; however, anti- peptide antibody titer may be boosted by coupling the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid. For instance, peptides containing cysteine residues may be coupled to a carrier using a linker such as maleimidobenzoyl- N-hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutar aldehyde. Animals such as rabbits, rats and mice are immunized with either free or carrier- coupled peptides, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 μg of peptide or carrier protein and Freund's adjuvant or any other adjuvant known for stimulating an immune response. Several booster injections may be needed, for instance, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface. The titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
As one of skill in the art will appreciate, and as discussed above, the polypeptides of the present invention comprising an immunogenic or antigenic epitope can be fused to other polypeptide sequences. For example, the polypeptides of the present invention may be fused with the constant domain of immunoglobulins (IgA, IgE, IgG, IgM), or portions thereof (CHI, CH2, CH3, or any combination thereof and portions thereof) resulting in chimeric polypeptides. Such fusion proteins may facilitate purification and may increase half-life in vivo. This has been shown for chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. See, e.g., EP 394,827; Traunecker et al., Nature, 331:84-86 (1988). Enhanced delivery of an antigen across the epithelial barrier to the immune system has been demonstrated for antigens (e.g., insulin) conjugated to an FcRn binding partner such as IgG or Fc fragments (see, e.g., PCT Publications WO 96/22024 and WO 99/04813). IgG Fusion proteins that have a disulfide-linked dimeric structure due to the IgG portion desulfide bonds have also been found to be more efficient in binding and neutralizing other molecules than monomeric polypeptides or fragments thereof alone. See, e.g., Fountoulakis et al., J. Biochem., 270:3958-3964 (1995). Nucleic acids encoding the above epitopes can also be recombined with a gene of interest as an epitope tag (e.g., the hemagglutinin ("HA") tag or flag tag) to aid in detection and purification of the expressed polypeptide. For example, a system described by Janknecht et al. allows for the ready purification of non-denatured fusion proteins expressed in human cell lines (Janknecht et al., 1991, Proc. Natl. Acad. Sci. USA 88:8972- 897). In this system, the gene of interest is subcloned into a vaccinia recombination plasmid such that the open reading frame of the gene is translationally fused to an amino-terminal tag consisting of six histidine residues. The tag serves as a matrix binding domain for the fusion protein. Extracts from cells infected with the recombinant vaccinia virus are loaded onto Ni2+ nitriloacetic acid-agarose column and histidine-tagged proteins can be selectively eluted with imidazole-containing buffers.
Additional fusion proteins of the invention may be generated through the techniques of gene-shuffling, motif-shuffling, exon-shuffling, and or codon-shuffling (collectively referred to as "DNA shuffling"). DNA shuffling may be employed to modulate the activities of polypeptides of the invention, such methods can be used to generate polypeptides with altered activity, as well as agonists and antagonists of the polypeptides. See, generally, U.S. Patent Nos. 5,605,793; 5,811,238; 5,830,721; 5,834,252; and 5,837,458, and Patten et al., Curr. Opinion Biotechnol. 8:724-33 (1997); Harayama, Trends Biotechnol. 16(2):76- 82 (1998); Hansson, et al., J. Mol. Biol. 287:265-76 (1999); and Lorenzo and Blasco, Biotechniques 24(2):308- 13 (1998) (each of these patents and publications are hereby incoφorated by reference in its entirety). In one embodiment, alteration of polynucleotides corresponding to SEQ ID NO:l or SEQ ID NO:3 and the polypeptides encoded by these polynucleotides may be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments by homologous or site-specific recombination to generate variation in the polynucleotide sequence. In another embodiment, polynucleotides of the invention, or the encoded polypeptides, may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of a polynucleotide encoding a polypeptide of the invention may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
Antibodies Further polypeptides of the invention relate to antibodies and T-cell antigen receptors
(TCR) which immunospecifically bind a polypeptide, polypeptide fragment, or variant of SEQ ED NO:2 or SED ED NO:4, and/or an epitope, of the present invention (as determined by immunoassays well known in the art for assaying specific antibody-antigen binding). Antibodies of the invention include, but are not limited to, polyclonal, monoclonal, multispecific, human, humanized or chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library, anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope -binding fragments of any of the above. The term "antibody," as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and LgA2) or subclass of immunoglobulin molecule. Most preferably the antibodies are human antigen-binding antibody fragments of the present invention and include, but are not limited to, Fab, Fab' and F(ab')2, Fd, single- chain Fvs (scFv), single-chain antibodies, disulfide-linked Fvs (sdFv) and fragments comprising either a VL or VH domain. Antigen-binding antibody fragments, including single-chain antibodies, may comprise the variable region(s) alone or in combination with the entirety or a portion of the following: hinge region, CHI, CH2, and CH3 domains. Also included in the invention are antigen-binding fragments also comprising any combination of variable region(s) with a hinge region, CHI, CH2, and CH3 domains. The antibodies of the invention may be from any animal origin including birds and mammals. Preferably, the antibodies are human, murine (e.g., mouse and rat), donkey, ship rabbit, goat, guinea pig, camel, horse, or chicken. As used herein, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin and include antibodies isolated from human immunoglobulin libraries or from animals transgenic for one or more human immunoglobulin and that do not express endogenous immunoglobulins, as described infra and, for example in, U.S. Patent No. 5,939,598 by Kucherlapati et al.
The antibodies of the present invention may be monospecific, bispecific, trispecific or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. See, e.g., PCT publications WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J. Immunol. 147:60-69 (1991); U.S. Patent Nos. 4,474,893; 4,714,681 ; 4,925,648; 5,573,920; 5,601 ,819; Kostelny et al., J. Immunol. 148:1547-1553 (1992).
Antibodies of the present invention may be described or specified in terms of the epitope(s) or portion(s) of a polypeptide of the present invention which they recognize or specifically bind. The epitope(s) or polypeptide portion(s) may be specified as described herein, e.g., by N-terminal and C-terminal positions, by size in contiguous amino acid residues, or listed in the Tables and Figures. Preferred epitopes of the invention include: those identified in Table 1 and Figure 13, as well as polynucleotides that encode these epitopes. Antibodies which specifically bind any epitope or polypeptide of the present invention may also be excluded. Therefore, the present invention includes antibodies that specifically bind polypeptides of the present invention, and allows for the exclusion of the same.
Antibodies of the present invention may also be described or specified in terms of their cross-reactivity. Antibodies that do not bind any other analog, ortholog, or homolog of a polypeptide of the present invention are included. Antibodies that bind polypeptides with at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, and at least 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In specific embodiments, antibodies of the present invention cross-react with murine, rat and/or rabbit homologs of human proteins and the corresponding epitopes thereof. Antibodies that do not bind polypeptides with less than 95%, less than 90%, less than 85%, less than 80%, less than 75%, less than 70%, less than 65%, less than 60%, less than 55%, and less than 50% identity (as calculated using methods known in the art and described herein) to a polypeptide of the present invention are also included in the present invention. In a specific embodiment, the above-described cross-reactivity is with respect to any single specific antigenic or immunogenic polypeptide, or combination(s) of 2, 3, 4, 5, or more of the specific antigenic and/or immunogenic polypeptides disclosed herein. Further included in the present invention are antibodies which bind polypeptides encoded by polynucleotides which hybridize to a polynucleotide of the present invention under stringent hybridization conditions (as described herein). Antibodies of the present invention may also be described or specified in terms of their binding affinity to a polypeptide of the invention. Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10"2 M, 10"2 M, 5 X 10"3 M, 10"3 M, 5 X 10" 4 M, 10"4 M, 5 X 10"5 M, 10"5 M, 5 X 10"6 M, 10"6M, 5 X 10"7 M, 107 M, 5 X 10"8 M, 10"8 M, 5 X 10"9 M, 10"9 M, 5 X 10 '° M, 10 '° M, 5 X 10'" M, 10"" M, 5 X 10 '2 M, 10 12 M, 5 X 10-" M, 10 '3 M, 5 X lO"'4 M, 10"'4 M, 5 X 10"15 M, or 10"'5 M. The invention also provides antibodies that competitively inhibit binding of an antibody to an epitope of the invention as determined by any method known in the art for determining competitive binding, for example, the immunoassays described herein. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85 %, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50%.
Antibodies of the present invention may act as agonists or antagonists of the polypeptides of the present invention. For example, the present invention includes antibodies which disrupt the receptor/ligand interactions with the polypeptides of the invention either partially or fully. Preferrably, antibodies of the present invention bind an antigenic epitope disclosed herein, or a portion thereof. The invention features both receptor- specific antibodies and ligand-specific antibodies. The invention also features receptor- specific antibodies which do not prevent ligand binding but prevent receptor activation. Receptor activation (i.e., signaling) may be determined by techniques described herein or otherwise known in the art. For example, receptor activation can be determined by detecting the phosphorylation (e.g., tyrosine or serine/threonine) of the receptor or its substrate by immunoprecipitation followed by western blot analysis (for example, as described supra). In specific embodiments, antibodies are provided that inhibit ligand activity or receptor activity by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%, or at least 50% of the activity in absence of the antibody.
The invention also features receptor-specific antibodies which both prevent ligand binding and receptor activation as well as antibodies that recognize the receptor-ligand complex, and, preferably, do not specifically recognize the unbound receptor or the unbound ligand. Likewise, included in the invention are neutralizing antibodies which bind the ligand and prevent binding of the ligand to the receptor, as well as antibodies which bind the ligand, thereby preventing receptor activation, but do not prevent the ligand from binding the receptor. Further included in the invention are antibodies which activate the receptor. These antibodies may act as receptor agonists, i.e., potentiate or activate either all or a subset of the biological activities of the ligand-mediated receptor activation, for example, by inducing dimerization of the receptor. The antibodies may be specified as agonists, antagonists or inverse agonists for biological activities comprising the specific biological activities of the peptides of the invention disclosed herein. The above antibody agonists can be made using methods known in the art. See, e.g., PCT publication WO 96/40281; U.S. Patent No. 5,811,097; Deng et al., Blood 92(6)3981-1988 (1998); Chen et al., Cancer Res. 58(16):3668-3678 (1998); Harrop et al., J. Immunol. 161(4): 1786-1794 (1998); Zhu et al., Cancer Res. 58(15):3209-3214 (1998); Yoon et al., J. Immunol. 160(7):3170-3179 (1998); Prat et al., J. Cell. Sci. l l l(Pt2):237-247 (1998); Pitard et al., J. Immunol. Methods 205(2)377-190 (1997); Liautard et al, Cytokine 9(4):233-241 (1997); Carlson et al., J . Biol. Chem. 272(17)31295-11301 (1997); Taryman et al., Neuron 14(4):755-762 (1995); Muller et al., Structure 6(9)3153-1167 (1998); Bartunek et al., Cytokine 8(1)34-20 (1996) (which are all incoφorated by reference herein in their entireties).
Antibodies of the present invention may be used, for example, but not limited to, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of the polypeptides of the present invention in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988) (incoφorated by reference herein in its entirety).
As discussed in more detail below, the antibodies of the present invention may be used either alone or in combination with other compositions. The antibodies may further be recombinantly fused to a heterologous polypeptide at the N- or C-terminus or chemically conjugated (including covalently and non-covalently conjugations) to polypeptides or other compositions. For example, antibodies of the present invention may be recombinantly fused or conjugated to molecules useful as labels in detection assays and effector molecules such as heterologous polypeptides, drugs, radionuclides, or toxins. See, e.g., PCT publications WO 92/08495; WO 91/14438; WO 89/12624; U.S. Patent No. 5,314,995; and EP 396,387. The antibodies of the invention include derivatives that are modified, i.e, by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from generating an anti-idiotypic response. For example, but not by way of limitation, the antibody derivatives include antibodies that have been modified, e.g., by glycosylation, acetylation, pegylation, phosphylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Any of numerous chemical modifications may be carried out by known techniques, including, but not limited to specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non-classical amino acids.
The antibodies of the present invention may be generated by any suitable method known in the art. Polyclonal antibodies to an antigen-of- interest can be produced by various procedures well known in the art. For example, a polypeptide of the invention can be administered to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen. Various adjuvants may be used to increase the immunological response, depending on the host species, and include but are not limited to, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette- Guerin) and corynebacterium parvum. Such adjuvants are also well known in the art.
Monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling, et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981) (said references incoφorated by reference in their entireties). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known in the art and are discussed in detail in the Examples. In a non-limiting example, mice can be immunized with a polypeptide of the invention or a cell expressing such peptide. Once an immune response is detected, e.g., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused by well known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
Accordingly, the present invention provides methods of generating monoclonal antibodies as well as antibodies produced by the method comprising culturing a hybridoma cell secreting an antibody of the invention wherein, preferably, the hybridoma is generated by fusing splenocytes isolated from a mouse immunized with an antigen of the invention with myeloma cells and then screening the hybridomas resulting from the fusion for hybridoma clones that secrete an antibody able to bind a polypeptide of the invention.
Antibody fragments which recognize specific epitopes may be generated by known techniques. For example, Fab and F(ab')2 fragments of the invention may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain.
For example, the antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phage used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VLLI protein. Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed in Brinkman et al., J. Immunol. Methods 182:41-50 (1995); Ames et al., J. Immunol. Methods 184:177-186 (1995); Kettleborough et al., Eur. J. Immunol. 24:952-958 (1994); Persic et al., Gene 187 9-18 (1997); Burton et al., Advances in Immunology 57: 191-280 (1994); PCT application No. PCT/GB91/01134; PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/11236; WO 95/15982; WO 95/20401; and U.S. Patent Nos. 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108; each of which is incoφorated herein by reference in its entirety. As described in the above references, after phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria, e.g., as described in detail below. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al., BioTechniques 12(6):864-869 (1992); and Sawai et al., AJRI 34:26-34 (1995); and Better et al., Science 240: 1041-1043 (1988) (said references incoφorated by reference in their entireties). Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Patents 4,946,778 and 5,258,498; Huston et al., Methods in Enzymology 203:46-88 (1991); Shu et al., PNAS 90:7995-7999 (1993); and Skerra et al., Science 240:1038-1040 (1988). For some uses, including in vivo use of antibodies in humans and in vitro detection assays, it may be preferable to use chimeric, humanized, or human antibodies. A chimeric antibody is a molecule in which different portions of the antibody are derived from different animal species, such as antibodies having a variable region derived from a murine monoclonal antibody and a human immunoglobulin constant region. Methods for producing chimeric antibodies are known in the art. See e.g., Morrison, Science 229:1202 (1985); Oi et al, BioTechniques 4:214 (1986); Gillies et al., (1989) J. Immunol. Methods 125:191-202; U.S. Patent Nos. 5,807,715; 4,816,567; and 4,816397, which are incoφorated herein by reference in their entirety. Humanized antibodies are antibody molecules from non-human species antibody that binds the desired antigen having one or more complementarity determining regions (CDRs) from the non- human species and a framework regions from a human immunoglobulin molecule. Often, framework residues in the human framework regions will be substituted with the corresponding residue from the CDR donor antibody to alter, preferably improve, antigen binding. These framework substitutions are identified by methods well known in the art, e.g., by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions. (See, e.g., Queen et al., U.S. Patent No. 5,585,089; Riechmann et al., Nature 332:323 (1988), which are incoφorated herein by reference in their entireties.) Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; PCT publication WO 91/09967; U.S. Patent Nos. 5,225,539; 5,530,101 ; and 5,585,089), veneering or resurfacing (EP 592,106; EP 519,596; Padlan, Molecular Immunology 28(4/5):489-498 (1991); Studnicka et al., Protein Engineering 7(6):805-814 (1994); Roguska. et al., PNAS 91:969-973 (1994)), and chain shuffling (U.S. Patent No. 5,565,332). Completely human antibodies are particularly desirable for therapeutic treatment of human patients. Human antibodies can be made by a variety of methods known in the art including phage display methods described above using antibody libraries derived from human immunoglobulin sequences. See also, U.S. Patent Nos. 4,444,887 and 4,716,11 1; and PCT publications WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; each of which is incoφorated herein by reference in its entirety.
Human antibodies can also be produced using transgenic mice which are incapable of expressing functional endogenous immunoglobulins, but which can express human immunoglobulin genes. For example, the human heavy and light chain immunoglobulin gene complexes may be introduced randomly or by homologous recombination into mouse embryonic stem cells. Alternatively, the human variable region, constant region, and diversity region may be introduced into mouse embryonic stem cells in addition to the human heavy and light chain genes. The mouse heavy and light chain immunoglobulin genes may be rendered non-functional separately or simultaneously with the introduction of human immunoglobulin loci by homologous recombination. In particular, homozygous deletion of the JH region prevents endogenous antibody production. The modified embryonic stem cells are expanded and microinjected into blastocysts to produce chimeric mice. The chimeric mice are then bred to produce homozygous offspring which express human antibodies. The transgenic mice are immunized in the normal fashion with a selected antigen, e.g., all or a portion of a polypeptide of the invention. Monoclonal antibodies directed against the antigen can be obtained from the immunized, transgenic mice using conventional hybridoma technology. The human immunoglobulin transgenes harbored by the transgenic mice rearrange during B cell differentiation, and subsequently undergo class switching and somatic mutation. Thus, using such a technique, it is possible to produce therapeutically useful IgG, IgA, IgM and IgE antibodies. For an overview of this technology for producing human antibodies, see Lonberg and Huszar, Int. Rev. Immunol. 13:65-93 (1995). For a detailed discussion of this technology for producing human antibodies and human monoclonal antibodies and protocols for producing such antibodies, see, e.g., PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European Patent No. 0 598 877; U.S. Patent Nos. 5,413,923; 5,625,126; 5,633,425; 5,569,825; 5,661,016; 5,545,806; 5,814,318; 5,885,793; 5,916,771; and 5,939,598, which are incoφorated by reference herein in their entirety. In addition, companies such as Abgenix, Inc. (Freemont, CA) and Genpharm (San Jose, CA) can be engaged to provide human antibodies directed against a selected antigen using technology similar to that described above.
Completely human antibodies which recognize a selected epitope can be generated using a technique referred to as "guided selection." In this approach a selected non-human monoclonal antibody, e.g., a mouse antibody, is used to guide the selection of a completely human antibody recognizing the same epitope. (Jespers et al., Bio/technology 12:899-903 (1988)).
Further, antibodies to the polypeptides of the invention can, in turn, be utilized to generate anti-idiotype antibodies that "mimic" polypeptides of the invention using techniques well known to those skilled in the art. (See, e.g., Greenspan & Bona, FASEB J. 7(5):437- 444; (1989) and Nissinoff, J. Immunol. 147(8):2429-2438 (1991)). For example, antibodies which bind to and competitively inhibit polypeptide multimerization and/or binding of a polypeptide of the invention to a ligand can be used to generate anti-idiotypes that "mimic" the polypeptide multimerization and/or binding domain and, as a consequence, bind to and neutralize polypeptide and or its ligand. Such neutralizing anti-idiotypes or Fab fragments of such anti-idiotypes can be used in therapeutic regimens to neutralize polypeptide ligand. For example, such anti-idiotypic antibodies can be used to bind a polypeptide of the invention and/or to bind its ligands/receptors, and thereby block its biological activity.
Polynucleotides Encoding Antibodies
The invention further provides polynucleotides comprising a nucleotide sequence encoding an antibody of the invention and fragments thereof. The invention also encompasses polynucleotides that hybridize under stringent or lower stringency hybridization conditions, e.g., as defined supra, to polynucleotides that encode an antibody, preferably, that specifically binds to a polypeptide of the invention, preferably, an antibody that binds to a polypeptide having the amino acid sequence of SEQ ED NO: 2 or SEQ ED NO:4. The polynucleotides may be obtained, and the nucleotide sequence of the polynucleotides determined, by any method known in the art. For example, if the nucleotide sequence of the antibody is known, a polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier et al., BioTechniques 17:242 (1994)), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding the antibody, annealing and ligating of those oligonucleotides, and then amplification of the ligated oligonucleotides by PCR.
Alternatively, a polynucleotide encoding an antibody may be generated from nucleic acid from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from a suitable source (e.g., an antibody cDNA library, or a cDNA library generated from, or nucleic acid, preferably poly A+ RNA, isolated from, any tissue or cells expressing the antibody, such as hybridoma cells selected to express an antibody of the invention) by PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of the sequence or by cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acids generated by PCR may then be cloned into replicable cloning vectors using any method well known in the art.
Once the nucleotide sequence and corresponding amino acid sequence of the antibody is determined, the nucleotide sequence of the antibody may be manipulated using methods well known in the art for the manipulation of nucleotide sequences, e.g., recombinant DNA techniques, site directed mutagenesis, PCR, etc. (see, for example, the techniques described in Sambrook et al., 1990, Molecular Cloning, A Laboratory Manual, 2d Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY and Ausubel et al, eds., 1998, Current Protocols in Molecular Biology, John Wiley & Sons, NY, which are both incoφorated by reference herein in their entireties ), to generate antibodies having a different amino acid sequence, for example to create amino acid substitutions, deletions, and/or insertions.
In a specific embodiment, the amino acid sequence of the heavy and/or light chain variable domains may be inspected to identify the sequences of the complementarity determining regions (CDRs) by methods that are well know in the art, e.g., by comparison to known amino acid sequences of other heavy and light chain variable regions to determine the regions of sequence hypervariability. Using routine recombinant DNA techniques, one or more of the CDRs may be inserted within framework regions, e.g., into human framework regions to humanize a non-human antibody, as described supra. The framework regions may be naturally occurring or consensus framework regions, and preferably human framework regions (see, e.g., Chothia et al., J. Mol. Biol. 278: 457-479 (1998) for a listing of human framework regions). Preferably, the polynucleotide generated by the combination of the framework regions and CDRs encodes an antibody that specifically binds a polypeptide of the invention. Preferably, as discussed supra, one or more amino acid substitutions may be made within the framework regions, and, preferably, the amino acid substitutions improve binding of the antibody to its antigen. Additionally, such methods may be used to make amino acid substitutions or deletions of one or more variable region cysteine residues participating in an intrachain disulfide bond to generate antibody molecules lacking one or more intrachain disulfide bonds. Other alterations to the polynucleotide are encompassed by the present invention and within the skill of the art.
In addition, techniques developed for the production of "chimeric antibodies" (Morrison et al., Proc. Natl. Acad. Sci. 81:851-855 (1984); Neuberger et al., Nature 312:604-608 (1984); Takeda et al., Nature 314:452-454 (1985)) by splicing genes from a mouse antibody molecule of appropriate antigen specificity together with genes from a human antibody molecule of appropriate biological activity can be used. As described supra, a chimeric antibody is a molecule in which different portions are derived from different animal species, such as those having a variable region derived from a murine mAb and a human immunoglobulin constant region, e.g., humanized antibodies.
Alternatively, techniques described for the production of single chain antibodies (U.S. Patent No. 4,946,778; Bird, Science 242:423- 42 (1988); Huston et al., Proc. Natl. Acad. Sci. USA 85:5879-5883 (1988); and Ward et al., Nature 334:544-54 (1989)) can be adapted to produce single chain antibodies. Single chain antibodies are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge, resulting in a single chain polypeptide. Techniques for the assembly of functional Fv fragments in E. coli may also be used (Skerra et al., Science 242:1038- 1041 (1988)).
Methods of Producing Antibodies
The antibodies of the invention can be produced by any method known in the art for the synthesis of antibodies, in particular, by chemical synthesis or preferably, by recombinant expression techniques.
Recombinant expression of an antibody of the invention, or fragment, derivative or analog thereof, (e.g., a heavy or light chain of an antibody of the invention or a single chain antibody of the invention), requires construction of an expression vector containing a polynucleotide that encodes the antibody. Once a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof (preferably containing the heavy or light chain variable domain), of the invention has been obtained, the vector for the production of the antibody molecule may be produced by recombinant DNA technology using techniques well known in the art. Thus, methods for preparing a protein by expressing a polynucleotide containing an antibody encoding nucleotide sequence are described herein. Methods which are well known to those skilled in the art can be used to construct expression vectors containing antibody coding sequences and appropriate transcriptional and translational control signals. These methods include, for example, in vitro recombinant DNA techniques, synthetic techniques, and in vivo genetic recombination.
The invention, thus, provides replicable vectors comprising a nucleotide sequence encoding an antibody molecule of the invention, or a heavy or light chain thereof, or a heavy or light chain variable domain, operably linked to a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., PCT Publication WO 86/05807; PCT Publication WO 89/01036; and U.S. Patent No. 5,122,464) and the variable domain of the antibody may be cloned into such a vector for expression of the entire heavy or light chain.
The expression vector is transferred to a host cell by conventional techniques and the transfected cells are then cultured by conventional techniques to produce an antibody of the invention. Thus, the invention includes host cells containing a polynucleotide encoding an antibody of the invention, or a heavy or light chain thereof, or a single chain antibody of the invention, operably linked to a heterologous promoter. In preferred embodiments for the expression of double-chained antibodies, vectors encoding both the heavy and light chains may be co-expressed in the host cell for expression of the entire immunoglobulin molecule, as detailed below.
A variety of host-expression vector systems may be utilized to express the antibody molecules of the invention. Such host-expression systems represent vehicles by which the coding sequences of interest may be produced and subsequently purified, but also represent cells which may, when transformed or transfected with the appropriate nucleotide coding sequences, express an antibody molecule of the invention in situ. These include but are not limited to microorganisms such as bacteria (e.g., E. coli, B. subtilis) transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors containing antibody coding sequences; yeast (e.g., Saccharomyces, Pichia) transformed with recombinant yeast expression vectors containing antibody coding sequences; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) containing antibody coding sequences; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid) containing antibody coding sequences; or mammalian cell systems (e.g., COS, CHO, BHK, 293, 3T3 cells) harboring recombinant expression constructs containing promoters derived from the genome of mammalian cells (e.g., metallothionein promoter) or from mammalian viruses (e.g., the adenovirus late promoter; the vaccinia virus 7.5K promoter). Preferably, bacterial cells such as Escherichia coli, and more preferably, eukaryotic cells, especially for the expression of whole recombinant antibody molecule, are used for the expression of a recombinant antibody molecule. For example, mammalian cells such as Chinese hamster ovary cells (CHO), in conjunction with a vector such as the major intermediate early gene promoter element from human cytomegalovirus is an effective expression system for antibodies (Foecking et al., Gene 45:101 (1986); Cockett et al., Bio/Technology 8:2 (1990)).
In bacterial systems, a number of expression vectors may be advantageously selected depending upon the use intended for the antibody molecule being expressed. For example, when a large quantity of such a protein is to be produced, for the generation of pharmaceutical compositions of an antibody molecule, vectors which direct the expression of high levels of fusion protein products that are readily purified may be desirable. Such vectors include, but are not limited, to the E. coli expression vector pUR278 (Ruther et al., EMBO J. 2:1791 (1983)), in which the antibody coding sequence may be ligated individually into the vector in frame with the lac Z coding region so that a fusion protein is produced; pIN vectors (Inouye & Inouye, Nucleic Acids Res. 13:3101-3109 (1985); Van Heeke & Schuster, J. Biol. Chem. 24:5503-5509 (1989)); and the like. pGEX vectors may also be used to express foreign polypeptides as fusion proteins with glutathione S- transferase (GST). In general, such fusion proteins are soluble and can easily be purified from lysed cells by adsoφtion and binding to matrix glutathione-agarose beads followed by elution in the presence of free glutathione. The pGEX vectors are designed to include thrombin or factor Xa protease cleavage sites so that the cloned target gene product can be released from the GST moiety.
In an insect system, Autographa califomica nuclear polyhedrosis virus (AcNPV) is used as a vector to express foreign genes. The virus grows in Spodoptera frugiperda cells. The antibody coding sequence may be cloned individually into non-essential regions (for example the polyhedrin gene) of the virus and placed under control of an AcNPV promoter (for example the polyhedrin promoter).
In mammalian host cells, a number of viral-based expression systems may be utilized. In cases where an adenovirus is used as an expression vector, the antibody coding sequence of interest may be ligated to an adenovirus transcription/translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene may then be inserted in the adenovirus genome by in vitro or in vivo recombination. Insertion in a non- essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the antibody molecule in infected hosts, (e.g., see Logan & Shenk, Proc. Natl. Acad. Sci. USA 81:355-359 (1984)). Specific initiation signals may also be required for efficient translation of inserted antibody coding sequences. These signals include the ATG initiation codon and adjacent sequences. Furthermore, the initiation codon must be in phase with the reading frame of the desired coding sequence to ensure translation of the entire insert. These exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of appropriate transcription enhancer elements, transcription terminators, etc. (see Bittner et al., Methods in Enzymol. 153:51-544 (1987)).
In addition, a host cell strain may be chosen which modulates the expression of the inserted sequences, or modifies and processes the gene product in the specific fashion desired. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different host cells have characteristic and specific mechanisms for the post-translational processing and modification of proteins and gene products. Appropriate cell lines or host systems can be chosen to ensure the correct modification and processing of the foreign protein expressed. To this end, eukaryotic host cells which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product may be used. Such mammalian host cells include but are not limited to CHO, VERY, BHK, Hela, COS, MDCK, 293, 3T3, WI38, and in particular, breast cancer cell lines such as, for example, BT483, Hs578T, HTB2, BT20 and T47D, and normal mammary gland cell line such as, for example, CRL7030 and Hs578Bst.
For long-term, high-yield production of recombinant proteins, stable expression is preferred. For example, cell lines which stably express the antibody molecule may be engineered. Rather than using expression vectors which contain viral origins of replication, host cells can be transformed with DNA controlled by appropriate expression control elements (e.g., promoter, enhancer, sequences, transcription terminators, polyadenylation sites, etc.), and a selectable marker. Following the introduction of the foreign DNA, engineered cells may be allowed to grow for 1-2 days in an enriched media, and then are switched to a selective media. The selectable marker in the recombinant plasmid confers resistance to the selection and allows cells to stably integrate the plasmid into their chromosomes and grow to form foci which in turn can be cloned and expanded into cell lines. This method may advantageously be used to engineer cell lines which express the antibody molecule. Such engineered cell lines may be particularly useful in screening and evaluation of compounds that interact directly or indirectly with the antibody molecule.
A number of selection systems may be used, including but not limited to the heφes simplex virus thymidine kinase (Wigler et al., Cell 11:223 (1977)), hypoxanthine-guanine phosphoribosyltransferase (Szybalska & Szybalski, Proc. Natl. Acad. Sci. USA 48:202 (1992)), and adenine phosphoribosyltransferase (Lowy et al., Cell 22:817 (1980)) genes can be employed in tk-, hgprt- or aprt- cells, respectively. Also, antimetabolite resistance can be used as the basis of selection for the following genes: dhfr, which confers resistance to methotrexate (Wigler et al., Natl. Acad. Sci. USA 77:357 (1980); O'Hare et al., Proc. Natl. Acad. Sci. USA 78: 1527 (1981)); gpt, which confers resistance to mycophenolic acid (Mulligan & Berg, Proc. Natl. Acad. Sci. USA 78:2072 (1981)); neo, which confers resistance to the aminoglycoside G-418 Clinical Pharmacy 12:488-505; Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, 1993, TLB TECH 11(5)355-215); and hygro, which confers resistance to hygromycin (Santerre et al., Gene 30:147 (1984)). Methods commonly known in the art of recombinant DNA technology may be routinely applied to select the desired recombinant clone, and such methods are described, for example, in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990); and in Chapters 12 and 13, Dracopoli et al. (eds), Current Protocols in Human Genetics, John Wiley & Sons, NY (1994); Colberre-Garapin et al., J. Mol. Biol. 150:1 (1981), which are incoφorated by reference herein in their entireties.
The expression levels of an antibody molecule can be increased by vector amplification (for a review, see Bebbington and Hentschel, The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning, Vol.3. (Academic Press, New York, 1987)). When a marker in the vector system expressing antibody is amplifiable, increase in the level of inhibitor present in culture of host cell will increase the number of copies of the marker gene. Since the amplified region is associated with the antibody gene, production of the antibody will also increase (Crouse et al., Mol. Cell. Biol. 3:257 (1983)).
The host cell may be co-transfected with two expression vectors of the invention, the first vector encoding a heavy chain derived polypeptide and the second vector encoding a light chain derived polypeptide. The two vectors may contain identical selectable markers which enable equal expression of heavy and light chain polypeptides. Alternatively, a single vector may be used which encodes, and is capable of expressing, both heavy and light chain polypeptides. In such situations, the light chain should be placed before the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc. Natl. Acad. Sci. USA 77:2197 (1980)). The coding sequences for the heavy and light chains may comprise cDNA or genomic DNA.
Once an antibody molecule of the invention has been produced by an animal, chemically synthesized, or recombinantly expressed, it may be purified by any method known in the art for purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion exchange, affinity, particularly by affinity for the specific antigen after Protein A, and sizing column chromatography), centrifugation, differential solubility, or by any other standard technique for the purification of proteins. In addition, the antibodies of the present invention or fragments thereof can be fused to heterologous polypeptide sequences described herein or otherwise known in the art, to facilitate purification.
The present invention encompasses antibodies recombinantly fused or chemically conjugated (including both covalently and non-covalently conjugations) to a polypeptide (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention to generate fusion proteins. The fusion does not necessarily need to be direct, but may occur through linker sequences. The antibodies may be specific for antigens other than polypeptides (or portion thereof, preferably at least 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 amino acids of the polypeptide) of the present invention. For example, antibodies may be used to target the polypeptides of the present invention to particular cell types, either in vitro or in vivo, by fusing or conjugating the polypeptides of the present invention to antibodies specific for particular cell surface receptors. Antibodies fused or conjugated to the polypeptides of the present invention may also be used in in vitro immunoassays and purification methods using methods known in the art. See e.g., Harbor et al., supra, and PCT publication WO 93/21232; EP 439,095; Naramura et al., Immunol. Lett. 39:91-99 (1994); U.S. Patent 5,474,981 ; Gillies et al., PNAS 89: 1428-1432 (1992); Fell et al., J. Immunol. 146:2446-2452(1991), which are incoφorated by reference in their entireties.
The present invention further includes compositions comprising the polypeptides of the present invention fused or conjugated to antibody domains other than the variable regions. For example, the polypeptides of the present invention may be fused or conjugated to an antibody Fc region, or portion thereof. The antibody portion fused to a polypeptide of the present invention may comprise the constant region, hinge region, CHI domain, CH2 domain, and CH3 domain or any combination of whole domains or portions thereof. The polypeptides may also be fused or conjugated to the above antibody portions to form multimers. For example, Fc portions fused to the polypeptides of the present invention can form dimers through disulfide bonding between the Fc portions. Higher multimeric forms can be made by fusing the polypeptides to portions of IgA and IgM. Methods for fusing or conjugating the polypeptides of the present invention to antibody portions are known in the art. See, e.g., U.S. Patent Nos. 5,336,603; 5,622,929; 5,359,046; 5,349,053; 5,447,851; 5,112,946; EP 307,434; EP 367,166; PCT publications WO 96/04388; WO 91/06570; Ashkenazi et al., Proc. Natl. Acad. Sci. USA 88: 10535-10539 (1991); Zheng et al., J. Immunol. 154:5590-5600 (1995); and Vil et al., Proc. Natl. Acad. Sci. USA 89: 11337- 11341(1992) (said references incoφorated by reference in their entireties).
As discussed, supra, the polypeptides corresponding to a polypeptide, polypeptide fragment, or a variant of SEQ ID NO:2 or SEQ ED NO:4 may be fused or conjugated to the above antibody portions to increase the in vivo half life of the polypeptides or for use in immunoassays using methods known in the art. Further, the polypeptides corresponding to SEQ ID NO:2 or SEQ ID NO:4 may be fused or conjugated to the above antibody portions to facilitate purification. One reported example describes chimeric proteins consisting of the first two domains of the human CD4-polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. (EP 394,827; Traunecker et al., Nature 331:84-86 (1988). The polypeptides of the present invention fused or conjugated to an antibody having disulfide- linked dimeric structures (due to the IgG) may also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone. (Fountoulakis et al., J. Biochem. 270:3958-3964 (1995)). In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties. (EP A 232,262). Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fc portions for the puφose of high-throughput screening assays to identify antagonists of ML- 5. (See, Bennett et al., J. Molecular Recognition 8:52-58 (1995); Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).
Moreover, the antibodies or fragments thereof of the present invention can be fused to marker sequences, such as a peptide to facilitate purification. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Other peptide tags useful for purification include, but are not limited to, the "HA" tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., Cell 37:767 (1984)) and the "flag" tag.
The present invention further encompasses antibodies or fragments thereof conjugated to a diagnostic or therapeutic agent. The antibodies can be used diagnostically to, for example, monitor the development or progression of a tumor as part of a clinical testing procedure to, e.g., determine the efficacy of a given treatment regimen. Detection can be facilitated by coupling the antibody to a detectable substance. Examples of detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, radioactive materials, positron emitting metals using various positron emission tomographies, and nonradioactive paramagnetic metal ions. The detectable substance may be coupled or conjugated either directly to the antibody (or fragment thereof) or indirectly, through an intermediate (such as, for example, a linker known in the art) using techniques known in the art. See, for example, U.S. Patent No. 4,741,900 for metal ions which can be conjugated to antibodies for use as diagnostics according to the present invention. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic group complexes include streptavidin/biotin and avidin/biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; an example of a luminescent material includes luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin; and examples of suitable radioactive material include 1251, 1311, 11 lln or 99Tc.
Further, an antibody or fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters such as, for example, 213BL A cytotoxin or cytotoxic agent includes any agent that is detrimental to cells. Examples include paclitaxol, cytochalasin B , gramicidin D, ethidium bromide, emetine, mitomycin, etoposide, tenoposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxy anthracin dione, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, and puromycin and analogs or homologs thereof. Therapeutic agents include, but are not limited to, antimetabolites (e.g., methotrexate, 6-mercaptopurine, 6-thioguanine, cytarabine, 5-fluorouracil decarbazine), alkylating agents (e.g., mechlorethamine, thioepa chlorambucil, melphalan, carmustine (BSNU) and lomustine (CCNU), cyclothosphamide, busulfan, dibromomannitol, streptozotocin, mitomycin C, and cis- dichlorodiamine platinum (II) (DDP) cisplatin), anthracyclines (e.g., daunorubicin (formerly daunomycin) and doxorubicin), antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)), and anti-mitotic agents (e.g., vincristine and vinblastine). The conjugates of the invention can be used for modifying a given biological response, the therapeutic agent or drug moiety is not to be construed as limited to classical chemical therapeutic agents. For example, the drug moiety may be a protein or polypeptide possessing a desired biological activity. Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, a-interferon, β-interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, e.g., TNF-alpha, TNF-beta, AIM I (See, International Publication No. WO 97/33899), AIM II (See, International Publication No. WO 97/34911), Fas Ligand (Takahashi et al, Int. Immunol, 6: 1567-1574 (1994)), VEGI (See, International Publication No. WO 99/23105), a thrombotic agent or an anti- angiogenic agent, e.g., angiostatin or endostatin; or, biological response modifiers such as, for example, lymphokines, interleukin- 1 ("IL-1"), interleukin-2 ("EL-2"), interleukin-6 ("IL- 6"), granulocyte macrophage colony stimulating factor ("GM-CSF"), granulocyte colony stimulating factor ("G-CSF"), or other growth factors.
Antibodies may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen. Such solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
Techniques for conjugating such therapeutic moiety to antibodies are well known, see, e.g., Arnon et al., "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", in Monoclonal Antibodies And Cancer Therapy, Reisfeld et al. (eds.), pp. 243-56 (Alan R. Liss, Inc. 1985); Hellstrom et al., "Antibodies For Drug Delivery", in Controlled Drug Delivery (2nd Ed.), Robinson et al. (eds.), pp. 623-53 (Marcel Dekker, Inc. 1987); Thoφe, "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", in Monoclonal Antibodies '84: Biological And Clinical Applications, Pinchera et al. (eds.), pp. 475-506 (1985); "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", in Monoclonal Antibodies For Cancer Detection And Therapy, Baldwin et al. (eds.), pp. 303-16 (Academic Press 1985), and Thoφe et al., "The Preparation And Cytotoxic Properties Of Antibody-Toxin Conjugates", Immunol. Rev. 62: 1 19-58 (1982).
Alternatively, an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Patent No. 4,676,980, which is incoφorated herein by reference in its entirety.
An antibody, with or without a therapeutic moiety conjugated to it, administered alone or in combination with cytotoxic factor(s) and/or cytokine(s) can be used as a therapeutic.
Immunophenotvping
The antibodies of the invention may be utilized for immunophenotyping of cell lines and biological samples. The translation product of the gene of the present invention may be useful as a cell specific marker, or more specifically as a cellular marker that is differentially expressed at various stages of differentiation and/or maturation of particular cell types. Monoclonal antibodies directed against a specific epitope, or combination of epitopes, will allow for the screening of cellular populations expressing the marker. Various techniques can be utilized using monoclonal antibodies to screen for cellular populations expressing the marker(s), and include magnetic separation using antibody-coated magnetic beads, "panning" with antibody attached to a solid matrix (i.e., plate), and flow cytometry (See, e.g., U.S. Patent 5,985,660; and Morrison et al, Cell, 96:731-49 (1999)).
These techniques allow for the screening of particular populations of cells, such as might be found with hematological malignancies (i.e. minimal residual disease (MRD) in acute leukemic patients) and "non-self cells in transplantations to prevent Graft- versus-Host Disease (GVHD). Alternatively, these techniques allow for the screening of hematopoietic stem and progenitor cells capable of undergoing proliferation and/or differentiation, as might be found in human umbilical cord blood.
Assays For Antibody Binding The antibodies of the invention may be assayed for immunospecific binding by any method known in the art. The immunoassays which can be used include but are not limited to competitive and non-competitive assay systems using techniques such as western blots, radioimmunoassays, ELISA (enzyme linked immunosorbent assay), "sandwich" immunoassays, immunoprecipitation assays, precipitin reactions, gel diffusion precipitin reactions, immunodiffusion assays, agglutination assays, complement-fixation assays, immunoradiometric assays, fluorescent immunoassays, protein A immunoassays, to name but a few. Such assays are routine and well known in the art (see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York, which is incoφorated by reference herein in its entirety). Exemplary immunoassays are described briefly below (but are not intended by way of limitation).
Immunoprecipitation protocols generally comprise lysing a population of cells in a lysis buffer such as RIPA buffer (1% NP-40 or Triton X- 100, 1% sodium deoxycholate, 0.1% SDS, 0.15 M NaCl, 0.01 M sodium phosphate at pH 7.2, 1% Trasylol) supplemented with protein phosphatase and/or protease inhibitors (e.g., EDTA, PMSF, aprotinin, sodium vanadate), adding the antibody of interest to the cell lysate, incubating for a period of time (e.g., 1-4 hours) at 4° C, adding protein A and/or protein G sepharose beads to the cell lysate, incubating for about an hour or more at 4° C, washing the beads in lysis buffer and resuspending the beads in SDS/sample buffer. The ability of the antibody of interest to immunoprecipitate a particular antigen can be assessed by, e.g., western blot analysis. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the binding of the antibody to an antigen and decrease the background (e.g., pre- clearing the cell lysate with sepharose beads). For further discussion regarding immunoprecipitation protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.16.1.
Western blot analysis generally comprises preparing protein samples, electrophoresis of the protein samples in a polyacrylamide gel (e.g., 8%- 20% SDS-PAGE depending on the molecular weight of the antigen), transferring the protein sample from the polyacrylamide gel to a membrane such as nitrocellulose, PVDF or nylon, blocking the membrane in blocking solution (e.g., PBS with 3% BSA or non-fat milk), washing the membrane in washing buffer (e.g., PBS-T ween 20), blocking the membrane with primary antibody (the antibody of interest) diluted in blocking buffer, washing the membrane in washing buffer, blocking the membrane with a secondary antibody (which recognizes the primary antibody, e.g., an anti-human antibody) conjugated to an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) or radioactive molecule (e.g., 32P or 1251) diluted in blocking buffer, washing the membrane in wash buffer, and detecting the presence of the antigen. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected and to reduce the background noise. For further discussion regarding western blot protocols see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 10.8.1.
ELISAs comprise preparing antigen, coating the well of a 96 well microtiter plate with the antigen, adding the antibody of interest conjugated to a detectable compound such as an enzymatic substrate (e.g., horseradish peroxidase or alkaline phosphatase) to the well and incubating for a period of time, and detecting the presence of the antigen. In ELISAs the antibody of interest does not have to be conjugated to a detectable compound; instead, a second antibody (which recognizes the antibody of interest) conjugated to a detectable compound may be added to the well. Further, instead of coating the well with the antigen, the antibody may be coated to the well. In this case, a second antibody conjugated to a detectable compound may be added following the addition of the antigen of interest to the coated well. One of skill in the art would be knowledgeable as to the parameters that can be modified to increase the signal detected as well as other variations of ELISAs known in the art. For further discussion regarding ELISAs see, e.g., Ausubel et al, eds, 1994, Current Protocols in Molecular Biology, Vol. 1, John Wiley & Sons, Inc., New York at 11.2.1.
The binding affinity of an antibody to an antigen and the off-rate of an antibody- antigen interaction can be determined by competitive binding assays. One example of a competitive binding assay is a radioimmunoassay comprising the incubation of labeled antigen (e.g., 3H or 1251) with the antibody of interest in the presence of increasing amounts of unlabeled antigen, and the detection of the antibody bound to the labeled antigen.
The affinity of the antibody of interest for a particular antigen and the binding off-rates can be determined from the data by scatchard plot analysis. Competition with a second antibody can also be determined using radioimmunoassay s. In this case, the antigen is incubated with antibody of interest conjugated to a labeled compound (e.g., 3H or 1251) in the presence of increasing amounts of an unlabeled second antibody.
Therapeutic Uses
The present invention is further directed to antibody-based therapies which involve administering antibodies of the invention to an animal, preferably a mammal, and most preferably a human, patient for treating one or more of the disclosed diseases, disorders, or conditions. Therapeutic compounds of the invention include, but are not limited to, antibodies of the invention (including fragments, analogs and derivatives thereof as described herein) and nucleic acids encoding antibodies of the invention (including fragments, analogs and derivatives thereof and anti-idiotypic antibodies as described herein). The antibodies of the invention can be used to treat, inhibit or prevent diseases, disorders or conditions associated with aberrant expression and/or activity of a polypeptide of the invention, including, but not limited to, any one or more of the diseases, disorders, or conditions described herein. The treatment and/or prevention of diseases, disorders, or conditions associated with aberrant expression and/or activity of a polypeptide of the invention includes, but is not limited to, alleviating symptoms associated with those diseases, disorders or conditions. Antibodies of the invention may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
A summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below. Armed with the teachings provided herein, one of ordinary skill in the art will know how to use the antibodies of the present invention for diagnostic, monitoring or therapeutic puφoses without undue experimentation.
The antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors (such as, e.g., IL-2, IL-3 and IL-7), for example, which serve to increase the number or activity of effector cells which interact with the antibodies.
The antibodies of the invention may be administered alone or in combination with other types of treatments (e.g., radiation therapy, chemotherapy, hormonal therapy, immunotherapy and anti-tumor agents). Generally, administration of products of a species origin or species reactivity (in the case of antibodies) that is the same species as that of the patient is preferred. Thus, in a preferred embodiment, human antibodies, fragments derivatives, analogs, or nucleic acids, are administered to a human patient for therapy or prophylaxis.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or neutralizing antibodies against polypeptides or polynucleotides of the present invention, fragments or regions thereof, for both immunoassays directed to and therapy of disorders related to polynucleotides or polypeptides, including fragments thereof, of the present invention. Such antibodies, fragments, or regions, will preferably have an affinity for polynucleotides or polypeptides of the invention, including fragments thereof. Preferred binding affinities include those with a dissociation constant or Kd less than 5 X 10'2 M, 10"2 M, 5 X 10"3 M, 10"3 M, 5 X 10"4 M, 10"4 M, 5 X 10"5 M, 10"5 M, 5 X 10"6 M, 10"6 M, 5 X 10"7 M, 107 M, 5 X 10"8 M, 10"8 M, 5 X 10"9 M, 10"9 M, 5 X 10"10 M, 10"'° M, 5 X 10"" M, lO"" M, 5 X 10 '2 M, 10"12 M, 5 X 10 '3 M, 10" I3 M, 5 X 10"14 M, 10'14 M, 5 X 10 '5 M, and 10"'5 M.
Gene Therapy
In a specific embodiment, nucleic acids comprising sequences encoding antibodies or functional derivatives thereof, are administered to treat, inhibit or prevent a disease or disorder associated with aberrant expression and/or activity of a polypeptide of the invention, by way of gene therapy. Gene therapy refers to therapy performed by the administration to a subject of an expressed or expressible nucleic acid. In this embodiment of the invention, the nucleic acids produce their encoded protein that mediates a therapeutic effect.
Any of the methods for gene therapy available in the art can be used according to the present invention. Exemplary methods are described below.
For general reviews of the methods of gene therapy, see Goldspiel et al., Clinical Pharmacy 12:488-505 (1993); Wu and Wu, Biotherapy 3:87-95 (1991); Tolstoshev, Ann.
Rev. Pharmacol. Toxicol. 32:573-596 (1993); Mulligan, Science 260:926-932 (1993); and
Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993); May, TEBTECH
11(5)355-215 (1993). Methods commonly known in the art of recombinant DNA technology which can be used are described in Ausubel et al. (eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); and Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press, NY (1990).
In a preferred aspect, the compound comprises nucleic acid sequences encoding an antibody, said nucleic acid sequences being part of expression vectors that express the antibody or fragments or chimeric proteins or heavy or light chains thereof in a suitable host. In particular, such nucleic acid sequences have promoters operably linked to the antibody coding region, said promoter being inducible or constitutive, and, optionally, tissue- specific. In another particular embodiment, nucleic acid molecules are used in which the antibody coding sequences and any other desired sequences are flanked by regions that promote homologous recombination at a desired site in the genome, thus providing for intrachromosomal expression of the antibody encoding nucleic acids (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); Zijlstra et al., Nature 342:435-438 (1989). In specific embodiments, the expressed antibody molecule is a single chain antibody; alternatively, the nucleic acid sequences include sequences encoding both the heavy and light chains, or fragments thereof, of the antibody.
Delivery of the nucleic acids into a patient may be either direct, in which case the patient is directly exposed to the nucleic acid or nucleic acid- carrying vectors, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then transplanted into the patient. These two approaches are known, respectively, as in vivo or ex vivo gene therapy.
In a specific embodiment, the nucleic acid sequences are directly administered in vivo, where it is expressed to produce the encoded product. This can be accomplished by any of numerous methods known in the art, e.g., by constructing them as part of an appropriate nucleic acid expression vector and administering it so that they become intracellular, e.g., by infection using defective or attenuated retrovirals or other viral vectors (see U.S. Patent No. 4,980,286), or by direct injection of naked DNA, or by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide which is known to enter the nucleus, by administering it in linkage to a ligand subject to receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)) (which can be used to target cell types specifically expressing the receptors), etc. In another embodiment, nucleic acid- ligand complexes can be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. In yet another embodiment, the nucleic acid can be targeted in vivo for cell specific uptake and expression, by targeting a specific receptor (see, e.g., PCT Publications WO 92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221). Alternatively, the nucleic acid can be introduced intracellularly and incoφorated within host cell DNA for expression, by homologous recombination (Koller and Smithies, Proc. Natl. Acad. Sci. USA 86:8932- 8935 (1989); Zijlstra et al, Nature 342:435-438 (1989)).
In a specific embodiment, viral vectors that contains nucleic acid sequences encoding an antibody of the invention are used. For example, a retroviral vector can be used (see Miller et al., Meth. Enzymol. 217:581-599 (1993)). These retroviral vectors contain the components necessary for the correct packaging of the viral genome and integration into the host cell DNA. The nucleic acid sequences encoding the antibody to be used in gene therapy are cloned into one or more vectors, which facilitates delivery of the gene into a patient. More detail about retroviral vectors can be found in Boesen et al., Biotherapy 6:291-302 (1994), which describes the use of a retroviral vector to deliver the mdrl gene to hematopoietic stem cells in order to make the stem cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes et al., J. Clin. Invest. 93:644-651 (1994); Kiem et al., Blood 83: 1467-1473 (1994); Salmons and Gunzberg, Human Gene Therapy 4:129-141 (1993); and Grossman and Wilson, Curr. Opin. in Genetics and Devel. 3:110-114 (1993).
Adenoviruses are other viral vectors that can be used in gene therapy. Adenoviruses are especially attractive vehicles for delivering genes to respiratory epithelia. Adenoviruses naturally infect respiratory epithelia where they cause a mild disease. Other targets for adenovirus-based delivery systems are liver, the central nervous system, endothelial cells, and muscle. Adenoviruses have the advantage of being capable of infecting non-dividing cells. Kozarsky and Wilson, Current Opinion in Genetics and Development 3:499-503 (1993) present a review of adenovirus-based gene therapy. Bout et al., Human Gene Therapy 5:3-10 (1994) demonstrated the use of adenovirus vectors to transfer genes to the respiratory epithelia of rhesus monkeys. Other instances of the use of adenoviruses in gene therapy can be found in Rosenfeld et al., Science 252:431-434 (1991); Rosenfeld et al., Cell 68: 143- 155 (1992); Mastrangeli et al., J. Clin. Invest. 91:225-234 (1993); PCT Publication WO94/12649; and Wang, et al., Gene Therapy 2:775-783 (1995). In a preferred embodiment, adenovirus vectors are used. Adeno-associated virus (AAV) has also been proposed for use in gene therapy
(Walsh et al., Proc. Soc. Exp. Biol. Med. 204:289-300 (1993); U.S. Patent No. 5,436,146).
Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, calcium phosphate mediated transfection, or viral infection. Usually, the method of transfer includes the transfer of a selectable marker to the cells. The cells are then placed under selection to isolate those cells that have taken up and are expressing the transferred gene. Those cells are then delivered to a patient. In this embodiment, the nucleic acid is introduced into a cell prior to administration in vivo of the resulting recombinant cell. Such introduction can be carried out by any method known in the art, including but not limited to transfection, electroporation, microinjection, infection with a viral or bacteriophage vector containing the nucleic acid sequences, cell fusion, chromosome-mediated gene transfer, microcell-mediated gene transfer, spheroplast fusion, etc. Numerous techniques are known in the art for the introduction of foreign genes into cells (see, e.g., Loeffler and Behr, Meth. Enzymol. 217:599-618 (1993); Cohen et al., Meth. Enzymol. 217:618-644 (1993); Cline, Pharmac. Ther. 29:69-92 (1985) and may be used in accordance with the present invention, provided that the necessary developmental and physiological functions of the recipient cells are not disrupted. The technique should provide for the stable transfer of the nucleic acid to the cell, so that the nucleic acid is expressible by the cell and preferably heritable and expressible by its cell progeny.
The resulting recombinant cells can be delivered to a patient by various methods known in the art. Recombinant blood cells (e.g., hematopoietic stem or progenitor cells) are preferably administered intravenously. The amount of cells envisioned for use depends on the desired effect, patient state, etc., and can be determined by one skilled in the art.
Cells into which a nucleic acid can be introduced for puφoses of gene therapy encompass any desired, available cell type, and include but are not limited to epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as Tlymphocytes, Blymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various stem or progenitor cells, in particular hematopoietic stem or progenitor cells, e.g., as obtained from bone marrow, umbilical cord blood, peripheral blood, fetal liver, etc.
In a preferred embodiment, the cell used for gene therapy is autologous to the patient. In an embodiment in which recombinant cells are used in gene therapy, nucleic acid sequences encoding an antibody are introduced into the cells such that they are expressible by the cells or their progeny, and the recombinant cells are then administered in vivo for therapeutic effect. In a specific embodiment, stem or progenitor cells are used. Any stem and/or progenitor cells which can be isolated and maintained in vitro can potentially be used in accordance with this embodiment of the present invention (see e.g. PCT Publication WO 94/08598; Stemple and Anderson, Cell 71:973-985 (1992); Rheinwald, Meth. Cell Bio. 21A:229 (1980); and Pittelkow and Scott, Mayo Clinic Proc. 61:771 (1986)).
In a specific embodiment, the nucleic acid to be introduced for puφoses of gene therapy comprises an inducible promoter operably linked to the coding region, such that expression of the nucleic acid is controllable by controlling the presence or absence of the appropriate inducer of transcription. Demonstration of Therapeutic or Prophylactic Activity The compounds or pharmaceutical compositions of the invention are preferably tested in vitro, and then in vivo for the desired therapeutic or prophylactic activity, prior to use in humans. For example, in vitro assays to demonstrate the therapeutic or prophylactic utility of a compound or pharmaceutical composition include, the effect of a compound on a cell line or a patient tissue sample. The effect of the compound or composition on the cell line and/or tissue sample can be determined utilizing techniques known to those of skill in the art including, but not limited to, rosette formation assays and cell lysis assays. In accordance with the invention, in vitro assays which can be used to determine whether administration of a specific compound is indicated, include in vitro cell culture assays in which a patient tissue sample is grown in culture, and exposed to or otherwise administered a compound, and the effect of such compound upon the tissue sample is observed.
Therapeutic/Prophylactic Administration and Composition
The invention provides methods of treatment, inhibition and prophylaxis by administration to a subject of an effective amount of a compound or pharmaceutical composition of the invention, preferably an antibody of the invention. In a preferred aspect, the compound is substantially purified (e.g., substantially free from substances that limit its effect or produce undesired side-effects). The subject is preferably an animal, including but not limited to animals such as cows, pigs, horses, chickens, cats, dogs, etc., and is preferably a mammal, and most preferably human.
Formulations and methods of administration that can be employed when the compound comprises a nucleic acid or an immunoglobulin are described above; additional appropriate formulations and routes of administration can be selected from among those described herein below. Various delivery systems are known and can be used to administer a compound of the invention, e.g., encapsulation in liposomes, microparticles, microcapsules, recombinant cells capable of expressing the compound, receptor-mediated endocytosis (see, e.g., Wu and Wu, J. Biol. Chem. 262:4429-4432 (1987)), construction of a nucleic acid as part of a retroviral or other vector, etc. Methods of introduction include but are not limited to intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. The compounds or compositions may be administered by any convenient route, for example by infusion or bolus injection, by absoφtion through epithelial or mucocutaneous linings (e.g., oral mucosa, rectal and intestinal mucosa, etc.) and may be administered together with other biologically active agents. Administration can be systemic or local. In addition, it may be desirable to introduce the pharmaceutical compounds or compositions of the invention into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir. Pulmonary administration can also be employed, e.g., by use of an inhaler or nebulizer, and formulation with an aerosolizing agent.
In a specific embodiment, it may be desirable to administer the pharmaceutical compounds or compositions of the invention locally to the area in need of treatment; this may be achieved by, for example, and not by way of limitation, local infusion during surgery, topical application, e.g., in conjunction with a wound dressing after surgery, by injection, by means of a catheter, by means of a suppository, or by means of an implant, said implant being of a porous, non-porous, or gelatinous material, including membranes, such as sialastic membranes, or fibers. Preferably, when administering a protein, including an antibody, of the invention, care must be taken to use materials to which the protein does not absorb.
In another embodiment, the compound or composition can be delivered in a vesicle, in particular a liposome (see Langer, Science 249: 1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 353- 365 (1989); Lopez-Berestein, ibid., pp. 317-327; see generally ibid.)
In yet another embodiment, the compound or composition can be delivered in a controlled release system. In one embodiment, a pump may be used (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). In another embodiment, polymeric materials can be used (see Medical Applications of Controlled Release, Langer and Wise (eds.), CRC Pres., Boca Raton, Florida (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen and Ball (eds.), Wiley, New York (1984); Ranger and Peppas, J., Macromol. Sci. Rev. Macromol. Chem. 23:61 (1983); see also Levy et al., Science 228: 190 (1985); During et al., Ann. Neurol. 25:351 (1989); Howard et al., J.Neurosurg. 71:105 (1989)). In yet another embodiment, a controlled release system can be placed in proximity of the therapeutic target, i.e., the brain, thus requiring only a fraction of the systemic dose (see, e.g., Goodson, in Medical Applications of Controlled Release, supra, vol. 2, pp. 1 15-138 (1984)). Other controlled release systems are discussed in the review by Langer (Science
249:1527-1533 (1990)).
In a specific embodiment where the compound of the invention is a nucleic acid encoding a protein, the nucleic acid can be administered in vivo to promote expression of its encoded protein, by constructing it as part of an appropriate nucleic acid expression vector and administering it so that it becomes intracellular, e.g., by use of a retroviral vector (see
U.S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment
(e.g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox- like peptide which is known to enter the nucleus (see e.g., Joliot et al., Proc. Natl. Acad. Sci. USA 88:1864- 1868 (1991)), etc. Alternatively, a nucleic acid can be introduced intracellularly and incoφorated within host cell DNA for expression, by homologous recombination.
The present invention also provides pharmaceutical compositions. Such compositions comprise a therapeutically effective amount of a compound, and a pharmaceutically acceptable carrier. In a specific embodiment, the term "pharmaceutically acceptable" means approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like. Water is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents. These compositions can take the form of solutions, suspensions, emulsion, tablets, pills, capsules, powders, sustained-release formulations and the like. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides. Oral formulation can include standard carriers such as pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, etc. Examples of suitable pharmaceutical carriers are described in "Remington's Pharmaceutical Sciences" by E.W. Martin. Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable amount of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration. In a preferred embodiment, the composition is formulated in accordance with routine procedures as a pharmaceutical composition adapted for intravenous administration to human beings. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. Where necessary, the composition may also include a solubilizing agent and a local anesthetic such as lignocaine to ease pain at the site of the injection. Generally, the ingredients are supplied either separately or mixed together in unit dosage form, for example, as a dry lyophilized powder or water free concentrate in a hermetically sealed container such as an ampoule or sachette indicating the quantity of active agent. Where the composition is to be administered by infusion, it can be dispensed with an infusion bottle containing sterile pharmaceutical grade water or saline. Where the composition is administered by injection, an ampoule of sterile water for injection or saline can be provided so that the ingredients may be mixed prior to administration.
The compounds of the invention can be formulated as neutral or salt forms. Pharmaceutically acceptable salts include those formed with anions such as those derived from hydrochloric, phosphoric, acetic, oxalic, tartaric acids, etc., and those formed with cations such as those derived from sodium, potassium, ammonium, calcium, ferric hydroxides, isopropylamine, triethylamine, 2-ethylamino ethanol, histidine, procaine, etc.
The amount of the compound of the invention which will be effective in the treatment, inhibition and prevention of a disease or disorder associated with aberrant expression and or activity of a polypeptide of the invention can be determined by standard clinical techniques. In addition, in vitro assays may optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each patient's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.
For antibodies, the dosage administered to a patient is typically 0.1 mg/kg to 100 mg/kg of the patient's body weight. Preferably, the dosage administered to a patient is between 0.1 mg/kg and 20 mg/kg of the patient's body weight, more preferably 1 mg/kg to
10 mg/kg of the patient's body weight. Generally, human antibodies have a longer half-life within the human body than antibodies from other species due to the immune response to the foreign polypeptides. Thus, lower dosages of human antibodies and less frequent administration is often possible. Further, the dosage and frequency of administration of antibodies of the invention may be reduced by enhancing uptake and tissue penetration (e.g., into the brain) of the antibodies by modifications such as, for example, lipidation.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration.
Diagnosis and Imaging Labeled antibodies, and derivatives and analogs thereof, which specifically bind to a polypeptide of interest can be used for diagnostic puφoses to detect, diagnose, or monitor diseases, disorders, and/or conditions associated with the aberrant expression and/or activity of a polypeptide of the invention. The invention provides for the detection of aberrant expression of a polypeptide of interest, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of aberrant expression.
The invention provides a diagnostic assay for diagnosing a disorder, comprising (a) assaying the expression of the polypeptide of interest in cells or body fluid of an individual using one or more antibodies specific to the polypeptide interest and (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed polypeptide gene expression level compared to the standard expression level is indicative of a particular disorder. With respect to cancer, the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms. A more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer.
Antibodies of the invention can be used to assay protein levels in a biological sample using classical immunohistological methods known to those of skill in the art (e.g., see Jalkanen, et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, et al., J. Cell . Biol. 105:3087-3096 (1987)). Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase; radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99Tc); luminescent labels, such as luminol; and fluorescent labels, such as fluorescein and rhodamine, and biotin.
One aspect of the invention is the detection and diagnosis of a disease or disorder associated with aberrant expression of a polypeptide of interest in an animal, preferably a mammal and most preferably a human. In one embodiment, diagnosis comprises: a) administering (for example, parenterally, subcutaneously, or intraperitoneally) to a subject an effective amount of a labeled molecule which specifically binds to the polypeptide of interest; b) waiting for a time interval following the administering for permitting the labeled molecule to preferentially concentrate at sites in the subject where the polypeptide is expressed (and for unbound labeled molecule to be cleared to background level); c) determining background level; and d) detecting the labeled molecule in the subject, such that detection of labeled molecule above the background level indicates that the subject has a particular disease or disorder associated with aberrant expression of the polypeptide of interest. Background level can be determined by various methods including, comparing the amount of labeled molecule detected to a standard value previously determined for a particular system.
It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S.W. Burchiel et al., "Immunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).
Depending on several variables, including the type of label used and the mode of administration, the time interval following the administration for permitting the labeled molecule to preferentially concentrate at sites in the subject and for unbound labeled molecule to be cleared to background level is 6 to 48 hours or 6 to 24 hours or 6 to 12 hours. In another embodiment the time interval following administration is 5 to 20 days or 5 to 10 days.
In an embodiment, monitoring of the disease or disorder is carried out by repeating the method for diagnosing the disease or disease, for example, one month after initial diagnosis, six months after initial diagnosis, one year after initial diagnosis, etc.
Presence of the labeled molecule can be detected in the patient using methods known in the art for in vivo scanning. These methods depend upon the type of label used. Skilled artisans will be able to determine the appropriate method for detecting a particular label. Methods and devices that may be used in the diagnostic methods of the invention include, but are not limited to, computed tomography (CT), whole body scan such as position emission tomography (PET), magnetic resonance imaging (MRI), and sonography.
In a specific embodiment, the molecule is labeled with a radioisotope and is detected in the patient using a radiation responsive surgical instrument (Thurston et al., U.S. Patent No. 5,441,050). In another embodiment, the molecule is labeled with a fluorescent compound and is detected in the patient using a fluorescence responsive scanning instrument. In another embodiment, the molecule is labeled with a positron emitting metal and is detected in the patent using positron emission-tomography. In yet another embodiment, the molecule is labeled with a paramagnetic label and is detected in a patient using magnetic resonance imaging (MRI).
Kits The present invention provides kits that can be used in the above methods. In one embodiment, a kit comprises an antibody of the invention, preferably a purified antibody, in one or more containers. In a specific embodiment, the kits of the present invention contain a substantially isolated polypeptide comprising an epitope which is specifically immunoreactive with an antibody included in the kit. Preferably, the kits of the present invention further comprise a control antibody which does not react with the polypeptide of interest. In another specific embodiment, the kits of the present invention contain a means for detecting the binding of an antibody to a polypeptide of interest (e.g., the antibody may be conjugated to a detectable substrate such as a fluorescent compound, an enzymatic substrate, a radioactive compound or a luminescent compound, or a second antibody which recognizes the first antibody may be conjugated to a detectable substrate).
In another specific embodiment of the present invention, the kit is a diagnostic kit for use in screening serum containing antibodies specific against proliferative and/or cancerous polynucleotides and polypeptides. Such a kit may include a control antibody that does not react with the polypeptide of interest. Such a kit may include a substantially isolated polypeptide antigen comprising an epitope which is specifically immunoreactive with at least one anti-polypeptide antigen antibody. Further, such a kit includes means for detecting the binding of said antibody to the antigen (e.g., the antibody may be conjugated to a fluorescent compound such as fluorescein or rhodamine which can be detected by flow cytometry). In specific embodiments, the kit may include a recombinantly produced or chemically synthesized polypeptide antigen. The polypeptide antigen of the kit may also be attached to a solid support.
In a more specific embodiment the detecting means of the above-described kit includes a solid support to which said polypeptide antigen is attached. Such a kit may also include a non-attached reporter-labeled anti-human antibody. In this embodiment, binding of the antibody to the polypeptide antigen can be detected by binding of the said reporter-labeled antibody.
In an additional embodiment, the invention includes a diagnostic kit for use in screening serum containing antigens of the polypeptide of the invention. The diagnostic kit includes a substantially isolated antibody specifically immunoreactive with polypeptide or polynucleotide antigens, and means for detecting the binding of the polynucleotide or polypeptide antigen to the antibody. In one embodiment, the antibody is attached to a solid support. In a specific embodiment, the antibody may be a monoclonal antibody. The detecting means of the kit may include a second, labeled monoclonal antibody. Alternatively, or in addition, the detecting means may include a labeled, competing antigen. In one diagnostic configuration, test serum is reacted with a solid phase reagent having a surface-bound antigen obtained by the methods of the present invention. After binding with specific antigen antibody to the reagent and removing unbound serum components by washing, the reagent is reacted with reporter-labeled anti-human antibody to bind reporter to the reagent in proportion to the amount of bound anti-antigen antibody on the solid support. The reagent is again washed to remove unbound labeled antibody, and the amount of reporter associated with the reagent is determined. Typically, the reporter is an enzyme which is detected by incubating the solid phase in the presence of a suitable fluorometric, luminescent or colorimetric substrate (Sigma, St. Louis, MO).
The solid surface reagent in the above assay is prepared by known techniques for attaching protein material to solid support material, such as polymeric beads, dip sticks, 96- well plate or filter material. These attachment methods generally include non-specific adsoφtion of the protein to the support or covalent attachment of the protein, typically through a free amine group, to a chemically reactive group on the solid support, such as an activated carboxyl, hydroxyl, or aldehyde group. Alternatively, streptavidin coated plates can be used in conjunction with biotinylated antigen(s).
Thus, the invention provides an assay system or kit for carrying out this diagnostic method. The kit generally includes a support with surface- bound recombinant antigens, and a reporter-labeled anti-human antibody for detecting surface-bound anti-antigen antibody.
Fusion Proteins
Any chemokine polypeptide of the invention can be used to generate fusion proteins. For example, a Ckβ-4 or Ckβ-10 polypeptide, when fused to a second protein, can be used as an antigenic tag. Antibodies raised against a Ckβ-4 or Ckβ-10 polypeptide can be used to indirectly detect the second protein by binding to a Ckβ-4 or Ckβ-10. Moreover, because secreted proteins target cellular locations based on trafficking signals, the chemokine polypeptides can be used as targeting molecules once fused to other proteins. Examples of domains that can be fused to the chemokine polypeptides include not only heterologous signal sequences, but also other heterologous functional regions. The fusion does not necessarily need to be direct, but may occur through linker sequences.
In certain preferred embodiments, Ckβ-10 proteins of the invention comprise fusion proteins wherein the Ckβ-10 polypeptides are those described above as m-n. In preferred embodiments, the application is directed to nucleic acid molecules at least 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequences encoding polypeptides having the amino acid sequence of the specific N- and C-terminal deletions recited herein. Polynucleotides encoding these polypeptides are also encompassed by the invention.
Moreover, fusion proteins may also be engineered to improve characteristics of the chemokine polypeptides. For instance, a region of additional amino acids, particularly charged amino acids, may be added to the N-terminus of a chemokine polypeptide of the invention to improve stability and persistence during purification from the host cell or subsequent handling and storage. Also, peptide moieties may be added to the chemokine polypeptide to facilitate purification. Such regions may be removed prior to final preparation of the chemokine polypeptide. The addition of peptide moieties to facilitate handling of polypeptides are familiar and routine techniques in the art.
As one of skill in the art will appreciate, polypeptides of the present invention and the epitope-bearing fragments thereof described above, can be combined with heterologous polypeptide sequences. For example, the polypeptides of the present invention may be fused with heterologous polypeptide sequences, for example, the polypeptides of the present invention may be fused with parts of the constant domain of immunoglobulins (IgA, IgE, IgG, IgM) or portions thereof (CHI , CH2, CH3, and any combination thereof, including both entire domains and portions thereof), resulting in chimeric polypeptides. These fusion proteins facilitate purification and show an increased half-life in vivo. One reported example describes chimeric proteins consisting of the first two domains of the human CD4- polypeptide and various domains of the constant regions of the heavy or light chains of mammalian immunoglobulins. (EP A 394,827; Traunecker et al., Nature 331:84-86 (1988).) Fusion proteins having disulfide-linked dimeric structures (due to the IgG) can also be more efficient in binding and neutralizing other molecules, than the monomeric secreted protein or protein fragment alone. (Fountoulakis et al., J. Biochem. 270:3958-3964 ( 1995).)
Similarly, EP-A-O 464 533 (Canadian counteφart 2045869) discloses fusion proteins comprising various portions of constant region of immunoglobulin molecules together with another human protein or part thereof. In many cases, the Fc part in a fusion protein is beneficial in therapy and diagnosis, and thus can result in, for example, improved pharmacokinetic properties. (EP-A 0232 262.) Alternatively, deleting the Fc part after the fusion protein has been expressed, detected, and purified, would be desired. For example, the Fc portion may hinder therapy and diagnosis if the fusion protein is used as an antigen for immunizations. In drug discovery, for example, human proteins, such as hIL-5, have been fused with Fc portions for the puφose of high-throughput screening assays to identify antagonists of hIL-5. (See, D. Bennett et al., J. Molecular Recognition 8:52-58 (1995); K. Johanson et al., J. Biol. Chem. 270:9459-9471 (1995).)
Moreover, the chemokine polypeptides can be fused to marker sequences, such as a peptide which facilitates purification of the chemokine polypeptide. In preferred embodiments, the marker amino acid sequence is a hexa-histidine peptide, such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, CA, 91311), among others, many of which are commercially available. As described in Gentz et al., Proc. Natl. Acad. Sci. USA 86:821-824 (1989), for instance, hexa-histidine provides for convenient purification of the fusion protein. Another peptide tag useful for purification, the "HA" tag, corresponds to an epitope derived from the influenza hemagglutinin protein. (Wilson et al., Cell 37:767 (1984).)
Thus, any of these above fusions can be engineered using the a Ckβ-4 or Ckβ-10 polynucleotides or polypeptides.
Vectors, Host Cells, and Protein Production
The present invention also relates to vectors which include Ckβ-4 or Ckβ-10 polynucleotides of the present invention, host cells which are genetically engineered with vectors of the invention and the production of polypeptides of the invention by recombinant techniques. The vector may be, for example, a phage, plasmid, viral, or retroviral vector. Retroviral vectors may be replication competent or replication defective. In the latter case, viral propagation generally will occur only in complementing host cells.
Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, a cloning vector or an expression vector. The vector may be, for example, in the form of a plasmid, a viral particle, a phage, etc. The engineered host cells can be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants or amplifying the Ckβ-4 and
MCP-4 genes (also referred to as Ckβ-10 genes). The culture conditions, such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
The polynucleotides of the present invention may be employed for producing polypeptides by recombinant techniques. Thus, for example, the polynucleotide may be included in any one of a variety of expression vectors for expressing a polypeptide. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculovirus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies. However, any other vector may be used as long as it is replicable and viable in the host.
The appropriate DNA sequence may be inserted into the vector by a variety of procedures. In general, the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
The DNA sequence in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli. lac or trp., the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic or eukaryotic cells or their viruses. Other suitable promoters will be known to the skilled artisan. The expression constructs will further contain sites for transcription initiation, termination, and, in the transcribed region, a ribosome binding site for translation. The coding portion of the transcripts expressed by the constmcts will preferably include a translation initiating codon at the beginning and a termination codon (UAA, UGA or UAG) appropriately positioned at the end of the polypeptide to be translated. The vector containing the appropriate DNA sequence as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein. Generally, a plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. If the vector is a virus, it may be packaged in vitro using an appropriate packaging cell line and then transduced into host cells.
As indicated, the expression vectors will preferably include at least one selectable marker. Such markers include dihydrofolate reductase, G418 or neomycin resistance for eukaryotic cell culture and tetracycline, kanamycin or ampicillin resistance genes for culturing in E. coli and other bacteria.
Representative examples of appropriate hosts include, but are not limited to, bacterial cells, such as E. coli, Streptomyces and Salmonella typhimurium cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
More particularly, the present invention also includes recombinant constructs comprising one or more of the sequences as broadly described above. The constructs comprise a vector, such as a plasmid or viral vector, into which a sequence of the invention has been inserted, in a forward or reverse orientation. In a preferred aspect of this embodiment, the construct further comprises regulatory sequences, including, for example, a promoter, operably linked to the sequence. Large numbers of suitable vectors and promoters are known to those of skill in the art, and are commercially available. The following vectors are provided by way of example. Bacterial: pQE70, pQE60, pQE-9 available from QIAGEN, Inc, pBS, pDIO, phagescript, psiX174, pbluescript SK, pbsks, Phagescript vectors, pNH8A, pNH16a, pNH18A, pNH46A available from Stratagene Cloning Systems, Inc.; ptrc99a, pKK223-3, pKK233-3, pDR540, pRIT5 (Pharmacia). Eukaryotic: pWLNEO, pSV2CAT, pOG44, pXTl, pSG (Stratagene) pSVK3, pBPV, pMSG, pSVL available from Pharmacia Biotech, Inc. Among preferred eukaryotic vectors are pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; and pSVK3, pBPV, pMSG and pSVL available from Pharmacia. Preferred expression vectors for use in yeast systems include, but are not limited to pYES2, pYDl, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalph, pPIC9, pPIC3.5, pHIL-D2, pHIL-Sl, pPIC3.5K, pPIC9K, and PAO815 (all available from Invitrogen, Carlbad, CA). Other suitable vectors will be readily apparent to the skilled artisan.
Promoter regions can be selected from any desired gene using CAT (chloramphenicol acetyl transferase) vectors or other vectors with selectable markers. Two appropriate vectors are pKK232-8 and pCM7. Particular named bacterial promoters include lad, lacZ, T3, T7, gpt, lambda PR, PL and tip. Eukaryotic promoters include CMV immediate early, HSV thymidine kinase, early and late SV40, LTRs from retrovims, and mouse metallothionein-I. Selection of the appropriate vector and promoter is well within the level of ordinary skill in the art.
In a further embodiment, the present invention relates to host cells containing the above-described constructs. The host cell can be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell can be a prokaryotic cell, such as a bacterial cell. Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE-Dextran mediated transfection, cationic lipid-mediated transfection, electroporation, transduction, infection, or other methods. Such methods are described in many standard laboratory manuals, such as Davis et al., Basic
Methods In Molecular Biology (1986). It is specifically contemplated that Ckβ-4 or Ckβ-10 polypeptides of the invention may in fact be expressed by a host cell lacking a recombinant vector.
The constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence. Alternatively, the polypeptides of the invention can be synthetically produced by conventional peptide synthesizers.
Mature proteins can be expressed in mammalian cells, yeast, bacteria, or other cells under the control of appropriate promoters. Cell-free translation systems can also be employed to produce such proteins using RNAs derived from the DNA constructs of the present invention. Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y., (1989), the disclosure of which is hereby incoφorated by reference.
Transcription of the DNA encoding the polypeptides of the present invention by higher eukaryotes is increased by inserting an enhancer sequence into the vector. Enhancers are cis-acting elements of DNA, usually about from 10 to 300 bp that act on a promoter to increase its transcription. Examples including the SV40 enhancer on the late side of the replication origin bp 100 to 270, a cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
Generally, recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRP1 gene, and a promoter derived from a highly- expressed gene to direct transcription of a downstream structural sequence. Such promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), α-factor, acid phosphatase, or heat shock proteins, among others. The heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium. Optionally, the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
Useful expression vectors for bacterial use are constructed by inserting a structural DNA sequence encoding a desired protein together with suitable translation initiation and termination signals in operable reading phase with a functional promoter. The vector will comprise one or more phenotypic selectable markers and an origin of replication to ensure maintenance of the vector and to, if desirable, provide amplification within the host. Suitable prokaryotic hosts for transformation include E. coli. Bacillus subtilis. Salmonella typhimurium and various species within the genera Pseudomonas, Streptomyces, and Staphylococcus, although others may also be employed as a matter of choice. Further representative examples of appropriate hosts include, but are not limited to, bacterial cells; fungal cells, such as yeast cells (e.g., Saccharomyces cerevisiae or Pichia pastoris (ATCC Accession No. 201178)); insect cells such as Drosophila S2 and Spodoptera Sf9 cells; animal cells such as CHO, COS, 293, and Bowes melanoma cells; and plant cells. Appropriate culture mediums and conditions for the above-described host cells are known in the art.
As a representative but nonlimiting example, useful expression vectors for bacterial use can comprise a selectable marker and bacterial origin of replication derived from commercially available plasmids comprising genetic elements of the well known cloning vector pBR322 (ATCC 37017). Such commercial vectors include, for example, pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden) and pGEMl (Promega Biotec, Madison, WI, USA). These pBR322 "backbone" sections are combined with an appropriate promoter and the structural sequence to be expressed.
Following transformation of a suitable host strain and growth of the host strain to an appropriate cell density, the selected promoter is induced by appropriate means (e.g., temperature shift or chemical induction) and cells are cultured for an additional period.
Cells are typically harvested by centrifugation, disrupted by physical or chemical means, and the resulting crude extract retained for further purification. Microbial cells employed in expression of proteins can be disrupted by any convenient method, including freeze-thaw cycling, sonication, mechanical disruption, or use of cell lysing agents, such methods are well know to those skilled in the art.
Various mammalian cell culture systems can also be employed to express recombinant protein. Examples of mammalian expression systems include the COS-7 lines of monkey kidney fibroblasts, described by Gluzman, Cell, 23:175 (1981), and other cell lines capable of expressing a compatible vector, for example, the C127, 3T3, CHO, HeLa and BHK cell lines. Mammalian expression vectors will comprise an origin of replication, a suitable promoter and enhancer, and also any necessary ribosome binding sites, polyadenylation site, splice donor and acceptor sites, transcriptional termination sequences, and 5' flanking nontranscribed sequences. DNA sequences derived from the SV40 splice, and polyadenylation sites may be used to provide the required nontranscribed genetic elements.
The chemokine polypeptides can be recovered and purified from recombinant cell cultures by methods including ammonium sulfate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography hydroxy lapatite chromatography and lectin chromatography. Protein refolding steps can be used, as necessary, in completing configuration of the mature protein. Finally, high performance liquid chromatography (HPLC) can be employed for final purification steps. Most preferably, high performance liquid chromatography ("HPLC") is employed for purification.
The chemokine polypeptides of the present invention may be a naturally purified product, including bodily fluids, tissues and cells, whether directly isolated or cultured; products of chemical synthetic procedures; or produced by recombinant techniques from a prokaryotic or eukaryotic host (for example, by bacterial, yeast, higher plant, insect and mammalian cells in culture). Depending upon the host employed in a recombinant production procedure, the polypeptides of the present invention may be glycosylated or may be non-glycosylated. Polypeptides of the invention may also include an initial methionine amino acid residue, in some cases as a result of host-mediated processes. Thus, it is well known in the art that the N-terminal methionine encoded by the translation initiation codon generally is removed with high efficiency from any protein after translation in all eukaryotic cells. While the N-terminal methionine on most proteins also is efficiently removed in most prokaryotes, for some proteins, this prokaryotic removal process is inefficient, depending on the nature of the amino acid to which the N-terminal methionine is covalently linked. In one embodiment, the yeast Pichia pastoris is used to express the chemokine polypeptides in a eukaryotic system. Pichia pastoris is a methylotrophic yeast which can metabolize methanol as its sole carbon source. A main step in the methanol metabolization pathway is the oxidation of methanol to formaldehyde using O2. This reaction is catalyzed by the enzyme alcohol oxidase. In order to metabolize methanol as its sole carbon source, Pichia pastoris must generate high levels of alcohol oxidase due, in part, to the relatively low affinity of alcohol oxidase for O2. Consequently, in a growth medium depending on methanol as a main carbon source, the promoter region of one of the two alcohol oxidase genes (AOXl) is highly active. In the presence of methanol, alcohol oxidase produced from the AOXl gene comprises up to approximately 30% of the total soluble protein in Pichia pastoris. See, Ellis, S.B., et al, Mol. Cell. Biol. 5:1111-21 (1985); Koutz, P.J, et al, Yeast 5: 167-77 (1989); Tschopp, J.F., et al, Nucl. Acids Res. 15:3859-76 (1987). Thus, a heterologous coding sequence, such as, for example, a chemokine polynucleotide of the present invention, under the transcriptional regulation of all or part of the AOXl regulatory sequence is expressed at exceptionally high levels in Pichia yeast grown in the presence of methanol.
In one example, the plasmid vector pPIC9K is used to express DNA encoding a chemokine polypeptide of the invention, as set forth herein, in a Pichea yeast system essentially as described in "Pichia Protocols: Methods in Molecular Biology," D.R. Higgins and J. Cregg, eds. The Humana Press, Totowa, NJ, 1998. This expression vector allows expression and secretion of a Ckβ-4 or Ckβ-10 protein of the invention by virtue of the strong AOXl promoter linked to the Pichia pastoris alkaline phosphatase (PHO) secretory signal peptide (i.e., leader) located upstream of a multiple cloning site. Many other yeast vectors could be used in place of pPIC9K, such as, pYES2, pYDl, pTEFl/Zeo, pYES2/GS, pPICZ, pGAPZ, pGAPZalpha, pPIC9, pPIC3.5, pHIL-D2, pHIL-Sl, pPIC3.5K, and PAO815, as one skilled in the art would readily appreciate, as long as the proposed expression construct provides appropriately located signals for transcription, translation, secretion (if desired), and the like, including an in-frame AUG as required.
In another embodiment, high-level expression of a heterologous coding sequence, such as, for example, a chemokine polynucleotide of the present invention, may be achieved by cloning the heterologous polynucleotide of the invention into an expression vector such as, for example, pGAPZ or pGAPZalpha, and growing the yeast culture in the absence of methanol.
In addition to encompassing host cells containing the vector constructs discussed herein, the invention also encompasses primary, secondary, and immortalized host cells of vertebrate origin, particularly mammalian origin, that have been engineered to delete or replace endogenous genetic material (e.g., a chemokine coding sequence), and/or to include genetic material (e.g., heterologous polynucleotide sequences) that is operably associated with a chemokine polynucleotide of the invention, and which activates, alters, and/or amplifies an endogenous chemokine polynucleotide. For example, techniques known in the art may be used to operably associate heterologous control regions (e.g., promoter and/or enhancer) and endogenous chemokine polynucleotide sequences via homologous recombination, resulting in the formation of a new transcription unit (see, e.g., U.S. Patent No. 5,641,670, issued June 24, 1997; U.S. Patent No. 5,733,761, issued March 31, 1998; International Publication No. WO 96/29411, published September 26, 1996; International Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989), the disclosures of each of which are incoφorated by reference in their entireties).
In addition, polypeptides of the invention can be chemically synthesized using techniques known in the art (e.g.. see Creighton, 1983, Proteins: Structures and Molecular Principles, W.H. Freeman & Co., N.Y., and Hunkapiller et al., Nature, 310:105-111 (1984)). For example, a polypeptide corresponding to a fragment of a chemokine polypeptide can be synthesized by use of a peptide synthesizer. Furthermore, if desired, nonclassical amino acids or chemical amino acid analogs can be introduced as a substitution or addition into a chemokine polypeptide sequence. Non-classical amino acids include, but are not limited to, to the D-isomers of the common amino acids, 2,4-diaminobutyric acid, a- amino isobutyric acid, 4-aminobutyric acid, Abu, 2-amino butyric acid, g-Abu, e-Ahx, 6-amino hexanoic acid, Aib, 2-amino isobutyric acid, 3-amino propionic acid, omithine, norleucine, norvaline, hydroxyproline, sarcosine, citrulline, homocitrulline, cysteic acid, t- butylglycine, t-butylalanine, phenyl glycine, cyclohexylalanine, b-alanine, fluoro-amino acids, designer amino acids such as b-methyl amino acids, Ca-methyl amino acids, Na- methyl amino acids, and amino acid analogs in general. Furthermore, the amino acid can be D (dextrorotary) or L (levorotary).
The invention encompasses Ckβ-4 and Ckβ-10 polypeptides which are differentially modified during or after translation, e.g., by glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to an antibody molecule or other cellular ligand, etc. Any of numerous chemical modifications may be carried out by known techniques, including but not limited, to specific chemical cleavage by cyanogen bromide, trypsin, chymotrypsin, papain, V8 protease, NaBH4; acetylation, formylation, oxidation, reduction; metabolic synthesis in the presence of tunicamycin; etc.
Additional post-translational modifications encompassed by the invention include, for example, e.g., N-linked or O-linked carbohydrate chains, processing of N-terminal or C-terminal ends), attachment of chemical moieties to the amino acid backbone, chemical modifications of N-linked or O-linked carbohydrate chains, and addition or deletion of an N-terminal methionine residue as a result of procaryotic host cell expression. The polypeptides may also be modified with a detectable label, such as an enzymatic, fluorescent, isotopic or affinity label to allow for detection and isolation of the protein.
Also provided by the invention are chemically modified derivatives of the polypeptides of the mvention which may provide additional advantages such as increased solubility, stability and circulating time of the polypeptide, or decreased immunogenicity (see U.S. Patent No. 4,179,337). The chemical moieties for derivitization may be selected from water soluble polymers such as polyethylene glycol, ethylene glycol propylene glycol copolymers, carboxymethylcellulose, dextran, polyvinyl alcohol and the like. The polypeptides may be modified at random positions within the molecule, or at predetermined positions within the molecule and may include one, two, three or more attached chemical moieties.
The polymer may be of any molecular weight, and may be branched or unbranched. For polyethylene glycol, the preferred molecular weight is between about 1 kDa and about 100 kDa (the term "about" indicating that in preparations of polyethylene glycol, some molecules will weigh more, some less, than the stated molecular weight) for ease in handling and manufacturing. Other sizes may be used, depending on the desired therapeutic profile (e.g., the duration of sustained release desired, the effects, if any on biological activity, the ease in handling, the degree or lack of antigenicity and other known effects of the polyethylene glycol to a therapeutic protein or analog).
The polyethylene glycol molecules (or other chemical moieties) should be attached to the protein with consideration of effects on functional or antigenic domains of the protein. There are a number of attachment methods available to those skilled in the art, e.g., EP 0 401 384, herein incoφorated by reference (coupling PEG to G-CSF), see also Malik et al., Exp. Hematol. 20: 1028-1035 (1992) (reporting pegylation of GM-CSF using tresyl chloride). For example, polyethylene glycol may be covalently bound through amino acid residues via a reactive group, such as, a free amino or carboxyl group. Reactive groups are those to which an activated polyethylene glycol molecule may be bound. The amino acid residues having a free amino group may include lysine residues and the N-terminal amino acid residues; those having a free carboxyl group may include aspartic acid residues glutamic acid residues and the C-terminal amino acid residue. Sulfhydryl groups may also be used as a reactive group for attaching the polyethylene glycol molecules. Preferred for therapeutic puφoses is attachment at an amino group, such as attachment at the N-terminus or lysine group.
One may specifically desire proteins chemically modified at the N-terminus. Using polyethylene glycol as an illustration of the present composition, one may select from a variety of polyethylene glycol molecules (by molecular weight, branching, etc.), the proportion of polyethylene glycol molecules to protein (polypeptide) molecules in the reaction mix, the type of pegylation reaction to be performed, and the method of obtaining the selected N-terminally pegylated protein. The method of obtaining the N-terminally pegylated preparation (i.e., separating this moiety from other monopegylated moieties if necessary) may be by purification of the N-terminally pegylated material from a population of pegylated protein molecules. Selective proteins chemically modified at the N-terminus modification may be accomplished by reductive alkylation which exploits differential reactivity of different types of primary amino groups (lysine versus the N-terminal) available for derivatization in a particular protein. Under the appropriate reaction conditions, substantially selective derivatization of the protein at the N-terminus with a carbonyl group containing polymer is achieved.
The chemokine polypeptides of the invention may be in monomers or multimers (i.e., dimers, trimers, tetramers and higher multimers). Accordingly, the present invention relates to monomers and multimers of the chemokine polypeptides of the invention, their preparation, and compositions (preferably, Therapeutics) containing them. In specific embodiments, the polypeptides of the invention are monomers, dimers, trimers or tetramers.
In additional embodiments, the multimers of the invention are at least dimers, at least trimers, or at least tetramers.
Multimers encompassed by the invention may be homomers or heteromers. As used herein, the term homomer, refers to a multimer containing only polypeptides corresponding to the amino acid sequence of SEQ ED NO:2 or SEQ ED NO:4 or encoded by the cDNA contained in the clones deposited as ATCC Deposit Nos. 75848 or 75849 (including fragments, variants, splice variants, and fusion proteins, corresponding to these as described herein). These homomers may contain chemokine polypeptides having identical or different amino acid sequences. In a specific embodiment, a homomer of the invention is a multimer containing only chemokine polypeptides having an identical amino acid sequence. In another specific embodiment, a homomer of the invention is a multimer containing chemokine polypeptides having different amino acid sequences. In specific embodiments, the multimer of the invention is a homodimer (e.g., containing chemokine polypeptides having identical or different amino acid sequences) or a homotrimer (e.g., containing chemokine polypeptides having identical and/or different amino acid sequences). In additional embodiments, the homomeric multimer of the invention is at least a homodimer, at least a homotrimer, or at least a homotetramer.
As used herein, the term heteromer refers to a multimer containing one or more heterologous polypeptides (i.e., polypeptides of different proteins) in addition to the chemokine polypeptides of the invention. In a specific embodiment, the multimer of the invention is a heterodimer, a heterotrimer, or a heterotetramer. In additional embodiments, the heteromeric multimer of the invention is at least a heterodimer, at least a heterotrimer, or at least a heterotetramer.
Multimers of the invention may be the result of hydrophobic, hydrophilic, ionic and or covalent associations and/or may be indirectly linked, by for example, liposome formation. Thus, in one embodiment, multimers of the invention, such as, for example, homodimers or homotrimers, are formed when polypeptides of the invention contact one another in solution. In another embodiment, heteromultimers of the invention, such as, for example, heterotrimers or heterotetramers, are formed when polypeptides of the invention contact antibodies to the polypeptides of the invention (including antibodies to the heterologous polypeptide sequence in a fusion protein of the invention) in solution. In other embodiments, multimers of the invention are formed by covalent associations with and/or between the chemokine polypeptides of the invention. Such covalent associations may involve one or more amino acid residues contained in the polypeptide sequence (e.g., that recited in SEQ LD NO: 2 or SEQ ED NO:4, or contained in the polypeptide encoded by the clones deposited as ATCC Deposit Nos. 75848 or 75849). In one instance, the covalent associations are cross-linking between cysteine residues located within the polypeptide sequences which interact in the native (i.e., naturally occurring) polypeptide. In another instance, the covalent associations are the consequence of chemical or recombinant manipulation. Alternatively, such covalent associations may involve one or more amino acid residues contained in the heterologous polypeptide sequence in a chemokine fusion protein. In one example, covalent associations are between the heterologous sequence contained in a fusion protein of the invention (see, e.g., U.S. Patent Number 5,478,925). In a specific example, the covalent associations are between the heterologous sequence contained in a chemokine-Fc fusion protein of the invention (as described herein). In another specific example, covalent associations of fusion proteins of the invention are between heterologous polypeptide sequence from another protein that is capable of forming covalently associated multimers, such as for example, oseteoprotegerin (see, e.g., International Publication No: WO 98/49305, the contents of which are herein incoφorated by reference in its entirety). In another embodiment, two or more polypeptides of the invention are joined through peptide linkers. Examples include those peptide linkers described in U.S. Pat. No. 5,073,627 (hereby incoφorated by reference). Proteins comprising multiple polypeptides of the invention separated by peptide linkers may be produced using conventional recombinant DNA technology. Another method for preparing multimer polypeptides of the invention involves use of polypeptides of the invention fused to a leucine zipper or isoleucine zipper polypeptide sequence. Leucine zipper and isoleucine zipper domains are polypeptides that promote multimerization of the proteins in which they are found. Leucine zippers were originally identified in several DNA-binding proteins (Landschulz et al, Science 240: 1759, (1988)), and have since been found in a variety of different proteins. Among the known leucine zippers are naturally occurring peptides and derivatives thereof that dimerize or trimerize. Examples of leucine zipper domains suitable for producing soluble multimeric proteins of the invention are those described in PCT application WO 94/10308, hereby incoφorated by reference. Recombinant fusion proteins comprising a polypeptide of the invention fused to a polypeptide sequence that dimerizes or trimerizes in solution are expressed in suitable host cells, and the resulting soluble multimeric fusion protein is recovered from the culture supernatant using techniques known in the art. Trimeric polypeptides of the invention may offer the advantage of enhanced biological activity. Preferred leucine zipper moieties and isoleucine moieties are those that preferentially form trimers. One example is a leucine zipper derived from lung surfactant protein D (SPD), as described in Hoppe et al. (FEBS Letters 344:191, (1994)) and in U.S. patent application Ser. No. 08/446,922, hereby incoφorated by reference. Other peptides derived from naturally occurring trimeric proteins may be employed in preparing trimeric polypeptides of the invention.
In another example, proteins of the invention are associated by interactions between Flag® polypeptide sequence contained in fusion proteins of the invention containing Flag® polypeptide seuqence. In a further embodiment, associations proteins of the invention are associated by interactions between heterologous polypeptide sequence contained in Flag® fusion proteins of the invention and anti-Flag® antibody.
The multimers of the invention may be generated using chemical techniques known in the art. For example, polypeptides desired to be contained in the multimers of the invention may be chemically cross-linked using linker molecules and linker molecule length optimization techniques known in the art (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety). Additionally, multimers of the invention may be generated using techniques known in the art to form one or more inter-molecule cross-links between the cysteine residues located within the sequence of the polypeptides desired to be contained in the multimer (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety). Further, polypeptides of the invention may be routinely modified by the addition of cysteine or biotin to the C terminus or N-terminus of the polypeptide and techniques known in the art may be applied to generate multimers containing one or more of these modified polypeptides (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety). Additionally, techniques known in the art may be applied to generate liposomes containing the polypeptide components desired to be contained in the multimer of the invention (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety).
Alternatively, multimers of the invention may be generated using genetic engineering techniques known in the art. In one embodiment, polypeptides contained in multimers of the invention are produced recombinantly using fusion protein technology described herein or otherwise known in the art (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety). In a specific embodiment, polynucleotides coding for a homodimer of the invention are generated by ligating a polynucleotide sequence encoding a polypeptide of the invention to a sequence encoding a linker polypeptide and then further to a synthetic polynucleotide encoding the translated product of the polypeptide in the reverse orientation from the original C-terminus to the N-terminus (lacking the leader sequence) (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety). In another embodiment, recombinant techniques described herein or otherwise known in the art are applied to generate recombinant polypeptides of the invention which contain a transmembrane domain (or hyrophobic or signal peptide) and which can be incoφorated by membrane reconstitution techniques into liposomes (see, e.g., US Patent Number 5,478,925, which is herein incoφorated by reference in its entirety).
Uses of the Ckβ-4 and Ckβ-10 Polynucleotides
The Ckβ-4 and Ckβ-10 polynucleotides identified herein can be used in numerous ways as reagents. The following description should be considered exemplary and utilizes known techniques. The sequences of the present invention are valuable for chromosome identification.
The sequence is specifically targeted to and can hybridize with a particular location on an individual human chromosome. Moreover, there is a current need for identifying particular sites on the chromosome. Few chromosome marking reagents based on actual sequence data (repeat polymoφhisms) are presently available for marking chromosomal location. The mapping of DNAs to chromosomes according to the present invention is an important first step in correlating those sequences with genes associated with disease.
Briefly, sequences can be mapped to chromosomes by preparing PCR primers (preferably 15-25 bp) from the cDNA shown in SEQ ID NO:l or SEQ ED NO: 3. Computer analysis of the cDNA is used to rapidly select primers that do not span more than one exon in the genomic DNA, thus complicating the amplification process. These primers are then used for PCR screening of somatic cell hybrids containing individual human chromosomes. Only those hybrids containing the human gene corresponding to the primer will yield an amplified fragment.
PCR mapping of somatic cell hybrids is a rapid procedure for assigning a particular DNA to a particular chromosome. Three or more clones can be assigned per day using a single thermal cycler. Using the present invention with the same oligonucleotide primers, sublocalization of the Ckβ-4 or Ckβ-10 polynucleotides can be achieved with panels of fragments from specific chromosomes or pools of large genomic clones in an analogous manner. Other mapping strategies that can similarly be used to map to its chromosome include in situ hybridization, prescreening with labeled flow-sorted chromosomes and preselection by hybridization to construct chromosome specific-cDNA libraries.
Fluorescence in situ hybridization (FISH) of a cDNA clone to a metaphase chromosomal spread can be used to provide a precise chromosomal location in one step. This technique can be used with cDNA as short as 500 or 600 bases; however, clones larger than 2,000 bp, preferrably 2,000-4,000 bp, have a higher likelihood of binding to a unique chromosomal location with sufficient signal intensity for simple detection. FISH requires use of the clones from which the EST was derived, and the longer the better. For example, 2,000 bp is good, 4,000 is better, and more than 4,000 is probably not necessary to get good results a reasonable percentage of the time. For a review of this technique, see Verma et al., Human Chromosomes: a Manual of Basic Techniques, Pergamon Press, New York (1988). For chromosome mapping, the Ckβ-4 or Ckβ-10 polynucleotides can be used individually (to mark a single chromosome or a single site on that chromosome) or in panels (for marking multiple sites and/or multiple chromosomes). Preferred polynucleotides correspond to the noncoding regions of the cDNAs because the coding sequences are more likely conserved within gene families, thus increasing the chance of cross hybridization during chromosomal mapping.
Once a sequence has been mapped to a precise chromosomal location, the physical position of the sequence on the chromosome can be correlated with genetic map data. Such data are found, for example, in V. McKusick, Mendelian Inheritance in Man (available on line through Johns Hopkins University Welch Medical Library). The relationship between genes and diseases that have been mapped to the same chromosomal region are then identified through linkage analysis (coinheritance of physically adjacent genes). Linkage analysis establishes coinheritance between a chromosomal location and presentation of a particular disease. With current resolution of physical mapping and genetic mapping techniques, a cDNA precisely localized to a chromosomal region associated with the disease could be one of between 50 and 500 potential causative genes. (This assumes 1 megabase mapping resolution and one gene per 20 kb).
Next, it is necessary to determine the differences in the cDNA or genomic sequence between affected and unaffected individuals. If a mutation is observed in some or all of the affected individuals but not in any normal individuals, then the mutation is likely to be the causative agent of the disease. Thus, once coinheritance is established, differences in the
Ckβ-4 or Ckβ-10 polynucleotide and the corresponding gene between affected and unaffected individuals can be examined. First, visible structural alterations in the chromosomes, such as deletions or translocations, are examined in chromosome spreads or by PCR. If no structural alterations exist, the presence of point mutations are ascertained. Mutations observed in some or all affected individuals, but not in normal individuals, indicates that the mutation may cause the disease. However, complete sequencing of the
Ckβ-4 or Ckβ-10 polynucleotide and the corresponding gene from several normal individuals is required to distinguish the mutation from a polymoφhism. If a new polymoφhism is identified, this polymoφhic polypeptide can be used for further linkage analysis.
Furthermore, increased or decreased expression of the gene in affected individuals as compared to unaffected individuals can be assessed using Ckβ-4 or Ckβ-10 polynucleotides.
Any of these alterations (altered expression, chromosomal rearrangement, or mutation) can be used as a diagnostic or prognostic marker.
Thus, the invention also provides a diagnostic method useful during diagnosis of a disorder, involving measuring the expression level of polynucleotides of the present invention in cells or body fluid from an individual and comparing the measured gene expression level with a standard level of polynucleotide expression level, whereby an increase or decrease in the gene expression level compared to the standard is indicative of a disorder.
In still another embodiment, the invention includes a kit for analyzing samples for the presence of proliferative and/or cancerous polynucleotides derived from a test subject. In a general embodiment, the kit includes at least one polynucleotide probe containing a nucleotide sequence that will specifically hybridize with a polynucleotide of the present invention and a suitable container. In a specific embodiment, the kit includes two polynucleotide probes defining an internal region of the polynucleotide of the present invention, where each probe has one strand containing a 31'mer-end internal to the region. In a further embodiment, the probes may be useful as primers for polymerase chain reaction amplification.
Where a diagnosis of a disorder, has already been made according to conventional methods, the present invention is useful as a prognostic indicator, whereby patients exhibiting enhanced or depressed polynucleotide of the present invention expression will experience a worse clinical outcome relative to patients expressing the gene at a level nearer the standard level.
By "measuring the expression level of polynucleotide of the present invention" is intended qualitatively or quantitatively measuring or estimating the level of the polypeptide of the present invention or the level of the mRNA encoding the polypeptide in a first biological sample either directly (e.g., by determining or estimating absolute protein level or mRNA level) or relatively (e.g., by comparing to the polypeptide level or mRNA level in a second biological sample). Preferably, the polypeptide level or mRNA level in the first biological sample is measured or estimated and compared to a standard polypeptide level or mRNA level, the standard being taken from a second biological sample obtained from an individual not having the disorder or being determined by averaging levels from a population of individuals not having a disorder. As will be appreciated in the art, once a standard polypeptide level or mRNA level is known, it can be used repeatedly as a standard for comparison.
By "biological sample" is intended any biological sample obtained from an individual, body fluid, cell line, tissue culture, or other source which contains the polypeptide of the present invention or mRNA. As indicated, biological samples include body fluids (such as semen, lymph, sera, plasma, urine, synovial fluid and spinal fluid) which contain the polypeptide of the present invention, and other tissue sources found to express the polypeptide of the present invention. Methods for obtaining tissue biopsies and body fluids from mammals are well known in the art. Where the biological sample is to include mRNA, a tissue biopsy is the preferred source.
The method(s) provided above may preferrably be applied in a diagnostic method and/or kits in which polynucleotides and/or polypeptides are attached to a solid support. In one exemplary method, the support may be a "gene chip" or a "biological chip" as described in US Patents 5,837,832, 5,874,219, and 5,856,174. Further, such a gene chip with polynucleotides of the present invention attached may be used to identify polymoφhisms between the polynucleotide sequences, with polynucleotides isolated from a test subject. The knowledge of such polymoφhisms (i.e. their location, as well as, their existence) would be beneficial in identifying disease loci for many disorders, including cancerous diseases and conditions. Such a method is described in US Patents 5,858,659 and 5,856,104. The US Patents referenced supra are hereby incoφorated by reference in their entirety herein.
The present invention encompasses polynucleotides of the present invention that are chemically synthesized, or reproduced as peptide nucleic acids (PNA), or according to other methods known in the art. The use of PNAs would serve as the preferred form if the polynucleotides are incoφorated onto a solid support, or gene chip. For the puφoses of the present invention, a peptide nucleic acid (PNA) is a polyamide type of DNA analog and the monomeric units for adenine, guanine, thymine and cytosine are available commercially (Perceptive Biosystems). Certain components of DNA, such as phosphorus, phosphorus oxides, or deoxyribose derivatives, are not present in PNAs. As disclosed by P. E. Nielsen, M. Egholm, R. H. Berg and O. Buchardt, Science 254, 1497 (1991); and M. Egholm, O. Buchardt, L.Christensen, C. Behrens, S. M. Freier, D. A. Driver, R. H. Berg, S. K. Kim, B. Norden, and P. E. Nielsen, Nature 365, 666 (1993), PNAs bind specifically and tightly to complementary DNA strands and are not degraded by nucleases. In fact, PNA binds more strongly to DNA than DNA itself does. This is probably because there is no electrostatic repulsion between the two strands, and also the polyamide backbone is more flexible. Because of this, PNA/DNA duplexes bind under a wider range of stringency conditions than DNA/DNA duplexes, making it easier to perform multiplex hybridization. Smaller probes can be used than with DNA due to the strong binding. In addition, it is more likely that single base mismatches can be determined with PNA/DNA hybridization because a single mismatch in a PNA/DNA 15-mer lowers the melting point (T.sub.m) by 8°-20° C, vs. 4°-16° C for the DNA/DNA 15-mer duplex. Also, the absence of charge groups in PNA means that hybridization can be done at low ionic strengths and reduce possible interference by salt during the analysis.
The present invention is useful for detecting cancer in mammals. In particular the invention is useful during diagnosis of pathological cell proliferative neoplasias which include, but are not limited to: acute myelogenous leukemias including acute monocytic leukemia, acute myeloblastic leukemia, acute promyelocytic leukemia, acute myelomonocytic leukemia, acute erythroleukemia, acute megakaryocytic leukemia, and acute undifferentiated leukemia, etc.; and chronic myelogenous leukemias including chronic myelomonocytic leukemia, chronic granulocytic leukemia, etc. Preferred mammals include monkeys, apes, cats, dogs, cows, pigs, horses, rabbits and humans. Particularly preferred are humans.
Pathological cell proliferative disorders are often associated with inappropriate activation of proto-oncogenes. (Gelmann, E. P. et al., "The Etiology of Acute Leukemia: Molecular Genetics and Viral Oncology," in Neoplastic Diseases of the Blood, Vol 1. , Wiemik, P. H. et al. eds., 161-182 (1985)). Neoplasias are now believed to result from the qualitative alteration of a normal cellular gene product, or from the quantitative modification of gene expression by insertion into the chromosome of a viral sequence, by chromosomal translocation of a gene to a more actively transcribed region, or by some other mechanism. (Gelmann et al., supra) It is likely that mutated or altered expression of specific genes is involved in the pathogenesis of some leukemias. among other tissues and cell types. (Gelmann et al., supra) Indeed, the human counteφarts of the oncogenes involved in some animal neoplasias have been amplified or translocated in some cases of human leukemia and carcinoma. (Gelmann et al., supra)
For example, c-myc expression is highly amplified in the non-lymphocytic leukemia cell line HL-60. When HL-60 cells are chemically induced to stop proliferation, the level of c-myc is found to be downregulated. (Intemational Publication Number WO 91/15580) However, it has been shown that exposure of HL-60 cells to a DNA construct that is complementary to the 5' end of c-myc or c-myb blocks translation of the corresponding mRNAs which downregulates expression of the c-myc or c-myb proteins and causes arrest of cell proliferation and differentiation of the treated cells. (International Publication Number WO 91/15580; Wickstrom et al, Proc. Natl. Acad. Sci. 85:1028 (1988); Anfossi et al., Proc. Natl. Acad. Sci. 86:3379 (1989)). However, the skilled artisan would appreciate the present invention's usefulness would not be Umited to treatment of proliferative diseases, disorders, and/or conditions of hematopoietic cells and tissues, in light of the numerous cells and cell types of varying origins which are known to exhibit proliferative phenotypes.
In addition to the foregoing, a Ckβ-4 or Ckβ-10 polynucleotide can be used to control gene expression through triple helix formation or antisense DNA or RNA. Antisense techniques are discussed, for example, in Okano, J. Neurochem. 56: 560 (1991); "Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression,CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance Lee et al., Nucleic Acids Research 6: 3073 (1979); Cooney et al., Science 241: 456 (1988); and Dervan et al., Science 251: 1360 (1991). Both methods rely on binding of the polynucleotide to a complementary DNA or RNA. For these techniques, preferred polynucleotides are usually oligonucleotides 20 to 40 bases in length and complementary to either the region of the gene involved in transcription (triple helix - see Lee et al., Nucl. Acids Res. 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251: 1360 (1991) ) or to the mRNA itself (antisense - Okano, J. Neurochem. 56:560 (1991); Oligodeoxy-nucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988).) Triple helix formation optimally results in a shut-off of RNA transcription from DNA, while antisense RNA hybridization blocks translation of an mRNA molecule into polypeptide. Both techniques are effective in model systems, and the information disclosed herein can be used to design antisense or triple helix polynucleotides in an effort to treat or prevent disease.
Ckβ-4 or Ckβ-10 polynucleotides are also useful in gene therapy. One goal of gene therapy is to insert a normal gene into an organism having a defective gene, in an effort to correct the genetic defect. Ckβ-4 or Ckβ-10 offers a means of targeting such genetic defects in a highly accurate manner. Another goal is to insert a new gene that was not present in the host genome, thereby producing a new trait in the host cell.
The Ckβ-4 or Ckβ-10 polynucleotides are also useful for identifying individuals from minute biological samples. The United States military, for example, is considering the use of restriction fragment length polymoφhism (RFLP) for identification of its personnel. In this technique, an individual's genomic DNA is digested with one or more restriction enzymes, and probed on a Southern blot to yield unique bands for identifying personnel. This method does not suffer from the current limitations of "Dog Tags" which can be lost, switched, or stolen, making positive identification difficult. The Ckβ-4 or Ckβ-10 polynucleotides can be used as additional DNA markers for RFLP. The Ckβ-4 or Ckβ-10 polynucleotides can also be used as an alternative to RFLP, by determining the actual base-by-base DNA sequence of selected portions of an individual's genome. These sequences can be used to prepare PCR primers for amplifying and isolating such selected DNA, which can then be sequenced. Using this technique, individuals can be identified because each individual will have a unique set of DNA sequences. Once an unique ED database is established for an individual, positive identification of that individual, living or dead, can be made from extremely small tissue samples. Forensic biology also benefits from using DNA-based identification techniques as disclosed herein. DNA sequences taken from very small biological samples such as tissues, e.g., hair or skin, or body fluids, e.g., blood, saliva, semen, synovial fluid, amniotic fluid, breast milk, lymph, pulmonary sputum or surfactant, urine,fecal matter, etc., can be amplified using PCR. In one prior art technique, gene sequences amplified from polymoφhic loci, such as DQa class II HLA gene, are used in forensic biology to identify individuals. (Erlich, H., PCR Technology, Freeman and Co. (1992).) Once these specific polymoφhic loci are amplified, they are digested with one or more restriction enzymes, yielding an identifying set of bands on a Southern blot probed with DNA corresponding to the DQa class II HLA gene. Similarly, Ckβ-4 or Ckβ-10 polynucleotides can be used as polymoφhic markers for forensic puφoses.
There is also a need for reagents capable of identifying the source of a particular tissue. Such need arises, for example, in forensics when presented with tissue of unknown origin. Appropriate reagents can comprise, for example, DNA probes or primers specific to particular tissue prepared from Ckβ-4 or Ckβ-10 sequences. Panels of such reagents can identify tissue by species and/or by organ type. In a similar fashion, these reagents can be used to screen tissue cultures for contamination.
Because Ckβ-4 is found expressed in gall bladder and Ckβ-10 is found expressed in nine week early human tissue, chemokine polynucleotides are useful as hybridization probes for differential identification of the tissue(s) or cell type(s) present in a biological sample. Similarly, polypeptides and antibodies directed to the chemokine polypeptides are useful to provide immunological probes for differential identification of the tissue(s) or cell type(s). In addition, for a number of diseases, disorders, and/or conditions of the above tissues or cells, particularly of the immune system, significantly higher or lower levels of Ckβ-4 or Ckβ-10 gene expression may be detected in certain tissues (e.g., cancerous and wounded tissues) or bodily fluids (e.g., serum, plasma, urine, synovial fluid or spinal fluid) taken from an individual having such a disorder, relative to a "standard" Ckβ-4 or Ckβ-10 gene expression level, i.e., the Ckβ-4 or Ckβ-10 expression level in healthy tissue from an individual not having the immune system disorder. Thus, the invention provides a diagnostic method of a disorder, which involves: (a) assaying Ckβ-4 or Ckβ-10 gene expression level in cells or body fluid of an individual; (b) comparing the Ckβ-4 or Ckβ-10 gene expression level with a standard Ckβ-4 or Ckβ-10 gene expression level, whereby an increase or decrease in the assayed Ckβ-4 or Ckβ-10 gene expression level compared to the standard expression level is indicative of disorder in the immune system.
In the very least, the Ckβ-4 or Ckβ-10 polynucleotides can be used as molecular weight markers on Southern gels, as diagnostic probes for the presence of a specific mRNA in a particular cell type, as a probe to "subtract-out" known sequences in the process of discovering novel polynucleotides, for selecting and making oligomers for attachment to a "gene chip" or other support, to raise anti-DNA antibodies using DNA immunization techniques, and as an antigen to elicit an immune response.
Uses of Ckβ-4 and Ckβ-10 Polypeptides Ckβ-4 and/or Ckβ-10 polypeptides can be used in numerous ways. The following description should be considered exemplary and utilizes known techniques.
Ckβ-4 and/or Ckβ-10 polypeptides can be used to assay protein levels in a biological sample using antibody-based techniques. For example, protein expression in tissues can be studied with classical immunohistological methods. (Jalkanen, M., et al., J. Cell. Biol. 101:976-985 (1985); Jalkanen, M., et al., J. Cell . Biol. 105:3087-3096 (1987).) Other antibody-based methods useful for detecting protein gene expression include immunoassays, such as the enzyme linked immunosorbent assay (ELISA) and the radioimmunoassay (RIA). Suitable antibody assay labels are known in the art and include enzyme labels, such as, glucose oxidase, and radioisotopes, such as iodine (1251, 1211), carbon (14C), sulfur (35S), tritium (3H), indium (112In), and technetium (99mTc), and fluorescent labels, such as fluorescein and rhodamine, and biotin.
In addition to assaying protein levels in a biological sample, proteins can also be detected in vivo by imaging. Antibody labels or markers for in vivo imaging of protein include those detectable by X-radiography, NMR or ESR. For X-radiography, suitable labels include radioisotopes such as barium or cesium, which emit detectable radiation but are not overtly harmful to the subject. Suitable markers for NMR and ESR include those with a detectable characteristic spin, such as deuterium, which may be incoφorated into the antibody by labeling of nutrients for the relevant hybridoma.
A protein-specific antibody or antibody fragment which has been labeled with an appropriate detectable imaging moiety, such as a radioisotope (for example, 1311, 112In, 99mTc), a radio-opaque substance, or a material detectable by nuclear magnetic resonance, is introduced (for example, parenterally, subcutaneously, or intraperitoneally) into the mammal. It will be understood in the art that the size of the subject and the imaging system used will determine the quantity of imaging moiety needed to produce diagnostic images. In the case of a radioisotope moiety, for a human subject, the quantity of radioactivity injected will normally range from about 5 to 20 millicuries of 99mTc. The labeled antibody or antibody fragment will then preferentially accumulate at the location of cells which contain the specific protein. In vivo tumor imaging is described in S.W. Burchiel et al., "Lmmunopharmacokinetics of Radiolabeled Antibodies and Their Fragments." (Chapter 13 in Tumor Imaging: The Radiochemical Detection of Cancer, S.W. Burchiel and B. A. Rhodes, eds., Masson Publishing Inc. (1982).)
Thus, the invention provides a diagnostic method of a disorder, which involves (a) assaying the expression of Ckβ-4 or Ckβ-10 polypeptide in cells or body fluid of an individual; (b) comparing the level of gene expression with a standard gene expression level, whereby an increase or decrease in the assayed Ckβ-4 or Ckβ-10 polypeptide gene expression level compared to the standard expression level is indicative of a disorder. With respect to cancer, the presence of a relatively high amount of transcript in biopsied tissue from an individual may indicate a predisposition for the development of the disease, or may provide a means for detecting the disease prior to the appearance of actual clinical symptoms. A more definitive diagnosis of this type may allow health professionals to employ preventative measures or aggressive treatment earlier thereby preventing the development or further progression of the cancer.
Moreover, Ckβ-4 or Ckβ-10 polypeptides can be used to treat, prevent, and/or diagnose disease. For example, patients can be administered Ckβ-4 or Ckβ-10 polypeptides in an effort to replace absent or decreased levels of a Ckβ-4 or Ckβ-10 polypeptide (e.g., insulin), to supplement absent or decreased levels of a different polypeptide (e.g., hemoglobin S for hemoglobin B, SOD, catalase, DNA repair proteins), to inhibit the activity of a polypeptide (e.g., an oncogene or tumor supressor), to activate the activity of a polypeptide (e.g., by binding to a receptor), to reduce the activity of a membrane bound receptor by competing with it for free ligand (e.g., soluble TNF receptors used in reducing inflammation), or to bring about a desired response (e.g., blood vessel growth inhibition, enhancement of the immune response to proliferative cells or tissues).
Similarly, antibodies directed to Ckβ-4 or Ckβ-10 polypeptides can also be used to treat, prevent, and/or diagnose disease. For example, administration of an antibody directed to a Ckβ-4 or Ckβ-10 polypeptide can bind and reduce oveφroduction of the polypeptide. Similarly, administration of an antibody can activate the polypeptide, such as by binding to a polypeptide bound to a membrane (receptor).
At the very least, the Ckβ-4 or Ckβ-10 polypeptides can be used as molecular weight markers on SDS-PAGE gels or on molecular sieve gel filtration columns using methods well known to those of skill in the art. Ckβ-4 or Ckβ-10 polypeptides can also be used to raise antibodies, which in turn are used to measure protein expression from a recombinant cell, as a way of assessing transformation of the host cell. Moreover, Ckβ-4 or Ckβ-10 polypeptides can be used to test the following biological activities. Examples and Figures identified in the calcium mobilization and chemotactic of the immune anc inflamatory cells is essential to biological activities of antiviral, antibacterial and anticancer and would healing.
Gene Therapy Methods
Another aspect of the present invention is to gene therapy methods for treating or preventing disorders, diseases and conditions. The gene therapy methods relate to the introduction of nucleic acid (DNA, RNA and antisense DNA or RNA) sequences into an animal to achieve expression of a Ckβ-4 or Ckβ-10 polypeptide of the present invention.
This method requires a polynucleotide which codes for a Ckβ-4 or Ckβ-10 polypeptide operatively linked to a promoter and any other genetic elements necessary for the expression of the polypeptide by the target tissue. Such gene therapy and delivery techniques are known in the art, see, for example, WO90/11092, which is herein incoφorated by reference.
Thus, for example, cells from a patient may be engineered with a polynucleotide
(DNA or RNA) comprising a promoter operably linked to a Ckβ-4 or Ckβ-10 polynucleotide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, see Belldegrun, A., et al., J. Natl. Cancer Inst. 85: 207-216 (1993); Ferrantini, M. et al., Cancer Research 53: 1107-1112 (1993); Ferrantini, M. et al., J. Immunology 153: 4604-4615 (1994); Kaido, T., et al., Int. J. Cancer 60: 221-229 (1995); Ogura, H., et al, Cancer Research 50: 5102-5106 (1990); Santodonato, L., et al., Human Gene Therapy 7:1-10 (1996); Santodonato, L., et al., Gene Therapy 4: 1246-1255 (1997); and Zhang, J.-F. et al., Cancer Gene Therapy 3: 31- 38 (1996)), which are herein incoφorated by reference. In one embodiment, the cells which are engineered are arterial cells. The arterial cells may be reintroduced into the patient through direct injection to the artery, the tissues surrounding the artery, or through catheter injection.
As discussed in more detail below, the Ckβ-4 and Ckβ-10 polynucleotide constmcts can be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, and the like). The Ckβ-4 and Ckβ-10 polynucleotide constructs may be delivered in a pharmaceutically acceptable liquid or aqueous carrier.
In one embodiment, the Ckβ-4 or Ckβ-10 polynucleotide is delivered as a naked polynucleotide. The term "naked" polynucleotide, DNA or RNA refers to sequences that are free from any delivery vehicle that acts to assist, promote or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like. However, the Ckβ-4 and Ckβ-10 polynucleotides can also be delivered in liposome formulations and lipofectin formulations and the like can be prepared by methods well known to those skilled in the art. Such methods are described, for example, in U.S. Patent Nos. 5,593,972, 5,589,466, and 5,580,859, which are herein incoφorated by reference.
The Ckβ-4 and Ckβ-10 polynucleotide vector constructs used in the gene therapy method are preferably constructs that will not integrate into the host genome nor will they contain sequences that allow for replication. Appropriate vectors include pWLNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Pharmacia; and pEFl/V5, pcDNA33, and pRc/CMV2 available from Invitrogen. Other suitable vectors will be readily apparent to the skilled artisan.
Any strong promoter known to those skilled in the art can be used for driving the expression of Ckβ-4 and Ckβ-10 polynucleotide sequence. Suitable promoters include adenoviral promoters, such as the adenoviral major late promoter; or heterologous promoters, such as the cytomegalovirus (CMV) promoter; the respiratory syncytial vims (RSV) promoter; inducible promoters, such as the MMT promoter, the metallothionein promoter; heat shock promoters; the albumin promoter; the ApoAI promoter; human globin promoters; viral thymidine kinase promoters, such as the Heφes Simplex thymidine kinase promoter; retroviral LTRs; the b-actin promoter; and human growth hormone promoters.
The promoter also may be the native promoter for Ckβ-4 or Ckβ-10.
Unlike other gene therapy techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
The Ckβ-4 or Ckβ-10 polynucleotide construct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, utems, rectum, nervous system, eye, gland, and connective tissue. Interstitial space of the tissues comprises the intercellular, fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels. Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides. For the naked nucleic acid sequence injection, an effective dosage amount of DNA or RNA will be in the range of from about 0.05 mg/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection. The appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration.
The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose. In addition, naked Ckβ-4 or Ckβ-10 DNA constructs can be delivered to arteries during angioplasty by the catheter used in the procedure. The naked polynucleotides are delivered by any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, and so-called "gene guns". These delivery methods are known in the art.
The constructs may also be delivered with delivery vehicles such as viral sequences, viral particles, liposome formulations, lipofectin, precipitating agents, etc. Such methods of delivery are known in the art.
In certain embodiments, the Ckβ-4 and Ckβ-10 polynucleotide constmcts are complexed in a liposome preparation. Liposomal preparations for use in the instant invention include cationic (positively charged), anionic (negatively charged) and neutral preparations. However, cationic liposomes are particularly preferred because a tight charge complex can be formed between the cationic liposome and the polyanionic nucleic acid. Cationic liposomes have been shown to mediate intracellular delivery of plasmid DNA (Feigner et al., Proc. Natl. Acad. Sci. USA (1987) 84:7413-7416, which is herein incoφorated by reference); mRNA (Malone et al., Proc. Natl. Acad. Sci. USA (1989) 86:6077-6081, which is herein incoφorated by reference); and purified transcription factors (Debs et al., J. Biol. Chem. (1990) 265:10189-10192, which is herein incoφorated by reference), in functional form. Cationic liposomes are readily available. For example,
N[l-2,3-dioleyloxy)propyl]-N,N,N-triethylammonium (DOTMA) liposomes are particularly useful and are available under the trademark Lipofectin, from GIBCO BRL, Grand Island, N.Y. (See, also, Feigner et al., Proc. Natl Acad. Sci. USA (1987) 84:7413-7416, which is herein incoφorated by reference). Other commercially available liposomes include transfectace (DDAB/DOPE) and DOTAP/DOPE (Boehringer).
Other cationic liposomes can be prepared from readily available materials using techniques well known in the art. See, e.g. PCT Publication No. WO 90/11092 (which is herein incoφorated by reference) for a description of the synthesis of DOTAP (1,2- bis(oleoyloxy)-3-(trimethylammonio)propane) liposomes. Preparation of DOTMA liposomes is explained in the literature, see, e.g., P. Feigner et al., Proc. Natl. Acad. Sci. USA 84:7413-7417, which is herein incoφorated by reference. Similar methods can be used to prepare liposomes from other cationic lipid materials.
Similarly, anionic and neutral liposomes are readily available, such as from Avanti Polar Lipids (Birmingham, Ala.), or can be easily prepared using readily available materials. Such materials include phosphatidyl, choline, cholesterol, phosphatidyl ethanolamine, dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), dioleoylphoshatidyl ethanolamine (DOPE), among others. These materials can also be mixed with the DOTMA and DOTAP starting materials in appropriate ratios. Methods for making liposomes using these materials are well known in the art.
For example, commercially dioleoylphosphatidyl choline (DOPC), dioleoylphosphatidyl glycerol (DOPG), and dioleoylphosphatidyl ethanolamine (DOPE) can be used in various combinations to make conventional liposomes, with or without the addition of cholesterol. Thus, for example, DOPG/DOPC vesicles can be prepared by drying 50 mg each of DOPG and DOPC under a stream of nitrogen gas into a sonication vial. The sample is placed under a vacuum pump overnight and is hydrated the following day with deionized water. The sample is then sonicated for 2 hours in a capped vial, using a Heat Systems model 350 sonicator equipped with an inverted cup (bath type) probe at the maximum setting while the bath is circulated at 15EC. Alternatively, negatively charged vesicles can be prepared without sonication to produce multilamellar vesicles or by extrusion through nucleopore membranes to produce unilamellar vesicles of discrete size. Other methods are known and available to those of skill in the art.
The liposomes can comprise multilamellar vesicles (MLVs), small unilamellar vesicles (SUVs), or large unilamellar vesicles (LUVs), with SUVs being preferred. The various liposome-nucleic acid complexes are prepared using methods well known in the art. See, e.g., Straubinger et al., Methods of Immunology (1983), 101 :512-527, which is herein incoφorated by reference. For example, MLVs containing nucleic acid can be prepared by depositing a thin film of phospholipid on the walls of a glass tube and subsequently hydrating with a solution of the material to be encapsulated. SUVs are prepared by extended sonication of MLVs to produce a homogeneous population of unilamellar liposomes. The material to be entrapped is added to a suspension of preformed MLVs and then sonicated. When using liposomes containing cationic lipids, the dried lipid film is resuspended in an appropriate solution such as sterile water or an isotonic buffer solution such as 10 mM Tris/NaCl, sonicated, and then the preformed liposomes are mixed directly with the DNA. The liposome and DNA form a very stable complex due to binding of the positively charged liposomes to the cationic DNA. SUVs find use with small nucleic acid fragments. LUVs are prepared by a number of methods, well known in the art. Commonly used methods include Ca2+-EDTA chelation (Papahadjopoulos et al., Biochim. Biophys. Acta (1975) 394:483; Wilson et al., Cell (1979) 17:77); ether injection (Deamer, D. and Bangham, A., Biochim. Biophys. Acta (1976) 443:629; Ostro et al., Biochem. Biophys. Res. Commun. (1977) 76:836; Fraley et al., Proc. Natl. Acad. Sci. USA (1979) 76:3348); detergent dialysis (Enoch, H. and Strittmatter, P., Proc. Natl. Acad. Sci. USA (1979) 76: 145); and reverse-phase evaporation (REV) (Fraley et al., J. Biol. Chem. (1980) 255:10431; Szoka, F. and Papahadjopoulos, D., Proc. Natl. Acad. Sci. USA (1978) 75: 145; Schaefer-Ridder et al., Science (1982) 215:166), which are herein incoφorated by reference.
Generally, the ratio of DNA to liposomes will be from about 10:1 to about 1: 10. Preferably, the ratio will be from about 5:1 to about 1 :5. More preferably, the ratio will be about 3: 1 to about 1 :3. Still more preferably, the ratio will be about 1:1.
U.S. Patent No. 5,676,954 (which is herein incoφorated by reference) reports on the injection of genetic material, complexed with cationic liposomes carriers, into mice. U.S . Patent Nos. 4,897,355, 4,946,787, 5,049,386, 5,459,127, 5,589,466, 5,693,622, 5,580,859, 5,703,055, and international publication no. WO 94/9469 (which are herein incoφorated by reference) provide cationic lipids for use in transfecting DNA into cells and mammals. U.S. Patent Nos. 5,589,466, 5,693,622, 5,580,859, 5,703,055, and international publication no. WO 94/9469 (which are herein incoφorated by reference) provide methods for delivering DNA-cationic lipid complexes to mammals.
In certain embodiments, cells are engineered, ex vivo or in vivo, using a retroviral particle containing RNA which comprises a sequence encoding Ckβ-4 or Ckβ-10.
Retrovimses from which the retroviral plasmid vectors may be derived include, but are not limited to, Moloney Murine Leukemia Vims, spleen necrosis virus, Rous sarcoma Virus, Harvey Sarcoma Vims, avian leukosis virus, gibbon ape leukemia vims, human immunodeficiency vims, Myeloproliferative Sarcoma Vims, and mammary tumor vims. The retroviral plasmid vector is employed to transduce packaging cell lines to form producer cell lines. Examples of packaging cells which may be transfected include, but are not limited to, the PE501, PA317, R-2, R-AM, PA12, T19-14X, VT-19-17-H2, RCRE, RCRIP, GP+E-86, GP+envAml2, and DAN cell lines as described in Miller, Human Gene Therapy 1:5-14 (1990), which is incoφorated herein by reference in its entirety. The vector may transduce the packaging cells through any means known in the art. Such means include, but are not limited to, electroporation, the use of liposomes, and CaPO4 precipitation. In one alternative, the retroviral plasmid vector may be encapsulated into a liposome, or coupled to a lipid, and then administered to a host.
The producer cell line generates infectious retroviral vector particles which include polynucleotide encoding Ckβ-4 or Ckβ-10. Such retroviral vector particles then may be employed, to transduce eukaryotic cells, either in vitro or in vivo. The transduced eukaryotic cells will express Ckβ-4 or Ckβ- 10.
In certain other embodiments, cells are engineered, ex vivo or in vivo, with Ckβ-4 or
Ckβ-10 polynucleotide contained in an adenovims vector. Adenovims can be manipulated such that it encodes and expresses Ckβ-4 or Ckβ-10, and at the same time is inactivated in terms of its ability to replicate in a normal lytic viral life cycle. Adenovims expression is achieved without integration of the viral DNA into the host cell chromosome, thereby alleviating concerns about insertional mutagenesis. Furthermore, adenovimses have been used as live enteric vaccines for many years with an excellent safety profile (Schwartz, A. R. et al. (1974) Am. Rev. Respir. Dis.109:233-238). Finally, adenovims mediated gene transfer has been demonstrated in a number of instances including transfer of alpha- 1-antitrypsin and CFTR to the lungs of cotton rats (Rosenfeld, M. A. et al. (1991) Science 252:431-434; Rosenfeld et al., (1992) Cell 68: 143-155). Furthermore, extensive studies to attempt to establish adenovims as a causative agent in human cancer were uniformly negative (Green, M. et al. (1979) Proc. Natl. Acad. Sci. USA 76:6606).
Suitable adenoviral vectors useful in the present invention are described, for example, in Kozarsky and Wilson, Curr. Opin. Genet. Devel. 3:499-503 (1993); Rosenfeld et al., Cell 68:143-155 (1992); Engelhardt et al., Human Genet. Ther. 4:759-769 (1993); Yang et al., Nature Genet. 7:362-369 (1994); Wilson et al., Nature 365:691-692 (1993); and U.S. Patent No. 5,652,224, which are herein incoφorated by reference. For example, the adenovims vector Ad2 is useful and can be grown in human 293 cells. These cells contain the El region of adenovims and constitutively express Ela and Elb, which complement the defective adenovimses by providing the products of the genes deleted from the vector. In addition to Ad2, other varieties of adenovims (e.g., Ad3, Ad5, and Ad7) are also useful in the present invention.
Preferably, the adenovimses used in the present invention are replication deficient. Replication deficient adenovimses require the aid of a helper virus and/or packaging cell line to form infectious particles. The resulting vims is capable of infecting cells and can express a polynucleotide of interest which is operably linked to a promoter, but cannot replicate in most cells. Replication deficient adenovimses may be deleted in one or more of all or a portion of the following genes: Ela, Elb, E3, E4, E2a, or LI through L5.
In certain other embodiments, the cells are engineered, ex vivo or in vivo, using an adeno-associated vims (AAV). AAVs are naturally occurring defective vimses that require helper viruses to produce infectious particles (Muzyczka, N., Curr. Topics in Microbiol. Immunol. 158:97 (1992)). It is also one of the few vimses that may integrate its DNA into non-dividing cells. Vectors containing as little as 300 base pairs of AAV can be packaged and can integrate, but space for exogenous DNA is limited to about 4.5 kb. Methods for producing and using such AAVs are known in the art. See, for example, U.S. Patent Nos. 5,139,941, 5,173,414, 5,354,678, 5,436,146, 5,474,935, 5,478,745, and 5,589,377.
For example, an appropriate AAV vector for use in the present invention will include all the sequences necessary for DNA replication, encapsidation, and host-cell integration.
The Ckβ-4 or Ckβ-10 polynucleotide constmct is inserted into the AAV vector using standard cloning methods, such as those found in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Press (1989). The recombinant AAV vector is then transfected into packaging cells which are infected with a helper virus, using any standard technique, including lipofection, electroporation, calcium phosphate precipitation, etc. Appropriate helper vimses include adenovimses, cytomegaloviruses, vaccinia viruses, or heφes viruses. Once the packaging cells are transfected and infected, they will produce infectious AAV viral particles which contain the Ckβ-4 or Ckβ-10 polynucleotide construct.
These viral particles are then used to transduce eukaryotic cells, either ex vivo or in vivo.
The transduced cells will contain the Ckβ-4 or Ckβ-10 polynucleotide constmct integrated into its genome, and will express Ckβ-4 or Ckβ-10. Another method of gene therapy involves operably associating heterologous control regions and endogenous polynucleotide sequences (e.g. encoding Ckβ-4 or Ckβ-10) via homologous recombination (see, e.g., U.S. Patent No. 5,641,670, issued June 24, 1997;
International Publication No. WO 96/29411, published September 26, 1996; International
Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc. Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989). This method involves the activation of a gene which is present in the target cells, but which is not normally expressed in the cells, or is expressed at a lower level than desired.
Polynucleotide constructs are made, using standard techniques known in the art, which contain the promoter with targeting sequences flanking the promoter. Suitable promoters are described herein. The targeting sequence is sufficiently complementary to an endogenous sequence to permit homologous recombination of the promoter-targeting sequence with the endogenous sequence. The targeting sequence will be sufficiently near the
5' end of the Ckβ-4 or Ckβ-10 desired endogenous polynucleotide sequence so the promoter will be operably linked to the endogenous sequence upon homologous recombination.
The promoter and the targeting sequences can be amplified using PCR. Preferably, the amplified promoter contains distinct restriction enzyme sites on the 5' and 3' ends. Preferably, the 3' end of the first targeting sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5' end of the second targeting sequence contains the same restriction site as the 3' end of the amplified promoter. The amplified promoter and targeting sequences are digested and ligated together. The promoter-targeting sequence constmct is delivered to the cells, either as naked polynucleotide, or in conjunction with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, whole viruses, lipofection, precipitating agents, etc., described in more detail above. The P promoter-targeting sequence can be delivered by any method, included direct needle injection, intravenous injection, topical administration, catheter infusion, particle accelerators, etc. The methods are described in more detail below. The promoter-targeting sequence constmct is taken up by cells. Homologous recombination between the constmct and the endogenous sequence takes place, such that an endogenous Ckβ-4 or Ckβ-10 sequence is placed under the control of the promoter. The promoter then drives the expression of the endogenous Ckβ-4 or Ckβ-10 sequence. The polynucleotides encoding Ckβ-4 or Ckβ-10 may be administered along with other polynucleotides encoding an angiogenic protein. Examples of angiogenic proteins include, but are not limited to, acidic and basic fibroblast growth factors, VEGF-1, VEGF-2, VEGF-3, epidermal growth factor alpha and beta, platelet-derived endothelial cell growth factor, platelet-derived growth factor, tumor necrosis factor alpha, hepatocyte growth factor, insulin like growth factor, colony stimulating factor, macrophage colony stimulating factor, granulocyte/macrophage colony stimulating factor, and nitric oxide synthase.
Preferably, the polynucleotide encoding Ckβ-4 or Ckβ-10 contains a secretory signal sequence that facilitates secretion of the protein. Typically, the signal sequence is positioned in the coding region of the polynucleotide to be expressed towards or at the 5' end of the coding region. The signal sequence may be homologous or heterologous to the polynucleotide of interest and may be homologous or heterologous to the cells to be transfected. Additionally, the signal sequence may be chemically synthesized using methods known in the art.
Any mode of administration of any of the above-described polynucleotides constmcts can be used so long as the mode results in the expression of one or more molecules in an amount sufficient to provide a therapeutic effect. This includes direct needle injection, systemic injection, catheter infusion, biolistic injectors, particle accelerators (i.e., "gene guns"), gelfoam sponge depots, other commercially available depot materials, osmotic pumps (e.g., Alza minipumps), oral or suppositorial solid (tablet or pill) pharmaceutical formulations, and decanting or topical applications during surgery. For example, direct injection of naked calcium phosphate -precipitated plasmid into rat liver and rat spleen or a protein-coated plasmid into the portal vein has resulted in gene expression of the foreign gene in the rat livers (Kaneda et al., Science 243:375 (1989)).
A preferred method of local administration is by direct injection. Preferably, a recombinant molecule of the present invention complexed with a delivery vehicle is administered by direct injection into or locally within the area of arteries. Administration of a composition locally within the area of arteries refers to injecting the composition centimeters and preferably, millimeters within arteries.
Another method of local administration is to contact a polynucleotide constmct of the present invention in or around a surgical wound. For example, a patient can undergo surgery and the polynucleotide constmct can be coated on the surface of tissue inside the wound or the constmct can be injected into areas of tissue inside the wound.
Therapeutic compositions useful in systemic administration, include recombinant molecules of the present invention complexed to a targeted delivery vehicle of the present invention. Suitable delivery vehicles for use with systemic administration comprise liposomes comprising ligands for targeting the vehicle to a particular site.
Preferred methods of systemic administration, include intravenous injection, aerosol, oral and percutaneous (topical) delivery. Intravenous injections can be performed using methods standard in the art. Aerosol delivery can also be performed using methods standard in the art (see, for example, Stribling et al., Proc. Natl. Acad. Sci. USA 189: 11277-11281, 1992, which is incoφorated herein by reference). Oral delivery can be performed by complexing a polynucleotide constmct of the present invention to a carrier capable of withstanding degradation by digestive enzymes in the gut of an animal. Examples of such carriers, include plastic capsules or tablets, such as those known in the art. Topical delivery can be performed by mixing a polynucleotide constmct of the present invention with a lipophilic reagent (e.g., DMSO) that is capable of passing into the skin.
Determining an effective amount of substance to be delivered can depend upon a number of factors including, for example, the chemical stmcture and biological activity of the substance, the age and weight of the animal, the precise condition requiring treatment and its severity, and the route of administration. The frequency of treatments depends upon a number of factors, such as the amount of polynucleotide constmcts administered per dose, as well as the health and history of the subject. The precise amount, number of doses, and timing of doses will be determined by the attending physician or veterinarian.
Therapeutic compositions of the present invention can be administered to any animal, preferably to mammals and birds. Preferred mammals include humans, dogs, cats, mice, rats, rabbits sheep, cattle, horses and pigs, with humans being particularly preferred.
Biological Activities of Ckβ-4 and Ckβ- 10 Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of
Ckβ-4 or Ckβ-10, can be used in assays to test for one or more biological activities. If Ckβ- 4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ- 10, do exhibit activity in a particular assay, it is likely that Ckβ-4 or Ckβ-10 may be involved in the diseases associated with the biological activity. Therefore, Ckβ-4 or Ckβ-10 could be used to treat, prevent, and/or diagnose the associated disease.
The chemokine polypeptides of the present invention are also useful for identifying other molecules which have similar biological activity. An example of a screen for this is isolating the coding region of the genes by using the known DNA sequence to synthesize oligonucleotide probes. Labeled oligonucleotides having a sequence complementary to that of the genes of the present invention are used to screen a library of human cDNA, genomic DNA or mRNA to determine which members of the library the probe hybridizes to.
The present invention also relates to a diagnostic assays for detecting altered levels of the polypeptides or the mRNA which provides the message for such polypeptides, both quantitatively and qualitatively. Such assays are well-known in the art and include an ELISA assay, the radioimmunoassay and RT-PCR. The levels of the polypeptides, or their mRNAs, which are detected in the assays may be employed for the elucidation of the significance of the polypeptides in various diseases and for the diagnosis of diseases in which altered levels of the polypeptides may be significant.
This invention provides a method for identification of the receptors for the polypeptides. The gene encoding the receptors can be identified by expression cloning. Polyadenylated RNA is prepared from a cell responsive to the polypeptides, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells, which may be cultured on slides are exposed to the labeled polypeptides. The polypeptides can be labeled by a variety of means including iodidation or inclusion of a recognition site for a site-specific protein kinase. Following fixation and incubation, the slides are subjected to autoradiographic analysis. Positive pools are identified and sub-pools are prepared and retransfected using an iterative sub-pooling and rescreening process, eventually yielding a single clones that encodes the putative receptor. As an alternative approach for receptor identification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to x-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of generate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
Immune Activity
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may be useful in treating diseases, disorders, and/or conditions of the immune system, by activating or inhibiting the proliferation, differentiation, or mobilization (chemotaxis) of immune cells. Immune cells develop through a process called hematopoiesis, producing myeloid (platelets, red blood cells, neutrophils, and macrophages) and lymphoid (B and T lymphocytes) cells from pluripotent stem cells. The etiology of these immune diseases, disorders, and/or conditions may be genetic, somatic, such as cancer or some autoimmune diseases, disorders, and/or conditions, acquired (e.g., by chemotherapy or toxins), or infectious. Moreover, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, can be used as a marker or detector of a particular immune system disease or disorder. The chemokine polypeptides may be used to inhibit bone marrow stem cell colony formation as adjunct protective treatment during cancer chemotherapy and for leukemia.
They may also be used to regulate hematopoiesis, by regulating the activation and differentiation of various hematopoietic progenitor cells .
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may be useful in treating, preventing, and/or diagnosing diseases, disorders, and/or conditions of hematopoietic cells. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to increase differentiation and proliferation of hematopoietic cells, including the pluripotent stem cells, in an effort to treat or prevent those diseases, disorders, and/or conditions associated with a decrease in certain (or many) types hematopoietic cells. Examples of immunologic deficiency syndromes include, but are not limited to: blood protein diseases, disorders, and or conditions (e.g. agammaglobulinemia, dysgammaglobulinemia), ataxia telangiectasia, common variable immunodeficiency, Digeorge Syndrome, HLV infection, HTLV-BLV infection, leukocyte adhesion deficiency syndrome, lymphopenia, phagocyte bactericidal dysfunction, severe combined immunodeficiency (SCIDs), Wiskott-Aldrich Disorder, anemia, thrombocytopenia, or hemoglobinuria.
Moreover, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, can also be used to modulate hemostatic (the stopping of bleeding) or thrombolytic activity (clot formation). For example, by increasing hemostatic or thrombolytic activity, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to treat or prevent blood coagulation diseases, disorders, and/or conditions (e.g., afibrinogenemia, factor deficiencies), blood platelet diseases, disorders, and/or conditions (e.g. thrombocytopenia), or wounds resulting from trauma, surgery, or other causes. Alternatively, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, that can decrease hemostatic or thrombolytic activity could be used to inhibit or dissolve clotting. These molecules could be important in the treatment or prevention of heart attacks (infarction), strokes, or scarring. The chemokine polypeptides may also be used to treat auto-immune disease and lymphocytic leukemias by inhibiting T cell proliferation by the inhibition of LL-2 biosynthesis.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of
Ckβ-4 or Ckβ-10, may also be useful in treating, preventing, and/or diagnosing autoimmune diseases, disorders, and/or conditions. Many autoimmune diseases, disorders, and/or conditions result from inappropriate recognition of self as foreign material by immune cells. This inappropriate recognition results in an immune response leading to the destmction of the host tissue. Therefore, the administration of Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, that can inhibit an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing autoimmune diseases, disorders, and/or conditions.
Examples of autoimmune diseases, disorders, and/or conditions that can be treated, prevented, and/or diagnosed or detected by Ckβ-4 or Ckβ-10 include, but are not limited to:
Addison's Disease, hemolytic anemia, antiphospholipid syndrome, rheumatoid arthritis, dermatitis, allergic encephalomyelitis, glomerulonephritis, Goodpasture's Syndrome, Graves' Disease, Multiple Sclerosis, Myasthenia Gravis, Neuritis, Ophthalmia, Bullous Pemphigoid, Pemphigus, Polyendocrinopathies, Puφura, Reiter's Disease, Stiff-Man Syndrome, Autoimmune Thyroiditis, Systemic Lupus Erythematosus, Autoimmune Pulmonary Inflammation, Guillain-Barre Syndrome, insulin dependent diabetes mellitis, and autoimmune inflammatory eye disease.
Similarly, allergic reactions and conditions, such as asthma (particularly allergic asthma) or other respiratory problems, may also be treated, prevented, and/or diagnosed by
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10. Moreover, these molecules can be used to treat anaphylaxis, hypersensitivity to an antigenic molecule, or blood group incompatibility.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of
Ckβ-4 or Ckβ-10, may also be used to treat, prevent, and/or diagnose organ rejection or graft- versus-host disease (GVHD). Organ rejection occurs by host immune cell destmction of the transplanted tissue through an immune response. Similarly, an immune response is also involved in GVHD, but, in this case, the foreign transplanted immune cells destroy the host tissues. The administration of Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, that inhibits an immune response, particularly the proliferation, differentiation, or chemotaxis of T-cells, may be an effective therapy in preventing organ rejection or GVHD.
Similarly, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may also be used to modulate inflammation. For example,
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or
Ckβ-10, may inhibit the proliferation and differentiation of cells involved in an inflammatory response. These molecules can be used to treat, prevent, and/or diagnose inflammatory conditions, both chronic and acute conditions, including chronic prostatitis, granulomatous prostatitis and malacoplakia, inflammation associated with infection (e.g., septic shock, sepsis, or systemic inflammatory response syndrome (SIRS)), ischemia-reperfusion injury, endotoxin lethality, arthritis, complement-mediated hyperacute rejection, nephritis, cytokine or chemokine induced lung injury, inflammatory bowel disease, Crohn's disease, or resulting from over production of cytokines (e.g., TNF or IL-1.)
Hyperproliferative Disorders
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, can be used to treat, prevent, and/or diagnose hypeφroliferative diseases, disorders, and/or conditions, including neoplasms. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may inhibit the proliferation of the disorder through direct or indirect interactions. Alternatively, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may proliferate other cells which can inhibit the hypeφroliferative disorder.
For example, by increasing an immune response, particularly increasing antigenic qualities of the hypeφroliferative disorder or by proliferating, differentiating, or mobilizing T-cells, hypeφroliferative diseases, disorders, and/or conditions can be treated, prevented, and/or diagnosed. This immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, decreasing an immune response may also be a method of treating, preventing, and/or diagnosing hypeφroliferative diseases, disorders, and/or conditions, such as a chemotherapeutic agent.
Examples of hypeφroliferative diseases, disorders, and/or conditions that can be treated, prevented, and/or diagnosed by Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, include, but are not limited to neoplasms located in the olon, abdomen, bone, breast, digestive system, liver, pancreas, peritoneum, endocrine glands (adrenal, parathyroid, pituitary, testicles, ovary, thymus, thyroid), eye, head and neck, nervous (central and peripheral), lymphatic system, pelvic, skin, soft tissue, spleen, thoracic, and urogenital.
The chemokine polypeptides may also be used to inhibit epidermal keratinocyte proliferation for treatment of psoriasis, which is characterized by keratinocyte hyper- proliferation.
Similarly, other hypeφroliferative diseases, disorders, and/or conditions can also be treated, prevented, and/or diagnosed by Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10. Examples of such hypeφroliferative diseases, disorders, and/or conditions include, but are not limited to: hypergammaglobulinemia, lymphoproliferative diseases, disorders, and/or conditions, paraproteinemias, puφura, sarcoidosis, Sezary Syndrome, Waldenstron's Macroglobulinemia, Gaucher's Disease, histiocytosis, and any other hypeφroliferative disease, besides neoplasia, located in an organ system listed above. One preferred embodiment utilizes polynucleotides of the present invention to inhibit aberrant cellular division, by gene therapy using the present invention, and/or protein fusions or fragments thereof.
Thus, the present invention provides a method for treating cell proliferative diseases, disorders, and/or conditions by inserting into an abnormally proliferating cell a polynucleotide of the present invention, wherein said polynucleotide represses said expression.
Another embodiment of the present invention provides a method of treating cell- proliferative diseases, disorders, and/or conditions in individuals comprising administration of one or more active gene copies of the present invention to an abnormally proliferating cell or cells. In a preferred embodiment, polynucleotides of the present invention is a DNA constmct comprising a recombinant expression vector effective in expressing a DNA sequence encoding said polynucleotides. In another preferred embodiment of the present invention, the DNA constmct encoding the poynucleotides of the present invention is inserted into cells to be treated utilizing a retrovims, or more preferrably an adenoviral vector (See G J. Nabel, et. al., PNAS 1999 96: 324-326, which is hereby incoφorated by reference). In a most preferred embodiment, the viral vector is defective and will not transform non-proliferating cells, only proliferating cells. Moreover, in a preferred embodiment, the polynucleotides of the present invention inserted into proliferating cells either alone, or in combination with or fused to other polynucleotides, can then be modulated via an external stimulus (i.e. magnetic, specific small molecule, chemical, or dmg administration, etc.), which acts upon the promoter upstream of said polynucleotides to induce expression of the encoded protein product. As such the beneficial therapeutic affect of the present invention may be expressly modulated (i.e. to increase, decrease, or inhibit expression of the present invention) based upon said external stimulus. Polynucleotides of the present invention may be useful in repressing expression of oncogenic genes or antigens. By "repressing expression of the oncogenic genes " is intended the suppression of the transcription of the gene, the degradation of the gene transcript (pre-message RNA), the inhibition of splicing, the destmction of the messenger RNA, the prevention of the post-translational modifications of the protein, the destmction of the protein, or the inhibition of the normal function of the protein.
For local administration to abnormally proliferating cells, polynucleotides of the present invention may be administered by any method known to those of skill in the art including, but not limited to transfection, electroporation, microinjection of cells, or in vehicles such as liposomes, lipofectin, or as naked polynucleotides, or any other method described throughout the specification. The polynucleotide of the present invention may be delivered by known gene delivery systems such as, but not limited to, retroviral vectors (Gilboa, J. Virology 44:845 (1982); Hocke, Nature 320:275 (1986); Wilson, et al., Proc. Natl. Acad. Sci. U.S.A. 85:3014), vaccinia vims system (Chakrabarty et al., Mol. Cell Biol. 5:3403 (1985) or other efficient DNA delivery systems (Yates et al., Nature 313:812 (1985)) known to those skilled in the art. These references are exemplary only and are hereby incoφorated by reference. In order to specifically deliver or transfect cells which are abnormally proliferating and spare non-dividing cells, it is preferable to utilize a retrovims, or adenoviral (as described in the art and elsewhere herein) delivery system known to those of skill in the art. Since host DNA replication is required for retroviral DNA to integrate and the retrovims will be unable to self replicate due to the lack of the retrovims genes needed for its life cycle. Utilizing such a retroviral delivery system for polynucleotides of the present invention will target said gene and constmcts to abnormally proliferating cells and will spare the non-dividing normal cells.
The polynucleotides of the present invention may be delivered directly to cell proliferative disorder/disease sites in internal organs, body cavities and the like by use of imaging devices used to guide an injecting needle directly to the disease site. The polynucleotides of the present invention may also be administered to disease sites at the time of surgical intervention.
By "cell proliferative disease" is meant any human or animal disease or disorder, affecting any one or any combination of organs, cavities, or body parts, which is characterized by single or multiple local abnormal proliferations of cells, groups of cells, or tissues, whether benign or malignant. Any amount of the polynucleotides of the present invention may be administered as long as it has a biologically inhibiting effect on the proliferation of the treated cells. Moreover, it is possible to administer more than one of the polynucleotide of the present invention simultaneously to the same site. By "biologically inhibiting" is meant partial or total growth inhibition as well as decreases in the rate of proliferation or growth of the cells. The biologically inhibitory dose may be determined by assessing the effects of the polynucleotides of the present invention on target malignant or abnormally proliferating cell growth in tissue culture, tumor growth in animals and cell cultures, or any other method known to one of ordinary skill in the art.
The present invention is further directed to antibody-based therapies which involve administering of anti-polypeptides and anti-polynucleotide antibodies to a mammalian, preferably human, patient for treating one or more of the described diseases, disorders, and/or conditions. Methods for producing anti-polypeptides and anti-polynucleotide antibodies polyclonal and monoclonal antibodies are described in detail elsewhere herein. Such antibodies may be provided in pharmaceutically acceptable compositions as known in the art or as described herein.
A summary of the ways in which the antibodies of the present invention may be used therapeutically includes binding polynucleotides or polypeptides of the present invention locally or systemically in the body or by direct cytotoxicity of the antibody, e.g. as mediated by complement (CDC) or by effector cells (ADCC). Some of these approaches are described in more detail below. Armed with the teachings provided herein, one of ordinary skill in the art will know how to use the antibodies of the present invention for diagnostic, monitoring or therapeutic puφoses without undue experimentation.
In particular, the antibodies, fragments and derivatives of the present invention are useful for treating a subject having or developing cell proliferative and/or differentiation diseases, disorders, and/or conditions as described herein. Such treatment comprises administering a single or multiple doses of the antibody, or a fragment, derivative, or a conjugate thereof. The antibodies of this invention may be advantageously utilized in combination with other monoclonal or chimeric antibodies, or with lymphokines or hematopoietic growth factors, for example, which serve to increase the number or activity of effector cells which interact with the antibodies.
It is preferred to use high affinity and/or potent in vivo inhibiting and/or neutralizing antibodies against polypeptides or polynucleotides of the present invention, fragments or regions thereof, for both immunoassays directed to and therapy of diseases, disorders, and/or conditions related to polynucleotides or polypeptides, including fragements thereof, of the present invention. Such antibodies, fragments, or regions, will preferably have an affinity for polynucleotides or polypeptides, including fragements thereof. Preferred binding affinities include those with a dissociation constant or Kd less than 5X10"6M, 10"6M, 5X10" 7M, 10"7M, 5X10"8M, 10"8M, 5X10"9M, 10"9M, 5X10"'°M, lθ '°M, 5X10"M, lO^'M, 5X10"'2M, 10"12M, 5X10"'3M, 10"' M, 5X10"' M, 10 14M, 5X10"'5M, and 10"'5M.
The chemokine polypeptides may also be used to treat solid tumors by stimulating the invasion and activation of host defense cells, e.g., CD8+, cytotoxic T cells and macrophages. Particularly, Ckβ-4 on peripheral blood lymphocytes and MCP-4 (also referred to as Ckβ- 10) on CD8+ T-cells, eosinophils and monocyctes.
Moreover, polypeptides of the present invention are useful in inhibiting the angiogenesis of proliferative cells or tissues, either alone, as a protein fusion, or in combination with other polypeptides directly or indirectly, as described elsewhere herein. In a most preferred embodiment, said anti-angiogenesis effect may be achieved indirectly, for example, through the inhibition of hematopoietic, tumor-specific cells, such as tumor- associated macrophages (See Joseph IB, et al. J Natl Cancer Inst, 90(21)3648-53 (1998), which is hereby incoφorated by reference). Antibodies directed to polypeptides or polynucleotides of the present invention may also result in inhibition of angiogenesis directly, or indirectly (See Witte L, et al., Cancer Metastasis Rev. 17(2)355-61 (1998), which is hereby incoφorated by reference)).
Polypeptides, including protein fusions, of the present invention, or fragments thereof may be useful in inhibiting proliferative cells or tissues through the induction of apoptosis. Said polypeptides may act either directly, or indirectly to induce apoptosis of proliferative cells and tissues, for example in the activation of a death-domain receptor, such as tumor necrosis factor (TNF) receptor- 1, CD95 (Fas/APO-1), TNF-receptor-related apoptosis-mediated protein (TRAMP) and TNF-related apoptosis-inducing ligand (TRAIL) receptor-1 and -2 (See Schulze-Osthoff K, et.al., Eur J Biochem 254(3):439-59 (1998), which is hereby incoφorated by reference). Moreover, in another preferred embodiment of the present invention, said polypeptides may induce apoptosis through other mechanisms, such as in the activation of other proteins which will activate apoptosis, or through stimulating the expression of said proteins, either alone or in combination with small molecule dmgs or adjuviants, such as apoptonin, galectins, thioredoxins, antiinflammatory proteins (See for example, Mutat Res 400(1 -2):447-55 (1998), Med Hypotheses.50(5):423- 33 (1998), Chem Biol Interact. Apr 24;111-112:23-34 (1998), J Mol Med.76(6):402-12 (1998), Int J Tissue React;20(l):3-15 (1998), which are all hereby incoφorated by reference).
Polypeptides, including protein fusions to, or fragments thereof, of the present invention are useful in inhibiting the metastasis of proliferative cells or tissues. Inhibition may occur as a direct result of administering polypeptides, or antibodies directed to said polypeptides as described elsewere herein, or indirectly, such as activating the expression of proteins known to inhibit metastasis, for example alpha 4 integrins, (See, e.g., Curr Top Microbiol Immunol 231:125-41 (1998), which is hereby incoφorated by reference). Such thereapeutic affects of the present invention may be achieved either alone, or in combination with small molecule dmgs or adjuvants.
In another embodiment, the invention provides a method of delivering compositions containing the polypeptides of the invention (e.g., compositions containing polypeptides or polypeptide antibodes associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodmgs) to targeted cells expressing the polypeptide of the present invention. Polypeptides or polypeptide antibodes of the invention may be associated with with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions.
Polypeptides, protein fusions to, or fragments thereof, of the present invention are useful in enhancing the immunogenicity and/or antigenicity of proliferating cells or tissues, either directly, such as would occur if the polypeptides of the present invention 'vaccinated' the immune response to respond to proliferative antigens and immunogens, or indirectly, such as in activating the expression of proteins known to enhance the immune response (e.g. chemokines), to said antigens and immunogens.
Infectious Disease
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, can be used to treat, prevent, and/or diagnose infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and or T cells, infectious diseases may be treated, prevented, and/or diagnosed. The immune response may be increased by either enhancing an existing immune response, or by initiating a new immune response. Alternatively, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may also directly inhibit the infectious agent, without necessarily eliciting an immune response. Vimses are one example of an infectious agent that can cause disease or symptoms that can be treated, prevented, and/or diagnosed by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention. Examples of vimses, include, but are not limited to Examples of vimses, include, but are not limited to the following DNA and RNA vimses and viral families: Arbovirus, Adenoviridae, Arenaviridae, Arterivirus, Bimaviridae, Bunyaviridae, Caliciviridae, Circoviridae, Coronaviridae, Dengue, EBV, HIV, Flaviviridae, Hepadnaviridae (Hepatitis), Heφesviridae (such as, Cytomegalovirus, Heφes Simplex, Heφes Zoster), Mononegavims (e.g., Paramyxoviridae, Morbilli virus, Rhabdoviridae), Orthomyxoviridae (e.g., Influenza A, Influenza B, and parainfluenza), Papiloma virus, Papovaviridae, Parvoviridae, Picornaviridae, Poxviridae (such as Smallpox or Vaccinia), Reoviridae (e.g., Rotavims), Retroviridae (HTLV-I, HTLV-II, Lentivims), and Togaviridae (e.g., Rubivims). Vimses falling within these families can cause a variety of diseases or symptoms, including, but not limited to: arthritis, bronchiollitis, respiratory syncytial virus, encephalitis, eye infections (e.g., conjunctivitis, keratitis), chronic fatigue syndrome, hepatitis (A, B, C, E, Chronic Active, Delta), Japanese B encephalitis, Junin, Chikungunya, Rift Valley fever, yellow fever, meningitis, opportunistic infections (e.g., AIDS), pneumonia, Burkitt's Lymphoma, chickenpox, hemorrhagic fever, Measles, Mumps, Parainfluenza, Rabies, the common cold, Polio, leukemia, Rubella, sexually transmitted diseases, skin diseases (e.g., Kaposi's, warts), and viremia. polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat, prevent, and/or diagnose any of these symptoms or diseases. In specific embodiments, polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat: meningitis, Dengue, EBV, and/or hepatitis (e.g., hepatitis B). In an additional specific embodiment polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat patients nonresponsive to one or more other commercially available hepatitis vaccines. In a further specific embodiment polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose AIDS.
Chemokines may also be used to enhance host defenses against resistant chronic infections, for example, mycobacteria, listeria or leishmania infections, or opportunistic infections such as, for example, cryptococcus infections, via the attraction of microbicidal leukocytes, such as peripheral blood leukocytes ("PBLs") by CKβ-4 and CD4+ T-cells, monocytes and eosinophils by MCP-4. Similarly, bacterial or fungal agents that can cause disease or symptoms and that can be treated, prevented, and or diagnosed by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, include, but not limited to, the following Gram-Negative and Gram-positive bacteria and bacterial families and fungi: Actinomycetales (e.g., Corynebacterium, Mycobacterium, Norcardia), Cryptococcus neoformans, Aspergillosis, Bacillaceae (e.g., Anthrax, Clostridium), Bacteroidaceae, Blastomycosis, Bordetella, Borrelia (e.g., Borrelia burgdorferi), Brucellosis, Candidiasis, Campylobacter, Coccidioidomycosis, Cryptococcosis, Dermatocycoses, E. coli (e.g., Enterotoxigenic E. coli and Enterohemorrhagic E. coli), Enterobacteriaceae (Klebsiella, Salmonella (e.g., Salmonella typhi, and Salmonella paratyphi), Serratia, Yersinia), Erysipelothrix, Helicobacter, Legionellosis, Leptospirosis, Listeria, Mycoplasmatales, Mycobacterium leprae, Vibrio cholerae, Neisseriaceae (e.g., Acinetobacter, Gonorrhea, Menigococcal), Meisseria meningitidis, Pasteurellacea Infections (e.g., Actinobacillus, Heamophilus (e.g., Heamophilus influenza type B), Pasteurella), Pseudomonas, Rickettsiaceae, Chlamydiaceae, Syphilis, Shigella spp., Staphylococcal, Meningiococcal, Pneumococcal and Streptococcal (e.g., Streptococcus pneumoniae and Group B Streptococcus). These bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis (e.g., mengitis types A and B), Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin diseases (e.g., cellulitis, dermatocycoses), toxemia, urinary tract infections, wound infections. Polynucleotides or polypeptides, agonists or antagonists of the invention, can be used to treat, prevent, and/or diagnose any of these symptoms or diseases. In specific embodiments, polynucleotides, polypeptides, agonists or antagonists of the invention are used to treat: tetanus, Diptheria, botulism, and or meningitis type B.
The chemokine polypeptides also increase the presence of eosinophils which have the distinctive function of killing the larvae of parasites that invade tissues, as in schistosomiasis, trichinosis and ascariasis.
Moreover, parasitic agents causing disease or symptoms that can be treated, prevented, and/or diagnosed by a polynucleotide or polypeptide and/or agonist or antagonist of the present invention include, but not limited to, the following families or class: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas and Sporozoans (e.g., Plasmodium virax, Plasmodium falciparium, Plasmodium malaiiae and Plasmodium ovale). These parasites can cause a variety of diseases or symptoms, including, but not limited to: Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g., AIDS related), malaria, pregnancy complications, and toxoplasmosis. polynucleotides or polypeptides, or agonists or antagonists of the invention, can be used to treat, prevent, and/or diagnose any of these symptoms or diseases. In specific embodiments, polynucleotides, polypeptides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose malaria. Preferably, treatment or prevention using a polypeptide or polynucleotide and/or agonist or antagonist of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy). Moreover, the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
Wound Healing and Epithelial Cell Proliferation
Ckβ-4 and MCP-4 (also referred to as Ckβ-10) may also be used in wound healing, both via the recmitment of debris clearing and connective tissue promoting inflammatory cells and also via its control of excessive TGFβ-mediated fibrosis. In this same manner,
Ckβ-4 and MCP-4 may also be used to treat other fibrotic disorders, including liver cirrhosis, osteoarthritis and pulmonary fibrosis.
In accordance with yet a further aspect of the present invention, there is provided a process for utilizing Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, for therapeutic puφoses, for example, to stimulate epithelial cell proliferation and basal keratinocytes for the puφose of wound healing, and to stimulate hair follicle production and healing of dermal wounds. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, may be clinically useful in stimulating wound healing including surgical wounds, excisional wounds, deep wounds involving damage of the dermis and epidermis, eye tissue wounds, dental tissue wounds, oral cavity wounds, diabetic ulcers, dermal ulcers, cubitus ulcers, arterial ulcers, venous stasis ulcers, bums resulting from heat exposure or chemicals, and other abnormal wound healing conditions such as uremia, malnutrition, vitamin deficiencies and complications associted with systemic treatment with steroids, radiation therapy and antineoplastic dmgs and antimetabolites. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to promote dermal reestablishment subsequent to dermal loss Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to increase the adherence of skin grafts to a wound bed and to stimulate re-epithelialization from the wound bed. The following are types of grafts that Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, agonists or antagonists of Ckβ-4 or
Ckβ-10, could be used to increase adherence to a wound bed: autografts, artificial skin, allografts, autodermic graft, autoepdermic grafts, avacular grafts, Blair-Brown grafts, bone graft, brephoplastic grafts, cutis graft, delayed graft, dermic graft, epidermic graft, fascia graft, full thickness graft, heterologous graft, xenograft, homologous graft, hypeφlastic graft, lamellar graft, mesh graft, mucosal graft, Ollier-Thiersch graft, omenpal graft, patch graft, pedicle graft, penetrating graft, split skin graft, thick split graft. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, can be used to promote skin strength and to improve the appearance of aged skin.
It is believed that Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, will also produce changes in hepatocyte proliferation, and epithelial cell proliferation in the lung, breast, pancreas, stomach, small intesting, and large intestine. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could promote proliferation of epithelial cells such as sebocytes, hair follicles, hepatocytes, type II pneumocytes, mucin-producing goblet cells, and other epithelial cells and their progenitors contained within the skin, lung, liver, and gastrointestinal tract. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, agonists or antagonists of Ckβ-4 or Ckβ-10, may promote proliferation of endothelial cells, keratinocytes, and basal keratinocytes.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could also be used to reduce the side effects of gut toxicity that result from radiation, chemotherapy treatments or viral infections. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, may have a cytoprotective effect on the small intestine mucosa. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, may also stimulate healing of mucositis (mouth ulcers) that result from chemotherapy and viral infections. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could further be used in full regeneration of skin in full and partial thickness skin defects, including burns, (i.e., repopulation of hair follicles, sweat glands, and sebaceous glands), treatment of other skin defects such as psoriasis. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to treat, prevent, and or diagnose epidermolysis bullosa, a defect in adherence of the epidermis to the underlying dermis which results in frequent, open and painful blisters by accelerating reepithelialization of these lesions. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could also be used to treat, prevent, and/or diagnose gastric and doudenal ulcers and help heal by scar formation of the mucosal lining and regeneration of glandular mucosa and duodenal mucosal lining more rapidly. Inflamamatory bowel diseases, such as Crohn's disease and ulcerative colitis, are diseases which result in destmction of the mucosal surface of the small or large intestine, respectively. Thus, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to promote the resurfacing of the mucosal surface to aid more rapid healing and to prevent progression of inflammatory bowel disease.
Treatment with Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, agonists or antagonists of
Ckβ-4 or Ckβ-10, is expected to have a significant effect on the production of mucus throughout the gastrointestinal tract and could be used to protect the intestinal mucosa from injurious substances that are ingested or following surgery. Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to treat, prevent, and/or diagnose diseases associate with the under expression of Ckβ-4 or Ckβ-10.
Moreover, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to prevent and heal damage to the lungs due to various pathological states. A growth factor such as Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, which could stimulate proliferation and differentiation and promote the repair of alveoli and brochiolar epithelium to prevent or treat acute or chronic lung damage. For example, emphysema, which results in the progressive loss of aveoli, and inhalation injuries, i.e., resulting from smoke inhalation and bums, that cause necrosis of the bronchiolar epithelium and alveoli could be effectively treated using Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, agonists or antagonists of Ckβ-4 or Ckβ-10. Also, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to stimulate the proliferation of and differentiation of type II pneumocytes, which may help treat, prevent, and/or diagnose disease such as hyaline membrane diseases, such as infant respiratory distress syndrome and bronchopulmonary displasia, in premature infants.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of
Ckβ-4 or Ckβ-10, could stimulate the proliferation and differentiation of hepatocytes and, thus, could be used to alleviate or treat, prevent, and/or diagnose liver diseases and pathologies such as fulminant liver failure caused by cirrhosis, liver damage caused by viral hepatitis and toxic substances (i.e., acetaminophen, carbon tetraholoride and other hepatotoxins known in the art).
In addition, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used treat, prevent, and/or diagnose the onset of diabetes mellitus. In patients with newly diagnosed Types I and II diabetes, where some islet cell function remains, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used to maintain the islet function so as to alleviate, delay or prevent permanent manifestation of the disease. Also, Ckβ-4 or
Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, could be used as an auxiliary in islet cell transplantation to improve or promote islet cell function.
Cardiovascular Disorders
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, encoding Ckβ-4 or Ckβ-10 may be used to treat, prevent, and/or diagnose cardiovascular diseases, disorders, and/or conditions, including peripheral artery disease, such as limb ischemia.
Cardiovascular diseases, disorders, and/or conditions include cardiovascular abnormalities, such as arterio-arterial fistula, arteriovenous fistula, cerebral arteriovenous malformations, congenital heart defects, pulmonary atresia, and Scimitar Syndrome. Congenital heart defects include aortic coarctation, cor triatriatum, coronary vessel anomalies, crisscross heart, dextrocardia, patent ductus arteriosus, Ebstein's anomaly, Eisenmenger complex, hypoplastic left heart syndrome, levocardia, tetralogy of fallot, transposition of great vessels, double outlet right ventricle, tricuspid atresia, persistent tmncus arteriosus, and heart septal defects, such as aortopulmonary septal defect, endocardial cushion defects, Lutembacher's Syndrome, trilogy of Fallot, ventricular heart septal defects.
Cardiovascular diseases, disorders, and/or conditions also include heart disease, such as arrhythmias, carcinoid heart disease, high cardiac output, low cardiac output, cardiac tamponade, endocarditis (including bacterial), heart aneurysm, cardiac arrest, congestive heart failure, congestive cardiomyopathy, paroxysmal dyspnea, cardiac edema, heart hypertrophy, congestive cardiomyopathy, left ventricular hypertrophy, right ventricular hypertrophy, post-infarction heart mpture, ventricular septal mpture, heart valve diseases, myocardial diseases, myocardial ischemia, pericardial effusion, pericarditis (including constrictive and tuberculous), pneumopericardium, postpericardiotomy syndrome, pulmonary heart disease, rheumatic heart disease, ventricular dysfunction, hyperemia, cardiovascular pregnancy complications, Scimitar Syndrome, cardiovascular syphilis, and cardiovascular tuberculosis.
Arrhythmias include sinus arrhythmia, atrial fibrillation, atrial flutter, bradycardia, extrasystole, Adams-Stokes Syndrome, bundle-branch block, sinoatrial block, long QT syndrome, parasystole, Lown-Ganong-Levine Syndrome, Mahaim-type pre-excitation syndrome, Wolff-Parkinson-White syndrome, sick sinus syndrome, tachycardias, and ventricular fibrillation. Tachycardias include paroxysmal tachycardia, supraventricular tachycardia, accelerated idioventricular rhythm, atrioventricular nodal reentry tachycardia, ectopic atrial tachycardia, ectopic junctional tachycardia, sinoatrial nodal reentry tachycardia, sinus tachycardia, Torsades de Pointes, and ventricular tachycardia.
Heart valve disease include aortic valve insufficiency, aortic valve stenosis, hear murmurs, aortic valve prolapse, mitral valve prolapse, tricuspid valve prolapse, mitral valve insufficiency, mitral valve stenosis, pulmonary atresia, pulmonary valve insufficiency, pulmonary valve stenosis, tricuspid atresia, tricuspid valve insufficiency, and tricuspid valve stenosis.
Myocardial diseases include alcoholic cardiomyopathy, congestive cardiomyopathy, hypertrophic cardiomyopathy, aortic subvalvular stenosis, pulmonary subvalvular stenosis, restrictive cardiomyopathy, Chagas cardiomyopathy, endocardial fibroelastosis, endomyocardial fibrosis, Kearns Syndrome, myocardial reperfusion injury, and myocarditis.
Myocardial ischemias include coronary disease, such as angina pectoris, coronary aneurysm, coronary arteriosclerosis, coronary thrombosis, coronary vasospasm, myocardial infarction and myocardial stunning.
Cardiovascular diseases also include vascular diseases such as aneurysms, angiodysplasia, angiomatosis, bacillary angiomatosis, Hippel-Lindau Disease, Klippel- Trenaunay-Weber Syndrome, Sturge-Weber Syndrome, angioneurotic edema, aortic diseases, Takayasu's Arteritis, aortitis, Leriche's Syndrome, arterial occlusive diseases, arteritis, enarteritis, polyarteritis nodosa, cerebrovascular diseases, disorders, and/or conditions, diabetic angiopathies, diabetic retinopathy, embolisms, thrombosis, erythromelalgia, hemorrhoids, hepatic veno-occlusive disease, hypertension, hypotension, ischemia, peripheral vascular diseases, phlebitis, pulmonary veno-occlusive disease, Raynaud's disease, CREST syndrome, retinal vein occlusion, Scimitar syndrome, superior vena cava syndrome, telangiectasia, atacia telangiectasia, hereditary hemorrhagic telangiectasia, varicocele, varicose veins, varicose ulcer, vasculitis, and venous insufficiency.
Aneurysms include dissecting aneurysms, false aneurysms, infected aneurysms, mptured aneurysms, aortic aneurysms, cerebral aneurysms, coronary aneurysms, heart aneurysms, and iliac aneurysms.
Arterial occlusive diseases include arteriosclerosis, intermittent claudication, carotid stenosis, fibromuscular dysplasias, mesenteric vascular occlusion, Moyamoya disease, renal artery obstmction, retinal artery occlusion, and thromboangiitis obliterans.
Cerebrovascular diseases, disorders, and/or conditions include carotid artery diseases, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformation, cerebral artery diseases, cerebral embolism and thrombosis, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, cerebral hemorrhage, epidural hematoma, subdural hematoma, subaraxhnoid hemorrhage, cerebral infarction, cerebral ischemia (including transient), subclavian steal syndrome, periventricular leukomalacia, vascular headache, cluster headache, migraine, and vertebrobasilar insufficiency.
Embolisms include air embolisms, amniotic fluid embolisms, cholesterol embolisms, blue toe syndrome, fat embolisms, pulmonary embolisms, and thromoboembolisms. Thrombosis include coronary thrombosis, hepatic vein thrombosis, retinal vein occlusion, carotid artery thrombosis, sinus thrombosis, Wallenberg's syndrome, and thrombophlebitis.
Ischemia includes cerebral ischemia, ischemic colitis, compartment syndromes, anterior compartment syndrome, myocardial ischemia, reperfusion injuries, and peripheral limb ischemia. Vasculitis includes aortitis, arteritis, Behcet's Syndrome, Churg-Strauss Syndrome, mucocutaneous lymph node syndrome, thromboangiitis obliterans, hypersensitivity vasculitis, Schoenlein-Henoch puφura, allergic cutaneous vasculitis, and Wegener's granulomatosis.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, are especially effective for the treatment of critical limb ischemia and coronary disease. Ckβ-4 or Ckβ-10 polypeptides may be administered using any method known in the art, including, but not limited to, direct needle injection at the delivery site, intravenous injection, topical administration, catheter infusion, biolistic injectors, particle accelerators, gelfoam sponge depots, other commercially available depot materials, osmotic pumps, oral or suppositorial solid pharmaceutical formulations, decanting or topical applications during surgery, aerosol delivery. Such methods are known in the art. Ckβ-4 or Ckβ-10 polypeptides may be administered as part of a Therapeutic, described in more detail below. Methods of delivering Ckβ-4 or Ckβ-10 polynucleotides are described in more detail herein.
Anti-Angiogenesis Activity
Chemokines may also be employed as inhibitors of angiogenesis, therefore, they have anti-tumor effects. The naturally occurring balance between endogenous stimulators and inhibitors of angiogenesis is one in which inhibitory influences predominate. Rastinejad et al, Cell 56:345-355 (1989). In those rare instances in which neovascularization occurs under normal physiological conditions, such as wound healing, organ regeneration, embryonic development, and female reproductive processes, angiogenesis is stringently regulated and spatially and temporally delimited. Under conditions of pathological angiogenesis such as that characterizing solid tumor growth, these regulatory controls fail. Unregulated angiogenesis becomes pathologic and sustains progression of many neoplastic and non- neoplastic diseases. A number of serious diseases are dominated by abnormal neovascularization including solid tumor growth and metastases, arthritis, some types of eye diseases, disorders, and/or conditions, and psoriasis. See, e.g., reviews by Moses et al, Biotech. 9:630-634 (1991); Folkman et al, N. Engl. J. Med, 333:1757-1763 (1995); Auerbach et al, J. Microvasc. Res. 29:401-411 (1985); Folkman, Advances in Cancer Research, eds. Klein and Weinhouse, Academic Press, New York, pp. 175-203 (1985); Patz, Am. J. Opthalmol. 94:715-743 (1982); and Folkman et al, Science 227:719-725 (1983). In a number of pathological conditions, the process of angiogenesis contributes to the disease state. For example, significant data have accumulated which suggest that the growth of solid tumors is dependent on angiogenesis. Folkman and Klagsbrun, Science 235:442-447 (1987).
The present invention provides for treatment of diseases, disorders, and/or conditions associated with neovascularization by administration of the polynucleotides and/or polypeptides of the invention, as well as agonists or antagonists of the present invention. Malignant and metastatic conditions which can be treated with the polynucleotides and polypeptides, or agonists or antagonists of the invention include, but are not limited to, malignancies, solid tumors, and cancers described herein and otherwise known in the art (for a review of such disorders, see Fishman et al, Medicine, 2d Ed., J. B. Lippincott Co., Philadelphia (1985)). Thus, the present invention provides a method of treating an angiogenesis-related disease and/or disorder, comprising administering to an individual in need thereof a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist of the invention. For example, polynucleotides, polypeptides, antagonists and/or agonists may be utilized in a variety of additional methods in order to therapeutically treat or prevent a cancer or tumor. Cancers which may be treated with polynucleotides, polypeptides, antagonists and/or agonists include, but are not limited to solid tumors, including prostate, lung, breast, ovarian, stomach, pancreas, larynx, esophagus, testes, liver, parotid, biliary tract, colon, rectum, cervix, utems, endometrium, kidney, bladder, thyroid cancer; primary tumors and metastases; melanomas; glioblastoma; Kaposi's sarcoma; leiomyosarcoma; non- small cell lung cancer; colorectal cancer; advanced malignancies; and blood bom tumors such as leukemias. For example, polynucleotides, polypeptides, antagonists and/or agonists may be delivered topically, in order to treat or prevent cancers such as skin cancer, head and neck tumors, breast tumors, and Kaposi's sarcoma. Within yet other aspects, polynucleotides, polypeptides, antagonists and/or agonists may be utilized to treat, prevent, and/or diagnose superficial forms of bladder cancer by, for example, intravesical administration. Polynucleotides, polypeptides, antagonists and/or agonists may be delivered directly into the tumor, or near the tumor site, via injection or a catheter. Of course, as the artisan of ordinary skill will appreciate, the appropriate mode of administration will vary according to the cancer to be treated. Other modes of delivery are discussed herein.
Polynucleotides, polypeptides, antagonists and/or agonists may be useful in treating other diseases, disorders, and/or conditions, besides cancers, which involve angiogenesis. These diseases, disorders, and/or conditions include, but are not limited to: benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas; artheroscleric plaques; ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, comeal graft rejection, neovascular glaucoma, retrolental fibroplasia, mbeosis, retinoblastoma, uvietis and Pterygia (abnormal blood vessel growth) of the eye; rheumatoid arthritis; psoriasis; delayed wound healing; endometriosis; vasculogenesis; granulations; hypertrophic scars (keloids); nonunion fractures; scleroderma; trachoma; vascular adhesions; myocardial angiogenesis; coronary collaterals; cerebral collaterals; arteriovenous malformations; ischemic limb angiogenesis; Osier-Webber Syndrome; plaque neovascularization; telangiectasia; hemophiliac joints; angiofibroma; fibromuscular dysplasia; wound granulation; Crohn's disease; and atherosclerosis.
For example, within one aspect of the present invention methods are provided for treating hypertrophic scars and keloids, comprising the step of administering a polynucleotide, polypeptide, antagonist and or agonist of the invention to a hypertrophic scar or keloid.
Within one embodiment of the present invention polynucleotides, polypeptides, antagonists and/or agonists are directly injected into a hypertrophic scar or keloid, in order to prevent the progression of these lesions. This therapy is of particular value in the prophylactic treatment of conditions which are known to result in the development of hypertrophic scars and keloids (e.g., bums), and is preferably initiated after the proliferative phase has had time to progress (approximately 14 days after the initial injury), but before hypertrophic scar or keloid development. As noted above, the present invention also provides methods for treating neovascular diseases of the eye, including for example, comeal neovascularization, neovascular glaucoma, proliferative diabetic retinopathy, retrolental fibroplasia and macular degeneration.
Moreover, Ocular diseases, disorders, and/or conditions associated with neovascularization which can be treated with the polynucleotides and polypeptides of the present invention (including agonists and/or antagonists) include, but are not limited to: neovascular glaucoma, diabetic retinopathy, retinoblastoma, retrolental fibroplasia, uveitis, retinopathy of prematurity macular degeneration, comeal graft neovascularization, as well as other eye inflammatory diseases, ocular tumors and diseases associated with choroidal or iris neovascularization. See, e.g., reviews by Waltman et al, Am. J. Ophthal. §5:704-710 (1978) and Gartner et al, Surv. Ophthal. 22:291-312 (1978). Thus, within one aspect of the present invention methods are provided for treating neovascular diseases of the eye such as comeal neovascularization (including comeal graft neovascularization), comprising the step of administering to a patient a therapeutically effective amount of a compound (as described above) to the cornea, such that the formation of blood vessels is inhibited. Briefly, the comea is a tissue which normally lacks blood vessels. In certain pathological conditions however, capillaries may extend into the comea from the pericorneal vascular plexus of the limbus. When the comea becomes vascularized, it also becomes clouded, resulting in a decline in the patient's visual acuity. Visual loss may become complete if the comea completely opacitates. A wide variety of diseases, disorders, and/or conditions can result in comeal neovascularization, including for example, comeal infections (e.g., trachoma, heφes simplex keratitis, leishmaniasis and onchocerciasis), immunological processes (e.g., graft rejection and Stevens-Johnson's syndrome), alkali bums, trauma, inflammation (of any cause), toxic and nutritional deficiency states, and as a complication of wearing contact lenses.
Within particularly preferred embodiments of the invention, may be prepared for topical administration in saline (combined with any of the preservatives and antimicrobial agents commonly used in ocular preparations), and administered in eyedrop form. The solution or suspension may be prepared in its pure form and administered several times daily. Alternatively, anti-angiogenic compositions, prepared as described above, may also be administered directly to the cornea. Within preferred embodiments, the anti-angiogenic composition is prepared with a muco-adhesive polymer which binds to cornea. Within further embodiments, the anti-angiogenic factors or anti-angiogenic compositions may be utilized as an adjunct to conventional steroid therapy. Topical therapy may also be useful prophylactically in co eal lesions which are known to have a high probability of inducing an angiogenic response (such as chemical bums). In these instances the treatment, likely in combination with steroids, may be instituted immediately to help prevent subsequent complications.
Within other embodiments, the compounds described above may be injected directly into the comeal stroma by an ophthalmologist under microscopic guidance. The preferred site of injection may vary with the moφhology of the individual lesion, but the goal of the administration would be to place the composition at the advancing front of the vasculature (i.e., interspersed between the blood vessels and the normal co ea). In most cases this would involve perilimbic comeal injection to "protect" the comea from the advancing blood vessels. This method may also be utilized shortly after a comeal insult in order to prophylactically prevent comeal neovascularization. In this situation the material could be injected in the perilimbic comea interspersed between the comeal lesion and its undesired potential limbic blood supply. Such methods may also be utilized in a similar fashion to prevent capillary invasion of transplanted corneas. In a sustained-release form injections might only be required 2-3 times per year. A steroid could also be added to the injection solution to reduce inflammation resulting from the injection itself.
Within another aspect of the present invention, methods are provided for treating neovascular glaucoma, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited. In one embodiment, the compound may be administered topically to the eye in order to treat or prevent early forms of neovascular glaucoma. Within other embodiments, the compound may be implanted by injection into the region of the anterior chamber angle. Within other embodiments, the compound may also be placed in any location such that the compound is continuously released into the aqueous humor. Within another aspect of the present invention, methods are provided for treating proliferative diabetic retinopathy, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eyes, such that the formation of blood vessels is inhibited.
Within particularly preferred embodiments of the invention, proliferative diabetic retinopathy may be treated by injection into the aqueous humor or the vitreous, in order to increase the local concentration of the polynucleotide, polypeptide, antagonist and/or agonist in the retina. Preferably, this treatment should be initiated prior to the acquisition of severe disease requiring photocoagulation.
Within another aspect of the present invention, methods are provided for treating retrolental fibroplasia, comprising the step of administering to a patient a therapeutically effective amount of a polynucleotide, polypeptide, antagonist and/or agonist to the eye, such that the formation of blood vessels is inhibited. The compound may be administered topically, via intravitreous injection and/or via intraocular implants.
Additionally, diseases, disorders, and/or conditions which can be treated with the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, hemangioma, arthritis, psoriasis, angiofibroma, atherosclerotic plaques, delayed wound healing, granulations, hemophilic joints, hypertrophic scars, nonunion fractures, Osler- Weber syndrome, pyogenic granuloma, scleroderma, trachoma, and vascular adhesions.
Moreover, diseases, disorders, and/or conditions and/or states, which can be treated with be treated with the the polynucleotides, polypeptides, agonists and/or agonists include, but are not limited to, solid tumors, blood bom tumors such as leukemias, tumor metastasis, Kaposi's sarcoma, benign tumors, for example hemangiomas, acoustic neuromas, neurofibromas, trachomas, and pyogenic granulomas, rheumatoid arthritis, psoriasis, ocular angiogenic diseases, for example, diabetic retinopathy, retinopathy of prematurity, macular degeneration, comeal graft rejection, neovascular glaucoma, retrolental fibroplasia, rubeosis, retinoblastoma, and uvietis, delayed wound healing, endometriosis, vascluogenesis, granulations, hypertrophic scars (keloids), nonunion fractures, scleroderma, trachoma, vascular adhesions, myocardial angiogenesis, coronary collaterals, cerebral collaterals, arteriovenous malformations, ischemic limb angiogenesis, Osier- Webber Syndrome, plaque neovascularization, telangiectasia, hemophiliac joints, angiofibroma fibromuscular dysplasia, wound granulation, Crohn's disease, atherosclerosis, birth control agent by preventing vascularization required for embryo implantation controlling menstruation, diseases that have angiogenesis as a pathologic consequence such as cat scratch disease (Rochele minalia quintosa), ulcers (Helicobacter pylori), Bartonellosis and bacillary angiomatosis.
In one aspect of the birth control method, an amount of the compound sufficient to block embryo implantation is administered before or after intercourse and fertilization have occurred, thus providing an effective method of birth control, possibly a "morning after" method. Polynucleotides, polypeptides, agonists and/or agonists may also be used in controlling menstruation or administered as either a peritoneal lavage fluid or for peritoneal implantation in the treatment of endometriosis. Polynucleotides, polypeptides, agonists and/or agonists of the present invention may be incoφorated into surgical sutures in order to prevent stitch granulomas.
Polynucleotides, polypeptides, agonists and/or agonists may be utilized in a wide variety of surgical procedures. For example, within one aspect of the present invention a compositions (in the form of, for example, a spray or film) may be utilized to coat or spray an area prior to removal of a tumor, in order to isolate normal surrounding tissues from malignant tissue, and/or to prevent the spread of disease to surrounding tissues. Within other aspects of the present invention, compositions (e.g., in the form of a spray) may be delivered via endoscopic procedures in order to coat tumors, or inhibit angiogenesis in a desired locale. Within yet other aspects of the present invention, surgical meshes which have been coated with anti- angiogenic compositions of the present invention may be utilized in any procedure wherein a surgical mesh might be utilized. For example, within one embodiment of the invention a surgical mesh laden with an anti-angiogenic composition may be utilized during abdominal cancer resection surgery (e.g., subsequent to colon resection) in order to provide support to the structure, and to release an amount of the anti-angiogenic factor.
Within further aspects of the present invention, methods are provided for treating tumor excision sites, comprising administering a polynucleotide, polypeptide, agonist and/or agonist to the resection margins of a tumor subsequent to excision, such that the local recurrence of cancer and the formation of new blood vessels at the site is inhibited. Within one embodiment of the invention, the anti-angiogenic compound is administered directly to the tumor excision site (e.g., applied by swabbing, brushing or otherwise coating the resection margins of the tumor with the anti-angiogenic compound). Alternatively, the anti- angiogenic compounds may be incoφorated into known surgical pastes prior to administration. Within particularly preferred embodiments of the invention, the anti- angiogenic compounds are applied after hepatic resections for malignancy, and after neurosurgical operations.
Within one aspect of the present invention, polynucleotides, polypeptides, agonists and/or agonists may be administered to the resection margin of a wide variety of tumors, including for example, breast, colon, brain and hepatic tumors. For example, within one embodiment of the invention, anti-angiogenic compounds may be administered to the site of a neurological tumor subsequent to excision, such that the formation of new blood vessels at the site are inhibited.
The polynucleotides, polypeptides, agonists and/or agonists of the present invention may also be administered along with other anti-angiogenic factors. Representative examples of other anti-angiogenic factors include: Anti-Invasive Factor, retinoic acid and derivatives thereof, paclitaxel, Suramin, Tissue Inhibitor of Metalloproteinase- 1, Tissue Inhibitor of Metalloproteinase-2, Plasminogen Activator Inhibitor- 1, Plasminogen Activator Inhibitor-2, and various forms of the lighter "d group" transition metals.
Lighter "d group" transition metals include, for example, vanadium, molybdenum, tungsten, titanium, niobium, and tantalum species. Such transition metal species may form transition metal complexes. Suitable complexes of the above-mentioned transition metal species include oxo transition metal complexes. Representative examples of vanadium complexes include oxo vanadium complexes such as vanadate and vanadyl complexes. Suitable vanadate complexes include metavanadate and orthovanadate complexes such as, for example, ammonium metavanadate, sodium metavanadate, and sodium orthovanadate. Suitable vanadyl complexes include, for example, vanadyl acetylacetonate and vanadyl sulfate including vanadyl sulfate hydrates such as vanadyl sulfate mono- and trihydrates. Representative examples of tungsten and molybdenum complexes also include oxo complexes. Suitable oxo tungsten complexes include tungstate and tungsten oxide complexes. Suitable tungstate complexes include ammonium tungstate, calcium tungstate, sodium tungstate dihydrate, and tungstic acid. Suitable tungsten oxides include tungsten (LV) oxide and tungsten (VI) oxide. Suitable oxo molybdenum complexes include molybdate, molybdenum oxide, and molybdenyl complexes. Suitable molybdate complexes include ammonium molybdate and its hydrates, sodium molybdate and its hydrates, and potassium molybdate and its hydrates. Suitable molybdenum oxides include molybdenum (VI) oxide, molybdenum (VI) oxide, and molybdic acid. Suitable molybdenyl complexes include, for example, molybdenyl acetylacetonate. Other suitable tungsten and molybdenum complexes include hydroxo derivatives derived from, for example, glycerol, tartaric acid, and sugars.
A wide variety of other anti-angiogenic factors may also be utilized within the context of the present invention. Representative examples include platelet factor 4; protamine sulphate; sulphated chitin derivatives (prepared from queen crab shells), (Murata et al., Cancer Res. 51:22-26, 1991); Sulphated Polysaccharide Peptidoglycan Complex (SP- PG) (the function of this compound may be enhanced by the presence of steroids such as estrogen, and tamoxifen citrate); Staurosporine; modulators of matrix metabolism, including for example, proline analogs, cishydroxyproline, d,L-3,4-dehydroproline, Thiaproline, alpha,alpha-dipyridyl, aminopropionitrile fumarate; 4-propyl-5-(4-pyridinyl)-2(3H)- oxazolone; Methotrexate; Mitoxantrone; Heparin; Interferons; 2 Macroglobulin-serum; ChIMP-3 (Pavloff et al., J. Bio. Chem. 267:17321-17326, 1992); Chymostatin (Tomkinson et al., Biochem J. 286:475-480, 1992); Cyclodextrin Tetradecasulfate; Eponemycin; Camptothecin; Fumagillin (Ingber et al., Nature 348:555-557, 1990); Gold Sodium Thiomalate ("GST"; Matsubara and Ziff, J. Clin. Invest. 79: 1440-1446, 1987); anticollagenase-serum; alpha2-antiplasmin (Holmes et al., J. Biol. Chem. 262(4)3659- 1664, 1987); Bisantrene (National Cancer Institute); Lobenzarit disodium (N-(2)- carboxyphenyl-4- chloroanthronilic acid disodium or "CCA"; Takeuchi et al., Agents Actions 36:312-316, 1992); Thalidomide; Angostatic steroid; AGM-1470; carboxynaminolmidazole; and metalloproteinase inhibitors such as BB94.
Diseases at the Cellular Level
Diseases associated with increased cell survival or the inhibition of apoptosis that could be treated, prevented, and/or diagnosed by Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as antagonists or agonists of Ckβ-4 or Ckβ-10, include cancers (such as follicular lymphomas, carcinomas with p53 mutations, and hormone-dependent tumors, including, but not limited to colon cancer, cardiac tumors, pancreatic cancer, melanoma, retinoblastoma, glioblastoma, lung cancer, intestinal cancer, testicular cancer, stomach cancer, neuroblastoma, myxoma, myoma, lymphoma, endothelioma, osteoblastoma, osteoclastoma, osteosarcoma, chondrosarcoma, adenoma, breast cancer, prostate cancer, Kaposi's sarcoma and ovarian cancer); autoimmune diseases, disorders, and/or conditions (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomerulonephritis and rheumatoid arthritis) and viral infections (such as heφes viruses, pox vimses and adenoviruses), inflammation, graft v. host disease, acute graft rejection, and chronic graft rejection. In preferred embodiments, Ckβ-4 or Ckβ-10 polynucleotides, polypeptides, and or antagonists of the invention are used to inhibit growth, progression, and/or metasis of cancers, in particular those listed above.
Additional diseases or conditions associated with increased cell survival that could be treated, prevented, and/or diagnosed by Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, include, but are not limited to, progression, and/or metastases of malignancies and related diseases, disorders, and/or conditions such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia)) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g.. Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, Waldenstrom's macroglobulinemia, heavy chain disease, and solid tumors including, but not limited to, sarcomas and carcinomas such as fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma. osteogenic sarcoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, papillary adenocarcinomas, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, seminoma, embryonal carcinoma, Wilm's tumor, cervical cancer, testicular tumor, lung carcinoma, small cell lung carcinoma, bladder carcinoma, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, acoustic neuroma, oligodendroglioma, menangioma, melanoma, neuroblastoma, and retinoblastoma.
Diseases associated with increased apoptosis that could be treated, prevented, and/or diagnosed by Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, as well as agonists or antagonists of Ckβ-4 or Ckβ-10, include ALDS; neurodegenerative diseases, disorders, and/or conditions (such as Alzheimer's disease, Parkinson's disease, Amyotrophic lateral sclerosis, Retinitis pigmentosa, Cerebellar degeneration and brain tumor or prior associated disease); autoimmune diseases, disorders, and/or conditions (such as, multiple sclerosis, Sjogren's syndrome, Hashimoto's thyroiditis, biliary cirrhosis, Behcet's disease, Crohn's disease, polymyositis, systemic lupus erythematosus and immune-related glomemlonephritis and rheumatoid arthritis) myelodysplastic syndromes (such as aplastic anemia), graft v. host disease, ischemic injury (such as that caused by myocardial infarction, stroke and reperfusion injury), liver injury (e.g., hepatitis related liver injury, ischemia/reperfusion injury, cholestosis (bile duct injury) and liver cancer); toxin-induced liver disease (such as that caused by alcohol), septic shock, cachexia and anorexia.
Neurological Diseases
Chemokines of the present invention also may be used to enhance neuronal survival and differentiation and they may be employed, where effective in this regard, in the treatment of neurodegenerative diseases. Thus, for instance, Ckβ-4 or Ckβ-10 may be used, where effective, to enhance neuton survival and neurite outgrowth.
Nervous system diseases, disorders, and/or conditions, which can be treated with the Ckβ-4 or Ckβ-10 compositions of the invention (e.g., Ckβ-4 or Ckβ-10 polypeptides, polynucleotides, and/or agonists or antagonists), include, but are not limited to, nervous system injuries, and diseases, disorders, and/or conditions which result in either a disconnection of axons, a diminution or degeneration of neurons, or demyelination. Nervous system lesions which may be treated in a patient (including human and non-human mammalian patients) according to the invention, include but are not limited to, the following lesions of either the central (including spinal cord, brain) or peripheral nervous systems: (1) ischemic lesions, in which a lack of oxygen in a portion of the nervous system results in neuronal injury or death, including cerebral infarction or ischemia, or spinal cord infarction or ischemia; (2) traumatic lesions, including lesions caused by physical injury or associated with surgery, for example, lesions which sever a portion of the nervous system, or compression injuries; (3) malignant lesions, in which a portion of the nervous system is destroyed or injured by malignant tissue which is either a nervous system associated malignancy or a malignancy derived from non-nervous system tissue; (4) infectious lesions, in which a portion of the nervous system is destroyed or injured as a result of infection, for example, by an abscess or associated with infection by human immunodeficiency virus, heφes zoster, or heφes simplex vims or with Lyme disease, tuberculosis, syphilis; (5) degenerative lesions, in which a portion of the nervous system is destroyed or injured as a result of a degenerative process including but not limited to degeneration associated with Parkinson's disease, Alzheimer's disease, Huntington's chorea, or amyotrophic lateral sclerosis (ALS); (6) lesions associated with nutritional diseases, disorders, and/or conditions, in which a portion of the nervous system is destroyed or injured by a nutritional disorder or disorder of metabolism including but not limited to, vitamin B12 deficiency, folic acid deficiency, Wemicke disease, tobacco-alcohol amblyopia, Marchiafava-Bignami disease (primary degeneration of the coφus callosum), and alcoholic cerebellar degeneration; (7) neurological lesions associated with systemic diseases including, but not limited to, diabetes (diabetic neuropathy, Bell's palsy), systemic lupus erythematosus, carcinoma, or sarcoidosis; (8) lesions caused by toxic substances including alcohol, lead, or particular neurotoxins; and (9) demyelinated lesions in which a portion of the nervous system is destroyed or injured by a demyelinating disease including, but not limited to, multiple sclerosis, human immunodeficiency vims-associated myelopathy, transverse myelopathy or various etiologies, progressive multifocal leukoencephalopathy, and central pontine myelinolysis.
In a preferred embodiment, the Ckβ-4 or Ckβ-10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to protect neural cells from the damaging effects of cerebral hypoxia. According to this embodiment, the Ckβ-4 or Ckβ-10 compositions of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with cerebral hypoxia. In one aspect of this embodiment, the Ckβ-4 or Ckβ-10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with cerebral ischemia. In another aspect of this embodiment, the Ckβ-4 or Ckβ-10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with cerebral infarction. In another aspect of this embodiment, the Ckβ-4 or Ckβ- 10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with a stroke. In a further aspect of this embodiment, the Ckβ-4 or Ckβ-10 polypeptides, polynucleotides, or agonists or antagonists of the invention are used to treat, prevent, and/or diagnose neural cell injury associated with a heart attack. The compositions of the invention which are useful for treating, preventing, and/or diagnosing a nervous system disorder may be selected by testing for biological activity in promoting the survival or differentiation of neurons. For example, and not by way of limitation, Ckβ-4 or Ckβ-10 compositions of the invention which elicit any of the following effects may be useful according to the invention: (1) increased survival time of neurons in culture; (2) increased sprouting of neurons in culture or in vivo; (3) increased production of a neuron-associated molecule in culture or in vivo, e.g. , choline acetyltransferase or acetylcholinesterase with respect to motor neurons; or (4) decreased symptoms of neuron dysfunction in vivo. Such effects may be measured by any method known in the art. In preferred, non-limiting embodiments, increased survival of neurons may routinely be measured using a method set forth herein or otherwise known in the art, such as, for example, the method set forth in Arakawa et al. (J. Neurosci. 10:3507-3515 (1990)); increased sprouting of neurons may be detected by methods known in the art, such as, for example, the methods set forth in Pestronk et al. (Exp. Neurol. 70:65-82 (1980)) or Brown et al. (Ann. Rev. Neurosci. 4:17-42 (1981)); increased production of neuron-associated molecules may be measured by bioassay, enzymatic assay, antibody binding, Northern blot assay, etc., using techniques known in the art and depending on the molecule to be measured; and motor neuron dysfunction may be measured by assessing the physical manifestation of motor neuron disorder, e.g., weakness, motor neuron conduction velocity, or functional disability. In specific embodiments, motor neuron diseases, disorders, and/or conditions that may be treated according to the invention include, but are not limited to, diseases, disorders, and/or conditions such as infarction, infection, exposure to toxin, trauma, surgical damage, degenerative disease or malignancy that may affect motor neurons as well as other components of the nervous system, as well as diseases, disorders, and/or conditions that selectively affect neurons such as amyotrophic lateral sclerosis, and including, but not limited to, progressive spinal muscular atrophy, progressive bulbar palsy, primary lateral sclerosis, infantile and juvenile muscular atrophy, progressive bulbar paralysis of childhood (Fazio-Londe syndrome), poliomyelitis and the post polio syndrome, and Hereditary Motorsensory Neuropathy (Charcot-Marie -Tooth Disease).
Additional examples of neurologic diseases which can be treated, prevented, and/or diagnosed with polynucleotides, polypeptides, agonists, and/or antagonists of the present invention include brain diseases, such as metabolic brain diseases which includes phenylketonuria such as maternal phenylketonuria, pymvate carboxylase deficiency, pyruvate dehydrogenase complex deficiency, Wemicke's Encephalopathy, brain edema, brain neoplasms such as cerebellar neoplasms which include infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms, supratentorial neoplasms, canavan disease, cerebellar diseases such as cerebellar ataxia which include spinocerebellar degeneration such as ataxia telangiectasia, cerebellar dyssynergia, Friederich's Ataxia, Machado-Joseph Disease, olivopontocerebellar atrophy, cerebellar neoplasms such as infratentorial neoplasms, diffuse cerebral sclerosis such as encephalitis periaxialis, globoid cell leukodystrophy, metachromatic leukodystrophy and subacute sclerosing panencephalitis, cerebrovascular diseases, disorders, and/or conditions (such as carotid artery diseases which include carotid artery thrombosis, carotid stenosis and Moyamoya Disease, cerebral amyloid angiopathy, cerebral aneurysm, cerebral anoxia, cerebral arteriosclerosis, cerebral arteriovenous malformations, cerebral artery diseases, cerebral embolism and thrombosis such as carotid artery thrombosis, sinus thrombosis and Wallenberg's Syndrome, cerebral hemorrhage such as epidural hematoma, subdural hematoma and subarachnoid hemorrhage, cerebral infarction, cerebral ischemia such as transient cerebral ischemia, Subclavian Steal Syndrome and vertebrobasilar insufficiency, vascular dementia such as multi-infarct dementia, periventricular leukomalacia, vascular headache such as cluster headache, migraine, dementia such as AIDS Dementia Complex, presenile dementia such as Alzheimer's Disease and Creutzfeldt-Jakob Syndrome, senile dementia such as Alzheimer's Disease and progressive supranuclear palsy, vascular dementia such as multi-infarct dementia, encephalitis which include encephalitis periaxialis, viral encephalitis such as epidemic encephalitis, Japanese Encephalitis, St. Louis Encephalitis, tick-bome encephalitis and West Nile Fever, acute disseminated encephalomyelitis, meningoencephalitis such as uveomeningoencephalitic syndrome, Postencephalitic Parkinson Disease and subacute sclerosing panencephalitis, encephalomalacia such as periventricular leukomalacia, epilepsy such as generalized epilepsy which includes infantile spasms, absence epilepsy, myoclonic epilepsy which includes MERRF Syndrome, tonic- clonic epilepsy, partial epilepsy such as complex partial epilepsy, frontal lobe epilepsy and temporal lobe epilepsy, post-traumatic epilepsy, status epilepticus such as Epilepsia Partialis Continua, Hallervorden-Spatz Syndrome, hydrocephalus such as Dandy-Walker Syndrome and normal pressure hydrocephalus, hypothalamic diseases such as hypothalamic neoplasms, cerebral malaria, narcolepsy which includes cataplexy, bulbar poliomyelitis, cerebri pseudotumor, Rett Syndrome, Reye's Syndrome, thalamic diseases, cerebral toxoplasmosis, intracranial ruberculoma and Zellweger Syndrome, central nervous system infections such as AIDS Dementia Complex, Brain Abscess, subdural empyema, encephalomyelitis such as Equine Encephalomyelitis, Venezuelan Equine Encephalomyelitis, Necrotizing Hemorrhagic Encephalomyelitis, Visna, cerebral malaria, meningitis such as arachnoiditis, aseptic meningtitis such as viral meningtitis which includes lymphocytic choriomeningitis. Bacterial meningtitis which includes Haemophilus Meningtitis, Listeria Meningtitis, Meningococcal Meningtitis such as Waterhouse-Friderichsen Syndrome, Pneumococcal Meningtitis and meningeal tuberculosis, fungal meningitis such as Cryptococcal Meningtitis, subdural effusion, meningoencephalitis such as uvemeningoencephalitic syndrome, myelitis such as transverse myelitis, neurosyphilis such as tabes dorsalis, poliomyelitis which includes bulbar poliomyelitis and postpoliomyelitis syndrome, prion diseases (such as Creutzfeldt-Jakob Syndrome, Bovine Spongiform Encephalopathy, Gerstmann-Straussler Syndrome, Kuru, Scrapie) cerebral toxoplasmosis, central nervous system neoplasms such as brain neoplasms that include cerebellear neoplasms such as infratentorial neoplasms, cerebral ventricle neoplasms such as choroid plexus neoplasms, hypothalamic neoplasms and supratentorial neoplasms, meningeal neoplasms, spinal cord neoplasms which include epidural neoplasms, demyelinating diseases such as Canavan Diseases, diffuse cerebral sceloris which includes adrenoleukodystrophy, encephalitis periaxialis, globoid cell leukodystrophy, diffuse cerebral sclerosis such as metachromatic leukodystrophy, allergic encephalomyelitis, necrotizing hemorrhagic encephalomyelitis, progressive multifocal leukoencephalopathy, multiple sclerosis, central pontine myelinolysis, transverse myelitis, neuromyelitis optica, Scrapie, Swayback, Chronic Fatigue Syndrome, Visna, High Pressure Nervous Syndrome, Meningism, spinal cord diseases such as amyotonia congenita, amyotrophic lateral sclerosis, spinal muscular atrophy such as Werdnig-Hoffmann Disease, spinal cord compression, spinal cord neoplasms such as epidural neoplasms, syringomyelia, Tabes Dorsalis, Stiff- Man Syndrome, mental retardation such as Angelman Syndrome, Cri-du-Chat Syndrome, De Lange's Syndrome, Down Syndrome, Gangliosidoses such as gangliosidoses G(M1), Sandhoff Disease, Tay-Sachs Disease, Hartnup Disease, homocystinuria, Laurence-Moon- Biedl Syndrome, Lesch-Nyhan Syndrome, Maple Syrup Urine Disease, mucolipidosis such as fucosidosis, neuronal ceroid-lipofuscinosis, oculocerebrorenal syndrome, phenylketonuria such as maternal phenylketonuria, Prader-Willi Syndrome, Rett Syndrome, Rubinstein-Taybi Syndrome, Tuberous Sclerosis, WAGR Syndrome, nervous system abnormalities such as holoprosencephaly, neural tube defects such as anencephaly which includes hydrangencephaly, Arnold-Chairi Deformity, encephalocele, meningocele, meningomyelocele, spinal dysraphism such as spina bifida cystica and spina bifida occulta, hereditary motor and sensory neuropathies which include Charcot-Marie Disease, Hereditary optic atrophy, Refsum's Disease, hereditary spastic paraplegia, Werdnig-Hoffmann Disease, Hereditary Sensory and Autonomic Neuropathies such as Congenital Analgesia and Familial Dysautonomia, Neurologic manifestations (such as agnosia that include Gerstmann's Syndrome, Amnesia such as retrograde amnesia, apraxia, neurogenic bladder, cataplexy, communicative diseases, disorders, and/or conditions such as hearing diseases, disorders, and/or conditions that includes deafness, partial hearing loss, loudness recmitment and tinnitus, language diseases, disorders, and/or conditions such as aphasia which include agraphia, anomia, broca aphasia, and Wemicke Aphasia, Dyslexia such as Acquired Dyslexia, language development diseases, disorders, and/or conditions, speech diseases, disorders, and/or conditions such as aphasia which includes anomia, broca aphasia and Wemicke Aphasia, articulation diseases, disorders, and/or conditions, communicative diseases, disorders, and/or conditions such as speech disorders which include dysarthria, echolalia, mutism and stuttering, voice diseases, disorders, and/or conditions such as aphonia and hoarseness, decerebrate state, delirium, fasciculation, hallucinations, meningism, movement diseases, disorders, and/or conditions such as angelman syndrome, ataxia, athetosis, chorea, dystonia, hypokinesia, muscle hypotonia, myoclonus, tic, torticollis and tremor, muscle hypertonia such as muscle rigidity such as stiff-man syndrome, muscle spasticity, paralysis such as facial paralysis which includes Heφes Zoster Oticus, Gastroparesis, Hemiplegia, ophthalmoplegia such as diplopia, Duane's Syndrome, Homer's Syndrome, Chronic progressive external ophthalmoplegia such as Keams Syndrome, Bulbar Paralysis, Tropical Spastic Paraparesis, Paraplegia such as Brown- Sequard Syndrome, quadriplegia, respiratory paralysis and vocal cord paralysis, paresis, phantom limb, taste diseases, disorders, and/or conditions such as ageusia and dysgeusia, vision diseases, disorders, and/or conditions such as amblyopia, blindness, color vision defects, diplopia, hemianopsia, scotoma and subnormal vision, sleep diseases, disorders, and/or conditions such as hypersomnia which includes Kleine-Levin Syndrome, insomnia, and somnambulism, spasm such as trismus, unconsciousness such as coma, persistent vegetative state and syncope and vertigo, neuromuscular diseases such as amyotonia congenita, amyotrophic lateral sclerosis, Lambert-Eaton Myasthenic Syndrome, motor neuron disease, muscular atrophy such as spinal muscular atrophy, Charcot-Marie Disease and Werdnig-Hoffmann Disease, Postpoliomyelitis Syndrome, Muscular Dystrophy, Myasthenia Gravis, Myotonia Atrophica, Myotonia Confenita, Nemaline Myopathy, Familial Periodic Paralysis, Multiplex Paramyloclonus, Tropical Spastic Paraparesis and Stiff-Man Syndrome, peripheral nervous system diseases such as acrodynia, amyloid neuropathies, autonomic nervous system diseases such as Adie's Syndrome, Barre-Lieou Syndrome, Familial Dysautonomia, Horner's Syndrome, Reflex Sympathetic Dystrophy and Shy- Drager Syndrome, Cranial Nerve Diseases such as Acoustic Nerve Diseases such as Acoustic Neuroma which includes Neurofibromatosis 2, Facial Nerve Diseases such as Facial Neuralgia,Melkersson-Rosenthal Syndrome, ocular motility diseases, disorders, and/or conditions which includes amblyopia, nystagmus, oculomotor nerve paralysis, ophthalmoplegia such as Duane's Syndrome, Homer's Syndrome, Chronic Progressive External Ophthalmoplegia which includes Keams Syndrome, Strabismus such as Esotropia and Exotropia, Oculomotor Nerve Paralysis, Optic Nerve Diseases such as Optic Atrophy which includes Hereditary Optic Atrophy, Optic Disk Drusen, Optic Neuritis such as Neuromyelitis Optica, Papilledema, Trigeminal Neuralgia, Vocal Cord Paralysis, Demyelinating Diseases such as Neuromyelitis Optica and Swayback, Diabetic neuropathies such as diabetic foot, nerve compression syndromes such as caφal tunnel syndrome, tarsal tunnel syndrome, thoracic outlet syndrome such as cervical rib syndrome, ulnar nerve compression syndrome, neuralgia such as causalgia, cervico-bracbial neuralgia, facial neuralgia and trigeminal neuralgia, neuritis such as experimental allergic neuritis, optic neuritis, polyneuritis, polyradiculoneuritis and radiculities such as polyradiculitis, hereditary motor and sensory neuropathies such as Charcot-Marie Disease, Hereditary Optic Atrophy, Refsum's Disease, Hereditary Spastic Paraplegia and Werdnig-Hoffmann Disease, Hereditary Sensory and Autonomic Neuropathies which include Congenital Analgesia and Familial Dysautonomia, POEMS Syndrome, Sciatica, Gustatory Sweating and Tetany).
Regeneration
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of
Ckβ-4 or Ckβ-10, can be used to differentiate, proliferate, and attract cells, leading to the regeneration of tissues. (See, Science 276:59-87 (1997).) The regeneration of tissues could be used to repair, replace, or protect tissue damaged by congenital defects, trauma (wounds, burns, incisions, or ulcers), age, disease (e.g. osteoporosis, osteocarthritis, periodontal disease, liver failure), surgery, including cosmetic plastic surgery, fibrosis, reperfusion injury, or systemic cytokine damage.
Tissues that could be regenerated using the present invention include organs (e.g., pancreas, liver, intestine, kidney, skin, endothelium), muscle (smooth, skeletal or cardiac), vasculature (including vascular and lymphatics), nervous, hematopoietic, and skeletal (bone, cartilage, tendon, and ligament) tissue. Preferably, regeneration occurs without or decreased scarring. Regeneration also may include angiogenesis.
Moreover, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may increase regeneration of tissues difficult to heal. For example, increased tendon/ligament regeneration would quicken recovery time after damage.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides. or agonists or antagonists of Ckβ-4 or Ckβ-10, of the present invention could also be used prophylactically in an effort to avoid damage. Specific diseases that could be treated, prevented, and/or diagnosed include of tendinitis, caφal tunnel syndrome, and other tendon or ligament defects. A further example of tissue regeneration of non-healing wounds includes pressure ulcers, ulcers associated with vascular insufficiency, surgical, and traumatic wounds.
Similarly, nerve and brain tissue could also be regenerated by using Ckβ-4 or Ckβ- 10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, to proliferate and differentiate nerve cells. Diseases that could be treated, prevented, and/or diagnosed using this method include central and peripheral nervous system diseases, neuropathies, or mechanical and traumatic diseases, disorders, and/or conditions (e.g., spinal cord disorders, head trauma, cerebrovascular disease, and stoke). Specifically, diseases associated with peripheral nerve injuries, peripheral neuropathy (e.g., resulting from chemotherapy or other medical therapies), localized neuropathies, and central nervous system diseases (e.g., Alzheimer's disease, Parkinson's disease, Huntington's disease, amyotrophic lateral sclerosis, and Shy-Drager syndrome), could all be treated, prevented, and/or diagnosed using the Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10.
Chemotaxis Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of
Ckβ-4 or Ckβ-10, may have chemotaxis activity. A chemotaxic molecule attracts or mobilizes cells (e.g., monocytes, fibroblasts, neutrophils, T-cells, mast cells, eosinophils, epithelial and or endothelial cells) to a particular site in the body, such as inflammation, infection, or site of hypeφroliferation. The mobilized cells can then fight off and/or heal the particular trauma or abnormality.
Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of
Ckβ-4 or Ckβ-10, may increase chemotaxic activity of particular cells. These chemotactic molecules can then be used to treat, prevent, and/or diagnose inflammation, infection, hypeφroliferative diseases, disorders, and/or conditions, or any immune system disorder by increasing the number of cells targeted to a particular location in the body. For example, chemotaxic molecules can be used to treat, prevent, and/or diagnose wounds and other trauma to tissues by attracting immune cells to the injured location. Chemotactic molecules of the present invention can also attract fibroblasts, which can be used to treat, prevent, and/or diagnose wounds. It is also contemplated that Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, may inhibit chemotactic activity. These molecules could also be used to treat, prevent, and/or diagnose diseases, disorders, and/or conditions. Thus, Ckβ-4 or Ckβ-10 polynucleotides or polypeptides, or agonists or antagonists of Ckβ-4 or Ckβ-10, could be used as an inhibitor of chemotaxis.
Binding Activity
Ckβ-4 or Ckβ-10 polypeptides may be used to screen for molecules that bind to
Ckβ-4 or Ckβ-10 or for molecules to which Ckβ-4 or Ckβ-10 binds. The binding of Ckβ- 4 or Ckβ-10 and the molecule may activate (agonist), increase, inhibit (antagonist), or decrease activity of the Ckβ-4 or Ckβ-10 or the molecule bound. Examples of such molecules include antibodies, oligonucleotides, proteins (e.g., receptors),or small molecules.
Preferably, the molecule is closely related to the natural ligand of Ckβ-4 or Ckβ-10, e.g., a fragment of the ligand, or a natural substrate, a ligand, a stmctural or functional mimetic. (See, Coligan et al., Current Protocols in Immunology l(2):Chapter 5 (1991).)
Similarly, the molecule can be closely related to the natural receptor to which Ckβ-4 or Ckβ- 10 binds, or at least, a fragment of the receptor capable of being bound by Ckβ-4 or Ckβ-10
(e.g., active site). In either case, the molecule can be rationally designed using known techniques.
Preferably, the screening for these molecules involves producing appropriate cells which express Ckβ-4 or Ckβ-10, either as a secreted protein or on the cell membrane.
Preferred cells include cells from mammals, yeast, Drosophila, or E. coli. Cells expressing
Ckβ-4 or Ckβ-10 (or cell membrane containing the expressed polypeptide) are then preferably contacted with a test compound potentially containing the molecule to observe binding, stimulation, or inhibition of activity of either Ckβ-4 or Ckβ-10 or the molecule.
The assay may simply test binding of a candidate compound to Ckβ-4 or Ckβ-10, wherein binding is detected by a label, or in an assay involving competition with a labeled competitor. Further, the assay may test whether the candidate compound results in a signal generated by binding to Ckβ-4 or Ckβ-10.
Alternatively, the assay can be carried out using cell-free preparations, polypeptide/molecule affixed to a solid support, chemical libraries, or natural product mixtures. The assay may also simply comprise the steps of mixing a candidate compound with a solution containing Ckβ-4 or Ckβ-10, measuring Ckβ-4 or Ckβ-10/molecule activity or binding, and comparing the Ckβ-4 or Ckβ-10/molecule activity or binding to a standard.
Preferably, an ELISA assay can measure Ckβ-4 or Ckβ-10 level or activity in a sample (e.g., biological sample) using a monoclonal or polyclonal antibody. The antibody can measure Ckβ-4 or Ckβ-10 level or activity by either binding, directly or indirectly, to
Ckβ-4 or Ckβ-10 or by competing with Ckβ-4 or Ckβ-10 for a substrate. Additionally, the receptor to which Ckβ-4 or Ckβ-10 binds can be identified by numerous methods known to those of skill in the art, for example, ligand panning and FACS sorting (Coligan, et al., Current Protocols in Immun., 1(2), Chapter 5, (1991)). For example, expression cloning is employed wherein polyadenylated RNA is prepared from a cell responsive to the polypeptides, for example, NIH3T3 cells which are known to contain multiple receptors for the FGF family proteins, and SC-3 cells, and a cDNA library created from this RNA is divided into pools and used to transfect COS cells or other cells that are not responsive to the polypeptides. Transfected cells which are grown on glass slides are exposed to the polypeptide of the present invention, after they have been labelled. The polypeptides can be labeled by a variety of means including iodination or inclusion of a recognition site for a site-specific protein kinase.
Following fixation and incubation, the slides are subjected to auto-radiographic analysis. Positive pools are identified and sub-pools are prepared and re-transf ected using an iterative sub-pooling and re-screening process, eventually yielding a single clones that encodes the putative receptor. As an alternative approach for receptor identification, the labeled polypeptides can be photoaffinity linked with cell membrane or extract preparations that express the receptor molecule. Cross-linked material is resolved by PAGE analysis and exposed to X-ray film. The labeled complex containing the receptors of the polypeptides can be excised, resolved into peptide fragments, and subjected to protein microsequencing. The amino acid sequence obtained from microsequencing would be used to design a set of degenerate oligonucleotide probes to screen a cDNA library to identify the genes encoding the putative receptors.
Moreover, the techniques of gene- shuffling, motif-shuffling, exon-shuf fling, and/or codon- shuffling (collectively referred to as "DNA shuffling") may be employed to modulate the activities of Ckβ-4 or Ckβ-10 thereby effectively generating agonists and antagonists of Ckβ-4 or Ckβ-10. See generally, U.S. Patent Nos. 5,605,793, 5,811,238, 5,830,721,
5,834,252, and 5,837,458, and Patten, P. A., et al, Curr. Opinion Biotechnol. 8:724-33
(1997); Harayama, S. Trends Biotechnol. 16(2):76-82 (1998); Hansson, L. O., et al, J.
Mol. Biol. 287:265-76 (1999); and Lorenzo, M. M. and Blasco, R. Biotechniques 24(2):308-13 (1998) (each of these patents and publications are hereby incoφorated by reference). In one embodiment, alteration of Ckβ-4 or Ckβ-10 polynucleotides and corresponding polypeptides may be achieved by DNA shuffling. DNA shuffling involves the assembly of two or more DNA segments into a desired Ckβ-4 or Ckβ-10 molecule by homologous, or site-specific, recombination. In another embodiment, Ckβ-4 or Ckβ-10 polynucleotides and corresponding polypeptides may be alterred by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination. In another embodiment, one or more components, motifs, sections, parts, domains, fragments, etc., of Ckβ-4 or Ckβ-10 may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules. In preferred embodiments, the heterologous molecules are Transforming Growth Factor family members. In further preferred embodiments, the heterologous molecule is a growth factor such as, for example, platelet-derived growth factor (PDGF), insulin-like growth factor (IGF-I), transforming growth factor (TGF)-alpha, epidermal growth factor (EGF), fibroblast growth factor (FGF), TGF-beta, bone moφhogenetic protein (BMP)-2, BMP-4, BMP-5, BMP-6, BMP-7, activins A and B, decapentaplegic(dpp), 60A, OP-2, dorsalin, growth differentiation factors (GDFs), nodal, MIS, inhibin-alpha, TGF-beta 1, TGF-beta2, TGF-beta3, TGF-beta5, and glial-derived neurotrophic factor (GDNF).
Other preferred fragments are biologically active Ckβ-4 or Ckβ-10 fragments.
Biologically active fragments are those exhibiting activity similar, but not necessarily identical, to an activity of the Ckβ-4 or Ckβ-10 polypeptide. The biological activity of the fragments may include an improved desired activity, or a decreased undesirable activity.
Additionally, this invention provides a method of screening compounds to identify those which modulate the action of the polypeptide of the present invention. An example of such an assay comprises combining a mammalian fibroblast cell, a the polypeptide of the present invention, the compound to be screened and 3[H] thymidine under cell culture conditions where the fibroblast cell would normally proliferate. A control assay may be performed in the absence of the compound to be screened and compared to the amount of fibroblast proliferation in the presence of the compound to determine if the compound stimulates proliferation by determining the uptake of 3[H] thymidine in each case. The amount of fibroblast cell proliferation is measured by liquid scintillation chromatography which measures the incoφoration of 3[H] thymidine. Both agonist and antagonist compounds may be identified by this procedure.
In another method, a mammalian cell or membrane preparation expressing a receptor for a polypeptide of the present invention is incubated with a labeled polypeptide of the present invention in the presence of the compound. The ability of the compound to enhance or block this interaction could then be measured. Alternatively, the response of a known second messenger system following interaction of a compound to be screened and the Ckβ-
4 or Ckβ-10 receptor is measured and the ability of the compound to bind to the receptor and elicit a second messenger response is measured to determine if the compound is a potential agonist or antagonist. Such second messenger systems include but are not limited to, cAMP guanylate cyclase, ion channels or phosphoinositide hydrolysis.
All of these above assays can be used as diagnostic or prognostic markers. The molecules discovered using these assays can be used to treat, prevent, and/or diagnose disease or to bring about a particular result in a patient (e.g., blood vessel growth) by activating or inhibiting the polypeptide/molecule. Moreover, the assays can discover agents which may inhibit or enhance the production of the polypeptides of the mvention from suitably manipulated cells or tissues. Therefore, the invention includes a method of identifying compounds which bind to Ckβ-4 or Ckβ-10 comprising the steps of: (a) incubating a candidate binding compound with Ckβ-4 or Ckβ-10; and (b) determining if binding has occurred. Moreover, the invention includes a method of identifying agonists/antagonists comprising the steps of: (a) incubating a candidate compound with
Ckβ-4 or Ckβ-10, (b) assaying a biological activity , and (b) determining if a biological activity of Ckβ-4 or Ckβ-10 has been altered.
Targeted Delivery
In another embodiment, the invention provides a method of delivering compositions to targeted cells expressing a receptor for a polypeptide of the invention, or cells expressing a cell bound form of a polypeptide of the invention.
As discussed herein, polypeptides or antibodies of the invention may be associated with heterologous polypeptides, heterologous nucleic acids, toxins, or prodrugs via hydrophobic, hydrophilic, ionic and/or covalent interactions. In one embodiment, the invention provides a method for the specific delivery of compositions of the invention to cells by administering polypeptides of the invention (including antibodies) that are associated with heterologous polypeptides or nucleic acids. In one example, the invention provides a method for delivering a therapeutic protein into the targeted cell. In another example, the invention provides a method for delivering a single stranded nucleic acid (e.g., antisense or ribozymes) or double stranded nucleic acid (e.g., DNA that can integrate into the cell's genome or replicate episomally and that can be transcribed) into the targeted cell.
In another embodiment, the invention provides a method for the specific destmction of cells (e.g., the destmction of tumor cells) by administering polypeptides of the invention (e.g., polypeptides of the invention or antibodies of the invention) in association with toxins or cytotoxic prodrugs.
By "toxin" is meant compounds that bind and activate endogenous cytotoxic effector systems, radioisotopes, holotoxins, modified toxins, catalytic subunits of toxins, or any molecules or enzymes not normally present in or on the surface of a cell that under defined conditions cause the cell's death. Toxins that may be used according to the methods of the invention include, but are not limited to, radioisotopes known in the art, compounds such as, for example, antibodies (or complement fixing containing portions thereof) that bind an inherent or induced endogenous cytotoxic effector system, thymidine kinase, endonuclease, RNAse, alpha toxin, ricin, abrin, Pseudomonas exotoxin A, diphtheria toxin, saporin, momordin, gelonin, pokeweed antiviral protein, alpha-sarcin and cholera toxin. By "cytotoxic prodrug" is meant a non-toxic compound that is converted by an enzyme, normally present in the cell, into a cytotoxic compound. Cytotoxic prodrugs that may be used according to the methods of the invention include, but are not limited to, glutamyl derivatives of benzoic acid mustard alkylating agent, phosphate derivatives of etoposide or mitomycin C, cytosine arabinoside, daunorubisin, and phenoxyacetamide derivatives of doxorubicin.
Drug Screening
This invention provides a method of screening dmgs to identify those which enhance (agonists) or block (antagonists) interaction of the polypeptides to their identified receptors. An agonist is a compound which increases the natural biological functions of the polypeptides, while antagonists eliminate such functions. Such a method would include contacting the polypeptide of the present invention with a selected compound(s) suspected of having antagonist or agonist activity, and assaying the activity of these polypeptides following binding. As an example, a mammalian cell or membrane preparation expressing the receptors of the polypeptides would be incubated with a labeled chemokine polypeptide, eg. radioactivity, in the presence of the dmg. The ability of the dmg to enhance or block this interaction could then be measured.
This invention is particularly useful for screening therapeutic compounds by using the polypeptides of the present invention, or binding fragments thereof, in any of a variety of drug screening techniques. The polypeptide or fragment employed in such a test may be affixed to a solid support, expressed on a cell surface, free in solution, or located intracellularly. One method of dmg screening utilizes eukaryotic or prokaryotic host cells which are stably transformed with recombinant nucleic acids expressing the polypeptide or fragment. Dmgs are screened against such transformed cells in competitive binding assays. One may measure, for example, the formulation of complexes between the agent being tested and a polypeptide of the present invention.
Thus, the present invention provides methods of screening for dmgs or any other agents which affect activities mediated by the polypeptides of the present invention. These methods comprise contacting such an agent with a polypeptide of the present invention or a fragment thereof and assaying for the presence of a complex between the agent and the polypeptide or a fragment thereof, by methods well known in the art. In such a competitive binding assay, the agents to screen are typically labeled. Following incubation, free agent is separated from that present in bound form, and the amount of free or uncomplexed label is a measure of the ability of a particular agent to bind to the polypeptides of the present invention.
Another technique for dmg screening provides high throughput screening for compounds having suitable binding affinity to the polypeptides of the present invention, and is described in great detail in European Patent Application 84/03564, published on September 13, 1984, which is incoφorated herein by reference herein. Briefly stated, large numbers of different small peptide test compounds are synthesized on a solid substrate, such as plastic pins or some other surface. The peptide test compounds are reacted with polypeptides of the present invention and washed. Bound polypeptides are then detected by methods well known in the art. Purified polypeptides are coated directly onto plates for use in the aforementioned drug screening techniques. In addition, non-neutralizing antibodies may be used to capture the peptide and immobilize it on the solid support.
This invention also contemplates the use of competitive drug screening assays in which neutralizing antibodies capable of binding polypeptides of the present invention specifically compete with a test compound for binding to the polypeptides or fragments thereof. In this manner, the antibodies are used to detect the presence of any peptide which shares one or more antigenic epitopes with a polypeptide of the invention.
Antisense And Ribozvme (Antagonists)
In specific embodiments, antagonists according to the present invention are nucleic acids corresponding to the sequences contained in SEQ ED NO3 or SEQ LD NO:3, or the complementary strand thereof, and/or to nucleotide sequences contained in the clones deposited as ATCC Nos:75848 or 75849. In one embodiment, antisense sequence is generated internally, by the organism, in another embodiment, the antisense sequence is separately administered (see, for example, O'Connor, J., Neurochem. 56:560 (1991). Oligodeoxynucleotides as Anitsense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Antisense technology can be used to control gene expression through antisense DNA or RNA, or through triple-helix formation. Antisense techniques are discussed for example, in Okano, J., Neurochem. 56:560 (1991); Oligodeoxynucleotides as Antisense Inhibitors of Gene Expression, CRC Press, Boca Raton, FL (1988). Triple helix formation is discussed in, for instance, Lee et al., Nucleic Acids Research 6:3073 (1979); Cooney et al., Science 241:456 (1988); and Dervan et al., Science 251:1300 (1991). The methods are based on binding of a polynucleotide to a complementary DNA or RNA.
For example, the use of c-myc and c-myb antisense RNA constmcts to inhibit the growth of the non-lymphocytic leukemia cell line HL-60 and other cell lines was previously described. (Wickstrom et al. (1988); Anfossi et al. (1989)). These experiments were performed in vitro by incubating cells with the oligoribonucleotide. A similar procedure for in vivo use is described in WO 91/15580. Briefly, a pair of oligonucleotides for a given antisense RNA is produced as follows: A sequence complimentary to the first 15 bases of the open reading frame is flanked by an EcoRI site on the 5' end and a Hindlll site on the 3' end. Next, the pair of oligonucleotides is heated at 90°C for one minute and then annealed in 2X ligation buffer (20mM TRIS HCl pH 7.5, lOmM MgC12, 10MM dithiothreitol (DTT) and 0.2 mM ATP) and then ligated to the EcoRl Hind III site of the retroviral vector PMV7 (WO 91/15580). For example, the 5' coding portion of a polynucleotide that encodes the mature polypeptide of the present invention may be used to design an antisense RNA oligonucleotide of from about 10 to 40 base pairs in length. A DNA oligonucleotide is designed to be complementary to a region of the gene involved in transcription thereby preventing transcription and the production of the receptor. The antisense RNA oligonucleotide hybridizes to the mRNA in vivo and blocks translation of the mRNA molecule into receptor polypeptide.
In one embodiment, the chemokine antisense nucleic acid of the invention is produced intracellularly by transcription from an exogenous sequence. For example, a vector or a portion thereof, is transcribed, producing an antisense nucleic acid (RNA) of the invention. Such a vector would contain a sequence encoding the chemokine antisense nucleic acid. Such a vector can remain episomal or become chromosomally integrated, as long as it can be transcribed to produce the desired antisense RNA. Such vectors can be constructed by recombinant DNA technology methods standard in the art. Vectors can be plasmid, viral, or others known in the art, used for replication and expression in vertebrate cells. Expression of the sequence encoding a chemokine of the invention, or fragments thereof, can be by any promoter known in the art to act in vertebrate, preferably human cells.
Such promoters can be inducible or constitutive. Such promoters include, but are not limited to, the SV40 early promoter region (Bemoist and Chambon, Nature 29:304-310 (1981), the promoter contained in the 3' long terminal repeat of Rous sarcoma vims (Yamamoto et al., Cell 22:787-797 (1980), the heφes thymidine promoter (Wagner et al., Proc. Natl. Acad. Sci. U.S.A. 78:1441-1445 (1981), the regulatory sequences of the metallothionein gene (Brinster, et al., Nature 296:39-42 (1982)), etc. The antisense nucleic acids of the invention comprise a sequence complementary to at least a portion of an RNA transcript of a chemokine gene. However, absolute complementarity, although preferred, is not required. A sequence "complementary to at least a portion of an RNA," referred to herein, means a sequence having sufficient complementarity to be able to hybridize with the RNA, forming a stable duplex; in the case of double stranded chemokine antisense nucleic acids, a single strand of the duplex DNA may thus be tested, or triplex formation may be assayed. The ability to hybridize will depend on both the degree of complementarity and the length of the antisense nucleic acid. Generally, the larger the hybridizing nucleic acid, the more base mismatches with a chemokine RNA it may contain and still form a stable duplex (or triplex as the case may be). One skilled in the art can ascertain a tolerable degree of mismatch by use of standard procedures to determine the melting point of the hybridized complex.
Oligonucleotides that are complementary to the 5' end of the message, e.g., the 5 ' untranslated sequence up to and including the AUG initiation codon, should work most efficiently at inhibiting translation. However, sequences complementary to the 3 ' untranslated sequences of mRNAs have been shown to be effective at inhibiting translation of mRNAs as well. See generally, Wagner, R., 1994, Nature 372:333-335. Thus, oligonucleotides complementary to either the 5'- or 3'- non- translated, non-coding regions of CKβ-4 or Ckβ-10 shown in Figure 1 (SEQ ED NO3) or Figure 2 (SEQ ED NO:3) respectively could be used in an antisense approach to inhibit translation of endogenous chemokine mRNA. Oligonucleotides complementary to the 5' untranslated region of the mRNA should include the complement of the AUG start codon. Antisense oligonucleotides complementary to mRNA coding regions are less efficient inhibitors of translation but could be used in accordance with the invention. Whether designed to hybridize to the 5'-, 3'- or coding region of CKβ-4 or Ckβ-10 mRNA, antisense nucleic acids should be at least six nucleotides in length, and are preferably oligonucleotides ranging from 6 to about 50 nucleotides in length. In specific aspects the oligonucleotide is at least 10 nucleotides, at least 17 nucleotides, at least 25 nucleotides or at least 50 nucleotides.
The polynucleotides of the invention can be DNA or RNA or chimeric mixtures or derivatives or modified versions thereof, single-stranded or double-stranded. The oligonucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, hybridization, etc. The oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo), or agents facilitating transport across the cell membrane (see, e.g., Letsinger et al., 1989, Proc. Natl. Acad. Sci. U.S.A. 86:6553-6556; Lemaitre et al., 1987, Proc. Natl. Acad. Sci. 84:648-652; PCT Publication No. WO88/09810, published December 15, 1988) or the blood-brain barrier (see, e.g., PCT Publication No. WO89/10134, published April 25, 1988), hybridization-triggered cleavage agents. (See, e.g., Krol et al., 1988, BioTechniques 6:958-976) or intercalating agents. (See, e.g., Zon, 1988, Pharm. Res. 5:539-549). To this end, the oligonucleotide may be conjugated to another molecule, e.g., a peptide, hybridization triggered cross-linking agent, transport agent, hybridization-triggered cleavage agent, etc. The antisense oligonucleotide may comprise at least one modified base moiety which is selected from the group including, but not limited to, 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xantine, 4-acetylcytosine,
5-(carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine,
5-carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N6-isopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5-methylaminomethyluracil, 5-methoxyaminomethyl-2-thiouracil, beta- D-mannosylqueosine, 5'-methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6- isopentenyladenine, uracil-5-oxyacetic acid (v), wybutoxosine, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4-thiouracil, 5-methyluracil, uracil- 5-oxyacetic acid methylester, uracil-5-oxyacetic acid (v), 5-methyl-2-thiouracil, 3-(3-amino- 3-N-2-carboxypropyl) uracil, (acp3)w, and 2,6-diaminopurine.
The antisense oligonucleotide may also comprise at least one modified sugar moiety selected from the group including, but not limited to, arabinose, 2-fluoroarabinose, xylulose, and hexose.
In yet another embodiment, the antisense oligonucleotide comprises at least one modified phosphate backbone selected from the group including, but not limited to, a phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, and a formacetal or analog thereof.
In yet another embodiment, the antisense oligonucleotide is an a-anomeric oligonucleotide. An a-anomeric oligonucleotide forms specific double-stranded hybrids with complementary RNA in which, contrary to the usual b-units, the strands run parallel to each other (Gautier et al., 1987, Nucl. Acids Res. 15:6625-6641). The oligonucleotide is a 2'-0- methylribonucleotide (Inoue et al., 1987, Nucl. Acids Res. 15:6131-6148), or a chimeric RNA-DNA analogue (Inoue et al., 1987, FEBS Lett. 215:327-330).
Polynucleotides of the invention may be synthesized by standard methods known in the art, e.g. by use of an automated DNA synthesizer (such as are commercially available from Biosearch, Applied Biosystems, etc.). As examples, phosphorothioate oligonucleotides may be synthesized by the method of Stein et al. (1988, Nucl. Acids Res. 16:3209), methylphosphonate oligonucleotides can be prepared by use of controlled pore glass polymer supports (Sarin et al., 1988, Proc. Natl. Acad. Sci. U.S.A. 85:7448-7451), etc.
While antisense nucleotides complementary to a chemokine coding region sequence could be used, those complementary to the transcribed untranslated region are most preferred.
Potential antagonists according to the invention also include catalytic RNA, or a ribozyme (See, e.g., PCT International Publication WO 90/11364, published October 4, 1990; Sarver et al, Science 247: 1222-1225 (1990). While ribozymes that cleave mRNA at site specific recognition sequences can be used to destroy chemokine mRNAs, the use of hammerhead ribozymes is preferred. Hammerhead ribozymes cleave mRNAs at locations dictated by flanking regions that form complementary base pairs with the target mRNA. The sole requirement is that the target mRNA have the following sequence of two bases: 5'-UG- 3'. The constmction and production of hammerhead ribozymes is well known in the art and is described more fully in Haseloff and Gerlach, Nature 334:585-591 (1988). There are numerous potential hammerhead ribozyme cleavage sites within the nucleotide sequence of
CKβ-4 or Ckβ-10 (Figures 1 or Figure 2 respectively). Preferably, the ribozyme is engineered so that the cleavage recognition site is located near the 5' end of the chemokine mRNA; i.e., to increase efficiency and minimize the intracellular accumulation of nonfunctional mRNA transcripts.
As in the antisense approach, the ribozymes of the invention can be composed of modified oligonucleotides (e.g. for improved stability, targeting, etc.) and should be delivered to cells which express a chemokine of the invention in vivo. DNA constmcts encoding the ribozyme may be introduced into the cell in the same manner as described above for the introduction of antisense encoding DNA. A preferred method of delivery involves using a DNA constmct "encoding" the ribozyme under the control of a strong constitutive promoter, such as, for example, pol III or pol II promoter, so that transfected cells will produce sufficient quantities of the ribozyme to destroy endogenous chemokine messages and inhibit translation. Since ribozymes unlike antisense molecules, are catalytic, a lower intracellular concentration is required for efficiency.
Potential antagonists include antibodies, or in some cases, oligonucleotides, which bind to the polypeptides. Another example of a potential antagonist is a negative dominant mutant of the polypeptides. Negative dominant mutants are polypeptides which bind to the receptor of the wild-type polypeptide, but fail to retain biological activity.
An assay to detect negative dominant mutants of the polypeptides include an in vitro chemotaxis assay wherein a multiwell chemotaxis chamber equipped with polyvinylpyrrolidone-free polycarbonate membranes is used to measure the chemoattractant ability of the polypeptides for leukocytes in the presence and absence of potential antagonist/inhibitor or agonist molecules. Another potential antagonist is a peptide derivative of the polypeptides which are naturally or synthetically modified analogs of the polypeptides that have lost biological function yet still recognize and bind to the receptors of the polypeptides to thereby effectively block the receptors. Examples of peptide derivatives include, but are not limited to, small peptides or peptide-like molecules. Antagonist/agonist compounds may be employed to inhibit the cell growth and proliferation effects of the polypeptides of the present invention on neoplastic cells and tissues, i.e. stimulation of angiogenesis of tumors, and, therefore, retard or prevent abnormal cellular growth and proliferation, for example, in tumor formation or growth.
The antagonist agonist may also be employed to prevent hyper-vascular diseases, and prevent the proliferation of epithelial lens cells after extracapsular cataract surgery. Prevention of the mitogenic activity of the polypeptides of the present invention may also be desirous in cases such as restenosis after balloon angioplasty.
The antagonist/agonist may also be employed to prevent the growth of scar tissue during wound healing. The antagonist/agonist may also be employed to treat the diseases described herein.
Thus, the invention provides a method of treating or preventing diseases, disorders, and/or conditions, including but not limited to the diseases, disorders, and/or conditions listed throughout this application, associated with overexpression of a polynucleotide of the present invention by administering to a patient (a) an antisense molecule directed to the polynucleotide of the present invention, and/or (b) a ribozyme directed to the polynucleotide of the present invention.
The antagonists may be employed to inhibit the chemotaxis and activation of macrophages and their precursors, and of neutrophils, basophils, B lymphocytes and some T cell subsets, e.g., activated and CD8+ cytotoxic T cells and natural killer cells, in auto- immune and chronic inflammatory and infective diseases. Examples of auto-immune diseases include rheumatoid arthritis, multiple sclerosis, and insulin-dependent diabetes. Some infectious diseases include silicosis, sarcoidosis, idiopafhic pulmonary fibrosis by preventing the recmitment and activation of mononuclear phagocytes, idiopathic hyper- eosinophilic syndrome by preventing eosinophil production and migration, endotoxic shock by preventing the migration of macrophages and their production of the chemokine polypeptides of the present invention. The antagonists may also be used for treating atherosclerosis, by preventing monocyte infiltration in the artery wall.
The antagonists may also be used to treat histamine-mediated allergic reactions by inhibiting chemokine-induced mast cell and basophil degranulation and release of histamine.
The antagonists may also be used to treat inflammation by preventing the attraction of monocytes to a wound area. They may also be used to regulate normal pulmonary macrophage populations, since acute and chronic inflammatory pulmonary diseases are associated with sequestration of mononuclear phagocytes in the lung.
Antagonists may also be used to treat rheumatoid arthritis by preventing the attraction of monocytes into synovial fluid in the joints of patients. Monocyte influx and activation plays a significant role in the pathogenesis of both degenerative and inflammatory arthropathies. The antagonists may be used to interfere with the deleterious cascades attributed primarily to LL-1 and TNF, which prevents the biosynthesis of other inflammatory cytokines. In this way, the antagonists may be used to prevent inflammation. The antagonists may also be used to inhibit prostaglandin-independent fever induced by chemokines. The antagonists may also be used to treat cases of bone marrow failure, for example, aplastic anemia and myelodysplastic syndrome.
The antagonists may also be used to treat asthma and allergy by preventing eosinophil accumulation in the lung. The antagonists may be employed in a composition with a pharmaceutically acceptable carrier, e.g., as hereinafter described. The chemokine polypeptides and agonists or antagonists of the present invention may be employed in combination with a suitable pharmaceutical carrier. Such compositions comprise a therapeutically effective amount of the polypeptide, and a pharmaceutically acceptable carrier or excipient. Such a carrier includes but is not limited to saline, buffered saline, dextrose, water, glycerol, ethanol, and combinations thereof. The formulation should suit the mode of administration.
The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the polypeptides of the present invention may be employed in conjunction with other therapeutic compounds.
The pharmaceutical compositions may be administered in a convenient manner such as by the topical, intravenous, intraperitoneal, intramuscular, intratumor, subcutaneous, intranasal or intradermal routes. The polypeptides are administered in an amount which is effective for treating and/or prophylaxis of the specific indication. In general, the polypeptides will be administered in an amount of at least about 10 μg g/kg body weight and in most cases they will be administered in an amount not in excess of about 8 mg/Kg body weight per day. In most cases, the dosage is from about 10 μg/kg to about 1 mg/kg body weight daily, taking into account the routes of administration, symptoms, etc.
The chemokine polypeptides and agonists or antagonists may be employed in accordance with the present invention by expression of such polypeptides in vivo, which is often referred to as "gene therapy."
Thus, for example, cells from a patient may be engineered with a polynucleotide
(DNA or RNA) encoding a polypeptide ex vivo, with the engineered cells then being provided to a patient to be treated with the polypeptide. Such methods are well-known in the art. For example, cells may be engineered by procedures known in the art by use of a retroviral particle containing RNA encoding a polypeptide of the present invention.
Similarly, cells may be engineered in vivo for expression of a polypeptide in vivo by, for example, procedures known in the art. As known in the art, a producer cell for producing a retroviral particle containing RNA encoding the polypeptide of the present invention may be administered to a patient for engineering cells in vivo and expression of the polypeptide in vivo. These and other methods for administering a polypeptide of the present invention by such method should be apparent to those skilled in the art from the teachings of the present invention. For example, the expression vehicle for engineering cells may be other than a retrovims, for example, an adenovims which may be used to engineer cells in vivo after combination with a suitable delivery vehicle.
Other Activities
A polypeptide, polynucleotide, agonist, or antagonist of the present invention, as a result of the ability to stimulate vascular endothelial cell growth, may be employed in treatment for stimulating re-vascularization of ischemic tissues due to various disease conditions such as thrombosis, arteriosclerosis, and other cardiovascular conditions. The polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to stimulate angiogenesis and limb regeneration, as discussed above.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for treating, preventing, and/or diagnosing wounds due to injuries, burns, post-operative tissue repair, and ulcers since they are mitogenic to various cells of different origins, such as fibroblast cells and skeletal muscle cells, and therefore, facilitate the repair or replacement of damaged or diseased tissue.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed stimulate neuronal growth and to treat and prevent neuronal damage which occurs in certain neuronal diseases, disorders, and/or conditions or neuro-degenerative conditions such as Alzheimer's disease, Parkinson's disease, and AEDS-related complex. A polypeptide, polynucleotide, agonist, or antagonist of the present invention may have the ability to stimulate chondrocyte growth, therefore, they may be employed to enhance bone and periodontal regeneration and aid in tissue transplants or bone grafts.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may be also be employed to prevent skin aging due to sunburn by stimulating keratinocyte growth. A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for preventing hair loss, since FGF family members activate hair-forming cells and promotes melanocyte growth. Along the same lines, a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be employed to stimulate growth and differentiation of hematopoietic cells and bone marrow cells when used in combination with other cytokines.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed to maintain organs before transplantation or for supporting cell culture of primary tissues. A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be employed for inducing tissue of mesodermal origin to differentiate in early embryos.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may
also increase or decrease the differentiation or proliferation of embryonic stem cells, besides, as discussed above, hematopoietic lineage.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be used to modulate mammalian characteristics, such as body height, weight, hair color, eye color, skin, percentage of adipose tissue, pigmentation, size, and shape (e.g., cosmetic surgery). Similarly, a polypeptide, polynucleotide, agonist, or antagonist of the present invention may be used to modulate mammalian metabolism affecting catabolism, anabolism, processing, utilization, and storage of energy.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may be used to change a mammal's mental state or physical state by influencing biorhythms, caricadic rhythms, depression (including depressive diseases, disorders, and/or conditions), tendency for violence, tolerance for pain, reproductive capabilities (preferably by Activin or
Inhibin-like activity), hormonal or endocrine levels, appetite, libido, memory, stress, or other cognitive qualities.
A polypeptide, polynucleotide, agonist, or antagonist of the present invention may also be used as a food additive or preservative, such as to increase or decrease storage capabilities, fat content, lipid, protein, carbohydrate, vitamins, minerals, cofactors or other nutritional components.
The above-recited applications have uses in a wide variety of hosts. Such hosts include, but are not limited to, human, murine, rabbit, goat, guinea pig, camel, horse, mouse, rat, hamster, pig, micro-pig, chicken, goat, cow, sheep, dog, cat, non-human primate, and human. In specific embodiments, the host is a mouse, rabbit, goat, guinea pig, chicken, rat, hamster, pig, sheep, dog or cat. In preferred embodiments, the host is a mammal. In most preferred embodiments, the host is a human. The present invention will be further described with reference to the following examples; however, it is to be understood that the present invention is not limited to such examples. All parts or amounts, unless otherwise specified, are by weight.
In order to faciEitate understanding of the following examples certain frequently occurring methods and/or terms will be described. "Plasmids" are designated by a lower case p preceded and/or followed by capital letters and/or numbers. The starting plasmids herein are either commercially available, publicly available on an unrestricted basis, or can be constmcted from available plasmids in accord with published procedures. In addition, equivalent plasmids to those described are known in the art and will be apparent to the ordinarily skilled artisan. "Digestion" of DNA refers to catalytic cleavage of the DNA with a restriction enzyme that acts only at certain sequences in the DNA. The various restriction enzymes used herein are commercially available and their reaction conditions, cofactors and other requirements were used as would be known to the ordinarily skilled artisan. For analytical purposes, typically 1 μg of plasmid or DNA fragment is used with about 2 units of enzyme in about 20 μl of buffer solution. For the puφose of isolating DNA fragments for plasmid constmction, typically 5 to 50 μg of DNA are digested with 20 to 250 units of enzyme in a larger volume. Appropriate buffers and substrate amounts for particular restriction enzymes are specified by the manufacturer. Incubation times of about 1 hour at 37°C are ordinarily used, but may vary in accordance with the supplier's instmctions. After digestion the reaction is electrophoresed directly on a polyacrylamide gel to isolate the desired fragment.
Size separation of the cleaved fragments is performed using 8 percent polyacrylamide gel described by Goeddel, D. et al, Nucleic Acids Res., 8:4057 (1980).
"Oligonucleotides" refers to either a single stranded polydeoxynucleotide or two complementary polydeoxynucleotide strands which may be chemically synthesized. Such synthetic oligonucleotides have no 5' phosphate and thus will not ligate to another oligonucleotide without adding a phosphate with an ATP in the presence of a kinase. A synthetic oligonucleotide will ligate to a fragment that has not been dephosphorylated.
"Ligation" refers to the process of forming phosphodiester bonds between two double stranded nucleic acid fragments (Maniatis, T., et al., Id., p. 146). Unless otherwise provided, ligation may be accomplished using known buffers and conditions with 10 units to
T4 DNA ligase ("ligase") per 0.5 μg of approximately equimolar amounts of the DNA fragments to be ligated.
Unless otherwise stated, transformation was performed as described in the method of Graham, F. and Van der Eb, A., Virology, 52:456-457 (1973).
EXAMPLE 1 ; Bacterial Expression and Purification of Ckβ-4
The DNA sequence encoding for Ckβ-4, ATCC # 75848, is initially amplified using
PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the processed Ckβ-4 protein (minus the putative signal peptide sequence). Additional nucleotides corresponding to Ckβ-4 were added to the 5' and 3' sequences respectively. The 5 ' oligonucleotide primer has the sequence (SEQ ED No. 5) 5 ' CCCGCATGCAAGCAGCAAGCAACTTT 3' contains a Sphl restriction enzyme site
(bold) followed by 17 nucleotides of Ckβ-4 coding sequence (underlined) starting from the
second nucleotide of the sequences coding for the mature protein. The ATG codon is included in the Sphl site. In the next codon following the ATG, the first base is from the Sphl site and the remaining two bases correspond to the second and third base of the first codon of the putative mature protein. As a consequence, in its constmct the amino acids MQA are added at the amino terminus of the mature protein sequence. The 3' sequence, (SEQ LD NO. 6) 5' AAAGGATCCCATGTTCTTGACTTTTTTACT 3' contains complementary sequences to a BamHI site (bold) and is followed by 21 nucleotides of gene specific sequences preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-70 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-70 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-70 was then digested with Sphl and BamHI. The amplified sequences were ligated into pQE-70 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform the E. coli strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constmcts were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1:100 to 1:250. The cells were grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine
HCl. After clarification, solubilized Ckβ-4 was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184
(1984)). Ckβ-4 ( >98% pure) was eluted from the column in 6 molar guanidine HCl pH 5.0. Protein renaturation out of GnHCl can be accomplished by several protocols (Jaenicke, R. and Rudolph, R., Protein Stmcture - A Practical Approach, IRL Press, New York (1990)). Initially, step dialysis is utilized to remove the GnHCL. Alternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is mn. The protein is allowed to renature while bound to
the column and is subsequently eluted with a buffer containing 250 mM Imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10% Glycerol. Finally, soluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate.
EXAMPLE 2: Bacterial Expression and Purification of MCP-4
The cDNA sequence coding for MCP-4 (also referred to as Ckβ-10), which is present in the human cDNA in the deposit in ATCC No. 75849, is initially amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the processed MCP-4 protein (minus the signal peptide sequence) and the vector sequences 3' to the MCP- 4 gene. Additional nucleotides corresponding to MCP-4 were added to the 5' and 3 ' sequences respectively. The 5' oligonucleotide primer has the sequence (SEQ ED NO. 7) 5 ' CCCGCATGCAGCCAGATGCACTCAACG 3' contains a Sphl restriction enzyme site (bold) followed by 19 nucleotides of MCP-4 coding sequence (underlined) starting from the sequences coding for the mature protein. The ATG codon is included in the Sphl site. The 3' sequence, (SEQ ID NO. 8) 5' AAAGGATCCAGTCTTCAGGGTGTGAGCT 3' contains complementary sequences to a BamHI site (bold) and is followed by 19 nucleotides of gene specific sequences preceding the termination codon. The restriction enzyme sites correspond to the restriction enzyme sites on the bacterial expression vector pQE-70 (Qiagen, Inc. 9259 Eton Avenue, Chatsworth, CA, 91311). pQE-70 encodes antibiotic resistance (Ampr), a bacterial origin of replication (ori), an IPTG-regulatable promoter operator (P/O), a ribosome binding site (RBS), a 6-His tag and restriction enzyme sites. pQE-70 was then digested with Sphl and BamHI. The amplified sequences were ligated into pQE-70 and were inserted in frame with the sequence encoding for the histidine tag and the RBS. The ligation mixture was then used to transform the E. coli strain available from Qiagen under the trademark M15/rep 4 by the procedure described in Sambrook, J. et al., Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989). M15/rep4 contains multiple copies of the plasmid pREP4, which expresses the lad repressor and also confers kanamycin resistance (Kanr). Transformants are identified by their ability to grow on LB plates and ampicillin/kanamycin resistant colonies were selected. Plasmid DNA was isolated and confirmed by restriction analysis. Clones containing the desired constmcts were grown overnight (O/N) in liquid culture in LB media supplemented with both Amp (100 ug/ml) and Kan (25 ug/ml). The O/N culture is used to inoculate a large culture at a ratio of 1: 100 to 1:250. The cells were grown to an optical density 600 (O.D.600) of between 0.4 and 0.6. IPTG ("Isopropyl-B-D-thiogalacto pyranoside") was then added to a final concentration of 1 mM. IPTG induces by inactivating the lad repressor, clearing the P/O leading to increased gene expression. Cells were grown an extra 3 to 4 hours. Cells were then harvested by centrifugation. The cell pellet was solubilized in the chaotropic agent 6 Molar Guanidine
HCl. After clarification, solubilized MCP-4 (also referred to as Ckβ-10) was purified from this solution by chromatography on a Nickel-Chelate column under conditions that allow for tight binding by proteins containing the 6-His tag (Hochuli, E. et al., J. Chromatography 411:177-184 (1984)). MCP-4 ( >98% pure) was eluted from the column in 6 molar guanidine HCl pH 5.0. Protein renaturation out of GnHCl can be accomplished by several protocols (Jaenicke, R. and Rudolph, R., Protein Structure - A Practical Approach, IRL Press, New York (1990)). Initially, step dialysis is utilized to remove the GnHCL. Alternatively, the purified protein isolated from the Ni-chelate column can be bound to a second column over which a decreasing linear GnHCL gradient is run. The protein is allowed to renature while bound to the column and is subsequently eluted with a buffer containing 250 mM imidazole, 150 mM NaCl, 25 mM Tris-HCl pH 7.5 and 10% Glycerol. Finally, soluble protein is dialyzed against a storage buffer containing 5 mM Ammonium Bicarbonate. The protein was then analyzed on an SDS-PAGE gel
EXAMPLE 3: Expression of Recombinant Ckβ-4 in COS cells
The expression of plasmid, Ckβ-4 HA is derived from a vector pcDNAJ/Amp
(Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire Ckβ-4 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMN promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Νiman, R. Heighten, A Cherenson, M. Connolly, and R. Lemer, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope. The plasmid constmction strategy is described as follows:
The DΝA sequence encoding for Ckβ-4, ATCC Deposit No. 75848, was constmcted by PCR on the original EST cloned using two primers: the 5' primer (SEQ ED NO. 9) 5' GGAAAGCTTATGTGCTGTACCAAGAGTTT 3" contains a Hindlll site followed by 20 nucleotides of Ckβ-4 coding sequence starting from the initiation codon; the
3' sequence (SEQ ID NO.10) 5 '
TCTAGATTAAGCGTAGTCTGGGACGTCGTATGGGTAACATGGTTCCTTGACTTTT T 3' contains complementary sequences to Xbal site, translation stop codon, HA tag and the last 20 nucleotides of the Ckβ-4 coding sequence (not including the stop codon). Therefore, the PCR product contains a Hindlll site, Ckβ-4 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNAI/Amp, were digested with Hindlll and Xbal restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant Ckβ-4, COS cells were transfected with the expression vector by DEAE- DEXTRAN method. (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A
Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the Ckβ-4
HA protein was detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 35S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 03% SDS, 50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). both cell lysate and culture media were precipitated with a HA specific monoclonal antibody. Proteins precipitated were analyzed by SDS-PAGE.
EXAMPLE 4: Expression of Recombinant MCP-4 in COS cells The expression of plasmid, MCP-4-HA (also referred to as Ckβ-10 HA) is derived from a vector pcDNAI/Amp (Invitrogen) containing: 1) SV40 origin of replication, 2) ampicillin resistance gene, 3) E.coli replication origin, 4) CMV promoter followed by a polylinker region, a SV40 intron and polyadenylation site. A DNA fragment encoding the entire MCP-4 precursor and a HA tag fused in frame to its 3' end was cloned into the polylinker region of the vector, therefore, the recombinant protein expression is directed under the CMV promoter. The HA tag correspond to an epitope derived from the influenza hemagglutinin protein as previously described (I. Wilson, H. Niman, R. Heighten, A Cherenson, M. Connolly, and R. Lerner, 1984, Cell 37, 767). The infusion of HA tag to the target protein allows easy detection of the recombinant protein with an antibody that recognizes the HA epitope.
The plasmid constmction strategy is described as follows:
The cDNA sequence encoding for MCP-4 (also referred to as Ckβ-10), which is present in the cDNA insert in the DNA in ATCC. Deposit No. 75849, was constmcted by PCR on the original EST cloned using two primers: the 5' primer (SEQ ED NO. 11) 5 ' GGAAAGCTTATGAAAGTTTCTGCAGTGC 3' contains a Hindlll site followed by 19 nucleotides of MCP-4 coding sequence starting from the initiation codon; the 3' sequence (SEQ ID NO. 12):
5'-CGCTCTAGAT CAAGCGTAGT CTGGGACGTC GTATGGGTAA GTCTTCAGGG TGTGAGCT-3' contains complementary sequences to Xbal site, translation stop codon, HA tag and the last 19 nucleotides of the MCP-4 coding sequence (not including the stop codon). Therefore, the PCR product contains a Hindlll site, MCP-4 coding sequence followed by HA tag fused in frame, a translation termination stop codon next to the HA tag, and an Xbal site. The PCR amplified DNA fragment and the vector, pcDNAI Amp, were digested with Hindlll and BamHI restriction enzyme and ligated. The ligation mixture was transformed into E. coli strain SURE (available from Stratagene Cloning Systems, 11099 North Torrey Pines Road, La Jolla, CA 92037) the transformed culture was plated on ampicillin media plates and resistant colonies were selected. Plasmid DNA was isolated from transformants and examined by restriction analysis for the presence of the correct fragment. For expression of the recombinant MCP-4 (also known as Ckβ-10), COS cells were transfected with the expression vector by DEAE-DEXTRAN method. (J. Sambrook, E. Fritsch, T. Maniatis, Molecular Cloning: A Laboratory Manual, Cold Spring Laboratory Press, (1989)). The expression of the MCP-4-HA protein was detected by radiolabelling and immunoprecipitation method. (E. Harlow, D. Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, (1988)). Cells were labelled for 8 hours with 35S-cysteine two days post transfection. Culture media were then collected and cells were lysed with detergent (RIPA buffer (150 mM NaCl, 1% NP-40, 0.1% SDS, 0.5% DOC, 50mM Tris, pH 7.5). (Wilson, I. et al., Id. 37:767 (1984)). Both cell lysate and culture media were precipitated with a HA specific monoclonal antibody. Proteins precipitated were analyzed by SDS-PAGE.
EXAMPLE 5 : Further cloning and expression of MCP-4 using the baculovirus expression system
The cDNA sequence encoding the full length MCP-4 protein (also known as Ckβ-10 protein), in the DNA in ATCC Deposit No. 75849, was amplified using PCR oligonucleotide primers corresponding to the 5' and 3' sequences of the gene, as follows. The 5' primer has the sequence (SEQ ID NO. 13):
5'-CGCGGGATCC TTAACCTTCA ACATGAAA-3' and contains a BamHI restriction enzyme site (in bold) followed by 12 nucleotides resembling an efficient signal for the initiation of translation in eukaryotic cells (J. Mol. Biol. 1987, 196, 947-950, Kozak, M.), and then is the first 6 nucleotides of the MCP-4 coding sequence (the initiation codon for translation "ATG" is underlined).
The 3' primer has the sequence (SEQ ID NO. 14): 5'-CGCGGGTACC TTAACACATA GTACATTTT-3' and contains the cleavage site for the restriction endonuclease Asp781 and 19 nucleotides complementary to the 3' non- translated sequence of the MCP-4 gene. The amplified sequences were isolated from a 1% agarose gel using a commercially available kit ("Geneclean," BIO 101 Inc., La Jolla, Ca.). The fragment was then digested with the endonucleases BamHI and Asp781 and then purified again on a 1% agarose gel. This fragment is designated F2.
The vector pA2 (modification of pVL941 vector, discussed below) is used for the expression of the MCP-4 protein using the baculovims expression system (for review see: Summers, M.D. and Smith, G.E. 1987, A manual of methods for baculovims vectors and insect cell culture procedures, Texas Agricultural Experimental Station Bulletin No. 1555). This expression vector contains the strong polyhedrin promoter of the Autographa californica nuclear polyhedrosis vims (AcMNPV) followed by the recognition sites for the restriction endonucleases BamHI and Asp781. The polyadenylation site of the simian vims (SV)40 is used for efficient polyadenylation. For an easy selection of recombinant vimses the beta- galactosidase gene from E.coli is inserted in the same orientation as the polyhedrin promoter followed by the polyadenylation signal of the polyhedrin gene. The polyhedrin sequences are flanked at both sides by viral sequences for the cell-mediated homologous recombination of cotransfected wild-type viral DNA. Many other baculovims vectors could be used in place of pRGl such as pAc373, pVL941 and pAcIMl (Luckow, V.A. and Summers, M.D., Virology, 170:31-39).
The plasmid was digested with the restriction enzymes BamHI and Asp781 and then dephosphorylated using calf intestinal phosphatase by procedures known in the art. The DNA was then isolated from a 1 % agarose gel. This vector DNA is designated V2.
Fragment F2 and the dephosphorylated plasmid V2 were ligated with T4 DNA ligase. E.coli HB101 cells were then transformed and bacteria identified that contained the plasmid pBacMCP-4 (also known as pBacCkβ-10) with the MCP-4 gene using the enzymes
BamHI and Asp781. The sequence of the cloned fragment was confirmed by DNA sequencing.
5g of the plasmid pBacMCP-4 were cotransfected with 1.0 μg of a commercially available linearized baculovims ("BaculoGold™ baculovims DNA", Pharmingen, San Diego, CA.) using the lipofection method (Feigner et al. Proc. Natl. Acad. Sci. USA, 84:7413-7417 (1987)). lug of BaculoGold™ vims DNA and 5 ug of the plasmid pBacMCP-4 were mixed in a sterile well of a microtiter plate containing 50 ul of semm free Grace's medium (Life Technologies Inc., Gaithersburg, MD). Afterwards 10 ul Lipofectin plus 90 ul Grace's medium were added, mixed and incubated for 15 minutes at room temperature. Then the transfection mixture was added dropwise to the Sf9 insect cells (ATCC CRL 1711) seeded in a 35 mm tissue culture plate with 1ml Grace' medium without semm. The plate was rocked back and forth to mix the newly added solution. The plate was then incubated for 5 hours at 27°C. After 5 hours the transfection solution was removed from the plate and 1 ml of Grace's insect medium supplemented with 10% fetal calf semm was added. The plate was put back into an incubator and cultivation continued at 27°C for four days.
After four days the supernatant was collected and a plaque assay performed similar as described by Summers and Smith (supra). As a modification an agarose gel with "Blue Gal" (Life Technologies Inc., Gaithersburg) was used which allows an easy isolation of blue stained plaques. (A detailed description of a "plaque assay" can also be found in the user's guide for insect cell culture and baculovirology distributed by Life Technologies Inc., Gaithersburg, page 9-10).
Four days after the serial dilution of the vimses was added to the cells, blue stained plaques were picked with the tip of an Eppendorf pipette. The agar containing the recombinant viruses was then resuspended in an Eppendorf tube containing 200 ul of Grace's medium. The agar was removed by a brief centrifugation and the supernatant containing the recombinant baculovimses was used to infect Sf9 cells seeded in 35 mm dishes. Four days later the supernatants of these culture dishes were harvested and then stored at 4°C. Sf9 cells were grown in Grace's medium supplemented with 10% heat-inactivated
FBS. The cells were infected with the recombinant baculovims V-MCP-4 (also referred to as V-Ckβ-10) at a multiplicity of infection (MOI) of 2. Six hours later the medium was removed and replaced with SF900 II medium minus methionine and cysteine (Life Technologies Inc., Gaithersburg). 42 hours later 5 uCi of 5S -methionine and 5 uCi 35S cysteine (Amersham) were added. The cells were further incubated for 16 hours before they were harvested by centrifugation and the labelled proteins visualized by SDS-PAGE and autoradiography.
EXAMPLES 6 THROUGH 12
Expression of MCP-4 (also referred to as Ckβ-10) using a baculovims expression system and a drosophila cell expression system and characterization of the expressed MCP-4
The following examples 6 - 12 were carried out as described above, with the modifications and additional techniques described generally immediately below, as well as in the specific examples themselves. (As noted elsewhere herein MCP-4 also is referred to and known as Ckβ-10)
Cloning and expression
The full-length cDNA encoding MCP-4 was cloned into a baculovims expression vector (PharMingen), SF9 cells were infected with the recombinant baculovims according to the manufacturer's instmctions, and the cell supernatant was collected by low-speed centrifugation. The supernatant was treated with a cocktail of protease inhibitors (20 ug/ml pefabloc SC, 1 ug/ml leupeptin, 1 ug/ml E64 and 1 mM EDTA), and the recombinant protein was purified by heparin affinity, cation exchange, and size exclusion chromatography. The protein of over 95% purity was analyzed by electron spray mass spectrometry and sequenced.
Chemokines
The chemokines used for comparison, MCP-1, MCP-2, MCP-3, RANTES, MlP-lα and eotaxin, were chemically synthesized according to established protocols Clark-Lewis et al, Biochemistry 30:3128-3135 (1991).
Cells
Monocytes (Uguccioni et al., Eur. J. Immunol. 25: 64-68 (1995)), and neutrophils (Peveri et al., J. Exp. Med. 167:1547-1559 (1988)), were isolated at more than 90 percent purity from donor blood buffy coats supplied by the Central Laboratory of the Swiss Red Cross. The same source was used for the isolation of blood lymphocytes (Loetscher et al., FASEB J. 83055-1060 (1994). Human CD4+ and CD8+ T cell clones were maintained in culture and used according to Loetscher et al, FASEB J. 8: 1055-1060 (1994). Fresh blood of healthy individuals was used to purify eosinophils by dextran sedimentation followed by Percoll density-gradient centrifucation and negative selection with anti-CD 16 mAB -coated magnetic beads (Rot et al, Exp. Med. 179:8960-8964 (1995)).
EXAMPLE 6 : Expression of MCP-4 (also referred to as Ckβ-10) in a baculovirus expression system
Construction of a baculovirus transfer vector containing the coding sequence of MCP4
The expression vector for this example was made much as described above. The plasmid vector pA2 was used to express MCP-4. This plasmid is a derivative of pNR704, described by Gentz et al.. Eur. J. Biochem 210 :545-554 (1992). The E coli β-galactosidase gene has been introduced into the vector as well to facilitate selection of recombinants.
The following PCR oligonucleotides were used to isolate and amplify the coding sequence of MCP-4. forward primer (SEQ ID NO. 15): 5' GCGGGATCCTTAACCTTCAACATGAAA reverse primer (SEQ ID NO. 16): 5' CGCGGGTACCTTAACACATAGTACATTTT
After amplification the fragment was digested with the restriction enzymes BamHI and Asp718 and then inserted into the expression vector, which contains these restriction sites downstream of the polyhedron promoter. Proper insertion and orientation of vector and insert was confirmed by restriction analysis and DNA sequencing.
Isolation of recombinant baculovirus
5ug of the expression vector containing the MCP-4 cDNA and 1 ug of linearized baculovims DNA ("BaculoGOLD TM, Pharmingen, San Diego, CA) were contransfected into Sf9 cells using the lipofectin method. After 3-4 days supernatants were collected. A series of limited dilutions was then performed and single, blue stained plaques were isolated.
The insect cell line Sf9 used in this example is well known and readily available. It may be obtained, for example, from the American type culture collection: ATCC CRL 1711, among other places.
Purification of MCP-4
Sf9 cells were grown at 27°C en EX-CELL 400 medium containing 2% FBS.
Before infection the cells were collected by low-speed centrifugation and the medium was replaced by EX-CELL 400 medium without semm. After 6 hours the cells were infected at an MOI=2. About 72 hours after infection the cells were removed by low-speed centrifugation. The supernatant was treated with a cocktail of protease inhibitors (20 ugml pefabloc SC, 1 ug/ml leupeptin, 1 ug/ml E-64 and 1 mM EDTA). The supernatant was passed through a strong cation exchange column I poros 50 HS, (Perseptive Biosystem) for initial capturing. The recombinant MCP-4 protein was eluted with 1 M NaCl in 25 mM sodium acetate, pH 6 and then further purified by heparin affinity chromatography (poros 20 HEIl, Perseptive Biosystem). The resultant MCP-4 protein was polished by size exclusion chromatography (Sephacryl S200 HR, Pharmacia). The purified MCP-4 obtained following size exclusion was about 95% or more pure. This material was further analyzed by mass spectroscopy and by microsequencing.
The purified material was analysed by standard mass spectral analysis. The purified MCP-4 also was analysed by microsequencing, using well known and routine techniques. For this puφose, the purified material was applied to SDS polyacrylamide gel electrophoresis (Novex 4-20% gels) and transblotted onto a ProBlott membrane (Applied Biosystems, Inc. (ABI). After staining with Ponceau S (o.2% in 4% acetic acid) the protein band was excised, placed in a "Blot Cartridge" and then subjected to N-terminal amino acid sequence analysis using a model ABI-494 sequencer (Perking-Elmer- Applied Biosystems, Inc.) with the Gas-phase Blot cycler.
Analytical results
Expression of MCP-4 from cloned genes using a baculovims expression system yielded several forms of MCP-4. MCP-4 made by expressing cDNA of Figure 1 in a baculovims expression system, isolated and characterized by electrophoresis on SDS PAGE containing 18% urea (Padrines et al., FEBS Lett. 352:231-235 (1994), as described above, gave rise to a single, somewhat broad band with an apparent Mr around 8,000 dalton. There was no indication of contaminant proteins. Mass spectrometry of the purified preparation yielded two main components with masses of 8,576 and 8,754 daltons, respectively.
Microsequencing revealed that three mature forms of MCP-4, which differ in length by a few residues at the NH2 terminus.
The sequences of these MCP-4 polypeptides are shown in Figure 5, along with the amino acid sequence encoded in the full length cDNA, which is also shown aligned with the sequences of MCP-3 and eotaxin. The major form of MCP-4 shares 60% amino acid identity with these proteins, and has 29, 39 and 41% identity with RANTES, MlP-lα and
MlP-lβ.
A mixture of the two closely related variants was used for the activity assays described herein below.
EXAMPLE 7: MCP-4 stimulates chemotaxis of a variety of blood cells Chemotaxis was assessed in 48-well chambers (Neuro Probe, Cabin John, MD, USA) using polyvinylprrolidone-free polycarbonate membranes (Nucleopore) with 5um pores for monocytes and eosinophils, and 3-um pores for lymphocytes, RPMI 1640 supplemented with 20 mM hepes, pH 7.4, and 1% pasteurized plasma protein solution (5% PPL SRK; Swiss Red Cross Laboratory, Bern, Switzerland) was used to dissolve the chemokines, which were placed in the lower well, and to suspend the cells (50,000 monocytes or eosinophils and 100,000 lymphocytes per upper well). After 60 min at 37°C, the membrane was removed, washed on the upper side with PBS, fixed and stained. All assays were done in triplicate, and the migrated cells were counted in five randomly selected fields at 1, 000-fold magnification. Spontaneous migration was determined in the absence of chemoaltractant.
MCP-4 induced the migration of monocytes, eosinophils and lymphocytes with a typical bimodai concentration dependence (as shown in Figures 6, 7 and 8).
The activity on monocytes was comparable to that of MCP-3, both in terms of efficacy and potency, as indicated by the numbers of migrating cells and the concentration (100 nM) at which maximum effects were observed, as illustrated in Graph (B) in Figure 6. In agreement with a former study (Uguccioni et al, Eur. J. Immunol. 25:64-68 (1995) MCP-1 was somewhat more efficacious and considerably more potent on these cells, reaching maximum effect at 1 nM. MCP-4 also induced strong migration of CD4+ and CD8+ T lymphocytes, as illustrated in Figure 7. Its efficacy was similar to that of MCP-1, but 10 to 100 nM MCP-4 were required for the maximum effects as compared to 1 nM MCP-1. Some migration of both types of T cells was also observed with eotaxin at concentrations between 10 nM and 1 uM. Freshly prepared blood lymphocytes did not migrate in response to any of the chemokines that were effective on cloned cells.
On eosinophils, as illustrated in Figure 8, MCP-4 elicited migration similar to eotaxin, with a maximum at 10 to 30 nM. MCP-3 had comparable efficacy, but its maximum effective concentration was 100 nM. Eotaxin and MCP-3 both potent attractants for these cells. MCP-1 is not a chemoattractant for eosinophils and served as negative control.
EXAMPLE 8: MCP-4 (also referred to as Ckβ-10) stimulates cells to release of N-acetyl-β-D-glucosaminidase
Uguccioni et al., Eur. J. Immunol. 25:64-68 (1995) showed that measuring the release of N-acetyl-β-D-glucosaminidase in response to chemostimulation is a particularly reliable and convenient way to determine quantitatively the response of monocytes. Monocyte responsiveness to chemokines was determined exactly as described therein.
In brief, samples of 1.2xl06 monocytes in 0.3 ml prewarmed medium (136 mM NaCl, 4.8 mM KCl, 1.2 mM KH2PO4, 1 mM CaCl2, 20 mM Hepes, pH 7.4, 5 mM D- glucose and 1 mg/ml fatty acid-free BSA) were pretreated for 2 min with cytochalasin B (2.7 ug/ml) and stimulated with a chemokine. The reaction was stopped after 3 min by cooling on ice and centrifugation (6,000, 3 min), and enzyme activity was determined in the supernatant.
As shown in Figure 6, Graph (A), cells exposed to MCP-4 were stimulated to release abundant amounts of lysosomal enzymes such as N-acetyl-β-D-glucosaminidase. In this regard, MCP-4 was as potent as MCP-2 and similar to the effects of other monocyte chemotactic proteins. In contrast, RANTES stimulated considerably less enzyme release and there was no stimulation of release by eotaxin.
Similarly, elastase release by neutrophils was measured to determine responsiveness to chemokines, in accordance with the methods described in Peveri et al., J. Exp. Med. 167:1547-1559 (1988). MCP-4 did not stimulate elastase release by neutoφhils in these experiments.
EXAMPLE 9: MCP-4 (also referred to as Ckβ-10) modulates cytostolic free
Ca2+ Changes in the cytosolic free Ca2+ concentration ([Ca2+]) were measured in monocytes, eosinophils and lymphocytes, using standard techniques, essentially as described by von Tscharner et al, Nature 324:369-372 (1986).
Cells were loaded with fura-2 by incubation for 30 min at 37° with 0.2 nmol fura-2 acetoxymethylester per 106 cells in a buffer containing 136 mM Nacl, 4.8 mM KCl, 1 mM CaCl2, 5 mM glucose, and 20 mM HEPES, pH 7.4. After centrifugation, the fura-loaded cells were resuspended in the same buffer (106 cells/ml) and stimulated with chemokine at
37°C. [CaCl2]-related fluorescence changes then were recorded.
A rapid and transient rise in [Ca2+] was observed after MCP-4 stimulation of monocytes, lymphocytes and eosinophils. The rate and magnitude of the rise increased with the MCP-4 concentration. Maximum rises in [Ca2+] were obtained at concentrations between 10 to 100 nM. MCP-4 and MCP-1 exhibited similar concentration-dependent
[Ca2+] transient induction on both CD4+ and CD8+ T lymphocytes. MlP-lα and eotaxin induced much smaller, but significant, [Ca2+] changes in both types of cells. The lower potency of these cytokines in this regard is consistent with previous reports by Loetscher et al., FASEB J. 83055-1060 (1994) and others that they are weak lymphocyte attractants. EXAMPLE 10; Receptor usage / desensitization experiments
Receptor usage was tested by monitoring changes in [Ca2+] brought about by repeated chemokine stimulation at short intervals. The consequent desensitization of the exposure regimen provides a measure of receptor utilization. The determinations were made using 90 sec intervals exactly as described for monocytes by Uguccioni et al., Eur. J.
Immunol. 25:64-68 (1995). Determinations were made in monocytes and eosinophils.
Stimulation of monocytes with MCP-1 or MCP-3 abolished responsiveness to MCP- 4, indicating that the novel chemokine shares receptors with these monocyte chemotactic proteins. In contrast, stimulation with RANTES or MlP-lα did not affect MCP-4 responsiveness in this assay.
In tests of the opposite polarity, monocytes first stimulated with MCP-4 were markedly less responsive to MCP-1, RANTES and MlP-lα and slightly less responsive to
MCP-3. Densensitization increased with the concentration of MCP-4 The results also show that MCP-4 shares receptors with other monocyte chemotactic proteins and that MCP- 4 recognizes a receptor that binds RANTES and MIP- 1 ,
In eosinophils, MCP-4 exhibited marked cross-desensitization with MCP-3,
RANTES and eotaxin. In fact, it abrogated the response to subsequent stimulation by eotaxin and MCP-3, markedly decreased responsiveness to RANTES. MCP-4, and it therefore appears to be a major agonist for these cells. The results indicate that MCP-4 shares receptors with MCP-3, RANTES and Eotaxin.
In contrast, stimulation with MCP-4 did not affect the response of eosinophils to
MlP-lα. Thus, MlP-lα. receptors apparently do not recognize or bind MCP-4. The same receptor is likely to bind RANTES, which retained some activity on cells that had been stimulated with MCP-4.
EXAMPLE 1 1; Expression of MCP-4 (also referred to as Ckβ-10) in a drosophila expression system
A full-length cDNA encoding MCP-4 was expressed in a well known and readily available drosophila cell expression, using routine techniques for expressing cloned genes in this system.
Expressed MCP-4 was prepared from cells in which the cDNA was expressed and then characterized, using well known, routine techniques for characterizing polypeptides and proteins.
Several forms of MCP-4 was found in the expressing cells, including MCP-4 with shortened amino and carboxyl termini and MCP-4 comprising post-translational modifications. In particular, drosophila cells expressed MCP-4 having the amino acid sequence set out in Figure 1 except for the following differences.
N-terminal sequences changed to:
Drol: QGLKAQPD
Dro2: pyroQGLKAQPD
Dro3++: LNVPST, which occurred in three forms differing by different deletions of the C-terminal sequence. In particular DRO3 was found with T, T (des3) and A (des 5) carboxyl termini as indicated in Figure 5. The full sequences are set out in Figure 5.
EXAMPLE 12: Assay of MCP-4 (also referred to as Ckβ-10) produced in a drosophila expression system
Differing forms of MCP-4 expressed in drosophila cells were assays for activities using the techniques described herein above. Drol and Dro2 mobilized monocyte, PBL and EOL-3 cells in the chemotaxis assays, and they both were active in Ca2+ mobilization assays.
Dro3 showed substantially reduced bioactivity and, in fact, can be used as an antagonist.
EXAMPLE 13: CKβ-4 enhances survival of cortical neurons
Cortical cells were derived from rat fetuses at gestation day 17. Following the preparation of a single cell suspension, the cells were plated at a density of 15,000 cells/well in semm containing medium. After 24 hr. the medium was changed to a serum-free medium and the test factors were added. The medium was changed every other day and the test factors were added again.
After 6-7 days the cell viability was determined using a two-color fluorescence that provides simultaneous determination of live and dead cells. Live cells in this assay are determined by intracellular esterase activity, quantitated by conversion of cell-permeant calcein AM, which is nearly non-fluorescent, calcein, which is intensely fluorescent. Living cells almost universally express esterase activity and well the polycationic, fluorescent calcein. Thus, living cells produce a uniform, intense green fluorescence in the assay. The assay can be calibrated so that emission at 520 nm can be used to determine total viable cell number in cultures. The assay can be implemented, as it was for the present example, using the Live/Dead Cell Assay Kit commercially available from Molecular Probes. As shown in Figure 9, CKβ-4 (closed squares) stimulates cortical neuron cell survival in culture similarly to HG0100 (open squares).
Each point represents the average for six replicate cultures. EXAMPLE 14: CKβ-4 increases outgrowth of cortical neurons
Cultures of cortical neurons were prepared and maintained according to standard techniques. After 6 to 7 days in the presence of the test factors, the amount of neurofilament protein present in the cultures was determined by ELISA.
As shown in Figure 10, Ckβ-4 at concentrations of 10-100 ng/ml enhances neurite outgrowth similarly to bFGF-10. Results are for six replicate cultures.
EXAMPLE 15: CKβ-4 induces chemotaxis of peripheral blood lymphocytes Chemotaxis of peripheral blood lymphocytes in response to Ckβ-4 and MCP-
1 was determined by the above described methods.
As shown in Figure 11, Ckβ-4 exhibit a peak of activity at 1 to 10 ng/ml, comparable to the activity of MCP-1 at saturation.
EXAMPLE 1 6: Intracellular Calcium Mobilization
As discussed supra in Example 9, Ckβ-10 polypeptides have been shown to mobilize calcium on eosinophils. The wild type Figure 1 (SEQ ID NO:4) and mutant Ckβ-10 polypeptides shown in Figure 12were tested for their ability to induce mobilization of intracellular calcium in human monocytes using human MCP-4 as a positive control. The experiment was performed as follows: Human eosinophils were isolated by elutriation and loaded with Indo-1/acetoxymethylester by incubating ι/ιmes osup6 cells in 1 ml of in HBSS containing 1 mM CaCl.sub 2, 2 mM MgSO.sub 4, 5 mM glucose and 10 mM HEPES, pH 7.4 plus 2.5 mM Indo-1/acetoxymethylester for 30 min at 37. degree. C. Cells were then washed with HBSS and resuspended in the same buffer at 5. times.10. sup.5 cells/ml and stimulated with various concentrations of the indicated proteins at 37. degree. C. The fluorescent signal induced in response to changes in intracellular calcium ((Ca++)i) was measured on an Hatchi F-2000 fluorescence spectrophotometer by monitoring Indo-1 at the excitation and emission indicated in Figure 13.
The results are shown in Figure 13. The results demonstrate that preparations N29- T98 and L28-T98 are more active than the wild type, whereas P25-T98 is similar to the wild type and V30-T98 is less active than the wild type.
EXAMPLE 17: Chemotaxis
As discussed above in Example 7, Ckβ-10 (MCP-4) polypeptide has been shown to mobilizes induce the migration of eosinophils. Wild type Figure 1 (SEQ ED NO:4) and mutant Ckβ-10 Figure 12 polypeptides were assayed as indicated in Example 7, supra.
Chemotaxis was measured in response to various concentrations of wild type and mutant
Ckβ-10 polypeptides in a 96- well neuroprobe chemotaxis chambers. The experiment was performed as follows: cells were washed three times in HBSS with 0.1% BSA (HBSS/BSA) and resuspended at 2.,lmes30.sup 6 /ml for labeling. Calcein-AM (Molecular Probes) was added to a final concentration of 1 mM and the cells were incubated at 37. degree. C. for 30 minutes. Following this incubation, the cells were washed three times in HBSS/BSA. Labeled cells were then resuspended to 8.,,mes30.sup 5 /ml and 25 ml of this suspension (2."mes30.sup 5 cells) dispensed into each upper chamber of a 96 well chemotaxis plate. The chemotactic agent was distributed at various concentrations in the bottom chamber of each well. The upper and the bottom chambers are separated by a polycarbonate filter (3- 5 mm pore size; PVP free; NeuroProbe, Inc.). Cells were allowed to migrate for 45-90 minutes and then the number of migrated cells (both attached to the bottom surface of the filter as well as in the bottom chamber) were quantitated using a Cytofluor 11 fluorescence plate reader (PerSeptive Biosystems). Values represent concentrations at which activity was observed with induction over background.
The results, shown in Figure.14, demonstrate that preparations V30-T98, L29-T98,
L28-T98, and P25-T98 mutant Ckβ-10 polypeptides are potent inducers of chemotaxis, whereas P31-T98, S32-T98 and T33-T98 were poor inducers of eosinophil chemotaxis as compared to the wild type.
EXAMPLE 18: Construction of N-Terminal and/or C-Terminal Deletion Mutants The following general approach may be used to clone a N-terminal or C-terminal
Ckβ-4 or Ckβ-10 deletion mutant. Generally, two oligonucleotide primers of about 15-25 nucleotides are derived from the desired 5' and 3' positions of a polynucleotide of SEQ ID NO3 or SEQ ID NO:3, respectively. The 5' and 3' positions of the primers are determined based on the desired Ckβ-4 or Ckβ-10 polynucleotide fragment. An initiation and stop codon are added to the 5' and 3' primers respectively, if necessary, to express the Ckβ-4 or
Ckβ-10 polypeptide fragment encoded by the polynucleotide fragment. Preferred Ckβ-4 or
Ckβ-10 polynucleotide fragments are those encoding the N-terminal and C-terminal deletion mutants disclosed above in the Specification. Preferred Ckβ-10 polynucleotide fragments are those encoding the Ntermal mutants shown in Figure 12. Additional nucleotides containing restriction sites to facilitate cloning of the Ckβ-4 or
Ckβ-10 polynucleotide fragment in a desired vector may also be added to the 5' and 3 ' primer sequences. The Ckβ-4 or Ckβ-10 polynucleotide fragment is amplified from genomic DNA or from the deposited cDNA clone using the appropriate PCR oligonucleotide primers and conditions discussed herein or known in the art. The Ckβ-4 or Ckβ-10 polypeptide fragments encoded by the Ckβ-4 or Ckβ-10 polynucleotide fragments of the present invention may be expressed and purified in the same general manner as the full length polypeptides, although routine modifications may be necessary due to the differences in chemical and physical properties between a particular fragment and full length polypeptide.
As a means of exemplifying but not limiting the present invention, the polynucleotide encoding the Ckβ-10 polypeptide fragment V-30 to T-98 is amplified and cloned as follows:
A 5' primer is generated comprising a restriction enzyme site followed by an initiation codon in frame with the polynucleotide sequence encoding the N-terminal portion of the polypeptide fragment beginning with V-30. A complementary 3' primer is generated comprising a restriction enzyme site followed by a stop codon in frame with the polynucleotide sequence encoding C-terminal portion of the Ckβ-10 polypeptide fragment ending with T-98.
The amplified polynucleotide fragment and the expression vector are digested with restriction enzymes which recognize the sites in the primers. The digested polynucleotides are then ligated together. The Ckβ-10 polynucleotide fragment is inserted into the restricted expression vector, preferably in a manner which places the Ckβ-10 polypeptide fragment coding region downstream from the promoter. The ligation mixture is transformed into competent E. coli cells using standard procedures and as described in the Examples herein. Plasmid DNA is isolated from resistant colonies and the identity of the cloned DNA confirmed by restriction analysis, PCR and DNA sequencing.
EXAMPLE 19: Protein Fusions of Ckβ-4 or Ckβ-10
Ckβ-4 and Ckβ-10 polypeptides are preferably fused to other proteins. These fusion proteins can be used for a variety of applications. For example, fusion of Ckβ-4 or Ckβ-10 polypeptides to His-tag, HA-tag, protein A, IgG domains, and maltose binding protein facilitates purification. (See Examples 1, 2, 3 and 4; see also EP A 394,827; Traunecker, et al., Nature 331:84-86 (1988).) Similarly, fusion to IgG-1, IgG-3, and albumin increases the halflife time in vivo. Nuclear localization signals fused to Ckβ-4 or Ckβ-10 polypeptides can target the protein to a specific subcellular localization, while covalent heterodimer or homodimers can increase or decrease the activity of a fusion protein. Fusion proteins can also create chimeric molecules having more than one function. Finally, fusion proteins can increase solubility and/or stability of the fused protein compared to the non-fused protein. All of the types of fusion proteins described above can be made by modifying the following protocol, which outlines the fusion of a polypeptide to an IgG molecule, or the protocol described in Examples 1, 2, 3 or 4.
Briefly, the human Fc portion of the IgG molecule can be PCR amplified, using primers that span the 5' and 3' ends of the sequence described below. These primers also should have convenient restriction enzyme sites that will facilitate cloning into an expression vector, preferably a mammalian expression vector.
For example, if pC4 (Accession No. 209646) is used, the human Fc portion can be ligated into the BamHI cloning site. Note that the 3' BamHI site should be destroyed. Next, the vector containing the human Fc portion is re-restricted with BamHI, linearizing the vector, and Ckβ-4 or Ckβ-10 polynucleotide, isolated by the PCR protocol described in
Example 1 or 2, respectively, is ligated into this BamHI site. Note that the polynucleotide is cloned without a stop codon, otherwise a fusion protein will not be produced.
If the naturally occurring signal sequence is used to produce the secreted protein, pC4 does not need a second signal peptide. Alternatively, if the naturally occurring signal sequence is not used, the vector can be modified to include a heterologous signal sequence. (See, e.g., WO 96/34891.)
Human IgG Fc region: GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAG CACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGA CACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTGGTGGACGTAAG CCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGC ATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTG GTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAG TGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCAAA GCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGA TGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCC AAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACA AGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCT CACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGA TGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGG GTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT (SEQ ID NO: 11) EXAMPLE 20: Production of an Antibody
a) Hybridoma Technology The antibodies of the present invention can be prepared by a variety of methods.
(See, Current Protocols, Chapter 2.) As one example of such methods, cells expressing
Ckβ-4 or Ckβ-10 are administered to an animal to induce the production of sera containing polyclonal antibodies. In a preferred method, a preparation of Ckβ-4 or Ckβ-10 protein is prepared and purified to render it substantially free of natural contaminants. Such a preparation is then introduced into an animal in order to produce polyclonal antisera of greater specific activity.
Monoclonal antibodies specific for Ckβ-4 or Ckβ-10 protein are prepared using hybridoma technology. (Kohler et al., Nature 256:495 (1975); Kohler et al., Eur. J. Immunol. 6:511 (1976); Kohler et al., Eur. J. Immunol. 6:292 (1976); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas, Elsevier, N.Y., pp. 563-681 (1981)).
In general, an animal (preferably a mouse) is immunized with Ckβ-4 or Ckβ-10 polypeptide or, more preferably, with a secreted Ckβ-4 or Ckβ-10 polypeptide-expressing cell. Such polypeptide-expressing cells are cultured in any suitable tissue culture medium, preferably in Earle's modified Eagle's medium supplemented with 10% fetal bovine semm (inactivated at about 56°C), and supplemented with about 10 g/1 of nonessential amino acids, about 1,000 U/ml of penicillin, and about 100 μg/ml of streptomycin.
The splenocytes of such mice are extracted and fused with a suitable myeloma cell line. Any suitable myeloma cell line may be employed in accordance with the present invention; however, it is preferable to employ the parent myeloma cell line (SP2O), available from the ATCC. After fusion, the resulting hybridoma cells are selectively maintained in HAT medium, and then cloned by limiting dilution as described by Wands et al. (Gastroenterology 80:225-232 (1981)). The hybridoma cells obtained through such a selection are then assayed to identify clones which secrete antibodies capable of binding a
Ckβ-4 or Ckβ-10 polypeptide. Alternatively, additional antibodies capable of binding to Ckβ-4 or Ckβ-10 polypeptide can be produced in a two-step procedure using anti-idiotypic antibodies. Such a method makes use of the fact that antibodies are themselves antigens, and therefore, it is possible to obtain an antibody which binds to a second antibody. In accordance with this method, protein specific antibodies are used to immunize an animal, preferably a mouse. The splenocytes of such an animal are then used to produce hybridoma cells, and the hybridoma cells are screened to identify clones which produce an antibody whose ability to bind to the Ckβ-4 or Ckβ-10 protein-specific antibody can be blocked by Ckβ-4 or Ckβ-10.
Such antibodies comprise anti-idiotypic antibodies to the Ckβ-4 or Ckβ-10 protein-specific antibody and are used to immunize an animal to induce formation of further Ckβ-4 or Ckβ- 10 protein-specific antibodies.
For in vivo use of antibodies in humans, an antibody is "humanized". Such antibodies can be produced using genetic constmcts derived from hybridoma cells producing the monoclonal antibodies described above. Methods for producing chimeric and humanized antibodies are known in the art and are discussed herein. (See, for review, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Cabilly et al., U.S. Patent No. 4,816,567; Taniguchi et al., EP 171496; Morrison et al., EP 173494; Neuberger et al., WO 8601533; Robinson et al., WO 8702671; Boulianne et al., Nature 312:643 (1984); Neuberger et al., Nature 314:268 (1985).)
b) Isolation Of Antibody Fragments Directed Against Ckβ-4 or Ckβ-10
From A Library Of scFvs
Naturally occurring V-genes isolated from human PBLs are constructed into a library of antibody fragments which contain reactivities against Ckβ-4 or Ckβ-10 to which the donor may or may not have been exposed (see e.g., U.S. Patent 5,885,793 incoφorated herein by reference in its entirety).
Rescue of the Library. A library of scFvs is constructed from the RNA of human PBLs as described in PCT publication WO 92/01047. To rescue phage displaying antibody fragments, approximately 109 E. coli harboring the phagemid are used to inoculate 50 ml of 2xTY containing 1% glucose and 100 μg/ml of ampicillin (2xTY-AMP-GLU) and grown to an O.D. of 0.8 with shaking. Five ml of this culture is used to innoculate 50 ml of 2xTY- AMP-GLU, 2 x 108 TU of delta gene 3 helper (Ml 3 delta gene III, see PCT publication WO 92/01047) are added and the culture incubated at 37°C for 45 minutes without shaking and then at 37°C for 45 minutes with shaking. The culture is centrifuged at 4000 r.p.m. for 10 min. and the pellet resuspended in 2 liters of 2xTY containing 100 μg/ml ampicillin and 50 ug/ml kanamycin and grown overnight. Phage are prepared as described in PCT publication WO 92/01047.
Ml 3 delta gene III is prepared as follows: Ml 3 delta gene III helper phage does not encode gene ILL protein, hence the phage(mid) displaying antibody fragments have a greater avidity of binding to antigen. Infectious M13 delta gene III particles are made by growing the helper phage in cells harboring a pUC19 derivative supplying the wild type gene III protein during phage moφhogenesis. The culture is incubated for 1 hour at 37° C without shaking and then for a further hour at 37°C with shaking. Cells are spun down (EEC-Centra 8,400 r.p.m. for 10 min), resuspended in 300 ml 2xTY broth containing 100 μg ampicillin/ml and 25 μg kanamycin/ml (2xTY-AMP-KAN) and grown overnight, shaking at 37°C. Phage particles are purified and concentrated from the culture medium by two PEG- precipitations (Sambrook et al., 1990), resuspended in 2 ml PBS and passed through a 0.45 μm filter (Minisart NML; Sartorius) to give a final concentration of approximately 1013 transducing units/ml (ampicillin-resistant clones).
Panning of the Library. Immunotubes (Nunc) are coated overnight in PBS with 4 ml of either 100 μg/ml or 10 μg/ml of a polypeptide of the present invention. Tubes are blocked with 2% Marvel-PBS for 2 hours at 37°C and then washed 3 times in PBS. Approximately 1013 TU of phage is applied to the tube and incubated for 30 minutes at room temperature tumbling on an over and under turntable and then left to stand for another 1.5 hours. Tubes are washed 10 times with PBS 0.1% Tween-20 and 10 times with PBS. Phage are eluted by adding 1 ml of 100 mM triethylamine and rotating 15 minutes on an under and over turntable after which the solution is immediately neutralized with 0.5 ml of 1.0M Tris-HCl, pH 7.4. Phage are then used to infect 10 ml of mid-log E. coli TGI by incubating eluted phage with bacteria for 30 minutes at 37°C. The E. coli are then plated on TYE plates containing 1% glucose and 100 μg/ml ampicillin. The resulting bacterial library is then rescued with delta gene 3 helper phage as described above to prepare phage for a subsequent round of selection. This process is then repeated for a total of 4 rounds of affinity purification with tube-washing increased to 20 times with PBS, 0.1% Tween-20 and 20 times with PBS for rounds 3 and 4.
Characterization of Binders. Eluted phage from the 3rd and 4th rounds of selection are used to infect E. coli HB 2151 and soluble scFv is produced (Marks, et al., 1991) from single colonies for assay. ELISAs are performed with microtitre plates coated with either 10 pg/ml of the polypeptide of the present invention in 50 mM bicarbonate pH 9.6. Clones positive in ELISA are further characterized by PCR fingeφrinting (see, e.g., PCT publication WO 92/01047) and then by sequencing. These ELISA positive clones may also be further characterized by techniques known in the art, such as, for example, epitope mapping, binding affinity, receptor signal transduction, ability to block or competitively inhibit antibody/antigen binding, and competitive agonistic or antagonistic activity.
EXAMPLE 21: Production Of Ckβ-4 or Ckβ-10 Protein For High
Throughput Screening Assays The following protocol produces a supernatant containing a Ckβ-4 or Ckβ-10 polypeptide to be tested. This supernatant can then be used in the Screening Assays described in Examples 23-30. First, dilute Poly-D-Lysine (644 587 Boehringer-Mannheim) stock solution (lmg/ml in PBS) 1:20 in PBS (w/o calcium or magnesium 17-516F Biowhittaker) for a working solution of 50ug/ml. Add 200 ul of this solution to each well (24 well plates) and incubate at RT for 20 minutes. Be sure to distribute the solution over each well (note: a 12-channel pipetter may be used with tips on every other channel). Aspirate off the Poly-D-Lysine solution and rinse with 1ml PBS (Phosphate Buffered Saline). The PBS should remain in the well until just prior to plating the cells and plates may be poly-lysine coated in advance for up to two weeks.
Plate 293T cells (do not carry cells past P+20) at 2 x 105 cells/well in .5ml DMEM(Dulbecco's Modified Eagle Medium)(with 4.5 G/L glucose and L-glutamine (12- 604F Biowhittaker))/10% heat inactivated FBSQ4-503F Biowhittaker)/ lx Penstrep(17-602E Biowhittaker). Let the cells grow overnight.
The next day, mix together in a sterile solution basin: 300 ul Lipofectamine (18324- 012 Gibco/BRL) and 5ml Optimem I (31985070 Gibco/BRL)/96-well plate. With a small volume multi-channel pipetter, aliquot approximately 2ug of an expression vector containing a polynucleotide insert, produced by the methods described in Examples 1-5, into an appropriately labeled 96-well round bottom plate. With a multi-channel pipetter, add 50ul of the Lipofectamine/Optimem I mixture to each well. Pipette up and down gently to mix. Incubate at RT 15-45 minutes. After about 20 minutes, use a multi-channel pipetter to add 150ul Optimem I to each well. As a control, one plate of vector DNA lacking an insert should be transfected with each set of transfections.
Preferably, the transfection should be performed by tag- teaming the following tasks. By tag-teaming, hands on time is cut in half, and the cells do not spend too much time on PBS. First, person A aspirates off the media from four 24-well plates of cells, and then person B rinses each well with .5-lml PBS. Person A then aspirates off PBS rinse, and person B, using a 12-channel pipetter with tips on every other channel, adds the 200ul of DNA/Lipofectamine/Optimem I complex to the odd wells first, then to the even wells, to each row on the 24-well plates. Incubate at 37 degree C for 6 hours.
While cells are incubating, prepare appropriate media, either 1%BSA in DMEM with lx penstrep, or HGS CHO-5 media (116.6 mg/L of CaC12 (anhyd); 0.00130 mg/L CuSO4- 5H2O; 0.050 mg/L of Fe(NO3)3-9H2O; 0.417 mg/L of FeSO4-7H2O; 311.80 mg/L of Kcl; 28.64 mg/L of MgC12; 48.84 mg/L of MgSO4; 6995.50 mg/L of NaCl; 2400.0 mg/L of NaHCO3; 62.50 mg/L of NaH2PO4-H20; 71.02 mg/L of Na2HPO4; .4320 mg/L of ZnSO4-7H2O; .002 mg/L of Arachidonic Acid ; 1.022 mg/L of Cholesterol; .070 mg/L of DL-alpha-Tocopherol-Acetate; 0.0520 mg/L of Linoleic Acid; 0.010 mg/L of Linolenic Acid; 0.010 mg/L of Myristic Acid; 0.010 mg/L of Oleic Acid; 0.010 mg/L of Palmitric Acid; 0.010 mg/L of Palmitic Acid; 100 mg/L of Pluronic F-68; 0.010 mg/L of Stearic Acid; 2.20 mg/L of Tween 80; 4551 mg/L of D-Glucose; 130.85 mg/ml of L- Alanine; 147.50 mg/ml of L-Arginine-HCL; 7.50 mg/ml of L-Asparagine-H20; 6.65 mg/ml of L-Aspartic Acid; 29.56 mg/ml of L-Cystine-2HCL-H20; 31.29 mg/ml of L-Cystine-2HCL; 7.35 mg/ml of L- Glutamic Acid; 365.0 mg/ml of L-Glutamine; 18.75 mg/ml of Glycine; 52.48 mg/ml of L- Histidine-HCL-H20; 106.97 mg/ml of L-Isoleucine; 111.45 mg/ml of L-Leucine; 163.75 mg/ml of L-Lysine HCL; 32.34 mg/ml of L-Methionine; 68.48 mg/ml of L-Phenylalainine; 40.0 mg/ml of L-Proline; 26.25 mg/ml of L-Serine; 101.05 mg/ml of L-Threonine; 19.22 mg/ml of L-Tryptophan; 91.79 mg/ml of L-Tryrosine-2Na-2H20; and 99.65 mg/ml of L- Valine; 0.0035 mg/L of Biotin; 3.24 mg/L of D-Ca Pantothenate; 11.78 mg/L of Choline Chloride; 4.65 mg/L of Folic Acid; 15.60 mg/L of i-Inositol; 3.02 mg/L of Niacinamide; 3.00 mg/L of Pyridoxal HCL; 0.031 mg/L of Pyridoxine HCL; 0.319 mg/L of Riboflavin; 3.17 mg/L of Thiamine HCL; 0.365 mg/L of Thymidine; 0.680 mg/L of Vitamin B12; 25 mM of HEPES Buffer; 2.39 mg/L of Na Hypoxanthine; 0.105 mg/L of Lipoic Acid; 0.081 mg/L of Sodium Putrescine-2HCL; 55.0 mg/L of Sodium Pymvate; 0.0067 mg/L of Sodium Selenite; 20uM of Ethanolamine; 0.122 mg/L of Ferric Citrate; 41.70 mg/L of Mefhyl-B- Cyclodextrin complexed with Linoleic Acid; 33.33 mg/L of Methyl-B -Cyclodextrin complexed with Oleic Acid; 10 mg/L of Methyl-B -Cyclodextrin complexed with Retinal Acetate. Adjust osmolarity to 327 mOsm) with 2mm glutamine and lx penstrep. (BSA (81- 068-3 Bayer) lOOgm dissolved in IL DMEM for a 10% BSA stock solution). Filter the media and collect 50 ul for endotoxin assay in 15ml polystyrene conical. The transfection reaction is terminated, preferably by tag-teaming, at the end of the incubation period. Person A aspirates off the transfection media, while person B adds 1.5ml appropriate media to each well. Incubate at 37 degree C for 45 or 72 hours depending on the media used: 1%BSA for 45 hours or CHO-5 for 72 hours.
On day four, using a 300ul multichannel pipetter, aliquot 600ul in one 1ml deep well plate and the remaining supernatant into a 2ml deep well. The supernatants from each well can then be used in the assays described in Examples 23-30.
It is specifically understood that when activity is obtained in any of the assays described below using a supernatant, the activity originates from either the Ckβ-4 or Ckβ- 10 polypeptide directly (e.g., as a secreted protein) or by Ckβ-4 or Ckβ-10 inducing expression of other proteins, which are then secreted into the supernatant. Thus, the invention further provides a method of identifying the protein in the supernatant characterized by an activity in a particular assay.
EXAMPLE 22: Construction of GAS Reporter Construct One signal transduction pathway involved in the differentiation and proliferation of cells is called the Jaks-STATs pathway. Activated proteins in the Jaks-STATs pathway bind to gamma activation site "GAS" elements or interferon-sensitive responsive element ("ISRE"), located in the promoter of many genes. The binding of a protein to these elements alter the expression of the associated gene.
GAS and ISRE elements are recognized by a class of transcription factors called Signal Transducers and Activators of Transcription, or "STATs." There are six members of the STATs family. Statl and Stat3 are present in many cell types, as is Stat2 (as response to IFN-alpha is widespread). Stat4 is more restricted and is not in many cell types though it has been found in T helper class I, cells after treatment with IL-12. Stat5 was originally called mammary growth factor, but has been found at higher concentrations in other cells including myeloid cells. It can be activated in tissue culture cells by many cytokines. The STATs are activated to translocate from the cytoplasm to the nucleus upon tyrosine phosphorylation by a set of kinases known as the Janus Kinase ("Jaks") family. Jaks represent a distinct family of soluble tyrosine kinases and include Tyk2, Jakl, Jak2, and Jak3. These kinases display significant sequence similarity and are generally catalytically inactive in resting cells. The Jaks are activated by a wide range of receptors summarized in the Table below.
(Adapted from review by Schidler and Darnell, Ann. Rev. Biochem. 64:621-51 (1995).) A cytokine receptor family, capable of activating Jaks, is divided into two groups: (a) Class 1 includes receptors for IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-11, IL-12, IL-15, Epo, PRL, GH, G-CSF, GM-CSF, LIF, CNTF, and thrombopoietin; and (b) Class 2 includes IFN-a, IFN-g, and IL-10. The Class 1 receptors share a conserved cysteine motif (a set of four conserved cysteines and one tryptophan) and a WSXWS motif (a membrane proximal region encoding Tφ-Ser-Xxx-Tφ-Ser (SEQ ID NO:22)).
Thus, on binding of a ligand to a receptor, Jaks are activated, which in turn activate STATs, which then translocate and bind to GAS elements. This entire process is encompassed in the Jaks-STATs signal transduction pathway.
Therefore, activation of the Jaks-STATs pathway, reflected by the binding of the GAS or the ISRE element, can be used to indicate proteins involved in the proliferation and differentiation of cells. For example, growth factors and cytokines are known to activate the Jaks-STATs pathway. (See Table below.) Thus, by using GAS elements linked to reporter molecules, activators of the Jaks-STATs pathway can be identified. .TAKs STATS GAS(elements) or ISRE
Ligand tγk2 Jakl Jak2 Jak3
IFN familv
IFN-a/B + + - - 1 ,2,3 ISRE
IFN-g + + - 1 GAS
(IRFl>Lys6>IFP)
11-10 -r 7 ? - 1 ,3 gp 130 familv
IL-6 (Pleiotrohic) + + + ? 1 ,3 GAS
(IRFl>Lys6>IFP)
11- 11 (Pleiotrohic) ? + 7 7 1 ,3
OnM(Pleiotrohic) ? + + 7 1 ,3
LLF(Pleiotrohic) ? + + 7 1 ,3
CNTF(Pleiotrohic) -/+ + + 7 1 ,3
G-CSF(Pleiotrohic) ? + 7 7 1 ,3
IL-12(Pleiotrohic) + - + + 1 ,3 -C familv
IL-2 (lymphocytes) - + - + 1,3,5 GAS
LL-4 (lymph/myeloid) - + - + 6 GAS (IRF1 = IFP
»Ly6)(IgH)
IL-7 (lymphocytes) - + - + 5 GAS
IL-9 (lymphocytes) - + - + 5 GAS
IL-13 (lymphocyte) - + 7 7 6 GAS
IL-15 ? + 7 + 5 GAS gp 140 familv
IL-3 (myeloid) - - + - 5 GAS
(IRFl>IFP»Ly6)
IL-5 (myeloid) - - + - 5 GAS
GM-CSF (myeloid) - - + - 5 GAS
Growth hormone familv
GH ? - + - 5
PRL ? +/- + - 1 ,3,5
EPO ? - + - 5 GAS(B-
CAS>IRFl=IFP»Ly6)
Receptor Tvrosine Kinases
EGF ? + + - 1 ,3 GAS (IRF1)
PDGF ? + + - 1,3
CSF-1 ? + + - 1 ,3 GAS (not IRF1) To constmct a synthetic GAS containing promoter element, which is used in the Biological Assays described in Examples 23-24, a PCR based strategy is employed to generate a GAS-SV40 promoter sequence. The 5' primer contains four tandem copies of the GAS binding site found in the IRFl promoter and previously demonstrated to bind STATs upon induction with a range of cytokines (Rothman et al., Immunity 1:457-468 (1994).), although other GAS or ISRE elements can be used instead. The 5' primer also contains 18bp of sequence complementary to the SV40 early promoter sequence and is flanked with an Xhol site. The sequence of the 5' primer is: 5':GCGCCTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAA TGATTTCCCCGAAATATCTGCCATCTCAATTAG:3' (SEQEDNO:23)
The downstream primer is complementary to the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO:24)
PCR amplification is performed using the SV40 promoter template present in the B- gahpromoter plasmid obtained from Clontech. The resulting PCR fragment is digested with Xhol/Hind III and subcloned into BLSK2-. (Stratagene.) Sequencing with forward and reverse primers confirms that the insert contains the following sequence: 5':CTCGAGATTTCCCCGAAATCTAGATTTCCCCGAAATGATTTCCCCGAAATGATT TCCCCGAAATATCTGCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACT CCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCT GACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATT CCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3' (SEQ ID NO:25)
With this GAS promoter element linked to the SV40 promoter, a GAS:SEAP2 reporter constmct is next engineered. Here, the reporter molecule is a secreted alkaline phosphatase, or "SEAP." Clearly, however, any reporter molecule can be instead of SEAP, in this or in any of the other Examples. Well known reporter molecules that can be used instead of SEAP include chloramphenicol acetyltransferase (CAT), luciferase, alkaline phosphatase, B-galactosidase, green fluorescent protein (GFP), or any protein detectable by an antibody.
The above sequence confirmed synthetic GAS-SV40 promoter element is subcloned into the pSEAP-Promoter vector obtained from Clontech using Hindlll and Xhol. effectively replacing the SV40 promoter with the amplified GAS:SV40 promoter element, to create the GAS-SEAP vector. However, this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems.
Thus, in order to generate mammalian stable cell lines expressing the GAS-SEAP reporter, the GAS-SEAP cassette is removed from the GAS-SEAP vector using Sail and Notl, and inserted into a backbone vector containing the neomycin resistance gene, such as pGFP-1 (Clontech), using these restriction sites in the multiple cloning site, to create the GAS-SEAP/Neo vector. Once this vector is transfected into mammalian cells, this vector can then be used as a reporter molecule for GAS binding as described in Examples 23-24.
Other constmcts can be made using the above description and replacing GAS with a different promoter sequence. For example, constmction of reporter molecules containing NFK-B and EGR promoter sequences are described in Examples 25 and 26. However, many other promoters can be substituted using the protocols described in these Examples. For instance, SRE, IL-2, NFAT, or Osteocalcin promoters can be substituted, alone or in combination (e.g., GAS/NF-KB/EGR, GAS/NF-KB, I1-2/NFAT, or NF-KB/GAS). Similarly, other cell lines can be used to test reporter constmct activity, such as HELA (epithelial), HUVEC (endothelial), Reh (B-cell), Saos-2 (osteoblast), HUVAC (aortic), or Cardiomyocyte.
EXAMPLE 23: High-Throughput Screening Assay for T-cell Activity. The following protocol is used to assess T-cell activity by identifying factors, and determining whether supemate containing a polypeptide of the invention proliferates and/or differentiates T-cells. T-cell activity is assessed using the GAS/SEAP/Neo constmct produced in Example 22. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway. The T-cell used in this assay is Jurkat T-cells (ATCC Accession No. TIB- 152), although Molt-3 cells (ATCC Accession No. CRL- 1552) and Molt-4 cells (ATCC Accession No. CRL-1582) cells can also be used.
Jurkat T-cells are lymphoblastic CD4+ Thl helper cells. In order to generate stable cell lines, approximately 2 million Jurkat cells are transfected with the GAS-SEAP/neo vector using DMRLE-C (Life Technologies)(transfection procedure described below). The transfected cells are seeded to a density of approximately 20,000 cells per well and transfectants resistant to 1 mg/ml genticin selected. Resistant colonies are expanded and then tested for their response to increasing concentrations of interferon gamma. The dose response of a selected clone is demonstrated.
Specifically, the following protocol will yield sufficient cells for 75 wells containing 200 ul of cells. Thus, it is either scaled up, or performed in multiple to generate sufficient cells for multiple 96 well plates. Jurkat cells are maintained in RPMI + 10% semm with l%Pen-Strep. Combine 2.5 mis of OPTI-MEM (Life Technologies) with 10 ug of plasmid DNA in a T25 flask. Add 2.5 ml OPTI-MEM containing 50 ul of DMREE-C and incubate at room temperature for 15-45 mins. During the incubation period, count cell concentration, spin down the required number of cells (107 per transfection), and resuspend in OPTI-MEM to a final concentration of 107 cells/ml. Then add 1ml of 1 x 107 cells in OPTI-MEM to T25 flask and incubate at 37 degree C for 6 hrs. After the incubation, add 10 ml of RPMI + 15% semm. The Jurkat:GAS-SEAP stable reporter lines are maintained in RPMI + 10% semm, 1 mg/ml Genticin, and 1% Pen-Strep. These cells are treated with supernatants containing
Ckβ-4 or Ckβ-10 polypeptides or Ckβ-4 or Ckβ-10 induced polypeptides as produced by the protocol described in Example 21. On the day of treatment with the supernatant, the cells should be washed and resuspended in fresh RPMI + 10% semm to a density of 500,000 cells per ml. The exact number of cells required will depend on the number of supernatants being screened. For one 96 well plate, approximately 10 million cells (for 10 plates, 100 million cells) are required.
Transfer the cells to a triangular reservoir boat, in order to dispense the cells into a 96 well dish, using a 12 channel pipette. Using a 12 channel pipette, transfer 200 ul of cells into each well (therefore adding 100, 000 cells per well).
After all the plates have been seeded, 50 ul of the supernatants are transferred directly from the 96 well plate containing the supernatants into each well using a 12 channel pipette. In addition, a dose of exogenous interferon gamma (0.1, 1.0, 10 ng) is added to wells H9, H10, and HI 1 to serve as additional positive controls for the assay.
The 96 well dishes containing Jurkat cells treated with supernatants are placed in an incubator for 48 hrs (note: this time is variable between 48-72 hrs). 35 ul samples from each well are then transferred to an opaque 96 well plate using a 12 channel pipette. The opaque plates should be covered (using sellophene covers) and stored at -20 degree C until SEAP assays are performed according to Example 27. The plates containing the remaining treated cells are placed at 4 degree C and serve as a source of material for repeating the assay on a specific well if desired.
As a positive control, 100 Unit ml interferon gamma can be used which is known to activate Jurkat T cells. Over 30 fold induction is typically observed in the positive control wells.
The above protocol may be used in the generation of both transient, as well as, stable transfected cells, which would be apparent to those of skill in the art.
EXAMPLE 24: High-Throughput Screening Assay Identifying Myeloid Activity
The following protocol is used to assess myeloid activity of Ckβ-4 or Ckβ-10 by determining whether Ckβ-4 or Ckβ-10 proliferates and/or differentiates myeloid cells.
Myeloid cell activity is assessed using the GAS/SEAP/Neo constmct produced in Example 22. Thus, factors that increase SEAP activity indicate the ability to activate the Jaks-STATS signal transduction pathway. The myeloid cell used in this assay is U937, a pre-monocyte cell line, although TF-1, HL60, or KG1 can be used.
To transiently transfect U937 cells with the GAS/SEAP/Neo constmct produced in Example 22, a DEAE-Dextran method (Kharbanda et. al., 1994, Cell Growth &
Differentiation, 5:259-265) is used. First, harvest 2xl0e7 U937 cells and wash with PBS.
The U937 cells are usually grown in RPMI 1640 medium containing 10% heat-inactivated fetal bovine semm (FBS) supplemented with 100 units/ml penicillin and 100 mg/ml streptomycin.
Next, suspend the cells in 1 ml of 20 mM Tris-HCl (pH 7.4) buffer containing 0.5 mg/ml DEAE-Dextran, 8 ug GAS-SEAP2 plasmid DNA, 140 mM NaCl, 5 mM KCl, 375 uM Na2HPO4.7H2O, 1 mM MgC12, and 675 uM CaC12. Incubate at 37 degrees C for 45 min. Wash the cells with RPMI 1640 medium containing 10% FBS and then resuspend in
10 ml complete medium and incubate at 37 degree C for 36 hr.
The GAS-SEAP/U937 stable cells are obtained by growing the cells in 400 ug/ml
G418. The G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 400 ug/ml G418 for couple of passages. These cells are tested by harvesting 1x10s cells (this is enough for ten 96-well plates assay) and wash with PBS. Suspend the cells in 200 ml above described growth medium, with a final density of 5x10s cells/ml. Plate 200 ul cells per well in the 96-well plate (or lxlO5 cells/well).
Add 50 ul of the supernatant prepared by the protocol described in Example 21. Incubate at 37 degee C for 48 to 72 hr. As a positive control, 100 Unit ml interferon gamma can be used which is known to activate U937 cells. Over 30 fold induction is typically observed in the positive control wells. SEAP assay the supernatant according to the protocol described in Example 27.
EXAMPLE 25: High-Throughput Screening Assay Identifying Neuronal Activity.
When cells undergo differentiation and proliferation, a group of genes are activated through many different signal transduction pathways. One of these genes, EGRl (early growth response gene 1), is induced in various tissues and cell types upon activation. The promoter of EGRl is responsible for such induction. Using the EGRl promoter linked to reporter molecules, activation of cells can be assessed by Ckβ-4 or Ckβ-10.
Particularly, the following protocol is used to assess neuronal activity in PC 12 cell lines. PC12 cells (rat phenochromocytoma cells) are known to proliferate and/or differentiate by activation with a number of mitogens, such as TPA (tetradecanoyl phorbol acetate), NGF (nerve growth factor), and EGF (epidermal growth factor). The EGRl gene expression is activated during this treatment. Thus, by stably transfecting PC 12 cells with a constmct containing an EGR promoter linked to SEAP reporter, activation of PC 12 cells by Ckβ-4 or Ckβ-10 can be assessed.
The EGR/SEAP reporter constmct can be assembled by the following protocol. The EGR-1 promoter sequence (-633 to +l)(Sakamoto K et al., Oncogene 6:867-871 (1991)) can be PCR amplified from human genomic DNA using the following primers: 5' GCGCTCGAGGGATGACAGCGATAGAACCCCGG -3' (SEQ ID NO:26)
5' GCGAAGCTTCGCGACTCCCCGGATCCGCCTC-3' (SEQ ID NO:27) Using the GAS:SEAP/Neo vector produced in Example 22, EGRl amplified product can then be inserted into this vector. Linearize the GAS:SEAP/Neo vector using restriction enzymes Xhol/Hindlll, removing the GAS/SV40 stuffer. Restrict the EGRl amplified product with these same enzymes. Ligate the vector and the EGRl promoter.
To prepare 96 well-plates for cell culture, two mis of a coating solution (1:30 dilution of collagen type I (Upstate Biotech Inc. Cat#08-115) in 30% ethanol (filter sterilized)) is added per one 10 cm plate or 50 ml per well of the 96-well plate, and allowed to air dry for 2 hr. PC 12 cells are routinely grown in RPMI- 1640 medium (Bio Whittaker) containing
10% horse semm (JRH BIOSCLENCES, Cat. # 12449-78P), 5% heat-inactivated fetal bovine semm (FBS) supplemented with 100 units/ml penicillin and 100 ug/ml streptomycin on a precoated 10 cm tissue culture dish. One to four split is done every three to four days. Cells are removed from the plates by scraping and resuspended with pipetting up and down for more than 15 times.
Transfect the EGR/SEAP/Neo constmct into PC 12 using the Lipofectamine protocol described in Example 21. EGR-SEAP/PC12 stable cells are obtained by growing the cells in 300 ug/ml G418. The G418-free medium is used for routine growth but every one to two months, the cells should be re-grown in 300 ug/ml G418 for couple of passages. To assay for neuronal activity, a 10 cm plate with cells around 70 to 80% confluent is screened by removing the old medium. Wash the cells once with PBS (Phosphate buffered saline). Then starve the cells in low semm medium (RPMI- 1640 containing 1% horse semm and 0.5% FBS with antibiotics) overnight.
The next morning, remove the medium and wash the cells with PBS. Scrape off the cells from the plate, suspend the cells well in 2 ml low semm medium. Count the cell number and add more low semm medium to reach final cell density as 5xl05 cells/ml.
Add 200 ul of the cell suspension to each well of 96-well plate (equivalent to 1x105 cells/well). Add 50 ul supernatant produced by Example 21, 37 degree C for 48 to 72 hr. As a positive control, a growth factor known to activate PC 12 cells through EGR can be used, such as 50 ng/ul of Neuronal Growth Factor (NGF). Over fifty-fold induction of SEAP is typically seen in the positive control wells. SEAP assay the supernatant according to Example 27. EXAMPLE 26: High-Throughput Screening Assay for T-cell Activity
NF-KB (Nuclear Factor KB) is a transcription factor activated by a wide variety of agents including the inflammatory cytokines LL-1 and TNF, CD30 and CD40, lymphotoxin- alpha and lymphotoxin-beta, by exposure to LPS or thrombin, and by expression of certain viral gene products. As a transcription factor, NF-KB regulates the expression of genes involved in immune cell activation, control of apoptosis (NF-KB appears to shield cells from apoptosis), B and T-cell development, anti-viral and antimicrobial responses, and multiple stress responses. In non-stimulated conditions, NF- KB is retained in the cytoplasm with I-KB
(Inhibitor KB). However, upon stimulation, I-KB is phosphorylated and degraded, causing NF-KB to shuttle to the nucleus, thereby activating transcription of target genes. Target genes activated by NF-KB include IL-2, IL-6, GM-CSF, ICAM-1 and class 1 MHC.
Due to its central role and ability to respond to a range of stimuli, reporter constmcts utilizing the NF-KB promoter element are used to screen the supernatants produced in Example 21. Activators or inhibitors of NF-KB would be useful in treating, preventing, and/or diagnosing diseases. For example, inhibitors of NF-KB could be used to treat those diseases related to the acute or chronic activation of NF-KB, such as rheumatoid arthritis.
To constmct a vector containing the NF-KB promoter element, a PCR based strategy is employed. The upstream primer contains four tandem copies of the NF-KB binding site (GGGGACTTTCCC) (SEQ ID NO:28), 18 bp of sequence complementary to the 5' end of the SV40 early promoter sequence, and is flanked with an Xhol site:
5':GCGGCCTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTT CCATCCTGCCATCTCAATTAG:3' (SEQ ID NO:29) The downstream primer is complementary to the 3' end of the SV40 promoter and is flanked with a Hind III site: 5':GCGGCAAGCTTTTTGCAAAGCCTAGGC:3' (SEQ ID NO:24)
PCR amplification is performed using the SV40 promoter template present in the pB- gahpromoter plasmid obtained from Clontech. The resulting PCR fragment is digested with Xhol and Hind III and subcloned into BLSK2-. (Stratagene) Sequencing with the T7 and T3 primers confirms the insert contains the following sequence:
5':CTCGAGGGGACTTTCCCGGGGACTTTCCGGGGACTTTCCGGGACTTTCCATCT GCCATCTCAATTAGTCAGCAACCATAGTCCCGCCCCTAACTCCGCCCATCCCGCC CCTAACTCCGCCCAGTTCCGCCCATTCTCCGCCCCATGGCTGACTAATTTTTTTTA TTTATGCAGAGGCCGAGGCCGCCTCGGCCTCTGAGCTATTCCAGAAGTAGTGAG GAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAAAAGCTT:3' (SEQ ID NO: 30)
Next, replace the SV40 minimal promoter element present in the pSEAP2-promoter plasmid (Clontech) with this NF-KB/SV40 fragment using Xhol and Hindlll. However, this vector does not contain a neomycin resistance gene, and therefore, is not preferred for mammalian expression systems.
In order to generate stable mammalian cell lines, the NF-KB/SV40/SEAP cassette is removed from the above NF-KB/SEAP vector using restriction enzymes Sail and Notl, and inserted into a vector containing neomycin resistance. Particularly, the NF-KB/SV40/SEAP cassette was inserted into pGFP-1 (Clontech), replacing the GFP gene, after restricting pGFP-1 with Sail and Notl.
Once NF-KB/SV40/SEAP/Neo vector is created, stable Jurkat T-cells are created and maintained according to the protocol described in Example 23. Similarly, the method for assaying supernatants with these stable Jurkat T-cells is also described in Example 23. As a positive control, exogenous TNF alpha (0.1,1, 10 ng) is added to wells H9, H10, and HI 1 , with a 5-10 fold activation typically observed.
EXAMPLE 27: Assay for SEAP Activity As a reporter molecule for the assays described in Examples 23-26, SEAP activity is assayed using the Tropix Phospho-light Kit (Cat. BP-400) according to the following general procedure. The Tropix Phospho-light Kit supplies the Dilution, Assay, and Reaction Buffers used below.
Prime a dispenser with the 2.5x Dilution Buffer and dispense 15 ul of 2.5x dilution buffer into Optiplates containing 35 ul of a supernatant. Seal the plates with a plastic sealer and incubate at 65 degree C for 30 min. Separate the Optiplates to avoid uneven heating.
Cool the samples to room temperature for 15 minutes. Empty the dispenser and prime with the Assay Buffer. Add 50 ml Assay Buffer and incubate at room temperature 5 min. Empty the dispenser and prime with the Reaction Buffer (see the table below). Add 50 ul Reaction Buffer and incubate at room temperature for 20 minutes. Since the intensity of the chemiluminescent signal is time dependent, and it takes about 10 minutes to read 5 plates on luminometer, one should treat 5 plates at each time and start the second set 10 minutes later.
Read the relative light unit in the luminometer. Set HI 2 as blank, and print the results. An increase in chemiluminescence indicates reporter activity.
Reaction Buffer Formulation:
# of plates Rxn buffer diluent (ml) CSPD (ml)
_ ________ _ ... _ _ _ _
10 60
11 65 3.25
12 70 3.5
13 75 3.75 80 4 85 4.25 90 4.5 95 4.75 100 5 105 5.25 110 5.5 115 5.75 120 6 125 6.25 130 6.5 135 6.75 140 7 145 7.25 150 7.5 155 7.75 160 8 165 8.25 170 8.5 175 8.75 180 9 185 9.25 190 9.5 195 9.75 200 10 205 10.25 210 10.5 215 10.75 220 11 225 11.25 230 11.5 235 11.75 240 12 245 12.25 250 12.5 255 12.75 260 13 EXAMPLE 28: High-Throughput Screening Assay Identifying Changes in Small Molecule Concentration and Membrane Permeability
Binding of a ligand to a receptor is known to alter intracellular levels of small molecules, such as calcium, potassium, sodium, and pH, as well as alter membrane potential. These alterations can be measured in an assay to identify supernatants which bind to receptors of a particular cell. Although the following protocol describes an assay for calcium, this protocol can easily be modified to detect changes in potassium, sodium, pH, membrane potential, or any other small molecule which is detectable by a fluorescent probe.
The following assay uses Fluorometric Imaging Plate Reader ("FLIPR") to measure changes in fluorescent molecules (Molecular Probes) that bind small molecules. Clearly, any fluorescent molecule detecting a small molecule can be used instead of the calcium fluorescent molecule, fluo-4 (Molecular Probes, Inc.; catalog no. F- 14202), used here.
For adherent cells, seed the cells at 10,000 -20,000 cells/well in a Co-star black 96- well plate with clear bottom. The plate is incubated in a CO2 incubator for 20 hours. The adherent cells are washed two times in Biotek washer with 200 ul of HBSS (Hank's Balanced Salt Solution) leaving 100 ul of buffer after the final wash.
A stock solution of 1 mg/ml fluo-4 is made in 10% pluronic acid DMSO. To load the cells with fluo-4 , 50 ul of 12 ug/ml fluo-4 is added to each well. The plate is incubated at 37 degrees C in a CO2 incubator for 60 min. The plate is washed four times in the Biotek washer with HBSS leaving 100 ul of buffer.
For non-adherent cells, the cells are spun down from culture media. Cells are resuspended to 2-5x106 cells/ml with HBSS in a 50-ml conical tube. 4 ul of 1 mg/ml fluo-4 solution in 10% pluronic acid DMSO is added to each ml of cell suspension. The tube is then placed in a 37 degrees C water bath for 30-60 min. The cells are washed twice with HBSS, resuspended to lxlO6 cells/ml, and dispensed into a microplate, 100 ul/well. The plate is centrifuged at 1000 φm for 5 min. The plate is then washed once in Denley CellWash with 200 ul, followed by an aspiration step to 100 ul final volume.
For a non-cell based assay, each well contains a fluorescent molecule, such as fluo- 4. The supernatant containing the protein to be tested is added to the well, and a change in fluorescence is detected.
To measure the fluorescence of intracellular calcium, the FLIPR is set for the following parameters: (1) System gain is 300-800 mW; (2) Exposure time is 0.4 second; (3) Camera F/stop is F/2; (4) Excitation is 488 nm; (5) Emission is 530 nm; and (6) Sample addition is 50 ul. Increased emission at 530 nm indicates an extracellular signaling event caused by the a molecule, either Ckβ-4 or Ckβ-10 or a molecule induced by Ckβ-4 or Ckβ- 10, which has resulted in an increase in the intracellular Ca++ concentration. EXAMPLE 29: High-Throughput Screening Assay Identifying Tyrosine Kinase Activity
The Protein Tyrosine Kinases (PTK) represent a diverse group of transmembrane and cytoplasmic kinases. Within the Receptor Protein Tyrosine Kinase RPTK) group are receptors for a range of mitogenic and metabolic growth factors including the PDGF, FGF,
EGF, NGF, HGF and Insulin receptor subfamilies. In addition there are a large family of
RPTKs for which the corresponding ligand is unknown. Ligands for RPTKs include mainly secreted small proteins, but also membrane-bound and extracellular matrix proteins.
Activation of RPTK by ligands involves ligand-mediated receptor dimerization, resulting in transphosphorylation of the receptor subunits and activation of the cytoplasmic tyrosine kinases. The cytoplasmic tyrosine kinases include receptor associated tyrosine kinases of the src-family (e.g., src, yes, lck, lyn, fyn) and non-receptor linked and cytosolic protein tyrosine kinases, such as the Jak family, members of which mediate signal transduction triggered by the cytokine superfamily of receptors (e.g., the Interleukins, Interferons, GM-CSF, and Leptin).
Because of the wide range of known factors capable of stimulating tyrosine kinase activity, identifying whether Ckβ-4 or Ckβ-10 or a molecule induced by Ckβ-4 or Ckβ-10 is capable of activating tyrosine kinase signal transduction pathways is of interest. Therefore, the following protocol is designed to identify such molecules capable of activating the tyrosine kinase signal transduction pathways.
Seed target cells (e.g., primary keratinocytes) at a density of approximately 25,000 cells per well in a 96 well Loprodyne Silent Screen Plates purchased from Nalge Nunc (Naperville, IL). The plates are sterilized with two 30 minute rinses with 100% ethanol, rinsed with water and dried overnight. Some plates are coated for 2 hr with 100 ml of cell culture grade type I collagen (50 mg/ml), gelatin (2%) or polylysine (50 mg/ml), all of which can be purchased from Sigma Chemicals (St. Louis, MO) or 10% Matrigel purchased from Becton Dickinson (Bedford,MA), or calf serum, rinsed with PBS and stored at 4 degree C. Cell growth on these plates is assayed by seeding 5,000 cells/well in growth medium and indirect quantitation of cell number through use of alamarBlue as described by the manufacturer Alamar Biosciences, Inc. (Sacramento, CA) after 48 hr. Falcon plate covers #3071 from Becton Dickinson (Bedford,MA) are used to cover the Loprodyne Silent Screen Plates. Falcon Microtest III cell culture plates can also be used in some proliferation experiments.
To prepare extracts, A431 cells are seeded onto the nylon membranes of Loprodyne plates (20,000/200ml/well) and cultured overnight in complete medium. Cells are quiesced by incubation in semm-free basal medium for 24 hr. After 5-20 minutes treatment with EGF (60ng/ml) or 50 ul of the supernatant produced in Example 21, the medium was removed and 100 ml of extraction buffer ((20 mM HEPES pH 7.5, 0.15 M NaCl, 1% Triton X-100, 0.1% SDS, 2 mM Na3VO4, 2 mM Na4P2O7 and a cocktail of protease inhibitors (# 1836170) obtained from Boeheringer Mannheim (Indianapolis, IN) is added to each well and the plate is shaken on a rotating shaker for 5 minutes at 4oC. The plate is then placed in a vacuum transfer manifold and the extract filtered through the 0.45 mm membrane bottoms of each well using house vacuum. Extracts are collected in a 96-well catch/assay plate in the bottom of the vacuum manifold and immediately placed on ice. To obtain extracts clarified by centrifugation, the content of each well, after detergent solubilization for 5 minutes, is removed and centrifuged for 15 minutes at 4 degree C at 16,000 x g. Test the filtered extracts for levels of tyrosine kinase activity. Although many methods of detecting tyrosine kinase activity are known, one method is described here.
Generally, the tyrosine kinase activity of a supernatant is evaluated by determining its ability to phosphorylate a tyrosine residue on a specific substrate (a biotinylated peptide). Biotinylated peptides that can be used for this puφose include PSK1 (corresponding to amino acids 6-20 of the cell division kinase cdc2-p34) and PSK2 (corresponding to amino acids 1-17 of gastrin). Both peptides are substrates for a range of tyrosine kinases and are available from Boehringer Mannheim.
The tyrosine kinase reaction is set up by adding the following components in order. First, add lOul of 5uM Biotinylated Peptide, then lOul ATP/Mg2+ (5mM ATP/50mM MgC12), then lOul of 5x Assay Buffer (40mM imidazole hydrochloride, pH7.3, 40 mM beta-glycerophosphate, lmM EGTA, lOOmM MgC12, 5 mM MnC12, 0.5 mg/ml BSA), then 5ul of Sodium Vanadate(lmM), and then 5ul of water. Mix the components gently and preincubate the reaction mix at 30 degree C for 2 min. Initial the reaction by adding lOul of the control enzyme or the filtered supernatant. The tyrosine kinase assay reaction is then terminated by adding 10 ul of 120mM
EDTA and place the reactions on ice.
Tyrosine kinase activity is determined by transferring 50 ul aliquot of reaction mixture to a microtiter plate (MTP) module and incubating at 37 degree C for 20 min. This allows the streptavadin coated 96 well plate to associate with the biotinylated peptide. Wash the MTP module with 300ul well of PBS four times. Next add 75 ul of anti-phospotyrosine antibody conjugated to horse radish peroxidase(anti-P-Tyr-POD(0.5u/ml)) to each well and incubate at 37 degree C for one hour. Wash the well as above.
Next add lOOul of peroxidase substrate solution (Boehringer Mannheim) and incubate at room temperature for at least 5 mins (up to 30 min). Measure the absorbance of the sample at 405 nm by using ELISA reader. The level of bound peroxidase activity is quantitated using an ELISA reader and reflects the level of tyrosine kinase activity. EXAMPLE 30: High-Throughput Screening Assay Identifying Phosphorylation Activity
As a potential alternative and/or compliment to the assay of protein tyrosine kinase activity described in Example 29, an assay which detects activation (phosphorylation) of major intracellular signal transduction intermediates can also be used. For example, as described below one particular assay can detect tyrosine phosphorylation of the Erk-1 and Erk-2 kinases. However, phosphorylation of other molecules, such as Raf, JNK, p38 MAP, Map kinase kinase (MEK), MEK kinase, Src, Muscle specific kinase (MuSK), IRAK, Tec, and Janus, as well as any other phosphoserine, phosphotyrosine, or phosphothreonine molecule, can be detected by substituting these molecules for Erk-1 or Erk-2 in the following assay.
Specifically, assay plates are made by coating the wells of a 96-well ELISA plate with 0.1ml of protein G (lug/ml) for 2 hr at room temp, (RT). The plates are then rinsed with PBS and blocked with 3% BSA/PBS for 1 hr at RT. The protein G plates are then treated with 2 commercial monoclonal antibodies (lOOng/well) against Erk-1 and Erk-2 (1 hr at RT) (Santa Cmz Biotechnology). (To detect other molecules, this step can easily be modified by substituting a monoclonal antibody detecting any of the above described molecules.) After 3-5 rinses with PBS, the plates are stored at 4 degree C until use.
A431 cells are seeded at 20,000/well in a 96-well Loprodyne filteφlate and cultured overnight in growth medium. The cells are then starved for 48 hr in basal medium (DMEM) and then treated with EGF (6ng/well) or 50 ul of the supernatants obtained in Example 21 for
5-20 minutes. The cells are then solubilized and extracts filtered directly into the assay plate.
After incubation with the extract for 1 hr at RT, the wells are again rinsed. As a positive control, a commercial preparation of MAP kinase (lOng/well) is used in place of A431 extract. Plates are then treated with a commercial polyclonal (rabbit) antibody (lug/ml) which specifically recognizes the phosphorylated epitope of the Erk-1 and Erk-2 kinases (1 hr at RT). This antibody is biotinylated by standard procedures. The bound polyclonal antibody is then quantitated by successive incubations with Europium-streptavidin and Europium fluorescence enhancing reagent in the Wallac DELFIA instmment (time-resolved fluorescence). An increased fluorescent signal over background indicates a phosphorylation by Ckβ-4 or Ckβ-10 or by a molecule induced by Ckβ-4 or Ckβ-10.
EXAMPLE 31: Method of Determining Alterations in the Ckβ-4 or Ckβ-10
Gene RNA isolated from entire families or individual patients presenting with a phenotype of interest (such as a disease) is be isolated. cDNA is then generated from these RNA samples using protocols known in the art. (See, Sambrook.) The cDNA is then used as a template for PCR, employing primers surrounding regions of interest in SEQ ED NO: 1 or SEQ ED NO:3. Suggested PCR conditions consist of 35 cycles at 95 degree C for 30 seconds; 60-120 seconds at 52-58 degree C; and 60-120 seconds at 70 degree C, using buffer solutions described in Sidransky, D., et al., Science 252:706 (1991). PCR products are then sequenced using primers labeled at their 5' end with T4 polynucleotide kinase, employing SequiTherm Polymerase. (Epicentre Technologies). The intron-exon borders of selected exons of Ckβ-4 or Ckβ-10 is also determined and genomic
PCR products analyzed to confirm the results. PCR products harboring suspected mutations in Ckβ-4 or Ckβ-10 are then cloned and sequenced to validate the results of the direct sequencing.
PCR products of Ckβ-4 or Ckβ-10 are cloned into T-tailed vectors as described in
Holton, T.A. and Graham, M.W., Nucleic Acids Research, 19: 1156 (1991) and sequenced with T7 polymerase (United States Biochemical). Affected individuals are identified by mutations in Ckβ-4 or Ckβ-10 not present in unaffected individuals. Genomic rearrangements are also observed as a method of determining alterations in a gene corresponding to Ckβ-4 or Ckβ-10. Genomic clones isolated according to methods known in the art are nick-translated with digoxigenindeoxy-uridine 5'-triphosphate (Boehringer Manheim), and FISH performed as described in Johnson, Cg. et al., Methods Cell Biol. 35:73-99 (1991). Hybridization with the labeled probe is carried out using a vast excess of human cot-1 DNA for specific hybridization to the Ckβ-4 or Ckβ-10 genomic locus.
Chromosomes are counterstained with 4,6-diamino-2-phenylidole and propidium iodide, producing a combination of C- and R-bands. Aligned images for precise mapping are obtained using a triple-band filter set (Chroma Technology, Brattleboro, VT) in combination with a cooled charge-coupled device camera (Photometries, Tucson, AZ) and variable excitation wavelength filters. (Johnson, Cv. et al., Genet. Anal. Tech. Appl., 8:75 (1991).) Lmage collection, analysis and chromosomal fractional length measurements are performed using the ISee Graphical Program System. (Inovision Coφoration, Durham,
NC.) Chromosome alterations of the genomic region of Ckβ-4 or Ckβ-10 (hybridized by the probe) are identified as insertions, deletions, and translocations. These Ckβ-4 or Ckβ- 10 alterations are used as a diagnostic marker for an associated disease. Example 32: Method of Detecting Abnormal Levels of Ckβ-4 or Ckβ-10 in a Biological Sample
Ckβ-4 or Ckβ-10 polypeptides can be detected in a biological sample, and if an increased or decreased level of Ckβ-4 or Ckβ-10 is detected, this polypeptide is a marker for a particular phenotype. Methods of detection are numerous, and thus, it is understood that one skilled in the art can modify the following assay to fit their particular needs.
For example, antibody-sandwich ELISAs are used to detect Ckβ-4 or Ckβ-10 in a sample, preferably a biological sample. Wells of a microtiter plate are coated with specific antibodies to Ckβ-4 or Ckβ-10, at a final concentration of 0.2 to 10 ug/ml. The antibodies are either monoclonal or polyclonal and are produced by the method described in Example
20. The wells are blocked so that non-specific binding of Ckβ-4 or Ckβ-10 to the well is reduced.
The coated wells are then incubated for > 2 hours at RT with a sample containing
Ckβ-4 or Ckβ-10. Preferably, serial dilutions of the sample should be used to validate results. The plates are then washed three times with deionized or distilled water to remove unbounded Ckβ-4 or Ckβ-10.
Next, 50 ul of specific antibody-alkaline phosphatase conjugate, at a concentration of 25-400 ng, is added and incubated for 2 hours at room temperature. The plates are again washed three times with deionized or distilled water to remove unbounded conjugate. Add 75 ul of 4-methylumbelliferyl phosphate (MUP) or p-nitrophenyl phosphate
(NPP) substrate solution to each well and incubate 1 hour at room temperature. Measure the reaction by a microtiter plate reader. Prepare a standard curve, using serial dilutions of a control sample, and plot Ckβ-4 or Ckβ-10 polypeptide concentration on the X-axis (log scale) and fluorescence or absorbance of the Y-axis (linear scale). Inteφolate the concentration of the Ckβ-4 or Ckβ-10 in the sample using the standard curve.
EXAMPLE 33: Formulation
The invention also provides methods of treatment and/or prevention of diseases, disorders, and/or conditions (such as, for example, any one or more of the diseases, disorders, and/or conditions disclosed herein) by administration to a subject of an effective amount of a Therapeutic. By therapeutic is meant a polynucleotides or polypeptides of the invention (including fragments and variants), agonists or antagonists thereof, and/or antibodies thereto, in combination with a pharmaceutically acceptable carrier type (e.g., a sterile carrier).
The Therapeutic will be formulated and dosed in a fashion consistent with good medical practice, taking into account the clinical condition of the individual patient (especially the side effects of treatment with the Therapeutic alone), the site of delivery, the method of administration, the scheduling of administration, and other factors known to practitioners. The "effective amount" for puφoses herein is thus determined by such considerations.
As a general proposition, the total pharmaceutically effective amount of the Therapeutic administered parenterally per dose will be in the range of about lug/kg/day to 10 mg/kg/day of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg/kg/day, and most preferably for humans between about 0.01 and 1 mg/kg/day for the hormone. If given continuously, the Therapeutic is typically administered at a dose rate of about 1 ug/kg/hour to about 50 ug/kg/hour, either by 1-4 injections per day or by continuous subcutaneous infusions, for example, using a mini-pump. An intravenous bag solution may also be employed. The length of treatment needed to observe changes and the interval following treatment for responses to occur appears to vary depending on the desired effect.
Therapeutics can be are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion. Therapeutics of the invention are also suitably administered by sustained-release systems. Suitable examples of sustained-release Therapeutics are administered orally, rectally, parenterally, intracistemally, intravaginally, intraperitoneally, topically (as by powders, ointments, gels, drops or transdermal patch), bucally, or as an oral or nasal spray. "Pharmaceutically acceptable carrier" refers to a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The term "parenteral" as used herein refers to modes of administration which include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
Therapeutics of the invention are also suitably administered by sustained-release systems. Suitable examples of sustained-release Therapeutics include suitable polymeric materials (such as, for example, semi-permeable polymer matrices in the form of shaped articles, e.g., films, or mirocapsules), suitable hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, and sparingly soluble derivatives (such as, for example, a sparingly soluble salt). Sustained-release matrices include polylactides (U.S. Pat. No. 3,773,919, EP 58,481), copolymers of L-glutamic acid and gamma-ethyl-L-glutamate (Sidman et al., Biopolymers 22:547-556 (1983)), poly (2- hydroxyethyl methacrylate) (Langer et al., J. Biomed. Mater. Res. 15:167-277 (1981), and Langer, Chem. Tech. 12:98-105 (1982)), ethylene vinyl acetate (Langer et al., Id.) or poly-D- (-)-3-hydroxybutyric acid (EP 133,988).
Sustained-release Therapeutics also include liposomally entrapped Therapeutics of the invention (see generally, Langer, Science 249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy of Infectious Disease and Cancer, Lopez-Berestein and Fidler (eds.), Liss, New York, pp. 317 -327 and 353-365 (1989)). Liposomes containing the Therapeutic are prepared by methods known per se: DE 3,218,121 ; Epstein et al., Proc. Natl. Acad. Sci. (USA) 82:3688-3692 (1985); Hwang et al., Proc. Natl. Acad. Sci.(USA) 77:4030-4034 (1980); EP 52,322; EP 36,676; EP 88,046; EP 143,949; EP 142,641; Japanese Pat. Appl. 83-118008; U.S. Pat. Nos. 4,485,045 and 4,544,545; and EP 102,324. Ordinarily, the liposomes are of the small (about 200-800 Angstroms) unilamellar type in which the lipid content is greater than about 30 mol. percent cholesterol, the selected proportion being adjusted for the optimal Therapeutic.
In yet an additional embodiment, the Therapeutics of the invention are delivered by way of a pump (see Langer, supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwald et al., Surgery 88:507 (1980); Saudek et al., N. Engl. J. Med. 321:574 (1989)). Other controlled release systems are discussed in the review by Langer (Science 249: 1527-1533 (1990)).
For parenteral administration, in one embodiment, the Therapeutic is formulated generally by mixing it at the desired degree of purity, in a unit dosage injectable form (solution, suspension, or emulsion), with a pharmaceutically acceptable carrier, i.e., one that is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation. For example, the formulation preferably does not include oxidizing agents and other compounds that are known to be deleterious to the Therapeutic. Generally, the formulations are prepared by contacting the Therapeutic uniformly and intimately with liquid carriers or finely divided solid carriers or both. Then, if necessary, the product is shaped into the desired formulation. Preferably the carrier is a parenteral carrier, more preferably a solution that is isotonic with the blood of the recipient. Examples of such carrier vehicles include water, saline, Ringer's solution, and dextrose solution. Non- aqueous vehicles such as fixed oils and ethyl oleate are also useful herein, as well as liposomes.
The carrier suitably contains minor amounts of additives such as substances that enhance isotonicity and chemical stability. Such materials are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, succinate, acetic acid, and other organic acids or their salts; antioxidants such as ascorbic acid; low molecular weight (less than about ten residues) polypeptides, e.g., polyarginine or tripeptides; proteins, such as semm albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids, such as glycine, glutamic acid, aspartic acid, or arginine; monosaccharides, disaccharides, and other carbohydrates including cellulose or its derivatives, glucose, manose, or dextrins; chelating agents such as EDTA; sugar alcohols such as mannitol or sorbitol; counterions such as sodium; and/or nonionic surfactants such as polysorbates, poloxamers, or PEG. The Therapeutic is typically formulated in such vehicles at a concentration of about
0.1 mg/ml to 100 mg/ml, preferably 1-10 mg/ml, at a pH of about 3 to 8. It will be understood that the use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of polypeptide salts.
Any pharmaceutical used for therapeutic administration can be sterile. Sterility is readily accomplished by filtration through sterile filtration membranes (e.g., 0.2 micron membranes). Therapeutics generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle.
Therapeutics ordinarily will be stored in unit or multi-dose containers, for example, sealed ampoules or vials, as an aqueous solution or as a lyophilized formulation for reconstitution. As an example of a lyophilized formulation, 10-ml vials are filled with 5 ml of sterile-filtered 1% (w/v) aqueous Therapeutic solution, and the resulting mixture is lyophilized. The infusion solution is prepared by reconstituting the lyophilized Therapeutic using bacteriostatic Water-for-Injection. The invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the Therapeutics of the invention. Associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. In addition, the Therapeutics may be employed in conjunction with other therapeutic compounds.
The Therapeutics of the invention may be administered alone or in combination with adjuvants. Adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, alum, alum plus deoxycholate (ImmunoAg), MTP-PE (Biocine Coφ.), QS21 (Genentech, Inc.), BCG, and MPL. In a specific embodiment, Therapeutics of the invention are administered in combination with alum. In another specific embodiment, Therapeutics of the invention are administered in combination with QS-21. Further adjuvants that may be administered with the Therapeutics of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS- 18, CRL1005, Aluminum salts, MF-59, and Virosomal adjuvant technology. Vaccines that may be administered with the Therapeutics of the invention include, but are not limited to, vaccines directed toward protection against MMR (measles, mumps, rubella), polio, varicella, tetanus/diptheria, hepatitis A, hepatitis B, haemophilus influenzae B, whooping cough, pneumonia, influenza, Lyme's Disease, rotavims, cholera, yellow fever, Japanese encephalitis, poliomyelitis, rabies, typhoid fever, and pertussis. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second.
The Therapeutics of the invention may be administered alone or in combination with other therapeutic agents. Therapeutic agents that may be administered in combination with the Therapeutics of the invention, include but not limited to, other members of the TNF family, chemotherapeutic agents, antibiotics, steroidal and non-steroidal anti-inflammatories, conventional immunotherapeutic agents, cytokines and/or growth factors. Combinations may be administered either concomitantly, e.g., as an admixture, separately but simultaneously or concurrently; or sequentially. This includes presentations in which the combined agents are administered together as a therapeutic mixture, and also procedures in which the combined agents are administered separately but simultaneously, e.g., as through separate intravenous lines into the same individual. Administration "in combination" further includes the separate administration of one of the compounds or agents given first, followed by the second.
In one embodiment, the Therapeutics of the invention are administered in combination with members of the TNF family. TNF, TNF-related or TNF-like molecules that may be administered with the Therapeutics of the invention include, but are not limited to, soluble forms of TNF-alpha, lymphotoxin-alpha (LT-alpha, also known as TNF-beta), LT-beta (found in complex heterotrimer LT-alpha2-beta), OPGL, FasL, CD27L, CD30L, CD40L, 4-1BBL, DcR3, OX40L, TNF-gamma (International Publication No. WO 96/14328), ALM-I (International Publication No. WO 97/33899), endokine-alpha (International Publication No. WO 98/07880), TR6 (International Publication No. WO 98/30694), OPG, and neutrokine-alpha (International Publication No. WO 98/18921, OX40, and nerve growth factor (NGF), and soluble forms of Fas, CD30, CD27, CD40 and 4-IBB, TR2 (International Publication No. WO 96/34095), DR3 (International Publication No. WO 97/33904), DR4 (International Publication No. WO 98/32856), TR5 (International Publication No. WO 98/30693), TR6 (International Publication No. WO 98/30694), TR7 (International Publication No. WO 98/41629), TRANK, TR9 (International Publication No. WO 98/56892),TR10 (International Publication No. WO 98/54202), 312C2 (International Publication No. WO 98/06842), and TR12, and soluble forms CD154, CD70, and CD153. In certain embodiments, Therapeutics of the invention are administered in combination with antiretroviral agents, nucleoside reverse transcriptase inhibitors, non- nucleoside reverse transcriptase inhibitors, and/or protease inhibitors. Nucleoside reverse transcriptase inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, RETROVER™ (zidovudine/AZT), VEDEX™
(didanosine/ddl), HTVTD™ (zalcitabine/ddC), ZERIT™ (stavudine/d4T), EPIVIR™ (lamivudine/3TC), and COMBIVLR™ (zidovudine/lamivudine). Non-nucleoside reverse transcriptase inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, VLRAMUNE™ (nevirapine), RESCRIPTOR™
(delavirdine), and SUSTIVA™ (efavirenz). Protease inhibitors that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, CRIXIVAN™ (indinavir), NORVIR™ (ritonavir), LNVIRASE™ (saquinavir), and
VLRACEPT™ (nelfinavir). In a specific embodiment, antiretroviral agents, nucleoside reverse transcriptase inhibitors, non-nucleoside reverse transcriptase inhibitors, and/or protease inhibitors may be used in any combination with Therapeutics of the invention to treat AIDS and/or to prevent or treat HIV infection. In other embodiments, Therapeutics of the invention may be administered in combination with anti-opportunistic infection agents. Anti-opportunistic agents that may be administered in combination with the Therapeutics of the invention, include, but are not limited to, TRIMETHOPRLM-SULFAMETHOXAZOLE™, DAPSONE™
PENTAMIDLNE™, ATOVAQUONE™, ISONIAZID™, RIFAMPIN™ PYRAZLNAMIDE™, ETHAMBUTOL™, RIFABUTIN™, CLARITHROMYCLN™
AZJ3ΗROMYCLN™, GANCICLOVIR™, FOSCARNET™, CIDOFOVIR™
FLUCONAZOLE™, LTRACONAZOLE™, KETOCONAZOLE™, ACYCLOVIR™
FAMCICOLVIR™, PYRIMETHAMLNE™, LEUCOVORIN™, NEUPOGEN™
(filgrastim/G-CSF), and LEUKINE™ (sargramostim/GM-CSF). In a specific embodiment, Therapeutics of the invention are used in any combination with TRLMETHOPRIM-
SULFAMETHOXAZOLE™, DAPSONE™, PENTAMIDLNE™, and/or ATOVAQUONE™ to prophylactically treat or prevent an opportunistic Pneumocystis caήnii pneumonia infection. In another specific embodiment, Therapeutics of the invention are used in any combination with ISONIAZID™, RIFAMPIN™, PYRAZLN AMIDE™, and/or
ETHAMBUTOL™ to prophylactically treat or prevent an opportunistic Mycobacterium avium complex infection. In another specific embodiment. Therapeutics of the invention are used in any combination with RIFABUTLN™, CLARITHROMYCIN™, and/or
AZITHROMYCEN™ to prophylactically treat or prevent an opportunistic Mycobacterium tuberculosis infection. In another specific embodiment, Therapeutics of the invention are used in any combination with GANCICLOVIR™, FOSCARNET™, and/or CIDOFOVLR™ to prophylactically treat or prevent an opportunistic cytomegalovims infection. In another specific embodiment, Therapeutics of the invention are used in any combination with
FLUCONAZOLE™, ITRACONAZOLE™, and/or KETOCONAZOLE™ to prophylactically treat or prevent an opportunistic fungal infection. In another specific embodiment,
Therapeutics of the invention are used in any combination with ACYCLOVTR™ and/or FAMCICOLVIR™ to prophylactically treat or prevent an opportunistic heφes simplex vims type I and/or type II infection. In another specific embodiment, Therapeutics of the invention are used in any combination with PYRLMETHAMLNE™ and/or LEUCOVORLN™ to prophylactically treat or prevent an opportunistic Toxoplasma gondii infection. In another specific embodiment, Therapeutics of the invention are used in any combination with LEUCOVORLN™ and/or NEUPOGEN™ to prophylactically treat or prevent an opportunistic bacterial infection.
In a further embodiment, the Therapeutics of the invention are administered in combination with an antiviral agent. Antiviral agents that may be administered with the Therapeutics of the invention include, but are not limited to, acyclovir, ribavirin, amantadine, and remantidine.
In a further embodiment, the Therapeutics of the invention are administered in combination with an antibiotic agent. Antibiotic agents that may be administered with the Therapeutics of the invention include, but are not limited to, amoxicillin, beta-lactamases, aminoglycosides, beta-lactam (glycopeptide), beta-lactamases, Clindamycin, chloramphenicol, cephalosporins, ciprofloxacin, ciprofloxacin, erythromycin, fluoroquinolones, macrolides, metronidazole, penicillins, quinolones, rifampin, streptomycin, sulfonamide, tetracyclines, trimethoprim, trimethoprim-sulfamthoxazole, and vancomycin. Conventional nonspecific immunosuppressive agents, that may be administered in combination with the Therapeutics of the invention include, but are not limited to, steroids, cyclosporine, cyclosporine analogs, cyclophosphamide methylprednisone, prednisone, azathioprine, FK-506, 15-deoxyspergualin, and other immunosuppressive agents that act by suppressing the function of responding T cells.
In specific embodiments, Therapeutics of the invention are administered in combination with immunosuppressants. Immunosuppressants preparations that may be administered with the Therapeutics of the invention include, but are not limited to,
ORTHOCLONE™ (OKT3), SANDLMMUNE™/NEORAL™/SANGDYA™ (cyclosporin), PROGRAF™ (tacrolimus), CELLCEPT™ (mycophenolate), Azathioprine, glucorticosteroids, and RAPAMUNE™ (sirolimus). In a specific embodiment, immunosuppressants may be used to prevent rejection of organ or bone marrow transplantation.
In an additional embodiment, Therapeutics of the invention are administered alone or in combination with one or more intravenous immune globulin preparations. Intravenous immune globulin preparations that may be administered with the Therapeutics of the invention include, but not limited to, GAMMAR™, IVEEGAM™, SANDOGLOBULIN™,
GAMMAGARD S/D™, and GAMLMUNE™. In a specific embodiment, Therapeutics of the invention are administered in combination with intravenous immune globulin preparations in transplantation therapy (e.g., bone marrow transplant).
In an additional embodiment, the Therapeutics of the invention are administered alone or in combination with an anti-inflammatory agent. Anti-inflammatory agents that may be administered with the Therapeutics of the invention include, but are not limited to, glucocorticoids and the nonsteroidal anti-inflammatories, aminoarylcarboxylic acid derivatives, arylacetic acid derivatives, arylbutyric acid derivatives, arylcarboxylic acids, arylpropionic acid derivatives, pyrazoles, pyrazolones, salicylic acid derivatives, thiazinecarboxamides, e-acetamidocaproic acid, S-adenosylmethionine, 3-amino-4- hydroxybutyric acid, amixetrine, bendazac, benzydamine, bucolome, difenpiramide, ditazol, emorfazone, guaiazulene, nabumetone, nimesulide, orgotein, oxaceprol, paranyline, perisoxal, pifoxime, proquazone, proxazole, and tenidap.
In another embodiment, compostions of the invention are administered in combination with a chemotherapeutic agent. Chemotherapeutic agents that may be administered with the Therapeutics of the invention include, but are not limited to, antibiotic derivatives (e.g., doxombicin, bleomycin, daunombicin, and dactinomycin); antiestrogens (e.g., tamoxifen); antimetabolites (e.g., fluorouracil, 5-FU, methotrexate, floxuridine, interferon alpha-2b, glutamic acid, plicamycin, mercaptopurine, and 6-thioguanine); cytotoxic agents (e.g., carmustine, BCNU, lomustine, CCNU, cytosine arabinoside, cyclophosphamide, estramustine, hydroxyurea, procarbazine, mitomycin, busulfan, cis- platin, and vincristine sulfate); hormones (e.g., medroxyprogesterone, estramustine phosphate sodium, ethinyl estradiol, estradiol, megestrol acetate, methyltestosterone, diethylstilbestrol diphosphate, chlorotrianisene, and testolactone); nitrogen mustard derivatives (e.g., mephalen, chorambucil, mechlorethamine (nitrogen mustard) and thiotepa); steroids and combinations (e.g., bethamethasone sodium phosphate); and others (e.g., dicarbazine, asparaginase, mitotane, vincristine sulfate, vinblastine sulfate, and etoposide). In a specific embodiment, Therapeutics of the invention are administered in combination with CHOP (cyclophosphamide, doxombicin, vincristine, and prednisone) or any combination of the components of CHOP. In another embodiment, Therapeutics of the invention are administered in combination with Rituximab. In a further embodiment, Therapeutics of the invention are administered with Rituxmab and CHOP, or Rituxmab and any combination of the components of CHOP.
In an additional embodiment, the Therapeutics of the invention are administered in combination with cytokines. Cytokines that may be administered with the Therapeutics of the invention include, but are not limited to, IL2, IL3, IL4, IL5, IL6, IL7, IL10, IL12, IL13, ELI 5, anti-CD40, CD40L, LFN-gamma and TNF-alpha. In another embodiment, Therapeutics of the invention may be administered with any interleukin, including, but not limited to, IL-lalpha, IL-lbeta, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, LL- 11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, LL-18, IL-19, IL-20, and IL-21.
In an additional embodiment, the Therapeutics of the invention are administered in combination with angiogenic proteins. Angiogenic proteins that may be administered with the Therapeutics of the invention include, but are not limited to, Glioma Derived Growth Factor (GDGF), as disclosed in European Patent Number EP-399816; Platelet Derived Growth Factor-A (PDGF-A), as disclosed in European Patent Number EP-682110; Platelet Derived Growth Factor-B (PDGF-B), as disclosed in European Patent Number EP-282317; Placental Growth Factor (P1GF), as disclosed in International Publication Number WO 92/06194; Placental Growth Factor-2 (PlGF-2), as disclosed in Hauser et al., Gorwth Factors, 4:259-268 (1993); Vascular Endothelial Growth Factor (VEGF), as disclosed in International Publication Number WO 90/13649; Vascular Endothelial Growth Factor-A (VEGF-A), as disclosed in European Patent Number EP-506477; Vascular Endothelial Growth Factor-2 (VEGF-2), as disclosed in International Publication Number WO 96/39515; Vascular Endothelial Growth Factor B (VEGF-3); Vascular Endothelial Growth Factor B-186 (VEGF-B186), as disclosed in International Publication Number WO 96/26736; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO 98/02543; Vascular Endothelial Growth Factor-D (VEGF-D), as disclosed in International Publication Number WO 98/07832; and Vascular Endothelial Growth Factor-E (VEGF-E), as disclosed in German Patent Number DEI 9639601. The above mentioned references are incoφorated herein by reference herein.
In an additional embodiment, the Therapeutics of the invention are administered in combination with hematopoietic growth factors. Hematopoietic growth factors that may be administered with the Therapeutics of the invention include, but are not limited to,
LEUKINE™ (SARGRAMOSTIM™) and NEUPOGEN™ (FILGRASTLM™).
In an additional embodiment, the Therapeutics of the invention are administered in combination with Fibroblast Growth Factors. Fibroblast Growth Factors that may be administered with the Therapeutics of the invention include, but are not limited to, FGF-1 ,
FGF-2, FGF-3, FGF-4, FGF-5, FGF-6, FGF-7, FGF-8, FGF-9, FGF- 10, FGF-11,
FGF- 12, FGF- 13, FGF- 14, and FGF- 15.
In additional embodiments, the Therapeutics of the invention are administered in combination with other therapeutic or prophylactic regimens, such as, for example, radiation therapy.
EXAMPLE 34: Method of Treating Decreased Levels of Ckβ-4 or Ckβ-10
The present invention relates to a method for treating an individual in need of an increased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an agonist of the invention (including polypeptides of the invention). Moreover, it will be appreciated that conditions caused by a decrease in the standard or normal expression level of Ckβ-4 or
Ckβ-10 in an individual can be treated by administering Ckβ-4 or Ckβ-10, preferably in the secreted form. Thus, the invention also provides a method of treatment of an individual in need of an increased level of Ckβ-4 or Ckβ-10 polypeptide comprising administering to such an individual a Therapeutic comprising an amount of Ckβ-4 or Ckβ-10 to increase the activity level of Ckβ-4 or Ckβ-10 in such an individual.
For example, a patient with decreased levels of Ckβ-4 or Ckβ-10 polypeptide receives a daily dose 0.1-100 ug/kg of the polypeptide for six consecutive days. Preferably, the polypeptide is in the secreted form. The exact details of the dosing scheme, based on administration and formulation, are provided in Example 33.
EXAMPLE 35: Method of Treating Increased Levels of Ckβ-4 or Ckβ-10
The present invention also relates to a method of treating an individual in need of a decreased level of a polypeptide of the invention in the body comprising administering to such an individual a composition comprising a therapeutically effective amount of an antagonist of the invention (including polypeptides and antibodies of the invention).
In one example, antisense technology is used to inhibit production of Ckβ-4 or Ckβ- 10. This technology is one example of a method of decreasing levels of Ckβ-4 or Ckβ-10 polypeptide, preferably a secreted form, due to a variety of etiologies, such as cancer.
For example, a patient diagnosed with abnormally increased levels of Ckβ-4 or Ckβ- 10 is administered intravenously antisense polynucleotides at 0.5, 1.0, 1.5, 2.0 and 3.0 mg/kg day for 21 days. This treatment is repeated after a 7-day rest period if the treatment was well tolerated. The formulation of the antisense polynucleotide is provided in Example 33.
EXAMPLE 36: Method of Treatment Using Gene Therapy - Ex Vivo
One method of gene therapy transplants fibroblasts, which are capable of expressing Ckβ-4 or Ckβ-10 polypeptides, onto a patient. Generally, fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in tissue-culture medium and separated into small pieces. Small chunks of the tissue are placed on a wet surface of a tissue culture flask, approximately ten pieces are placed in each flask. The flask is turned upside down, closed tight and left at room temperature over night. After 24 hours at room temperature, the flask is inverted and the chunks of tissue remain fixed to the bottom of the flask and fresh media (e.g., Ham's F12 media, with 10% FBS, penicillin and streptomycin) is added. The flasks are then incubated at 37 degree C for approximately one week. At this time, fresh media is added and subsequently changed every several days. After an additional two weeks in culture, a monolayer of fibroblasts emerge. The monolayer is trypsinized and scaled into larger flasks. pMV-7 (Kirschmeier, P.T. et al., DNA, 7:219-25 (1988)), flanked by the long terminal repeats of the Moloney murine sarcoma vims, is digested with EcoRI and Hindlll and subsequently treated with calf intestinal phosphatase. The linear vector is fractionated on agarose gel and purified, using glass beads. The cDNA encoding Ckβ-4 or Ckβ-10 can be amplified using PCR primers which correspond to the 5' and 3' end sequences respectively as set forth in Example 1 and Example 2, respectively. Preferably, the 5' primer contains an EcoRI site and the 3' primer includes a Hindlll site. Equal quantities of the Moloney murine sarcoma vims linear backbone and the amplified EcoRI and Hindlll fragment are added together, in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The ligation mixture is then used to transform bacteria HB101, which are then plated onto agar containing kanamycin for the puφose of confirming that the vector contains properly inserted Ckβ-4 or Ckβ-10.
The amphotropic pA317 or GP+aml2 packaging cells are grown in tissue culture to confluent density in Dulbecco's Modified Eagles Medium (DMEM) with 10% calf semm (CS), penicillin and streptomycin. The MSV vector containing the Ckβ-4 or Ckβ-10 gene is then added to the media and the packaging cells transduced with the vector. The packaging cells now produce infectious viral particles containing the Ckβ-4 or Ckβ-10 gene (the packaging cells are now referred to as producer cells).
Fresh media is added to the transduced producer cells, and subsequently, the media is harvested from a 10 cm plate of confluent producer cells. The spent media, containing the infectious viral particles, is filtered through a millipore filter to remove detached producer cells and this media is then used to infect fibroblast cells. Media is removed from a sub- confluent plate of fibroblasts and quickly replaced with the media from the producer cells. This media is removed and replaced with fresh media. If the titer of vims is high, then virtually all fibroblasts will be infected and no selection is required. If the titer is very low, then it is necessary to use a retroviral vector that has a selectable marker, such as neo or his. Once the fibroblasts have been efficiently infected, the fibroblasts are analyzed to determine whether Ckβ-4 or Ckβ-10 protein is produced.
The engineered fibroblasts are then transplanted onto the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads.
EXAMPLE 37: Gene Therapy Using Endogenous Ckβ-4 or Ckβ-10 Gene
Another method of gene therapy according to the present invention involves operably associating the endogenous Ckβ-4 or Ckβ-10 sequence with a promoter via homologous recombination as described, for example, in U.S. Patent No. 5,641,670, issued June 24,
1997; International Publication No. WO 96/29411, published September 26, 1996;
International Publication No. WO 94/12650, published August 4, 1994; Koller et al., Proc.
Natl. Acad. Sci. USA 86:8932-8935 (1989); and Zijlstra et al., Nature 342:435-438 (1989).
This method involves the activation of a gene which is present in the target cells, but which is not expressed in the cells, or is expressed at a lower level than desired.
Polynucleotide constmcts are made which contain a promoter and targeting sequences, which are homologous to the 5' non-coding sequence of endogenous Ckβ-4 or Ckβ-10, flanking the promoter. The targeting sequence will be sufficiently near the 5' end of Ckβ-4 or Ckβ-10 so the promoter will be operably linked to the endogenous sequence upon homologous recombination. The promoter and the targeting sequences can be amplified using PCR. Preferably, the amplified promoter contains distinct restriction enzyme sites on the 5' and 3' ends. Preferably, the 3' end of the first targeting sequence contains the same restriction enzyme site as the 5' end of the amplified promoter and the 5 ' end of the second targeting sequence contains the same restriction site as the 3' end of the amplified promoter.
The amplified promoter and the amplified targeting sequences are digested with the appropriate restriction enzymes and subsequently treated with calf intestinal phosphatase. The digested promoter and digested targeting sequences are added together in the presence of T4 DNA ligase. The resulting mixture is maintained under conditions appropriate for ligation of the two fragments. The constmct is size fractionated on an agarose gel then purified by phenol extraction and ethanol precipitation.
In this Example, the polynucleotide constmcts are administered as naked polynucleotides via electroporation. However, the polynucleotide constmcts may also be administered with transfection-facilitating agents, such as liposomes, viral sequences, viral particles, precipitating agents, etc. Such methods of delivery are known in the art.
Once the cells are transfected, homologous recombination will take place which results in the promoter being operably linked to the endogenous Ckβ-4 or Ckβ-10 sequence.
This results in the expression of Ckβ-4 or Ckβ-10 in the cell. Expression may be detected by immunological staining, or any other method known in the art.
Fibroblasts are obtained from a subject by skin biopsy. The resulting tissue is placed in DMEM + 10% fetal calf serum. Exponentially growing or early stationary phase fibroblasts are trypsinized and rinsed from the plastic surface with nutrient medium. An aliquot of the cell suspension is removed for counting, and the remaining cells are subjected to centrifugation. The supernatant is aspirated and the pellet is resuspended in 5 ml of electroporation buffer (20 mM HEPES pH 7.3, 137 mM NaCl, 5 mM KCl, 0.7 mM Na2 HPO4, 6 mM dextrose). The cells are recentrifuged, the supernatant aspirated, and the cells resuspended in electroporation buffer containing 1 mg/ml acetylated bovine semm albumin. The final cell suspension contains approximately 3X106 cells/ml. Electroporation should be performed immediately following resuspension.
Plasmid DNA is prepared according to standard techniques. For example, to constmct a plasmid for targeting to the Ckβ-4 or Ckβ-10 locus, plasmid pUC18 (MBI
Fermentas, Amherst, NY) is digested with Hindlll. The CMV promoter is amplified by
PCR with an Xbal site on the 5' end and a BamHI site on the 3'end. Two Ckβ-4 or Ckβ-10 non-coding sequences are amplified via PCR: one Ckβ-4 or Ckβ-10 non-coding sequence (Ckβ-4 or Ckβ-10 fragment 1) is amplified with a Hindlll site at the 5' end and an Xba site at the 3'end; the other Ckβ-4 or Ckβ-10 non-coding sequence (Ckβ-4 or Ckβ-10 fragment 2) is amplified with a BamHI site at the 5 'end and a Hindlll site at the 3'end. The CMV promoter and Ckβ-4 or Ckβ-10 fragments (1 and 2) are digested with the appropriate enzymes (CMV promoter - Xbal and BamHI; Ckβ-4 or Ckβ-10 fragment 1 - Xbal; Ckβ-4 or Ckβ-10 fragment 2 - BamHI) and ligated together. The resulting ligation product is digested with Hindlll, and ligated with the Hindlll-digested pUC18 plasmid.
Plasmid DNA is added to a sterile cuvette with a 0.4 cm electrode gap (Bio-Rad). The final DNA concentration is generally at least 120 μg/ml. 0.5 ml of the cell suspension (containing approximately 1.5.X106 cells) is then added to the cuvette, and the cell suspension and DNA solutions are gently mixed. Electroporation is performed with a Gene-Pulser apparatus (Bio-Rad). Capacitance and voltage are set at 960 μF and 250-300 V, respectively. As voltage increases, cell survival decreases, but the percentage of surviving cells that stably incoφorate the introduced DNA into their genome increases dramatically. Given these parameters, a pulse time of approximately 14-20 mSec should be observed.
Electroporated cells are maintained at room temperature for approximately 5 min, and the contents of the cuvette are then gently removed with a sterile transfer pipette. The cells are added directly to 10 ml of prewarmed nutrient media (DMEM with 15% calf semm) in a 10 cm dish and incubated at 37 degree C. The following day, the media is aspirated and replaced with 10 ml of fresh media and incubated for a further 16-24 hours.
The engineered fibroblasts are then injected into the host, either alone or after having been grown to confluence on cytodex 3 microcarrier beads. The fibroblasts now produce the protein product. The fibroblasts can then be introduced into a patient as described above.
EXAMPLE 38: Method of Treatment Using Gene Therapy - In Vivo
Another aspect of the present invention is using in vivo gene therapy methods to treat disorders, diseases and conditions. The gene therapy method relates to the introduction of naked nucleic acid (DNA, RNA, and antisense DNA or RNA) Ckβ-4 or Ckβ-10 sequences into an animal to increase or decrease the expression of the Ckβ-4 or Ckβ-10 polypeptide. The Ckβ-4 or Ckβ-10 polynucleotide may be operatively linked to a promoter or any other genetic elements necessary for the expression of the Ckβ-4 or Ckβ-10 polypeptide by the target tissue. Such gene therapy and delivery techniques and methods are known in the art, see, for example, WO90/11092, WO98/11779; U.S. Patent NO. 5693622, 5705151, 5580859; Tabata H. et al. (1997) Cardiovasc. Res. 35(3):470-479, Chao J et al. (1997) Pharmacol. Res. 35(6):517-522, Wolff J.A. (1997) Neuromuscul. Disord. 7(5):314-318, Schwartz B. et al. (1996) Gene Ther. 3(5):405-411, Tsurumi Y. et al. (1996) Circulation 94(12):3281-3290 (incoφorated herein by reference).
The Ckβ-4 or Ckβ-10 polynucleotide constmcts may be delivered by any method that delivers injectable materials to the cells of an animal, such as, injection into the interstitial space of tissues (heart, muscle, skin, lung, liver, intestine and the like). The Ckβ-4 or Ckβ- 10 polynucleotide constmcts can be delivered in a pharmaceutically acceptable liquid or aqueous carrier.
The term "naked" polynucleotide, DNA or RNA, refers to sequences that are free from any delivery vehicle that acts to assist, promote, or facilitate entry into the cell, including viral sequences, viral particles, liposome formulations, lipofectin or precipitating agents and the like. However, the Ckβ-4 or Ckβ-10 polynucleotides may also be delivered in liposome formulations (such as those taught in Feigner P.L. et al. (1995) Ann. NY Acad. Sci. 772:126-139 and Abdallah B. et al. (1995) Biol. Cell 85(1)3-7) which can be prepared by methods well known to those skilled in the art.
The Ckβ-4 or Ckβ-10 polynucleotide vector constmcts used in the gene therapy method are preferably constmcts that will not integrate into the host genome nor will they contain sequences that allow for replication. Any strong promoter known to those skilled in the art can be used for driving the expression of DNA. Unlike other gene therapies techniques, one major advantage of introducing naked nucleic acid sequences into target cells is the transitory nature of the polynucleotide synthesis in the cells. Studies have shown that non-replicating DNA sequences can be introduced into cells to provide production of the desired polypeptide for periods of up to six months.
The Ckβ-4 or Ckβ-10 polynucleotide constmct can be delivered to the interstitial space of tissues within the an animal, including of muscle, skin, brain, lung, liver, spleen, bone marrow, thymus, heart, lymph, blood, bone, cartilage, pancreas, kidney, gall bladder, stomach, intestine, testis, ovary, utems, rectum, nervous system, eye, gland, and connective tissue. Interstitial space of the tissues comprises the intercellular fluid, mucopolysaccharide matrix among the reticular fibers of organ tissues, elastic fibers in the walls of vessels or chambers, collagen fibers of fibrous tissues, or that same matrix within connective tissue ensheathing muscle cells or in the lacunae of bone. It is similarly the space occupied by the plasma of the circulation and the lymph fluid of the lymphatic channels. Delivery to the interstitial space of muscle tissue is preferred for the reasons discussed below. They may be conveniently delivered by injection into the tissues comprising these cells. They are preferably delivered to and expressed in persistent, non-dividing cells which are differentiated, although delivery and expression may be achieved in non-differentiated or less completely differentiated cells, such as, for example, stem cells of blood or skin fibroblasts. In vivo muscle cells are particularly competent in their ability to take up and express polynucleotides.
For the naked Ckβ-4 or Ckβ-10 polynucleotide injection, an effective dosage amount of DNA or RNA will be in the range of from about 0.05 g/kg body weight to about 50 mg/kg body weight. Preferably the dosage will be from about 0.005 mg/kg to about 20 mg/kg and more preferably from about 0.05 mg/kg to about 5 mg/kg. Of course, as the artisan of ordinary skill will appreciate, this dosage will vary according to the tissue site of injection. The appropriate and effective dosage of nucleic acid sequence can readily be determined by those of ordinary skill in the art and may depend on the condition being treated and the route of administration. The preferred route of administration is by the parenteral route of injection into the interstitial space of tissues. However, other parenteral routes may also be used, such as, inhalation of an aerosol formulation particularly for delivery to lungs or bronchial tissues, throat or mucous membranes of the nose. In addition, naked Ckβ-4 or Ckβ-10 polynucleotide constmcts can be delivered to arteries during angioplasty by the catheter used in the procedure.
The dose response effects of injected Ckβ-4 or Ckβ-10 polynucleotide in muscle in vivo is determined as follows. Suitable Ckβ-4 or Ckβ-10 template DNA for production of mRNA coding for Ckβ-4 or Ckβ-10 polypeptide is prepared in accordance with a standard recombinant DNA methodology. The template DNA, which may be either circular or linear, is either used as naked DNA or complexed with liposomes. The quadriceps muscles of mice are then injected with various amounts of the template DNA.
Five to six week old female and male Balb/C mice are anesthetized by intraperitoneal injection with 0.3 ml of 2.5% Avertin. A 1.5 cm incision is made on the anterior thigh, and the quadriceps muscle is directly visualized. The Ckβ-4 or Ckβ-10 template DNA is injected in 0.1 ml of carrier in a 1 cc syringe through a 27 gauge needle over one minute, approximately 0.5 cm from the distal insertion site of the muscle into the knee and about 0.2 cm deep. A suture is placed over the injection site for future localization, and the skin is closed with stainless steel clips. After an appropriate incubation time (e.g., 7 days) muscle extracts are prepared by excising the entire quadriceps. Every fifth 15 um cross-section of the individual quadriceps muscles is histochemically stained for Ckβ-4 or Ckβ-10 protein expression. A time course for Ckβ-4 or Ckβ-10 protein expression may be done in a similar fashion except that quadriceps from different mice are harvested at different times. Persistence of Ckβ-4 or Ckβ-10 DNA in muscle following injection may be determined by Southern blot analysis after preparing total cellular DNA and HIRT supernatants from injected and control mice. The results of the above experimentation in mice can be use to extrapolate proper dosages and other treatment parameters in humans and other animals using Ckβ-4 or Ckβ-10 naked DNA.
EXAMPLE 39: Ckβ-4 or Ckβ-10 Transgenic Animals.
The Ckβ-4 or Ckβ-10 polypeptides can also be expressed in transgenic animals.
Animals of any species, including, but not limited to, mice, rats, rabbits, hamsters, guinea pigs, pigs, micro-pigs, goats, sheep, cows and non-human primates, e.g., baboons, monkeys, and chimpanzees may be used to generate transgenic animals. In a specific embodiment, techniques described herein or otherwise known in the art, are used to express polypeptides of the invention in humans, as part of a gene therapy protocol.
Any technique known in the art may be used to introduce the transgene (i.e., polynucleotides of the invention) into animals to produce the founder lines of transgenic animals. Such techniques include, but are not limited to, pronuclear microinjection (Paterson et al., Appl. Microbiol. Biotechnol. 40:691-698 (1994); Carver et al., Biotechnology (NY) 11:1263-1270 (1993); Wright et al., Biotechnology (NY) 9:830-834 (1991); and Hoppe et al., U.S. Pat. No. 4,873,191 (1989)); retrovims mediated gene transfer into germ lines (Van der Putten et al., Proc. Natl. Acad. Sci., USA 82:6148-6152 (1985)), blastocysts or embryos; gene targeting in embryonic stem cells (Thompson et al., Cell 56:313-321 (1989)); electroporation of cells or embryos (Lo, 1983, Mol Cell. Biol. 3: 1803-1814 (1983)); introduction of the polynucleotides of the invention using a gene gun (see, e.g., Ulmer et al., Science 259:1745 (1993); introducing nucleic acid constmcts into embryonic pleuripotent stem cells and transferring the stem cells back into the blastocyst; and sperm-mediated gene transfer (Lavitrano et al., Cell 57:717-723 (1989); etc. For a review of such techniques, see Gordon, "Transgenic Animals," Intl. Rev. Cytol. 115:171-229 (1989), which is incoφorated by reference herein in its entirety.
Any technique known in the art may be used to produce transgenic clones containing polynucleotides of the invention, for example, nuclear transfer into enucleated oocytes of nuclei from cultured embryonic, fetal, or adult cells induced to quiescence (Campell et al., Nature 380:64-66 (1996); Wilmut et al., Nature 385:810-813 (1997)).
The present invention provides for transgenic animals that carry the transgene in all their cells, as well as animals which carry the transgene in some, but not all their cells, i.e., mosaic animals or chimeric. The transgene may be integrated as a single transgene or as multiple copies such as in concatamers, e.g., head-to-head tandems or head-to-tail tandems. The transgene may also be selectively introduced into and activated in a particular cell type by following, for example, the teaching of Lasko et al. (Lasko et al., Proc. Natl. Acad. Sci. USA 89:6232-6236 (1992)). The regulatory sequences required for such a cell-type specific activation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. When it is desired that the polynucleotide transgene be integrated into the chromosomal site of the endogenous gene, gene targeting is preferred.
Briefly, when such a technique is to be utilized, vectors containing some nucleotide sequences homologous to the endogenous gene are designed for the puφose of integrating, via homologous recombination with chromosomal sequences, into and dismpting the function of the nucleotide sequence of the endogenous gene. The transgene may also be selectively introduced into a particular cell type, thus inactivating the endogenous gene in only that cell type, by following, for example, the teaching of Gu et al. (Gu et al., Science 265:103-106 (1994)). The regulatory sequences required for such a cell-type specific inactivation will depend upon the particular cell type of interest, and will be apparent to those of skill in the art. The contents of each of the documents recited in this paragraph is herein incoφorated by reference in its entirety.
Any of the Ckβ-4 or Ckβ-10 polypeptides disclose throughout this application can be used to generate transgenic animals. For example, DNA encoding amino acids M1-T98 of SEQ LD NO:4 can be inserted into a vector containing a promoter, such as the actin promoter, which will ubiquitously express the inserted fragment. Primers that can be used to generate such fragments include a 5' primer containing a Hindlll restriction site shown in bold:
GGGATCCGGAGCCCAAATCTTCTGACAAAACTCACACATGCCCACCGTGCCCAG CACCTGAATTCGAGGGTGCACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGA CACCCTCATGATCTCCCGGACTCCTGAGGTCACATGCGTGGTGGTGGACGTAAG CCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTGGAGGTGC ATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCACGTACCGTGTG GTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATGGCAAGGAGTACAAG TGCAAGGTCTCCAACAAAGCCCTCCCAACCCCCATCGAGAAAACCATCTCCAAA GCCAAAGGGCAGCCCCGAGAACCACAGGTGTACACCCTGCCCCCATCCCGGGA TGAGCTGACCAAGAACCAGGTCAGCCTGACCTGCCTGGTCAAAGGCTTCTATCC AAGCGACATCGCCGTGGAGTGGGAGAGCAATGGGCAGCCGGAGAACAACTACA AGACCACGCCTCCCGTGCTGGACTCCGACGGCTCCTTCTTCCTCTACAGCAAGCT CACCGTGGACAAGAGCAGGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGA TGCATGAGGCTCTGCACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGG GTAAATGAGTGCGACGGCCGCGACTCTAGAGGAT (SEQ ED NO: 11) and a 3' primer, containing a Asp781 restriction site shown in bold: CGCGGGTACC TTAACACATA GTACATTTT (SEQ ID NO: 14). This constmct will express the full length Ckβ-10 under the control of the actin promoter for ubiquitous expression. The region Ckβ- 10 included in this constmct extends from M1-K232 of SEQ ID NO:2.
Similarly, the DNA encoding the full length KGF-2 protein can also be inserted into a vector for tissue specific expression using the following primers: A 5' primer containing a BamHI restriction site shown in bold:
GCAGCAGGATCCGCCATCATGGTCATGAGGCCCCTGTGGAGTCTGCTTCTC (SEQ ID NO: 22) and a 3' primer, containing a Xba restriction site shown in bold: GCAGCATCTAGATTATGGCAGATCCTGCACAAGGGGGTTCTCTGTC (SEQ ED NO: 23).
In addition to expressing the polypeptide of the present invention in a ubiquitous or tissue specific manner in transgenic animals, it would also be routine for one skilled in the art to generate constmcts which regulate expression of the polypeptide by a variety of other means (for example, developmentally or chemically regulated expression). Once transgenic animals have been generated, the expression of the recombinant gene may be assayed utilizing standard techniques. Initial screening may be accomplished by Southern blot analysis or PCR techniques to analyze animal tissues to verify that integration of the transgene has taken place. The level of mRNA expression of the transgene in the tissues of the transgenic animals may also be assessed using techniques which include, but are not limited to, Northern blot analysis of tissue samples obtained from the animal, in situ hybridization analysis, and reverse transcriptase-PCR (rt-PCR). Samples of transgenic gene-expressing tissue may also be evaluated immunocytochemically or immunohistochemically using antibodies specific for the transgene product.
Once the founder animals are produced, they may be bred, inbred, outbred, or crossbred to produce colonies of the particular animal. Examples of such breeding strategies include, but are not limited to: outbreeding of founder animals with more than one integration site in order to establish separate lines; inbreeding of separate lines in order to produce compound transgenics that express the transgene at higher levels because of the effects of additive expression of each transgene; crossing of heterozygous transgenic animals to produce animals homozygous for a given integration site in order to both augment expression and eliminate the need for screening of animals by DNA analysis; crossing of separate homozygous lines to produce compound heterozygous or homozygous lines; and breeding to place the transgene on a distinct background that is appropriate for an experimental model of interest. Transgenic animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of Ckβ-4 or Ckβ-10 polypeptides, studying diseases, disorders, and/or conditions associated with aberrant Ckβ- 4 or Ckβ-10 expression, and in screening for compounds effective in ameliorating such diseases, disorders, and/or conditions.
EXAMPLE 40: Ckβ-4 or Ckβ-10 Knock-Out Animals. Endogenous Ckβ-4 or Ckβ-10 gene expression can also be reduced by inactivating or "knocking out" the Ckβ-4 or Ckβ-10 gene and/or its promoter using targeted homologous recombination. (E.g., see Smithies et al., Nature 317:230-234 (1985); Thomas & Capecchi, Cell 51:503-512 (1987); Thompson et al., Cell 5:313-321 (1989); each of which is incoφorated by reference herein in its entirety). For example, a mutant, non-functional polynucleotide of the invention (or a completely unrelated DNA sequence) flanked by DNA homologous to the endogenous polynucleotide sequence (either the coding regions or regulatory regions of the gene) can be used, with or without a selectable marker and/or a negative selectable marker, to transfect cells that express polypeptides of the invention in vivo. In another embodiment, techniques known in the art are used to generate knockouts in cells that contain, but do not express the gene of interest. Insertion of the DNA construct, via targeted homologous recombination, results in inactivation of the targeted gene. Such approaches are particularly suited in research and agricultural fields where modifications to embryonic stem cells can be used to generate animal offspring with an inactive targeted gene (e.g., see Thomas & Capecchi 1987 and Thompson 1989, supra). However this approach can be routinely adapted for use in humans provided the recombinant DNA constmcts are directly administered or targeted to the required site in vivo using appropriate viral vectors that will be apparent to those of skill in the art.
In further embodiments of the invention, cells that are genetically engineered to express the polypeptides of the invention, or alternatively, that are genetically engineered not to express the polypeptides of the invention (e.g., knockouts) are administered to a patient in vivo. Such cells may be obtained from the patient (i.e., animal, including human) or an MHC compatible donor and can include, but are not limited to fibroblasts, bone maπow cells, blood cells (e.g.. lymphocytes), adipocytes, muscle cells, endothelial cells etc. The cells are genetically engineered in vitro using recombinant DNA techniques to introduce the coding sequence of polypeptides of the invention into the cells, or alternatively, to dismpt the coding sequence and/or endogenous regulatory sequence associated with the polypeptides of the invention, e.g., by transduction (using viral vectors, and preferably vectors that integrate the transgene into the cell genome) or transfection procedures, including, but not limited to, the use of plasmids, cosmids, YACs, naked DNA, electroporation, liposomes, etc. The coding sequence of the polypeptides of the invention can be placed under the control of a strong constitutive or inducible promoter or promoter/enhancer to achieve expression, and preferably secretion, of the Ckβ-4 or Ckβ-10 polypeptides. The engineered cells which express and preferably secrete the polypeptides of the invention can be introduced into the patient systemically, e.g., in the circulation, or intraperitoneally.
Alternatively, the cells can be incoφorated into a matrix and implanted in the body, e.g.. genetically engineered fibroblasts can be implanted as part of a skin graft; genetically engineered endothelial cells can be implanted as part of a lymphatic or vascular graft. (See, for example, Anderson et al. U.S. Patent No. 5,399,349; and Mulligan & Wilson, U.S .
Patent No. 5,460,959 each of which is incoφorated by reference herein in its entirety).
When the cells to be administered are non-autologous or non-MHC compatible cells, they can be administered using well known techniques which prevent the development of a host immune response against the introduced cells. For example, the cells may be introduced in an encapsulated form which, while allowing for an exchange of components with the immediate extracellular environment, does not allow the introduced cells to be recognized by the host immune system. Knock-out animals of the invention have uses which include, but are not limited to, animal model systems useful in elaborating the biological function of Ckβ-4 or Ckβ-10 polypeptides, studying diseases, disorders, and/or conditions associated with aberrant Ckβ-
4 or Ckβ-10 expression, and in screening for compounds effective in ameliorating such diseases, disorders, and/or conditions.
EXAMPLE 41: Assays Detecting Stimulation or Inhibition of B cell Proliferation and Differentiation
Generation of functional humoral immune responses requires both soluble and cognate signaling between B-lineage cells and their microenvironment. Signals may impart a positive stimulus that allows a B-lineage cell to continue its programmed development, or a negative stimulus that instincts the cell to arrest its current developmental pathway. To date, numerous stimulatory and inhibitory signals have been found to influence B cell responsiveness including IL-2, IL-4, IL-5, IL-6, IL-7, IL10, IL-13, IL-14 and IL-15. Interestingly, these signals are by themselves weak effectors but can, in combination with various co-stimulatory proteins, induce activation, proliferation, differentiation, homing, tolerance and death among B cell populations.
One of the best studied classes of B-cell co-stimulatory proteins is the TNF- superfamily. Within this family CD40, CD27, and CD30 along with their respective ligands CD 154, CD70, and CD 153 have been found to regulate a variety of immune responses. Assays which allow for the detection and/or observation of the proliferation and differentiation of these B-cell populations and their precursors are valuable tools in determining the effects various proteins may have on these B-cell populations in terms of proliferation and differentiation. Listed below are two assays designed to allow for the detection of the differentiation, proliferation, or inhibition of B-cell populations and their precursors. In Vitro Assay- Purified Ckβ-4 or Ckβ-10 protein, or tmncated forms thereof, is assessed for its ability to induce activation, proliferation, differentiation or inhibition and/or death in B-cell populations and their precursors. The activity of Ckβ-4 or Ckβ-10 protein on purified human tonsillar B cells, measured qualitatively over the dose range from 0.1 to 10,000 ng/mL, is assessed in a standard B-lymphocyte co-stimulation assay in which purified tonsillar B cells are cultured in the presence of either formalin-fixed Staphylococcus aureus Cowan I (SAC) or immobilized anti-human IgM antibody as the priming agent. Second signals such as IL-2 and IL-15 synergize with SAC and IgM crosslinking to elicit B cell proliferation as measured by tritiated-thymidine incoφoration. Novel synergizing agents can be readily identified using this assay. The assay involves isolating human tonsillar B cells by magnetic bead (MACS) depletion of CD3-positive cells. The resulting cell population is greater than 95% B cells as assessed by expression of CD45R(B220).
Various dilutions of each sample are placed into individual wells of a 96-well plate to which are added 105 B-cells suspended in culture medium (RPMI 1640 containing 10% FBS, 5 X 10"5M 2ME, lOOU/ml penicillin, lOug/ml streptomycin, and 10~5 dilution of SAC) in a total volume of 150ul. Proliferation or inhibition is quantitated by a 20h pulse (luCi/well) with 3H-thymidine (6.7 Ci/mM) beginning 72h post factor addition. The positive and negative controls are EL2 and medium respectively.
In Vivo Assay- BALB/c mice are injected (i.p.) twice per day with buffer only, or 2 mg/Kg of Ckβ-4 or Ckβ-10 protein, or tmncated forms thereof. Mice receive this treatment for 4 consecutive days, at which time they are sacrificed and various tissues and semm collected for analyses. Comparison of H&E sections from normal and Ckβ-4 or Ckβ-10 protein-treated spleens identify the results of the activity of Ckβ-4 or Ckβ-10 protein on spleen cells, such as the diffusion of peri-arterial lymphatic sheaths, and/or significant increases in the nucleated cellularity of the red pulp regions, which may indicate the activation of the differentiation and proliferation of B-cell populations. Immunohistochemical studies using a B cell marker, anti-CD45R(B220), are used to determine whether any physiological changes to splenic cells, such as splenic disorganization, are due to increased B-cell representation within loosely defined B-cell zones that infiltrate established T-cell regions. Flow cytometric analyses of the spleens from Ckβ-4 or Ckβ-10 protein-treated mice is used to indicate whether Ckβ-4 or Ckβ-10 protein specifically increases the proportion of
ThB+, CD45R(B220)dull B cells over that which is observed in control mice.
Likewise, a predicted consequence of increased mature B-cell representation in vivo is a relative increase in semm Ig titers. Accordingly, semm IgM and IgA levels are compared between buffer and Ckβ-4 or Ckβ-10 protein-treated mice.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 42: T Cell Proliferation Assay
A CD3-induced proliferation assay is performed on PBMCs and is measured by the uptake of 3H-thymidine. The assay is performed as follows. Ninety-six well plates are coated with 100 μl/well of mAb to CD3 (HIT3a, Pharmingen) or isotype-matched control mAb (B33.1) overnight at 4°C (1 μg/ml in .05M bicarbonate buffer, pH 9.5), then washed three times with
PBS. PBMC are isolated by F/H gradient centrifugation from human peripheral blood and added to quadmplicate wells (5 x 104/well) of mAb coated plates in RPMI containing 10% FCS and P/S in the presence of varying concentrations of Ckβ-4 or Ckβ-10 protein (total volume 200 μl). Relevant protein buffer and medium alone are controls. After 48 hr. culture at 37°C, plates are spun for 2 min. at 1000 rpm and 100 μl of supernatant is removed and stored -20°C for measurement of LL-2 (or other cytokines) if effect on proliferation is observed. Wells are supplemented with 100 μl of medium containing 0.5 μCi of 3H-thymidine and cultured at 37°C for 18-24 hr. Wells are harvested and incoφoration of 3H-thymidine used as a measure of proliferation. Anti-CD3 alone is the positive control for proliferation. IL-2 (100 U/ml) is also used as a control which enhances proliferation. Control antibody which does not induce proliferation of T cells is used as the negative controls for the effects of Ckβ-4 or Ckβ-10 proteins.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 43: Effect of Ckβ-4 or Ckβ-10 on the Expression of MHC Class
II, Costimulatory and Adhesion Molecules and Cell Differentiation of Monocytes and Monocyte-Derived Human Dendritic Cells
Dendritic cells are generated by the expansion of proliferating precursors found in the peripheral blood: adherent PBMC or elutriated monocytic fractions are cultured for 7-10 days with GM-CSF (50 ng/ml) and IL-4 (20 ng/ml). These dendritic cells have the characteristic phenotype of immature cells (expression of CD1, CD80, CD86, CD40 and MHC class II antigens). Treatment with activating factors, such as TNF-α, causes a rapid change in surface phenotype (increased expression of MHC class I and II, costimulatory and adhesion molecules, downregulation of FCγRII, upregulation of CD83). These changes correlate with increased antigen-presenting capacity and with functional maturation of the dendritic cells.
FACS analysis of surface antigens is performed as follows. Cells are treated 1-3 days with increasing concentrations of Ckβ-4 or Ckβ-10 or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1:20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for 30 minutes at 4°C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton
Dickinson).
Effect on the production of cytokines. Cytokines generated by dendritic cells, in particular IL-12, are important in the initiation of T-cell dependent immune responses. IL-12 strongly influences the development of Thl helper T-cell immune response, and induces cytotoxic T and NK cell function. An ELISA is used to measure the IL-12 release as follows. Dendritic cells (lOVml) are treated with increasing concentrations of Ckβ-4 or
Ckβ-10 for 24 hours. LPS (100 ng/ml) is added to the cell culture as positive control.
Supernatants from the cell cultures are then collected and analyzed for EL- 12 content using commercial ELISA kit (e..g, R & D Systems (Minneapolis, MN)). The standard protocols provided with the kits are used.
Effect on the expression of MHC Class II, costimulatory and adhesion molecules. Three major families of cell surface antigens can be identified on monocytes: adhesion molecules, molecules involved in antigen presentation, and Fc receptor. Modulation of the expression of MHC class II antigens and other costimulatory molecules, such as B7 and ICAM-1, may result in changes in the antigen presenting capacity of monocytes and ability to induce T cell activation. Increase expression of Fc receptors may correlate with improved monocyte cytotoxic activity, cytokine release and phagocytosis.
FACS analysis is used to examine the surface antigens as follows. Monocytes are treated 1-5 days with increasing concentrations of Ckβ-4 or Ckβ-10 or LPS (positive control), washed with PBS containing 1% BSA and 0.02 mM sodium azide, and then incubated with 1 :20 dilution of appropriate FITC- or PE-labeled monoclonal antibodies for
30 minutes at 4°C. After an additional wash, the labeled cells are analyzed by flow cytometry on a FACScan (Becton Dickinson).
Monocyte activation and/or increased survival. Assays for molecules that activate (or alternatively, inactivate) monocytes and/or increase monocyte survival (or alternatively, decrease monocyte survival) are known in the art and may routinely be applied to determine whether a molecule of the invention functions as an inhibitor or activator of monocytes.
Ckβ-4 or Ckβ-10, agonists, or antagonists of Ckβ-4 or Ckβ-10 can be screened using the three assays described below. For each of these assays, Peripheral blood mononuclear cells (PBMC) are purified from single donor leukopacks (American Red Cross, Baltimore, MD) by centrifugation through a Histopaque gradient (Sigma). Monocytes are isolated from PBMC by counterflow centrifugal elutriation.
Monocyte Survival Assay. Human peripheral blood monocytes progressively lose viability when cultured in absence of semm or other stimuli. Their death results from internally regulated process (apoptosis). Addition to the culture of activating factors, such as TNF-alpha dramatically improves cell survival and prevents DNA fragmentation. Propidium iodide (PI) staining is used to measure apoptosis as follows. Monocytes are cultured for 48 hours in polypropylene tubes in semm-free medium (positive control), in the presence of 100 ng/ml TNF-alpha (negative control), and in the presence of varying concentrations of the compound to be tested. Cells are suspended at a concentration of 2 x
106/ml in PBS containing PI at a final concentration of 5 μg/ml, and then incubaed at room temperature for 5 minutes before FACScan analysis. PI uptake has been demonstrated to correlate with DNA fragmentation in this experimental paradigm.
Effect on cytokine release. An important function of monocytes/macrophages is their regulatory activity on other cellular populations of the immune system through the release of cytokines after stimulation. An ELISA to measure cytokine release is performed as follows. Human monocytes are incubated at a density of 5xl05 cells/ml with increasing concentrations of Ckβ-4 or Ckβ-10 and under the same conditions, but in the absence of Ckβ-4 or Ckβ-10. For IL-12 production, the cells are primed overnight with IFN (100
U/ml) in presence of Ckβ-4 or Ckβ-10. LPS (10 ng/ml) is then added. Conditioned media are collected after 24h and kept frozen until use. Measurement of TNF-alpha, IL-10, MCP-1 and LL-8 is then performed using a commercially available ELISA kit (e..g, R & D Systems (Minneapolis, MN)) and applying the standard protocols provided with the kit.
Oxidative burst. Purified monocytes are plated in 96- w plate at 2-lxl05 cell/well.
Increasing concentrations of Ckβ-4 or Ckβ-10 are added to the wells in a total volume of
0.2 ml culture medium (RPMI 1640 + 10% FCS, glutamine and antibiotics). After 3 days incubation, the plates are centrifuged and the medium is removed from the wells. To the macrophage monolayers, 0.2 ml per well of phenol red solution (140 mM NaCl, 10 mM potassium phosphate buffer pH 7.0, 5.5 mM dextrose, 0.56 mM phenol red and 19 U/ml of HRPO) is added, together with the stimulant (200 nM PMA). The plates are incubated at
37°C for 2 hours and the reaction is stopped by adding 20 μl IN NaOH per well. The absorbance is read at 610 nm. To calculate the amount of H2O2 produced by the macrophages, a standard curve of a H2O2 solution of known molarity is performed for each experiment.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of
Ckβ-4 or Ckβ-10.
EXAMPLE 44: Ckβ-4 or Ckβ-10 Biological Effects Astrocyte and Neuronal Assays. Recombinant Ckβ-4 or Ckβ-10, expressed in Escherichia coli and purified as described above, can be tested for activity in promoting the survival, neurite outgrowth, or phenotypic differentiation of cortical neuronal cells and for inducing the proliferation of glial fibrillary acidic protein immunopositive cells, astrocytes. The selection of cortical cells for the bioassay is based on the prevalent expression of FGF- 1 and FGF-2 in cortical stmctures and on the previously reported enhancement of cortical neuronal survival resulting from FGF-2 treatment. A thymidine incoφoration assay, for example, can be used to elucidate Ckβ-4 or Ckβ-10's activity on these cells.
Moreover, previous reports describing the biological effects of FGF-2 (basic FGF) on cortical or hippocampal neurons in vitro have demonstrated increases in both neuron survival and neurite outgrowth (Walicke, P. et al., "Fibroblast growth factor promotes survival of dissociated hippocampal neurons and enhances neurite extension." Proc. Natl. Acad. Sci. USA 83:3012- 3016. (1986), assay herein incoφorated by reference in its entirety). However, reports from experiments done on PC- 12 cells suggest that these two responses are not necessarily synonymous and may depend on not only which FGF is being tested but also on which receptor(s) are expressed on the target cells. Using the primary cortical neuronal culture paradigm, the ability of Ckβ-4 or Ckβ-10 to induce neurite outgrowth can be compared to the response achieved with FGF-2 using, for example, a thymidine incoφoration assay.
Fibroblast and endothelial cell assays.
Human lung fibroblasts are obtained from Clonetics (San Diego, CA) and maintained in growth media from Clonetics. Dermal microvascular endothelial cells are obtained from Cell Applications (San Diego, CA). For proliferation assays, the human lung fibroblasts and dermal microvascular endothelial cells can be cultured at 5,000 cells/well in a 96-well plate for one day in growth medium. The cells are then incubated for one day in 0.1% BSA basal medium. After replacing the medium with fresh 0.1% BSA medium, the cells are incubated with the test proteins for 3 days. Alamar Blue (Alamar Biosciences, Sacramento, CA) is added to each well to a final concentration of 10%. The cells are incubated for 4 hr. Cell viability is measured by reading in a CytoFluor fluorescence reader. For the PGE2 assays, the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or Ckβ-4 or Ckβ-10 with or without IL-lα for 24 hours. The supernatants are collected and assayed for PGE2 by ELA kit (Cayman, Ann Arbor,
MI). For the IL-6 assays, the human lung fibroblasts are cultured at 5,000 cells/well in a 96-well plate for one day. After a medium change to 0.1% BSA basal medium, the cells are incubated with FGF-2 or Ckβ-4 or Ckβ-10 with or without IL-lα for 24 hours. The supernatants are collected and assayed for IL-6 by ELISA kit (Endogen, Cambridge, MA).
Human lung fibroblasts are cultured with FGF-2 or Ckβ-4 or Ckβ-10 for 3 days in basal medium before the addition of Alamar Blue to assess effects on growth of the fibroblasts. FGF- 2 should show a stimulation at 10 - 2500 ng/ml which can be used to compare stimulation with
Ckβ-4 or Ckβ-10.
Parkinson Models.
The loss of motor function in Parkinson's disease is attributed to a deficiency of striatal dopamine resulting from the degeneration of the nigrostriatal dopaminergic projection neurons.
An animal model for Parkinson's that has been extensively characterized involves the systemic administration of l-methyl-4 phenyl 1,2,3,6-tetrahydropyridine (MPTP). In the CNS, MPTP is taken-up by astrocytes and catabolized by monoamine oxidase B to l-methyl-4-phenyl pyridine (MPP+) and released. Subsequently, MPP+ is actively accumulated in dopaminergic neurons by the high-affinity reuptake transporter for dopamine. MPP+ is then concentrated in mitochondria by the electrochemical gradient and selectively inhibits nicotidamide adenine disphosphate: ubiquinone oxidoreductionase (complex I), thereby interfering with electron transport and eventually generating oxygen radicals.
It has been demonstrated in tissue culture paradigms that FGF-2 (basic FGF) has trophic activity towards nigral dopaminergic neurons (Ferrari et al., Dev. Biol. 1989). Recently, Dr. Unsicker's group has demonstrated that administering FGF-2 in gel foam implants in the striatum results in the near complete protection of nigral dopaminergic neurons from the toxicity associated with MPTP exposure (Otto and Unsicker, J. Neuroscience, 1990).
Based on the data with FGF-2, Ckβ-4 or Ckβ-10 can be evaluated to determine whether it has an action similar to that of FGF-2 in enhancing dopaminergic neuronal survival in vitro and it can also be tested in vivo for protection of dopaminergic neurons in the striatum from the damage associated with MPTP treatment. The potential effect of Ckβ-4 or Ckβ-10 is first examined in vitro in a dopaminergic neuronal cell culture paradigm. The cultures are prepared by dissecting the midbrain floor plate from gestation day 14 Wistar rat embryos. The tissue is dissociated with trypsin and seeded at a density of 200,000 cells/cm2 on polyorthinine-laminin coated glass coverslips. The cells are maintained in Dulbecco's Modified Eagle's medium and F12 medium containing hormonal supplements (NI). The cultures are fixed with paraformaldehyde after 8 days in vitro and are processed for tyrosine hydroxylase, a specific marker for dopminergic neurons, immunohistochemical staining. Dissociated cell cultures are prepared from embryonic rats. The culture medium is changed every third day and the factors are also added at that time.
Since the dopaminergic neurons are isolated from animals at gestation day 14, a developmental time which is past the stage when the dopaminergic precursor cells are proliferating, an increase in the number of tyrosine hydroxylase immunopositive neurons would represent an increase in the number of dopaminergic neurons surviving in vitro. Therefore, if Ckβ-4 or Ckβ-10 acts to prolong the survival of dopaminergic neurons, it would suggest that
Ckβ-4 or Ckβ-10 may be involved in Parkinson's Disease.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10. EXAMPLE 45: The Effect of Ckβ-4 or Ckβ-10 on the Growth of Vascular
Endothelial Cells
On day 1, human umbilical vein endothelial cells (HUVEC) are seeded at 2-5x104 cells/35 mm dish density in M199 medium containing 4% fetal bovine semm (FBS), 16 units/ml heparin, and 50 units/ml endothelial cell growth supplements (ECGS, Biotechnique, Inc.). On day 2, the medium is replaced with M199 containing 10% FBS, 8 units/ml heparin. Ckβ-4 (SEQ ED NO.
2) or Ckβ-10 (SEQ ED NO:4) protein, and positive controls, such as VEGF and basic FGF
(bFGF) are added, at varying concentrations. On days 4 and 6, the medium is replaced. On day 8, cell number is determined with a Coulter Counter.
An increase in the number of HUVEC cells indicates that Ckβ-4 or Ckβ-10 may proliferate vascular endothelial cells.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 46: Stimulatory Effect of Ckb-4 or Ckb-10 on the Proliferation of Vascular Endothelial Cells For evaluation of mitogenic activity of growth factors, the colorimetric MTS (3-(4,5- dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)2H-tetrazolium) assay with the electron coupling reagent PMS (phenazine methosulfate) was performed (CellTiter 96 AQ, Promega). Cells are seeded in a 96-well plate (5,000 cells/well) in 0.1 mL semm-supplemented medium and are allowed to attach overnight. After serum-starvation for 12 hours in 0.5% FBS, conditions (bFGF, VEGF165 or Ckβ-4 or Ckβ-10 in 0.5% FBS) with or without Heparin (8
U/ml) are added to wells for 48 hours. 20 mg of MTS/PMS mixture (1:0.05) are added per well and allowed to incubate for 1 hour at 37°C before measuring the absorbance at 490 nm in an ELISA plate reader. Background absorbance from control wells (some media, no cells) is subtracted, and seven wells are performed in parallel for each condition. See, Leak et al. In Vitro Cell. Dev. Biol. 304:512-518 (1994).
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 47: Inhibition of PDGF-induced Vascular Smooth Muscle Cell Proliferation Stimulatory Effect HAoSMC proliferation can be measured, for example, by BrdUrd incoφoration. Briefly, subconfluent, quiescent cells grown on 4-chamber slides are pulsed with 10% calf semm as a positive control, or dilutions of the polypeptide of the present invention, and 6 mg/ml BrdUrd. After 24 h, immunocytochemistry is performed by using BrdUrd Staining Kit (Zymed Laboratories). In brief, the cells are incubated with the biotinylated mouse anti -BrdUrd antibody at 4 °C for 2 h after being exposed to denaturing solution and then incubated with the streptavidin-peroxidase and diaminobenzidine. After counterstaining with hematoxylin, the cells are mounted for microscopic examination, and the BrdUrd-positive cells are counted. The BrdUrd index is calculated as a percent of the BrdUrd-positive cells to the total cell number. See, Ellwart and Dormer, Cytometry, 6:513-20 (1985), herein incoφorated by reference in its entirety.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 48: Stimulation of Endothelial Migration
This example will be used to explore the possibility that Ckβ-4 or Ckβ-10 may stimulate lymphatic endothelial cell migration.
Endothelial cell migration assays are performed using a 48 well microchemotaxis chamber (Neuroprobe Inc., Cabin John, MD; Falk, W., et al., J. Immunological Methods 1980;33:239- 247). Polyvinylpyrrolidone-free polycarbonate filters with a pore size of 8 um (Nucleopore Coφ. Cambridge, MA) are coated with 0.1% gelatin for at least 6 hours at room temperature and dried under sterile air. Test substances are diluted to appropriate concentrations in Ml 99 supplemented with 0.25% bovine semm albumin (BSA), and 25 ul of the final dilution is placed in the lower chamber of the modified Boyden apparatus. Subconfluent, early passage (2-6) HUVEC or BMEC cultures are washed and trypsinized for the minimum time required to achieve cell detachment. After placing the filter between lower and upper chamber, 2.5 x 105 cells suspended in 50 ul Ml 99 containing 1% FBS are seeded in the upper compartment. The apparatus is then incubated for 5 hours at 37°C in a humidified chamber with 5% CO2 to allow cell migration. After the incubation period, the filter is removed and the upper side of the filter with the non-migrated cells is scraped with a mbber policeman. The filters are fixed with methanol and stained with a Giemsa solution (Diff-Quick, Baxter, McGraw Park, IL). Migration is quantified by counting cells of three random high-power fields (40x) in each well, and all groups are performed in quadmplicate.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 49: Stimulation of Nitric Oxide Production by Endothelial Cells Nitric oxide released by the vascular endothelium is believed to be a mediator of vascular endothelium relaxation. Thus, Ckβ-4 or Ckβ-10 activity can be assayed by determining nitric oxide production by endothelial cells in response to Ckβ-4 or Ckβ-10.
Nitric oxide is measured in 96-well plates of confluent microvascular endothelial cells after 24 hours starvation and a subsequent 4 hr exposure to various levels of a positive control (such as VEGF-1) and Ckβ-4 or Ckβ-10. Nitric oxide in the medium is determined by use of the Griess reagent to measure total nitrite after reduction of nitric oxide-derived nitrate by nitrate reductase. The effect of Ckβ-4 or Ckβ-10 on nitric oxide release is examined on HUVEC.
Briefly, NO release from cultured HUVEC monolayer is measured with a NO-specific polarographic electrode connected to a NO meter (Iso-NO, World Precision Instmments Inc.) (1049). Calibration of the NO elements is performed according to the following equation: 2 KNO2 + 2 KI + 2 H2SO4 6 2 NO + I2 + 2 H2O + 2 K2SO4 The standard calibration curve is obtained by adding graded concentrations of KNO2 (0, 5, 10, 25, 50, 100, 250, and 500 nmol/L) into the calibration solution containing KI and H2SO4. The specificity of the Iso-NO electrode to NO is previously determined by measurement of NO from authentic NO gas (1050). The culture medium is removed and HUVECs are washed twice with Dulbecco's phosphate buffered saline. The cells are then bathed in 5 ml of filtered Krebs- Henseleit solution in 6-well plates, and the cell plates are kept on a slide warmer (Lab Line Instmments Inc.) To maintain the temperature at 37°C. The NO sensor probe is inserted vertically into the wells, keeping the tip of the electrode 2 mm under the surface of the solution, before addition of the different conditions. S-nitroso acetyl penicillamin (SNAP) is used as a positive control. The amount of released NO is expressed as picomoles per lxlO6 endothelial cells. All values reported are means of four to six measurements in each group (number of cell culture wells). See, Leak et al. Biochem. and Biophys. Res. Comm. 277:96-105 (1995).
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 50: Effect of Ckb-4 or Ckb-10 on Cord Formation in Angiogenesis
Another step in angiogenesis is cord formation, marked by differentiation of endothelial cells. This bioassay measures the ability of microvascular endothelial cells to form capillary-like stmctures (hollow stmctures) when cultured in vitro. CADMEC (microvascular endothelial cells) are purchased from Cell Applications, Inc. as proliferating (passage 2) cells and are cultured in Cell Applications' CADMEC Growth Medium and used at passage 5. For the in vitro angiogenesis assay, the wells of a 48-well cell culture plate are coated with Cell Applications' Attachment Factor Medium (200 ml/well) for 30 min. at 37°C. CADMEC are seeded onto the coated wells at 7,500 cells/well and cultured overnight in Growth Medium. The Growth Medium is then replaced with 300 mg Cell Applications' Chord
Formation Medium containing control buffer or Ckβ-4 or Ckβ-10 (0.1 to 100 ng/ml) and the cells are cultured for an additional 48 hr. The numbers and lengths of the capillary-like chords are quantitated through use of the Boeckeler VIA- 170 video image analyzer. All assays are done in triplicate. Commercial (R&D) VEGF (50 ng/ml) is used as a positive control, b-esteradiol (1 ng/ml) is used as a negative control. The appropriate buffer (without protein) is also utilized as a control.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 51: Angiogenic Effect on Chick Chorioallantoic Membrane
Chick chorioallantoic membrane (CAM) is a well-established system to examine angiogenesis. Blood vessel formation on CAM is easily visible and quantifiable. The ability of
Ckβ-4 or Ckβ-10 to stimulate angiogenesis in CAM can be examined.
Fertilized eggs of the White Leghorn chick (Gallus gallus) and the Japanese qual (Coturnix coturnix) are incubated at 37.8°C and 80% humidity. Differentiated CAM of 16-day- old chick and 13-day-old qual embryos is studied with the following methods. On Day 4 of development, a window is made into the egg shell of chick eggs. The embryos are checked for normal development and the eggs sealed with cellotape. They are further incubated until Day 13. Thermanox coverslips (Nunc, Naperville, EL) are cut into disks of about 5 mm in diameter. Sterile and salt-free growth factors are dissolved in distilled water and about 3.3 mg/ 5 ml are pipetted on the disks. After air-drying, the inverted disks are applied on CAM. After 3 days, the specimens are fixed in 3% glutaraldehyde and 2% formaldehyde and rinsed in 0.12 M sodium cacodylate buffer. They are photographed with a stereo microscope [Wild M8] and embedded for semi- and ultrathin sectioning as described above. Controls are performed with caπier disks alone.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 52: Angiogenesis Assay Using a Matrigel Implant in Mouse In vivo angiogenesis assay of Ckβ-4 or Ckβ-10 measures the ability of an existing capillary network to form new vessels in an implanted capsule of murine extracellular matrix material (Matrigel). The protein is mixed with the liquid Matrigel at 4 degree C and the mixture is then injected subcutaneously in mice where it solidifies. After 7 days, the solid "plug" of Matrigel is removed and examined for the presence of new blood vessels. Matrigel is purchased from Becton Dickinson Labware/Collaborative Biomedical Products.
When thawed at 4 degree C the Matrigel material is a liquid. The Matrigel is mixed with
Ckβ-4 or Ckβ-10 at 150 ng/ml at 4 degree C and drawn into cold 3 ml syringes. Female
C57B1/6 mice approximately 8 weeks old are injected with the mixture of Matrigel and experimental protein at 2 sites at the midventral aspect of the abdomen (0.5 ml/site). After 7 days, the mice are sacrificed by cervical dislocation, the Matrigel plugs are removed and cleaned (i.e., all clinging membranes and fibrous tissue is removed). Replicate whole plugs are fixed in neutral buffered 10% formaldehyde, embedded in paraffin and used to produce sections for histological examination after staining with Masson's Trichrome. Cross sections from 3 different regions of each plug are processed. Selected sections are stained for the presence of vWF. The positive control for this assay is bovine basic FGF (150 ng/ml). Matrigel alone is used to determine basal levels of angiogenesis.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 53: Rescue of Ischemia in Rabbit Lower Limb Model
To study the in vivo effects of Ckβ-4 or Ckβ-10 on ischemia, a rabbit hindlimb ischemia model is created by surgical removal of one femoral arteries as described previously (Takeshita, S. et al, Am J. Pathol 7473649-1660 (1995)). The excision of the femoral artery results in retrograde propagation of thrombus and occlusion of the external iliac artery. Consequently, blood flow to the ischemic limb is dependent upon collateral vessels originating from the internal iliac artery (Takeshita, S. et al. Am J. Pathol 747: 1649-1660 (1995)). An interval of 10 days is allowed for post-operative recovery of rabbits and development of endogenous collateral vessels. At 10 day post-operatively (day 0), after performing a baseline angiogram, the internal iliac artery of the ischemic limb is transfected with 500 mg naked Ckβ-4 or Ckβ-10 expression plasmid by arterial gene transfer technology using a hydrogel-coated balloon catheter as described (Riessen, R. et al. Hum Gene Ther. 4:749-758 (1993); Leclerc, G. et al. J. Clin. Invest. 90: 936-944 (1992)). When Ckβ-4 or Ckβ-10 is used in the treatment, a single bolus of 500 mg
Ckβ-4 or Ckβ-10 protein or control is delivered into the internal iliac artery of the ischemic limb over a period of 1 min. through an infusion catheter. On day 30, various parameters are measured in these rabbits: (a) BP ratio - The blood pressure ratio of systolic pressure of the ischemic limb to that of normal limb; (b) Blood Flow and Flow Reserve - Resting FL: the blood flow during undilated condition and Max FL: the blood flow during fully dilated condition (also an indirect measure of the blood vessel amount) and Flow Reserve is reflected by the ratio of max FL: resting FL; (c) Angiographic Score - This is measured by the angiogram of collateral vessels. A score is determined by the percentage of circles in an overlaying grid that with crossing opacified arteries divided by the total number m the rabbit thigh; (d) Capillary density - The number of collateral capillaries determined in light microscopic sections taken from hindlimbs.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 54: Effect of Ckb-4 or Ckb-10 on Vasodilation
Since dilation of vascular endothelium is important in reducing blood pressure, the ability of Ckβ-4 or Ckβ-10 to affect the blood pressure in spontaneously hypertensive rats (SHR) is examined. Increasing doses (0, 10, 30, 100, 300, and 900 mg/kg) of the Ckβ-4 or Ckβ-10 are administered to 13-14 week old spontaneously hypertensive rats (SHR). Data are expressed as the mean +/- SEM. Statistical analysis are performed with a paired t-test and statistical significance is defined as p<0.05 vs. the response to buffer alone. The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 55: Rat Ischemic Skin Flap Model
The evaluation parameters include skin blood flow, skin temperature, and factor VEtl immunohistochemistry or endothelial alkaline phosphatase reaction. Ckβ-4 or Ckβ-10 expression, during the skin ischemia, is studied using in situ hybridization. The study in this model is divided into three parts as follows: a) Ischemic skin b) Ischemic skin wounds c) Normal wounds
The experimental protocol includes: a) Raising a 3x4 cm, single pedicle full-thickness random skin flap (myocutaneous flap over the lower back of the animal). b) An excisional wounding (4-6 mm in diameter) in the ischemic skin (skin-flap). c) Topical treatment with Ckβ-4 or Ckβ-10 of the excisional wounds (day 0, 1, 2, 3, 4 post-wounding) at the following various dosage ranges: lmg to 100 mg. d) Harvesting the wound tissues at day 3, 5, 7, 10, 14 and 21 post-wounding for histological, immunohistochemical, and in situ studies.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 56: Peripheral Arterial Disease Model
Angiogenic therapy using Ckβ-4 or Ckβ-10 is a novel therapeutic strategy to obtain restoration of blood flow around the ischemia in case of peripheral arterial diseases. The experimental protocol includes: a) One side of the femoral artery is ligated to create ischemic muscle of the hindlimb, the other side of hindlimb serves as a control. b) Ckβ-4 or Ckβ-10 protein, in a dosage range of 20 mg - 500 mg, is delivered intravenously and/or intramuscularly 3 times (perhaps more) per week for 2-3 weeks. c) The ischemic muscle tissue is collected after ligation of the femoral artery at 1, 2, and 3 weeks for the analysis of Ckβ-4 or Ckβ-10 expression and histology. Biopsy is also performed on the other side of normal muscle of the contralateral hindlimb.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 57: Ischemic Myocardial Disease Model Ckβ-4 or Ckβ-10 is evaluated as a potent mitogen capable of stimulating the development of collateral vessels, and restmcturing new vessels after coronary artery occlusion. Alteration of
Ckβ-4 or Ckβ-10 expression is investigated in situ. The experimental protocol includes: a) The heart is exposed through a left-side thoracotomy in the rat. Immediately, the left coronary artery is occluded with a thin suture (6-0) and the thorax is closed. b) Ckβ-4 or Ckβ-10 protein, in a dosage range of 20 mg - 500 mg, is delivered intravenously and/or intramuscularly 3 times (perhaps more) per week for 2-4 weeks. c) Thirty days after the surgery, the heart is removed and cross-sectioned for moφhometric and in situ analyzes.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein. However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 58: Rat Corneal Wound Healing Model This animal model shows the effect of Ckβ-4 or Ckβ-10 on neovascularization. The experimental protocol includes: a) Making a 1 - 1.5 mm long incision from the center of comea into the stromal layer. b) Inserting a spatula below the lip of the incision facing the outer comer of the eye. c) Making a pocket (its base is 1- 1.5 mm form the edge of the eye). d) Positioning a pellet, containing 50ng- 5ug of Ckβ-4 or Ckβ-10, within the pocket. e) Ckβ-4 or Ckβ-10 treatment can also be applied topically to the comeal wounds in a dosage range of 20mg - 500mg (daily treatment for five days). The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or
Ckβ-10.
EXAMPLE 59: Diabetic Mouse and Glucocorticoid-Impaired Wound Healing Models
A . Diabetic db+/db+ Mouse Model.
To demonstrate that Ckβ-4 or Ckβ-10 accelerates the healing process, the genetically diabetic mouse model of wound healing is used. The full thickness wound healing model in the db+/db+ mouse is a well characterized, clinically relevant and reproducible model of impaired wound healing. Healing of the diabetic wound is dependent on formation of granulation tissue and re-epithelialization rather than contraction (Gartner, M.H. et al, J. Surg. Res. 52:389 (1992); Greenhalgh, D.G. et al, Am. J. Pathol. 136: 1235 (1990)).
The diabetic animals have many of the characteristic features observed in Type II diabetes mellitus. Homozygous (db+/db+) mice are obese in comparison to their normal heterozygous (db+/+m) littermates. Mutant diabetic (db+/db+) mice have a single autosomal recessive mutation on chromosome 4 (db+) (Coleman et al. Proc. Natl. Acad. Sci. USA 77:283-293 (1982)). Animals show polyphagia, polydipsia and polyuria. Mutant diabetic mice (db+/db+) have elevated blood glucose, increased or normal insulin levels, and suppressed cell-mediated immunity (Mandel et al, J. Immunol. 120:1315 (1978); Debray-Sachs, M. et al, Clin. Exp. Immunol. 51(1):\-1 (1983); Leiter et al, Am. J. of Pathol 114:46-55 (1985)). Peripheral neuropathy, myocardial complications, and microvascular lesions, basement membrane thickening and glomemlar filtration abnormalities have been described in these animals (Norido, F. et al, Exp. Neurol. 83(2/221-232 (1984); Robertson et al, Diabetes 29(1):60-61 (1980); Giacomelli et al, Lab Invest. 40(4):460-413 (1979); Coleman, D.L., Diabetes 31 (Suppl/Λ-6 (1982)). These homozygous diabetic mice develop hyperglycemia that is resistant to insulin analogous to human type II diabetes (Mandel et al, J. Immunol. 120: 1315-1311 (1978)).
The characteristics observed in these animals suggests that healing in this model may be similar to the healing observed in human diabetes (Greenhalgh, et al, Am. J. of Pathol. 736:1235-1246 (1990)). Genetically diabetic female C57BL/KsJ (db+/db+) mice and their non-diabetic (db+/+m) heterozygous littermates are used in this study (Jackson Laboratories). The animals are purchased at 6 weeks of age and are 8 weeks old at the beginning of the study. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. The experiments are conducted according to the rules and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.
Wounding protocol is performed according to previously reported methods (Tsuboi, R. and Rifkin, D.B., J. Exp. Med. 172:245-251 (1990)). Briefly, on the day of wounding, animals are anesthetized with an intraperitoneal injection of Avertin (0.01 mg/mL), 2,2,2-tribromoethanol and 2-methyl-2-butanol dissolved in deionized water. The dorsal region of the animal is shaved and the skin washed with 70% ethanol solution and iodine. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is then created using a Keyes tissue punch. Immediately following wounding, the surrounding skin is gently stretched to eliminate wound expansion. The wounds are left open for the duration of the experiment. Application of the treatment is given topically for 5 consecutive days commencing on the day of wounding. Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the day of surgery and at two day intervals thereafter. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.
Ckβ-4 or Ckβ-10 is administered using at a range different doses of Ckβ-4 or Ckβ-10, from 4mg to 500mg per wound per day for 8 days in vehicle. Vehicle control groups received 50mL of vehicle solution.
Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital
(300mg/kg). The wounds and surrounding skin are then harvested for histology and immunohistochemistry. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing. Three groups of 10 animals each (5 diabetic and 5 non-diabetic controls) are evaluated: 1)
Vehicle placebo control, 2) untreated; and 3) treated group.
Wound closure is analyzed by measuring the area in the vertical and horizontal axis and obtaining the total square area of the wound. Contraction is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64mm2, the corresponding size of the dermal punch. Calculations are made using the following formula: [Open area on day 8] - [Open area on day 1] / [Open area on day 1]
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned peφendicular to the wound surface (5mm) and cut using a Reichert-Jung microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-sections of bisected wounds. Histologic examination of the wounds are used to assess whether the healing process and the moφhologic appearance of the repaired skin is altered by treatment with Ckβ-4 or Ckβ-10. This assessment included verification of the presence of cell accumulation, inflammatory cells, capillaries, fibroblasts, re-epithelialization and epidermal maturity (Greenhalgh, D.G. et al, Am. J. Pathol. 136: 1235 (1990)). A calibrated lens micrometer is used by a blinded observer.
Tissue sections are also stained immunohistochemically with a polyclonal rabbit anti- human keratin antibody using ABC Elite detection system. Human skin is used as a positive tissue control while non-immune IgG is used as a negative control. Keratinocyte growth is determined by evaluating the extent of reepithelialization of the wound using a calibrated lens micrometer.
Proliferating cell nuclear antigen/cyclin (PCNA) in skin specimens is demonstrated by using anti-PCNA antibody (1:50) with an ABC Elite detection system. Human colon cancer can serve as a positive tissue control and human brain tissue can be used as a negative tissue control. Each specimen includes a section with omission of the primary antibody and substitution with non-immune mouse IgG. Ranking of these sections is based on the extent of proliferation on a scale of 0-8, the lower side of the scale reflecting slight proliferation to the higher side reflecting intense proliferation.
Experimental data are analyzed using an unpaired t test. A p value of < 0.05 is considered significant.
B. Steroid Impaired Rat Model
The inhibition of wound healing by steroids has been well documented in various in vitro and in vivo systems (Wahl, S.M. Glucocorticoids and Wound healing. In: Anti-Inflammatory Steroid Action: Basic and Clinical Aspects. 280-302 (1989); Wahl, S.M.et al, J. Immunol. 775: 476-481 (1975); Werb, Z. et al, J. Exp. Med. 747:1684-1694 (1978)). Glucocorticoids retard wound healing by inhibiting angiogenesis, decreasing vascular permeability ( Ebert, R.H. , et al, An. Intern. Med. 37:701-705 (1952)), fibroblast proliferation, and collagen synthesis (Beck, L.S. et al, Growth Factors. 5: 295-304 (1991); Haynes, B.F. et al, J. Clin. Invest. 61: 703-797 (1978)) and producing a transient reduction of circulating monocytes (Haynes, B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989)). The systemic administration of steroids to impaired wound healing is a well establish phenomenon in rats (Beck, L.S. et al, Growth Factors. 5: 295-304 (1991); Haynes, B.F., et al., J. Clin. Invest. 61: 703-797 (1978); Wahl, S. M., "Glucocorticoids and wound healing", In: Antiinflammatory Steroid Action: Basic and Clinical Aspects, Academic Press, New York, pp. 280-302 (1989); Pierce, G.F. et al, Proc. Natl. Acad. Sci. USA 86: 2229-2233 (1989)).
To demonstrate that Ckβ-4 or Ckβ-10 can accelerate the healing process, the effects of multiple topical applications of Ckβ-4 or Ckβ-10 on full thickness excisional skin wounds in rats in which healing has been impaired by the systemic administration of methylprednisolone is assessed. Young adult male Sprague Dawley rats weighing 250-300 g (Charles River Laboratories) are used in this example. The animals are purchased at 8 weeks of age and are 9 weeks old at the beginning of the study. The healing response of rats is impaired by the systemic administration of methylprednisolone (17mg/kg/rat intramuscularly) at the time of wounding. Animals are individually housed and received food and water ad libitum. All manipulations are performed using aseptic techniques. This study is conducted according to the mles and guidelines of Human Genome Sciences, Inc. Institutional Animal Care and Use Committee and the Guidelines for the Care and Use of Laboratory Animals.
The wounding protocol is followed according to section A, above. On the day of wounding, animals are anesthetized with an intramuscular injection of ketamine (50 mg/kg) and xylazine (5 mg/kg). The dorsal region of the animal is shaved and the skin washed with 70% ethanol and iodine solutions. The surgical area is dried with sterile gauze prior to wounding. An 8 mm full-thickness wound is created using a Keyes tissue punch. The wounds are left open for the duration of the experiment. Applications of the testing materials are given topically once a day for 7 consecutive days commencing on the day of wounding and subsequent to methylprednisolone administration. Prior to treatment, wounds are gently cleansed with sterile saline and gauze sponges.
Wounds are visually examined and photographed at a fixed distance at the day of wounding and at the end of treatment. Wound closure is determined by daily measurement on days 1-5 and on day 8. Wounds are measured horizontally and vertically using a calibrated Jameson caliper. Wounds are considered healed if granulation tissue is no longer visible and the wound is covered by a continuous epithelium.
Ckβ-4 or Ckβ-10 is administered using at a range different doses of Ckβ-4 or Ckβ-10, from 4mg to 500mg per wound per day for 8 days in vehicle. Vehicle control groups received 50mL of vehicle solution. Animals are euthanized on day 8 with an intraperitoneal injection of sodium pentobarbital
(300mg/kg). The wounds and surrounding skin are then harvested for histology. Tissue specimens are placed in 10% neutral buffered formalin in tissue cassettes between biopsy sponges for further processing.
Four groups of 10 animals each (5 with methylprednisolone and 5 without glucocorticoid) are evaluated: 1) Untreated group 2) Vehicle placebo control 3) Ckβ-4 or Ckβ-10 treated groups.
Wound closure is analyzed by measuring the area in the vertical and horizontal axis and obtaining the total area of the wound. Closure is then estimated by establishing the differences between the initial wound area (day 0) and that of post treatment (day 8). The wound area on day 1 is 64mm2, the corresponding size of the dermal punch. Calculations are made using the following formula:
[Open area on day 8] - [Open area on day 1] / [Open area on day 1]
Specimens are fixed in 10% buffered formalin and paraffin embedded blocks are sectioned peφendicular to the wound surface (5mm) and cut using an Olympus microtome. Routine hematoxylin-eosin (H&E) staining is performed on cross-sections of bisected wounds.
Histologic examination of the wounds allows assessment of whether the healing process and the moφhologic appearance of the repaired skin is improved by treatment with Ckβ-4 or Ckβ-10. A calibrated lens micrometer is used by a blinded observer to determine the distance of the wound gap- Experimental data are analyzed using an unpaired t test. A p value of < 0.05 is considered significant.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 60: Lymphadema Animal Model
The puφose of this experimental approach is to create an appropriate and consistent lymphedema model for testing the therapeutic effects of Ckβ-4 or Ckβ-10 in lymphangiogenesis and re-establishment of the lymphatic circulatory system in the rat hind limb. Effectiveness is measured by swelling volume of the affected limb, quantification of the amount of lymphatic vasculature, total blood plasma protein, and histopathology. Acute lymphedema is observed for 7-10 days. Perhaps more importantly, the chronic progress of the edema is followed for up to 3- 4 weeks. Prior to beginning surgery, blood sample is drawn for protein concentration analysis. Male rats weighing approximately ~350g are dosed with Pentobarbital. Subsequently, the right legs are shaved from knee to hip. The shaved area is swabbed with gauze soaked in 70% EtOH.
Blood is drawn for semm total protein testing. Circumference and volumetric measurements are made prior to injecting dye into paws after marking 2 measurement levels (0.5 cm above heel, at mid-pt of dorsal paw). The intradermal dorsum of both right and left paws are injected with 0.05 ml of 1% Evan's Blue. Circumference and volumetric measurements are then made following injection of dye into paws.
Using the knee joint as a landmark, a mid-leg inguinal incision is made circumferentially allowing the femoral vessels to be located. Forceps and hemostats are used to dissect and separate the skin flaps. After locating the femoral vessels, the lymphatic vessel that runs along side and underneath the vessel(s) is located. The main lymphatic vessels in this area are then electrically coagulated or suture ligated.
Using a microscope, muscles in back of the leg (near the semitendinosis and adductors) are bluntly dissected. The popliteal lymph node is then located. The 2 proximal and 2 distal lymphatic vessels and distal blood supply of the popliteal node are then and ligated by suturing.
The popliteal lymph node, and any accompanying adipose tissue, is then removed by cutting connective tissues.
Care is taken to control any mild bleeding resulting from this procedure. After lymphatics are occluded, the skin flaps are sealed by using liquid skin (Vetbond) (AJ Buck). The separated skin edges are sealed to the underlying muscle tissue while leaving a gap of -0.5 cm around the leg. Skin also may be anchored by suturing to underlying muscle when necessary.
To avoid infection, animals are housed individually with mesh (no bedding). Recovering animals are checked daily through the optimal edematous peak, which typically occurred by day
5-7. The plateau edematous peak are then observed. To evaluate the intensity of the lymphedema, the circumference and volumes of 2 designated places on each paw before operation and daily for 7 days are measured. The effect plasma proteins on lymphedema is determined and whether protein analysis is a useful testing perimeter is also investigated. The weights of both control and edematous limbs are evaluated at 2 places. Analysis is performed in a blind manner. Circumference Measurements: Under brief gas anesthetic to prevent limb movement, a cloth tape is used to measure limb circumference. Measurements are done at the ankle bone and dorsal paw by 2 different people then those 2 readings are averaged. Readings are taken from both control and edematous limbs.
Volumetric Measurements: On the day of surgery, animals are anesthetized with Pentobarbital and are tested prior to surgery. For daily volumetrics animals are under brief halothane anesthetic (rapid immobilization and quick recovery), both legs are shaved and equally marked using wateφroof marker on legs. Legs are first dipped in water, then dipped into instrument to each marked level then measured by Buxco edema software(Chen/Nictor). Data is recorded by one person, while the other is dipping the limb to marked area.
Blood-plasma protein measurements: Blood is drawn, spun, and semm separated prior to surgery and then at conclusion for total protein and Ca2+ comparison.
Limb Weight Comparison: After drawing blood, the animal is prepared for tissue collection. The limbs are amputated using a quillitine, then both experimental and control legs are cut at the ligature and weighed. A second weighing is done as the tibio-cacaneal joint is disarticulated and the foot is weighed.
Histological Preparations: The transverse muscle located behind the knee (popliteal) area is dissected and arranged in a metal mold, filled with freezeGel, dipped into cold methylbutane, placed into labeled sample bags at - 80EC until sectioning. Upon sectioning, the muscle is observed under fluorescent microscopy for lymphatics.
The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
EXAMPLE 61: Suppression of TNF alpha-induced adhesion molecule expression by Ckb-4 or Ckb-10
The recmitment of lymphocytes to areas of inflammation and angiogenesis involves specific receptor-ligand interactions between cell surface adhesion molecules (CAMs) on lymphocytes and the vascular endothelium. The adhesion process, in both normal and pathological settings, follows a multi-step cascade that involves intercellular adhesion molecule- 1 (ICAM-1), vascular cell adhesion molecule- 1 (VCAM-1), and endothelial leukocyte adhesion molecule- 1 (E-selectin) expression on endothelial cells (EC). The expression of these molecules and others on the vascular endothelium determines the efficiency with which leukocytes may adhere to the local vasculature and extravasate into the local tissue during the development of an inflammatory response. The local concentration of cytokines and growth factor participate in the modulation of the expression of these CAMs.
Tumor necrosis factor alpha (TNF-a), a potent proinflammatory cytokine, is a stimulator of all three CAMs on endothelial cells and may be involved in a wide variety of inflammatory responses, often resulting in a pathological outcome.
The potential of Ckβ-4 or Ckβ-10 to mediate a suppression of TNF-a induced CAM expression can be examined. A modified ELISA assay which uses ECs as a solid phase absorbent is employed to measure the amount of CAM expression on TNF-a treated ECs when co-stimulated with a member of the FGF family of proteins.
To perform the experiment, human umbilical vein endothelial cell (HUVEC) cultures are obtained from pooled cord harvests and maintained in growth medium (EGM-2; Clonetics, San Diego, CA) supplemented with 10% FCS and 1% penicillin/streptomycin in a 37 degree C humidified incubator containing 5% CO2. HUVECs are seeded in 96-well plates at concentrations of 1 x 104 cells/well in EGM medium at 37 degree C for 18-24 hrs or until confluent. The monolayers are subsequently washed 3 times with a semm-free solution of RPMI- 1640 supplemented with 100 U/ml penicillin and 100 mg/ml streptomycin, and treated with a given cytokine and/or growth factor(s) for 24 h at 37 degree C. Following incubation, the cells are then evaluated for CAM expression.
Human Umbilical Vein Endothelial cells (HUVECs) are grown in a standard 96 well plate to confluence. Growth medium is removed from the cells and replaced with 90 ul of 199 Medium (10% FBS). Samples for testing and positive or negative controls are added to the plate in triplicate (in 10 ul volumes). Plates are incubated at 37 degree C for either 5 h (selectin and integrin expression) or 24 h (integrin expression only). Plates are aspirated to remove medium and 100 μl of 0.1% paraformaldehyde-PBS(with Ca-H- and Mg++) is added to each well. Plates are held at 4°C for 30 min.
Fixative is then removed from the wells and wells are washed IX with PBS(+Ca,Mg)+0.5% BSA and drained. Do not allow the wells to dry. Add 10 μl of diluted primary antibody to the test and control wells. Anti-ICAM-1 -Biotin, Anti- VCAM-1 -Biotin and Anti-E-selectin-Biotin are used at a concentration of 10 μg/ml (1: 10 dilution of 0.1 mg/ml stock antibody). Cells are incubated at 37°C for 30 min. in a humidified environment. Wells are washed X3 with PBS(+Ca,Mg)+0.5% BSA.
Then add 20 μl of diluted ExtrAvidin- Alkaline Phosphotase (1:5,000 dilution) to each well and incubated at 37°C for 30 min. Wells are washed X3 with PBS(+Ca,Mg)+0.5% BSA. 1 tablet of p-Nitrophenol Phosphate pNPP is dissolved in 5 ml of glycine buffer (pH 10.4). 100 μl of pNPP substrate in glycine buffer is added to each test well. Standard wells in triplicate are prepared from the working dilution of the ExtrAvidin-Alkaline Phosphotase in glycine buffer: 1:5,000 (10°) > 10"05 > 10"1 > 10"1 5. 5 μl of each dilution is added to triplicate wells and the resulting AP content in each well is 5.50 ng, 1.74 ng, 0.55 ng, 0.18 ng. 100 μl of pNNP reagent must then be added to each of the standard wells. The plate must be incubated at 37°C for 4h. A volume of 50 μl of 3M NaOH is added to all wells. The results are quantified on a plate reader at 405 nm. The background subtraction option is used on blank wells filled with glycine buffer only. The template is set up to indicate the concentration of AP-conjugate in each standard well [ 5.50 ng; 1.74 ng; 0.55 ng; 0.18 ng]. Results are indicated as amount of bound AP-coηjugate in each sample. The studies described in this example tested activity in Ckβ-4 or Ckβ-10 protein.
However, one skilled in the art could easily modify the exemplified studies to test the activity of
Ckβ-4 or Ckβ-10 polynucleotides (e.g., gene therapy), agonists, and/or antagonists of Ckβ-4 or Ckβ-10.
It will be clear that the invention may be practiced otherwise than as particularly described in the foregoing description and examples. Numerous modifications and variations of the present invention are possible in light of the above teachings and, therefore, are within the scope of the appended claims.
The entire disclosure of each document cited (including patents, patent applications, journal articles, abstracts, laboratory manuals, books, or other disclosures) in the
Background of the Invention, Detailed Description, and Examples is hereby incoφorated herein by reference. Moreover, the sequence listing form U.S. application Serial No. are 08/613,822; 09/261,201 ; 08/847,585; and 08/458,355 is herein incoφorated by reference.
INDICATIONS RELATING TO A DEPOSITED MICROORGAJNϊSM^
(PCT Rule \ 3bιs )
A. The indications made below relate to the microorganism referred to in the description
B. IDENTIFICATIONOFDEPOSΓΓ Further deposits aie identified on an additional sheet
Name ot deposπarv institution
American Type Culture Collection ("ATCC")
Address of depositaiv institution timludine, postal code and countn) 10801 University Boulevard Mansassas Virginia 20110-2209 US
Date of deposit Accession Number
29 July 1994 75849
C. ADDITIONAL INDICATIONS This information is continued on an additional sheet [ |
DNA Plasmid 75849
In respect to those designations in which a European Patent is sought a sample of the deposited microorganism will be made available until the publication of the mention of the grant of the European patent or until the date on which application has been refused or withdrawn or is deemed to be withdrawn only by the issue of such a sample to an expert nominated by the person requesting the sample (Rule 28(4) EPC)
D. DESIGNATED STATES FOR WHICH INDICATIONS ARE MADEliftl indications are noi tor all designated States)
E. SEPARATE FURNISHING OF lNOlCATlONStlea\eblankιfnotapplιcable)
The indications listed below will be submitted to the International Bureau later (specify tin "metal natu e ol the indications i ? Accession Number of Deposit )
Form PCT/R0/I 34 (Julv 1992) ATCC Deposit No. 75848
CANADA
The applicant requests that, until either a Canadian patent has been issued on the basis of an application or the application has been refused, or is abandoned and no longer subject to reinstatement, or is withdrawn, the Commissioner of Patents only authorizes the furnishing of a sample of the deposited biological material referred to in the application to an independent expert nominated by the Commissioner, the applicant must, by a written statement, inform the International Bureau accordingly before completion of technical preparations for publication of the international application.
NORWAY
The applicant hereby requests that the application has been laid open to public inspection (by the Norwegian Patent Office), or has been finally decided upon by the Norwegian Patent Office without having been laid open inspection, the furnishing of a sample shall only be effected to an expert in the art. The request to this effect shall be filed by the applicant with the Norwegian Patent Office not later than at the time when the application is made available to the public under Sections 22 and 33(3) of the Norwegian Patents Act. If such a request has been filed by the applicant, any request made by a third party for the furnishing of a sample shall indicate the expert to be used. That expert may be any person entered on the list of recognized experts drawn up by the Norwegian Patent Office or any person approved by the applicant in the individual case.
AUSTRALIA
The applicant hereby gives notice that the furnishing of a sample of a microorganism shall only be effected prior to the grant of a patent, or prior to the lapsing, refusal or withdrawal of the application, to a person who is a skilled addressee without an interest in the invention (Regulation 3.25(3) of the Australian Patents Regulations).
FINLAND
The applicant hereby requests that, until the application has been laid open to public inspection (by the National Board of Patents and Regulations), or has been finally decided upon by the National Board of Patents and Registration without having been laid open to public inspection, the furnishing of a sample shall only be effected to an expert in the art.
UNITED KINGDOM
The applicant hereby requests that the furnishing of a sample of a microorganism shall only be made available to an expert. The request to this effect must be filed by the applicant with the International Bureau before the completion of the technical preparations for the international publication of the application.
ATCC Deposit No. 75848
DENMARK
The applicant hereby requests that, until the application has been laid open to public inspection (by the Danish Patent Office), or has been finally decided upon by the Danish Patent office without having been laid open to public inspection, the furnishing of a sample shall only be effected to an expert in the art. The request to this effect shall be filed by the applicant with the Danish Patent Office not later that at the time when the application is made available to the public under Sections 22 and 33(3) of the Danish Patents Act. If such a request has been filed by the applicant, any request made by a third party for the furnishing of a sample shall indicate the expert to be used. That expert may be any person entered on a list of recognized experts drawn up by the Danish Patent Office or any person by the applicant in the individual case.
SWEDEN
The applicant hereby requests that, until the application has been laid open to public inspection (by the Swedish Patent Office), or has been finally decided upon by the Swedish Patent Office without having been laid open to public inspection, the furnishing of a sample shall only be effected to an expert in the art. The request to this effect shall be filed by the applicant with the International Bureau before the expiration of 16 months from the priority date (preferably on the Form PCT/RO/134 reproduced in annex Z of Volume I of the PCT Applicant's Guide). If such a request has been filed by the applicant any request made by a third party for the furnishing of a sample shall indicate the expert to be used. That expert may be any person entered on a list of recognized experts drawn up by the Swedish Patent Office or any person approved by a applicant in the individual case.
NETHERLANDS
The applicant hereby requests that until the date of a grant of a Netherlands patent or until the date on which the application is refused or withdrawn or lapsed, the microorganism shall be made available as provided in the 31F(1) of the Patent Rules only by the issue of a sample to an expert. The request to this effect must be furnished by the applicant with the Netherlands Industrial Property Office before the date on which the application is made available to the public under Section 22C or Section 25 of the Patents Act of the Kingdom of the Netherlands, whichever of the two dates occurs earlier.

Claims

What Is Claimed Is:
1 . An isolated polynucleotide comprising a nucleic acid sequence at least 90% identical to a member selected from the group consisting of:
(a) a nucleotide sequence encoding amino acid residues 29 to 98 of SEQ ID NO:4;
(b) a nucleotide sequence encoding amino acid residues 30 to 98 of SEQ ID NO:4;
(c) a nucleotide sequence encoding amino acid residues 31 to 98 of SEQ ID NO:4;
(d) a nucleotide sequence encoding amino acid residues 32 to 98 of SEQ ID NO:4;
(e) a nucleotide sequence encoding amino acid residues 33 to 98 of SEQ ID NO:4;
(f) a nucleotide sequence encoding amino acid residues 34 to 98 of SEQ ID NO:4;
(g) a nucleotide sequence encoding amino acid residues 35 to 98 of SEQ ID NO:4; (h) a nucleotide sequence encoding amino acid residues 25 to 98 of SEQ ID NO:4; (i) a nucleotide sequence encoding amino acid residues 26 to 98 of SEQ ID NO:4; (j) a nucleotide sequence encoding amino acid residues 27 to 98 of SEQ ID NO:4 (k) a nucleotide sequence encoding the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 29;
(1) a nucleotide sequence encoding the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849. excepting the N-terminal amino acid residues 1 to 28;
(m) a nucleotide sequence encoding the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 27;
(n) a nucleotide sequence encoding the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 24; and
(o) a nucleotide sequence complementary to any of the nucleotide sequences in (a), (b), (c), (d), (e), (f), (g), (h), (i), ), (k), (1), (m), or (n), above.
2. The isolated polynucleotide of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 2 (SEQ ID NO:3) encoding the polypeptide having the amino acid sequence in positions 30 to 98 of SEQ ID NO:4.
3. The isolated polynucleotide of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 2 (SEQ ID NO:3) encoding the polypeptide having the amino acid sequence in positions 29 to 98 of SEQ ID NO:4.
4. The isolated polynucleotide of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 2 (SEQ ID NO: 3) encoding the polypeptide having the amino acid sequence in positions 28 to 98 of SEQ ID NO:4.
5. The isolated polynucleotide of claim 1 wherein said polynucleotide has the nucleotide sequence in Figure 2 (SEQ ID NO: 3) encoding the polypeptide having the amino acid sequence in positions 25 to 98 of SEQ ID NO:4.
6. An isolated nucleic acid molecule comprising a polynucleotide which hybridizes under stringent hybridization conditions to a polynucleotide having a nucleotide sequence identical to a nucleotide sequence in (a), (b), (c), (d), (e), (f), (g), (h), (i), (j), (k), (1), (m), or (n) of claim 1 wherein said polynucleotide which hybridizes does not hybridize under stringent hybridization conditions to a polynucleotide having a nucleotide sequence consisting of only A residues or of only T residues.
7. A method for making a recombinant vector comprising inserting an isolated nucleic acid molecule of claim 1 into a vector.
8. A recombinant vector produced by the method of claim 7.
9. A method of making a recombinant host cell comprising introducing the recombinant vector of claim 8 into a host cell.
10. A recombinant host cell produced by the method of claim 9.
1 1. A recombinant method for producing a polypeptide, comprising culturing the recombinant host cell of claim 10 under conditions such that said polypeptide is expressed and recovering said polypeptide.
12. An isolated polypeptide comprising an amino acid sequence at least 90% identical to a member selected from the group consisting of:
(a) amino acid residues 29 to 98 of SEQ ID NO:4;
(b) amino acid residues 30 to 98 of SEQ ID NO:4;
(c) amino acid residues 31 to 98 of SEQ ID NO:4;
(d) amino acid residues 32 to 98 of SEQ ID NO:4;
(e) amino acid residues 33 to 98 of SEQ ID NO:4;
(f) amino acid residues 34 to 98 of SEQ ID NO:4;
(g) amino acid residues 35 to 98 of SEQ ID NO:4; (h) amino acid residues 25 to 98 of SEQ ID NO:4;
(i) amino acid residues 26 to 98 of SEQ ID NO:4;
(j) amino acid residues 27 to 98 of SEQ ID NO:4;
(k) the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 29;
(1) the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 28;
(m) the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 27; and
(n) the polypeptide encoded by the human cDNA contained in ATCC Deposit No: 75849, excepting the N-terminal amino acid residues 1 to 24.
13. An isolated antibody that binds specifically to an isolated polypeptide of claim 12.
14. A pharmaceutical composition comprising an isolated polypeptide of claim 12 in a pharmaceutically acceptable carrier.
15. The product produced by the method of claim 11.
16. An agonist of the polypeptide of claim 12.
17. An antagonist of the polypeptide of claim 12.
18. A method for preventing, treating, or ameliorating a medical condition which comprises administering to a mammalian subject a therapeutically effective amount of the polypeptide of claim 12 or of the polynucleotide of claim 1.
19. A method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject related to expression or activity of a secreted protein comprising:
(a) determining the presence or absence of a mutation in the polynucleotide of claim
1;
(b) diagnosing a pathological condition or a susceptibility to a pathological condition based on the presence or absence of said mutation.
20. A method of diagnosing a pathological condition or a susceptibility to a pathological condition in a subject related to increased or decreased expression or activity of the polypeptide of claim 14 comprising:
(a) determining the presence or amount of expression or activity of the polypeptide of claim 14 in a biological sample;
(b) diagnosing a pathological condition or a susceptibility to a pathological condition based on the presence or amount of expression or activity of the polypeptide.
21. An isolated Ckβ-10 N-terminal deletion mutant polypeptide consisting of an amino acid sequence selected from the group consisting of: 29-98, 30-98, 31-98, 32-98, 33-98, 34-98 and 35-98 of SEQ ID NO:4.
22. An isolated Ckβ-10 N-terminal deletion mutant polypeptide consisting of an amino acid sequence selected from the group consisting of: 30-98, 29-98, 28-98, 27-98, 26-98, and 25- 98 of SEQ ID NO:4.
EP00903142A 1999-01-08 2000-01-07 MUTANT POLYPEPTIDES OF HUMAN CHIMIOKIN BETA-10 Withdrawn EP1141295A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US11543999P 1999-01-08 1999-01-08
US115439P 1999-01-08
PCT/US2000/000296 WO2000040726A1 (en) 1999-01-08 2000-01-07 Human chemokine beta-10 mutant polypeptides

Publications (2)

Publication Number Publication Date
EP1141295A1 true EP1141295A1 (en) 2001-10-10
EP1141295A4 EP1141295A4 (en) 2002-09-18

Family

ID=22361410

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00903142A Withdrawn EP1141295A4 (en) 1999-01-08 2000-01-07 MUTANT POLYPEPTIDES OF HUMAN CHIMIOKIN BETA-10

Country Status (4)

Country Link
EP (1) EP1141295A4 (en)
AU (1) AU2493000A (en)
CA (1) CA2359853A1 (en)
WO (1) WO2000040726A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6989247B2 (en) * 2000-11-28 2006-01-24 Celltech R & D, Inc. Compositions and methods for diagnosing or treating psoriasis

Family Cites Families (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9308060D0 (en) * 1993-04-19 1993-06-02 Cancer Res Campaign Tech Stem cell inhibitor
US5981230A (en) * 1994-08-23 1999-11-09 Human Genome Sciences, Inc. Polynucleotide encoding chemokine β-4
ZA968897B (en) * 1995-10-24 1998-07-14 Smithkline Beecham Corp Novel chemokine for mobilizing stem cells
WO1997031098A1 (en) * 1996-02-23 1997-08-28 Human Genome Sciences, Inc. Human chemokine polypeptides

Also Published As

Publication number Publication date
CA2359853A1 (en) 2000-07-13
EP1141295A4 (en) 2002-09-18
AU2493000A (en) 2000-07-24
WO2000040726A1 (en) 2000-07-13

Similar Documents

Publication Publication Date Title
US6593112B1 (en) Polynucleotides encoding fibroblast growth factor 15
US6472512B1 (en) Keratinocyte derived interferon
US6953667B2 (en) Antibodies against human protein HUVDJ43
US20060039905A1 (en) Galectin 11
US20090305991A1 (en) 33 Human Secreted Proteins
WO2000075163A1 (en) Angiogenic proteins and uses thereof
US6605441B1 (en) Antibodies against fibroblast growth factor 11
US20050064458A1 (en) 143 human secreted proteins
US6433145B1 (en) Keratinocyte derived interferon
US20070190612A1 (en) 31 Human Secreted Proteins
US20050019824A1 (en) Fibroblast Growth Factor-10
WO2000063221A2 (en) Galectin 11
US6936688B2 (en) Human chemokine beta-10 mutant polypeptides
US20020025553A1 (en) Transforming growth factor alpha HIII
EP1223946A1 (en) Human neuropeptide receptor
US20030175778A1 (en) Interferon Receptor HKAEF92
WO2001007608A1 (en) Keratinocyte derived interferon
US20050026838A1 (en) Fibroblast Growth Factor-13
WO2000071715A1 (en) Fibroblast growth factor 11
WO2000071152A1 (en) Fibroblast growth factor 10
WO2000067775A1 (en) Fibroblast growth factor 15
EP1248801A1 (en) Human polynucleotides, polypeptides, and antibodies
WO2000040726A1 (en) Human chemokine beta-10 mutant polypeptides
WO2000071567A2 (en) Fibroblast growth factor 13
WO2000042165A2 (en) Bone marrow-specific protein

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010803

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

A4 Supplementary search report drawn up and despatched

Effective date: 20020801

AK Designated contracting states

Kind code of ref document: A4

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

17Q First examination report despatched

Effective date: 20030624

GRAP Despatch of communication of intention to grant a patent

Free format text: ORIGINAL CODE: EPIDOSNIGR1

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20060817