EP1140146A1 - Porcine b7-1 and antibodies thereto - Google Patents

Porcine b7-1 and antibodies thereto

Info

Publication number
EP1140146A1
EP1140146A1 EP00973762A EP00973762A EP1140146A1 EP 1140146 A1 EP1140146 A1 EP 1140146A1 EP 00973762 A EP00973762 A EP 00973762A EP 00973762 A EP00973762 A EP 00973762A EP 1140146 A1 EP1140146 A1 EP 1140146A1
Authority
EP
European Patent Office
Prior art keywords
porcine
antibodies
cells
antibody
human
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP00973762A
Other languages
German (de)
French (fr)
Other versions
EP1140146A4 (en
Inventor
William L. Fodor
Susan Faas Knight
Louis A. Matis
Russell P. Rother
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Alexion Pharmaceuticals Inc
Original Assignee
Alexion Pharmaceuticals Inc
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Alexion Pharmaceuticals Inc filed Critical Alexion Pharmaceuticals Inc
Publication of EP1140146A1 publication Critical patent/EP1140146A1/en
Publication of EP1140146A4 publication Critical patent/EP1140146A4/en
Withdrawn legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503Immunoglobulin superfamily
    • C07K14/70532B7 molecules, e.g. CD80, CD86
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2827Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against B7 molecules, e.g. CD80, CD86
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides

Definitions

  • Soluble and transmembrane porcine B7-1 proteins, their amino acid sequences, DNA and cDNA, as well as antibodies reactive with the B7-1 proteins are ⁇ isclosed.
  • T cells also called T lymphocytes
  • T cells recognize foreign pathogens (such as bacteria, viruses, or parasites) , foreign cells tissues, and or organs, become activated and thereby initiate an immune response that results in elimination of the foreign agent from the body.
  • T cell activation is not only dependent on antigen recognition, but also on engagement of costimulatory molecules found on antigen presenting cells (APCs) .
  • APCs antigen presenting cells
  • costimulatory signal that determines whether antigen recognition leads to T cell activation is that generated by the interaction of CD28 on the T cells with the B7 molecules on the APCs. It is known that both B7-1 (CD80) and B7-2 (CD86) molecules on APCs provide critical costimulatory signals in T cell activation through their binding with the CD28 molecule on the T cell, and, moreover, that antigens presented in the absence of such costimulatory signals results in T cell anergy.
  • the genomic organization of botn human and mouse B7-1 molecules are known m the art.
  • the B7-1 molecule is a 60 KD trans-membrane glycoprotem usually present on the surface of APCs, and having two ligands, CD28 (discussed a ⁇ ove) and CTLA-4. Interaction of B7 molecules with CTLA-4 is known to down-regulate T cell activation.
  • PCT application number WO 92/00092 to Linsley et al . describes the B7 antigen as a ligand for the CD28 receptor on T cells.
  • the application states that "the B7 antigen, or its fragments or derivatives are reacted with CD28 positive T cells to regulate T cell interactions with other cells . . . B7 antigen or CD28 receptor may be used to inhibit interaction of cells associated with these molecules, thereby regulating T cell responses.”
  • U.S. Patent No. 5,869,050 to de Boer et al . describes the use of ant ⁇ -B7 and ant ⁇ -CD40 antibodies to treat allograft transplant rejection, graft versus host disease and rheumatoid arthritis, stating that " . . . ant ⁇ -B7 and ant ⁇ -CD40 antibodies . . . can be used to prevent or treat an antibody-mediated or immune system disease in a patient.”
  • Porcine B7-1 DNA in the form of, for example, cDNA including transmembrane porcine coding sequences, nucleic acid molecules coding for a soluble form of the porcine B7-1 protein, as well as, both transmembrane and soluble porcine B7-1 proteins lac ing a transmembrane and cytoplasm c domain, have surprisingly been created.
  • an isolated nucleic ac d molecule including a DNA encoding for a polypepticie having at least 80% identity (preferably at least 90% anct mere preferable at least 95%) sequence identity with porcine B7-1 protein is provi ⁇ ed.
  • ant porcine 37-1 antibodies are provided.
  • the term "antibodies” refers to 1) immunoglobulms produced in vivo; 2) those produced in vitro by a hybriaoma; 3) antigen binding fragments (e.g., Fab' preparations) of such immunoglobulms; and 4) recombinantly expressed antigen binding proteins (including chimeric immunoglobulms, bispecific immunoglobulms , heterocon ugate immunoglobulms, "humanized” immuncglobulins , single chain antibodies, antigen binding fragments thereof, and other recomb ant proteins containing antigen binding domains derived from immunoglobulms) .
  • Antibodies that bind to porcine B7-1 molecules, but not to human B7-1 molecules are also provided.
  • therapeutic agents and methods for their use in the prevention and/or treatment of porcine xenograft rejection are described. These agents contain the porcine proteins and/or the anti-porcine antibodies discussed hereinabove.
  • therapeutic agents and methods for their use in the treatment of inflammatory diseases such as autoimmune diseases are described.
  • These agents contain the soluble porcine proteins discussed herein.
  • porcine cells, tissues and whole organs lacking the B7-1 molecule are provided.
  • FIG. 1 Sequence comparisons between porcine and human B7-1.
  • sB7-l Amino acid sequences of soluble porcine B7-1 (sB7-l), the transmembrane form of porcine B ⁇ -l (tmB7-l) and human 37-1 (hB7-i) were aligned based on ammo acid identity and structural similarity. Identical amino acids are denoted by asterisks, and gaps in the sequences are indicated by dashes.
  • FIG. 1 Porcine B7-1 binding to the human receptors CD28 and CTLA-4.
  • Human Jurkat cells that are known to express CD28 but net CTLA-4 were incubated with sB7-l tagged with histidine residues (sB7-l-His) followed by incubation with fluorescein isothior- cyanate (FITC) -labelled polyclonal IgG recognizing the histidine tag. Binding was determined by Flow cytometry (described in the Examples herein below) .
  • Panel A depicts the binding of sB ⁇ -l-His to Jurkat cells that have been previously incubated with buffer alone (no Ab (antibodies) ) , with a functionally blocking anti-CD28 mAb cr with an irrelevant isotype matched mAb (Anti-CD59) .
  • Panel B shows the binding of sB7-l following preincubaticn with buffer alone (no Ab) human CTLA-4Ig or an irrelevant isotype matched mAb (Anti-CD3) . The binding of the anti-histidine IgG in the absence of s37-l-His is shown in both panels (control) .
  • sB7-l blocks human T cell activation by xenogeneic or allcgeneic cells. Mitomcycin-C treated porcine cr human stimulator cells were incubated with human responder cells in the presence or absence of sB7-l and levels of T cell activation were determined. Curves show thymidine incorporation by human T cells in response to either porcine (panel A) or human (panel 3) P5L in the presence of increasing concentrations of s ⁇ ⁇ -l (closed circles) .
  • Bars represent absorbances in O.D. units cf CTLA-4-Ig binding to 37-1 in the presence of the various hybridoma supernatants.
  • Other bars represent hybridoma supernatants that either inhibited cr augmented CTLA-4-Ig/B7-l binding.
  • Anti-porcine B7-1 hybridoma supernatants modify interactions between porcine B7-1 and human CD28.
  • the binding of sE7-l to human CD28 on the surface of Jurkat cells was assayed in the presence of anti-B7-l hybridoma supernatants.
  • Bolded peaks i: each panel represent the binding of sB7-l to CD28 in the absence cf hybridoma supernatants. Peaks shown by solid lines represent background binding in the absence of sB7-l. Peaks indicated by dotted lines show the binding between sB7-l and CD28 in the presence of the various supernatants.
  • FIG. 6 mAbs generated to porcine B7-1 and 37-2 inhibit human T cell activation by porcine stimulator cells .
  • Mitomycin C-treated porcine stimulator cells (porcine peripheral blood lymphocytes; PBL) were incubated with human responder cells in the presence or absence of anti-porcine B7 mAbs and levels of T cell activation were determined.
  • Curves show thymidine incorporation by human T cells in response to porcine PBL in the presence of increasing concentrations of anti-B7-l (closed circles) , anti-B7-2 (open cirles) or a combination of both antibodies (open triangles) .
  • Single points indicate levels of T cell activation in the absence of anti-B7 mAbs (open square) , in the presence of human CTLA-4-
  • Ig at 100 ⁇ g/ml (closed square) or in the presence of an isotype matched murine mAb at 100 ⁇ g/ml (closed triangle) .
  • Figure 7 cDNA encoding soluble porcine 37-1 (s 37-1) .
  • Capital letters represent the coding sequence while lower letters show 5 or 3' untranslated regions.
  • Figure 8 cDNA encoding transmembrane porcine B7-1 1 (tmB7-l)
  • Capital letters represent the coding sequence while lower letter; show 5' or 3' untranslated regions.
  • Isolated nucleic acid molecules including sequences that are unique to the porcine genome are provided.
  • the isolated nucleic acid molecules include sense sequences of contiguous nucleotides of the porcine sequences disclosed herein, for example in Figures 7 & 8. These sense sequences are unique to the porcine genome, and can be used as PCR primers or hybridization probes for the identi ication and/or isolation of the homologous porcine genes from porcine genomic DNA, and for the quantification of 37-1 message in porcine RNA samples. Antisense sequences of contiguous nucleotides complementary to such sense sequences are also required in order to practice PCR, and may also be used as hybridization probes. In order to be used for such purposes, the sequences of contiguous nucleotides must span a sufficient length.
  • oligonucleotide length required for specific hybridization i.e., hybridization under conditions requiring an essentially perfect match of complementary nucleotides wherein the sequence of the probe can be expected to occur only once in the genome of the organism being probed
  • this span is at least 14 nucleotides, and, preferably, at least 18 nucleotides. Because at least 2 PCR primers are generally required to carry out a PCR reaction, the specificity of the PCR reaction is greater than that of each cf the oligonucleotide primers used to drive the reaction.
  • a cloned porcine cDNA molecule having a sequence of nucleotides unique to the porcine genome is provided.
  • This cloned molecule is characterized by hybridizing specifically to an isolated nucleic acid molecule as described in the preceding paragraph. Specific hybridization is used to clone this DNA molecule.
  • This cloning can be accomplished by several methods well known in the art, such as by PCR using porcine reverse-transcribed DNA templates, or by conventional screening cf phage or other libraries of porcine cDNA or genomic DNA, (e.g., by- plaque lift filter hybridization) .
  • recombmant expression vectors which include synthetic or cDNA-derived DNA fragments encoding porcine B7-1 proteins are provided.
  • the nuclecti ⁇ e sequences coding for porcine B7-1 proteins can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements fcr the transcription and translation of tne inserted protein-coding sequence.
  • the necessary transcripticr.al and translational signals can also be supplied by the native gene and/or its flanking regions.
  • Suitable host vector systems include, but are not limited to: mammalian cell systems infected with viral vectors (e . g .
  • vaccinia virus adenovirus, retroviruses, etc.
  • mammalian cell systems transfected with plasmids include mammalian cell systems transfected with plasmids; insect cell systems infected with viral vectors (e.g., baculovirus) ; microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA.
  • yeast containing yeast expression vectors or bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA.
  • Suitable bacterial expression vectors include a selectable marker and bacterial origin of replication derived from commercially available plasmids having genetic elements of the well-known cloning vector pBR322 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, United States of America; ATCC Accession No. 37017) . These pBR322 "backbone sections,” or functionally equivalent sequences, are combined with an appropriate promoter and the structural gene to be expressed.
  • Suitable promoters include, but are not limited to, the lactose promoter system (Chang, et al . , Nature 275,, pp. 615. 1978) the tryptophan (trp) promoter; see Goeddel, et al . , Nucl Acids Res 8, pp. 4057 1980, and the tac promoter, cr a fusion between the tac and trp promoters referred to as the trc promoter; (see Maniatis, Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp.412; 1982).
  • Preferred bacterial expression vectors include, but are not limited to, vector pSE420 (comimercialy available from Invitrogen Corporation, San Diego, California) . This vector harbors the trc promoter, the lacO operon, an anti-terminator sequence, the glO ribosome binding sequence, a translation terminator sequence, the laclq repressor, the ColEl origin of replication, and the ampicillin resistance gene.
  • Recombinant porcine B7-1 proteins may also be expressed in suitable fungal hosts, such as yeast of the Saccharomyces genus such as S. cerevisiae. Fungi of other genera such as Asner ⁇ illus , Pichia or Kluyveromyces may also be employed.
  • Fungal vectors will generally contain an origin cf replication from the 2 ⁇ m yeast piasmid or another autonomously replicating sequence (ARS) , a promoter, DNA encoding a porcine B7-1 molecule, sequences directing pclyadenylation and transcription termination, and a selectable marker gene.
  • fungal vectors will include an origin of replication and selectable markers permitting transformation and selection in both ⁇ . coli and fungi.
  • Suitable promoter systems in fungi include the promoters for metallothionein, 3-phosphoglycerate kinase, or other glycolytic enzymes such as enolase, hexokinase, pyruvate kinase, glucokinase, the giucose-repressible alcohol dehydrogenase promoter (ADH2), the constitutive promoter from the alcohol dehydrogenase gene, ADHl, and others (see, for example, Schena, et al . Meth Enzymol 194, pp.
  • Secretion signals such as those directing the secretion of yeast ⁇ -factor or yeast invertase, can be incorporated into the fungal vector to promote secretion of soluble porcine B7-1 proteins into the fungal growth medium. (See Moir, et al . , Meth Enzymol 194, pp.491; 1991.)
  • Preferred fungal expression vectors can be assembled using DNA sequences from pBR322 for selection and replication in bacteria, and fungal DNA sequences, including the ADHl promoter and the alcohol dehydrogenase ADHl termination sequence, as found in vector pAAH5 (Ammerer, 1983) .
  • the ADHl promoter is effective in yeast in that ADHl mRNA is estimated to be 1 - 2% of total poly (A) RNA.
  • Mammalian or insect cell culture systems can be employed to express recombinant porcine B7-1 proteins.
  • Suitable baculovirus systems for production of heterolcgous proteins in insect cells are reviewed by Luckow, et al . , 3io/Technology 6, pp. 47. 1988
  • Mammalian expression vectors may have non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the porcine B7-1 protein gene to be expressed, and other 5' or 3 ' flanking sequences such as a ribosome binding site, a polyadenylation sequence, splice donor and acceptor sites, and transcriptional termination sequences.
  • the transcriptional and translational control sequences in mammalian expression vector systems to be used in transforming vertebrate cells may be provided by viral sources.
  • viral sources for example, commonly used promoters and enhancers are derived from polyoma virus, adenovirus, Simian virus 40 (SV40) , and human cytomegalovirus . (CMV) , including the cytomegalcvirus immediate- early gene 1 promoter and enhancer.
  • Suitable eukaryotic vectors for the expression of porcine B7-1 proteins include but are not limited to pAPEX-3(see Evans et al . Gene 84, pp. 135; 1989), and pcDNAI/Amp (commercially available from Invitrogen Corporation, San Diego, California) .
  • a particularly preferred host cell for the expression of inserts in the pAPEX-3 vector is the human 293 EBNA cell line (commercially available from Invitrogen, San Diego, CA) .
  • the pcDNAI/Amp expression vector contains the human CMV immediate-early gene I promoter and enhancer elements, the SV40 consensus intron donor and acceptor splice sequences, and the SV40 consensus polyadenylation signal.
  • This vector also contains an SV40 origin of replication that permits episomal amplification in cells (e.g., COS cells, MOP8 cells, etc.) transformed with the SV40 large T antigen, and an ampicillin resistance gene for propagation and selection in bacterial hosts.
  • cells e.g., COS cells, MOP8 cells, etc.
  • an ampicillin resistance gene for propagation and selection in bacterial hosts.
  • EF-1 alpha promoters or inducible promoter systems (using e.g., the tetracycline-dependent derepression mechanism or an ecdvsone-inducible expression system) are also suitable for use herein .
  • inducible promoter systems using e.g., the tetracycline-dependent derepression mechanism or an ecdvsone-inducible expression system
  • purified porcine B7-1 proteins are prepared by culturing suitable host/vector systems to express the recombinant translation products of the nucleic acid molecules of the present invention, which are then purified from the culture media or cell extracts of the host system (e.g., the bacterial, insect, fungal, or mammalian cells) .
  • the host system e.g., the bacterial, insect, fungal, or mammalian cells
  • Fermentation of fungi cr mammalian cells that express soluble porcine B7-1 proteins containing a histidine tag sequence comprising a string of at least 5 histidine residues in a row
  • Such histidine tagged sequence enables binding, under specific conditions, to metals such as nickel, thus permitting efficient purification by passage over nickel Columbus.
  • the purification of recombinant porcine B7-1 proteins is performed using a suitable set of concentration, fractionation, and chromatcgraphy steps well known in the art (see, for example, Deutscher, Guide to Protein Purifications, Vol. 182; Academic Press, Inc., San Diego Calif. 1990; and Harris and Angal, Protein Purification Methods: A Practical Approach. IRL Press Oxford University Press. Oxford, 1989). Denaturation of the purified protein, followed by refolding under reducing conditions, is then performed to enable proper disulfide bond formation.
  • Porcine 37-1 proteins purified from bodily fluids of transgenic animals engineered to produce such proteins, as well as porcine B7-1 proteins that are produced in part cr entirely by in vitro methods are provided.
  • porcine B7-1 proteins include, but are net limited to, 1) reagents for blocking T cell activation; 2) immunogens for the purpose of raising antibodies to porcine 57-1 proteins; and, 3) antigens for use in immunoassays to detect soluble porcine B7-1 proteins as markers of inflammation in primate recipients of porcine xenografts, discussed hereinbelow.
  • antibodies reactive with porcine 37-1 proteins, but not human B7-1 proteins are provided.
  • Suitable antibodies include, but are not limited to, polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies.
  • Such antibodies can be prepared by applying methods known in the art. See for example; Reichmann, et al . , Nature 332, pp. 323, 1988. Winter and Milstein, 1991; Clackson, et al., Nature 352, pp.624. 1991; Morrison, Annu Rev Immunol 10, pp. 239; 1992; Haber, Immunol Rev 130, pp. 189; 1992; and Rodrigues, et al . , J Immune1 151, pp. 6954; 1993.
  • Polyclonal anti B7-1 antibodies are provided. Methods cf preparing such antibodies are known to one skilled in the art and the immunization protocol may be selected without undue experimentation. Suitable methods for raising polyclonal anti 37-1 antibodies in a mammal include injecting the mammal with an immunizing agent and optionally in the presence in the presence orabsence of an adjuvant. The regimen includes multiple subcutaneous or interperitoneal injections with the immunizing agent, such as the B7-1 protein or fragments thereof. It may be useful to conjugate the immunizing agent to a carrier known to be immunogenic in the mammal being immunized.
  • Monoclonal anti 37-1 antibodies are provided. Monoclonal antibodies may be prepared by using methods to generate hvbridcmas such as those described in Kohler et al, Nature , 256:495 (1975; . Briefly, a mouse, hamster, cr other suitable host is immunized with an immunizing agent to elicit lymphocytes that produce cr are capable of producing antibodies that will bind to the lmmunizmq agent. The lymphocytes may also be activated to produce antibodies immunized in vitro. The lymphocytes are then fused to myeloma cells in vitro to immortalize the antibody-producing cells .
  • Suitable hybridomas for producing such antibodies can be obtained using purified porcine B7-1 proteins as the immunizing agent followed by screening to identify hybridomas producing antibodies with the desired properties. Such screening can be carried out using suitable immunoassays such the ELISA described below and in copending U.S. patent application serial no.: 08/252,493, filed June 1, 1994, which is incorporated herein by- reference. A simple modification of this ELISA (i.e., substituting soluble human 37-1 proteins for soluble porcine 37-1 proteins) can be used to identify those of the hybridomas producing antibodies that bind to porcine B7-1 proteins but do net bind to human B7-1 proteins.
  • Humanized anti B7-1 antibodies are provided.
  • Humanized forms cf non-human (e.g., munne) antibodies are chimeric immunoglobulms, immunoglobulin chains or fragments thereof (such as Fv, scFv, Fab, Fab',F(ab'); cr other antigen- binding subsequences cf antibodies) which contain minimal secuence derived from non-human immunoglobulin.
  • Humanized antibodies include human immunoglobulms (recipient antibody) in which residues from complementary determining regions (CDRs) of the recipient are replaced by residues from CDRs cf a non-human species (donor antibody) such as mouse, rat cr rabbit having the desired specificity, affinity and binding capacity.
  • CDRs complementary determining regions
  • donor antibody such as mouse, rat cr rabbit having the desired specificity, affinity and binding capacity.
  • specific Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues.
  • Humanized antibodies may also comprise residue
  • a humanized antibody contains one or more amino acid residues that are introduced from a non-human antibody source. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import” variable domain. Humanization can be essentially performed following the method of Winter and co-workers (Jones et al . , Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-32 '7 (1988); Verhoeyen et al .
  • Humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
  • Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol . Biol . , 227:381 (1991); Marks et al. J. Mol. Biol., 222:581 (1991)].
  • the techiniques of Cole et al . and Boerner et al . are also available for the preparation of human monoclonal antibodies [(Cole et al . , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss p. 77(1985) and Boerner et al . , J. Immunol. 147 (1) : 86-95 (1991) 1.
  • human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, (e.g., mice) in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge with antigens, only human antibodies are produced in a manner similar to that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. See for example, in U.S. Patent Nos . 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications; Marks et al . , Bio/Technology 10, 779-783 (1992); Lonberg et al .
  • Polyspecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at leas: two different antigens. One cf the binding specificities may be for the B7-1 protein, while the other may be for any other antigen, cell-surface protein, receptor or receptor subunit.
  • bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains and/or the two light chains have different specificities [See Milstein and Cuello, Nature, 305:537-539 (1983)]. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in Traunecker et al . , EMBO J. 10:3655-3659 (1991).
  • Heteroconjugate antibodies are provided. Heteroconjugate antibodies are composed of two covalently joined antibodies. Sue: antibodies have, for example, been proposed to link immune system cells to unwanted target cells to enable their rapid elimination [U.S. Patent No. 4, 676,980], and to treat HIV infection [WO 91/00360; WO 92/200373; EP 03089] . It is contemplated that the antibodies may be prepared in vi tro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructec using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980.
  • Antibody glycosylation Porcine B7-1 proteins and anti-porcme 37-1 antibodies with or without associated native patterns of glycosylation are also provided. For example, expressing proteins recombinantly in bacteria such as E. coli provides non-glycosylated molecules, while expressing porcine 37-1 proteins or anti porcine B7-1 protein antibodies in mammalian cells can provide glycosylated molecules .
  • Anti-porcine 37-1 antibodies or soluble B7-1 proteins can be used for the prevention or treatment of xenotrasplant rejection in patients suffering from that have received porcine cells or tissues.
  • a combination of anti-porcine B7-1 and anti-porcine B7-2 antibodies can be used to inhibit host T cell activation.
  • the therapeutic porcine B7-1 agents can be administered in a variety of unit dosage forms.
  • the dose will vary according to the particular agent.
  • antibodies prepared as Fab' cr F(ab')2 fragments are of considerably smaller mass than the equivalent intact immunoglobulins, and thus require lower dosages to reach the same molar levels in the patient's blood.
  • Antibodies with different affirmatives will also differ in their regarded dosages.
  • the dose will also vary depending on the manner cf administration, the particular symptoms of the patient being treated, the overall health, condition, size, and age of the patient, and the judgment of the prescribing physician.
  • Dosage levels of the therapeutic porcine 37-1 agents for human subjects range between about 1 mg per kg and about 100 mg per kg per patient per treatment.
  • the therapeutic porcine 37-1 agent concentrations are preferably in the range from about 25 ⁇ g/ml to about 500 ⁇ g/ml.
  • a typical therapeutic treatment includes a series of doses, which are usually administered concurrent with the monitoring of clinical endpoints. These may include xenctransplant biopsies cr measures of organ function (e.g. for xenotransplanted kidneys, BUN creatines and, proteinuria levels, etc.), with treatment dosage levels adjusted as needed to achieve the desired clinical outcome.
  • Therapeutic porcine B7-1 agents can be administered by- methods well known in the art, such as by bolus injection, intravenous delivery, continuous infusion, sustained release from implants, etc.
  • the therapeutic porcine 37-1 agents may also be entrapped microcapsules (such as hydroxymethylcellulose cr gelatin-micrccapsules) ; liposomes; and other sustained-release matrices such as polyesters, hydrogels (for example, polyhydroxyethylmethacrylate or polyvinylalcohol) or mjectable microspheres cf biodegradeable materials, such as polymers and copolymers cf glycolide, lactide, and/or ethylene glycol.
  • microcapsules such as hydroxymethylcellulose cr gelatin-micrccapsules
  • liposomes such as hydroxymethylcellulose cr gelatin-micrccapsules
  • other sustained-release matrices such as polyesters, hydrogels (for example, polyhydroxyethylmethacrylate or polyvinylalcohol) or mjectable microspheres cf biodegradeable materials, such as polymers and copolymers cf glycolide, lactide, and/or
  • the therapeutic porcine B7-1 agents can be used in compositions to treat episodes of xenograft rejection, either alone cr in combination with known immunosuppressive agents such as cyclosporin A, FK506, rapamycin, corticosteroids, etc.
  • Formulations suitable for injection are found in Remington ' s Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, PA, 17th ed. (1985) .
  • Such formulations must be sterile and non- pyrogenic, and generally will include purified therapeutic porcine B7-1 agents in conjunction with a pharmaceutically effective carrier, such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like.
  • a pharmaceutically effective carrier such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like.
  • the formulations may contain pharmaceutically acceptable auxiliary substances as required, such as, tonicity adjusting agents, wetting agents, bactericidal agents, preservatives, stabilizers, and the like.
  • the therapeutic porcine B7-1 agent is formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose, albumin) as diluents.
  • excipient solutions e.g., sucrose, albumin
  • the amount and frequency of administration will depend, of course, on such factors as the nature and severity of the rejection episode being treated, the desired response, the condition of the patient, and so forth.
  • the formulations can be distributed in sterile form as articles of manufacture comprising packaging material and the therapeutic porcine B7-1 agents.
  • the packaging material will include a label which indicates that the formulation s for use in the prevention or treatment of porcine xenctransplant rejection.
  • Certain of the isolated nucleic acid molecules of the invention are also useful as to direct and/cr modulate the expression cf porcine E7-1 molecules in porcine cells, e.g., by altering the expression cf porcine B ⁇ -1 genes. Such modulation may be accomplished by the use of techniques well known in the art .
  • a suitable method by which the expression of porcine B ⁇ -l proteins on transgenic pig cells can be inhibited (to thereby reduce a potential human immune response against transplanted transgenic cells or tissues) is by genetic manipulations referred to in the art as "gene disruption” or “gene knockout.”
  • Gene knockout uses specially designed DNA molecules (gene knockout constructions) to achieve targeted inactivaticn (knockout) cf a particular gene, via homologous recombination,- upon introduction of the construct into a cell. See for example; Thomas, et al.,Cell 44(3), pp. 419; 1986; Thomas, et al.,Cell 51(3), pp. 503;1987; Jasin and Berg, Genes & Development 2, pp.
  • Gene knockouts and gene replacements can be achieved in mammalian zygotes through techniques well known in the art, including, but not limited to, microinjection, of nuclei or pronuclei, electroporation of ova or zygotes, nuclear transplantation, and/or the stable transfection or transducticn of embryonic stem cells (see for example Brinster, et al . , Proc Natl Acad Sci 86. pp. 7087; 1989, U.S. Patent No. 5,032,407 to Wagner et al., PCT Publication WO90/08832, and preferably, PCT Publication WO 99/07829.)
  • swine lacking B7-1 mclecules can be created by the genetic manipulation of embryonic stem cells (ES cells) as described in PCT Patent Publication No. WO 93/02188 and Robertson, 198 " , Teratocarcinomas and Embryonic Stem Cells a Practical Approach. IRL Press Eynsham, Oxford, England.
  • ES cells are grown in vitro as described in, for example, Robertson, in Robertson, ed. "Teratocarcinomas and Embryonic Stem Cells a Practical Approach” IRL Press, Eynsham, Oxford, England 1987, and in U.S. Patent No. 5,166,065.
  • Genetic material having a defective or altere ⁇ gene encoding porcine B7-1 is introduced into the embryonic stem cells by elec t roporation according, for example, to the method cf McMahon, et al . , Cell 62, pp. 1073; 1990. cr by transducticn with a retroviral vector according, for example, to the method cf Robertson, et al . , Nature 323, pp. 445; 1986 cr by any cf the various t echniques described by Lovell-Badge , Teratocarcinomas anc Embryonic Stem Cells a Practical Approach. IRL Press Eynsham, Oxford, England 1987.
  • the selected cells then may be injected mt a blastocysts of an animal (e.g. a pig) to form aggregation chimeras (see for example, Teratocarcinomas and Embrionic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, pp 113 ; 1987) . a suitable pseu opregnant female foster animal and the embryo brought to term to create the "knockout" progency.
  • an animal e.g. a pig
  • aggregation chimeras see for example, Teratocarcinomas and Embrionic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, pp 113 ; 1987.
  • mutant porcine B7-1 nucleotide sequences including nucleotide deletions, insertions, subs t itutions, and additions to the exon and/or intron regions cf the porcine B7-1 such that the resultant mutant does not encode a functional B7-1 protein.
  • These nucleotide sequences may be utilized in homologous recombination techniques. In such techniques, mutant sequences are used in homologous recombination techniques. In such techniques, mutant sequences are recombined with wild type genomic sequences in stem cells, ova, or newly fertilized cells of about 1 to about 500 cells. Nucleotide sequences used in this homologous recombination may be in the form of isolated nucleic acid sequences or in the context cf vectors. Upon recombination, destruction of the functional gene takes place.
  • Diagnostic use of the anti-porcine B7-1 antibodies include but are not limited to assaying the patient's blood for levels of one cr more porcine B7-1 proteins. Measurement cf porcine B7-1 protein levels may be accomplished by RIA, ELISA, or other suitable immunoassay using the anti-porcine E7-1 antibodies as detection reagents. General methods for performing such assays are set forth in Coligan, et al., Current Protocols in Immunol, John Wiley & Sons, New York 1992. Blood porcine B7-1 protein levels xeno intanspla t recipients must be monitored at regular intervals, e.g., daily cr weekly, and changes in such levels recorded.
  • a significant increase in the levels of porcine B7-1 protein levels in the patient's bleed is an indication that the porcine tissue is becoming inflammed, and may indicate the onset of a rejection episode.
  • An alternative test for rejection (cr a test confirming tha: rejection is occurring, as indicated by measurement cf soluble B7- 1 protein levels) may be obtained by monitoring porcine cell, tissue, or organ function or by biopsy and histopathological examination of the porcine cell, tissue or organ. Such examination will be carried out in order to detect the typical manifestations of transplant rejection such as, cellular infiltration, inflammation, and necrosis.
  • An immunohistopathological examination of the biopsied materials will also be performed, using certain of the anti-porcine B7-1 antibodies to detect the levels of expression cf one or mere porcine B7-1 proteins on the surface cf the xenotransplanted cells. High levels of such expression (compared to levels on non- transplanted control tissue samples) are indicative of xenotransplant rejection.
  • RNA was prepared from freshly isolated porcine peripheral blood leukocytes (PBL) using the acid/guanidinium thiocyanate technique as described in Chomczynski and Sacchi, 1987. Ten micrograms of total RNA were heated at 65°C for 3 minutes, quenched on ice, and subjected to first strand cDNA synthesis for (1 hour at 37°C) in the following 100 ⁇ l reaction mixture: 10 mM Tris-HCl (pH 8.3), 50 mM KCL 1.5 mM MgCl 2; 10 mM dithiothreotol, 0.20 mM of each dNTP, 0.5 ⁇ g oligo dT 16 and 20 Units of avian mveloblastosis virus reverse transcriptase, commercially available from Seikagaku Inc., Rockville, MD.
  • PBL porcine peripheral blood leukocytes
  • oligonucleotide primers were generated from regions of high homology between human and mouse B7-1 sequence: 1) 5' TGGCCCGAGTATAAGAACCGGAC3' and 2) 5' TCAGTTTCAGGATCTTGGGAAA 3'.
  • PCR amplification was performed for 30 cycles (94°C for 1 min, 50°C for 1 min, 72°C for 1 min) followed by 1 cycle at 72°C for 10 min.
  • the resulting 338 bp fragment was cloned into the pCR2.1 vector using the T/A cloning system (commercially available from Invitrogen, San Diego, CA) and identified by DNA sequence analysis as a porcine B7-1 homologue.
  • Two gene-specific oligonucleotides were derived from the porcine B7-1 sequence and a 250 bp fragment was generated by PCR. This DNA fragment was used to screen a ⁇ gtlO porcine macrophage library (provided by Dr. Michael Murtaugh, Department of Veterinary PathoBiology, University of Minnesota).
  • Membranes were hybridized at 60°C overnight and subsequently washed using the following conditions: two-30 min washes with 2x SSC/0.1% SDS at room temperature, one-30 min wash with 0.5x SSC/0.1% SDS at 50°C and one-30 min wash with 0.2x SSC/0.1% SDS at 60°C. Positive plaques present on duplicate filters were purified and the B7-1 DNA was recovered by PCR using primers that flanked the insertion site of the ⁇ gtlO vector. After cloning the PCR fragment into pCR2.1-TOPO. both strands of the putative full-length clone were sequenced using the chain termination method. Clones derived from different PCR reactions were also sequenced to rule out potential errors introduced during amplification. The DNA templates were primed with vector sequence primers flanking the multiple cloning site, or primers constructed from internal cDNA sequence.
  • Clones containing the B7-1 related sequence were identified at a frequency of approximately one clone per 1 x 10 5 phage.
  • DNA sequence analysis performed as described above revealed a full-length cDNA that lacked both the transmembrane and cytoplasmic domains normally found in B7-1. Therefore the clones represented a soluble form of B7-1 (sB7-l) and containing 1620 bp comprised of a 718 bp 5' untranslated region (UTR), a 215 bp 3'UTR and an open reading frame that encoded 229 amino acids.
  • sB7-l soluble form of B7-1
  • 1620 bp comprised of a 718 bp 5' untranslated region (UTR), a 215 bp 3'UTR and an open reading frame that encoded 229 amino acids.
  • the transmembrane form of porcine B7-1 (tmB7-l) was isolated by RT-PCR of freshly isolated porcine lung RNA using an oligonucleotide from the 3' end of the sB7-l coding region as the 5' primer (GCTACCAACACGATGCTTTCC) and oligo dT ]6 as the 3 ' primer.
  • RNA isolation and RT-PCR were otherwise identical to those described in Example I.
  • the two major products resulting from the RT-PCR were cloned into pCR2.1-TOPO and inserts were sequenced for identification.
  • tmB7-l One of the clones obtained through PCR (tmB7-l) contained the complete transmembrane domain coding region and most of the cytoplasmic domain coding region (based on comparison with B7- 1 from other species), but the translational stop site and 3' UTR were not present.
  • the truncation of tmB7-l, and the lack of detection of tmB7-l in the oligo dT primed porcine macrophage library suggested strong 3' UTR secondary structure in these transcripts.
  • porcine B7-1 and human B7-1 shared 65% sequence identity and an overall conservation of the Ig V-like and Ig C-like structural domains characteristic of other B7 molecules (Judge et al., 1995).
  • the signal peptide for sB7-l was 29 amino acids in length as determined by amino terminal sequencing of purified protein. Amino acids that have been shown to be critical for the binding of B7- 1 to both CD28 and CTLA-4 (Guo et al., 1995) were highly conserved. A clone containing the complete coding region for tmB7-l was not found, but based on sequence comparison with various other species, the terminal amino acid is expexted to be very close to the translational stop site.
  • sB7-l-His expression of sB7-l protein tagged with a carboxy-terminal histidine hexapeptide (sB7-l-His) was generated in the mammalian expression vector Apex3P (Evans et al., 1995) by PCR amplification of B7-1 cDNA in pCR2.1-TOPO.
  • the 5' primer (CCGGGGATCCCTTCTGTTTTCATCCTCATCAAGC) was derived from the 5'UTR of B7-1 and ' contained a BamHI site for subcloning.
  • the 3' primer (GGCCTGCAGGTCATCAATGGTGATGGTGATGGTGGCATTTTTGCCAGTTGAA GGTCTGTGAC) inserted the histidine tag just upstream of the stop codon and an Sse83371 subcloning site.
  • 293-EBNA embryonic kidney cells (commercially available from Invitrogen, Carlsbad, CA) were transfected with sB7-l-His in Apex3P according to methods described by Evans et al., 1995.
  • Cells were grown in D10 medium (DMEM containing 5% FCS, 2 mM glutamine, 100 IU/ml penicillin and 100 ⁇ /ml streptomycin) supplemented with puromycin at a final concentration of 1 ⁇ g/ml.
  • D10 medium DMEM containing 5% FCS, 2 mM glutamine, 100 IU/ml penicillin and 100 ⁇ /ml streptomycin
  • puromycin at a final concentration of 1 ⁇ g/ml.
  • Cells that expressed sB7-l-His were cloned by limiting dilution, and those producing high levels of protein were chosen by standard Western immuno-blot analysis of cell supernatants using rabbit anti-histidine polyclonal IgG (coomercially available from Santa Cruz Biotechnology, Inc., Santa Cruz, CA).
  • the sB7-l-His protein was purified by affinity chromatography using a nickel charged nitrilotriacetic acid (NT A) resin commercially available from Qiagen, Chatsworth, CA as previously described (see Mueller et al., 1995).
  • NT A nickel charged nitrilotriacetic acid
  • mAbs Monoclonal antibodies
  • polyclonal antisera directed against porcine B7-1 were generated by repeated immunization of mice and rabbits, respectively, with sB7-l-His according to methods routinely performed at Cocalico, Inc., Reamstown, Pennsylvania.
  • MAbs were produced by immune eymphoetes and immortal myeloma cells according to methods discribed by Kohler et al.. Nature 1975. Select clones were injected into mice in order to produce ascites using protocols already established and commercially available at Cocalico.
  • MAb supernatants were collected from hybridomas that had been cloned from the original fusion.
  • Anti-B7-1 specific IgG was purified from selected hybridoma super natants by passage over a Protein A-Sepharose column (commercially available from Pharmacia, Piscataway, NJ). This purified IgG was utilized to assess the effect of anti-porcine B7-1 mAbs on human xenogeneic MLRs. Total IgG preimmune rabbit serum, or from serum from B 7-1 -immunized rabbits was also purified by passage over a protein A-sepharose column. This polyclonal IgG was utilized to assess the cell surface expression of B 7-1 on porcine PBL.
  • Freshly isolated or activated cell populations were pre-incubated in PBS containing 5% goat serum. Cells were then incubated with anti-porcine-B7-l or preimmune rabbit IgG, in combination with murine antibodies directed against porcine CD3, IgM, class II and B7-2 cell surface antigens, in PBS containing 2% goat serum. Cells were washed in the same and then reacted with fluorescein isothyocyanate (FITC)-labeled goat anti-mouse Ig and with phycoerythrin (PE)-labeled goat anti-rabbit Ig.
  • FITC fluorescein isothyocyanate
  • PE phycoerythrin
  • Cell-surface B7-1 was detected on subpopulations of activated lymphocytes, defined by the expression of CD3 (T cells), IgM (B cells) and Class II and B7-2 (antigen presenting cells), by two-color immunofluorescence and flow cytometry as described in Materials and Methods.
  • Example VII sB7-l binds human CD28 and CTLA4
  • porcine adhesion and costimulatory molecules have been shown to be conserved across species, including humans. These include the ligands for porcine E-selectin, porcine VCAM-1 and porcine B7-2 (Matis et al, 1995; Maher et al., 1996). The fact that all amino acids shown to be critical for the binding of B7-1 to both CD28 and CTLA-4 are conserved in porcine B7-1 ( Figure 1, panel A), suggests that this molecule will interact with its human counterpart ligands.
  • sB7-l-His was incubated with human Jurkat T cells (available from the American Type Culture Collection, Rockville Maryland, hereinafter "ATCC"; clone TIB 152) and the interaction was assayed by indirect immunoflourescence and flow cytometry as described in Example VI, using a polyclonal anti-porcine B7-1 IgG followed by an FITC conjugated goat anti rabbit IgG.
  • Jurkat cells have been shown to express CD28 but not the alternative B7-1 ligand, CTLA-4 (Freeman et al., 1992).
  • Example VIII sB7-l Inhibits Human T Cell IL-2 Production in Response to Costimulation by Porcine or Human Cells
  • Efficient T cell activation requires both a primary signal through the T cell receptor and a secondary signal mediated through binding of B7-1 and B7-2 costimulatory molecules on APCs, with CD28 on the surface of T cells.
  • Jurkat cells do not constitutively elaborate IL-2, even in the presence of PHA, which can provide an obligate primary signal through the TCR.
  • PHA signaling in the presence of a source of APCs that provide a second signal, or in the presence of stimulatory anti-CD28 antibodies results in significant IL-2 production (Williams et al., 1992).
  • porcine aortic endothelial cells PAEC porcine aortic endothelial cells PAEC
  • Jurkat T cells (1 x 10 6 cells/well) were then added to the wells in the presence or absence of 10 ⁇ g/ml phytohemagglutinin (PHA; commercially available from Sigma) and increaseing concentrations of sB7-l, or humans CTLA-4Ig or porcine P-selectin-His.
  • PHA phytohemagglutinin
  • Raji cells (1 x 10 6 cells/well) were substituted for PAEC, but were added to the Jurkat cells at the initiation of the experiment.
  • the cultures were maintained at 37°C in 5% CO 2 for 24 h, at which time the culture supernatants were harvested for IL-2 detection.
  • Assays to detect and quantitate human IL-2 were performed using an ELISA kit (Quantikine Human IL-2 Immunoassay; commercially available from R&D Systems), according to the manufacturer's protocol. Briefly, serial dilutions of a recombinant human IL-2 standard (commercially available from R&D Systems) or culture supernatants were added, in duplicate, to ELISA wells that had been previously coated with a "capture" monoclonal antibody specific for human IL-2, and incubated overnight at 4°C.
  • Bound IL-2 was revealed by incubation with a second IL-2-specific antibody conjugated with horseradish peroxidase (HRP), followed by extensive washing and addition of substrate (hydrogen peroxide and chromogen) to produce a colored product. The reaction was stopped by the addition of 2 N sulfuric acid. The optical density of each well was determined using a microtiter plate reader (commercially available from BioRad. Model 3550. Hercules, CA) set to 450 nm. with values corrected by subtraction of readings taken at 595 nm. IL-2 concentrations were calculated using Microplate Manager software (commercially available from BioRad).
  • sB7-l can bind to human T cells and block their activation by costimulatory signals delivered by either allogeneic human cells (Raji) or xenogeneic porcine cells (PAEC). Since Jurkat cells do not express CTLA-4, it can be concluded that sB7-l inhibits activation by binding to CD28 and blocking signaling through that molecule.
  • MLRs were performed in the presence of increasing amounts of sB7-l, an irrelevant histidine tagged protein or CTLA-4Ig.
  • Cells were maintained for 4-5 days at 37°C in 5% C0 2 in air.
  • [ ⁇ jthymidine (1.0 ⁇ Ci/well; commercially available from NEN Dupont, Boston. MA) was added to the cell cultures during the last 16-18 h of the incubation.
  • the cells were harvested onto glass fiber filters with an automated sample harvester (Wallac; Turku, Finland) and the filters counted in a beta liquid scintillation counter. Results were expressed as mean counts per minute (cpm) of triplicate cultures.
  • Hybridoma supernatants (generated at Cocalico Inc., Reamstown, PA) were diluted 1 :2 with 4 ⁇ g/ml human CTLA-4-Ig-biotin (commercially available from Ancell, Bayport, MN), at 4 ⁇ g/ml and added to the wells for 1 h at 37°C. Plates were washed 3x before the addition of streptavidin-horseradish peroxidase (commercially available from Pharmingen, San Diego, CA) at a 1 :1000 dilution. Finally, plates were washed 3x, developed with O-phenylenediamine dihydrochloride (commercially available from Sigma, St.
  • a blocking assay was performed. Human Jurkat cells that are known to express CD28 but not CTLA-4 were incubated with sB7-l in the presence of hybridoma supernatants. First. sB7-l (2.5 ⁇ g/ml) was preincubated in HBSS containing either human CTLA-4Ig (20 ⁇ g/ml) or various anti-B7-l hybridoma supernatants (neat) or buffer alone before addition to Jurkat cells (2.5 x 10 D cells/reaction) for an additional incubation.
  • Short-term primary human xenogeneic MLRs (as described in Example IX) were performed to assess the ability of anti-porcine-B7-l and B7-2 mAbs to block human T cell activation to response to by porcine stimulator cells.
  • Human PBL were incubated with mitomycin-C treated porcine PBL and human T cell activation was determined.
  • MLRs were performed in the presence of increasing amounts of anti-B7-l, anti-B7-2 or a combination of the two antibodies and responder cell proliferation was assessed on day 4- 5 of culture. The effect of an isotype matched murine mAb or CTLA-4-Ig on T cell activation was also measured.
  • CD28-mediated signaling co-stimultes murine T cells and prevents induction of anergy in T cell clones. Nature 356:607.
  • CTLA-4 ligation blocks CD28-dependent T cell activation. J. Exp. Med. 183:2541.
  • VCAM Porcine vascular cell adhesion molecule
  • Porcine aortic endothelial cells activate human T cells: direct presentation of MHC antigens and costimulation by ligands for human CD2 and CD28. Immunity 1 :57.
  • CTLA-4 and CD28 mRNA are coexpressed in most T cells after activation: expression of CTLA-4 and CD28 mRNA does not correlate with the pattern of lymphokine production. J. Immunol. 149:3795.
  • CTLA-4 is a second receptor for the B cell activation antigen B7. J. Exp. Med. 174:561.
  • nucleotide sequences cf the porcine B7-1 protein-encoding nucleic acid molecules may be modified by creating nucleic acid mutations which include third nucleotide changes in degenerate codcns (and other "silent" mutations that do not change the encoded ami ⁇ c acid sequence) .
  • nucleotide and amino acid sequences encoding naturally occurring allelic variants of the porcine B7-1 protein genes; sequences which have been truncated so as to only encode the mature porcine B7-1 protein pcIypeptides, (i.e., a porcine B7-1 polypeptide without the amino terminal leader sequence that directs the protein to its typical transmembrane orientation in the cell); sequences in which the B7-1 protein amino terminal leader sequences have been altered (e.g., substituted with a different leader sequence); sequences in which a peptide "tag" sequence has been inserted or added on to enable the ready identification and/or purification of recombinant proteins (such as the FLAG epitope (which enables specific binding to anti-FLAG antibodies) or a histidine tag sequence) ; and sequences that have been altered to produce a soluble porcine B7-1 protein by, for example, truncation.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)
  • Peptides Or Proteins (AREA)

Abstract

Soluble and transmembrane porcine B7-1 proteins, their amino acid sequences, nucleic acid sequences coding therefor, as well as antibodies reactive with the B7-1 proteins are disclosed. Methods of making the soluable and transmembrane porcine B7-1 DNA, cDNA, proteins, and antibodies, as well as, methods of using the B7-1 molecules and antibodies thereto, including use in the prevention and/or treatment of rejection of xenotransplants and treatment of inflammatory diseases, are described.

Description

Porcine B7-1 and Antibodies Thereto
Technical Field
Soluble and transmembrane porcine B7-1 proteins, their amino acid sequences, DNA and cDNA, as well as antibodies reactive with the B7-1 proteins are αisclosed. Methods of making the soluble and transmembrane porcine B7-1 DNA, cDNA, proteins, and antibodies and methods of using tne B7-1 molecules and antibodies thereto, including use m the prevention and/or treatment of rejection of xenotransplants and the treatment of inflammatory diseases, are described.
Background
It is known n the art that the generation of an immune response against a pathogen (bacterial, viral or parasitic) or transplanted cell, tissue or organ depends on the delivery of the appropriate stimulus to the immune system of the host. T cells, also called T lymphocytes, are a part of the vertebrate immune system. T cells recognize foreign pathogens (such as bacteria, viruses, or parasites) , foreign cells tissues, and or organs, become activated and thereby initiate an immune response that results in elimination of the foreign agent from the body. T cell activation is not only dependent on antigen recognition, but also on engagement of costimulatory molecules found on antigen presenting cells (APCs) . One costimulatory signal that determines whether antigen recognition leads to T cell activation is that generated by the interaction of CD28 on the T cells with the B7 molecules on the APCs. It is known that both B7-1 (CD80) and B7-2 (CD86) molecules on APCs provide critical costimulatory signals in T cell activation through their binding with the CD28 molecule on the T cell, and, moreover, that antigens presented in the absence of such costimulatory signals results in T cell anergy.
The genomic organization of botn human and mouse B7-1 molecules are known m the art. The B7-1 molecule is a 60 KD trans-membrane glycoprotem usually present on the surface of APCs, and having two ligands, CD28 (discussed aβove) and CTLA-4. Interaction of B7 molecules with CTLA-4 is known to down-regulate T cell activation.
Host immune responses often cause rejection of both allogeneic and xenogeneic transplanted cells, tissues, and organs . Clearly, reduction or inhibition of such immune responses m the transplant recipient is critical to the success of transplantation. The B7 antigen s involved in T cell activation during transplant rejection. Therefore, the ability to block the B7-1 / CD28 pathway to reduce or prevent T cell activation and to possibly help to create a state of unresponsiveness, or anergy, of donor-reactive T cells, would be advantageous .
PCT application number WO 92/00092 to Linsley et al . describes the B7 antigen as a ligand for the CD28 receptor on T cells. The application states that "the B7 antigen, or its fragments or derivatives are reacted with CD28 positive T cells to regulate T cell interactions with other cells . . . B7 antigen or CD28 receptor may be used to inhibit interaction of cells associated with these molecules, thereby regulating T cell responses."
U.S. Patent No. 5,869,050 to de Boer et al . describes the use of antι-B7 and antι-CD40 antibodies to treat allograft transplant rejection, graft versus host disease and rheumatoid arthritis, stating that " . . . antι-B7 and antι-CD40 antibodies . . . can be used to prevent or treat an antibody-mediated or immune system disease in a patient."
It is further known that swine are considered the most likely candidates for xenotransplantation of tissues or organs into human recipients, and moreover, that ofMatis et al., The molecular basis of human anti-porcine cellular interactions. Xeno 3:1; 1995 state that the rejection of donor organs mediated by porcine adhesion and/or costimulatory molecules is likely to represent at least one major barrier for such transplants. Therefore, it would be advantageous to have soluble porcine B7-1 proteins, as well as antibodies reactive with the B7-1 proteins to help modulate T cell responses to xenotransplants (either alone or m combination with other agents) to treat xenotransplant recipients. In addition, the use of porcine B7-1 DNA sequences to facilitate the generation of porcine organs void of B7-1 would also be useful.
Summary
Porcine B7-1 DNA, in the form of, for example, cDNA including transmembrane porcine coding sequences, nucleic acid molecules coding for a soluble form of the porcine B7-1 protein, as well as, both transmembrane and soluble porcine B7-1 proteins lac ing a transmembrane and cytoplasm c domain, have surprisingly been created.
In one embcαiment, an isolated nucleic ac d molecule including a DNA encoding for a polypepticie having at least 80% identity (preferably at least 90% anct mere preferable at least 95%) sequence identity with porcine B7-1 protein is proviαed.
In a further embodiment, ant porcine 37-1 antibodies are provided. As used herein, the term "antibodies" refers to 1) immunoglobulms produced in vivo; 2) those produced in vitro by a hybriaoma; 3) antigen binding fragments (e.g., Fab' preparations) of such immunoglobulms; and 4) recombinantly expressed antigen binding proteins (including chimeric immunoglobulms, bispecific immunoglobulms , heterocon ugate immunoglobulms, "humanized" immuncglobulins , single chain antibodies, antigen binding fragments thereof, and other recomb ant proteins containing antigen binding domains derived from immunoglobulms) . Antibodies that bind to porcine B7-1 molecules, but not to human B7-1 molecules are also provided.
In another embodiment, therapeutic agents and methods for their use in the prevention and/or treatment of porcine xenograft rejection are described. These agents contain the porcine proteins and/or the anti-porcine antibodies discussed hereinabove.
In another embodiment, therapeutic agents and methods for their use in the treatment of inflammatory diseases, such as autoimmune diseases are described. These agents contain the soluble porcine proteins discussed herein.
In a further embodiment, porcine cells, tissues and whole organs lacking the B7-1 molecule are provided.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Sequence comparisons between porcine and human B7-1. (A) Amino acid sequences of soluble porcine B7-1 (sB7-l), the transmembrane form of porcine B^-l (tmB7-l) and human 37-1 (hB7-i) were aligned based on ammo acid identity and structural similarity. Identical amino acids are denoted by asterisks, and gaps in the sequences are indicated by dashes. Assignment of structural domains are based on exon boundaries published for human B7-1 and are identified by the following abbreviations: signal peptide, SP; immunoglobulin variable-like domain, Ig V- like; immunoglobulin constant-like domain, Ig C-like; transmembrane domain, TM; cytoplasmic domain, CYT . Tne signal peptide is depicted by single underline. The transmembrane domain was determined using the PSORT II program
(http://psort.nibb.ac.jp) and is indicated by dashed underline. Sites known to be critical for 37-1/CD2S binding are shown by double underline. Translations! stop sites are indicated by closed diamonds while the closed circles at the end of the mB""-l sequence indicate that the stop codon was not identified m this molecule. The transmembrane and cytoplasmic domains are absent in s3~-l. (B) Partial nucleic acid sequence flanking the junction site of hB7-l exons 4 and 5 were aligned with s3"-l and tm37-l based on sequence similarities. Encoded aminc acid sequences for each are also shown. Protein domains corresponding to exons 4 and 5 are depicted as extracellular or transmembrane. The transiational stop site for sB7-l is indicated by an asterisk.
Figure 2. Porcine B7-1 binding to the human receptors CD28 and CTLA-4. Human Jurkat cells that are known to express CD28 but net CTLA-4 were incubated with sB7-l tagged with histidine residues (sB7-l-His) followed by incubation with fluorescein isothior- cyanate (FITC) -labelled polyclonal IgG recognizing the histidine tag. Binding was determined by Flow cytometry (described in the Examples herein below) . Panel A depicts the binding of sB~-l-His to Jurkat cells that have been previously incubated with buffer alone (no Ab (antibodies) ) , with a functionally blocking anti-CD28 mAb cr with an irrelevant isotype matched mAb (Anti-CD59) . Panel B shows the binding of sB7-l following preincubaticn with buffer alone (no Ab) human CTLA-4Ig or an irrelevant isotype matched mAb (Anti-CD3) . The binding of the anti-histidine IgG in the absence of s37-l-His is shown in both panels (control) .
Figure 3. sB7-l blocks human T cell activation by xenogeneic or allcgeneic cells. Mitomcycin-C treated porcine cr human stimulator cells were incubated with human responder cells in the presence or absence of sB7-l and levels of T cell activation were determined. Curves show thymidine incorporation by human T cells in response to either porcine (panel A) or human (panel 3) P5L in the presence of increasing concentrations of sΞ~-l (closed circles) . Single points indicate levels of T ceil activation in the absence of B7-1 (open circle) , in the presence of human CTLA- 4-Ig at 100 μg/ml (closed square) or in the presence of soluble porcine ?-selectin at 100 μg/ml (open square) . Thymidine incorporation in wells with either stimulator cells cr responder cells alone are also shown (open triangle cr open diamond, respectively) . Figure 4. Anti-porcine B7-1 hybridoma supernatants modify interactions between porcine B7-1 and human CTLA-4. The binding of human CTLA-4-Ig to plate-coated sB7-l was assayed in the presence of anti-57-i hybridoma supernatants. Bars represent absorbances in O.D. units cf CTLA-4-Ig binding to 37-1 in the presence of the various hybridoma supernatants. The bar labeled N=lβ represents the mean absorbance of 16 different supernatants that demonstrated levels of CTLA-4-Ig/B7-I binding in the range c: that abserved in the absence anti-B7-l hybridoma supernatants. Other bars represent hybridoma supernatants that either inhibited cr augmented CTLA-4-Ig/B7-l binding.
Figure 5. Anti-porcine B7-1 hybridoma supernatants modify interactions between porcine B7-1 and human CD28. The binding of sE7-l to human CD28 on the surface of Jurkat cells was assayed in the presence of anti-B7-l hybridoma supernatants. Bolded peaks i: each panel represent the binding of sB7-l to CD28 in the absence cf hybridoma supernatants. Peaks shown by solid lines represent background binding in the absence of sB7-l. Peaks indicated by dotted lines show the binding between sB7-l and CD28 in the presence of the various supernatants.
Figure 6. mAbs generated to porcine B7-1 and 37-2 inhibit human T cell activation by porcine stimulator cells . Mitomycin C-treated porcine stimulator cells (porcine peripheral blood lymphocytes; PBL) were incubated with human responder cells in the presence or absence of anti-porcine B7 mAbs and levels of T cell activation were determined. Curves show thymidine incorporation by human T cells in response to porcine PBL in the presence of increasing concentrations of anti-B7-l (closed circles) , anti-B7-2 (open cirles) or a combination of both antibodies (open triangles) . Single points indicate levels of T cell activation in the absence of anti-B7 mAbs (open square) , in the presence of human CTLA-4-
Ig at 100 μg/ml (closed square) or in the presence of an isotype matched murine mAb at 100 μg/ml (closed triangle) .
Figure 7 cDNA encoding soluble porcine 37-1 (s 37-1) . Capital letters represent the coding sequence while lower letters show 5 or 3' untranslated regions.
Figure 8 cDNA encoding transmembrane porcine B7-1 1 (tmB7-l) Capital letters represent the coding sequence while lower letter; show 5' or 3' untranslated regions. Detailed Description
Compositions
Isolated nucleic acid molecules including sequences that are unique to the porcine genome are provided.
The isolated nucleic acid molecules include sense sequences of contiguous nucleotides of the porcine sequences disclosed herein, for example in Figures 7 & 8. These sense sequences are unique to the porcine genome, and can be used as PCR primers or hybridization probes for the identi ication and/or isolation of the homologous porcine genes from porcine genomic DNA, and for the quantification of 37-1 message in porcine RNA samples. Antisense sequences of contiguous nucleotides complementary to such sense sequences are also required in order to practice PCR, and may also be used as hybridization probes. In order to be used for such purposes, the sequences of contiguous nucleotides must span a sufficient length. The minimum oligonucleotide length required for specific hybridization (i.e., hybridization under conditions requiring an essentially perfect match of complementary nucleotides wherein the sequence of the probe can be expected to occur only once in the genome of the organism being probed) of both hybridization probes and PCR primers is well known in the art, and is discussed in, for example, Sambrook, et al, 1989, Molecular Cloning: A Laboratory Manual. 2 Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., on pages 11.7-11.8. In practice, this span is at least 14 nucleotides, and, preferably, at least 18 nucleotides. Because at least 2 PCR primers are generally required to carry out a PCR reaction, the specificity of the PCR reaction is greater than that of each cf the oligonucleotide primers used to drive the reaction.
In another embodiment, a cloned porcine cDNA molecule having a sequence of nucleotides unique to the porcine genome is provided. This cloned molecule is characterized by hybridizing specifically to an isolated nucleic acid molecule as described in the preceding paragraph. Specific hybridization is used to clone this DNA molecule. This cloning can be accomplished by several methods well known in the art, such as by PCR using porcine reverse-transcribed DNA templates, or by conventional screening cf phage or other libraries of porcine cDNA or genomic DNA, (e.g., by- plaque lift filter hybridization) . In another embodiment, recombmant expression vectors which include synthetic or cDNA-derived DNA fragments encoding porcine B7-1 proteins are provided. The nuclectiαe sequences coding for porcine B7-1 proteins can be inserted into an appropriate expression vector, i.e., a vector that contains the necessary elements fcr the transcription and translation of tne inserted protein-coding sequence. The necessary transcripticr.al and translational signals can also be supplied by the native gene and/or its flanking regions. Suitable host vector systems include, but are not limited to: mammalian cell systems infected with viral vectors (e . g . , vaccinia virus, adenovirus, retroviruses, etc.); mammalian cell systems transfected with plasmids; insect cell systems infected with viral vectors (e.g., baculovirus) ; microorganisms such as yeast containing yeast expression vectors, or bacteria transformed with bacteriophage DNA, plasmid DNA, or cosmid DNA. See, for example, Goeddel (ed) , Gene Expression Technology, Volume 185. 1990 Academic Press, Inc., San Diego, Calif.
Suitable bacterial expression vectors include a selectable marker and bacterial origin of replication derived from commercially available plasmids having genetic elements of the well-known cloning vector pBR322 (American Type Culture Collection, 12301 Parklawn Drive, Rockville, Maryland 20852, United States of America; ATCC Accession No. 37017) . These pBR322 "backbone sections," or functionally equivalent sequences, are combined with an appropriate promoter and the structural gene to be expressed.
Suitable promoters include, but are not limited to, the lactose promoter system (Chang, et al . , Nature 275,, pp. 615. 1978) the tryptophan (trp) promoter; see Goeddel, et al . , Nucl Acids Res 8, pp. 4057 1980, and the tac promoter, cr a fusion between the tac and trp promoters referred to as the trc promoter; (see Maniatis, Molecular Cloning: A Laboratory Manual Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y., pp.412; 1982). Preferred bacterial expression vectors include, but are not limited to, vector pSE420 (comimercialy available from Invitrogen Corporation, San Diego, California) . This vector harbors the trc promoter, the lacO operon, an anti-terminator sequence, the glO ribosome binding sequence, a translation terminator sequence, the laclq repressor, the ColEl origin of replication, and the ampicillin resistance gene.
Recombinant porcine B7-1 proteins may also be expressed in suitable fungal hosts, such as yeast of the Saccharomyces genus such as S. cerevisiae. Fungi of other genera such as Asnerσillus , Pichia or Kluyveromyces may also be employed. Fungal vectors will generally contain an origin cf replication from the 2 μm yeast piasmid or another autonomously replicating sequence (ARS) , a promoter, DNA encoding a porcine B7-1 molecule, sequences directing pclyadenylation and transcription termination, and a selectable marker gene. Preferably, fungal vectors will include an origin of replication and selectable markers permitting transformation and selection in both Ξ. coli and fungi.
Suitable promoter systems in fungi include the promoters for metallothionein, 3-phosphoglycerate kinase, or other glycolytic enzymes such as enolase, hexokinase, pyruvate kinase, glucokinase, the giucose-repressible alcohol dehydrogenase promoter (ADH2), the constitutive promoter from the alcohol dehydrogenase gene, ADHl, and others (see, for example, Schena, et al . Meth Enzymol 194, pp. 389; 1991.) Secretion signals, such as those directing the secretion of yeast α-factor or yeast invertase, can be incorporated into the fungal vector to promote secretion of soluble porcine B7-1 proteins into the fungal growth medium. (See Moir, et al . , Meth Enzymol 194, pp.491; 1991.)
Preferred fungal expression vectors can be assembled using DNA sequences from pBR322 for selection and replication in bacteria, and fungal DNA sequences, including the ADHl promoter and the alcohol dehydrogenase ADHl termination sequence, as found in vector pAAH5 (Ammerer, 1983) . The ADHl promoter is effective in yeast in that ADHl mRNA is estimated to be 1 - 2% of total poly (A) RNA.
Various mammalian or insect cell culture systems can be employed to express recombinant porcine B7-1 proteins. Suitable baculovirus systems for production of heterolcgous proteins in insect cells are reviewed by Luckow, et al . , 3io/Technology 6, pp. 47. 1988 Mammalian expression vectors may have non-transcribed elements such as an origin of replication, a suitable promoter and enhancer linked to the porcine B7-1 protein gene to be expressed, and other 5' or 3 ' flanking sequences such as a ribosome binding site, a polyadenylation sequence, splice donor and acceptor sites, and transcriptional termination sequences.
The transcriptional and translational control sequences in mammalian expression vector systems to be used in transforming vertebrate cells may be provided by viral sources. For example, commonly used promoters and enhancers are derived from polyoma virus, adenovirus, Simian virus 40 (SV40) , and human cytomegalovirus . (CMV) , including the cytomegalcvirus immediate- early gene 1 promoter and enhancer.
Suitable eukaryotic vectors for the expression of porcine B7-1 proteins include but are not limited to pAPEX-3(see Evans et al . Gene 84, pp. 135; 1989), and pcDNAI/Amp (commercially available from Invitrogen Corporation, San Diego, California) . A particularly preferred host cell for the expression of inserts in the pAPEX-3 vector is the human 293 EBNA cell line (commercially available from Invitrogen, San Diego, CA) . The pcDNAI/Amp expression vector contains the human CMV immediate-early gene I promoter and enhancer elements, the SV40 consensus intron donor and acceptor splice sequences, and the SV40 consensus polyadenylation signal. This vector also contains an SV40 origin of replication that permits episomal amplification in cells (e.g., COS cells, MOP8 cells, etc.) transformed with the SV40 large T antigen, and an ampicillin resistance gene for propagation and selection in bacterial hosts.
Many other useful mammalian promoter systems known in the art, such as EF-1 alpha promoters or inducible promoter systems (using e.g., the tetracycline-dependent derepression mechanism or an ecdvsone-inducible expression system) are also suitable for use herein .
In a further embodiment, purified porcine B7-1 proteins are prepared by culturing suitable host/vector systems to express the recombinant translation products of the nucleic acid molecules of the present invention, which are then purified from the culture media or cell extracts of the host system (e.g., the bacterial, insect, fungal, or mammalian cells) . Fermentation of fungi cr mammalian cells that express soluble porcine B7-1 proteins containing a histidine tag sequence (comprising a string of at least 5 histidine residues in a row) as a secreted product greatly simplifies purification. Such histidine tagged sequence enables binding, under specific conditions, to metals such as nickel, thus permitting efficient purification by passage over nickel Columbus.
In general terms, the purification of recombinant porcine B7-1 proteins is performed using a suitable set of concentration, fractionation, and chromatcgraphy steps well known in the art (see, for example, Deutscher, Guide to Protein Purifications, Vol. 182; Academic Press, Inc., San Diego Calif. 1990; and Harris and Angal, Protein Purification Methods: A Practical Approach. IRL Press Oxford University Press. Oxford, 1989). Denaturation of the purified protein, followed by refolding under reducing conditions, is then performed to enable proper disulfide bond formation.
Porcine 37-1 proteins purified from bodily fluids of transgenic animals engineered to produce such proteins, as well as porcine B7-1 proteins that are produced in part cr entirely by in vitro methods are provided.
Preferred uses of porcine B7-1 proteins include, but are net limited to, 1) reagents for blocking T cell activation; 2) immunogens for the purpose of raising antibodies to porcine 57-1 proteins; and, 3) antigens for use in immunoassays to detect soluble porcine B7-1 proteins as markers of inflammation in primate recipients of porcine xenografts, discussed hereinbelow.
Antibodies
In another embodiment, antibodies reactive with porcine 37-1 proteins, but not human B7-1 proteins are provided. Suitable antibodies include, but are not limited to, polyclonal, monoclonal, humanized, bispecific, and heteroconjugate antibodies. Such antibodies can be prepared by applying methods known in the art. See for example; Reichmann, et al . , Nature 332, pp. 323, 1988. Winter and Milstein, 1991; Clackson, et al., Nature 352, pp.624. 1991; Morrison, Annu Rev Immunol 10, pp. 239; 1992; Haber, Immunol Rev 130, pp. 189; 1992; and Rodrigues, et al . , J Immune1 151, pp. 6954; 1993.
Polyclonal Antibodies
Polyclonal anti B7-1 antibodies are provided. Methods cf preparing such antibodies are known to one skilled in the art and the immunization protocol may be selected without undue experimentation. Suitable methods for raising polyclonal anti 37-1 antibodies in a mammal include injecting the mammal with an immunizing agent and optionally in the presence in the presence orabsence of an adjuvant. The regimen includes multiple subcutaneous or interperitoneal injections with the immunizing agent, such as the B7-1 protein or fragments thereof. It may be useful to conjugate the immunizing agent to a carrier known to be immunogenic in the mammal being immunized.
Monoclonal Antibodies
Monoclonal anti 37-1 antibodies are provided. Monoclonal antibodies may be prepared by using methods to generate hvbridcmas such as those described in Kohler et al, Nature , 256:495 (1975; . Briefly, a mouse, hamster, cr other suitable host is immunized with an immunizing agent to elicit lymphocytes that produce cr are capable of producing antibodies that will bind to the lmmunizmq agent. The lymphocytes may also be activated to produce antibodies immunized in vitro. The lymphocytes are then fused to myeloma cells in vitro to immortalize the antibody-producing cells .
Techniques for the following are all known in the art: 1) immunization of animals (in this case with isolated porcine E",-l proteins or fragments thereof) , isolation of antibody producing cells, 2) fusion of such cells with immortal cells (e.g., myeloma cells) to generate hybridomas secreting monoclonal antibodies, 3) screening cf hybridoma supernatants for reactivity and/or lack of reactivity of secreted monoclonal antibodies with particular antigens (in this case reactivity with a porcine B7-1 protein but not with the corresponding human B7-1 protein), 4) the preparation of quantities of such antibodies in hybridoma supernatants or as- cites fluids, and 5) the purification and storage of such monoclonal antibodies. See for example, Coligan, et al . , eds . Current Protocols In Immunology, John Wiley & Sons, New York, 1992; Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1988; Liddell and Cryer, A Practical Guide To Monoclonal Antibodies, John Wiley & Sons, Chichester, West Sussex, England, 1991; the contents of all of which are incorporated herein by reference.
Suitable hybridomas for producing such antibodies can be obtained using purified porcine B7-1 proteins as the immunizing agent followed by screening to identify hybridomas producing antibodies with the desired properties. Such screening can be carried out using suitable immunoassays such the ELISA described below and in copending U.S. patent application serial no.: 08/252,493, filed June 1, 1994, which is incorporated herein by- reference. A simple modification of this ELISA (i.e., substituting soluble human 37-1 proteins for soluble porcine 37-1 proteins) can be used to identify those of the hybridomas producing antibodies that bind to porcine B7-1 proteins but do net bind to human B7-1 proteins.
Humanized and Human antibodies.
Humanized anti B7-1 antibodies are provided. Humanized forms cf non-human (e.g., munne) antibodies are chimeric immunoglobulms, immunoglobulin chains or fragments thereof (such as Fv, scFv, Fab, Fab',F(ab'); cr other antigen- binding subsequences cf antibodies) which contain minimal secuence derived from non-human immunoglobulin. Humanized antibodies include human immunoglobulms (recipient antibody) in which residues from complementary determining regions (CDRs) of the recipient are replaced by residues from CDRs cf a non-human species (donor antibody) such as mouse, rat cr rabbit having the desired specificity, affinity and binding capacity. In some instances, specific Fv framework residues of the human immunoglobulin are replaced by corresponding non-human residues. Humanized antibodies may also comprise residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences .
Methods for humanizing non-human antibodies are well known in the art. Generally, a humanized antibody contains one or more amino acid residues that are introduced from a non-human antibody source. These non-human amino acid residues are often referred to as "import" residues, which are typically taken from an "import" variable domain. Humanization can be essentially performed following the method of Winter and co-workers (Jones et al . , Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-32'7 (1988); Verhoeyen et al . , Science, 239:1534-1536 (1988)), by substituting rodent CDRs or CDR sequences for the corresponding sequences of a human antibody. Humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues are substituted by residues from analogous sites in rodent antibodies.
Human antibodies can also be produced using various techniques known in the art, including phage display libraries [Hoogenboom and Winter, J. Mol . Biol . , 227:381 (1991); Marks et al. J. Mol. Biol., 222:581 (1991)]. The techiniques of Cole et al . and Boerner et al . are also available for the preparation of human monoclonal antibodies [(Cole et al . , Monoclonal Antibodies and Cancer Therapy, Alan R. Liss p. 77(1985) and Boerner et al . , J. Immunol. 147 (1) : 86-95 (1991) 1. Similarly, human antibodies can be made by introducing human immunoglobulin loci into transgenic animals, (e.g., mice) in which the endogenous immunoglobulin genes have been partially or completely inactivated. Upon challenge with antigens, only human antibodies are produced in a manner similar to that seen in humans in all respects, including gene rearrangement, assembly, and antibody repertoire. See for example, in U.S. Patent Nos . 5,545,807; 5,545,806; 5,569,825; 5,625,126; 5,633,425; 5,661,016, and in the following scientific publications; Marks et al . , Bio/Technology 10, 779-783 (1992); Lonberg et al . , Nature 368 856-859 (1994); Morrison, Nature 368 812-13 (1994); Fishwild et al . , Nature Biotechnology 14 , 845-51 (1996); Neuberger, Nature Biotechnology 1 , 826(1996); Lonberg anc Huszar, Intern. Rev. Immunol. 13 65-93(1995) .
Polyspecific antibodies.
Polyspecific anti-B7-I antibodies are provided.
Polyspecific antibodies are monoclonal, preferably human or humanized, antibodies that have binding specificities for at leas: two different antigens. One cf the binding specificities may be for the B7-1 protein, while the other may be for any other antigen, cell-surface protein, receptor or receptor subunit.
Methods for making bispecific antibodies are known in the art. Traditionally, the recombinant production of bispecific antibodies is based on the co-expression of two immunoglobulin heavy-chain/light-chain pairs, where the two heavy chains and/or the two light chains have different specificities [See Milstein and Cuello, Nature, 305:537-539 (1983)]. The purification of the correct molecule is usually accomplished by affinity chromatography steps. Similar procedures are disclosed in Traunecker et al . , EMBO J. 10:3655-3659 (1991).
Heteroconjugate antibodies
Heteroconjugate antibodies are provided. Heteroconjugate antibodies are composed of two covalently joined antibodies. Sue: antibodies have, for example, been proposed to link immune system cells to unwanted target cells to enable their rapid elimination [U.S. Patent No. 4, 676,980], and to treat HIV infection [WO 91/00360; WO 92/200373; EP 03089] . It is contemplated that the antibodies may be prepared in vi tro using known methods in synthetic protein chemistry, including those involving crosslinking agents. For example, immunotoxins may be constructec using a disulfide exchange reaction or by forming a thioether bond. Examples of suitable reagents for this purpose include iminothiolate and methyl-4-mercaptobutyrimidate and those disclosed, for example, in U.S. Patent No. 4,676,980.
Antibody glycosylation Porcine B7-1 proteins and anti-porcme 37-1 antibodies with or without associated native patterns of glycosylation are also provided. For example, expressing proteins recombinantly in bacteria such as E. coli provides non-glycosylated molecules, while expressing porcine 37-1 proteins or anti porcine B7-1 protein antibodies in mammalian cells can provide glycosylated molecules .
Therapeutic Treatment
Anti-porcine 37-1 antibodies or soluble B7-1 proteins (collectively referred to hereinafter as "therapeutic porcine B7-1 agents") can be used for the prevention or treatment of xenotrasplant rejection in patients suffering from that have received porcine cells or tissues. In a further embodiment, a combination of anti-porcine B7-1 and anti-porcine B7-2 antibodies can be used to inhibit host T cell activation.
The therapeutic porcine B7-1 agents, including but not limited to a combination of anti-porcine B7-1 and anti-porcine B7- 2 antibodies, can be administered in a variety of unit dosage forms. The dose will vary according to the particular agent. For example, antibodies prepared as Fab' cr F(ab')2 fragments are of considerably smaller mass than the equivalent intact immunoglobulins, and thus require lower dosages to reach the same molar levels in the patient's blood. Antibodies with different affirmatives will also differ in their regarded dosages.
The dose will also vary depending on the manner cf administration, the particular symptoms of the patient being treated, the overall health, condition, size, and age of the patient, and the judgment of the prescribing physician. Dosage levels of the therapeutic porcine 37-1 agents for human subjects range between about 1 mg per kg and about 100 mg per kg per patient per treatment. In terms of plasma concentrations, the therapeutic porcine 37-1 agent concentrations are preferably in the range from about 25 μg/ml to about 500 μg/ml.
Subject to the judgement of the physician, a typical therapeutic treatment includes a series of doses, which are usually administered concurrent with the monitoring of clinical endpoints. These may include xenctransplant biopsies cr measures of organ function (e.g. for xenotransplanted kidneys, BUN creatines and, proteinuria levels, etc.), with treatment dosage levels adjusted as needed to achieve the desired clinical outcome. Therapeutic porcine B7-1 agents can be administered by- methods well known in the art, such as by bolus injection, intravenous delivery, continuous infusion, sustained release from implants, etc. The therapeutic porcine 37-1 agents may also be entrapped microcapsules (such as hydroxymethylcellulose cr gelatin-micrccapsules) ; liposomes; and other sustained-release matrices such as polyesters, hydrogels (for example, polyhydroxyethylmethacrylate or polyvinylalcohol) or mjectable microspheres cf biodegradeable materials, such as polymers and copolymers cf glycolide, lactide, and/or ethylene glycol.
The therapeutic porcine B7-1 agents can be used in compositions to treat episodes of xenograft rejection, either alone cr in combination with known immunosuppressive agents such as cyclosporin A, FK506, rapamycin, corticosteroids, etc.
Formulations suitable for injection are found in Remington ' s Pharmaceutical Sciences, Mack Publishing Company, Philadelphia, PA, 17th ed. (1985) . Such formulations must be sterile and non- pyrogenic, and generally will include purified therapeutic porcine B7-1 agents in conjunction with a pharmaceutically effective carrier, such as saline, buffered (e.g., phosphate buffered) saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions, and the like. The formulations may contain pharmaceutically acceptable auxiliary substances as required, such as, tonicity adjusting agents, wetting agents, bactericidal agents, preservatives, stabilizers, and the like.
In one preferred embodiment, the therapeutic porcine B7-1 agent is formulated as a lyophilizate using appropriate excipient solutions (e.g., sucrose, albumin) as diluents. The amount and frequency of administration will depend, of course, on such factors as the nature and severity of the rejection episode being treated, the desired response, the condition of the patient, and so forth.
The formulations can be distributed in sterile form as articles of manufacture comprising packaging material and the therapeutic porcine B7-1 agents. The packaging material will include a label which indicates that the formulation s for use in the prevention or treatment of porcine xenctransplant rejection. Knockout
Certain of the isolated nucleic acid molecules of the invention are also useful as to direct and/cr modulate the expression cf porcine E7-1 molecules in porcine cells, e.g., by altering the expression cf porcine Bπ-1 genes. Such modulation may be accomplished by the use of techniques well known in the art .
A suitable method by which the expression of porcine B~-l proteins on transgenic pig cells can be inhibited (to thereby reduce a potential human immune response against transplanted transgenic cells or tissues) is by genetic manipulations referred to in the art as "gene disruption" or "gene knockout." Gene knockout uses specially designed DNA molecules (gene knockout constructions) to achieve targeted inactivaticn (knockout) cf a particular gene, via homologous recombination,- upon introduction of the construct into a cell. See for example; Thomas, et al.,Cell 44(3), pp. 419; 1986; Thomas, et al.,Cell 51(3), pp. 503;1987; Jasin and Berg, Genes & Development 2, pp. 1353. 1988; Mansour, et al., Nature 336, pp. 348; 1988; Brinster, et al . , Proc Natl Acad Sci 86. pp. 7087; 1989; Capecchi, Trends in Genetics 5(3) pp. 70; 1989; Frohman and Martin, Ceil 56. Pp. 145; 1989; Hasty, et al . , Mol Cell Bio 11(11), pp. 5586; 1991; Jeannotte, et al . , Mol Cell Bio 11(11) pp. 5578; 1991; and Mortensen, et al . , Mol Cell 3io 12 (5) , pp. 2391; 1992.
Gene knockouts and gene replacements can be achieved in mammalian zygotes through techniques well known in the art, including, but not limited to, microinjection, of nuclei or pronuclei, electroporation of ova or zygotes, nuclear transplantation, and/or the stable transfection or transducticn of embryonic stem cells (see for example Brinster, et al . , Proc Natl Acad Sci 86. pp. 7087; 1989, U.S. Patent No. 5,032,407 to Wagner et al., PCT Publication WO90/08832, and preferably, PCT Publication WO 99/07829.)
In the latter case, swine lacking B7-1 mclecules can be created by the genetic manipulation of embryonic stem cells (ES cells) as described in PCT Patent Publication No. WO 93/02188 and Robertson, 198", Teratocarcinomas and Embryonic Stem Cells a Practical Approach. IRL Press Eynsham, Oxford, England. In accordance with this technique, ES cells are grown in vitro as described in, for example, Robertson, in Robertson, ed. "Teratocarcinomas and Embryonic Stem Cells a Practical Approach" IRL Press, Eynsham, Oxford, England 1987, and in U.S. Patent No. 5,166,065. Genetic material having a defective or altereα gene encoding porcine B7-1 is introduced into the embryonic stem cells by electroporation according, for example, to the method cf McMahon, et al . , Cell 62, pp. 1073; 1990. cr by transducticn with a retroviral vector according, for example, to the method cf Robertson, et al . , Nature 323, pp. 445; 1986 cr by any cf the various techniques described by Lovell-Badge , Teratocarcinomas anc Embryonic Stem Cells a Practical Approach. IRL Press Eynsham, Oxford, England 1987. The selected cells then may be injected mt a blastocysts of an animal (e.g. a pig) to form aggregation chimeras (see for example, Teratocarcinomas and Embrionic Stem Cells: A Practical Approach, E.J. Robertson, ed. (IRL, Oxford, pp 113; 1987) . a suitable pseu opregnant female foster animal and the embryo brought to term to create the "knockout" progency.
In another embodiment, mutant porcine B7-1 nucleotide sequences including nucleotide deletions, insertions, substitutions, and additions to the exon and/or intron regions cf the porcine B7-1 such that the resultant mutant does not encode a functional B7-1 protein. These nucleotide sequences may be utilized in homologous recombination techniques. In such techniques, mutant sequences are used in homologous recombination techniques. In such techniques, mutant sequences are recombined with wild type genomic sequences in stem cells, ova, or newly fertilized cells of about 1 to about 500 cells. Nucleotide sequences used in this homologous recombination may be in the form of isolated nucleic acid sequences or in the context cf vectors. Upon recombination, destruction of the functional gene takes place.
Diagnostic Use
Diagnostic use of the anti-porcine B7-1 antibodies include but are not limited to assaying the patient's blood for levels of one cr more porcine B7-1 proteins. Measurement cf porcine B7-1 protein levels may be accomplished by RIA, ELISA, or other suitable immunoassay using the anti-porcine E7-1 antibodies as detection reagents. General methods for performing such assays are set forth in Coligan, et al., Current Protocols in Immunol, John Wiley & Sons, New York 1992. Blood porcine B7-1 protein levels xeno intanspla t recipients must be monitored at regular intervals, e.g., daily cr weekly, and changes in such levels recorded. A significant increase in the levels of porcine B7-1 protein levels in the patient's bleed is an indication that the porcine tissue is becoming inflammed, and may indicate the onset of a rejection episode. An alternative test for rejection, (cr a test confirming tha: rejection is occurring, as indicated by measurement cf soluble B7- 1 protein levels) may be obtained by monitoring porcine cell, tissue, or organ function or by biopsy and histopathological examination of the porcine cell, tissue or organ. Such examination will be carried out in order to detect the typical manifestations of transplant rejection such as, cellular infiltration, inflammation, and necrosis. An immunohistopathological examination of the biopsied materials will also be performed, using certain of the anti-porcine B7-1 antibodies to detect the levels of expression cf one or mere porcine B7-1 proteins on the surface cf the xenotransplanted cells. High levels of such expression (compared to levels on non- transplanted control tissue samples) are indicative of xenotransplant rejection.
In order that those skilled in the art may be better able to practice the compositions and methods described herein, the following examples are given to illustrate the preparation of soluble porcine B7-1, transmembrane porcine B7-1, and antibodies thereto, as well as to evaluate the ability of soluble and transmembrane porcine B7-1 to inhibit T cell activation. It is to be understood that commercially available reagents referred to in the examples were used according to the manufacturer's instructions unless otherwise indicated.
Examples
Example I
Cloning of sB7-l
Total RNA was prepared from freshly isolated porcine peripheral blood leukocytes (PBL) using the acid/guanidinium thiocyanate technique as described in Chomczynski and Sacchi, 1987. Ten micrograms of total RNA were heated at 65°C for 3 minutes, quenched on ice, and subjected to first strand cDNA synthesis for (1 hour at 37°C) in the following 100 μl reaction mixture: 10 mM Tris-HCl (pH 8.3), 50 mM KCL 1.5 mM MgCl2; 10 mM dithiothreotol, 0.20 mM of each dNTP, 0.5 μg oligo dT16 and 20 Units of avian mveloblastosis virus reverse transcriptase, commercially available from Seikagaku Inc., Rockville, MD. The following oligonucleotide primers were generated from regions of high homology between human and mouse B7-1 sequence: 1) 5' TGGCCCGAGTATAAGAACCGGAC3' and 2) 5' TCAGTTTCAGGATCTTGGGAAA 3'. Five microliters of the cDNA pool was used as a template in a 100 μl PCR reaction under the following reaction conditions: 50 mM KC1, 10 mM Tris-HCl (pH 9.0), 1.5 mM MgCl2, 0.1% (w/v) gelatin, 1% Triton X-100, 200 μM each dNTP, 2.5 U Taq DNA polymerase (commercially available from Perkin Elmer Cetus, Norwalk, CT) and 25 pmol of each primer. PCR amplification was performed for 30 cycles (94°C for 1 min, 50°C for 1 min, 72°C for 1 min) followed by 1 cycle at 72°C for 10 min. The resulting 338 bp fragment was cloned into the pCR2.1 vector using the T/A cloning system (commercially available from Invitrogen, San Diego, CA) and identified by DNA sequence analysis as a porcine B7-1 homologue. Two gene-specific oligonucleotides were derived from the porcine B7-1 sequence and a 250 bp fragment was generated by PCR. This DNA fragment was used to screen a λgtlO porcine macrophage library (provided by Dr. Michael Murtaugh, Department of Veterinary PathoBiology, University of Minnesota). To screen the λgtlO porcine macrophage library, approximately 1 x 106 phage were isolated on nitrocellulose filters which were subsequently denatured, neutralized and air dried and subjected to uv crosslinking. Denatured filters were prehybridized in BSA/SDS buffer (1% BSA, 7% SDS, 0.5M sodium phosphate buffer, pH 6.8 and 1 mM EDTA) for 2 h at 65°C before addition of the porcine B7-1 fragment previously j2P labeled with the Prime-It II random primer kit (Stratagene, La Jolla, CA) to a specific activity of 1 x 109 counts per minute (CPM) /μg of DNA. Membranes were hybridized at 60°C overnight and subsequently washed using the following conditions: two-30 min washes with 2x SSC/0.1% SDS at room temperature, one-30 min wash with 0.5x SSC/0.1% SDS at 50°C and one-30 min wash with 0.2x SSC/0.1% SDS at 60°C. Positive plaques present on duplicate filters were purified and the B7-1 DNA was recovered by PCR using primers that flanked the insertion site of the λgtlO vector. After cloning the PCR fragment into pCR2.1-TOPO. both strands of the putative full-length clone were sequenced using the chain termination method. Clones derived from different PCR reactions were also sequenced to rule out potential errors introduced during amplification. The DNA templates were primed with vector sequence primers flanking the multiple cloning site, or primers constructed from internal cDNA sequence.
Clones containing the B7-1 related sequence were identified at a frequency of approximately one clone per 1 x 105 phage. DNA sequence analysis performed as described above revealed a full-length cDNA that lacked both the transmembrane and cytoplasmic domains normally found in B7-1. Therefore the clones represented a soluble form of B7-1 (sB7-l) and containing 1620 bp comprised of a 718 bp 5' untranslated region (UTR), a 215 bp 3'UTR and an open reading frame that encoded 229 amino acids. The abnormally long 5'UTR for sB7-l corresponded to that of B7-1 clones derived from other species (Freeman et al., 1989; Freeman et al., 1991). No clones containing both transmembrane and cytoplasmic domains of B7-1 were isolated.
Example II
Cloning of porcine transmembrane B7-1
The transmembrane form of porcine B7-1 (tmB7-l) was isolated by RT-PCR of freshly isolated porcine lung RNA using an oligonucleotide from the 3' end of the sB7-l coding region as the 5' primer (GCTACCAACACGATGCTTTCC) and oligo dT]6 as the 3 ' primer. Conditions for RNA isolation and RT-PCR were otherwise identical to those described in Example I. The two major products resulting from the RT-PCR were cloned into pCR2.1-TOPO and inserts were sequenced for identification. One of the clones obtained through PCR (tmB7-l) contained the complete transmembrane domain coding region and most of the cytoplasmic domain coding region (based on comparison with B7- 1 from other species), but the translational stop site and 3' UTR were not present. The truncation of tmB7-l, and the lack of detection of tmB7-l in the oligo dT primed porcine macrophage library suggested strong 3' UTR secondary structure in these transcripts.
Example III
Comparison ofsB7-l and tmB7-l
The predicted amino acid sequences for sB7-l, tmB7-l and human B7-1 (hB7-l) were compared (Figure 1 , panel A). Sequences were segregated into domains based on exon boundaries identified for human B7-1 (Selvakumar et al., 1992). sB7-l and tmB7-l were identical prior to the transmembrane domain (only sB7-l is depicted before this domain). Excluding the transmembrane and cytoplasmic domains, which are highly divergent between species, porcine B7-1 and human B7-1 shared 65% sequence identity and an overall conservation of the Ig V-like and Ig C-like structural domains characteristic of other B7 molecules (Judge et al., 1995). The signal peptide for sB7-l was 29 amino acids in length as determined by amino terminal sequencing of purified protein. Amino acids that have been shown to be critical for the binding of B7- 1 to both CD28 and CTLA-4 (Guo et al., 1995) were highly conserved. A clone containing the complete coding region for tmB7-l was not found, but based on sequence comparison with various other species, the terminal amino acid is expexted to be very close to the translational stop site.
Various splice variants have been reported for the B7 molecules, none of which encode a soluble product (Borriello et al., 1995; Inobe et al., 1994; Borriello et al, 1994). To examine the splicing mechanism that generated sB7-l, the nucleic acid and amino acid sequences corresponding to the junction of exons 4 and 5 of human B7-1 were compared to porcine sB7-l and tmB7-l (Figure 1, panel B). Sequence identity between the alternative forms of porcine B7-1 were identical in exon 4 but showed no homology beginning with exon 5. A stop codon was generated in the beginning of exon 5 for sB7- 1. These data suggest that sB7-l is a splice variant lacking exons coding for both the transmembrane and cytoplasmic domains and represents the first report of a naturally occurring soluble form of B7-1.
Example IV
Generation of porcine His- tagged sB7-l
Expression of sB7-l protein tagged with a carboxy-terminal histidine hexapeptide (sB7-l-His) was generated in the mammalian expression vector Apex3P (Evans et al., 1995) by PCR amplification of B7-1 cDNA in pCR2.1-TOPO. The 5' primer (CCGGGGATCCCTTCTGTTTTCATCCTCATCAAGC) was derived from the 5'UTR of B7-1 and ' contained a BamHI site for subcloning. The 3' primer (GGCCTGCAGGTCATCAATGGTGATGGTGATGGTGGCATTTTTGCCAGTTGAA GGTCTGTGAC) inserted the histidine tag just upstream of the stop codon and an Sse83371 subcloning site. For stable expression of sB7-l-His, 293-EBNA embryonic kidney cells (commercially available from Invitrogen, Carlsbad, CA) were transfected with sB7-l-His in Apex3P according to methods described by Evans et al., 1995. Cells were grown in D10 medium (DMEM containing 5% FCS, 2 mM glutamine, 100 IU/ml penicillin and 100 μ/ml streptomycin) supplemented with puromycin at a final concentration of 1 μg/ml. Cells that expressed sB7-l-His were cloned by limiting dilution, and those producing high levels of protein were chosen by standard Western immuno-blot analysis of cell supernatants using rabbit anti-histidine polyclonal IgG (coomercially available from Santa Cruz Biotechnology, Inc., Santa Cruz, CA). The sB7-l-His protein was purified by affinity chromatography using a nickel charged nitrilotriacetic acid (NT A) resin commercially available from Qiagen, Chatsworth, CA as previously described (see Mueller et al., 1995). Example V
Raising antibodies to porcine B7-1
Monoclonal antibodies (hereinafter "mAbs") and polyclonal antisera directed against porcine B7-1 were generated by repeated immunization of mice and rabbits, respectively, with sB7-l-His according to methods routinely performed at Cocalico, Inc., Reamstown, Pennsylvania. MAbs were produced by immune eymphoetes and immortal myeloma cells according to methods discribed by Kohler et al.. Nature 1975. Select clones were injected into mice in order to produce ascites using protocols already established and commercially available at Cocalico. MAb supernatants were collected from hybridomas that had been cloned from the original fusion. These supernatants were diluted 1 :2 for use in assessing their effect on interactions between sB7-l and human CD28 and CTLA4. Anti-B7-1 specific IgG was purified from selected hybridoma super natants by passage over a Protein A-Sepharose column (commercially available from Pharmacia, Piscataway, NJ). This purified IgG was utilized to assess the effect of anti-porcine B7-1 mAbs on human xenogeneic MLRs. Total IgG preimmune rabbit serum, or from serum from B 7-1 -immunized rabbits was also purified by passage over a protein A-sepharose column. This polyclonal IgG was utilized to assess the cell surface expression of B 7-1 on porcine PBL.
Example VI
Expression of Cell-Surface B7-1 on Subpopulations of PMA/IM Stimulated Porcine PBL
Most studies have indicated that the B7-1 costimulatory molecule is undetectable, or present on only a small subset of resting human B and T cells, but that the molecule is upregulated in these cell types upon stimulation by various means (Lenschow et al., 1996). To assess the cell-surface expression of porcine B7-1 on various subsets of cells, freshly isolated porcine PBL were evaluated, prior to and following stimulation with 1 ng/ml phorbol mystric acetate (PMA) and 400ng/ml ionomycin for 72 hours at 37°C, using mAbs recognizing porcine cell surface marker and polyclonal anti-B7-l IgG by 2- color immunofluorescence and flow cytometry. Freshly isolated or activated cell populations were pre-incubated in PBS containing 5% goat serum. Cells were then incubated with anti-porcine-B7-l or preimmune rabbit IgG, in combination with murine antibodies directed against porcine CD3, IgM, class II and B7-2 cell surface antigens, in PBS containing 2% goat serum. Cells were washed in the same and then reacted with fluorescein isothyocyanate (FITC)-labeled goat anti-mouse Ig and with phycoerythrin (PE)-labeled goat anti-rabbit Ig. The cells were again washed and analyzed for surface immunofluorescence using a Becton Dickenson FACSort flow cytometer and CellQuest Software (both commercially available from Becton Dickenson & Co., Mountain View, CA). Further analysis was performed using WinMDI Version 2.7 software (provided by Dr. Joseph Trotter, University of San Diego). B7-1 was found on 49.8% of peripheral T cells, 64.9% of class II positive cells, 94.8% of IgM positive B cells, and 71.1% of B7-2 positive cells; see Table 1 below. These data suggest that a membrane bound form of porcine B7-1 is abundant on the surface of both peripheral T cells and antigen presenting
> cells.
Table 1. Expression of Cell-Surface B7-1 on Subpopulations of PMA IM Stimulated Porcine PBL
* Cell-surface B7-1 was detected on subpopulations of activated lymphocytes, defined by the expression of CD3 (T cells), IgM (B cells) and Class II and B7-2 (antigen presenting cells), by two-color immunofluorescence and flow cytometry as described in Materials and Methods.
Example VII sB7-l binds human CD28 and CTLA4
The ligands for several porcine adhesion and costimulatory molecules have been shown to be conserved across species, including humans. These include the ligands for porcine E-selectin, porcine VCAM-1 and porcine B7-2 (Matis et al, 1995; Maher et al., 1996). The fact that all amino acids shown to be critical for the binding of B7-1 to both CD28 and CTLA-4 are conserved in porcine B7-1 (Figure 1, panel A), suggests that this molecule will interact with its human counterpart ligands. To confirm that porcine B7-1 interacts with its ligand homologues on human cells, purified sB7-l-His was incubated with human Jurkat T cells (available from the American Type Culture Collection, Rockville Maryland, hereinafter "ATCC"; clone TIB 152) and the interaction was assayed by indirect immunoflourescence and flow cytometry as described in Example VI, using a polyclonal anti-porcine B7-1 IgG followed by an FITC conjugated goat anti rabbit IgG. Jurkat cells have been shown to express CD28 but not the alternative B7-1 ligand, CTLA-4 (Freeman et al., 1992). The binding of sB7-l-His to CD28 was effectively blocked by preincubating the cells with an anti-CD28 mAb (20mg/ml), further establishing the specificity of this interaction. An isotype matched irrelevant mAb (anti- CD59 mAb; 20 mg/ml) did not interfere with sB7-l-His/CD28 binding.
It has been demonstrated that both CD28 and CTLA-4 bind to very similar sites on B7-1 (Guo et al.. 1995). To analyze the ability of porcine B7-1 to bind its alternative ligand (CTLA-4), sB7-l-His was preincubated with human CTLA-4Ig (20mg/ml) prior to its addition to Jurkat cells and again analyzed by immunofluoresence and flow cytometrv. Human CTLA-4Ig effectively inhibited the binding of sB7-l to CD28 on these cells (Figure 2, panel B). By contrast, preincubation with an isotype-matched irrelevant mAb had no effect on sB7-l-His/CD28 binding. These data show that a naturally occurring soluble form of B7-1 maintains the ability to bind both CD28 and CTLA-4. Furthermore, the binding of porcine B7-1 to its human counterpart ligands suggests that this interaction could play a role in human T cell activation following pig to human xenotransplantation.
Example VIII sB7-l Inhibits Human T Cell IL-2 Production in Response to Costimulation by Porcine or Human Cells
Efficient T cell activation requires both a primary signal through the T cell receptor and a secondary signal mediated through binding of B7-1 and B7-2 costimulatory molecules on APCs, with CD28 on the surface of T cells. Jurkat cells do not constitutively elaborate IL-2, even in the presence of PHA, which can provide an obligate primary signal through the TCR. However, PHA signaling in the presence of a source of APCs that provide a second signal, or in the presence of stimulatory anti-CD28 antibodies, results in significant IL-2 production (Williams et al., 1992). In order to examine whether sB7-l could interact functionally with human T cells, the molecule was titrated into the Jurkat costimulation assay and its effect on T cell activation evaluated by detection of IL-2 in the culture supernatants. To perform this assay, porcine aortic endothelial cells PAEC) were seeded in wells of 96-well microtiter plates at 5 x 104 cells/well in complete medium, and allowed to adhere overnight at 37°C. Jurkat T cells (1 x 106 cells/well) were then added to the wells in the presence or absence of 10 μg/ml phytohemagglutinin (PHA; commercially available from Sigma) and increaseing concentrations of sB7-l, or humans CTLA-4Ig or porcine P-selectin-His. In some experiments, Raji cells (1 x 106 cells/well) were substituted for PAEC, but were added to the Jurkat cells at the initiation of the experiment. The cultures were maintained at 37°C in 5% CO2 for 24 h, at which time the culture supernatants were harvested for IL-2 detection. Assays to detect and quantitate human IL-2 were performed using an ELISA kit (Quantikine Human IL-2 Immunoassay; commercially available from R&D Systems), according to the manufacturer's protocol. Briefly, serial dilutions of a recombinant human IL-2 standard (commercially available from R&D Systems) or culture supernatants were added, in duplicate, to ELISA wells that had been previously coated with a "capture" monoclonal antibody specific for human IL-2, and incubated overnight at 4°C. Unbound cytokine was removed by repeated washes according to Quantikine kit instructions Bound IL-2 was revealed by incubation with a second IL-2-specific antibody conjugated with horseradish peroxidase (HRP), followed by extensive washing and addition of substrate (hydrogen peroxide and chromogen) to produce a colored product. The reaction was stopped by the addition of 2 N sulfuric acid. The optical density of each well was determined using a microtiter plate reader (commercially available from BioRad. Model 3550. Hercules, CA) set to 450 nm. with values corrected by subtraction of readings taken at 595 nm. IL-2 concentrations were calculated using Microplate Manager software (commercially available from BioRad).
As expected, in the absence of PAEC or Raji cells, Jurkat cells did not generate detectable IL-2 under any of the culture conditions tested (Table 2). By contrast, Jurkat cells generated high levels of IL-2 when stimulated with PHA together with either PAEC or Raji cells. Addition of sB7-l inhibited the production of IL-2 in a dose-dependant manner, with maximal inhibition equivalent to that observed with the addition of human CTLA-4Ig. Inhibition of IL-2 production was virtually complete at high doses of sB7-l (100 μg/ml) regardless of the APC (PAEC or Raji cells) used to provide the second signal. Addition of recombinant porcine P-selectin-His did not significantly influence IL- 2 production in this assay.
Taken together, these data suggest that sB7-l can bind to human T cells and block their activation by costimulatory signals delivered by either allogeneic human cells (Raji) or xenogeneic porcine cells (PAEC). Since Jurkat cells do not express CTLA-4, it can be concluded that sB7-l inhibits activation by binding to CD28 and blocking signaling through that molecule.
Table 2. spB7-l Inhibits Human T Cell IL-2 Production in Response to Costimulation by Porcine or Human Cells
Stimulation IL-2 production (pg/ml) μg/ml Jurkat + Jurkat + Jurkat spB7-l PAEC Raji alone
PHA 1881.6 1116.0 142.7
0.1 1226.8 1161.4 116.6
0.2 1279.9 925.6 149.9
0.4 1053.2 1 142.7 136.4
0.8 852.7 91 1.4 1 16.6
1.6 960.0 666.7 1 13.1
3.2 706.0 593.8 130.1
6.3 531.6 JC .J 118.4
12.5 544.2 204.9 122.9
25 328.3 129.3 105.9
50 248.3 97.3 94.2
100 210.5 55.5 52.8
PHA + CTLA-4Ig* — 394.0 109.7 69.0
" + p-selectin""1 < 1096.1 984.3 68.9
* CTLA-4Ig was added at 50 μg/ml ** p-selectin was added at 100 μg/ml
Example IX
Effect of sB7-l on human allogeneic and xeno geneic Mixed Lymphocyte Reactions (MLR) Although inhibition of activation by sB7-l was readily observed under conditions where only the B7 target ligand CD28 was expressed (e.g. in the Jurkat costimulation assay), it was important to determine the potential effect of the molecule on T cell activation in a MLR under conditions in which both CD28 and CTLA-4 molecules were present. To this end, short-term primary human allogeneic and xenogeneic MLRs were established by coculturing human PBL with mitomycin-C treated porcine (Figure 3A) or human (Figure 3B) PBL, respectively. MLRs were performed in the presence of increasing amounts of sB7-l, an irrelevant histidine tagged protein or CTLA-4Ig. Cells were maintained for 4-5 days at 37°C in 5% C02 in air. [Ηjthymidine (1.0 μCi/well; commercially available from NEN Dupont, Boston. MA) was added to the cell cultures during the last 16-18 h of the incubation. The cells were harvested onto glass fiber filters with an automated sample harvester (Wallac; Turku, Finland) and the filters counted in a beta liquid scintillation counter. Results were expressed as mean counts per minute (cpm) of triplicate cultures. The addition of sB7-l at high concentrations (25-100 μg/ml) inhibited both allogeneic- and xenogeneic-stimulated T cell proliferation (Figures 3A and 3B). Addition of murine CTLA-4Ig at concentrations of 100 μg/ml effectively inhibited cell proliferation in both assays, while addition of porcine P-selectin-His made at Alexion (lOOug/ml) had no effect on cell proliferation. These results indicate that binding of porcine sB7-l to CD28 and/or CTLA-4 ligands on human T cells inhibits their activation by allogeneic or xenogeneic stimulation in a concentration-dependent manner. sB7-l may thus represent a regulatory component of the immune system that heretofore has not been described.
Example X
Effect of anti-porcine B7-1 hybridoma supernatants on B7-1 interactions with human CD28 and CTLA-4
To assess the ability of hybridoma supernatants containing anti-porcine B7-1 mAbs to block the binding of B7-1 to its human counterpart ligand CTLA-4, a blocking ELISA was performed. The wells of 96 well plates were coated overnight at 4°C with sB7-l-His at 2 μg/ml. Plates were washed 3x with PBS containing 0.5% Tween-20 before blocking with PBS with 0.05% Tween-20 for 1 h at 37°C. Plates were again washed 3x. Hybridoma supernatants (generated at Cocalico Inc., Reamstown, PA) were diluted 1 :2 with 4μg/ml human CTLA-4-Ig-biotin (commercially available from Ancell, Bayport, MN), at 4 μg/ml and added to the wells for 1 h at 37°C. Plates were washed 3x before the addition of streptavidin-horseradish peroxidase (commercially available from Pharmingen, San Diego, CA) at a 1 :1000 dilution. Finally, plates were washed 3x, developed with O-phenylenediamine dihydrochloride (commercially available from Sigma, St. Louis), MO, for 30 min and the optical density (OD) was determined on a microplate reader (model 3550-UV; commercially available from Bio-Rad, Hercules, CA) at 490 nm. The majority of supernatants bound to B7-1 on the plate, generating OD readings of between 1.7 and 2.8 (Figure 4; N=16). However, three supernatants gave OD readings significantly lower (Figure 4; 2E4, 2F4 and 13B9). In addition, several supernatants augmented the binding of CTLA-4-Ig to B7-1 (Figure 4; 3H8, 3A1 1, 9A6, A3 and 2C4). These results demonstrate that porcine B7-1 binds human CTLA-4-Ig and that supernatants containing anti-B7-l antibodies can block or augment this interaction.
To determine if anti-B7-l hybridoma supernatants can also inhibit or augment the binding of porcine B7-1 to human CD28. a blocking assay was performed. Human Jurkat cells that are known to express CD28 but not CTLA-4 were incubated with sB7-l in the presence of hybridoma supernatants. First. sB7-l (2.5 μg/ml) was preincubated in HBSS containing either human CTLA-4Ig (20 μg/ml) or various anti-B7-l hybridoma supernatants (neat) or buffer alone before addition to Jurkat cells (2.5 x 10D cells/reaction) for an additional incubation. Cells were then incubated with rabbit anti-porcine-B7-l- IgG (10 μg/ml), washed in HBSS and finally incubated in FITC-conjugated goat anti- rabbit Ab (1 :100 dilution). All incubations were performed for 30 min at 4°C. Jurkat/sB7-l binding was detected by Immunofluorescence and flow cytometry as described in Example VI.
Most supernatants did not affect the binding of sB7-l to CD28 (Figure 5). However hybridoma supernatants 3B9 and 2E4 reduced the binding of sB7-l to CD28 to a level equivalent to that observed with CTLA-4Ig. Conversely, 9A6, 3H8, 3A1 1 and 2C4 hybridoma supernatants augmented B7-1 binding to CD28. These data show that porcine B7-1 binds human CD28 and that anti-B7-l hybridoma supernatants can block or augment this interaction. 13B9 was subsequently subcloned and analyzed in the same assay at increasing concentrations. At a concentration of 10 μg/ml of purified mAb, 13B9 completely blocked the interaction between porcine sB7-l and human CD28.
Example XI
Effect of anti-porcine B7-1 and B7-2 mAbs on human xenogeneic MLRs
Short-term primary human xenogeneic MLRs (as described in Example IX) were performed to assess the ability of anti-porcine-B7-l and B7-2 mAbs to block human T cell activation to response to by porcine stimulator cells. Human PBL were incubated with mitomycin-C treated porcine PBL and human T cell activation was determined. MLRs were performed in the presence of increasing amounts of anti-B7-l, anti-B7-2 or a combination of the two antibodies and responder cell proliferation was assessed on day 4- 5 of culture. The effect of an isotype matched murine mAb or CTLA-4-Ig on T cell activation was also measured. At the highest concentration (100 μg/ml), the addition of anti-B7-l inhibited T cell activation by approximately 50% (Figure 6). Anti-B7-2 mAb inhibited T cell activation by approximately 75% at all concentrations tested (12.5-100 μg/ml). Addition of both antibodies simultaneously was most effective at inhibiting T cell activation as approximately 95% of thymidine incorporation was blocked at all concentrations tested. Addition of murine CTLA-4Ig at a concentration of 100 μg/ml also effectively inhibited cell proliferation while an isotype matched mAb had no effect in the assay. These results indicate that both anti-porcine B7-1 and B7-2 mAbs effectively inhibit a human T cell response to porcine stimulator cells, with a combination of the two antibodies as the most effective treatment. References
The following references are incorporated herein by reference to more fully describe the state of the art. All patent and literature references cited in the present specification are hereby incorporated by reference.
1. Mueller, D. L.. M. K. Jenkins, and R. H. Schwartz. 1989. Clonal expansion versus functional inactivation: a costimulatory signaling pathway determines the outcome of T cell antigen receptor occupancy. Annu. Rev. Immunol. 7:445.
2. Linsley, P. S., W. Brady, L. Grosmaire, A. Aruffo, N. K. Damle, and J. A. Ledbetter. 1991. Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation. J. Exp. Med. 173:721.
3. Freeman, G. J., J. G. Gribben, V. A. Boussiotis, J. W. Ng, V. A. Restivo, L. A. Lombard, G. S. Gray, and L. M. Nadler. 1993. Cloning of B7-2: a CTLA-4 counter- receptor that costimulates human T cell proliferation. Science 262:909.
4. Harding, F. A., J. G. McArthur, J. A. Gross, D. H. Raulet, and J. P. Allison. 1992. CD28-mediated signaling co-stimultes murine T cells and prevents induction of anergy in T cell clones. Nature 356:607.
5. Gimmi, C. D., G. J. Freeman, J. G. Gribben, G. S. Gray, and L. M. Nadler. 1993. Human T-cell clonal anergy is induced by antigen presentation in the absence of B7 costimulation. Proc. Natl. Acad. Sci. USA 90:6586.
6. Freeman, G. J., A. S. Freedman, J. M. Segil, G. Lee, J. F. Whitman, and L. M. Nadler. 1989. B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells. J. Immunol. 143:2714.
7. Azuma, M., M. Cayabyab, D. Buck, J. H. Phillips, and L. L. Lanier. 1992. CD28 interaction with B7 co-stimulates primary allogeneic proliferative responses and cytotoxicity mediated by small, resting T lymphocytes. J. Exp. Med. 175:353.
8. Kearney, E. R., T. L. Walunas, R. W. Karr, P. A. Morton, D. Y. Loh, J. A. Bluestone, and M. K. Jenkins. 1995. Antigen-dependent clonal expansion of a trace population of antigen-specific CD4+ T cells in vivo is dependent on CD28 costimulation and inhibited by CTLA-4. J. Immunol. 155:1032.
9. Krummel, M. F. and J. P. Allison. 1995. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J. Exp. Med. 182:459.
10. Walunas, T. L., C. Y. Bakker, and J. A. Bluestone. 1996. CTLA-4 ligation blocks CD28-dependent T cell activation. J. Exp. Med. 183:2541.
11. Davis, T. A., N. Craighead, A. J. Williams, A. Scadron, C. H. June, and K. P. Lee. 1996. Primary porcine endothelial cells express membrane-bound B7-2 (CD86) and a soluble factor that co-stimulate cyclosporin A-resistant and CD28-dependent human T cell proliferation. Int. Immunol. 8:1099.
12. McHugh, R. S., W. D. Ratnoff, R. Gilmartin. K. W. Sell, and P. Selvaraj. 1998. Detection of a soluble form of B7-1 (CD80) in synovial fluid from patients with arthritis using monoclonal antibodies against distinct epitopes of human B7-1. Clin. Immunol. Immunopathol. 87:50. 13. Borriello. F.. J. Oliveros, G. J. Freeman. L. M. Nadler, and A. H. Sharpe. 1995. Differential expression of alternate mB7-2 transcripts. J. Immunol. 155:5490.
14. Inobe, M., P. S. Linsley, J. A. Ledbetter, Y. Nagai. M. Tamakoshi. and T. Uede.
1994. Identification of an alternatively spliced form of the murine homologue of B7. Biochem. Biophys. Res. Commun. 200:443.
15. Selvakumar, A., B. K. Mohanraj, R. L. Eddy, T. B. Shows. P. C. White, and B. Dupont. 1992. Genomic organization and chromosomal location of the human gene encoding the B-lymphocyte activation antigen B7. Immunogenetics 36:175.
16. Selvakumar, A., P. C. White, and B. Dupont. 1993. Genomic organization of the mouse B-lymphocyte activation antigen B7. Immunogenetics 38:292.
17. Borriello, F., G. J. Freeman, S. Edelhoff, C. M. Disteche, L. M. Nadler, and A. H. Sharpe. 1994. Characterization of the murine B7-1 genomic locus reveals an additional exon encoding an alternative cytoplasmic domain and a chromosomal location of chromosome 16, band B5. J. Immunol. 153:5038.
18. Chomczynski, P. and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocvanate-phenol-chloroform extraction. Analytical Biochemistry 162:156.
19. Evans, M. J., S. L. Hartman, D. W. Wolff, S. A. Rollins, and S. P. Squinto. 1995. Rapid expression of an anti-human C5 chimeric Fab utilizing a vector that replicates in COS and 293 cells. J. Immunol. Meth. 184:123.
20. Mueller, J. P., M. J. Evans, R. Cofiell, R. P. Rother, L. A. Matis, and E. A. Elliot.
1995. Porcine vascular cell adhesion molecule (VCAM) mediates endothelial cell adhesion to human T cells. Transplantation 60:1299.
21. Murray, A. G., M. M. Khodadoust, J. S. Pober, and A. L. M. Bothwell. 1994. Porcine aortic endothelial cells activate human T cells: direct presentation of MHC antigens and costimulation by ligands for human CD2 and CD28. Immunity 1 :57.
22. Rollins, S. A., S. P. Kennedy, A. J. Chodera, E. A. Elliott, G. B. Zavoico, and L. A. Matis. 1994. Evidence that activation of human T cells by porcine endothelium involves direct recognition of porcine SLA and costimulation bv porcine ligands for LFA-1 and CD2. Transplantation 57:1709.
23. Lenschow, D. J., G. H.-T. Su, L. A. Zuckerman. N. Nabavi, C. L. Jellis, G. S. Gray, J. Miller, and J. A. Bluestone. 1993. Expression and functional significance of an additional ligand for CTLA-4. Proc. Natl. Acad. Sci. USA 90:1 1054.
24. Chen, C. and N. Nabavi. 1994. In vitro induction of T cell anergy by blocking B7 and early T cell costimulatory molecule ETC-1/B7-2. Immunity 1 :147.
25. Lenschow, D. J., Y. Zeng, K. S. Hathcock, L. A. Zuckerman, G. J. Freeman. J. R. Thistlethwaite, G. S. Gray, R. J. Hodes, and J. A. Bluestone. 1995. Inhibition of transplant rejection following treatment with anti-B7-2 and anti-B7-l antibodies. Transplantation 60: 1171. 26. Maher. S. E., K. Karmann, W. Min, C. C. W. Hughes. J. S. Pober. and A. L. M. Bothwell. 1996. Porcine endothelial CD86 is a major costimulator of xenogeneic human T cells. J. Immunol. 157:3838.
27. Freeman, G. J., G. S. Gray, C. D. Gimmi. D. B. Lombard, L. J. Zhou, M. White, J. D. Fingeroth. J. G. Gribben, and L. M. Nadler. 1991. Structure, expression, and T-cell costimulatorv activity of murine homologue of human B lymphocvte activation anti sen B7. J. Exp. Med. 174:625.
28. Judge, T. A., M. Liu, P. J. Christensen, J. J. Jak, and L. A. Turka. 1995. Cloning the rat homolog of the CD28/CTLA-4-ligand B7-1: structural and functional analysis. Int. Immunol. 7:171.
29. Guo, Y.. Y. Wu. M. Zhao, X.-P. Kong, and Y. Liu. 1995. Mutational analysis and an alternatively spliced product of B7 defines its CD28/CTLA-4-binding site on immunoglobulin C-like domain. J. Exp. Med. 181 :1345.
30. Lenschow, D. J., T. L. Walunas, and J. A. Bluestone. 1996. CD28/B7 system of T cell costimulation. Clin. Immunol. Immunopathol. 14:233.
31. Rollins, S. A., M. J. Evans, K. K. Johnson, E. A. Elliot, S. P. Squinto, L. A. Matis, and R. P. Rother. 1994. Molecular and functional analysis of porcine E-selectin reveals a potential role in xenograft rejection. Biochem. Biophys. Res. Commun. 204:763.
32. Freeman, G. J., D. B. Lombard, C. D. Gimmi, S. A. Brod, K. Lee, J. C. Laning, D. A. Hafler, M. E. Dorf, G. S. Gray, H. Reiser, C. H. June, C. B. Thompson, and L. M. Nadler. 1992. CTLA-4 and CD28 mRNA are coexpressed in most T cells after activation: expression of CTLA-4 and CD28 mRNA does not correlate with the pattern of lymphokine production. J. Immunol. 149:3795.
33. Williams. T. M., D. M. Moolten, H. Makni, H. W. Kim, J. A. Kant, and M. Kamoun. 1992. CD28-stimulated IL-2 gene expression in Jurkat T cells occurs in part transcriptionally and is cyclosporine-A sensitive. J. Exp. Med. 148:2609.
34. Yamashita, K., C. R. Parish, H. S. Warren, and L. C. Harrison. 1997. A multimeric form of soluble recombinant sheep LFA-3 (CD58) inhibits human T-cell proliferation. Immunology 92:39.
35. Meager, A., C. Bird, and A. Mire-Sluis. 1996. Assays for measuring soluble cellular adhesion molecules and soluble cytokine receptors. J. Immunol. Meth. 191 :97.
36. Rose- John, S. and P. C. Heinrich. 1994. Soluble receptors for cytokines and growth factors: generation and biological function. Biochem. J. 300:281.
37. Inobe, M., N. Aoki, P. Linsley, J. A. Ledbetter, R. Abe. M. Murakami, and T. Uede. 1996. The role of the B7- la molecule, an alternatively spliced form of murine B7-1 (CD80), on T cell activation. J. Immunol. 157:582.
38. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Construction and Analysis of cDNA Libraries. In Molecular Cloning: A Laboratory Manual, second ed. AnonymousCold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, p. 1. 39. van der Merwe, P. A., D. L. Bodian, S. Dainke, P. Linsley, and S. J. Davis. 1997. CD80 (B7-1) binds both CD28 and CTLA-4 with low affinity and verv fast kinetics. J. Exp. Med. 185:393.
40. Gerstmayer, B., U. Pessara, and W. Wels. 1997. Construction and expression in the yeast Pichia pastoris of functionally active soluble forms of the human costimulatory molecules B7-1 and B7-2 and the B7 counter-receptor CTLA-4. FEBS Lett. 407:63.
41. Linsley, P. S., W. Brady, M. Urnes, L. S. Grosmaire, N. K. Damle, and J. A. Ledbetter. 1991. CTLA-4 is a second receptor for the B cell activation antigen B7. J. Exp. Med. 174:561.
42. Boise, L. H., A. J. Minn, P. J. Noel, C. H. June, M. A. Accavitti, T. Lindsten, and C. B. Thompson. 1995. CD28 costimulation can promote T cell survival by enhancing the expression of Bcl-XL. Immunity 3:87.
43. Matis, L. A., E. A. Elliott, M. J. Evans, J. P. Mueller, S. A. Rollins, R. P. Rother, and M.-C. Shanafelt. 1995. The molecular basis of human anti-porcine cellular interactions. Xeno 3:1.
44. Freeman, G. J., F. Borriello, R. J. Hodes, H. Reiser, K. S. Hathcock, G. Laszlo, A. J. McKnight, J. Kim, L. Du, D. B. Lombard, G. S. Gray, L. M. Nadler, and A. H. Sharpe. 1993. Uncovering of functional alternative CTLA-4 counter-receptor in B7-deficient mice. Science 262:907.
It will be understood that various modifications may be made to the embodiments disclosed herein. For example, the nucleotide sequences cf the porcine B7-1 protein-encoding nucleic acid molecules may be modified by creating nucleic acid mutations which include third nucleotide changes in degenerate codcns (and other "silent" mutations that do not change the encoded amiπc acid sequence) . Also contemplated are nucleotide and amino acid sequences encoding naturally occurring allelic variants of the porcine B7-1 protein genes; sequences which have been truncated so as to only encode the mature porcine B7-1 protein pcIypeptides, (i.e., a porcine B7-1 polypeptide without the amino terminal leader sequence that directs the protein to its typical transmembrane orientation in the cell); sequences in which the B7-1 protein amino terminal leader sequences have been altered (e.g., substituted with a different leader sequence); sequences in which a peptide "tag" sequence has been inserted or added on to enable the ready identification and/or purification of recombinant proteins (such as the FLAG epitope (which enables specific binding to anti-FLAG antibodies) or a histidine tag sequence) ; and sequences that have been altered to produce a soluble porcine B7-1 protein by, for example, truncation. Mutations which result in a highly conservative or silent amino acid substitution for an encoded amino acid while leaving the leucocyte binding (or other cell binding) characteristics cf the porcine B7-1 proteins essentially unchanged are also within the scope of disclosure and considered as equivalents of the specific embodiments set forth herein. Therefore, the above description should not be construed as limiting, but merely as exemplifications of preferred embodiments. Those skilled in the art will envision other modifications within the scope of the claims appended hereto.

Claims

WHAT IS CLAIMED IS:
1) A composition comprising isolated porcine 37-1 proteins having at least 80% amino acid sequence identity to a porcine 3~-l protein sequence.
2) A composition comprising a nucleic acid sequence having at least 80% sequence identity to a molecule encoding a porcine 37-1 protein, which includes allelic variants of said protein
3) A composition according to claim 2, wherein the nucleic acid sequence is cDNA.
4) A composition according to claim 3, wherein the cDNA comprises a nucleic acid sequence shown in Figure 8.
5) A vector comprising the nucleic acid sequence of claim 3.
6) A host cell comprising the vector of claim 5.
7) The host cell of claim 6, wherein the host cell is selected from the group essentially consisting of CHO cells, E. S.C.CoIi., and yeast, COS cells of L cells, C127 mammary epithelial cells, Balb/3T3 cells, 293 EBNA, HeLa cells, myelomas, BHK cells, picia, tobbacco.
8) A composition according to claim 1 comprising a transmembrane and cytoplasmic domain deleted variant.
9) A composition according to claim 8 comprising the nucleic acid sequence of Figure 7.
10) A vector comprising the nucleic acid sequence of claim 9.
11) A host cell comprising the vector of claim 10.
12) The host cell of claim 11, wherein the host cell is selected from the group essentially consisting of CHO ceils, Ξ. Coli., and yeast cells, COS cells of monkey kidney origin, mouse I cells, murine C127 mammary epithelial cells, murine Balb/3T3 cells, human 293 EBNA, HeLa cells, myelomas, and BHK cells.
13) An antibody which binds to porcine B7-1. 14) The antibody of ciain 13, wnerem tne antiooαy is se_ecteα from the group consisting essentially of monoclonal antiboαies, polyclonal antibodies, humanized antiboαies, bispecific antibodies, heteroconjugate antibodies, and fragments thereof.
15) The antioody of claim 14, wnerem the humanizeα antiboαy is selected from the group consisting of chimeric antioodies and CDR grafted antibodies .
16) Tne antioody of claim 13, wnerem the ant_ooαy binds to porcine B7-1, but not to numan 37-1.
17) The antibody of claim 16, wherein the antiooαy is selected from the group consisting essentially of a monoclonal antibodies, polyclonal antibodies, humanizeα antibodies, bispecific antibodies, heteroconjugate antibodies, and fragments thereof.
18) The antibody of claim 17, wherein the humanized antibody is selected from the group consisting of chimeric antibodies and CDR grafted antibodies .
19) Agents for the diagnosis of porcine xenograft rejection based upon the anti-porcme antibodies of claim 13.
20) Porcine cells characterized by the absence of B7-1 molecules.
21) Porcine tissues characterized by the absence of B7-1 molecules .
22) Porcine whole organs characterized by the absence of 37-1 molecules .
22) A therapeutic agent, for their use for tne prevention and/or treatment of a member of the group selected from porcine xenograft rejection and inflammatory disease, comprising a member selected from the group consisitmg of the porcine B7-1 protein of claim 1 and the antibody of claim 13.
23) The therapeutic agent of claim 22, further comprising anti- porcme B7-2 antibodies.
24) The therapeutic agent of claim 22 wherein the antibody is a humanized antibody.
25) A method for treating a member of the group selected from porcine xenograft rejection and inflammatory disease comprising administering to a patient in need of such treatment a therapeutically effective amount of a molecule that binds to the B7-1 antigen and an immunosuppressive agent.
26) The method of claim 25 wherein the molecule that binds to the E7-1 antigen is an antibody which binds to porcine 37-1.
27) The antibody of claim 26, wherein the antibody is selected from the group consisting essentially of a monoclonal antibodies, polyclonal antibodies, humanized antibodies, bispecific antibodies, heteroconjugate antibodies, and fragments thereof.
28) The antibody of claim 27, wherein the humanized antibody is selected from the group consisting of chimeric antibodies and CDR grafted antibodies .
29) The antibody of claim 28, wherein the antibody binds to porcine B7-1, but not to human B7-1.
30) The method of claim 25, wherein the therapeutic agent is administered by bolus dosage.
31) The method of claim 25, wherein the therapeutic agent is administered intravenously.
32) The method of claim 25, wherein the therapeutic agent is administered via continuous infusion.
33) The method of claim 25, wherein the immunosuppressive agent is selected from the group consisting of cyclosporin A, FK506, rapamycin and a corticosteroid.
34) The method of claim 25 wherein the therapeutic agent is administered in the form of a member selected from the group consisting of microcapsules, liposomes, and sustained-release matrices .
35) The method of claim 34, wherein the microcapsules comprise a member selected from the group consisting of hydroxymethylcellulose or gelatin.
36) The method of claim 34, wherein sustained-release matrices comprise a member selected from the group consisting of polyesters, hydrogels, and injectable microspheres of biodegradeable materials. 37) The method cf claim 25, wherein the therapeutic agent comprises soluble 37-1.
EP00973762A 1999-10-22 2000-10-21 Porcine b7-1 and antibodies thereto Withdrawn EP1140146A4 (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
US16114099P 1999-10-22 1999-10-22
US161140P 1999-10-22
PCT/US2000/029155 WO2001030377A1 (en) 1999-10-22 2000-10-21 Porcine b7-1 and antibodies thereto

Publications (2)

Publication Number Publication Date
EP1140146A1 true EP1140146A1 (en) 2001-10-10
EP1140146A4 EP1140146A4 (en) 2004-10-13

Family

ID=22579983

Family Applications (1)

Application Number Title Priority Date Filing Date
EP00973762A Withdrawn EP1140146A4 (en) 1999-10-22 2000-10-21 Porcine b7-1 and antibodies thereto

Country Status (4)

Country Link
EP (1) EP1140146A4 (en)
AU (1) AU1223401A (en)
CA (1) CA2361637A1 (en)
WO (1) WO2001030377A1 (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11260027B2 (en) 2015-07-29 2022-03-01 Musc Foundation For Research Development Donor organ pre-treatment formulation

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5747034A (en) * 1992-07-09 1998-05-05 Chiron Corporation Methods and materials for the induction of T cell anergy
US5759550A (en) * 1993-05-06 1998-06-02 Pharmagenesis, Inc. Method for suppressing xenograft rejection
US6852847B1 (en) * 1998-03-19 2005-02-08 Heska Corporation Canine and feline B7-2 nucleic acid molecules and uses thereof

Also Published As

Publication number Publication date
CA2361637A1 (en) 2001-05-03
AU1223401A (en) 2001-05-08
WO2001030377A1 (en) 2001-05-03
EP1140146A4 (en) 2004-10-13

Similar Documents

Publication Publication Date Title
JP3833723B2 (en) Immune response modulating composition
EP1073465B1 (en) T cell inhibitory receptor compositions and uses thereof
US7572772B2 (en) Soluble CTLA4 mutant molecules
CA2146895C (en) Ctla4/cd28ig hybrid fusion proteins
US7368535B2 (en) CD200 receptors
US5885579A (en) CTLA4 receptor and uses thereof
US20020151485A1 (en) Methods and compositions for modulating fertility
JP2009060905A (en) B7-2: CTLA4 / CD28 counter receptor
JPH08508719A (en) Treatment of insulin-dependent diabetes
CN101072578A (en) Combination cancer immunotherapy with co-stimulatory molecules
US20080095774A1 (en) Agents and Methods for Specifically Blocking CD28-Mediated Signaling
EP2351840A1 (en) Polypeptides involved in immune response
AU776618B2 (en) Improvement of tolerance to a xenograft
EP1140146A1 (en) Porcine b7-1 and antibodies thereto
Gaglia et al. Characterization of endogenous Chinese hamster ovary cell surface molecules that mediate T cell costimulation
US6841152B1 (en) Methods for protecting against autoimmune diabetes
AU784510B2 (en) Methods for modulating T cell unresponsiveness
CA2276733A1 (en) Methods and compositions for preventing autoimmune disease
HK1160665A (en) Polypeptides involved in immune response
MXPA01006304A (en) Improvement of tolerance to a xenograft
MXPA95001794A (en) Ctla4 molecules and il-4 link molecules and uses of mis
HK1159128A1 (en) Novel polypeptides involved in immune response

Legal Events

Date Code Title Description
PUAI Public reference made under article 153(3) epc to a published international application that has entered the european phase

Free format text: ORIGINAL CODE: 0009012

17P Request for examination filed

Effective date: 20010802

AK Designated contracting states

Kind code of ref document: A1

Designated state(s): AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU MC NL PT SE

AX Request for extension of the european patent

Free format text: AL;LT;LV;MK;RO;SI

RAP1 Party data changed (applicant data changed or rights of an application transferred)

Owner name: ALEXION PHARMACEUTICALS, INC.

A4 Supplementary search report drawn up and despatched

Effective date: 20040827

STAA Information on the status of an ep patent application or granted ep patent

Free format text: STATUS: THE APPLICATION IS DEEMED TO BE WITHDRAWN

18D Application deemed to be withdrawn

Effective date: 20041113