EP1117809A1 - Nucleic acid constructs for the modification of polyamine levels in plants - Google Patents

Abstract

The invention provides a nucleic acid construct for transforming a plant cell, the construct comprising a promoter operatively linked to a nucleotide sequence, the promoter being selectively activated in cells of propagating material for a plant, the nucleotide sequence being such that its transcription leads to an alteration in the levels of polyamines produced in transformed cells of propagating material relative to untransformed cells.

Description

NUCLEIC ACID CONSTRUCTS FOR THE MODIFICATION OF POLYAMINE

LEVELS IN PLANTS

FIELD OF THE INVENTION The present invention relates to modified plant propagating material, particularly modified via the manipulation of polyamine biosynthesis within the propagating material. The present invention further relates to novel nucleic acid constructs and to foods comprising the modified plant propagating material for nutritional or medicinal purposes.

BACKGROUND TO THE INVENTION

The natural polyamines spermidine (Spd) and spermine (Spm) are essential for cell growth and proliferation through their involvement in DNA, RNA and protein synthesis. They are also mediators of growth factors and hormones, and it is now known that large amounts of these polyamines are required during the development and growth of tumours. In mammals, putrescine, spermidine and spermine are the most abundant polyamines but agmatine and cadaverine can be formed in some tissues.

The biosynthetic pathways for polyamines are well established in many organisms. A schematic pathway for the biosynthesis of polyamines is shown in Figure 1. The key enzymes in polyamine biosynthesis are arginine decarboxylase (ADC) and ornithine decarboxylase (ODC. ADC catalyses the decarboxylation of L-arginine to the diamine putrescine, via agmatine and N-carbamoylputrescine. This is one of the two main pathways of putrescine synthesis in plants and some bacteria, in contrast to the pathway in animals and most fungi in which the sole route to putrescine biosynthsesis is the direct decarboxylation of L-ornithine in a reaction catalysed by ODC. The biosynthesis of spermidine and spermine is carried out by the addition of an aminopropyl group to one or both of primary amino groups of putrescine by spermidine and spermine synthases, respectively. This aminopropyl group is derived from methionine, which is first converted into S-adenosylmethionine (SAM) catalysed by SAM synthetase, and decarboxylated in a reaction catalysed by SAM decarboxylase (SAMDC).

Inhibitors of the enzymes involved in polyamine biosynthesis are known. Thus, for example, the enzymes ADC and ODC can be inhibited by the irreversible inhibitors DL-α-difluoromethylarginine (DFMA) and DL-α-difluoromethyloraithine (DFMO) respectively. Methylglyoxal-ό/s-guanyl hydrazone (MGBG) and cyclohexyl amine are reversible inhibitors of SAMDC and spermidine synthase activities, respectively.

Since all cells can synthesise polyamines, it was originally believed that they are produced in situ according to need. However, it now appears that the body also relies on a continuous supply of polyamines from food, most of which are not retained by the gut tissues but become distributed in different organs of the body. Thus, the polyamine requirement that cannot be met by biosynthesis has to be satisfied by exogenous polyamines derived from food.

An aim of many known anti-cancer strategies has been to interfere with de novo polyamine synthesis. A large number of inhibitors, for example DFMO, have been tested in experimental animal systems. This approach has been essentially unsuccessful, however, because the contribution of polyamines provided by the diet was not recognised. Tumour development is especially dependent on a sufficient and continuous dietary supply of polyamines. Traditional foods based on animal products (such as meat, fish, dairy products and eggs), cereals, legumes and other crop plants provide extremely high levels of these molecules. Although a diet rich in polyamines is of obvious importance for babies, young individuals and healthy adults, it will not be beneficial for patients suffering from cancer.

Studies on the biosynthesis of polyamines in several mammalian systems have led to two important observations. Firstly, in any tissue undergoing a marked change in its growth rate, particularly during tumour formation, there is an increase in polyamine levels, mostly in spermidine (Spd) content. Secondly, slowly growing or non-proliferating cells have a lower spermidine to spermine ratio than do rapidly growing cells.

As large amounts of polyamines, viz. spermidine and spermine, are required for cancer growth, specific population groups such as patients suffering from cancer (and other diseases, for example psoriasis, ulcerative colitis, irritable bowel syndrome, and diamine/polyamine oxidase deficiency, involving undesirable cell growth), would benefit from minimising the intake of spermidine and spermine to slow down the growth and progression of the tumour or of the disease. In contrast, during periods where intensive growth is required, such as normal healing, post-operational recovery, liver regeneration, kidney hypertrophy, compensatory growth of the lung or gut and for supporting growth in babies and young children, dietary spermidine and spermine have a major role to play.

Various attempts have been made to bring about physiological or therapeutic effects by modifying dietary polyamine intake.

Thus, for example, Japanese Patent No. 10262607 discloses a nutritional composition for babies and children containing, inter alia, polyamines particularly spermine, spermidine, putrescine and/or cadaverine which stimulates maturation of the digestive tract.

WO 98/32428 discloses a composition containing compounds associated with the synthesis of polyamines, for example L-arginine, for treating endotoxic shock and/or mortality, for example in patients undergoing major surgery, burn patients, patients suffering from acute trauma, and patients with acute liver disease.

European Patent Application EP-A-641562 discloses a nutritional supplement containing a compound associated with polyamine synthesis, for example arginine, which is useful for stimulating the immune system of patients suffering from HIV-related infection.

US Patent No. 5162373 discloses a formulation comprising a growth promoting concentration of ornithine in a diluent containing thiamine which is stated to be suitable for preventing gut atrophy and useful in the detection of recurrent malignant disease in patients. Such formulations are disclosed as stimulating tumour-specific polyamine production to a greater extent than non-tumour related polyamine production.

Compositions containing inhibitors of inter alia polyamine synthesis for use in foods, food supplements, medicaments or dietetic foods for treating cancer, such as prostate cancer, or for use as an immuno-stimulant, for example by stimulating natural killer cell activity, are disclosed in WO 95/00041.

Moreover, US Patent 4988724 discloses amino acid formulations particularly arginine-free formulations for preventing stimulation of tumour growth. Since plant-based foods can form 80-90% of the human diet and contain relatively large amounts of polyamines, plants are a major contributor of polyamines to the body pool. Many genes encoding the enzymes of the polyamine biosynthetic pathway in plants have been isolated, and modification of the levels of polyamines in plants has been achieved by over-expressing or down-regulating one or more of these genes in plants.

For example, inducible over-expression of the oat arginine decarboxylase (ADC) gene and resultant changes in polyamine levels have been achieved in transgenic tobacco plants (Masgrau et al, The Plant Journal, 1997, 1 1(3), 465-473). In this publication, the authors report phenotypic changes to the transgenic plants as a result of the higher levels of endogenous putrescine which are believed to be toxic for the vegetative growth of the plant. Moreover, over-expression of the oat ADC in transgenic rice has been reported to affect normal developmental patterns in vitro, and this is believed to be as a result of putrescine accumulation in the transgenic plants (Capell et al, Theoretical Applied Genetics, 1998, 97, 246-254).

Kumar et al, Plant Journal, 1996, 9, 147-158 used sense and anti-sense constructs containing the potato SAMDC cDNA to produce transgenic potato plants. However, over- expression of the SAMDC sense construct was lethal to the plants. Moreover, anti-sense transgenic plants showed a range of stunted phenotypes types as well as other morphologically abnormal phenotypes.

Thus, the aforementioned references demonstrate that over-expression of polyamine biosynthetic genes in plants using either constitutive or inducible promoters has resulted in altered phenotypes of the plants, often with undesirable consequences.

Where inducible promoters were used, the altered phenotypes were found to correlate in general with changes in polyamine levels (Masgrau et al, The Plant Journal, 1997, 1 1(3), 465-473).

Pedros et al. Planta (1999), 209: 153-160 disclose the manipulation of S- adenosylmethionine decarboxylase (SAMDC) activity in potato tubers and report that an increase in SAMDC activity leads to an increase in tuber number and a change in tuber size distribution. However, although polyamine levels were modified in developing tubers, the mature tuber did not show any appreciable changes in polyamine levels. SUMMARY OF THE INVENTION

The present invention sets out to provide a means of varying polyamine levels in edible plant materials, particularly cereals, whilst avoiding the problem of adverse phenotypic changes often associated with changes in the polyamine biosynthetic pathway.

The solution offered by the present invention is to manipulate the levels of polyamines in plants through transgenics by directing expression of the polyamine biosynthesis genes selectively to the propagating material of the plants. In this way, polyamine levels are altered within that part of the plant that serves as a foodstuff, but not to any great extent, if at all, within the other non-food parts of the plant.

Accordingly, in a first aspect of the present invention, there is provided a nucleic acid construct for transforming a plant cell, the construct comprising a promoter operatively linked to a nucleotide sequence, the promoter being selectively activated in cells of propagating material for a plant, the nucleotide sequence being such that its transcription leads to an alteration in the levels of polyamines produced in transformed cells of propagating material relative to untransformed cells.

The term 'propagating material' as used herein refers to the reproductive material of the plant, for example fruits, seeds, tubers and grains. Preferably, the propagating material of the present invention consists of seeds or grains, or parts thereof. The propagating material is typically a mature propagating material, i.e. a material which has completed its development and is capable of germination to produce new individuals.

The cultivated plants of the invention are suitably plants which are commercially important for food production, for example cereals including wheat, rice, barley, maize and oats. In addition, the cultivated plants of the present invention are preferably plants such as wheat wherein there exists little variation in polyamine content between varieties prior to transformation. For example, the polyamine content may differ by less than 50%, e.g. less than 40%, or less than 30%, or less than 20%, or less than 10%, or less than 5% between varieties.

In one embodiment, the cultivated plants are monocotyledons. In a preferred embodiment of the invention, the cultivated plants are wheat and the propagating material is wheat grain or parts thereof. Where the plant is wheat, it can be tetraploid or hexaploid, for example, and preferably is hexaploid.

The term 'promoter' as used herein refers to a transcription regulatory element. The promoters used in the nucleic acid molecules or constructs of the invention are those which direct gene expression selectively (and preferably solely) in the propagating material of plants. The nucleotide sequence of the promoter is provided upstream or 5' of the sequence encoding a protein involved in polyamine biosynthesis.

Without wishing to be bound by any theory, it is considered that the basis of the contrast in spatial expression of many seed storage protein genes at very high levels in seed tissues and their complete silence in vegetative tissues lies in the transcriptional regulation of these genes. Intrinsic to gene expression is the establishment of the transcription complex. Promoters for seed protein genes are typically highly seed- specific, and multiple transcription factors in the seed are believed to contribute to the overall regulation of gene expression by the promoter. Several tissue specific transcription factors are known to interact in various combinations to occupy binding sites on the promoter during transcription activation.

The sequences of many seed or seed-tissue specific promoters are known and such promoters typically contain motifs corresponding to both tissue-specific and tissue nonspecific transcription factor binding sites which interact with suitable transcription factors during assembly of the basal transcription complex.

It is known that seed specific promoters can interact productively with general transcription factors in vegetative tissues when supplied as naked DNA, and therefore the factors which determine spatial regulation of gene expression are unclear. It is believed, again without wishing to be bound by any theory, that the chromatin structure of the promoter is important in transcriptional regulation of gene expression as demonstrated for the promoter for the phaseolin gene encoding the major storage protein of bean (Phaseolus vulgaris) (Hall et al, Journal of Plant Physiology, 1998, 152, 614-620). The model proposed by the authors suggests that once the chromatin structure of the promoter is relaxed, transcription factors can gain access to the promoter in order to activate transcription.

The present invention relates to promoters which ensure gene expression selectively in the propagating material for cultivated plants. In this context, the promoter may contain tissue-specific and tissue non-specific transcription factor binding sites.

Moreover, the promoter may demonstrate a degree of tissue specificity, for example the promoter may be highly seed-selective. In a preferred aspect of the invention the promoter is seed-specific.

The promoters used in the nucleic acid molecules or constructs of the invention can be promoters which ensure gene expression selectively in the cells of one or more tissues or compartments of the propagating material, for example the embryo or endosperm. In a preferred aspect of the present invention the promoter is endosperm- selective and preferably endosperm-specific.

For seed-specific gene expression, examples of promoters include the promoters from seed protein genes including the zein genes of maize, the legume globulin promoters of for example pea, the prolamin gene promoters of for example wheat and maize, and the phaseolin promoter. The details of such promoters are disclosed in, for example, Seed Proteins, Eds Casey and Shewry, P. R Kluwer Academic Press, pp.229-261; Forde et al.,

Nucleic Acids Research, 1985, 13, 7327-7339; Quayle and Faix, Molecular and General Genetics, 1992, 231, 369-374.

For endosperm-specific expression, examples of promoters include the promoters of several gliadin and hordein genes (Forde et al., Nucleic Acids Research, 1985, 13,

7327-7339) and the promoters of storage protein genes from a wide range of other species, including some zein genes (Quayle and Faix, Molecular and General Genetics, 1992, 231, 369-374) all of which contain the conserved sequence known as the prolamin box or endosperm element. The endosperm element is a regulatory sequence which is known to confer endosperm-specific gene expression. The prolamin box is approximately 30 base pairs long, is generally positioned around 300 base pairs upstream of the transcription start site and has the consensus sequence: 5'-TGACATGTAAAGTGAATAAGATGAGTCATG (SEQ. ID. NO. 1). The prolamin box contains the conserved endosperm motif, or E-motif, TGTAAAGT (SEQ. ID. NO. 2) (Hammond-Kosack et al, The EMBO Journal, 1993, 12,

545-555).

In addition to its tissue-specificity, the promoter of the invention may be selective in such a way that gene expression activated by the promoter takes place constitutiveiy, or at a certain point of time of the plant development, or at a point of time determined by external circumstances (ie the promoter is inducible). Furthermore, with respect to the plant, the promoter may be homologous or heterologous.

The invention further provides nucleic acid molecules or constructs containing promoters which drive endosperm-specific gene expression but which do not contain the prolamin box or a close variant of it. Such promoters may be expressed at higher levels than the above-mentioned seed or seed-tissue specific promoters. Examples of such promoters are the promoters of the high molecular weight (HMW) prolamin genes in wheat (Halford et al., Theoretical and Applied Genetics, 1992, 83, 373-378; Barro et al, Nature Biotechnology, 1997).

The major regulatory element of the HMW prolamin promoters is understood to be a 38 base pair sequence 5'-GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATCCA

GCT (SEQ. ID. NO. 3) identified by Thomas and Flavell, The Plant Cell, 1990, 2, 1 Hil l 80. This sequence is highly conserved in all the HMW prolamin genes characterised so far (Shewry et al., In: Seed Proteins, Kluwer Academic Press, 1999).

In a particular embodiment of the invention, the promoter is a HMW prolamin gene promoter such as the HMW glutenin promoter from wheat. Such promoters in wheat are well characterised with respect to sequence conservation within the enhancer and proximal regulatory elements (Halford et al., Plant Science, 1989, 62, 207-216). A preferred promoter is the 1DX5 promoter of the Glu-lD-1 gene from wheat cv. Cheyenne (Halford et al., Plant Science, 1989, 62, 207-216). A particularly preferred promoter is a promoter which comprises all or part of the nucleotide sequence corresponding to SEQ.ID. NO. 4 and promoters having a nucleotide sequence which is complementary to all or to a part of SEQ. ID. NO. 4. The promoters of the invention preferably effect constitutive expression of a gene encoding a protein involved in polyamine synthesis selectively in the cells of one or more tissues or compartments within the propagating material for cultivated plants. In a preferred embodiment, the propagating material and cultivated plants generated therefrom are preferably wheat grain and wheat plants respectively.

The nucleic acid molecules or constructs of the invention typically are DNA sequences, for example gene sequences or cDNA sequences. The nucleic acid sequences may be isolated from natural sources or synthesised by means of methods known to the skilled person.

The nucleic acid molecules of the invention comprise one or more genes encoding one or more proteins having the biological activity of an enzyme involved in the polyamine biosynthesis pathway. Examples of such enzymes are those having the biological activity of arginine decarboxylase (ADC), ornithine decarboxylase (ODC), spermidine synthase (Spd synthase), spermine synthase (Spm synthase), S- adenosylmethionine synthetase, and S-adenosylmethionine decarboxylase (SAMDC). In a preferred embodiment the gene sequence of the present invention encodes a protein with the biological activity of arginine decarboxylase (ADC). The enzymes can be, or can have protein structures substantially identical to, the native or wild-type enzyme, or can have modified amino-acid sequences, provided of course that they retain the biological activity of the native enzyme.

A particular protein or enzyme is that which is expressed by a gene including the nucleotide sequence depicted under SEQ ID No.5. The invention particularly relates to nucleic acid molecules which comprise all or part of the nucleotide sequence mentioned under SEQ ID No.5

In a further aspect the invention relates to the ribonucleotide sequences corresponding to all or part of the nucleotide sequences of SEQ ID No.4 and SEQ ID

No.5. Nucleic acid molecules comprising genes encoding proteins involved in polyamine synthesis and the sequence of which differs from the nucleotide sequences of the above- mentioned molecules due to the degeneracy of the genetic code are also the subject-matter of the invention. The genome from which the nucleotide sequence encoding a polyamine synthesis enzyme is derived can be, for example, that of any plant such as a vegetable plant, for example a potato or carrot plant, or a cereal plant, for example a wheat, oat, barley or maize plant. In a preferred embodiment the nucleotide sequence is derived from the genome of an oat plant.

The present invention further provides nucleic acid molecules comprising a one or more genes encoding proteins involved in the catabolism or degradation of polyamines.

The nucleic acid molecules of the present invention can comprise a termination sequence which serves to end the transcription correctly and to add a poly-A-tail to the transcript which is believed to stabilise the transcripts. The invention particularly relates to terminator sequences which comprise all or part of the nucleotide sequence mentioned under SEQ ID No.6. The invention also relates to termination sequences having a nucleotide sequence which is complementary to all or to a part of the above-mentioned sequence. The nucleotide sequence of the terminator is provided downstream or 3' of the gene encoding the protein involved in polyamine biosynthesis.

The nucleic acid molecules of the invention typically comprise a promoter as defined above, a gene encoding a protein involved in polyamine biosynthesis as defined above, and a termination sequence. For example, nucleic acid molecules may comprise a seed-tissue specific promoter, for example a HMW prolamin gene promoter, operatively linked to one or more of the genes ADC, ODC, Spd synthase, Spm synthase, SAM synthetase or SAMDC which is operatively linked to a terminator. Specific combinations may include:

(a) HMW prolamin gene promoter, for example, 1 DX5, linked to an ADC gene, linked to a terminator, hereafter abbreviated as promoter: ADC :terminator, or

(b) promoter: ODC :terminator, or (c) promoter: Spd synthase:terminator, or

(d) promoter: Spm synthase:terminator, or

(e) promoter: SAM synthetase:terminator, or

(f) promoter: SAMDC :terminator. The invention relates to nucleic acid constructs which comprise one or more of the nucleotide sequences disclosed in SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6.

In a preferred embodiment of the invention, the nucleic acid molecules comprise nucleic acid sequences comprising all or part of the sequences disclosed in SEQ ID No.4, SEQ ID No.5 and SEQ ID No. 6. In a preferred embodiment the sequences are contained in a construct wherein all or part of the sequence of SEQ ID No. 4 is upstream or 5' from the sequence of SEQ ID No.5 and the sequence of SEQ ID No.6 is downstream or 3' to the sequence of SEQ ID No.5.

The invention provides translatable RNA species, for example messenger RNAs, synthesised during transcription of all or part of the nucleotide sequence of the invention, in the propagating material for a plant.

In a further aspect, the invention provides vectors, especially plasmids, cosmids, bacteriophages, retroviral vectors, intermediate or binary vectors sharing sequence homology to sequences within the T-DNA of Agrobacterium, Agrobacterium vectors and other vectors common in genetic engineering, which contain the above-mentioned nucleotide sequences and nucleic acid molecules and constructs of the invention. In a preferred embodiment, the nucleotide sequences and nucleic acid molecules of the invention are contained in one or more plasmid vectors.

The invention provides one or more gene sequences of the invention contained in a vector which are linked to regulatory elements that ensure the transcription and synthesis of a translatable RNA corresponding to the gene(s) in prokaryotic and eucaryotic cells.

By means of methods known to the skilled person plant cells can be transformed with vectors comprising the nucleic acid molecules of the invention. In order to integrate DNA into plant host cells, a wide range of techniques are available. Examples of such techniques include the transformation of plant cells with T-DNA by using Agrobacterium tumefaciens or Agrobacterium rhizogenes as transformation medium, the fusion of protoplasts, the injection and electroporation of DNA and the integration of DNA by means of the biolistic method. In the case of injection, the biolistic method and electroporation of DNA into plant cells, there are no special demands made to the plasmids used. Simple plasmids such as pUC derivatives may be used. However in the case that whole plants are to be regenerated from cells transformed in such a way, a selectable marker gene should be present.

Electroporation of plant tissue, transformation of protoplasts and DNA transfer by particle bombardment in regenerative tissue and cells are particularly suitable for cereal transformation.

In one preferred embodiment, the method of transformation of the invention is non-biological. An example of a non-biological method is the method of microprojectile bombardment whereby DNA-coated micro-projectiles are shot into plant cells using a microprojectile gun. A system developed by Weeks et al (Plant Physiology, 1993, 102, 1077-1084) constitutes a basis for the transformation experiments described in the examples. In this preferred system the scutellum of immature embryos is used as a target tissue for the DNA transformation. Moreover, the bar gene, encoding a phosphinothricin phosphotransferase and therefore conveying a resistance against the herbicide phosphinothricin, can be used as a selectable marker gene to allow for the selection of transformed cells to cells lacking the integrated DNA. It will be appreciated however that other herbicide resistance genes can be used instead of or in addition to the bar gene.

In a still further aspect, the invention provides host cells, in particular prokaryotic or eucaryotic cells, which have been transformed and/or genetically modified by one or more nucleic acid molecules of the invention or by a vector of the invention as well as cells (e.g. a bacterial cell or a plant cell) derived from cells transformed and/or genetically modified in such a way and containing a nucleic acid molecule of the invention or a vector of the invention. Such cells are characterised in that the introduced nucleic acid molecule of the invention is either heterologous with respect to the transformed cell or is integrated at a position in the genome of the cell at which it does not naturally occur.

Furthermore, the invention also provides novel proteins encoded by the gene in the nucleic acid molecules of the invention, as well as methods for their production whereby a host cell of the invention is cultivated under conditions that allow for synthesis of the novel protein.

The nucleic acid molecules of the invention may produce plants in which the activity of at least one of the polyamine synthesis enzymes, or isotypes thereof, is increased or reduced and which at the same time the activities of other enzymes involved in polyamine synthesis are affected. By increasing the activity of one or more isotypes of the polyamine synthetic enzymes in the cells of the propagating material of transformed plants for example in the endosperm of wheat, increased yields of polyamines may be the result.

The present invention further relates to transgenic plant cells transformed with one or more nucleic acid molecule(s) of the invention. By means of methods known to the skilled person, the transgenic plant cells can be regenerated to whole plants. The resulting plants can be cultivated in the usual way and cross-bred with plants having the same transformed genetic heritage or another genetic heritage.

Thus, the plants obtained by regenerating the transgenic plant cells of the invention are also within the scope of the present invention. Such plants are typically cultivated plants, for example those mentioned above. Preferably, the plants are useful plants. Wheat is particularly preferred.

In general, two or more generations of the transformed plants should be grown and the seeds or grain harvested in order to ensure that the phenotype is stably transferred in the plants and remains in the seed or grain.

In a still further aspect, the invention provides propagating material obtained from plants containing the transgenic plant cells of the invention. These plants are preferably the cultivated plants referred to above and the propagating material is preferably as hereinbefore defined. Wheat is preferred.

In a preferred embodiment, the present invention provides propagating material obtained from the above mentioned transgenic plant and, in a particular embodiment, provides endosperm derived from the propagating material of the invention. Thus, in a further aspect the invention provides propagating material for cultivated plants, the propagating material having integrated into the genome of its cells a nucleic acid molecule comprising a promoter and a gene encoding a protein involved in polyamine biosynthesis, wherein the promoter effects transcription of the gene selectively (e.g. exclusively) in tissue of the propagating material.

By means of the methods of the invention, there is provided the possibility of increasing the production of one or more polyamines in propagating material of genetically modified plants by over-expressing the gene contained in the nucleic acid molecules of the invention. Therefore, it is possible to express the nucleic acid molecules of the invention in the cells of the propagating material for cultivated plants in order to increase the activity of one or more polyamine biosynthetic enzymes and thus the production of one or more polyamines in these cells.

During expression of the nucleic acid constructs of the invention in plants, the promoter ensures localisation of synthesised proteins selectively and preferably exclusively in propagating material only.

Transgenic plant cells in which the activity of at least one protein according to the invention is reduced when compared to non-transformed plant cells represent a further aspect of the invention.

The production of plant cells with a reduced activity of at least one protein of the invention may, for example, be achieved by the expression of at least one corresponding anti-sense RNA or of at least one sense-RNA for achieving a co-suppression effect.

Co-suppression is a term known to the skilled person which describes the reciprocal and coordinated inactivation of host genes and homologous transgenes. Without wishing to be bound by theory, it is believed that co-suppression is a trans interaction between duplicated genes that is dependant on homology. However, in transgenic plants gene duplication does not always lead to suppression. Thus, homology alone is not sufficient for co-suppression to occur (Jorgensen, 1990, Trends in Biotechnology, 8, 340-344). Rather, co-suppression seems to be the result of a homology- dependant interaction between any or most homologous sequences under appropriate conditions. It is believed that genomic sequences surrounding the transgene at the site of insertion may play a crucial role in the determination of co-suppression (de Borne et al., 1994, Molecular and General Genetics, 243, 613-621). Moreover it is believed that triggering of the phenomenom is developmental ly regulated (ibid.).

Typically, transgenes that trigger co-suppression carry the entire coding sequence of a plant gene cloned downstream of a terminator sequence (Fray and Grierson 1993, Plant Molecular Biology, 22, 589-602; Seymour et al, 1993, Plant Molecular Biology, 23, 1-9). However, it is now believed that co-suppression does not require the presence of the entire sequence of the corresponding mRNA on the transgene (de Borne et al., 1994, Molecular and General Genetics, 243, 613-621).

The method for suppressing the expression of sequences of the invention in plant cells is known to the skilled person and has been described in, for example, Jorgensen, 1990, Trends in Biotechnology, 8, 340-344; de Borne et al, 1994, Molecular and General

Genetics, 243, 613-621 and in other sources.

In order to inhibit, block or co-suppress the expression of sequences encoding one or more polyamine synthesis enzymes in the propagating material of transformed plants, nucleic acid constructs can be used for transformation, which at the same time contain one or more regions in either sense or anti-sense orientation controlled by a suitable promoter and encoding the corresponding polyamine biosynthetic enzymes. Each sequence may be controlled by its own promoter or may be transcribed as a fusion of a common promoter.

In order to express a sense RNA or anti-sense RNA, on the one hand nucleic acid constructs can be used which comprise the complete gene sequence encoding a protein of the invention, including nucleic acid constructs which only comprise parts of the encoding sequence whereby these parts have to be long enough in order to prompt a co-suppression or anti-sense, respectively effect within the cells. Coding sequences with a minimum length of 15 base pairs, preferably with a length of 100-500 base pairs may be sufficient for producing the effect. For efficient antisense inhibition, uninterrupted coding sequences with a length greater than 500 base pairs are preferred in particular sequences with a length of between 500 and 1000, 1000 and 1500, 1500 and 2000 or 2000 and 2500 base pairs. Generally DNA constructs are used which are shorter than 5000 base pairs, preferably sequences with a length of less than 2500 base pairs.

DNA sequences which are highly homologous, but not entirely identical to the sequences of the DNA constructs of the invention may be used. The minimal homology should be more than about 65%. Preferably, sequences with homologies between 95 and 100% should be used.

Thus, in another aspect the invention provides plant cells, plants and propagating material obtained therefrom containing plant cells transformed with one or more nucleic acid constructs of the invention in which one or more regions of the genes are in either sense or anti-sense orientation. The invention further provides endosperm derived from the above-mentioned propagating material.

The polyamines encoded by the nucleic acid molecules of the invention and synthesised in the propagating material of the invention may be determined using many analytical methods including high-performance liquid chromatography (HPLC), thin-layer chromatography, thin-layer electrophoresis and paper electrophoresis.

The invention also contemplates foodstuffs obtained from the propagating material of the invention. Such foodstuffs may be provided in the form of a composition comprising other compounds, solutes or solvents for use as anticancer agents, cancer detection agents, immunostimulants, analgesics and appetite suppressants.

In addition the invention also contemplates the use of compounds derived from the propagating material of the invention for the manufacture of a medicament for use in the treatment or prophylaxis of proliferative diseases such as cancer or immune-deficiency related diseases.

Moreover the invention provides foods, food supplements, cosmetic preparations, nutritional formulations and pharmaceutical preparations or medicaments containing the propagating material, or materials derived therefrom, of the invention. A foodstuff may derive from the whole or part of the propagating material of the invention for example the foodstuff may derive from the endosperm only. Food products and food supplements containing the propagating material of the invention, or parts thereof, may include cereal-based foods, for example breakfast cereals, flours and foods containing these flours for example breads, breadcrumb, batter, cakes, pastries, biscuits, bakery goods and pasta. Moreover, foods and food supplements containing the propagating material of vegetables, or parts thereof, for example tubers and yams are also provided.

The food product can be, for example, selected from

(a) a babyfood or formulae; or (b) a bakery product (for example a bread, yeasted goods or a cake); or

(c) a bakery supply product (for example, a custard or a bakery filling or topping); or

(d) a batter; or

(e) a breading; or

(f) a cereal; or (g) a confectionary; or

(h) a flavour or beverage emulsion; or

(i) a fruit filling; or

(j) a gravy, soup, sauce or food thickener; or

(k) a meal or meal component; or (1) a meat product; or

(m) a petfood; or

(n) a pharmaceutical or nutraceutical; or

(o) a potato or yam product; or

(p) a dairy product (for example a dessert or yoghurt); or (q) a salad dressing; or

(r) a snack or cracker; or

(s) a spread; or

(t) a pasta product (for example a noodle)

A pharmaceutical preparation or composition comprising the product of the invention can be a solid semisolid or liquid composition in a form, concentration and level of purity suitable for administration to a patient upon which administration it can elicit the desired pharmaceutical effect. The pharmaceutical compositions can take the form of, for example, tablets, capsules, pills, solutions, syrups, suspensions, powders, suppositories, ointments, patches or inserts. The compositions can be administered orally or by injection for example.

The invention finds application in the treatment or prophylaxis of any hyperproliferative disease and in particular a cancer such as cervical, breast, colorectal, prostate and hepatic cancer as well as leukaemia and any other disease involving undesirable cell growth. In such cases, foodstuffs, foods or compositions containing reduced levels of polyamines would typically be administered.

In contrast to the application of the invention in slowing down the growth and progression of a tumour or disease such as lymphoma, Hodgkin's disease, psoriasis, ulcerative colitis, irritable bowel syndrome, and diamine/polyamine oxidase deficiency, the invention further finds application during periods where intensive growth is required, such as normal healing, post-operational recovery, liver regeneration, kidney hypertrophy, compensatory growth of the lung or gut and for supporting growth in babies and young children.

Moreover, the invention finds application in the treatment of endotoxic shock and/or mortality, for example in patients undergoing major surgery, burn patients, patients suffering from acute trauma, and patients with acute liver disease. Further applications of the present invention may be in the stimulation of the immune system of patients suffering from HIV-related infection and in other patients suffering from host defence mechanisms as a result of, for example, post-surgical trauma, chemotherapy/radiation therapy, sepsis, and transfusion induced suppression.

The invention finds application in nutritional formulations in particular as part of the diet of babies, children and of patients suffering from immuno-deficiency related diseases. Nutritional formulations comprising the product of the invention can be in a solid or liquid composition in a form suitable for administration for example in the form of powdered milk/feed formulae to babies. In such cases, foodstuffs, foods or compositions containing increased levels of polyamines would typically be administered.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 shows the pathways for polyamine biosynthesis; Abbreviations: SAM, S- adenosylmethionine; ACC, 1-aminocyclopropane-l-carboxylic acid; MGBG, methylglyoxal-bis-guanyl hydrazone; SAMDC, S-adenosylmethionine decarboxylase; ADC, arginine decarboxylase; DFMA, DL-α-difluoromethylarginine; ODC, ornithine decarboxylase; DFMO, DL-α-difluoromethylornithine.

Figure 2 is the plasmid vector, pHMW-ADC(+), showing the inserted nucleic acid construct comprising the HMW 1DX5 promoter, the oat adc gene and the 35S terminator.

Figures 3 to 6 show histogram representations of the data recorded in Table 1 herein.

Figures 7 to 10 show histogram representations of the data recorded in Table 2 herein.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

The invention will now be illustrated, but not limited, by reference to the following examples.

EXAMPLE 1

Production of the plant transformation vector phmw-adc(+)

The oat adc gene (Bell and Malmberg, Molecular & General Genetics, 1990, 224,

431-436) was provided by Dr Antonio Tiburcio at the University of Barcelona, Barcelona, Spain, as a 2124 base pair fragment cloned into the cloning vector pTZ19R. The oat adc gene was isolated from pTZ19R by cutting with the restriction enzymes Sma I and EcoR I.

The hanging ends of the EcoR I site were filled using the Klenow polymerase method to produce a blunt-ended fragment. The sequence of the adc gene is shown under SEQ ID

No. 5. The excised adc gene fragments were isolated from the gel using QIEX II fragment isolation kit available from QIAGEN. The gene was cloned into the plasmid vector pLRPT. The pLRPT vector was created as follows:

1. Digesting the 2686 base pair plasmid, pUC 19, with Sph I and Sal I.

2. Cloning the 1257 base pair fragment corresponding to the high molecular weight (HMW) glutenin promoter, lDx5, into the Sph II Sal I sites of pUC19, from 1 above. The 1DX5 promoter was provided as a Sph l-Sal I fragment by Dr Jonathan Napier at IACR-Long Ashton Research Station, University of Bristol, Bristol, UK. The 1DX5 promoter was isolated from the Glu-1D-1 gene from Triticea cv. Cheyenne by Dr Nigel Halford (ibid). Functional analyses of the promoter regions of the family of wheat proteins to which Glu-ID-1 belongs is described in Halford et al, Plant Science, 1989, 62, 207-216. 3. Excising the 710 base pair sequence corresponding to the 35S-CAMV terminator sequence (SEQ ID No. 6) from the plasmid pJIT60 (constructed by Dr Phil Mullineaux at the John Innes Centre, Norwich, UK as part of the John Innes Centre Toolkit (JIT) programme) by digesting pJIT60 with EcoR I and EcoR V.

The isolated EcoR VEcoR V fragment was cloned into the EcoR llEcoR V sites of EcoR VEcoR V digested pBluescript. The terminator fragment was excised from pBluescript following digestion with Xba VEcoR V. The pUC19 plasmid containing the 1DX5 promoter, described in 2 above, was digested with Xba I and Sma I. The Xba VEcoR V terminator fragment was then ligated to the Xba VSma I fragment resulting in a vector which has a pUC 19 backbone and which contains the 1DX5 promoter and the 35S terminator.

Cloning of the adc gene fragment into pLRPT was as follows: 1. pLRPT, into which was cloned the 1DX5 promoter and 35S terminator as described above, was digested with Sma I and treated with calf intestine alkaline phosphatase (CIAP) (in a 50μl reaction volume: 40μl (20g) vector + lμl CIAP (Stratagene) + 5μl lOxCIAP buffer + 4μl sterile distilled water. 2. pLRPT and the isolated adc gene were blunt-end ligated using T4 Ligase enzyme (Stratagene) following the manufacturer's instructions and employing a 1 : 1 vectoπinsert molar ratio (in a lOμl reaction volume: lμl T4 ligase (4000units/ml) + 0.5μl vector (lOOng) + 0.5μl insert (50ng) + lμl 10xT4 buffer + 7μl sterile distilled water). The ligation reaction was incubated at 4°C overnight. Confirmation that the construct contained the adc gene in the desired sense, rather than antisense, orientation was obtained by enzyme restriction analysis using restriction enzymes or combinations thereof which included: Sst I, Sal I, Bam HI, Xba I, EcoR V, Kpn I, Kpn I and EcoR V, Bam HI and EcoR V. The resulting plasmid vector, pHMW-ADC(+), containing the construct comprising the 1DX5 promoter, the adc gene and the 35S terminator is shown in Figure 2. pHMW-ADC(H-) was then transformed into E.coli XL 1 -blue strain for multiplication. The plasmid vector for transformation was prepared using QIAGEN Mega Kit, supplied by QIAGEN, following the manufacturer's instructions.

The pLRPT plasmid does not contain a selectable marker suitable for selection of transformed plant cells, therefore in the subsequent transformation experiments, the plasmid pAHC25 (Christensen and Quail, Transgenic Research, 1996, 5, 213-218) which contains the uidA gene coding for β-glucuronidase (GUS) and the bar gene coding for resistance to phosphinothricin (PPT), both under control of the maize ubiquitin promoter, was used. The pAHC25 vector was delivered in co-transformations at equimolar ratio with the pAHC25 vector containing the oat arginine decarboxylase (ADC) gene controlled by the endosperm specific HMW promoter; pHMW-ADC(+).

EXAMPLE 2

Transformation of immature wheat embryos with phmw-adc(+') Preparation of Plant Materials

Donor wheat plants from current European wheat varieties Imp and Cadenza were grown in a greenhouse under the following conditions;

1. Soil Composition:

75% L&P (L&P suppliers) fine-grade peat, 12% screened sterilised loam 10% 6mm screened, lime-free grit 3% medium grade vermiculite

3.5kg Osmocote (Scott United Kingdom Ltd) per m³ soil (slow-release fertilizer, 15-11-13 NPK plus micronutrients)

0.5kg PG (P&G suppliers) mix per m³ (14-16-18 NPK (nitrogen, phosphorous and potassium) granular fertiliser plus micronutrients);

2. Ambient Conditions:

16 hour photoperiod (natural light supplemented with 400 W sodium lamps) 18 to 20° C day and 16 °C night temperature 50 to 70%) relative air humidity; and 3. Pest Control: sulphur spray (Thiovit) every 4 to 6 weeks and biological control of thrips using Amblyseius caliginosus (Novartis BCM Ltd., UK).

Preparation for Bombardment

Early-medium milk stage grains containing immature translucent embryos from the donor plants were harvested and surface-sterilised in 70%> ethanol for five minutes and 10% commercial bleach ("Domestos" RTM) for fifteen minutes. Under aseptic conditions, embryos of approximately 0.5- 1.5mm length were isolated and the embryo axis was removed. Thirty scutella (embryos) were placed in the centre (18mm target circle) of a 90mm Petri dish containing culture medium. Embryos were placed with the embryo-axis side in contact with the medium (callus induction) exposing the scutellum to bombardment. Cultures were incubated at 26 °C in darkness for approximately 24 hours prior to bombardment.

DNA Precipitation Procedure for Particle Bombardment

Gold particles (0.6 submicron gold, Bio-Rad), were coated with plasmid DNA prepared according to Example 1 following a protocol supplied by the manufacturers but modified as described in Barcelo and Lazzeri 1995, In: Methods in Molecular Biology, Vol. 49: Plant Gene Transfer and Expression, Humana Press, H. Jones (Ed). The standard precipitation mixture consisted of lmg of gold particles in 50μl of 2.5M calcium chloride, 20μl of lOOmM spermidine free base and 5μl pAHC25 (concentration lμg/μl) and an equimolar ratio of pHMW-ADC(+). The transformation control experiments consisted of the gold particles only ie, minus the plasmids. After combining the components, the mixture was vortexed and the supernatant was discarded. The particles were then washed with 150μl absolute ethanol and finally resuspended in 85μl absolute ethanol. For each bombardment, 5μl of DNA gold ethanol solution were loaded onto the microcarrier. The DNA gold ethanol solution was kept on ice to minimise ethanol evaporation.

Particle bombardments were carried out using a PDS 1000/He gun (BioRad, UK) with a target distance of 5.5cm from the stopping plate at 650 psi helium pressure.

After bombardment, embryos were spread over the surface of the medium across three plates. Histochemical β-glucuronidase (GUS) assays were conducted two days after bombardment to check the success of gene delivery (see Example 4).

EXAMPLE 3

Selection of Transformants and Regeneration of Transformed Plants Transformants were selected by successive three-week rounds of selection in plant maintenance medium (RO) as described in Rasco-Gaunt and Barcelo, 1999, In: Methods in Molecular Biology, Vol.l 11, Plant Cell Culture Protocols, Humana Press, R. Hall (Ed) using 2 or 4mg/L gluphosinate ammonium (Greyhound, UK) until all control (non- transformed) plantlets were killed and surviving putative transformed plantlets had developed good root systems. All plants regenerating from the same scutellum/callus were noted. Putative transgenic plantlets (T₀) were then potted in soil after 6-9 weeks in the plant maintenance/selection medium.

Culture Media and Conditions The standard callus induction medium for scutellar tissues consisted of solidified

(0.5% Agargel) modified MS medium (lOOml/L macrosalts; lml/L microsalts) as described in Rasco-Gaunt and Barcelo, 1999, In: Methods in Molecular Biology, Vol. l 1 1, Plant Cell Culture Protocols, Humana Press, R. Hall (Ed); 2ml L Fe/NaEDTA; 30g/L sucrose) supplemented with 9%> sucrose and 0.5mg/L, 2,4-D (2,4, Dichlorophenoxyacetic acid) and 5mg/L zeatin for shoot regeneration. Cultures were incubated at 26°C under a 12 hour photoperiod. The numbers of calluses producing shoots were assessed after three weeks of shoot induction. Regenerated plantlets were maintained in RO medium with the same composition as RZ medium, as described in Rasco-Gaunt and Barcelo, 1999, In: Methods in Molecular Biology, Vol.l 1 1, Plant Cell Culture Protocols, Humana Press, R. Hall (Ed), but without 2,4-D and zeatin.

EXAMPLE 4

Assessment of Transient Expression using histochemical β-glucuronidase assay

Two days after bombardment, β-glucuronidase (GUS) expression was examined by immersing explants in X-gluc buffer containing ImM X-gluc (5-bromo-4-chloro-3- indoyl-β-D-glucuronidecyclohexylammonium salt), lOOmM sodium phosphate buffer pH 7.0, 0.5mM potassium ferricyanide, 0.5mM potassium ferrocyanide, and 0.1% v/v Triton X-100 (RTM). Blue staining was assessed after incubation overnight at 37°C and two days at 26 °C. GUS expression of tissues was assessed based on the percentage of the tissue area covered by blue spots, using scores 0 to 10 (10 = 100%, 9 = 90%, 5 = 50%o, 1 = 10% and 0 = no blue spots).

EXAMPLE 5 Analyses of Marker Gene Activity

GUS expression was assayed in young leaf tissues of regenerated plants as described in Example 4, with the modification that chlorophyll was extracted after staining by incubation with 70% ethanol for one hour followed by incubation with 100% ethanol overnight. An assessment of bar gene expression was then carried out by means of an ammonium-evolution assay (Rasco-Gaunt et al, Molecular Breeding, 1999, 5, 255-

262).

EXAMPLE 6 Molecular Analyses of Transformed Plants

DNA was isolated from leaf tissue using a CTAB (cetyltriethylammonium bromide) procedure (Stacey and Isaac, 1994, In: Methods in Molecular Biology Protocols for Nucleic Acid Analysis by Non-radioactive Probes, Vol. 20, pp9- 15, Humana Press). Approximately 100-200mg frozen leaf material was ground into powder in liquid nitrogen and homogenised in 1ml of CTAB extraction buffer (2% CTAB, 0.02M EDTA, 0.1M

Tris-Cl pH 8, 1.4M NaCl, 25mM DTT (dithiothreitol) for 30 minutes at 65 °C. Homogenised samples were allowed to cool at room temperature for 15 minutes and then a single protein extraction was carried out using approximately 1ml 24:1 v/v chloroform:octanol. Samples were centrifuged for 7 minutes at 13,000 rpm and the upper layer of supernatant was collected using wide-mouthed pipette tips. DNA was precipitated from the supernatant by incubation in 95% ethanol on ice for one hour. DNA threads were spooled onto a glass hook, washed in 75% ethanol containing 0.2M sodium acetate for 10 minutes, air-dried for 5 minutes and resuspended in TE (Trizma-EDTA) buffer. RNAse A (5μl) (Pharmacia) was added to the samples which were then incubated at 37^QC for one hour.

The extracted DNA was then subjected to PCR analysis in order to detect the presence of the uidA gene, bar gene and adc gene. PCR reactions were carried out on lμl aliquots of the DNA [50 - 100 ng/μl] in a 30μl reaction volume containing 50mM KC1, lOmM Tris-HCl (pH 8.8), 1.5mM MgCl₂, 0.1% Triton X-100, 200μM of dNTPs (dATP+dCTP+dTTP+dGTP), 0.3 μM of each primer and 0.66 U of Dynazyme (RTM) DNA polymerase (Flowgen, UK). Thermocycling was carried out for 30 cycles, each cycle comprising denaturation at 94 °C for 30 seconds, annealing for 30 seconds, and extension at 72 °C for 2 minutes. The PCR primers and annealing temperatures used were as follows:

uidA gene

5'-AGTGTACGTATCACCGTTTGTGTGAAC-3' (SEQ ID No. 7) 5'-ATCGCCGCTTTGGACATACCATCCGTA-3' (SEQ ID No. 8) annealing temperature 62 °C

bar gene

5'-GTCTGCACCATCGTCAACC-3' (SEQ ID No. 9) 5'-GAAGTCCAGCTGCCAGAAAC-3' (SEQ ID No. 10) annealing temperature 57 °C

pHMW-ADC adc gene

5'-TACTGGGGCATCCAGCATCT-3' (SEQ ID No. 1 1) 5'-CTTCTTACCTTGCACAGGGC-3' (SEQ ID No. 12) annealing temperature 57 °C

The PCR products were analysed by electrophoresis on 0.8%> w/v agarose gels and the PCR product lengths were as follows: uidA = 1020 bp, bar = 420 bp, adc = 1300 bp.

EXAMPLE 7

Polyamine Assay of Transgenic Lines

Methods

The Cadenza and Imp transgenic wheat lines produced by the methods described above were assayed for polyamines by the method of Marce et al, Journal of

Chromatography B, 1995, 666, 329-335. The Marce method is a high pressure liquid chromatography (HPLC) method which employs pre-column derivatisation with dansyl chloride for the determination of the polyamines putrescine, spermidine and spermine. Results

Tables 1 and 2 below show the polyamine content of the transgenic wheat seeds of the Cadenza and Imp varieties respectively. In the Tables, the following abbreviations are used:

S = free soluble polyamines

SH = polyamines liberated from soluble conjugates

PH = polyamines liberated from insoluble conjugates

ND = not detected Total = total polyamines

TABLE 1 - Cadenza Variety

TABLE 2 - Imp Variety

For convenience the data in Table 1 and Table 2 is presented as a histogram in Figures 3 to 6 and 7 to 10 respectively. As can be seen from the Tables and the Figures, seeds from the transgenic wheat line 787.9.1 (Cadenza variety) showed generally increased levels of the different polyamines as compared to the levels of polyamines in seeds of the control plants, with the increase in putrescine levels being the most dramatic as shown in Figures 3 to 6.

Seeds of the transgenic wheat line 832.4.2 and 832.4.3 (Imp variety) also showed increased levels of the different polyamines as compared to seeds of control plants as shown in Figures 7 to 10. However, seeds of the transgenic wheat line 809.9.3 showed a reduced expression of putrescine, spermidine and spermine similar to the controls. This is believed to be due to the fact that the transgene had not inserted into the genome of this line during transformation. Alternatively, this result could be explained by a cosuppression effect (see hereinabove) of the transgene copy upon the expression of the native copy.

Phenotypic Assessment

The T₀ transgenic plants grown from the T₀ transgenic plantlets appeared phenotypically normal. The seeds, T„ harvested from mature T₀ plants also did not display any noticeable abnormalities.

Claims

1. A nucleic acid construct for transforming a plant cell, the construct comprising a promoter operatively linked to a nucleotide sequence, the promoter being selectively activated in cells of propagating material for a plant, the nucleotide sequence being such that its transcription leads to an alteration in the levels of polyamines produced in transformed cells of propagating material relative to untransformed cells.

2. A nucleic acid construct for transforming a plant cell, the construct comprising a promoter operatively linked to a nucleotide sequence, the promoter being selectively activated in cells of propagating material for a plant, the nucleotide sequence being such that its transcription leads to an alteration in the levels of polyamines produced in transformed cells of propagating material relative to untransformed cells, wherein the propagating material is other than a potato tuber.

3. A nucleic acid construct for transforming a plant cell, the construct comprising a promoter operatively linked to a nucleotide sequence, the promoter being selectively activated in cells of propagating material for a plant, the nucleotide sequence being such that its transcription leads to an alteration in the levels of polyamines produced in transformed cells of mature propagating material relative to untransformed cells.

4. A nucleic acid construct according to any one of the preceding claims wherein the transcription of the nucleotide sequence leads to an increase in the levels of polyamines produced in the transformed cell.

5. A nucleic acid construct according to claim 4 wherein the nucleotide sequence comprises a gene encoding a protein involved in polyamine biosynthesis.

6. A nucleic acid construct according to any one of claims 1 to 3 wherein the transcription of the nucleotide sequence leads to a reduction in the levels of polyamines produced in the transformed cell.

7. A nucleic acid construct according to claim 6 wherein the nucleotide sequence comprises one or more regions which are in antisense orientation relative to a native gene in the transformed cell encoding a protein involved in polyamine biosynthesis.

8. A nucleic acid construct according to claim 6 wherein the reduction in the levels of polyamines produced in the transformed cell is effected by the expression of at least one corresponding anti-sense RNA or of at least one sense-RNA for achieving a co- suppression effect.

9. A nucleic acid construct according to any one of the preceding claims wherein the promoter is highly seed-selective.

10. A nucleic acid construct according to claim 9 wherein the promoter is seed-specific.

11. A nucleic acid construct according to any one of the preceding claims wherein the promoter is selected from: (a) the promoters from seed protein genes, such as (i) the zein genes of maize, (ii) the legume globulin promoters of, for example, pea, (iii) the prolamin gene promoters of, for example, wheat and maize, and (iv) the phaseolin promoter; and (b) endosperm-specific promoters, such as (i) the promoters of gliadin and hordein genes, (ii) the promoters of storage protein genes such as zein genes which contain a prolamin box or endosperm element conserved sequence.

12. A nucleic acid construct according to claim 1 1 wherein the promoter is an endosperm- specific promoter containing the conserved endosperm motif, TGTAAAGT (SEQ. ID. NO. 2).

13. A nucleic acid construct according to claim 12 wherein the promoter contains a prolamin box sequence having the consensus sequence: 5'- TGACATGTAAAGTGAATAAGATGAGTCATG (SEQ. ID. NO. 1).

14. A nucleic acid construct according to any one of claims 1 to 10 wherein the promoter is the promoter for a high molecular weight (HMW) prolamin gene derivable from wheat.

15. A nucleic acid construct according to claim 14 wherein the promoter comprises the sequence 5'- GTTTTGCAAAGCTCCAATTGCTCCTTGCTTATC CAGCT (SEQ. ID. NO. 3).

16. A nucleic acid construct according to claim 15 wherein the promoter is the 1 DX5 promoter of the Glu-1D-1 gene from wheat cv

17. A nucleic acid construct according to claim 15 or claim 16 wherein the promoter is selected from (i) a promoter which comprises all or part of the nucleotide sequence corresponding to SEQ.ID. NO. 4 and (ii) promoters having a nucleotide sequence which is complementary to all or to a part of SEQ. ID. NO. 4.

18. A nucleic acid construct according to any one of the preceding claims wherein the promoter effects constitutive expression of a gene encoding a protein involved in polyamine synthesis selectively in the cells of one or more tissues or compartments within the propagating material for cultivated plants.

19. A nucleic acid construct according to claim 18 wherein the protein involved in polyamine biosynthesis is an enzyme having activity corresponding to one of arginine decarboxylase (ADC), ornithine decarboxylase (ODC), spermidine synthase (Spd synthase), spermine synthase (Spm synthase), S-adenosylmethionine synthetase, and S-adenosylmethionine decarboxylase (SAMDC).

20. A nucleic acid construct according to claim 19 wherein the protein has the biological activity of arginine decarboxylase (ADC).

21. A nucleic acid construct according to claim 20 wherein the protein is that which is expressed by a gene including the nucleotide sequence depicted under SEQ ID No.5.

22. A nucleic acid construct according to claim 21 in which the nucleotide sequence further comprises the gene sequence indicated in SEQ ID No.6.

23. A nucleic acid construct according to any one of the preceding claims comprising a DNA sequence, for example a gene sequence or cDNA sequence.

24. A translatable RNA species, for example a messenger RNA, synthesised during transcription in the propagating material for a plant of all or part of the nucleic acid constructs as defined in any one of the preceding claims, whereby translation of the RNA species leads to an alteration in the levels of polyamines produced in transformed cells of

5 propagating material relative to untransformed cells.

25. A vector comprising a nucleic acid construct as defined in any one of the preceding claims.

10 26. A vector according to claim 25 which is selected from plasmids, cosmids, bacteriophages and retroviral vectors.

27. A vector according to claim 26 which is a plasmid.

1 5 28. A host cell which has been transformed and/or genetically modified by a vector as defined in any one of claims 25 to 27.

29. A host cell according to claim 28 which is a transgenic plant cell.

20 30. A plant obtained by regenerating transgenic plant cells as defined in claim 29.

31. A plant according to claim 30 which is a cereal such as wheat, rice, barley, maize and oats.

25 32. A plant according to claim 30 or claim 31 selected from plants wherein there exists less than 10%) variation in polyamine content of the propagating material between varieties prior to transformation.

33. A plant according to claim 31 or claim 32 which is wheat. 30

34. Propagating material obtainable from the plants of any one of claims 30 to 33.

35. Propagating material according to claim 34 selected from fruits, seeds, tubers and grains.

36. Propagating material according to claim 35 which consists of seeds or grains, or parts thereof.

37. Propagating material according to claim 36 which consists essentially of endosperm.

38. Propagating material for cultivated plants (such as wheat grain), the propagating material having integrated into the genome of its cells a nucleic acid molecule comprising a promoter and a gene encoding a protein involved in polyamine biosynthesis, wherein the promoter effects transcription of the gene selectively (e.g. exclusively) in tissue of the

10 propagating material.

39. A foodstuff obtainable from or containing the propagating material of any one of claims 34 to 38.

1 5 40. A foodstuff according to claim 39 which is selected from cereal-based foods, for example breakfast cereals, flours and foods containing these flours for example breads, breadcrumb, batter, cakes, pastries, biscuits, bakery goods and pasta.

41. A foodstuff according to claim 40 which selected from

(a) a babyfood or formulae; or

(b) a bakery product (for example a bread, yeasted goods or a cake); or

(c) a bakery supply product (for example, a custard or a bakery filling or topping); or

(d) a batter; or

(e) a breading; or

(f) a cereal; or

(g) a confectionary; or

(h) a flavour or beverage emulsion; or

(i) a fruit filling; or

(j) a gravy, soup, sauce or food thickener; or

(k) a meal or meal component; or

(1) a meat product; or

(m) a petfood; or

(n) a pharmaceutical or nutraceutical; or

(o) a potato or yam product; or (p) a dairy product (for example a dessert or yoghurt); or

(q) a salad dressing; or

(r) a snack or cracker; or

(s) a spread; or

(t) a pasta product (for example a noodle).

42. A process for altering the levels of polyamines in a propagating material for a cultivated plant by transforming a plant cell with a vector as defined in any one of claims 25 to 27.