EP1105526A1

EP1105526A1 - Hepg2 cells stably transfected with hcv

Info

Publication number: EP1105526A1
Application number: EP00936474A
Authority: EP
Inventors: Mark A. Feitelson
Original assignee: Thomas Jefferson University
Current assignee: Thomas Jefferson University
Priority date: 1999-06-03
Filing date: 2000-06-02
Publication date: 2001-06-13
Also published as: WO2000075376A1; JP2003501073A; CA2339255A1

Abstract

The present invention involves a cell line stably transfected with the hepatitis C virus and the use of this cell line to facilitate study of a hepatitis C virus or a hepatitis C virus mutant and identification of efficacious antiviral agents for treatment of a hepatitis C virus or a hepatitis C virus mutant.

Description

HEPG2 CELLS STABLY TRANSFECTED WITH HCV

CROSS REFERENCE TO RELATED APPLICATIONS

This application claims priority, in part, under 35 U.S.C. §119 based upon U.S. Provisional Patent Application No. 60/137,531, filed June 3, 1999.

FIELD OF THE INVENTION

The present invention relates to the fields of molecular biology and virology and to a cell line facilitating study of a virus and identification of efficacious antiviral agents and, more particularly, to HepG2 cells which are stably transfected with the hepatitis C virus and to use of a cell line for effective study of the hepatitis C virus or a hepatitis C virus mutant and for identification of efficacious therapeutic agents for such viruses or mutant viruses.

BACKGROUND OF THE INVENTION

HCV is a major cause of post-transfusion and community acquired non-A, non-B hepatitis worldwide. Even with widespread anti-HCV testing, there are nearly 4 million chronically infected people in the U.S., with 28,000 new infections/year, and 8,000-10,000 HCV related deaths annually. There are an estimated 170 million chronically infected people worldwide who are at high risk for the development of hepatitis, cirrhosis and hepatocellular carcinoma (HCC).

A major problem in studying virus replication, in elucidating host-virus relationships, and in screening for anti-viral drugs in vitro, is the lack of a stable tissue culture system. Primary human and chimpanzee hepatocytes are susceptible to HCV, and replicate the virus, but primary hepatocytes are difficult to obtain, and usually survive less than two weeks in culture. The same restrictions apply when hepatocytes are harvested from already infected individuals. Several cell lines that appear to be susceptible to HCV infection have not consistently generated stable baseline levels of virus. Full length HCV RNA has been successfully transfected into a number of cell lines, but replicative levels are not stable and become undetectable within a few weeks. More recently, subgenomic regions of HCV have been cloned and expressed at high levels in minireplicons, but none of these minireplicons support virus replication. Hence, there is still a need for the development of one or more systems capable of stably supporting HCV replication. The present invention relates to HepG2 cells stably transfected with a clone of full length HCV cDNA.

SUMMARY OF THE INVENTION

The present invention relates to a cell line stably expressing a wild type hepatitis C virus.

Another aspect of the present invention is a method of identifying a therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus replication, comprising: contacting a cell line stably expressing said hepatitis C virus with said therapeutic agent and measuring changes in said hepatitis C virus replication.

Yet another aspect of the present invention is a method of identifying a therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus maturation, comprising: contacting a cell line stably expressing said hepatitis C virus with said therapeutic agent and measuring changes in said hepatitis C virus maturation.

Another aspect of the present invention is a method of identifying an efficacy of a cloned therapeutic agent, comprising: inserting a therapeutic gene sequence into a stably producing hepatitis C virus cell line and measuring viral replication and maturation.

Another aspect of the present invention is a cell line stably expressing a mutated hepatitis C virus.

Yet another aspect of the present invention is a method of studying viral replication and maturation, comprising: a) growing said cell line of claim 5 wherein said mutated hepatitis C virus is expressed; b) growing said cell line of claim 1 wherein said wild type hepatitis C virus is expressed; c) determining an amount of viral replication and maturation in step a); d) determining an amount of viral replication and maturation in step b); and e) analyzing an effect of a mutation in said mutated hepatitis C virus by comparing said viral replication and maturation of said mutated hepatitis C virus determined in step c) to that of wild type hepatitis C virus determined in step d).

DESCRIPTION OF THE DRAWINGS

Figure 1. Construction and characterization of HepG2-HCV [+] cells.

Figure 2. RT/PCR using in vitro generated HCV RNA template with strand specific primers.

Figure 3. Strand specific RT/PCR for HCV in HepG2-HCV cell lysates Figure 4. HCV RNA in cesium chloride density gradient fractions from HepG2 cells stably transfected with HCV cDNA.

Figure 5. Stable production of HCV RNA in HepG2 cells over time.

Figure 6. The presence of HCV RNA in the blood of immunodeficient mice injected with HepG2-HCV or control cells. Figure 7. Effect of actinomycin D treatment upon steady state levels of HCV RNA compared to cellular RNA

Figure 8. Protection of putative HCV RNA from Rnase A in the serum of severe combined immunodeficient (SCID) mice injected with HepG2-HCV cells.

Figure 9. Detection of RNA for HCV or neo in gradient fractions from serum of severe combined immunodeficient injected with HepG2-HCV cells

Figure 10. Evidence for expression of NS5B polymerase in HepG2-HCV cells. DESCRIPTION OF THE INVENTION

Construction and characterization of HepG2-HCV [+] cells The 3' end 98 base pair sequence was added to a near full length clone of

HCV cDNA (pRc/CMV/HCV9.4, Takehara, T., et al., Hepatology 21 :746-751, 1995) to make it full length, and then the sequence of the entire cDNA confirmed. In this plasmid, HCV expression is under control of the CMV early-intermediate promoter. To express HCV from its endogenous promoters, full length HCV cDNA was excised from pRc/CMV/HCV with Hindϊll. The insert (9.6 kb) was then subcloned into pZErO-1.1 (InVitrogen), which is a vector that lacks the CMV promoter. The sequence of the HCV clone was identical to that reported earlier (Takehara, T., et al., Hepatology 21:746-751, 1995). The full length clone in pRc/CMV/HCV or pZErO-1.1 was then stably transfected into HepG2 cells (Figure 1), and the cultures selected for 3 weeks in G418 or zeocin, respectively. No zeocin resistant colonies were recovered. G418 resistant cultures were assayed for the presence of HCV production.

Strand specific PCR discriminates the detection of minus strand RNA Full length HCV cDNA was used as a template to produce plus strand RNA or minus strand RNA by in vitro transcription (Figure 2). Each reaction was then treated with RNase free DNase. An equivalent amount of each RNA was serially diluted 10-fold. The reverse transcription step was initiated with each dilution of

RNA by adding a plus strand "tagged" primer TAG-MF7 (5' TCATGGTGGCGAATAA⁹²GTCTTCACGCAGAAAGCGTCTAGCCAT"⁸ 3',

SEQ. ID. NO: 1). The "tag" is 16 nucleotides that are unrelated to the HCV sequence (underlined sequences in SEQ. ID. NO: 1), so that following reverse transcription the cDNA generated has a tag sequence at the extreme 5' end.

Following RNase digestion, PCR was conducted by addition of the plus strand "tagged" primer and a minus strand primer MF8 (5'

³⁶⁰CGAGACCTCCCGGGGCACTCGCAAGCACCC³³¹ 3', SEQ. ID. NO: 2) to each reaction. The results show that about 10⁷ copies of plus strand HCV RNA are required to form enough product for ethidium bromide staining (Figure 2A) while only 10 copies of minus strand are required (Figure 2B). These results show that the strand specific PCR discriminates about a million fold the detection of minus (specific) over plus (nonspecific) strand. The inverse experiment, using a minus strand tagged primer in the reverse transcription step, shows similar results.

Strand specific RT/PCR for HCV in HepG2-HCV cell lysates.

RNA was extracted from HepG2 cells and then mRNA further purified using an oligo-dT column. The isolated mRNA was then treated with RNase free DNase, followed by RT/PCR. For RT/PCR, a specific minus (SEQ. ID. NO: 2) or plus sense primer MF7 (5' ⁹²GTCTTCACGCAGAAAGCGTCTAGCCAT¹¹⁸ 3', SEQ. ID. NO: 3) within the 5' untranslated region (nts 92-118) was used initially for asymmetric single strand synthesis at high temperature (55°C). In addition to HCV specific sequences, this primer had a 5' extension of HCV unrelated (tag) sequences (16 nt) so that the single stranded cDNA generated had tag sequences at the extreme 5' end. Ten percent of the cDNA was then transferred to a fresh tube containing a complementary HCV primer. The plus sense primer MF7 for the plus sense RNA (SEQ. ID. NO: 3) and the minus sense primer MF8 for the minus sense RNA (SEQ. ID. NO: 2) and a primer containing only the tag sequences (5' TCATGGTGGCGAATAA 3', SEQ. ID. NO: 4). The latter primer was used to direct PCR amplification exclusively to the single stranded cDNA. These samples were then PCR amplified, and the products analyzed by agarose gel electrophoresis and Southern blot hybridization using an HCV specific (5'-GAGAGC CATAGTGGTCTGCGGAACCGGTGAGTACAC-3', SEQ. ID. NO: 5) probe (Figure 3). Lane 1 is the reaction starting with minus strand primer without reverse transcriptase. Lane 2 is the same reaction with reverse transcriptase. The results reflect the presence of plus strand HCV RNA. When the same experiment was performed with a tagged plus strand primer in the reverse transcriptase step, the results without (Figure 3, lane 3) or with (Figure 3, lane 4) reverse transcriptase yielded RT/PCR products that reflect the presence of HCV minus strand RNA. When these reactions were carried out in HCV negative HepG2 cells, there was no plus or minus strand HCV RNA detected. The results in lane 5 are for the plus strand reaction. Strand specificity was confirmed by using primers from several regions of the HCV RNA to reduce self or random priming. Overall, these results imply the presence of HCV minus and plus strand RNA in HepG2-HCV cells. They also show that the PCR products are not the result of transgene amplification, nor the result of random priming, since no product was detected in the absence of reverse transcription (Figure 3, lane 1).

HepG2 cells stably transfected with HCV cDNA.

Lysates were prepared from an equal number of HCV plus [+] and minus [-] HepG2 cells by gentle disruption using Dounce homogenization. The lysates were clarified and layered on top of preformed CsCl gradients (1.05-1.40 gms/ml) in 5 ml heat sealable tubes, and the samples centrifuged to equilibrium at 10°C, for 70 hrs at 68,000 rpm in a table top ultracentrifuge (Beckman) (Figure 4). RNA was extracted from aliquots of each fraction and subjected to RT/PCR using primers from the 5' untranslated region spanning nucleotides 62-91 (MF16: 5' ⁶²CCATAGATCACTCCCCTGTGAGGAACT⁹¹ 3', SEQ. ID. NO: 6) ) and 431-414 (MF17: 5' ⁴³¹TTAACGTCCTGTGGGCGGCGGTTGGTG⁴¹⁴ 3', SEQ. ID. NO: 7). The products were then analyzed by agarose gel electrophoresis and Southern blot hybridization under stringent conditions using an HCV DNA probe (SEQ. ID. NO: 5) spanning sequences within the 5' untranslated region amplicon. The probe was made by PCR that incorporated biotinylated bases into the products. Hybridization was detected by the addition of horseradish peroxidase conjugated streptavidin, and finally by addition of the enhanced chemiluminescense (ECL) reagent (Amersham) (Figure 4).

HCV RNA is encapsidated

To test for encapsidated HCV RNA, cell lysates were prepared in non-ionic buffer containing 0.1 % NP40 + 0.1 % Tween 20, clarified by centrifugation and then centrifuged to equilibrium in CsCl gradients, as described supra. When gradient fractions were assayed for HCV RNA by RT/PCR, signals were observed only at a density characteristic of HCV (1.1 gms/ml), implying encapsidation (Figure 4). The HCV RNA in these fractions was RNase resistant. Anti-HCV E1/E2 immunoprecipitated material from the expected gradient fractions and upon amplification yielded RT/PCR products for HCV. These experiments imply that human liver cells encapsidate HCV RNA into virions with the appropriate density and immunochemical characteristics. Intracellular virus production has been consistent at levels of 1-5 x 10⁴ virus genome equivalents / 10⁶ cells, for more than 1 year, implying a stable baseline of HCV production (Figure 5).

Stable production of HCV RNA in HepG2 cells over time

Cultures of HepG2-HCV cells were passaged every 4-5 days. Cell lysates were prepared at 3, 6, 9, and 12 months (Figure 5) and equal quantities of extracted RNA subjected to RT/PCR analysis for HCV using primers from the 5' untranslated region of the genome (SEQ. ID. NO: 1 and 2). Equal quantities of RNA were amplified with increasing known amounts of template (spike) containing the same sequences as the amplicon save an internal deletion of 100 bp (spans the HCV sequence from nucleotides 62 through 162 fused to nucleotides 163 through 414). The latter permitted separation of the amplicon from the sample (upper band) from that of the spike (lower band) by agarose gel electrophoresis (Figure 5). Figure 5 shows the competitive RT/PCR analysis of samples collected on 3, 6, 9, and 12 months of culture on ethidium bromide stained gels (lower portion of figure), and after gel scanning, in graphic form (upper portion of figure). The results imply consistent production of stable levels of HCV RNA in HepG2-HCV cultures. The present invention provides cell lines derived from these stably producing HepG2- HCV cultures. The stable baseline of virus production in these cells provides an important tool for the screening of antiviral compounds. These results also demonstrate that the integrated HCV cDNA clone serves as a template for the consistent production of virus.

Demonstration of HCV RNA in the serum of SCID mice

SCID mice were injected subcutaneously with HepG2-HCV or an equal number of HepG2 -vector transfected cells. Mice were bled every 10 days postinjection, and the serum samples tested for HCV RNA by semiquantitative

RT/PCR (Figure 6). Randomly chosen positive and negative control samples were analyzed by CsCl density equilibrium centrifugation, as described supra. The results show the presence of HCV RNA at a density (D) of roughly 1.1 gm/ml in animals injected with HCV plus [+] but not HCV minus [-] cells. The signal was resistant to pretreatment with RNase. Together, these results imply that HCV virions are secreted into the blood of SCID mice injected with HepG2-HCV cells.

HCV RNA is secreted

To test for virus secretion, aliquots of tissue culture supernatants were analyzed by RT/PCR amplification, but the initial results were not consistently positive. However, when cells were injected into immunodeficient mice, where they grew out as subcutaneous tumors, 6 out of 6 mice injected became RT/PCR positive for HCV RNA in their blood (Figure 6,)- This had the appropriate density on CsCl gradients for HCV of 1.1 gm/ml. Semi-quantitation by RT/PCR showed that the concentrations of HCV in vivo reached 10^ to 10°^" virus genome equivalents/ml of blood in individual mice by day 40 postinjection (Table 1). These results imply that virus is secreted and is stable in vivo. These signals were resistant to RNase and DNase pretreatment. The putative viral polymerase, NS5B, was detected by immunoprecipitation of radiolabeled cell lysates with anti-NS5B. Therefore, HCV stably replicates in HepG2 cells, and provides a long term culture of HCV suitable for a large variety of basic and applied studies.

Effect of Actinomycin D treatment on steady state levels of HCV RNA

Cultures of 7 x 10⁶ HepG2-HCV cells were treated for 72 hrs. with 0.4, 0.7, or 1.0 μg/ml with actinomycin D (Figure 7). Whole cell RNA was then extracted and subjected to semiquantitative HCV specific RT/PCR (Figure 7A). RNA from the same extractions were subjected to northern blot analysis with a G3PDH specific probe (Figure 7B). The results show a roughly 10-fold decrease in G3PDH mRNA, but no detectable decrease in HCV RNA. G3PDH mRNA, which is of cellular origin, is sensitive to inhibition by actinomycin D. The relative resistance of HCV RNA implies that some of the viral RNA derives from the action of the HCV polymerase, which is resistant to actinomycin D. Protection of HCV RNA from RNase A in the serum of SCID mice

SCID mice were each injected with 5 x 10⁶ HepG2-pRc/CMV-HCV cells or control HepG2-pRc/CMV cells. The mice were bled once every 10 days post injection for a total of 30 days. Some serum samples were pretreated with RNase, and after inactivation, the RNA was extracted and subjected to RT/PCR, and finally analyzed on 1.4% agarose gels (Figure 8). The spike (1 x 10⁵ copies) added just prior to RT/PCR consisted of HCV sequences containing an internal deletion that permitted faster migration on agarose gels relative to the viral amplicon. The gel containing the indicated samples was ethidium bromide stained.

Detection of RNA for HCV in the serum of SCID mice injected with HepG2-HCV

CsCl density equilibrium centrifugation was performed with serum samples obtained from SCID mice injected with HepG2-HCV cells 40 post injection prior to bleeding. RNA was extracted from each gradient fraction, and subjected to RT/PCR using primers (SEQ. ID. NO: 1 and 2) that spanned the 5' untranslated region of HCV (Figure 9, top gel) or primers that amplified the downstream neo gene in the pRc/CMV plasmid into which the full length HCV cDNA was cloned. The results show the presence of HCV, but not neo sequences, at a density of 1.1 gm/ml, implying that viral but not downstream plasmid sequences are transcribed and packaged.

Expression of NS5B in HepG2-HCV cells

HeρG2-pRc/CMV and HepG2-pRc/CMV-HCV cells were radiolabeled with 100 μCi/ml each of ³⁵S-cysteine plus ³⁵S-methionine for 3 hours. Cell lysates were prepared in standard RIP A buffer (4°C for 10 min), clarified, and immunoprecipitated with anti-NS5B or control serum, followed by protein G- agarose beads (Santa Cruz Biotech). The resulting material was washed 4X, collected by centrifugation (1000 x g for 5 min. at 4°C), and analyzed by SDS/PAGE and autoradiography (Figure 10). The results show the expected band at 68 kDa in HCV [+] (Figure 10, lane 2) but not HCV [-]cells (Figure 10, lane 1), implying the presence of the HCV RNA dependent RNA polymerase in infected cells only. This observation is consistent with virus replication. Uses of HepG2-HCV cells

The present invention relates to the stable integration of HCV into HepG2 cells, thereby allowing for the stable production of hepatitis C virus. In one embodiment of the present invention, this stable HCV producing cell line is used to study viral replication and maturation.

Mutations to the genome in the original wild-type hepatitis C virus clone are made using methodologies well known to those skilled in the art. These mutated viruses are then stably integrated into cells, as described supra, thereby producing cells that stably express a mutated virus genome. In one embodiment of the present invention, a mutation in a specific viral protein is introduced into the viral genome and the role of that viral protein in the replication or maturation of virus particles is determined. The present invention includes, but is not limited to, mutations in the active site of an enzyme, for example the NS5T polymerase or the NS3 protease. The HCV polymerase is necessary for replication of the viral genome and the protease is necessary for the processing of the virus polyprotein into mature, biologically active polypeptides. Replication and maturation of wild type virus in HepG2-HCV cells is used as a base line for replicative capacity, as well as for maturation of wild type hepatitis C virus. The replicative capacity and maturation of the stably integrated mutated hepatitis C virus is then determined and compared to the wild type. Assessing the effects of specific mutations upon replication and/or maturation of virus particles, will allow the role(s) of the respective viral proteins to be elucidated. The present invention identifies which proteins, and sites within these proteins, are most relevant targets for anti-viral intervention. Hepatitis C virus RNA replication in the cell lines stably expressing hepatitis

C virus is determined by Northern blot analysis of viral RNA extracted from purified intracellular core particles, as is well known to those skilled in the art. The same technique is used to determine mutated hepatitis C viral replication in cell lines expressing a mutated RNA genome of the hepatitis C virus. Cells stably expressing the hepatitis C virus, or a hepatitis C virus with a mutation in a gene, are lysed at 4.degree C by the addition of 500 .μl of a mixture containing TNE, 1 % Nonidet P-40 (NP40) and protease inhibitors (Boehringer Mannheim Corp. , Indianapolis, Ind.). The cell lysates are cleared of nuclei and cellular debris by centrifugation at 10,000. times. g for 1 min. Cell lysates are mixed with Laemmli sample buffer, boiled for 5 min, and electrophoresed through a 15% SDS-polyacrylamide gel (Protogel, National Diagnostics, Atlanta, Ga.). The separated proteins are then transferred onto Immobilon-PT.TM. membrane (Millipore Co., Bedford, Mass.) (Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor, Cold Spring Harbor, N.Y. 1988). Hepatitis C viral proteins are detected using peptide antisera raised against specific viral proteins, as is standard methodology. This antibody is used for immunoprecipitation of the protein, which is then analyzed by Western blot analysis. The same antibody is used for both immunoprecipitation and Western blot analysis. Bound antibody was revealed by a chemiluminescence method utilizing horseradish peroxidase-labeled goat anti-rabbit or anti-mouse IgG antibodies (SuperSignal.TM., Pierce, Rockford, 111.).

Screening of antiviral compounds

Cell lines expressing the hepatitis C virus are used to evaluate antibodies, peptides, or other molecules with therapeutic value in hepatitis C infections. Screening of organic or peptide libraries with cell lines expressing the hepatitis C virus are useful for identification of therapeutic molecules that function to inhibit or prevent viral replication and/or viral maturation. Synthetic and naturally occurring products are screened in a number of ways deemed routine to those skilled in the art. In general, these methodologies involve contacting the therapeutic agent with the cell line expressing the hepatitis C virus and measuring the efficacy of inhibiting or preventing viral replication or maturation.

In another embodiment of the present invention, viral based expression systems, specifically a retrovirus, adenovirus, or adeno-associated virus, are utilized. In cases where an adenovirus is used as an expression vector, a cloned therapeutic agent, including but not limited to, any cytokine, (such as interferon or interleukin), antisense molecule, ribozyme or anti-viral antibody fragment (sFv), is ligated to an adenovirus transcription/ translation control complex, e.g., the late promoter and tripartite leader sequence. This chimeric gene is then inserted in the adenovirus genome by recombination. Insertion in a non-essential region of the viral genome (e.g., region El or E3) will result in a recombinant virus that is viable and capable of expressing the cloned therapeutic agent in the stably producing hepatitis C virus cell line, (e.g., see Logan & Shenk, 1984, Proc. Natl. Acad. Sci. U.S.A. 81:3655-3659). Insertion of a therapeutic gene sequence into the stably producing hepatitis C virus cell line allows for therapeutic efficacy of gene therapy to be determined. The efficacy of the cloned therapeutic agent is assessed by its effect on viral replication and maturation. Efficacious agents are then used as gene therapy to treat individuals having hepatitis C infections. Oligonucleotide sequences, that include antisense RNA and DNA molecules and ribozymes that function to inhibit the translation of a viral mRNA are within the scope of the invention. "Antisense" as used herein refers to a nucleic acid capable of hybridizing to a portion of the hepatitis C virus RNA (preferably mRNA) by virtue of some sequence complementarity. Antisense RNA and DNA molecules act to directly block the translation of mRNA by binding to targeted mRNA and preventing protein translation. In regard to antisense DNA, oligodeoxyribonucleo tides derived from the translation initiation site, e.g., between -10 and + 10 regions of a hepatitis C virus nucleotide sequence, are preferred. The present invention provides for an antisense molecule comprising a nucleotide sequence complementary to at least a part of the coding sequence of a hepatitis C virus protein which is hybridizable to a hepatitis C virus mRNA. The present invention also provides for an antisense molecule comprising a nucleotide sequence complementary to at least a part of a non-coding sequence.

Ribozymes are enzymatic RNA molecules capable of catalyzing the specific cleavage of RNA. The mechanism of ribozyme action involves sequence specific hybridization of the ribozyme molecule to complementary target RNA, followed by an endonucleolytic cleavage. Within the scope of the invention are engineered hammerhead motif ribozyme molecules that specifically and efficiently catalyze endonucleolytic cleavage of HCV RNA sequences. Specific ribozyme cleavage sites within any potential RNA target are initially identified by scanning the target molecule for ribozyme cleavage sites which include the following sequences: GUA, GUU and GUC. Once identified, short RNA sequences of between 15 and 20 ribonucleotides corresponding to the region of the target gene containing the cleavage site are evaluated for predicted structural features such as secondary structure that may render the oligonucleotide sequence unsuitable. The suitability of candidate targets is also evaluated by testing their accessibility to hybridization with complementary oligonucleotides by using ribonuclease protection assays.

Screening therapeutic agents for their efficacy in inhibiting or preventing hepatitis C virus replication or maturation is carried out by titrating the amount of therapeutic agent added to the stably producing hepatitis C virus cells. Viral replication and/or mamration is then measured by any of a variety of commonly known methods. These methods include, but are not limited to, measuring changes in viral RNA transcription, levels of virus particles secreted, or changes in viral protein levels.

Claims

What is claimed is:

1. A cell line stably expressing a wild type hepatitis C virus.

2. A method of identifying a therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus replication, comprising: a) contacting a cell line stably expressing said hepatitis C virus with said therapeutic agent, and b) measuring changes in said hepatitis C virus replication.

3. A method of identifying a therapeutic agent efficacious in inhibiting or preventing a hepatitis C virus maturation, comprising: a) contacting a cell line stably expressing said hepatitis C virus with said therapeutic agent, and b) measuring changes in said hepatitis C virus maturation

4. A method of identifying an efficacy of a cloned therapeutic agent, comprising: a) inserting a therapeutic gene sequence into a stably producing hepatitis C virus cell line, and b) measuring viral replication and maturation.

5. A cell line stably expressing a mutated hepatitis C virus.

6. A method of studying viral replication and maturation, comprising: a) growing said cell line of claim 5 wherein said mutated hepatitis C virus is expressed, b) growing said cell line of claim 1 wherein said wild type hepatitis C virus is expressed, c) determining an amount of viral replication and maturation in step a), d) determining an amount of viral replication and maturation in step b), and analyzing an effect of a mutation in said mutated hepatitis C virus by comparing said viral replication and maturation of said mutated hepatitis C virus determined in step c) to that of wild type hepatitis C virus determined in step d).