EP0979092A2 - Allelic polygene diagnosis of reward deficiency syndrome and treatment - Google Patents

Allelic polygene diagnosis of reward deficiency syndrome and treatment

Info

Publication number
EP0979092A2
EP0979092A2 EP98920019A EP98920019A EP0979092A2 EP 0979092 A2 EP0979092 A2 EP 0979092A2 EP 98920019 A EP98920019 A EP 98920019A EP 98920019 A EP98920019 A EP 98920019A EP 0979092 A2 EP0979092 A2 EP 0979092A2
Authority
EP
European Patent Office
Prior art keywords
allele
gene
genes
adhd
rds
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Withdrawn
Application number
EP98920019A
Other languages
German (de)
French (fr)
Inventor
Kenneth Blum
David E. Comings
John L. Ivy
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Kenneth Blum Inc
City of Hope National Medical Center
University of Texas System
Original Assignee
KENNETH BLUM Inc
City of Hope National Medical Center
University of Texas System
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by KENNETH BLUM Inc, City of Hope National Medical Center, University of Texas System filed Critical KENNETH BLUM Inc
Publication of EP0979092A2 publication Critical patent/EP0979092A2/en
Withdrawn legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/195Carboxylic acids, e.g. valproic acid having an amino group
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K33/00Medicinal preparations containing inorganic active ingredients
    • A61K33/24Heavy metals; Compounds thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/465Nicotine; Derivatives thereof
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/555Heterocyclic compounds containing heavy metals, e.g. hemin, hematin, melarsoprol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/18Antipsychotics, i.e. neuroleptics; Drugs for mania or schizophrenia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/20Hypnotics; Sedatives
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/24Antidepressants
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/28Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00Drugs for disorders of the nervous system
    • A61P25/30Drugs for disorders of the nervous system for treating abuse or dependence
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/04Anorexiants; Antiobesity agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • This invention in part, relates to the coupling of certain anti-craving compositions and specific genotyping of a number of genes all involved in neurotransmitter function of reward behavior.
  • An aspect of this invention is the understanding of the involvement of how certain established neurotransmitters work in concert to activate neuropathways in the meso-limbic system of the brain leading to feelings of well being, and the development of compositions that affect these neuropathways.
  • This invention in part, relates to the utilization of precursor amino acids and certain herbal compounds to enhance attentional processing and memory as well increase focus in healthy individuals, as well as to enhance weight loss and control overeating.
  • diagnostic methods of neurological disorders and behaviors utilizing genetic polymorphisms of neurotransmitter genes, and therapeutic methods of treatment of patients so identified using the compositions ofthe invention. Also disclosed are diagnostic methods for polygenic traits.
  • the mesolimbic dopamine system connects structures high in the brain, especially the orbiofrontal cortex (in the prefrontal area behind the forehead) with the amygdala in the brain's center, and with the nucleus accumbens, which has been proven in animal research to be a major site of activity in addiction.
  • the various brain pathways involved in multiple addictions converge on certain dopaminergic receptors (DI, D2, D3, D4, D5) where the D2 site seems to be most prominent.
  • dopamine is released in the nucleus accumbens and the hippocampus (Koob and Bloom, 1988). Dopamine appears to be the primary neurotransmitter of reward at these reinforcement sites.
  • NA and the locus coeruleus (LC) play a role in arousal and vigilance, critical aspects of attention (Aston-Jones et al, 1984). It has been proposed that stress tolerance and good performance on tasks were related to low basal or tonic levels of catecholamines and to higher acute releases during mental stress (Traditionally, 1989). The opposite may occur in ADHD, with an increased baseline tonic stimulation of NA and a decreased release of catecholamines during stress (Pliszka et al, 1996).
  • MHPG 3-methoxy-4-hydroxyphenylglycol
  • d-amphetamine and desipramine both of which are commonly used in the treatment of ADHD, lead to a significant decrease in the excretion of MHPG has been proposed (Mefford and Potter, 1989; Shekim et al, 1979).
  • methylphenidate (Ritalin) the most commonly prescribed medication for the treatment of ADHD does not result in a decrease in MHPG excretion (Zametkin et al, 1985) and other medications that reduce MHPG excretion, such as fenfluramine (Donnelly et al, 1989), are not effective in the treatment of ADHD.
  • NA and adrenergic ⁇ 2-receptors played a role in some forms of ADHD through a dysregulation at the LC of the posterior cortical attention system (Posner and Peterson, 1990; Pliszka 1996) of the parietal/temporal lobes, and that a second form of ADHD was due to dopaminergic defects that primarily affected the prefrontal lobe attentional system which was associated with impulsivity and disorders of executive dysfunction.
  • D2 receptor Comings et al, 1991
  • D4 dopamine D 4 receptor
  • DAT dopamine transporter
  • ADHD + cognitive disorders was due to a dysregulation of NA metabolism of the LC involving adrenergic ⁇ 2 receptors, and primarily affected the posterior attention system ofthe parietal cortex (Halperin et al, YEAR) Since these brain areas are in proximity to auditory and linguistic processing regions, this could account for the comorbid cognitive disabilities. It would be a mistake to assume that these are pure forms since ADHD is a polygenic disorder (Comings et al, 1996), and most individuals are likely to have inherited genes for both types. Studies in primates show that NA and defects in adrenergic ⁇ 2 receptors also play a role in prefrontal lobe cognitive defects (Arnsten, 1997).
  • neurotransmitters involved in the biology of reward is complex, at least three other neurotransmitters are known to be involved at several sites in the brain: serotonin in the hypothalamus, the enkephalins (opioid peptides) in the ventral tegmental area and the nucleus accumbens, and the inhibitory neurotransmitter GABA in the Substantia nigra, ventral tegmental area and the nucleus accumbens (Stein and Belluzzi, 1986; Blum and Kozlowski, 1990).
  • GABA GABA
  • the glucose receptor is an important link between the serotonergic system and the opioid peptides in the hypothalamus.
  • An alternative reward pathway involves the release of norepinephrine in the hippocampus from neuronal fibers that originate in the locus coeruleus.
  • alcohol preferring rats When compared to normal non-alcohol preferring rats, alcohol preferring rats have fewer serotonin neurons in the hypothalamus, higher levels of enkephalins in the hypothalamus (because less is released), more GABA neurons in the nucleus accumbens and a lower density of D2 receptors in certain areas of the limbic system (McBride et al, 1995; Smith et al, 1997; and McBride et al, 1997).
  • Androgent Receptor gene Specific mutations of the AR gene have been reported to cause a wide range of types of androgen insensitivity syndromes (Gott Kunststoff et al, 1977).
  • two sets of polymorphic tricnucleotide repeat sequences, CAG (Edwards et al, 1992) and GGC (Sleddens et al, 1993; Sleddens et al, 1992), resulting in polyamino acid tracts in the protein, are present in the first exon of the AR gene.
  • CAG trinucleotide repeat When highly expanded, from 43 to 65 times, the CAG trinucleotide repeat has been shown to cause X-linked spinal muscular atrophy (La Spada et al, 1991).
  • the repeat length in the normal population is 11 to 31 times (Edwards et al, 1992).
  • the non-highly expanded alleles of micro- and minisatellites present in the normal population might play a direct role in the regulation of genes. This was based on the observation that most short tandem repeats are associated with the formation of Z-DNA (Schroth et al, 1992), and Z-DNA has repeatedly been implicated in various aspects of gene regulation (Rich et al, 1984; Hamada et al, 1982; Wolff et al, 1996). Since the amount of Z-DNA formed is highly sensitive to the length of the repeats (Schroth et al, 1992), it was suggested that the size of the repeat alleles could themselves be related to phenotypic effects (Comings, 1997).
  • the opposing effect of the Dj and D 2 receptor agonists on cocaine seeking behavior in rats have been reported (Self et al, 1996).
  • TD probands, smokers, and pathological gamblers were consistent with negative heterosis, in that the most consistent difference was a relative decrease in the frequency of 12 heterozygotes and an increase in 11 and 22 homozygotes of the Dde 1 polymorphism (Comings et al. (1996)).
  • positive heterosis was present at the DRD2 gene, with quantitative scores being highest for 12 heterozygotes and lowest for 11 and 22 homozygotes. While the results for ADHD at the DRDl locus alone was not significant, there was a significant additive effect of examining the presence of negative heterosis at the DRDl gene and/or positive heterosis at the DRD2 gene (Comings et al, 1997k).
  • D2A1 Dopamine D2 Receptor Gene
  • the Taql D2 Al carriers showed a significantly lower relative glucose metabolism in the putamen, nucleus accumbens, frontal and temporal gyri and medial prefrontal, occipito-temporal and orbital cortices than those with the A22 genotype (Nobel et al, 1997).
  • the Taql D2 Al carriers had a significantly decreased dopamine D2 receptor B max in the basal ganglia (Noble et al, 1991k).
  • Enkephalin increases blood flow in similar regions as methylphenidate and may therefore involve a dopaminergic mechanism (Blum et al, 1985k).
  • a significant decrease in dopamine D2 receptor density was measured in individuals with detachment, social isolation, and lack of intimate friendships (Farde et al, 1997k).
  • the DRD 2 gene A allele has been found to associate with a number of behaviors including severe alcoholism, polysubstance dependence, crack/cocaine addiction, tobacco smoking, pathological gambling, lack of a major depressive episode, and carbohydrate bingeing or generalized to DSM- IV substance use disorder (Blum et al, 1996e; Blum et al, 1995b; Comings et al, 1996c).
  • the MCMI-II assessed schizoid/avoidant cluster compared to other Axis II diagnostic clusters (antisocial, narcissistic, paranoid) significantly correlated with alcohol abuse scales (Corbisiero et al, 1991).
  • CSF HVA levels and the DRD2 Taql Al I 2 polymorphism were examined in Finnish and American alcoholics, and no association was found when examining the 1 vs. 2 alleles, and not the 1 ,1+1,2 vs. the 2,2 genotypes (Goldman et al, 1992).
  • Heterosis at the DRD2 gene was indicated by comparison of the CSF levels of HVA, to the DRD2 genotype using Taql polymorphism (Jonsson et al, 1996k).
  • the 12 heterozygotes showed the highest inattention score subjects who were 12 heterozygotes had the lowest levels of CSF HVA (Jonsson et al, 1996).
  • the highest levels of HVA were seen in the 11 homozygotes, with the 22 homozygotes being intermediate.
  • ADHD probands showed a significant association with the 48bp variant of the D4 gene, but not the DRD2, DRD3 or the serotonin transporter genes.
  • the 7-fold repeat allele of the DRD4 occurred significantly more frequently in that children with ADHD.
  • novelty seeking characterized as impulsive, exploratory, fickle, excitable, quick tempered and obsolete
  • DRD2 Al allele in cocaine dependent probands was associated with the opposite: low novelty seeking, characterized by reflective, rigid, stoic, slow-tempered, avoidant, as well as having enhanced withdrawal depression (Compton et al, 1996).
  • D 2 dopamine receptor (DRD2) Al allele with alcoholism and drug abuse (Blum et al, 1990).
  • Reduced central dopaminergic function has been suggested in subjects who carry the Al allele (Al + ) compared with those who do not (AT) (Nobel et al 1997).
  • the genes responsible for alcoholism are unknown, although the many studies to date indicate a significant role for the DRD2 gene in more severe cases (Noble, 1993; Blum et al, 1995).
  • the DRD2 gene has been associated with the compulsive behavior ⁇ Comings and Comings, 1987b) and addictive, impulsive behaviors, including compulsive eating, gambling and smoking. (Self et al, 1996; Ogilvie et al, 1996; Blum et al, 1995b; Blum et al, 1996e). These behaviors have previously been reported to be associated with the DRD2 gene (Comings et al, 1993a; Noble et al, 1994d; Blum et al, 1996a; Comings et al, 1996c; Noble et al, 1994c; Noble, 1993; Comings et al, 1996e) in subjects distinct from the TS group.
  • Dopamine D2 receptor availability was significantly lower in alcoholics than in nonalcoholics, and was not correlated with days since last alcohol use (Volkow et al, 1997).
  • the ratio DRD2 receptor to transporter availability was significantly higher in nonalcoholics than in alcoholics.
  • Alcoholics showed significant reductions in D2 receptors (postsynaptic marker) but not in DA transporter availability tpresynaptic marker) when compared with nonalcoholics. Because D2 receptors in striatum are mainly localized in GABA cells, these results provide evidence of GABAergic involvement in the dopaminergic abnormalities seen in alcoholics.
  • DRD3 Dopamine D 3 Receptor Gene
  • DRD4 a 48 bp and 16 amino-acid repeat polymorphism within the DNA coding for the third cytoplasmic loop responsible for binding to guanine -nucleotide proteins (Van Tol et al, 1992k; Lichter et al, 1993k) has been reported. This DNA region is repeated 2 to 1 1 times, with the most common alleles being the 2, 4, and 7 repeat. The 7 allele demonstrates a blunted response to dopamine in regards to intracellular adenyl cyclase inhibition (Asghari et al, 1995k).
  • DAT1 Dopamine Transporter Gene
  • the DAT1 gene marker frequencies at the vesicular transporter locus showed substantial heterogeneity in different Caucasian-Americans originating from different European countries, but no association with substance abuse was evident (Uhl et al, 1993; Persico et al, 1993). Distributions of the DAT1 VNTR alleles do not distinguish any substance user or control sample for psychostimulant abusers (Persico et al, 1996), however an association was observed with Japanese alcoholics (Muramatsu and Higuchi, 1995). The DAT1 gene has also been implicated as having a role in compulsive and addictive disorders.
  • Dopamine- ⁇ -Hydroxylase D ⁇ H is one of the major enzymes for dopamine metabolism and catalyzes the conversion of dopamine to norepinephrine (NE).
  • NE norepinephrine
  • the inhibition of D ⁇ H activity results in a decrease in norepinephrine levels which releases the inhibition of tyrosine hydroxylase resulting in the excessive production of dopamine.
  • the later is associated with hyperactivity, aggression, self- stimulation, and stereotypic movements (Randrup and Scheel-Kruger, 1966; Shekin et al, 1983k).
  • D ⁇ H dopamine-Beta-hydroxylase
  • Linkage studies between the D ⁇ H locus and schizophrenia (Aschauer and Meszaros, 1994), alcoholism, depression, manic- depression and Tourette's syndrome (Comings, et al, 1986) have been negative.
  • sib pair analyses suggest a weak linkage between the ABO blood group and D ⁇ H, and some psychiatric disorders such as depression and alcoholism (Wilson et al, 1992).
  • Cannabinoid Receptors While the association of cannabinoid receptors with the reward pathways may be primary, it is more likely that the effect is secondary through the modulating effect of anandaide and cannabinoid receptors on dopamine metabolism. This is consistent with the similarity between the results with CB1 receptors and the DRD2 receptors. Like the CB1 gene the association of genetic variants of the DRD2 gene with polysubstance abuse has been more reproducible (O ⁇ ara et al, 1993; Smith et al, 1992; Noble et al, 1993; Comings et al, 1994) than the association with alcoholism per se. One interpretation of these observations is that the dopaminergic-cannabinoid reward pathways are activated more by drugs, especially cocaine and amphetamines, than by alcohol (DiChiara and Imperato. 1988).
  • Activation of the mesolimbic dopamine system is known to trigger a relapse to cocaine seeking behavior in animal models of drug dependence.
  • This priming effect is enhanced by dopamine D 2 agonists but inhibited by dopamine D, agonists (Self et al 1996).
  • the ability of anandamide to cause a decrease in the ratio of D, and D 2 receptors in the striatum may be the link that accounts for the role of CB1 variants in drug dependence.
  • Tivol et al (1996) have recently sequenced the exons of 40 control males who showed a > 100-fold variation in MAO A enzyme activity. There was remarkable conservation of the coding sequence. Only five polymorphisms were found. Of these, four involved the third codon position with no change in the amino acid sequence. The other was a neutral lys — arg substitution.
  • Nicotine Receptor Genes The gene for the CHRNA4 gene is located on chromosome 20ql3.2-13.3 (Steinlein et al, 1994) and consists of 6 exons over 17 kb of genomic DNA (Steinlein et al, 1996).
  • a Ser248Phe missense mutation in the transmembrane domain 2 of the CHRNA4 gene was found to be associated with autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) in one extended
  • EEG (Steinlein et al, 1992) have also been linked to the region of the CHRNA4 locus. D20S19, a highly polymo ⁇ hic locus, is in tight linkage with the genes for all three of these disorders (Steinlein et al, 1996).
  • VNTR polymo ⁇ hism located in the first intron of the CHRNA4 gene was reported by Weiland and Steinlein (Weiland and Steinlein).
  • Ser248Phe missense mutation associated with ADNFLE and four silent polymo ⁇ hisms, Steinlein et al, Ser248Phe missense mutation reported a modest increase in the frequency of the T allele of the Cfol 595 polymo ⁇ hism in common idiopathic generalized epilepsies of childhood (.085) versus controls (.027).
  • Micro/minisatellite polymorphisms Studies of behavioral phenotypes associated with micro/minisatellite polymo ⁇ hisms at different neuropsychiatric candidate genes have found a significant association between the shorter or longer alleles with various quantitative behavioral traits and mini- or microsatellites at the following genes: MAOA, MAOB, HTR1A, DATl, DRD4, HRAS, HTT, OB, CNR1, GABRA3, GABRB3, FRAJXA, and NO (Comings et al, 1996k; Comings et al, 19961; Comings et al, 1996m; Johnson et al. 1997; Comings et al, 1998; Gade et al, 1997).
  • Taql polymorhisms of the apolipoprotein gene ⁇ APOE-D was found to associate with obese subjects and between the APO-D and fasting-insulin. This work suggests that that the APO-D polymo ⁇ hism may be a genetic marker for both obesity and hyperinsulinemia (Vijayaraghavan et al, 1994).
  • catecholamine innervation of the cerebral cortex may be the control of attention.
  • catecholamine projections to the cerebral cortex from the reticular formation namely dopamine neurons in the ventral tegmentum of the midbrain and the NE neurons of the locus coeruleus in the upper pons.
  • ACH acetylcholinergic
  • DA dopaminergic systems
  • Choice accuracy deficit induced by blockade of either muscarinic- or nicotinic-ACH receptors The choice accuracy deficit induced by blockade of muscarinic receptors with scopolamine can be reversed by the dopamine receptor blocker, haloperidol.
  • the specific DAD1 blocker SCH23390 also has this effect, whereas the specific D 2 blocker raclopride did not. This effect is seen with the D 2 antagonist raclopride, but not with the Dj antagonist SCH23390.
  • the D 2 receptor was indicated in nicotinic actions on cognitive function by the finding that the selective D 2 agonist LY 1771555 reverses the choice accuracy deficit caused by mecamylamine.
  • the effectiveness of these selective DA treatments in reversing cognitive deficits was due to ACH under-activation (Levin et al. 1990k).
  • NE Norepinephrine
  • LC coeruleo- cortical
  • SP neurokinin substance P
  • N-terminal SP1-7 enhanced memory
  • C-hepta- and hexapeptidsequences of SP proved to be reinforcing in a dose equimolar to SP.
  • bromocriptine a D 2 dopamine receptor agonist
  • This form of memory in which some aspect of a stimulus is maintained over a short interval of time, has also been found to be closely tied to prefrontal cortical function in both lesion and single unit recording studies with monkeys and in neuro-imaging studies in humans (Goldman et al, 1987k; Jonidas et al, 1993).
  • a selective positive effect of bromocryptine, in reducing release rates in alcoholics as a function of dopamine D 2 receptor genotype has also been reported.
  • a double-blind study demonstrated that a D 2 agonist bromocryptine or a placebo administered to alcoholics who were carriers of the Al allele (Al/Nl and A1/A2 genotypes), or who only carried the A2 allele (A2/A2) reduced craving and anxiety among the Al carriers who were treated with bromocryptine.
  • the attrition rate was highest among the Al carriers who were treated with placebo.
  • the bromocryptine effect on the Al carriers was much more robust as one approached the six wk period of treatment.
  • Dopamine D 2 agonist bromocryptine can improve higher- level cognitive functions. Studies using sophisticated techniques in animals, including microdialysis measurements, have demonstrated changes in neurotransmitter output following precursor amino acid loading (Hernandez et al, 1988).
  • phenylalanine deficiency PHD
  • phenylalanine and tyrosine constitute the two initial steps in the biosynthesis of dopamine, which, in its turn, is the metabolic precursor of NE.
  • the extracellular phenylalanine concentration influences brain function in PHD by decreased dopamine synthesis. It has been shown to induce EEG slowing and has prolonged the performance time on neuropsychological tests.
  • the tyrosine concentration in the CNS is reduced in PHD, possibly implying an insufficient substrate of tyrosine for catecholamine synthesis due to competition inhibition, for instance across the blood brain barrier.
  • a combination of precursor amino acids having enkephalinase inhibition activity may be used for the treatment of cocaine dependence (U. S. Patent No. 5,189,064). It is known that acute use of cocaine can improve certain aspects of brain electrophysiological dysfunction (Maurer et al, 1988k). Chronic cocaine abuse alters attentional processing (Noldy et al, 1990k). It is known that acute use of cocaine can improve certain aspects of brain electrophysiological dysfunction (Jonsson et al, 1996). However, paradoxically, chronic cocaine abuse alters attentional processing (Braverman and Blum, 1996). Although still controversial, attentional processing has been shown to be dependent on biogenic amine regulation (Lyoo et al, 1996).
  • Obesity and Neurological Functions Obesity generally is defined as being 20% or more over ideal body weight. Numerous methods of weight reduction have been attempted including hypocaloric balanced diets, "fad” diets, behavior modification, drugs ⁇ i.e. D-phenflouramine, phenteramine, etc.), surgery, total starvation, jaw wiring, and combinations of these methods. Most of these are short- term approaches to the problem and have been only transiently effective and some can even pose serious danger (Lockwood and Amatruda, 1984). Even if weight loss is demonstrated in the short-term, the weight usually is regained following discontinuation of the weight-loss regiment. Despite the fact that about 28% of the American population is obese, obesity is widely perceived as a food-addiction, a self- imposed condition with cosmetic rather than health indications (Krai et al, 1989; Weintraub and Bray, 1989).
  • D2 receptor D2
  • DATl dopamine transporter
  • the primary neurotransmitters involved in eating behavior include the monoamines dopamine (DA), norepinephrine (Ne), epinephrine (EPI), and serotonin (5-HT); the inhibitory neurotransmitter gamma-aminobutyric (GABA); and a variety of neuropeptides such as the pancreatic polypeptides, opioid peptides, hormone-releasing factors, and various gut-brain peptides (for reviews see Cooper et al, 1988; Gosnell, 1987; Bouchard, 1994).
  • DA dopamine
  • Ne norepinephrine
  • EPI epinephrine
  • serotonin 5-HT
  • GABA inhibitory neurotransmitter gamma-aminobutyric
  • neuropeptides such as the pancreatic polypeptides, opioid peptides, hormone-releasing factors, and various gut-brain peptides (for reviews see Cooper et al, 1988; Gosnell, 1987;
  • Nicotine Nicotine also releases dopamine, and nicotine has been found to improve memory performance in a variety of tests in rats, monkeys, and humans (DiChiara et al, 1988). Nicotine in a dose dependent fashion reduced incorrect responding on discrimination behavior in rats (Geller et al, 1970). This effect was similar to chlordiazepoxide but could not be mimicked by the stimulant caffeine (Geller et al, 1970).
  • Nicotine in the form of gum or skin patches (Sanberg et al, 1988; McConville et al, 1992; Sanberg et al, 1997) has been shown to be effective in the treatment of tics in some subjects with Tourette syndrome (TS), and cigarette smoking has been reported to enhance attention, arousal, learning and memory (Wesnes and Warburton, 1984; Warburton, 1992; Balfour and Fagerstr ⁇ m, 1996) and to improve the symptoms of ADHD (Coger et al, 1996; Conners et al, 1996; Levin et al, 1996).
  • the working memory deficit caused by the nicotinic antagonist mecamylamine was potentiated by the D1/D2 DA antagonists haloperidol and the specific D 2 antagonist raclopride.
  • the mecamylamine- induced deficit was reversed by co-administration of the D2/D3 agonist quinpirole.
  • Nicotine also has significant interactions with dopamine drugs with regard to working memory performance in the radial-arm maze.
  • the dopamine agonist pergolide did not by itself improve radial-arm choice accuracy. Nicotine was effective in reversing this deficit.
  • the D2/D3 agonist quinpirole improved RAM choice accuracy relative to either drug alone.
  • Acute local infusion of mecamylamine to the midbrain dopamine nuclei effectively impairs working memory function in the radial-arm (Noble et al, 1998).
  • Chromium Salts Trivalent chromium is a mineral essential for normal insulin function (Jeejeehboy et al, 1977; Schwartz et al, 1959).
  • CAD coronary artery disease
  • NIDDM non-insulin- dependent diabetes mellitus
  • Chromium Picolinate (CrP) is the most heavily used, studied and promoted chromium compound, but in vitro work suggests that chromium nicotinate may be also viable in the area of weight loss and changes in body composition.
  • Previous research has shown chromium picolinate supplementation decreasing fat mass and increasing fat- free mass (Kaats et al, 1991 ; Page et al, 1991). Pervious studies of exercise training have shown increases in fat free mass as well (Stefanick, 1993).
  • Nutritional Supplements in Treatment of Behavioral Disorders may underlay a variety of psychiatric and behavioral disorders (Blum et al, 1996c; Persico and Uhl, 1997; Noble et al, 1991). Specifically, anomalous regulation of dopamine, serotonin, norepinephrine, gammaminobutyric acid (GABA), glutamine, and the opioid peptides are thought to play crucial roles in the addictive disorders, particularly those involving alcohol and cocaine abuse (Pohjalainen et al, 1996). Consequently, these observations have provided momentum to the idea that ingestion of selected nutrients could affect mood and therefore behavior in humans.
  • GABA gammaminobutyric acid
  • the invention first provides a composition for the treatment of Reward Deficiency Syndrome (RDS) behaviors in a subject.
  • this composition includes at least one of the following components: an opiate destruction- inhibiting amount of at least one substance which inhibits the enzymatic destruction of a neuropeptidyl opiate, the substance being either amino acids, peptides.
  • a neurotransmitter synthesis-promoting amount of at least one neurotransmitter precursor the neurotransmitter precursor being either a dopamine precursor such as L-Tyr, L-Phe and L-dopa, a serotonin precursor such as L-T ⁇ and 5-hydroxytryptophan, or a gamma amino butyric acid (GABA) precursor such as L-glutamine, L-glutamic acid, and L-glutamate; a tryptophan concentration enhancing amount of chromium picolinate or chromium nicotinate; a compound that releases enkephaline, the enkephaline releaser being, but not limited to, a peptide, and preferably a D-amino acid containing peptide; or an opiate antagonist amount of at least one compound which blocks the effects of an opiate at either the delta, mu, kappa, sigma, or epsilon receptors.
  • GABA gamma amino butyric acid
  • the composition is used in preventing or reducing a subject's unwanted weight.
  • the composition is preferably used in the treatment of Attention Deficits disorder, attentional processing or memory.
  • the composition more preferably includes a neurotransmitter synthesis-promoting amount of at least one neurotransmitter synthesis promoting substance selected from the group Rhodila or hubazine.
  • a neurotransmitter synthesis-promoting amount of at least one neurotransmitter synthesis promoting substance selected from the group Rhodila or hubazine.
  • derivative may refer to a chemically modified compound, and “analog” refers to a different compound that is similar properties or structure to the compound it is being compared.
  • this composition may be used in the treatment of all RDS related behaviors disclosed herein.
  • RDS behaviors are those behaviors related to a chemical imbalance manifests itself as one or more behavioral disorders related to an individual's feeling of well-being with anxiety, anger or a craving for a substance.
  • RDS behaviors include, alcoholism, SUD, smoking, BMI or obesity, pathological gambling, carbohydrate bingeing, axis 1 1 diagnosis, SAB, ADD/ADHD, CD, TS, family history of SUD, and Obesity, are described herein.
  • the invention also provides a method of treating a subject for RDS behaviors, including but not limited to SUD, Obesity, Smoking, Tourettes Syndrome, ADHD, Schizoid/Avoidant Behavior, Aggression, Posttraumatic stress syndrome, PMS or tobacco use.
  • RDS behaviors are not specifically limited to these disorders, as many types of sub-disorders are encompassed by these conditions.
  • attention deficit hyperactivity disorder may manifest itself as alcohol, drugs, obsessive compulsive behaviors, learning disorders, reading problems, gambling, manic symptoms, phobias, panic attacks, oppositional defiant behavior, conduct disorder, academic problems in grade school, smoking, sexual behaviors, schizoid, somatization, depression, sleep disorders, general anxiety, stuttering, and tics disorders. All these behaviors, and others described herein as associated with RDS behaviors or genes involved in the neurological pathways related to RDS, are included as RDS behaviors as part of this invention.
  • Sleep Disorders including Primary Sleep Disorders such as Dyssomnias which include Primary Insomnia 307.42, Primary Hypersomnia 307.44, Narcolepsy 347, Circadian Rhythm Sleep Disorder, 307.45, Dyssomnia NOS 307.47, Parasomnias which include Nightmare Disorder 307.47, Sleep Terror Disorder 307.46, Sleepwalking Disorder 307.46, Parasomnia NOS 307.47, Sleep Disorders Related to Another Mental Disorder which include
  • Cannabis-Induced Psychotic Disorder with hallucinations 292.12, Cannabis- Induced Anxiety Disorder, 292.89, Cannabis Related Disorder NOS, 292.9, Cannabis Intoxication, 292.89, Cocaine Related Disorders which include Cocaine Dependence, 304.20, Cocaine Abuse, 305.60, Cocaine Intoxication. 292.89, Cocaine Withdrawal, 292.0, Cocaine Intoxication Delirium, 292.81 , Cocaine-Induced Psychotic Disorder with delusions, 292.1 1, Cocaine-Induced Psychotic Disorders with hallucinations,
  • Opioid Abuse 305.50, Opioid Intoxication, 292.89, Opioid Intoxication Delirium, 292.81, Opioid-Induced Psychotic Disorder, with delusions, 292.11, Opioid-Induced Psychotic Disorder with hallucinations, 292.12, Opioid-Induced Anxiety Disorder, 292.89, Opioid Related Disorder NOS, 292.9, Opioid Intoxication, 292.89, Opioid Withdrawal, 292.0; Polysubstance Related Disorders which include Polysubstance Dependence, 304.80; Tic Disorders which include Tourette's Disorder, 307.23, Chronic Motor or Vocal Tic Disorder 307.22, Transient Tic Disorder 307.21, Tic Disorder NOS 307.20, Stuttering 307.0, Autistic Disorder, 299.00, and Somatization Disorder 300.81.
  • RDS disorders are defined as would be known to one of skill in the art, such as Novelty Seeking, defined in (Clonigen et al, 1993).
  • Other disorders, if not specifically defined herein, are the same as commonly known to one of skill in the art, including common abbreviations.
  • the amount of each of the above mentioned compounds administered daily for use in the treatment of RDS behaviors or disorders may be of about 1, about 2, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 1 1, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24. about 25, about 26, about 27, about 28, about 29, about 30, about 31 , about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40.
  • the preferred ranges and components of the composition are 460 mg DL- phenylalanine, 25 mg L-tryptophan, 25 mg L-glutamine, and 5 mg pyridoxal -5'- phosphate administered daily.
  • the subject is tested using the methods disclosed herein or known to one of skill in the art to determine whether the subject has a family history of chemical dependency, wherein the family history indicates an improved likelihood for successful treatment.
  • the treatment inhibits binge eating.
  • the treatment inhibits craving.
  • the composition contains chromium salts.
  • a subject is tested using a molecular biology assay, as described herein, for an allele associated with an RDS or psychological behavior, and the presence of such an diagnostic allele is indicative a subject more likely to respond positively to the compositions disclosed herein for therapy.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one ofthe following alleles: D 2 Taql Al, BI, Cl or exon " haplotype HTR2A - C allele homozygous OB - homozygosity for ⁇ 208 BP alleles of 1875 dinucleotide repeat polymo ⁇ hism human chromosome 2 microsatellite polymo ⁇ hism, APO-D - Taql 2.2 or 2.7 BP, or OB gene D7S1875, where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
  • alleles D 2 Taql Al, BI, Cl or exon " haplotype HTR2A - C allele homozygous OB - homozygosity for ⁇ 208 BP alleles of 1875 dinucleotide repeat polymo ⁇ hism human chromosome 2 microsatellite
  • the composition includes an effective amount of chromium nicotinate, and the subject is tested for the presence of the DRD2 Al allele, wherein the presence of the DRD2 Al allele indicates an improved likelihood of response using the treatment.
  • the composition includes an effective amount of chromium picolinate, and the subject is tested for the presence of the DRD2 A2 allele, wherein the presence of the DRD2 Al allele indicates an improved likelihood of response using the treatment.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles: DI (homozygosity of Dde Al) D2 ⁇ Taql Al) D4 (VNTR 2) D5 (dinucleotide 13 alleles range 135-159 BP) DATl VNTR (10/10) D ⁇ H ⁇ Taql BI allele), where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
  • DI homozygosity of Dde Al
  • D2 ⁇ Taql Al) D4 (VNTR 2)
  • D5 dinucleotide 13 alleles range 135-159 BP)
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles: DI (homozygosity of Dde Al) D2 ⁇ Taql 1) D4 (VNTR 2) D5 (dinucleotide 13 alleles range 135-159 BP) DATl VNTR (10/10) D ⁇ H ⁇ Taql BI allele) MAOA(X), where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
  • the composition includes an effective amount of Rhodila or hubazine.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles DI (homozygosity of Dde Al) D2 (Taql Al, BI, Cl), where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
  • DI homozygosity of Dde Al
  • D2 Taql Al, BI, Cl
  • RDS behavior further comprises pathological violence, Schizoid/ Avoidant (SAB), Aggression, Anger,
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles D2 ⁇ Taql Al, BI, Cl, exon 6"7 ) DATl (VNTR 10/10) mNOSIa - homozygosity for ⁇ 201 BP, where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the alleles from the DATl VNTR (10/10) D 2 Taql Al, BI, Cl, exon 6"7 haplotype, or alleles from the DRDl, DRD2, DRD4, HTT, HTRIA, TDO2, D ⁇ H, MAO, COMT, GABRAB, GABRB3, PENk, ADRA2A or ADRN2C genes, where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
  • the invention further provides a method of determining a genetic predisposition of a subject to at least one RDS behavior, by detecting at least one allele from the group including, but not limited to the DRDl, DRD2, DRD3, DRD4, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A, ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDAR1, PENK, AR, CRF, HTRlD , HTR2A, HTR2C, interferon- ⁇ , CD8A, or RS7 genes, where the allele is diagnostic for an RDS behavior.
  • the allele is diagnostic for an RDS behavior.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of at least one is a V ⁇ TR polymo ⁇ hism of a MAOA gene allele, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including mania, OCD, sexual, sleep, grade school behavior, gambling, learning, inattention, ADHD, ADDR, impulsivity, MDE, CD, hyperactivity, phobia, schizoid behavior, general anxiety, somatization, drugs, IV drugs, read, ODD, tics, alcohol, or tobacco use.
  • an RDS behavior including mania, OCD, sexual, sleep, grade school behavior, gambling, learning, inattention, ADHD, ADDR, impulsivity, MDE, CD, hyperactivity, phobia, schizoid behavior, general anxiety, somatization, drugs, IV drugs, read, ODD, tics, alcohol, or tobacco use.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of at least one DRD 2 gene A, allele, the DAT gene, V ⁇ TR 10/10 allele, or the D ⁇ H gene B, allele, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including schizoid or Avoidant.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of an increased number of (NAT) n triplet repeats in the CNRl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including Drug Use.
  • NAT molecular biological assay
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of an increased number of the D7S1873, D7S1875, D7S514 or D7S680 dinucleotide repeats in the OB gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior including obesity, anxiety, depression, psychoses, hostility, paranoid ideation, obsessive-compulsive, symptom total, general symptom index, novelty seeking, overall total, neurotogni and conscientiousness.
  • an RDS behavior including obesity, anxiety, depression, psychoses, hostility, paranoid ideation, obsessive-compulsive, symptom total, general symptom index, novelty seeking, overall total, neurotognitiveness.
  • the allele is the D7S1875 dinucleotide repeats is greater than 225 bp in length, and this allele is present in both copies of the CNR/ gene.
  • another allele detected is the D2AI allele of the DRD2 gene.
  • the RDS behavior is obesity.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the D2AI allele of the DRD2 gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including Tourette's Syndrome, manic symptoms, oppositional defiant, sexual, ADHD-R, schizoid, ADHD, tics, major depression, conduct, stuttering, obsessive-compulsive, somatization, alcohol abuse, learning, and sleep problems.
  • a genetic predisposition to an RDS behavior including Tourette's Syndrome, manic symptoms, oppositional defiant, sexual, ADHD-R, schizoid, ADHD, tics, major depression, conduct, stuttering, obsessive-compulsive, somatization, alcohol abuse, learning, and sleep problems.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Taq Al allele of the D ⁇ H gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including Tourette's Syndrome, ADHD, smoking, learn, grade school, ADHD-R, oppositional defiant, tics, mania, alcohol, reading, drug abuse, sleep, stuttering, obsessive compulsive, somatization and major depression.
  • the alleles detected are the Taq BI allele and the Taq Al allele of the D ⁇ H gene, and that the RDS behavior is Tourette's Syndrome.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 10 allele of the DATl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an Tourette's syndrome, autism, somatization, alcohol, AD ⁇ D-R, major depression, panic, obsessive compulsive, general anxiety, mania, oppositional defiant, sexual, read, and ADHD.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 10 allele of the DATl gene, the Taq Al allele of the D ⁇ H gene, or the D 2 A1 allele of the DRD2 gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to ADHD, stuttering, ADHD-R, oppositional, defiant, tics, conduct, obsessive compulsive, mania, alcohol, general anxiety, panic schizoid, sleep, sexual, drugs, and major depression.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Ddel allele of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to alcohol, smoking, compulsive eating, tics, gambling, drugs, reading, shopping, oppositional defiant, major depressive episode, schizoid, ADHD, conduct disorder, obsessive compulsive, and mania.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Taql Al and the Taql A2 alleles of the DRD2 gene, wherein the presence of those alleles are diagnostic for a subject with a genetic predisposition to oppositional defiant, conduct disorder, eating, smoking, gambling, ADHD, obsessive compulsive, mania, and alcohol.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 1 1 or the 22 genotype of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to Tourettes syndrome, smoking, and gambling.
  • the alleles detected are two copies per genome ofthe Ddel allele ofthe DRDl gene.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 1 1 genotype of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to oppositional defiant behavior, conduct disorder, compulsive eating, smoking, gambling, ADHD mania, stuttering, obsessive-compulsive, and schizoid behaviors.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Ddel allele of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising gambling, smoking, compulsive eating, oppositional defiant, major depressive episode, ADHD, conduct disorder, schizoid, obsessive-compulsive, mania, and alcohol.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 1 1 or the 22 genotype of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising alcohol, smoking, compulsive eating, tics, gambling, drugs, reading, shopping, gambling, and grade school problems.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the intron 6 G ⁇ A polymo ⁇ hism of the Tryptophan 2,3 dioxygenase gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising Tourettes Syndrome.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the intron 6 G— T polymo ⁇ hism of the Tryptophan 2,3 dioxygenase gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising ADHD, alcohol dependence, drug dependence, pathological gambling.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the intron 6 DGGE polymo ⁇ hism of the Tryptophan 2,3 dioxygenase gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising ADHD, alcohol dependence, drug dependence, pathological gambling, and depression.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the low base pair alleles ( ⁇ 181 bp) polymo ⁇ hism of the ADRA2C dinucleotide repeat polymo ⁇ hism, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising drug use.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the two high base pair alleles for the >183 bp of the ADRA2C dinucleotide repeat polymo ⁇ hism, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising alcohol use.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the two homologous alleles for the presenilin-1 (PSI) polymo ⁇ hism. wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising alcohol and tobacco use.
  • PSI presenilin-1
  • the alleles detected are two homologous alleles of greater than 80 bp of the CA dinucleotide repeat polymo ⁇ hism ofthe PENK gene.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of short GGC alleles of the AR gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising CD, ODD, or hyperactivity.
  • the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the DRD2 allele, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising Type B behavior in alcoholics, cocaine addicts, or RDS probands.
  • the invention further provides a method for determining a genetic predisposition to a polygenic trait comprising detecting at least one allele associated from the group comprising the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A.
  • the polygenic trait is ADHD, and the allele is associated with the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A, ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDARl, PENK, AR, or CRF genes.
  • the polygenic trait is a lack of susceptibility to ADHD, and the allele is associated with the DRD3, DRD4, HTRJDfi, HTR2A, HTR2C, interferon- ⁇ , CD8A, or RS7 genes.
  • the polygenic trait is OOD, and the allele is associated with the DRDl, DRD2, DRD3, DATl, HTT, HTRIA, HTR2A, HTR2C, DBH, ADRA2A, ADRA2C, MAOA, GABRA3, GABRB3, CNRl, CHRNA4, NMDARl, PENK, AR or CD8A genes.
  • the polygenic trait is tics, and the allele is associated with the DRD7, DRD5, HTRIA, HTRlD ⁇ , HTR2C, TD02, DBH, ADR2C, COMT, GABRA3, CNRl or CHRNA4 genes.
  • the polygenic trait is LD, and the allele is associated with the DRD7, HTR2C, TD02. DBH, ADR2A, ADR2C, MAOA, CNRl or CNRA4 genes.
  • the polygenic trait is LDL, and the allele is associated with the HTT, OXYR, DRD2 or PS 1 genes.
  • the polygenic trait is longevity, and the allele is associated with the PS 1 , OXYR or APOE genes.
  • the invention additionally provides a method for developing a diagnostic, polygenic assay by identifying the trait that is to be studied, creating a scale measuring the severity of the trait to be studied; selecting at least one candidate gene that may contribute to the trait, identify at least one polymo ⁇ hism associated with the candidate gene, correlating allelic patterns of the polymo ⁇ hism with the scale, and comparing the association of the allelic pattern to the correlation of the candidate gene to the trait.
  • the allelic patterns that are positively associated with the trait are added together, to form a polygenic assay that is diagnostic for a subject's susceptibility to possess polygenic trait. It is also part of the invention that allelic patterns that are negatively associated with the trait are added to form a polygenic assay that is diagnostic for a subject's lack of susceptibility to posses a polygenic trait.
  • the candidate genes include, but are not limited to, the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A,
  • HTR1D HTR2A, HTR2C, interferon- ⁇ , CD8A, or
  • the polygenic traits include, but are not limited to ADHD, lack of ADHD, ODD, CD, LD, Tics, Drug Abuse/Dependence,
  • the polygenic assay to ADHD is the detection at least one allele associated with the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A, ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDARl. PENK, AR, or CRF genes.
  • the polygenic assay is to a reduced susceptibility to ADHD comprises detecting at least one allele associated with the DRD3, DRD4, H7R/D ⁇ , HTR2A, HTR2C, interferon- ⁇ , CD8A, or RS7 genes.
  • the polygenic assay to the OOD comprises detecting at least one allele associated with the DRDl, DRD2, DRD3, DATl, HTT, HTRIA, HTR2A, HTR2C, DBH, ADRA2A, ADRA2C, MAOA, GABRA3, GABRB3, CNRl, CHRNA4, NMDARl, PENK, AR or CD8A genes.
  • the polygenic assay to the tics comprises detecting at least one allele associated with the DRDl, DRD5, HTRIA, H7R7D ⁇ , HTR2C, TD02, DBH, ADR2C, COMT, GABRA3, CNRl or CHRNA4 genes.
  • the polygenic assay to the LD comprises detecting at least one allele associated with the DRD7, HTR2C, TD02, DBH, ADR2A, ADR2C, MAOA, CNRl or CNRA4 genes.
  • polygenic assay to the elevated LDL levels comprises detecting at least one allele associated with the HTT, OXYR, DRD2, or PSI genes.
  • the polygenic assay to the longevity comprises detecting at least one allele associated with the PSI, OXYR or APOE genes.
  • the polygenic assay to the osteoarthritis further comprises detecting at least one allele associated with the COL2A1 , COL2A1, COL2A1, COL9A1, COL9A1, AGC1, IGF1, IGF1, IGF1R,
  • IGF1R IGF2, IGF2R, TGFB1, TGFB2, ILIA, IL1B, IL1R1, IL1RN, MMP9, TIMP1 or Vitamin D3 genes.
  • the word “a” or “an” or “the” may mean one or more than one.
  • FIG. 1 The DRD2 Gene in "Super Controls (Normals)” and Severe “RDS” Probands.
  • the Linear trend analysis for comparing across the groups depicted had a p ⁇ 0.000001.
  • Group I Carefully assessed for alcoholism, substance use disorder, polysubstance dependence, family history of chemical dependence and obesity nicotine dependence (smoking) BMI over 25, carbohydrate binging, autism,
  • Group VI C6
  • C7 Same exclusion criteria of Groups I, II, 111, W, V, VI except BMI over 25 is included.
  • N 140)
  • FIG. 2 The Effects of PhencalTM on Weight Loss. This figure shows the comparison weight in both the PHENCALTM and non- PHENCALTM groups after a two year period. At the end of the two year study, subjects taking PHENCALTM
  • FIG. 4 Additive effect of an increasing numbers of variant additive genes on the ADHD score. It showed a progressive increasing trend from 1.0 for those with only 4 or 5 variant genes, to 25.0 for those carrying 15 variant genes.
  • the p value for linear chi square test of a progressive increase in the ADHD score was ⁇ 10 .
  • FIG. 5 Additive and subtractive effect of all 29 genes on the ADHD score, and additive effect of only the additive genes.
  • the open squares on the bottom represent the r values for each gene assigned random scores that matched the frequency of the observed scores.
  • the progressively additive effect of the r ⁇ values is shown by empty squares and the additive effect of using only the positive correlations are shown by squares containing an x.
  • the lines whose points are marked by an "x" are additive genes
  • the line whose points are marked by a solid dot are additive and subtractive genes.
  • the final r " using both the additive and subtractive genes was .0001.
  • the final r using only the additive random genes was .0004. Neither was significant.
  • the commutative r was as high as .008 at the random PENK gene, this fell back to .0004 when the last random additive gene (CD8A) was added.
  • the solid dots represent the group I data, the solid squares represent the group two II data.
  • FIG. 7 Distribution of the number of variant genes for subjects with no DSM-IV ADHD symptoms versus those fulfilling DSM-IV criteria for ADHD.
  • the inventors believe that various psychological disorders are linked by a common biological substrate, a "hard-wired" system in the brain that provides pleasure in the process of rewarding certain behavior.
  • the inventors propose in this invention that an inborn chemical imbalance that alters the intercellular signaling in the nucleus accumbens or other limbic reward regions could supplant an individual's feeling of well-being with anxiety, anger or a craving for a substance ⁇ i.e. alcohol) that can alleviate the negative emotions.
  • This chemical imbalance manifests itself as one or more behavioral disorders for which the term "Reward Deficiency Syndrome" has been coined (Blum et al, 1996a).
  • the present invention identified the correlation between the predisposition to RDS and alleles of a number of genes including but not limited to the dopaminergic genes DRDl, DRD2, DRD3, DRD4, DRD5, dopamine transporter gene (DATl); Serotonin genes HTT, HTRA, HTRDb, HTRA, HTRC, tryptophan 2.3- hydroxalase (TD02); Norepinephrine genes, D ⁇ H, ADRAA, ADRAC, NT, Catecholamine metabolizing genes, MAOA, COMT; GAGA genes, GABRAA, GABRAB; Canabinoid receptor gene, CNR; Nicotinic cholinergic, CHRNA; NMD A receptor gene, NMDAR; Enkephalin genes, PENK; Androgen receptor gene, AR; Interferon gamma gene, INFG; CDA:
  • RDS and related behaviors being very complex, and the importance of a number of environmental factors, negates the possibility that one particular gene or environmental factor indeed contributes 100% as the determinant. While it is believed that, in general, the "reward cascade model", when impaired, leads to RDS behaviors, the inventors are careful to point out that while more than one gene may be responsible for a percent of the overall variance in one RDS subtrait, it may have little or nothing to do with another related RDS behavior.
  • RDS behaviors including alcoholism, SUD, smoking, BMI or obesity, pathological gambling, carbohydrate bingeing, axis 1 1 diagnosis, SAB, ADD/ADHD, CD, TS, family history of SUD, and Obesity
  • One important embodiment of this application involves a method to detect a number of genetic variants, alone or in combination, based on their individual contribution to the RDS behavior being diagnosed.
  • the inventors believe that by utilizing a combination of genes and detecting said specific polymo ⁇ hism or actual mutation one would be able to identify individuals at risk in a manner whereby greater accuracy would be achieved than if only one gene was detected as the original issued patents suggested with the DNA based detection of the dopamine D2 receptor gene. In order to provide a clearer overview of the magnitude of this potential some of the genes suspected as being involved in the reward pathway.
  • MULTI- PLEX GENESCANTM MULTI- PLEX GENESCANTM to detect a number of already associated genes in impulsive- compulsive-addictive behaviors the inventors characterized as comprising Reward Deficiency Syndrome, as well as other polygenic traits.
  • MUA Multiple Additive Associations
  • Steps to the Multiple Additive Associations (MAA) Technique The specific examples demonstrate the use of the MAA Technique to construct diagnostic assays for RDS related disorders. However, the inventors give a number of examples that are independent of psychiatric disorders and illustrate that the MAA technique can be generalized to all polygenic disorders and all polygenic traits. Thus, the inventors contemplate that the MAA technique as a procedure for all polygenic disorders. Polygenic disorders are characterized as being due to the additive effect of many genes each of which individually account for only a small percent of the variance of the phenotype. They are present to varying degrees in all individuals. Polygenic disorders are much more common than single gene disorders, affecting from 1 to 20 percent of the population.
  • Some examples are hypertension, obesity, most psychiatric disorders, multiple sclerosis, lupus erythematosis, osteoporosis, coronary artery disease, rheumatoid arthritis, osteoarthritis, weight, height, blood pressure, age (longevity), psychological traits and any other trait that is determined in part by more than one gene or allele.
  • the following teaches how the MAA technique is performed.
  • the present MAA technique has the following unique added features. First, it dramatically expands the number of genes that can be examined to thousands. It places all quantitative or dichotomous traits on the same scale by using the correlation coefficient (r), and the percent of the variance (r2) instead of the trait itself.
  • the MAA technique By examining the additive effect of multiple genes rather than examining genes one-gene-at-a-time, the MAA technique has much more power to identify the genes involved in polygenic disorders than procedures such as lod score, sib pair, haplotype relative risk (Falk and Rubinstein, 1987), and transmission disequilibrium tests (Shman and Ewens, 1996) that examine genes singly.
  • the MAA technique shows that p values for associations studies examining one-gene-at-a-time have little relevance to whether a gene is involved in a polygenic disorder or trait.
  • the MAA technique can be described as having the following steps, though certain steps are unique to the technique.
  • the first step is to identify the polygenic disorder or trait to be studied, i.e. attention deficit hyperactivity disorder (ADHD), depression, cholesterol level, weight, obesity, longevity, blood pressure, multiple sclerosis, or any other disorder or trait that is polygenic, or suspected of being polygenic.
  • ADHD attention deficit hyperactivity disorder
  • SCID SCID
  • the second step is setting a scale that measures the severity of the polygenic disorder.
  • This can be a quantitative trait or dichotomous variable (QT or DV).
  • QT or DV dichotomous variable
  • the quantitative scale could be diastolic blood pressure
  • height is studied the height in inches or cm could be used
  • obesity the scale could be weight or BMI
  • depression is studied the scale could be the number of positive DSM-IV criteria for depression, etc.
  • Scores for genes refer to assigning a 'score' of 0, 1 or 2 to the genotypes depending upon which genotypes were associated with the least, intermediate or greatest phenotypic effect.
  • the third step is to identify the candidate genes to be tested.
  • this application shows the 29 candidate genes chosen for ADHD, oppositional defiant disorder, conduct disorder, learning disorders, alcohol were those genes that play a role in the regulation of neurotransmitters including dopamine, serotonin, norepinephrine, GABA, and others.
  • any gene may potentially contribute to a polygenic trait. Selection of a candidate gene or set of genes to be used in the MAA technique would be facilitated by first selecting genes that would have some metabolic or physiological relationship to the trait being examined.
  • Genbank a computerized database
  • One of skill in the art would recognize that there are other sources of genetic information, including personal knowledge or knowledge that is not published or publicly available, which can be used to identify candidate genes for most polygenic traits and disorders, and such resources may be used in the practice ofthe MAA method.
  • candidate genes involved in a polygenic trait such as height, or susceptibility to osteoporosis
  • genes involved in bone and/or connective tissue formation, growth, and/or regulation Another trait that could be evaluated would be obesity, and candidate gene would include these genes plus the OB gene, the OB receptor gene, the neuropeptide Y gene and the neuropeptide Y receptor genes would be candidate genes.
  • candidate genes would be those relating the norepinephrine, epinephrine, steroid, and rennin metabolism.
  • genes were selected that were suspected of contributing to a polygenic trait. Of particular interest were genes suspected of contributing to RDS behaviors.
  • the criteria for the selection of a gene included indications of their involvement, from the literature, in one or more RDS behaviors or other polygenic traits of interest, and/or experimental data by the inventors, which is described below.
  • the inventors contemplate that the association of a gene or polymo ⁇ hism with a given trait may be used in a diagnostic assay for that trait, as well as provide guidance to the suitability of a gene and/or its specific polymo ⁇ hisms for inclusion in a MAA diagnostic assay for the polygenic trait of interest.
  • the traits do not have to be associated with RDS for the gene or polymo ⁇ hism.
  • DRDl Gene This particular gene in preliminary studies by the inventors did not associate with severe alcoholic probands compared to controls, thus, these additional findings with a larger sample was su ⁇ rising.
  • the DI receptor gene polymo ⁇ hism may be more associated with polysubstance abusers rather than severe alcoholics.
  • Dopaminergic Genes, Violence and Schizoid/Avoidant Behaviors Other findings support the concept of polygenic inheritance in complex personality disorders such as "pathological violence” and schizoid/avoidant behaviors (SAB).
  • SAB schizoid/avoidant behaviors
  • the inventors found a strong association between the DRD2 Al allele and "pathological violence" in adolescent probands and also found a similar association for the 10 allele of the dopamine transporter gene (DATl). Strong association was found for the DRD2A1 allele with SAB, no association was found for the D ⁇ H gene, however, albeit weaker an association was found for the DATl gene with SAB (Blum et al, 1997).
  • D ⁇ H alleles may be the most precise approach to examining the potential role of D ⁇ H in human behavioral disorders. This is the first study supporting a strong association between the DRD27 ⁇ 7L47 allele with SAB and PV. Where these complex traits do not show simple Mendelian patterns of inheritance one would not expect simple genetic answers caused by a single gene. The relationship of dopamine genes to pathological violence is further described in Specific Example 17.
  • Dopamine D2 Receptor Gene Putative mutations located in 3' and 5' non- coding regions of the gene that were maintained in linkage disequilibrium with the polymo ⁇ hic markers, may influence DRD2 transcription and/or mRNA stability and thus affect DRD2 receptor number, based on the following: a stronger association found with markers located on the flanking regions rather than at exonal point mutations; the reported lack of mutations in exons (except exon 8) of "Al -marked " DRD2 alleles; and the decreased DRD2 Bmax reported with presence of the Al marker in the absence of Kd changes (Noble et al, 1991). This may help explain the lack of association with one polymo ⁇ hism, the Taql D2.
  • PTT Positron emission tomography
  • Al + group The mean relative glucose metabolic rate (GMR) was significantly lower in the Al than the Al " group in many brain regions, including the putamen, nucleus accumbens, frontal and temporal gyri and medial prefrontal, occipito-temporal and orbital cortices.
  • GMR mean relative glucose metabolic rate
  • Decreased relative GMR in the Al + group was also found in Broca's area, anterior insula, hippocampus, and substantia nigra. A few brain areas, however, showed increased relative GMR in the Al + group.
  • DRD2 gene has been demonstrated in studies of ours (Comings et al, 1996b) and others (Noble et al, 1994; Lerman et al,
  • Dopamine- ⁇ -Hydroxylase Since D ⁇ H is located in the sympathetic nerve terminal and released into the circulation during the release of norepinephrine, the genes involved in its control could reside at loci other than the D ⁇ H gene itself. Thus, association studies between genetic markers at the D ⁇ H locus and ADHD, CD, alcoholism as well as other RDS related behaviors could be negative. On the other hand, if the serum levels of D ⁇ H are cofounded by a range of environmental factors, association studies with genetic markers of D ⁇ H could provide a more accurate assessment ofthe role ofthe D ⁇ H gene in these disorders than blood levels.
  • D ⁇ H activity results in the excessive production of dopamine which is associated with hyperactivity, aggression, self-stimulation and stereotypic movements (Randrup and Scheel-Kruger, 1996).
  • Increased frequency of the diagnosis of CD in emotionally disturbed boys with low plasma D ⁇ H levels has been reported (O'Connell et al, 1992; Rogeness et al, 1984; Rogeness, et al, 1986; Rogeness, et al, 1988; Rogeness, et al, 1987).
  • Another aspect of the invention involves association studies with the dopamine-beta hydroxylase gene and shows the first association between the D ⁇ H dinucleotide repeat polymo ⁇ hism and drug abuse patterns (Comings et al, 1996a).
  • the dinucleotide repeat polymo ⁇ hism for D ⁇ H was found to have a bimodel allelic distribution at below or above 175bp.
  • Subjects were genotyped as homozygous for low ( ⁇ 174bp) or high ( ⁇ 176bp), or heterozygous.
  • patients with the high bp homozygotes were found on the ASI to have greater number of previous drug treatments, longer history of cocaine use, more frequent IV injection of amphetamines, more frequent IV drug use. These subjects reported paternal alcoholism more often and a history of having been sexually abused in childhood.
  • For the patients with the high bp genotype was associated with lower scores on Self- Acceptance, Enlighted Second Nature, and Self-Directiveness.
  • the D ⁇ H BI allele was most associated with the variables ADHD, obsessive-compulsive, manic, oppositional defiant, and sleep. Differences included the greater association of the DRD2 Al allele with the schizoid, sexual, conduct and stuttering variables, while the D ⁇ H BI allele was more strongly associated with learning, reading and school problems. The tendency for the variables associated with school performance, such as reading, learning and grade school, to rank high in the D ⁇ H studies is especially striking in contrast to the DRD2 studies where they tended to rank at the bottom. This may be related to the role of D ⁇ H in memory.
  • Tourette's syndrome may be one of the most complex recognizable forms of RDS. Since all of the behaviors associated with the inhibition of D ⁇ H activity are common in patients with Tourette's syndrome (TS) (Comings and Comings, 1984; Comings and Comings, 1987b; Knell and Comings, 1993; Comings, 1990) an association between the D ⁇ H Taq B polymo ⁇ hism (d'Amato et al, 1989) and TS, conduct disorder, attention deficit hyperactivity disorder (ADHD), autism, or related behaviors may exist.
  • TS Tourette's syndrome
  • Al allele indicates increased risk not only for obesity, but also for other related addictive behaviors and that a BMI over 25 by itself (without characterization of macroselection [carbohydrate bingeing] or comorbid SUD) is not a sufficient criterion for association with the DRD2 Al allele (Blum et al, 1996).
  • the Cannabinoid Receptor Gene The likelihood of intravenous drug (IV) drug use may be affected by both genetic and environmental factors. To explore these gene-culture etiologic factors, 77 male non-Hispanic Caucasian substance abusers and 70 ethnically matched controls were examined. Patients were administered the Addiction Severity Index; all probands were administered the Family Environment Scale and a childhood-experiences survey questionnaire, and were genotyped for dopaminergic, cannabinoid, and GABAergic genes. The inventors found a higher prevalence of IV drug use among subjects whose genotypes included only high molecular-weight alleles of the CR/ (cannabinoid) receptor gene and low molecular weight alleles of the GABRB3 gene.
  • the CR7 gene is a tri-nucleotide repeat with at least 9 alleles, and the inventors found evidence that its effects on the phenotype may not be linearly predictable from the relative weight of the alleles, but are rather more complex in their interactions with IV drug use.
  • Electrophysiological Abnormalities and Substance Use Disorder (SUD):
  • the inventors present evidence for a significant association between decreased frontal lobe P300 amplitude and homozygosity for the >5 repeat alleles of the cannabinoid receptor gene (CBl).
  • CBl cannabinoid receptor gene
  • the present invention identifies a significant relationship between brain electrical activity mapping (BEAM) abnormalities, and association with DRD2 genotypes.
  • BEAM brain electrical activity mapping
  • the inventors believe this has commercial value as a important confirmation test for diagnosing genetically induced predisposition to RDS behaviors. It is suggested the method involves the detection of said human dopamine receptor gene Al allele and the cannabinoid receptor gene (CNRl) to accompany a standard brain map (i.e. Nicolett(TM)).
  • Serotonin Genes Defects in serotonin metabolism, and abnormalities in both blood serotonin and tryptophan levels, have been reported in many psychiatric disorders. Tryptophan 2,3-dioxygenase (TD02) is the rate limiting enzyme for the breakdown of tryptophan to N-formyl kenurenine. The inventors sought to determine if genetic variants at the serotonin HTRIA gene were associated with the phenotypic expression of TS or any of its associated comorbid behaviors. There was a significant association between the presence of the less common (shorter and the longer alleles) and scores for ADHD, CD, and oppositional defiant disorder (ODD), tics, sexual and other behaviors.
  • TD02 Tryptophan 2,3-dioxygenase
  • the T/C polymo ⁇ hism in the 5HT-2 receptor gene was also examined for possible association using Axis II Personality Disorders Structural Interview and the Addiction Severity Index (ASI) and the Buss-Durkey Hostility Scale (BHDS).
  • ASI Addiction Severity Index
  • BHDS Buss-Durkey Hostility Scale
  • the 22 genotype was associated with diagnosis of borderline personality disorder (p ⁇ 0.05) and depression (p ⁇ 0.05).
  • this marker was associated with amount of money spent on drugs (p ⁇ 0.05) and a history of rape (p ⁇ 0.0.05) and shoplifting/vandalism(p ⁇ 0.05).
  • the 22 genotype was associated with elevated scores on the Assault (p ⁇ 0.01) and Indirect Hostility (p ⁇ 0.05), subscales.
  • the 5HT-2R gene was associated with Indirect Hostility (p ⁇ 0.05), Negativism (p ⁇ 0.05), Verbal Hostility (p ⁇ 0.005), and Feelings of Guilt (p ⁇ 0.05), as well as total Hostility score (p ⁇ 0.01), but the polarity of the association was reversed (e.g., the 11 genotype was associated with higher values on all scores).
  • the gender-reversal of genotype associations suggests this is a complex gene that may interact with sex steroids.
  • Estrogen receptor the Aromatase locus, and the Arginine Vasopressin
  • Senno et al, 1992 at this gene might also be relevant to conduct disorder.
  • Two other relevant genes would be those at the aromatase (CYP 19) locus (Polymeropoulos et al, 1991 ) and the arginine vasopressin (AVP) gene (Summar, 1992).
  • Nicotinic Receptors Genes. Nicotinic receptors in the prefrontal cortex are involved in delayed response tasks, while muscarinic receptors are more involved in general working memory (Granon et al, 1995). Many studies have shown an intimate interaction between nicotine and dopamine. As with other addicting drugs nicotine produces an increase in the release of dopamine in the mesolimbic and nucleus accumbens neurons (DiChiara and Imperato, 1988; Corrigall et al, 1994; Pontiefi et al, 1996) and robust self administration (Corrigall and Coen, 1989; Corrigall and Coen, 1991 ). However, tolerance rapidly develops with repeated administration (Lapin et al, 1989).
  • NOS Neuronal Nitric Oxide Synthase
  • the nitric oxide synthase gene has recently been implicated in aggressive behavior in mice.
  • Studies of ob/ob mice show increased levels of nitric oxide synthase (NOS) compared to non-ob/ob litter mates.
  • Studies of NOS knockout mice have emphasized the important role of nitric oxide in aggressive and sexual behavior.
  • Ob/ob mice also show significantly increased levels of norepinephrine in paraventricular nucleus and lateral hypothalamus and significantly decreased levels of dopamine in the arcuate-infundibulum (Oltman, 1983).
  • nNOSla neuronal nitric oxide synthase gene
  • This genotype was also associated with having fewer friends (p ⁇ 0.04), having less friendship with the friends they have (p ⁇ 0.0005), having been married more times (p ⁇ 0.05).
  • this genotype was associated with increased Impulsiveness (p ⁇ 0.01), and decreased scores on Attachment (p ⁇ 0.05), Dependence (p ⁇ 0.02), Reward Dependence (p ⁇ 0.05), Pu ⁇ osefulness (p ⁇ 0.01), Self-Directiveness (p ⁇ 0.05), Empathy (p ⁇ 0.05), Helpfulness (p ⁇ 0.02), Pure-Hearted Conscience (p ⁇ 0.02), and Cooperativeness (p ⁇ 0.05).
  • MAO Monoamine Oxidase Gene
  • glucokinase regulatory protein GCR
  • pro-opiomelacortin CNKR
  • GNKR glucokinase regulatory protein
  • POMC pro-opiomelacortin
  • N potential mechanism related to the POMC gene is that it is the precursor for adrenocorticotropic hormone (ACTH), which acts on the cortex of the adrenal glands leading to the production of glucocorticoid.
  • ACTH adrenocorticotropic hormone
  • the POMC gene also acts as a precursor to the opioid peptides.
  • UCPl uncoupling protein
  • the present invention couples polygenic analysis of all these obesity genes, which have a number of different physiological mechanisms. These differences may allow for additive effects rather than synergism leading to a more accurate DNA based prediagnostic test. Combining the DRD2, OB, Chromosomal 2, UCP-2 and APO-D genes in one sample is the preferred embodiment rather than any gene alone. Additionally, the invention determines probands that are morbidly obese as determined by not BMI (which is not the best obesity determinant) but by percent body fat: 34% for females and 28% for males.
  • DRDl 1 1 genotype ICO Intellectual and Cultural Orientation from the FES
  • GABRB3 ⁇ 188 bp alleles 7 ARO Active Raceal Orientation from the FES
  • the fourth step is to identify one or more polymo ⁇ hisms associated with each gene.
  • These can be single base pair restriction fragment length polymo ⁇ hisms (RFLPs), or dinucleotide, trinucleotide, or other repeat polymo ⁇ hisms, such as well as variable tandem repeats, or any other marker of a gene locus.
  • RFLPs restriction fragment length polymo ⁇ hisms
  • Such polymo ⁇ hisms and methods of detection may be readily available in previously published or unpublished bodies of work, as previously described above for identifying candidate genes, in addition to the polymo ⁇ hisms disclosed herein.
  • a gene is suspected of contributing to a polygenic trait of interest, but no polymo ⁇ hism is currently available for use in the MAA technique after a review of the literature and genetic databases, one may perform genetic assays to determine polymo ⁇ hisms in a gene that may be used in the MAA technique.
  • Such assays are commonly used and described in the literature', in addition to the techniques described herein. Methods for genetic screening to accurately detect mutations in genomic DNA, cDNA or RNA samples may be employed, depending on the specific situation.
  • the present invention concerns the detection, diagnosis, prognosis and treatment of RDS diseases, and the detection, diagnosis, and prognosis of polygenic traits using the MAA technique.
  • Markers of alleles that contribute additively or subtractively to a polygentic trait, in the form of nucleic acid sequences isolated from an individual, and methods of identifying and detecting new markers to be used in MAA assays, are disclosed. These markers are indicators of a polygenic trait being assayed, and are diagnostic of the potential for an individual to exhibit a particular trait.
  • nucleic acid sequences disclosed herein may be used in the MAN technique, and thus will find utility in a variety of applications in the detection, diagnosis, prognosis and treatment or RDS or other polygenic traits.
  • applications within the scope of the present invention comprise amplification of one or more markers of a polygenic trait, using specific primers, detection of markers of a polygenic trait, such by hybridization with oligonucleotide or nucleic acid probes, inco ⁇ oration of isolated nucleic acids into vectors, and expression of RNA from the vectors.
  • the requirement to test for multiple genes in behavioral disorders and other polygenic traits is feasible and requires no new technology.
  • the polymo ⁇ hisms and variants involved are to two types, 1) single base pair changes producing restriction fragment length polymo ⁇ hisms (RFLPs), and 2) short tandem repeat polymo ⁇ hisms (STRs) [especially di-and trinucleotide repeats].
  • RFLPs restriction fragment length polymo ⁇ hisms
  • STRs short tandem repeat polymo ⁇ hisms
  • RFLP's Applied Biosystems, a division of Perkin-Elmer Co ⁇ oration, has developed a new technology and instrumentation that allows the rapid testing for PCRTM based single pair RFLP type genetic polymo ⁇ hisms.
  • This instrument, Applied Biosystems Prism 7200 sequence Detection System (TaqMan) allows for multiple gene testing.
  • This approach uses standard primers to electrophorese the section of DNA containing the restriction endonuclease polymo ⁇ hism site.
  • the unique aspect of this technology is that two short oligmers are then designed, one exactly matching one of the alleles, the other matching the other allele.
  • a fluorescent dye is attached to one end of each, and a quenching dye is attached to the other end.
  • the match is perfect, when the DNA polymerase reaches the hybridized oligmer, it is digested into nucleotides as the polymerase passes. This releasers the quencher and the dye now fluoresces maximally. However, if the oligmer does not match, instead of the nuclease digestion, the oligomer is pushed off the site and the quenching persists. Dual wavelength reading of the plate allows distinction between 11,12,22 genotypes. The entire process of reading the results on 96 samples requires less than fifteen min and the results are fed into a computer for analysis and storage. This technology, aided by a computerized workstation to set up to PCRTM reactions, allows hundreds of different RFLPs to be examined in one day.
  • PCRTM reactions for the STRs.
  • the difference is that for the STRs the primers themselves are labeled with different fluorescent dyes.
  • the accuracy necessary to identify alleles differing by only two bp is obtained from the Applied Biosystems 373 DNA sequencer which allows the sample labeled with a second dye. Each is detected by laser scanning at a different wavelength.
  • one PCRTM primer is labeled with fluorescent HEX Amidite (Applied Biosystems, Foster City, CA) or other fluorescent dye.
  • Two ⁇ l of the 10 fold diluted PCRTM product is then added to 2.5 ⁇ l deionized formamide and 0.5 ⁇ l of ROX 500 standard, denatured for 2 min at 92 C and loaded on 6% denaturing polyacrylamide gel in an AB 373 DNA sequencer.
  • the gel is electrophoresed for 5 h at a constant 25W.
  • the gel is laser scanned and analyzed using the internal ROX 500 standards present in each lane. The peaks are recognized by Genotyper( version 1.1) based on the color fragments sized by base pair length.
  • DGGE denaturing gradient gel electrophoresis
  • restriction enzyme polymo ⁇ hism analysis restriction enzyme polymo ⁇ hism analysis
  • chemical and enzymatic cleavage methods and others.
  • SSCP single-strand conformation polymo ⁇ hism analysis
  • mismatch is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion deletion mutations, as well as single and multiple base point mutations.
  • U.S. Patent No. 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase A. After the RNase cleavage reaction, the RNase is inactivated by proteolytic digestion and organic extraction, and the cleavage products are denatured by heating and analyzed by electrophoresis on denaturing polyacrylamide gels. For the detection of mismatches, the single-stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as positive.
  • RNase mismatch cleavage assays including those performed according to U.S. Patent No. 4,946,773, require the use of radiolabeled RNA probes.
  • Myers and Maniatis in U.S. Patent No. 4,946,773 describe the detection of base pair mismatches using RNase A.
  • Other investigators have described the use of an E. coli enzyme, RNase I, in mismatch assays. Because it has broader cleavage specificity than RNase A, RNase I would be a desirable enzyme to employ in the detection of base pair mismatches if components can be found to decrease the extent of non-specific cleavage and increase the frequency of cleavage of mismatches.
  • the use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is shown in their literature to cleave three out of four known mismatches, provided the enzyme level is sufficiently high.
  • the RNase protection assay was first used to detect and map the ends of specific mRNA targets in solution.
  • the assay relies on being able to easily generate high specific activity radiolabeled RNA probes complementary to the mRNA of interest by in vitro transcription.
  • the templates for in vitro transcription were recombinant plasmids containing bacteriophage promoters.
  • the probes are mixed with total cellular RNA samples to permit hybridization to their complementary targets, then the mixture is treated with RNase to degrade excess unhybridized probe.
  • the RNase used is specific for single-stranded RNA, so that hybridized double-stranded probe is protected from degradation. After inactivation and removal of the RNase, the protected probe (which is proportional in amount to the amount of target mRNA that was present) is recovered and analyzed on a polyacrylamide gel.
  • the RNase Protection assay was adapted for detection of single base mutations.
  • radiolabeled RNA probes transcribed in vitro from wild-type sequences are hybridized to complementary target regions derived from test samples.
  • the test target generally comprises DNA (either genomic DNA or DNA amplified by cloning in plasmids or by PCRTM), although RNA targets (endogenous mRNA) have occasionally been used. If single nucleotide (or greater) sequence differences occur between the hybridized probe and target, the resulting disruption in Watson-Crick hydrogen bonding at that position ("mismatch”) can be recognized and cleaved in some cases by single-strand specific ribonuclease.
  • RNase A has been used almost exclusively for cleavage of single-base mismatches, although RNase I has recently been shown as useful also for mismatch cleavage.
  • MutS protein and other DNA-repair enzymes for detection of single-base mismatches. Additional methods for detection of nucleic acids, and mutations are described herein.
  • nucleic Acids As described herein, an aspect of the present disclosure is 29 previously known genes whose allelic polymo ⁇ hisms are markers of polygenic traits, including markers for such polygenic traits as ADHD, oppositional defiant disorder, conduct disorder, learning disorders, alcohol, cholesterol, and LDL.
  • the nucleic acid sequences disclosed herein will find utility as hybridization probes or amplification primers. These nucleic acids may be used, for example, in diagnostic evaluation of tissue samples or employed to clone full length cDNAs or genomic clones corresponding thereto. In certain embodiments, these probes and primers consist of oligonucleotide fragments. Such fragments should be of sufficient length to provide specific hybridization to a RNA or DNA tissue sample. The sequences typically will be 10-20 nucleotides, but may be longer. Longer sequences, e.g., 40, 50, 100, 500 and even up to full length, are preferred for certain embodiments.
  • Nucleic acid molecules having contiguous stretches of about 10, 15, 17, 20, 30, 40, 50, 60, 75 or 100 or 500 nucleotides from a sequence selected from any gene that may be used in the diagnostic or treatment methods disclosed herein are contemplated. Molecules that are complementary to the above mentioned sequences and that bind to these sequences under high stringency conditions also are contemplated. These probes will be useful in a variety of hybridization embodiments, such as Southern and Northern blotting. In some cases, it is contemplated that probes may be used that hybridize to multiple target sequences without compromising their ability to effectively diagnose a polygenic trait.
  • probes and primers can be designed around the disclosed nucleotide sequences, or the sequences surrounding a polymo ⁇ hism useful as a marker, be it a gene disclosed herein or a gene latter added the set of 29 genes described herein. It is contemplated that other genes may be used to create new sets for examination of different polygenic traits, and the use of any other genes, or preferably gene polymo ⁇ hisms, in the MAA technique is encompassed as part of the invention.
  • Primers may be of any length but, typically, are 10-20 bases in length.
  • n is an integer from 1 to the last number of the sequence and y is the length of the primer minus one (9 to 19), where n + y does not exceed the last number ofthe sequence.
  • the probes correspond to bases 1 to 10, 2 to 11, 3 to 12 ... and so on.
  • the probes correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on.
  • the probes correspond to bases 1 to 20, 2 to 21, 3 to 22 ... and so on.
  • multiple probes may be used for hybridization to a single sample.
  • the use of a hybridization probe of between 14 and 100 nucleotides in length allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over stretches greater than 20 bases in length are generally preferred, in order to increase stability and selectivity ofthe hybrid, and thereby improve the quality and degree of particular hybrid molecules obtained.
  • Such fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production.
  • nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of genes or RNAs or to provide primers for amplification of DNA or RNA from tissues.
  • one will desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of probe towards target sequence.
  • relatively stringent conditions For applications requiring high selectivity, one will typically desire to employ relatively stringent conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C.
  • relatively low salt and/or high temperature conditions such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C.
  • Such high stringency conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for isolating specific genes or detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.
  • hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl 2 , 10 mM dithiothreitol, at temperatures between approximately 20°C to about 37°C.
  • Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 ⁇ M MgCl 2 , at temperatures ranging from approximately 40°C to about 72°C.
  • nucleic acid sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization.
  • appropriate indicator means include fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected.
  • enzyme tags colorimetric indicator substrates are known which can be employed to provide a detection means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples.
  • the hybridization probes described herein will be useful both as reagents in solution hybridization, as in PCRTM, for detection of expression of corresponding genes, as well as in embodiments employing a solid phase.
  • the test D ⁇ A (or R ⁇ A) is adsorbed or otherwise affixed to a selected matrix or surface.
  • This fixed, single-stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions.
  • the selected conditions will depend on the particular circumstances based on the particular criteria required (depending, for example, on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.).
  • hybridization is detected, or even quantified, by means ofthe label.
  • Nucleic acid used as a template for amplification is isolated from cells contained in the biological sample, according to standard methodologies (Sambrook et al, 1989).
  • the nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to convert the RNA to a complementary DNA.
  • the RNA is whole cell RNA and is used directly as the template for amplification. Pairs of primers that selectively hybridize to nucleic acids corresponding to genes of a polygenic trait are contacted with the isolated nucleic acid under conditions that permit selective hybridization.
  • primer is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process.
  • primers are oligonucleotides from ten to twenty or thirty base pairs in length, but longer sequences can be employed.
  • Primers may be provided in double-stranded or single-stranded form, although the single-stranded form is preferred.
  • the nucleic acid:primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles,” are conducted until a sufficient amount of amplification product is produced.
  • the amplification product is detected.
  • the detection may be performed by visual means.
  • the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of inco ⁇ orated radiolabel or fluorescent label or even via a system using electrical or thermal impulse signals (Affymax technology).
  • PCRTM polymerase chain reaction
  • PCRTM two primer sequences are prepared that are complementary to regions on opposite complementary strands of the marker sequence.
  • An excess of deoxynucleoside triphosphates are added to a reaction mixture along with a DNA polymerase, e.g., Taq polymerase. If the marker sequence is present in a sample, the primers will bind to the marker and the polymerase will cause the primers to be extended along the marker sequence by adding on nucleotides.
  • the extended primers will dissociate from the marker to form reaction products, excess primers will bind to the marker and to the reaction products and the process is repeated.
  • a reverse transcriptase PCRTM amplification procedure may be performed in order to quantify the amount of mRNA amplified.
  • Methods of reverse transcribing RNA into cDN A are well known and described in Sambrook et al, 1989.
  • Alternative methods for reverse transcription utilize thermostable, RNA-dependent DNA polymerases. These methods are described in WO 90/07641, filed December 21, 1990, inco ⁇ orated herein by reference. Polymerase chain reaction methodologies are well known in the art.
  • LCR ligase chain reaction
  • Qbeta Replicase described in PCT Application No. PCT/US87/00880, inco ⁇ orated herein by reference, may also be used as still another amplification method in the present invention.
  • a replicative sequence of RNA that has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase.
  • the polymerase will copy the replicative sequence that can then be detected.
  • SDA Strand Displacement Amplification
  • RCR Repair Chain Reaction
  • CPR cyclic probe reaction
  • a probe having 3' and 5' sequences of non-specific DNA and a middle sequence of specific RNA is hybridized to DNA that is present in a sample.
  • the reaction is treated with RNase H, and the products of the probe identified as distinctive products that are released after digestion.
  • the original template is annealed to another cycling probe and the reaction is repeated.
  • primers are used in a PCRTM-like, template- and enzyme-dependent synthesis.
  • the primers may be modified by labeling with a capture moiety (e.g., biotin) and/or a detector moiety (e.g., enzyme).
  • a capture moiety e.g., biotin
  • a detector moiety e.g., enzyme
  • an excess of labeled probes are added to a sample.
  • the probe binds and is cleaved catalytically. After cleavage, the target sequence is released intact to be bound by excess probe. Cleavage of the labeled probe signals the presence ofthe target sequence.
  • nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Gingeras et al, PCT Application WO 88/10315, inco ⁇ orated herein by reference).
  • TAS transcription-based amplification systems
  • NASBA nucleic acid sequence based amplification
  • 3SR Genomerase binding amplification
  • the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a clinical sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA.
  • amplification techniques involve annealing a primer which has target specific sequences. Following polymerization, DNA/RNA hybrids are digested with RNase H while double stranded DNA molecules are heat denatured again.
  • the single stranded DNA is made fully double stranded by addition of second target specific primer, followed by polymerization.
  • the double-stranded DNA molecules are then multiply transcribed by an RNA polymerase such as T7 or SP6.
  • an RNA polymerase such as T7 or SP6.
  • the RNA's are reverse transcribed into single stranded DNA, which is then converted to double stranded DNA, and then transcribed once again with an RNA polymerase such as T7 or SP6.
  • the resulting products whether truncated or complete, indicate target specific sequences.
  • ssRNA single-stranded RNA
  • dsDNA double-stranded DNA
  • the ssRNA is a template for a first primer oligonucleotide, which is elongated by reverse transcriptase (RNA-dependent DNA polymerase).
  • RNA-dependent DNA polymerase reverse transcriptase
  • the RNA is then removed from the resulting DNA:RNA duplex by the action of ribonuclease H (RNase H, an RNase specific for RNA in duplex with either DNA or RNA).
  • RNase H ribonuclease H
  • the resultant ssDNA is a template for a second primer, which also includes the sequences of an RNA polymerase promoter (exemplified by T7 RNA polymerase) 5' to its homology to the template.
  • This primer is then extended by DNA polymerase (exemplified by the large "Klenow" fragment of E. coli DNA polymerase I), resulting in a double-stranded DNA (“dsDNA”) molecule, having a sequence identical to that of the original RNA between the primers and having additionally, at one end, a promoter sequence.
  • This promoter sequence can be used by the appropriate RNA polymerase to make many RNA copies of the DNA. These copies can then re-enter the cycle leading to very swift amplification. With proper choice of enzymes, this amplification can be done isothermally without addition of enzymes at each cycle. Because of the cyclical nature of this process, the starting sequence can be chosen to be in the form of either DNA or RNA.
  • Miller et al, PCT Application WO 89/06700 disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter/primer sequence to a target single-stranded DNA ("ssDNA”) followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e. new templates are not produced from the resultant RNA transcripts.
  • Other amplification methods include "RACE” and "one-sided PCRTM" (Frohman, 1990, inco ⁇ orated herein by reference).
  • Methods based on ligation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby amplifying the di-oligonucleotide may also be used in the amplification step of the present invention.
  • amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al, 1989).
  • chromatographic techniques may be employed to effect separation.
  • chromatography There are many kinds of chromatography which may be used in the present invention: adso ⁇ tion, partition, ion-exchange and molecular sieve, and many specialized techniques for using them including column, paper, thin-layer and gas chromatography.
  • Amplification products must be visualized in order to confirm amplification of the marker sequences.
  • One typical visualization method involves staining of a gel with ethidium bromide and visualization under UV light.
  • the amplification products can then be exposed to x-ray film or visualized under the appropriate stimulating spectra, following separation.
  • visualization is achieved indirectly.
  • a labeled, nucleic acid probe is brought into contact with the amplified marker sequence.
  • the probe preferably is conjugated to a chromophore but may be radiolabeled.
  • the probe is conjugated to a binding partner, such as an antibody or biotin, and the other member of the binding pair carries a detectable moiety.
  • detection is by Southern blotting and hybridization with a labeled probe.
  • the techniques involved in Southern blotting are well known to those of skill in the art and can be found in many standard books on molecular protocols. See Sambrook et al, 1989. Briefly, amplification products are separated by gel electrophoresis. The gel is then contacted with a membrane, such as nitrocellulose, permitting transfer of the nucleic acid and non-covalent binding. Subsequently, the membrane is incubated with a chromophore-conjugated probe that is capable of hybridizing with a target amplification product. Detection is by exposure of the membrane to x-ray film or ion-emitting detection devices.
  • kits This generally will comprise preselected primers for specific markers. Also included may be enzymes suitable for amplifying nucleic acids including various polymerases (RT, Taq, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification.
  • enzymes suitable for amplifying nucleic acids including various polymerases (RT, Taq, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification.
  • kits generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker primer pair.
  • Preferred pairs of primers for amplifying nucleic acids are selected to amplify the sequences specified in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l l, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28. SEQ ID NO:29. SEQ
  • kits will comprise hybridization probes specific for genes involved in polygenic traits corresponding to the sequences specified in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:19, SEQ ID NO:20.
  • SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25 SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25.
  • kits generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker hybridization probe.
  • D ⁇ A segments encoding a specific gene may be introduced into recombinant host cells and employed for expressing a specific structural or regulatory protein. Alternatively, through the application of genetic engineering techniques, subportions or derivatives of selected genes may be employed. Upstream regions containing regulatory regions such as promoter regions may be isolated and subsequently employed for expression ofthe selected gene.
  • this invention is not limited to the particular probes disclosed herein and particularly is intended to encompass at least nucleic acid sequences that are hybridizable to the disclosed sequences or are functional sequence analogs of these sequences.
  • a partial sequence may be used to identify a structurally-related gene or the full length genomic or cD ⁇ A clone from which it is derived.
  • Those of skill in the art are well aware of the methods for generating cD ⁇ A and genomic libraries which can be used as a target for the above-described probes (Sambrook et al, 1989).
  • nucleic acid segments of the present invention are inco ⁇ orated into vectors, such as plasmids, cosmids or viruses
  • these segments may be combined with other DNA sequences, such as promoters, polyadenylation signals, restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably.
  • a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
  • the sample finds a complementary probe on the Chip, it will bind; if it does not find a complementary strand, it will wash off the Chip (segments of DNA that have complementary bases are said themselves to be complementary: the fragments ATTTGCGC (SEQ ID NO:l) will bind, for example to a complementary fragment with the sequence TNAACGCG (SEQ ID ⁇ O:2).
  • the sequence and location of each probe is known, so the scanner can determine to which probe the sample has bound. Because the sequence of the probe on the Chip is known, the sequence of the sample DNA is also known, since its sequence will be complementary.
  • the use of gene chips does not require the copying of messenger RNA into cDNAs and can quantitatively detect 1 messenger rNAs and cDNAs.
  • Genotying by mass spectrometry is contemplated.
  • Sequenom San Diego, CA
  • MALDI-TOF matrix-assisted laser deso ⁇ tion/ionization-time-of-flight mass spectrometry
  • PCRTM amplification of the region of the polymo ⁇ hism with biotin attached to one of the primers is conducted (Jurinke et al, 1997).
  • immobilization of the amplified DNA to strepavidin beads occurs (Jurinke et al, 1997)
  • hybridization of a primer adjacent to the polymo ⁇ hism site is done (Braun, Little, K ⁇ ster, 1997).
  • extension with DNA polymerase past the polymo ⁇ hic site in the presence of dNTPs and ddNTPs which are not present in the deoxyform form is done. When suitably designed according to the sequence, this results in the addition of only a few additional bases (Braun, Little, K ⁇ ster, 1997).
  • the DNA is then processed to remove unused nucleotides and salts.
  • the short primer + polymo ⁇ hic site is removed by denaturation and transferred to silicon wafers using a piezoelectric pipette (O'Donnell et al, 1997).
  • the mass of the primer + polymo ⁇ hic site is then determined by delayed extraction MALDI-TOF mass spectrometry (Li et al, 1996; Tang et al, 1995). Single base pair and tandem repeat variations in sequence are easily determined by their mass. This final step is very rapid, requiring only 5 sec per assay. All of these steps are robotically automated. This technology has the potential of performing up to 20,000 genotypings per day.
  • This technology is rapid, extremely accurate, and adaptable to any polymo ⁇ hism. It has a significant advantage over chip technology in that it is much more accurate, can identify both single base pair and short tandem repeat polymo ⁇ hisms, and adding or removing polymo ⁇ hisms to be tested can be done in a few sec at trivial cost.
  • Drug abuse including IV drug use DI, D2, D4, CNRl, GABAB3, TD02, HT-2R,
  • SUD sub-class Stimulant Withdrawal COMT, nNosla
  • SUD sub-class Stimulant Withdrawal: Depression TD02
  • Compulsivity subclass Pathological Gambling DI, D2, TD02
  • Compulsivity subclass Sexual Compulsions
  • Obesity subclass APOD, CHROME-2
  • Obesity subclass DATl, OB
  • Attention Deficits subclass Tourette's DI, D2, TD02, D ⁇ H, MAOA(X), HTRIA
  • ADHD HTRIA ADHD HTRIA
  • D2 DATl
  • D ⁇ H ADHD HTRIA
  • TD02 Attention Deficits subclass: ADHD HTRIA, D2, DATl, D ⁇ H, TD02
  • the fifth step would be to assign a score to the genotypes based on independent studies showing which genotypes are associated with the highest quantitative scores and which are associated with the lowest scores.
  • the scoring of the genes is based on the use of ANOVA to examine the magnitude of the mean Kellgren score for each genotype of each polymo ⁇ hism. These studies are performed in a set of subjects independent of those used for the MAA.
  • DRD2 For example, for the Taql A1/A2 polymo ⁇ hism of the dopamine D 2 receptor gene, DRD2, all studies have shown that the 1 allele is associated with a range of impulsive, compulsive, additive behaviors, and some studies show that the heterozygous genotype, 12, was associated with the highest scores and the 1 1 and 22 genotypes with the lowest scores.
  • STEP 6 Set up a dummy polygenic or PG variable, by progressively adding the scores of each gene. For example, if for case 1 , the score for the first gene examined was 2, and for the second gene the score was 1, the PG score variable would be 3.
  • the correlation coefficient, r, for 1 thru n cases against the quantitative trait variable score would be determined by regression analysis, preferably using any off- the-self statistical program. The percent of the variance is r . Then, for cases 1 thru n, the gene score for the 3rd gene is added and the process repeated. The final results are plotted.
  • STEP 7. Perform univariate regression analysis of PG versus QT or DV.
  • the following is an example generalized to any quantitative trait or dichotomous variable.
  • each additional gene score is added, a regression analysis performed, the second gene score is added, the regression analysis is repeated. This is continued until all of the tested genes have been added.
  • One preferred method of analyzing the data would be to enter all the data into a statistical package such as SPSS. Using the values for the DRD2 gene as described under Step 5 above, the syntax file for the SPSS program would be opened and the following sample algorithm set up.
  • the PG variable is set to 0. Since the DRD7, DRD2, DRD3 and DRD4 genes were scored as 0 or 2 they required only a single line increasing PG by 2 if the subject carried the DRDl Ddel 1 1 genotype, and/or the DRD2 Taql 12 genotype and/or the DRD3 Mscl 1 1 or 22 genotype, and/or DRD4 46,47, or 77 genotype. By contrast the DRD5 and DATl genes were scored as 1 or 2, requiring two lines of code. Regression analysis is performed against the PG score against the QTV (ADHD score), as each gene is added.
  • ADHD score QTV
  • STEP 8 Plot the results.
  • the results are plotted with the progressively added genes on the X axis and the r2 on the Y axis, as shown in the line in FIG. 5 showing the additive and subtractive genes for ADHD.
  • STEP 9 Repeat the procedure using only the additive genes. This is shown in the line in FIG. 6 showing the additive genes.
  • Certain anti-craving substances which reduce the desire for euphoriants by virtue of enhancing the effectiveness of endogenous and or exogenous neuropeptides and neurotransmitters such as dopamine release in the nucleus accumbens, significantly reduces aberrant craving behavior, termed "RDS" behavior, for euphoriant substances to include but not limited to alcohol, cocaine, opiates, nicotine, glucose or other sugars, as well as certain acts such as sexual, gambling, aggression and violence.
  • RDS behaviors have a common genetic basis, and based on adequate supplies of neurotransmitters in the meso-limbic system.
  • the final pathway of reward involves dopaminergic activation at receptor sites (DI, D2, D3, D4, D5 and subtypes) and the density of these receptors are determined by their respective genes as well as genes responsible for dopamine, synthesis, storage, release and metabolism.
  • This invention proposes to couple the use of enhancement of synaptic dopamine release via enkephalinase inhibition and an enkephalin releaser such as kyoto ⁇ hin (Tyr-Arg) or its stable analog, TyrD-Arg, to promote a chronic occupancy of D2 receptors with potential for D2 receptor proliferation or up-regulation (Fitz et al, 1994).
  • an enkephalin releaser such as kyoto ⁇ hin (Tyr-Arg) or its stable analog, TyrD-Arg
  • This invention involves, in part, the idea of polygenic inheritance and therefore promotes the concept of multiple gene loci as determinants for identifying high risk candidates for RDS.
  • Work involving quantitative trait loci studies in genetically distinguishable mouse strains provided negative evidence for the one single gene mechanism theory. Fifteen strains of mice were tested on their reaction to alcohol, mo ⁇ hine and methamphetamine. These strains were found to react differentially to these three substances, which suggests that different genes determine the susceptibility to different addictive substances.
  • the pattern of findings further suggests that genetically influenced sensitivity to alcohol is not a monolithic phenomenon. Rather, it is specific to the particular response variable studied (Crabbe et al, 1994).
  • an aspect of this invention is the genotyping certain of the above specified genes, and other genes suspected of contributing to RDS behaviors or other polygenic traits, to obtain haplotype profiles would be an important aspect of targeted treatment of RDS, related behaviors, or other polygenic traits.
  • the inventors can utilize this knowledge to assist the clinician in pharmacogenetically targeting treatment.
  • the invention couples the use of genotyping and precursor amino-acid loading, enkephalinase inhibition, enkephalin-induced release, narcotic antagonism, and chromium piccolinate or niccotinate for the preferential enhancement of dopamine in the nucleus accumbens as anti-craving compositions.
  • the inventors propose that an alteration in any of the genes that are involved in the expression of molecules in the reward cascade (which might be as many as 100 or more) might predispose an individual to RDS and related behaviors, even including ADHD and violence. While the above may be true, it is very difficult at this time to predict which particular genes are involved, that is, until the disclosure of the present invention as it relates to the MAA technique. However evidence for a role of at least the D2 dopamine receptor gene is profound and the inventors believe that the D2 dopamine receptor gene represents a major "reward gene" important in RDS and related behaviors.
  • the preferred embodiment of this invention is to couple the TaqAl DRD2 alleles (Al , BI , Cl, haplotype polymo ⁇ hism between exon 6-7) and targeted treatment outcomes (i.e. attention processing, prevention of regained weight, smoking cessation, reduction of carbohydrate bingeing, reduction of AMA rate, elapse prevention in polysubstance dependence, and reduction in violent behavior, among others).
  • targeted treatment outcomes i.e. attention processing, prevention of regained weight, smoking cessation, reduction of carbohydrate bingeing, reduction of AMA rate, elapse prevention in polysubstance dependence, and reduction in violent behavior, among others.
  • the inventors will also provide examples of a number of likely genotypes based on specific genes as listed above which should respond best to certain drug classes.
  • hypothalamic serotonergic neurons innervate and activate met-enkephalinergic neurons that, in turn, inhibit ⁇ -aminobutyric acid (GABA) neurons, which then activate DA neurons of the ventral tegmentum.
  • GABA ⁇ -aminobutyric acid
  • These DA neurons then project to the Acb and to Cluster Al (CA1) cluster cells in the hippocampus, where the neurotransmitter DA acts as the primary reward substrates (Stein and Beluzzi, 1978).
  • CA1 Cluster Al
  • the nucleus accumbens and enkephalins in this complex circuit is important (Heidreder et al, 1988).
  • DA release in the striatum was induced after local application of enkephalinase inhibitor, which suggests regulation by delta receptor stimulation (Chesselet et al, 1981 ).
  • Kelato ⁇ han may also protect against possible cholecysterkinine-8 (CCK-8) degradation by brain peptidases.
  • This important satiety neuropeptide is colocalized with DA in the nucleus accumbens, and there is a close interaction between CCK-8, DA, and endogenous opioid peptides (Koob, 1992).
  • compositions of the present invention are especially designed to enhance these food inhibitory neurotransmitters through precursor amino acid loading, including 1-tryptophan (5-HT precursor), l-phenylalanine (DA and NE precursor), as well the enkephalinase inhibitor d-phenylalanine (Blum et al, 1986).
  • 5-HT precursor 1-tryptophan
  • DA and NE precursor l-phenylalanine
  • d-phenylalanine Blum et al, 1986.
  • the inventors are currently performing research on Lewis rats to establish the effect of these agent categories. Lewis rats seem to have proclivity for polysubstance abuse, and serve as an important animal model for RDS behavior.
  • DPA D-phenylalanine
  • NTX naltrexone
  • TA Ty-D-Arg
  • compositions for Treating RDS Although a variety of disorders are categorized as belonging to RDS and affect the dopaminergic system, one cannot treat all individuals suffering from RDS alike. Numerous other systems can be affected and require simultaneous treatment in order for an overall success to be achieved. In particular, disorders which involve drug or substance abuse must be treated individually. Thus although the overall treatment comprises giving a patient an effective dose of enkephalinase inhibitors, enkephalin releasers and amino acid precursors for the dopaminergic system, additional components are utilized to enhance the overall effect of treatment. Certain therapeutic agents are favored by the "gene-D2 receptor deficiency theory". It is well established that DRD2A1 carriers have low levels of DRD2 receptors.
  • An important embodiment of this invention relates to the providing of certain precursor amino-acids, a trace metal such as Chromium piccolinate and/or chromium niccotinate, an enkephalinase inhibitor, a narcotic antagonist and an ekephalin releasing agent in therapeutic amounts (alone or in combination) to in fact cause a natural release of dopamine to induce D2 proliferation, especially in D2A1 carriers.
  • a trace metal such as Chromium piccolinate and/or chromium niccotinate
  • an enkephalinase inhibitor e.g., a narcotic antagonist
  • an ekephalin releasing agent in therapeutic amounts (alone or in combination) to in fact cause a natural release of dopamine to induce D2 proliferation, especially in D2A1 carriers.
  • TROP AMINETM A formulation developed by the prime inventor called TROP AMINETM has been studied and utilized in patients. TROPAMINETM has been compared to other medications, and shows a major benefit in terms of both
  • Medication Patients Physicians Medication Patients Physicians lmipramine 2,885 122 2.48 Phenobarbital 100 3 NR
  • a component of this embodiment is to first genotype the patient and then based on his/her genotype provide the appropriate cocktail.
  • the inventors have developed an appropriate cocktail which is described herein.
  • Table 5 summarizes the uses of compositions of the present invention as improved with specific genotypes.
  • Tables 6-16 list the preferred components of these compositions that are useful for the treatment of various disorders. Also, see Tables 17-19 for a brief schematic of how certain elements effect reward induced by stimulants (cocaine, etc.), opiates and sedative-hypnotics.
  • AlcotrolTM Substance Use Disorder Anti-craving, reduced anxiety, DBPC- DI (Increased frequency of Dde — special emphasis on reduced-relapse, reduced against Inpatient homozygosity of the Al allele) sedative-hypnotic abuse medical advice rates (AMA), D 2 (Taq Al, BI , exon " haplotypes, (i.e. alcohol, opiates, improved physical and BESS Cl) barbiturates) scores
  • PHENCALTM Obesity (carbohydrate weight loss, reduced bingeing DBPC - D 2 ro ? I Al, Bl, Cl or exon °" bingers, anorexia, episodes, positive body Outpatient haplotype bulemia) composition changes, prevention HTR2A - C allele homozygous of lost weight regained OB - homozygosity for ⁇ 208 BP alleles of 1875 dinucleotide repeat polymo ⁇ hism human chromosome 2 microsatellite polymo ⁇ hism, D2S1788
  • PMXTM PMS reduced pain or cramps, reduced OT Outpatient Same as for AlcotrolTM and headaches, improved overall CocotrolTM mood POMC/Pre- enkephalin/Dyno ⁇ hin/O ⁇ han
  • Alternate composition is restricted to the following: D-phenylanine 500 mg per capsule 6 ⁇ day; Tye-D-Arg - 1 mg per capsule 6 ⁇ day; Naltrexone 50 mg per capsule 1 to 3 per day.
  • D-phenylanine 500 mg per capsule 6 ⁇ day Tye-D-Arg - 1 mg per capsule 6 ⁇ day
  • Naltrexone 50 mg per capsule 1 to 3 per day *GABRB3-homozygousity of dinucleotide repeat ⁇ l 85 bp HTRIA - TC polymo ⁇ hism HTR2A - C allele (homozygosity)
  • ABBREVIATIONS :
  • ADHD Attention Deficit Hyperactivity Disorder
  • DBPC double-blind, placebo-controlled
  • the inventors recommend administering the "core" Neutraceutical three times per day (before meal times). If the patient has a persistent set of addictive/impulsive/compulsive behaviors, or significantly severe addictive/impulse/compulsive behaviors, the inventors recommend administering the "Core" Neutraceutical plus the appropriate adjunctive Neutraceutical packet at the appropriate times daily.
  • the patient should take the white colored capsules at the times in which he/she is directed to take the "core" neutraceutical.
  • the patient should take the orange colored capsules before the morning meal.
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate 0.330
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate
  • Vitamin B-l 2 0.670
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate
  • Vitamin B-l 2 0.670
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate
  • composition per capsule in mgs
  • Vitamin B-6 (P-5 phosphate) 1.000
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate
  • Vitamin B-l 2 0.001 pharmaline 50 huberzine 150 ⁇ g
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate
  • composition per capsule in mgs
  • Vitamin B-6 P-5 phosphate
  • composition per capsule in mgs
  • Vitamin B-6 P-5 Phosphate
  • composition per capsule in mgs
  • Vitamin B-6 P-5 Phosphate
  • GABA A receptor antagonists Inhibition GABA ⁇ receptor agonists Facilitation Opioid receptor antagonists
  • Dopamine receptor antagonists Inhibition 6-HT receptor agonists
  • Noradrenaline synthesis inhibitors Inhibition
  • D-phenylalanine, D-leucine and any D-amino acid including hydrocinnamic acid are included in the treatment formulations.
  • the enkephalinase inhibitors are included in the formulations, including, but not limited to: certain protein synthesis inhibitors, such as bacitracin, bestatin, and puromycin; peptide amino acids such as mono free form amino acids of the D-form, di- and tripeptides of the essential amino acids in the D- form; thiol benzyl amino acids (2-[mercapto-3-phenyl-propanoyl]-L-leucine); carboxyalkyl methyl esters (N-[(R,S)-2-carbethoxy-3-phenyl propanol]-L leucine); as well as a number of other structurally unrelated compounds such as secobarbitol, pyrophosphate, O-phenanthroline, phosphamidon,
  • the inventors realized that by also supplying an enkephalin releaser they could dramatically improve the response of the patient to treatment.
  • the enkephlin releasers Tyr-Arg and Tyr-D-Arg are also included in the treatment formulations.
  • the linkage of numerous genetic alleles to a wide variety of impulsive, compulsive and addictive disorders suggest that a common mechanism is affected by both psychostimulants as well as non-psychostimulants to cause a preferential release of dopamine (DA) into the medial nucleus accumbens (Acb).
  • DA dopamine
  • compositions that alter neurotransmission of the "reward cascade” should have beneficial effects for substance and behavioral disorders.
  • Abused substances and behavioral disorders include, but are not limited to, alcohol, cocaine, nicotine, glucose, Cannabis, opiates and opiate derivatives, gambling, sexual compulsion, hyperactivity, chronic violent behavior and stress disorders, and also symptoms related to premenstrual syndrome (PMS).
  • An important component of this embodiment is to first genotype the patient and then based on his/her genotype provide the appropriate cocktail.
  • the inventors have developed an appropriate cocktail which is described herein.
  • Synthetic agonists are not preferred therapeutic agents.
  • a given agonist may act on several receptors, or similar receptors on different cells, not just on the particular receptor or cell one desires to stimulate.
  • tolerance to a drug develops (through changes in the number of receptors and their affinity for the drug), tolerance to the agonist may likewise develop.
  • a particular problem for example, bromocryptine or methamphetamine, is that it may itself create a drug dependency. It is known that both bromocryptine is self-administered by rhesus monkeys (Woolverton, et al. 1984).
  • DPA D-phenylalanine
  • releasers are effective only if they have something to release. They will not cure a state of dopamine depletion. Indeed, the inventors would be concerned that dopamine releasers by themselves would exacerbate the chronic depletion of dopamine.
  • precursors use a naturally regulated pathway. The precursor is converted to the neurotransmitter only when needed, and then the body distributes the product on the basis of need.
  • d-fenfluramine acts via decreases in daily energy intake varying between 13-25%. D-fenfluramine also works by decreasing the desire for fatty foods. The notion here is that with the PHENCALTM formula even more than what is generally accepted for the first FDA approved drug for weight reduction since d-amphetamine and other stimulants has been achieved. The inventors believe that the results on utilizing amino-acid precursor loading and enkephalinase inhibition is by far the greatest advance to prevent weight regain.
  • the basic treatment regime for RDS behaviors should contain at least one of the substances below alone or in combination (Table 20). This list contains the major constituents ofthe treatment in terms of either drug or "neutraceutical” (for specific formulas see Tables 6-16):
  • Vitamin B6 (as pyridoxine 1 to 1000 mg
  • Phrase typing of Alcoholics and Cocaine Abusers Genotyping Type A and B Probands.
  • researchers have been testing the concept of classifying or subtyping, alcoholics as Type A or Type B. and are now finding the concept useful in studying cocaine abuse.
  • Subtyping is a system for classifying and studying individuals who share one or more common characteristics.
  • Subtyping alcoholics provides a greater understanding of the complex interactions between genetic, personality, and environmental risk factors in the development of alcoholism, as well as resiliency against succumbing to these risk factors.
  • Type B alcoholism appears to have several characteristics: it is more related to hereditary factors than type A; it is more likely to occur among men; type B's are more impulsive and tend to have stronger family history of alcohol abuse; they have more childhood conduct disorder problems and more severe alcohol dependence, polydrug abuse, and psychiatric disorders, especially anti-social personality.
  • Type B scored higher than Type A in assessments of sensation seeking, aggression, criminality, violence and impairment of social adjustment.
  • the former type also used greater amounts of cocaine more frequently and for longer durations than Type A cocaine abusers.
  • Type B's also suffered more adverse effects from their drug use, such as unconsciousness, and violence (among others), and they reported a greater degree of additional drug abuse to relieve withdrawal distress.
  • Type B abusers become involved with cocaine at younger ages for: first use, first binge, first regular use, first daily use and first symptoms of addiction.
  • An aspect of the present invention combines new work utilizing molecular genetic diagnosis with previously identified markers of Type B behavior to more accurately typograph both the alcoholic and cocaine abuser.
  • the new genetic findings suprisingly fit the Type B associated variables (Ball et al, 1995).
  • the following associations with only the DRD2 gene in by itself closely associates with almost all of the Type B parameters suggested by Ball et al, 1995.
  • the evidence provided comes from a number of studies concerned with genotyping non-Hispanic Caucasians with polymo ⁇ hism of the dopamine D2 receptor gene (see Table 20-A).
  • Attention Processing Disorder One aspect of the invention is the treatment of attention processing disorder and other RDS related syndromes.
  • the inventors base this treatment on the fact that attentional processing is governed by neurotransmitter function and certain specific neurotransmitters are responsible for normal brain cognitive functioning, which could be modulated by certain precursor amino acids. Understanding of electrophysiological functioning ofthe brain resides in the biogenetic aspects of the chemical mediators known to be involved in attentional processing.
  • ADHD attention- deficit/hyperactivity disorder
  • This invention provides a composition of matter (including the use of phenylalanine) which promotes neurotransmitter manipulation which leads to natural dopamine release which overcomes PHD as well as facilitate the proliferation of dopamine D 2 receptors via occupancy by synaptic dopamine.
  • Serotonin (5-hydoxytryptamine, 5HTP) is a CNS neurotransmitter. It is also found in the enterochromaffin system of the intestine, and in blood platelets. This neurochemical is biosynthesized by first hydroxylating L-tryptophan to obtain 5 -hydroxytryptophan and then decarboxylating the latter to obtain serotonin. The hydroxylation (the rate-limiting step) is performed by the enzyme tryptophan hydroxylase, while the decarboxylation is accomplished by the ubiquitous enzyme L-aromatic acid decarboxylase. This enzyme requires pyridoxal phosphate as a cofactor.
  • Serotonin is metabolized into 5-hydroxyindole-acetic acid by monoamine oxidase. This metabolite is then excreted in the urine.
  • Central brain serotonin mechanisms may be important in the control of mood and behavior, motor activity, feeding and control of hunger, thermoregulation, sleep, certain hallucinatory states, and possibly some neuroendocrine control mechanisms in the hypothalamus.
  • Cocaine apparently reduces uptake of the serotonin precursor tryptophan, thereby reducing serotonin synthesis.
  • Cocaine also reduces tryptophan hydroxylase activity.
  • cocaine decreases serotonergic action (Reith et al, 1985).
  • tryptophan was injected into the bloodstream, the levels of tryptophan and serotonin in the brain were elevated nine- and two-fold, respectively. Infusion of tryptophan in neurological patients with both depression and insomnia resulted in six-fold elevations in cortical tryptophan levels (Gillman et al, 1981). Comparison of tryptophan (50 mg/kg) and tyrosine (100 mg/kg) or placebo in a double-blind crossover study in eight healthy men (Lieberman et al, 1983). Tryptophan, but not tyrosine. significantly reduced pain discriminibility.
  • tryptophan hydroxylase is not saturated, i.e. the enzyme is not working to full capacity and thus tryptophan hydroxylase activity is significantly affected by L-tryptophan.
  • the amount of available free L-tryptophan is dependent on a number of factors including the concentration of circulating L-tryptophan in the plasma at the rate of its uptake in the brain and presynaptic terminals.
  • the inventors contemplate using L-tryptophan or 5HTP to restore the serotonergic system disrupted by cocaine.
  • 5HTP is not as useful as a therapeutic agent.
  • the rate of entry of L-tryptophan into the brain depends upon the ratio of free-bound tryptophan in the plasma, and this ratio is influenced by the concentration in the blood of neutral amino acids, insulin and pharmaceutic agents, which compete for the plasma protein binding sites, as well as for the tryptophan-uptake sites.
  • 5HTP is taken up by neurons other than just 5HT neurons; therefore the increases in 5HT synthesis are not selectively limited to serotonin neurons.
  • Inhibitors of enzymes involved in 5HT synthesis include irreversible tryptophan hydroxylase inhibitors (DL-parachlorophenylalanine, 6-Flurotryptophan and L-propyldoracetamide) and inhibitors of 5HTP decarboxylase (carbidopa and l-methyl-5HTP).
  • Serotonin can be released into the synaptic cleft by the process of exocytosis in response to action potentials and to drugs.
  • Facilitation of 5HT release can be accomplished with cocaine, (+)-amphetamine, methamphetamine, fenfluramine, parachloramphetamine, clorimipramine (clomipramine) and amitriptyline.
  • 5HT receptor agonists include LSD, quipazine, N,N-dimethyl-tryptamine (DMT).
  • 5HT receptor antagonists include cyproheptadine, methysergide, LSD, 2-bromo-CSD (BOL), ketanserin, xylamidine, cinanserin and 1 -(-)-cocaine.
  • Inactivation of 5HT involves high-affinity energy-dependent active-transport mechanism which exists to remove 5HT from the synaptic cleft back into the presynaptic neuron.
  • Inhibitors of neuronal uptake of 5HT include the tricyclic anti-depressants
  • Enhancer/releaser of Opioid Peptides Enhancer/Releaser of Opiod Peptides
  • An aspect of this invention is the use of substances which inhibit the destruction of neuropeptidyl opiates. These opiates promote the synthesis and release of dopamine. It has been shown that the administration of opiate-like substances to animals increases the rate or striatal DA biosynthesis and metabolism, an effect which is mediated by special opiate receptors located on nigrostriatal dopaminergic terminals (Clouet et al, 1970; Biggio et al, 1978; Regiawi, 1980).
  • Cocaine also affects opiodergic action. With chronic exposure cocaine to rats, dose-dependent alteration of naloxone binding was observed. Opiate receptor density was significantly decreased in several brain structures, while it was increased in the lateral hypothalamus. It appears that opiate binding was specifically affected in "reward centers” and not in other regions (Hammer et al, 1987). Furthermore, naloxone, in another study, effectively blocked the threshold lowering action of cocaine in reward centers of the brain (Bain and Korwetsky, 1987). Moreover, cocaine appears to affect the analgesic action of certain opiates (Misra et al, 1987). The inventors believe that the reinforcing action of cocaine may be mediated in part by opiate systems in brain reward centers, which are altered by chronic cocaine exposure.
  • Narcotic drugs were found to act at various "opiate receptors.”
  • the brain and other nervous tissue were found to possess endogenous opioids (EO).
  • EO endogenous opioids
  • the related pentapeptides, methionine and leucine-enkephalin were identified in the brain (Hughes et al, 1975).
  • the enkephalins activate both delta and mu receptors, while beta endo ⁇ hin activates the epsilon receptor.
  • Endocrinologists were able to show that B-lipotropin (B-LPH), already recognized as a pituitary hormone, contained the Met-enkephalin sequence of five amino acids, and that B-LPH was hydrolyzed to an active opioid, B-endo ⁇ hin (Li et al, 1976).
  • the endo ⁇ hin family includes the large precursor, pro-opiocortin, B-LPH, and B-endo ⁇ hin.
  • the second family of EO's is the enkephalin family. Both [Met]enkephalin and [Leu]-enkephalin are derived from a large peptide precursor containing both sequences.
  • the third family are kappa agonists, such as dyno ⁇ hins 1-13 and 1-17. These CNS components antagonize mo ⁇ hine actions.
  • Dyno ⁇ hin may act as a precursor of Leu-enkephalin which forms the N-terminus; conversion to the subendo ⁇ hin form (E5) will then result in altered receptor affinity (kappa to delta), illustrating a possible new regulatory role for enzyme modulating ligand expression.
  • Peptides from each family seem to act both as neurotransmitters and as neurohormones.
  • the pentapeptide enkephalins are localized in nerve terminals and are released from neurons upon stimulation.
  • Leu- and Met-enkephalins are released from the adrenal medulla into the blood and act as neurohormones.
  • Beta-endo ⁇ hin is released from the pituitary gland into blood and it may act as a neurotransmitter in discrete areas of the brain (Bloom et al, 1978).
  • Both endo ⁇ hins and enkephalins produce biochemical and pharmacological responses, including tolerance, dependencies and abstinence, similar to those produced by narcotic analgesic drugs when the EO's are administered to man or animals.
  • the endogenous opiates like the narcotic drugs, are members of the class "opioids.”
  • Enzymes which degrade enkephalins (E5) are generally called “enkephalinases.”
  • Enzymes acting as enkephalinases include soluble and particulate bound aminopeptidases (Hersh, 1981) and others acting at the Gly3-Phe4 site such as peptidyl dipeptidases or metalloendopeptidases (Benuck et al. 1982; Schwartz et al, 1980).
  • the metalloenzyme carboxypeptidase A cleaves enkephalin leaving Tyr-Gly-Gly-C and the terminal dipeptides Met-Phe or Leu-Phe.
  • One strategy to deal with the degradation is to provide E5 surrogates.
  • tissue enzymes include: a) modification of N-terminal-Tyr inasmuch as tyrosine-modified analogs of methionine enkephalinase resist degradation (Coy and Kastin, 1980); b) presence of a D-amino acid in position 2 to block effects of amino peptidases: and/or c) modification or presence of a D-amino acid in positions 3-5 to block action of peptidyl dipeptidases or other enzymes acting at the Gly3-Phe4 bond.
  • D-Ala-enkephlamide or FK 33-824 as mu agonists
  • delta agonists such as enkephalin- Arg-Phe
  • dyno ⁇ hin 1-13 or 1-17 which are kappa agonists (Wisler et ⁇ /., 1981).
  • Gly-Gly-Phe-Met or Gly-Gly-Phe-Leu, Phe-Met, Phe-Leu can act as inhibitors of enkephalin and it is likely that larger enkephalin-type forms themselves also have inhibitory properties.
  • enkephalinase inhibitors includes but is not limited to D-Phenylalanine (DPA), DL-Phenylalanine (DLPA), hydrocinnamic acid, and D-amino acids such as D-Leucine.
  • DPA D-Phenylalanine
  • DLPA DL-Phenylalanine
  • hydrocinnamic acid hydrocinnamic acid
  • D-amino acids such as D-Leucine
  • enkephalinase inhibitors selected from a group consisting of certain protein synthesis inhibitors (bacitracin, bestatin, and puromycin), peptide amino acids (free, D-form monoamino acids, di-and tripeptides of the essential amino acids in the D-form, thiol benzyl amino acids, (e.g., 2-[mercapto-3-phenylpropanoyl]-L-Leucine), carboxyl alkyl methyl esters, N-[(R,S)-2-carbethoxy-3-[phenyl propanol]-L leucine), benzomo ⁇ han-enkaphalins, and other, structurally unrelated compounds such as secobarbital, pyrophosphate, o-phenanthroline, phosphamidon, Z-leucine-NHOFI, and Z-glycine-NHOH.
  • protein synthesis inhibitors bacitracin, bestatin, and puromycin
  • peptide amino acids free
  • Dipeptides D-Phe-D-Leu and D-Phe-D-Met and the polypeptide L-Tyr-Gly-Gly-D-Phe-D-Leu and L-Tyr-Gly-Gly-D-Phe-D-Met, together with D-Phe, D-Leu, and hydrocinnamic acid, are of particular interest.
  • D-phenylalanine has been known to inhibit carboxypeptidase A (Hartruck and Lipscomb, 1971) and more recently has been shown to possess analgesic properties (Ehrenfeld et al, 1978; Delia Bella et al, 1979) as well as antidepressant action (Beckmann et ⁇ /., 1977).
  • D-phenylalanine As an inhibitor of enkephalinases it was shown that the compound indeed significantly reduced degradation of the oligopeptides (D-Ala2-D-Leu5) enkephalin (DAPLE) and Tyr-D-Ala-Gly-Phe (TAAGP), in rat intestinal mucosa (Gail et al, 1983).
  • D-phenylalanine was much less effective when studied in vitro for inhibitory activity against both enkephalinase A and enkephalinase B activity obtained from calf brain (Amsterdam et al, 1983).
  • the addition of just one amino acid to form the dipeptide D-Phe-Tyr markedly enhances the inhibitory potency.
  • D-phenylalanine has been shown to inhibit the degradation of both enkephalins and B-endo ⁇ hin. It works better on the enzymes regulating enkephalin breakdown as compared to the enzymes regulating B-endo ⁇ hin. Its activity is also tissue-specific; in the hypothalamus, enkephalinase is 80% inhibited and endo ⁇ hinase 5%; in the cortex, enkephalinase 60%, but endo ⁇ hinase only 18%; in the striatum, enkephalinase 78% and endo ⁇ hinase 10%; and, in the spinal cord, enkephalinase 84%, endo ⁇ hinase 40% (Ehrenfeld et al, 1981).
  • Another aspect of this invention is to combine an enkephalinase inhibitor with an enkephalin releasing agent.
  • the rationale for this is that by doing so the inventors could significantly enhance the effect of enkephalin on its respective opiate receptor sites (e.g., delta or mu).
  • the inventors would prefer to use the peptide Tyr-Arg (Kyoto ⁇ hin), or its stable analog, Tyr-D-Arg, which has been shown to be analgesic and to enhance intracellular calcium in synaptosomes in rat brain striatal slices. These substances appear to be putative methionine-enkephalin releasers acting by an unknown mechanism (Ueda et al, 1986).
  • Tyr-Arg the substance known as Kyoto ⁇ hin (Tyr-Arg) may be used at a daily dosage range of 15 ⁇ g-15 mg (Takagi et al, 1979).
  • the more stable analog Tyr-D-Arg, at a daily dosage range of 15 ⁇ g-15 mg may be substituted as a enkephalin releaser (Tajima et al, 1980; Ueda et al, 1986).
  • an enkephalin releaser may be combined with an enkephalinase inhibitor to achieve a high degree of enkephalinergic activity at the synapse to further augment the release of reuronal dopamine.
  • GABA Gammabutyric Acid
  • GABA is an inhibitory neurotransmitter which controls the release of dopamine (Gessa et al, 1985). It seems to reduce seizure activity during alcohol withdrawal.
  • GABA gamma-aminobutyric acid
  • GABA gamma-aminobutyric acid
  • GABA glutamic acid decarboxylase
  • GAD is found exclusively in the cytoplasm of synaptic GABA nerve terminals.
  • the basic control of GABA synthesis is GAD which seems to be the rate limiting step in GABA synthesis.
  • GABA can influence FAD activity by end-product inhibition. Saturation concentrations of L-glutamic acid are present in the presynaptic neuron; thus, increased substrate concentrations do not normally affect the rate of GABA synthesis. Therefore, the exogenous administration of L-glutamic acid may not significantly increase the neurotransmitter GABA, unless L-glutamic acid levels are abnormally low.
  • GABA-A receptor sensitive to the competitive blocking action of bicuculline and picrotoxin or picrotoxinin. These receptors are on postsynaptic structures and mediate classical inhibitory actions of GABA; and GABA-B receptors are located on presynaptic terminals and these receptors are insensitive to the blocker actions of bicuculline. GABA-B receptors can modify release of not only GABA in the CNS, but also NE from certain sites in the sympathetic nervous system.
  • GABA-modulin is similar to GTP regulator protein associated with receptors linked to adenylate cyclase. The activity of GABA-modulin is determined by phosphorylation.
  • GABA is typically associated with short inhibitory neurons in the hypothalamus, hippocampus, basal ganglia of the brain, substantia gelatinosa of the dorsal horn of the spinal cord and in the retina. Some long-axon pathways within the CNS have been identified as associated with GABAgeric activity.
  • GABA agonists include imidazole acetic acid, 3-aminopropane sulphonic acid, and THIP (4, 5, 6, 7, -tetrahydro-isoyazolo-[415-C]-pyridin-3-ol, and muscimol (3-hydroxy-5-amino-methylisoxazole) which is found in amanita muscaria.
  • GABA antagonists include bicuculline, picrotoxin, picrotoxinin and benzylpenicillin.
  • Inhibitors of GABA uptake include, for the neuronal uptake type, diaminobutyric acid and cis-2, 3aminocyclohexane, carboxylic acid; for the glial uptake type B-alanine; and for the miscellaneous uptake type, nipecotic acid, benzodiazepines, neuroleptics and tricyclic antidepressants.
  • GABA taken back into the presynaptic neuron after release and receptor interaction, is recycled as a potentially reusable transmitter.
  • GABA is enzymatically metabolized in both the nerve terminal and glial tissue and converted, in the presence of A-oxoglutamic acid, to succini semialdehyde by the mitochondrial enzyme GABA amino tranferase (GABA-T).
  • GABA-T GABA amino tranferase
  • the succinic acid which is formed enters the tricarboxylic acid (Krebs) cycle.
  • GABA-T requires pyridoxal phosphate as a co-factor.
  • Succinic semialdehyde is rapidly oxidized to succinic acid by the enzyme succinic semialdehyde dehydrogenase which also involves NAD and NADH as co-factors.
  • the inventors' formulation for RDS takes this fact into account by adding pyridoxal-5 -phosphate as a promoter ofthe oxidative-reductive pathway. In this regard.
  • GABA concentrations can be increased by the administration, to animals, including humans, of the following inhibitors of GABA-T: ethanoloamine-P-sulphate, gamma acetylenic GABA, gamma vinyl GABA, gabcuculline, hydazinopropionic acid, sodium di-N-propylacetate (sodium valproate) and aminooxyacetic acid (inhibitor of Vitamin B6), L-glutamine (Bloom, 1985).
  • Catecholamines are compounds which possess two adjacent hydroxyl (OH) groups on a benzene ring. In the body, such substances are synthesized form the aromatic amino acid L-tyrosine, which is hydroxylated to L-3, 4-dihydroxyphenylalanine (L-dopa) by the enzyme tyrosine hydroxylase. L-tyrosine is actively take up into noradrenergic nerve terminals. L-phenylalanine is a precursor of L-Tyrosine (Blum and Kozlowski, 1990; Schwartz et al, 1992).
  • Tyrosine hydroxylase is located in the cytoplasm of noradrenergic neurons and is the rate-limiting enzyme in the synthesis of NE.
  • Extensive research has revealed that reduced pteridine cofactor, molecular oxygen and ferrous ions are all required for activity.
  • L-dopa is decarboxylated to DA by L-aromatic amino acid decarboxylase, an enzyme which requires pyridoxal phosphate (Vitamin B6) as a cofactor.
  • the dopamine (DA) is actively taken up into granular storage vesicles in which the DA is hydroxylated to form norepinephrine (NE) by the enzyme dopamine-Bhydroxylase.
  • NE is further converted to epinephrine (E) by the enzyme phenylethanolamine-N-methyltransferase.
  • Tyrosine hydroxylase activity is influenced by the following: "end product" inhibition, caused by increased concentration of NE within nerve terminals which decreases the rate of conversion of L-tyrosine into L-dopa; increased sympathetic activity from the CNS which increases the synthesis of NE; the angiotensin II mediated increases the rate of NE synthesis; and agonists (e.g., clonidine) and blockers (e.g., phentolamine) of adreno-receptors which change the rate of NE release by mechanisms involving adrenergic receptors located on the presynaptic terminal.
  • end product inhibition caused by increased concentration of NE within nerve terminals which decreases the rate of conversion of L-tyrosine into L-dopa
  • increased sympathetic activity from the CNS which increases the synthesis of NE
  • the angiotensin II mediated increases the rate of NE synthesis
  • agonists e.g., clonidine
  • blockers e.
  • Inhibitors of the enzymes of NE synthesis include: methyl-p-tyrosine (inhibits tyrosine hydroxylase); carbidopa (inhibits aromatic amino acid decarboxylase in tissues outside the CNS); and diethyldithiocarbonate, FAI63 and disulfiram (inhibitors of dopamine-B-hydroxylase).
  • NE is stored within the nerve terminal in multiple storage complexes and more than one anatomical location.
  • One form of NE storage type is a granular complex found within vesicles in noradrenergic nerve terminals.
  • the granular complex consists of NE bound to ATP, several proteins collectively called chromogranins, includes dopamine-B-hydroxylase and Mg++, Zn++ and Cu++.
  • the uptake of DA and NE into storage vesicles is an active-transport process which requires ATP as an energy source and Mg++ to activate the ATPase enzyme which is Mg++ dependent.
  • This Mg++-dependent uptake process of NE and DA into storage vesicles is a separate and different process from the neuronal uptake process for NE across the nerve cell membrane, which is an Na.sup.+ /K.sup.+ -ATPase dependent.
  • the stability of the NE- ATP -protein- ion storage complex can be disrupted by some compounds which act as chelators of Mg++. This may be linked to the magnesium deficiency sometimes found in chronic cocaine abusers. In this regard, chronic administration of cocaine produces an increase in NE turnover.
  • NE from nerve terminals occurs by a process of exocytosis, which is calcium dependent, whereby a vesicular membrane fuses with the plasma membrane and the vesicular contents, consisting of NE, ATP, dopamine-Bhydroxylase and chromogranins, are released into the synaptic cleft.
  • exocytosis which is calcium dependent, whereby a vesicular membrane fuses with the plasma membrane and the vesicular contents, consisting of NE, ATP, dopamine-Bhydroxylase and chromogranins, are released into the synaptic cleft.
  • One mechanism known to control the availability of NE to postsynaptic receptors operates by means of presynaptic receptors located on the terminal from which NE is released.
  • the actions of NE in the synaptic cleft are terminated by removal from the synaptic cleft by an uptake system found on presynaptic nerve endings.
  • Uptake I is energy dependent, requiring ATP which is broken down by a sodium dependent ATPase. This is a high-affinity process, which means that it is efficient at the eliminating low concentrations of NE from the synaptic cleft.
  • the neuronal uptake system transports NE into the nerve terminal. Inside the nerve terminal most of the NE is taken up into storage vesicles. Inhibitors of this process include: cocaine, tricyclic anti-depressants, amphetamine and tyramine.
  • Uptake II involves the accumulation of NE by nonneuronal tissues.
  • High plasma levels of NE derived from stimulation of the adrenal medulla, or intravenous injection of a catecholamine will be removed by uptake into non-nervous tissues such as liver, muscle and connective tissue.
  • the NE or any other catecholamine diffuses back into the circulation or, more commonly is destroyed intracellularly by the enzymes monoamine oxidase (MAO) and catechol-O-methyltransferase (COMT).
  • MAO monoamine oxidase
  • COMP catechol-O-methyltransferase
  • MAO is found in all tissues which contain mitochondria, and is bound to their outer membranes. MAO is present in liver, brain, nerves, muscles and all actively metabolizing tissues. It oxidatively deaminates NE to c, 4-dihydroxymandelic acid which can then by O-methylated (by COMT) to give rise to 3-methoxy-4-hydroxy-mandelic acid.
  • MAO in actuality describes a group of isoenzymes which possess different tissue distributions, substrate specificities, inhibitor characteristics and physical properties. For example, MAO A has a substrate preference for NE and 5HT, and is selectively inhibited by clorgyline.
  • MAO B has a substrate preference for olopamine and phenylethylamine, and is selectively inhibited by deprenyl (selegiline).
  • Other well known MAO inhibitors include iproniazid, nialamide, pargyline, tranclypromine and phenelzine.
  • COMT is found in large quantity in liver cells.
  • COMT acts on E and NE which has not been inactivated by neuronal re-uptake.
  • Pyrogallol an inhibitor works by blocking the COMT dependent transfer of a methyl group from S-adenosyl-L-methionine to the hydroxyl group at the 3' position of the catechol ring of NE, E and DA.
  • Dopamine is the precursor of NE and E, and plays a significant role in the CNS and at some ganglia in the autonomic nervous system. High intraneuronal amounts of DA inhibits tyrosine hydroxylase by end-product inhibition, thus decreasing the rate of DA synthesis.
  • the rate-limiting step in the synthesis of DA is the conversion of tyrosine to L-dopa by tyrosine hydroxylase.
  • tyrosine hydroxylase is completely saturated with L-tyrosine and thus increase in circulatory tyrosine levels do not increase the rate of DA synthesis.
  • this fact changes when there is a deficit in both the amount of DA and when tyrosine hydroxylase is compromised as under the influence of cocaine.
  • L-dopa is actively taken up into DA neurons in the CNS where it is converted to DA. Following L-dopa therapy there is a significantly increase in the amount of DA synthesized and stored. By comparison with the dopaminergic system, there is relatively little increase in the synthesis of NE following L-dopa, treatment.
  • Dopamine is stored in storage granules where the catecholamine is complexed with chromogranins, divalent metal ions and ATP.
  • DA is believed to be released into the synaptic cleft by exocytosis. As with NE, this is a calcium dependent process and occurs in response to action potentials reaching nerve terminals or to drugs.
  • the following substances can increase DA release; cocaine, (+)-amphetamine, methylamphetamine, tyramine, amantadine, m-phenmetrazine, phentermine and nomifensine.
  • these compounds can also, to different degrees, inhibit neuronal re-uptake of DA.
  • DA neuronal re-uptake system which is a high affinity, energy-dependent active-transport process.
  • MAO and COMT are responsible for the transformation of DA to 3, 4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA, 3-methoxy-4-hydroxy-phenylacetic acid), respectively.
  • DOPAC 4-dihydroxyphenylacetic acid
  • HVA homovanillic acid
  • Cocaine by virtue of blocking re-uptake of DA into presynaptic nerve terminals, prolongs the effect of release DA in the synaptic cleft.
  • Elevation of brain tyrosine levels results in an increase in L-DOPA synthesis in the brain.
  • L-DOPA in turn is metabolized to dopamine.
  • the synthesis and release of dopamine is elevated following tyrosine administration.
  • dietary tyrosine increases turnover and release of dopamine and norepinephrine.
  • Stress, cold or certain drugs induce an increase in nerve firing to lower the levels of catecholamines in the nerve terminals.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biomedical Technology (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Epidemiology (AREA)
  • Psychiatry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Addiction (AREA)
  • Anesthesiology (AREA)
  • Pain & Pain Management (AREA)
  • Child & Adolescent Psychology (AREA)
  • Diabetes (AREA)

Abstract

Enhancement of attentional processing is attained by administration of an endorphinase inhibitor or enkephalinase inhibitor and optionally, a dopamine precursor, or a serotonin precursor, a GABA precursor, or an endorphin or enkephalinase releaser, or certain herbal compounds including Rhodiola rosea extract (Pharmaline) and/or Huperzine. These components promote restoration of normal neurotransmitter function and the components combined enhance the release of dopamine at the nucleus accumbens and are non-addictive. Use of the dopamine precursors L-phenylalanine, or L-Tyrosine, the enkephalinase inhibitor D-phenylalanine, and/or the serotonin precursor -hydroxytryptophan and a natural acetylcholenesterase inhibitor and chromium salts (i.e. picolinate, nicotinate, etc.) is especially preferred, but not limited to assist in relieving symptoms associated with brain phenylalanine deficiency.

Description

APPLICATION FOR UNITED STATES LETTERS PATENT for
ALLELIC POLYGENE DIAGNOSIS OF REWARD DEFICIENCY SYNDROME AND TREATMENT by
Kenneth Blum,
David E. Comings and
John L. Ivy
BACKGROUND OF THE INVENTION
The government owns rights in the present invention pursuant to grant number 1-R01-DA08417 from National Institutes of Drug Abuse and Tobacco Related Research Disease Program grant 4RT-01 10.
1. Field of the Invention
This invention, in part, relates to the coupling of certain anti-craving compositions and specific genotyping of a number of genes all involved in neurotransmitter function of reward behavior. An aspect of this invention is the understanding of the involvement of how certain established neurotransmitters work in concert to activate neuropathways in the meso-limbic system of the brain leading to feelings of well being, and the development of compositions that affect these neuropathways. This invention, in part, relates to the utilization of precursor amino acids and certain herbal compounds to enhance attentional processing and memory as well increase focus in healthy individuals, as well as to enhance weight loss and control overeating. Disclosed are various diagnostic methods of neurological disorders and behaviors utilizing genetic polymorphisms of neurotransmitter genes, and therapeutic methods of treatment of patients so identified using the compositions ofthe invention. Also disclosed are diagnostic methods for polygenic traits.
2. Description of Related Art During the past several decades, research on the biological basis of chemical dependency has been able to establish some of the brain regions and neurotransmitters involved in reward. In particular, it appears that the dependence on alcohol, opiates and cocaine relies on a common set of biochemical mechanisms (Cloninger, 1983; Blum, 1978; Blum, 1989). A neuronal circuit deep in the brain involving the limbic system and two regions called the nucleus accumbens and the globus pallidus appears to be critical in the expression of reward of people taking drugs (Wise and Bozarth, 1984). It has been demonstrated that the chronic use of cocaine, morphine and alcohol results in several biochemical adaptations in the limbic dopamine system (Ortiz et a/., 1996). The mesolimbic dopamine system connects structures high in the brain, especially the orbiofrontal cortex (in the prefrontal area behind the forehead) with the amygdala in the brain's center, and with the nucleus accumbens, which has been proven in animal research to be a major site of activity in addiction. The various brain pathways involved in multiple addictions converge on certain dopaminergic receptors (DI, D2, D3, D4, D5) where the D2 site seems to be most prominent. Although each substance of abuse appears to act on different parts of the circuit, the end result is the same: dopamine is released in the nucleus accumbens and the hippocampus (Koob and Bloom, 1988). Dopamine appears to be the primary neurotransmitter of reward at these reinforcement sites.
Abnormalities in dopamine metabolism have been implicated in several behaviors, i.e. sexual disorders (Gessa and Tagiamonte, 1975), mania (Goodwin and Jamison, 1990), schizoid behaviors (Carlsson, 1978; Snyder, 1976), ADHD (Shaywitz et al., 1976), conduct disorder or aggression (Rogeness et al., 1986; Valzelli, 1981 ; King, 1986), alcohol abuse (Blum et al., 1990) and stuttering. In addition, haloperidol, a DRD2 receptor antagonist, has been reported to be effective in the treatment of some stutters (Murray et al., 1977; Prins et al., 1980). While serotonergic mechanisms have been most often implicated for obsessive- compulsive behaviors, abnormalities in dopamine have also been considered (Austin et al., 1991 ; Delgado et al., 1990). Abnormal circuits involving the thalamus, basal ganglion and frontal lobes have been implicated in obsessive-compulsive disorder (Baxter et al., 1992; Rauch et al., 1994; Modell et al., 1989) and dopamine is a major neurotransmitter especially in the striatum and frontal lobes.
Defects in central noradrenergic mechanisms have been frequently implicated in the etiology of attention-deficit hyperactivity disorder. A significant increase in plasma noradreneline (NA) in ADHD children with reading and other cognitive disabilities compared to ADHD children without cognitive disabilities has been demonstrated (Halperin et al., YEAR). They proposed that the ADHD + cognitive disabilities was associated with NA dysregulation affecting the parietal/temporal lobe attention centers. Since these brain areas are in proximity to auditory and linguistic processing regions, this could account for the comorbid cognitive disabilities. From a clinical perspective, the significant improvement in symptoms that often occurs following treatment with clonidine (Hunt et al, 1985; Comings et al, 1990) implies a role of NA in at least some ADHD. Clonidine is a presynaptic a2-noradrenergic receptor agonist that results in the inhibition of release of noradrenaline into the synapse (Starke et al. 1974).
It has been proposed that NA and the locus coeruleus (LC) play a role in arousal and vigilance, critical aspects of attention (Aston-Jones et al, 1984). It has been proposed that stress tolerance and good performance on tasks were related to low basal or tonic levels of catecholamines and to higher acute releases during mental stress (Dienstbier, 1989). The opposite may occur in ADHD, with an increased baseline tonic stimulation of NA and a decreased release of catecholamines during stress (Pliszka et al, 1996). To test the hypothesis that NA defects are involved in ADHD, a number of studies of CSF, plasma and urinary excretion of the NA metabolite (3-methoxy-4-hydroxyphenylglycol (MHPG) have been performed. Some show that ADHD patients have lower rates of MHPG excretion than controls (Oades, 1987; Shekim et al, 1983; Shekim, Dekirmenjian, and Chapel, 1997; Yu-cum and Yu-feng, 1984) while others show no change (Rapoport et al, 1978; Zametkin et al, 1985) or an increase in NA turnover (Khan and Dekirmenjian, 1981). Epinephrine levels have been reported to be significantly lower (Hanna et al, 1996; Klinteberg and Magnusson, 1989; Pliszka et al, 1994), or to show a blunted response to glucose ingestion (Girardi et al, 1995) in ADHD subjects compared to controls. Norepinephrine is converted to epinephrine (adrenaline) by phenylethanolamine N-methyl-transferase coded by the PNMT gene.
A model of ADHD based on failure of epinephrine to tonically inhibit NA neurons in the locus coeruleus. d-amphetamine and desipramine, both of which are commonly used in the treatment of ADHD, lead to a significant decrease in the excretion of MHPG has been proposed (Mefford and Potter, 1989; Shekim et al, 1979). However, methylphenidate (Ritalin) the most commonly prescribed medication for the treatment of ADHD does not result in a decrease in MHPG excretion (Zametkin et al, 1985) and other medications that reduce MHPG excretion, such as fenfluramine (Donnelly et al, 1989), are not effective in the treatment of ADHD. These observations are consistent with the presence of several types of ADHD and an involvement with multiple neurotransmitters and genes.
It has been proposed that NA and adrenergic α2-receptors played a role in some forms of ADHD through a dysregulation at the LC of the posterior cortical attention system (Posner and Peterson, 1990; Pliszka 1996) of the parietal/temporal lobes, and that a second form of ADHD was due to dopaminergic defects that primarily affected the prefrontal lobe attentional system which was associated with impulsivity and disorders of executive dysfunction. Several dopaminergic genes, such as the dopamine D2 receptor (DRD2) (Comings et al, 1991 ), dopamine D4 receptor (DRD4) (Lahoste et al, 1996), and dopamine transporter (DAT]) (Cook et al, 1995; Comings et al,. 1996; Gill et al, 1997; Waldmaqn et al, 1996) genes have been found to be associated with ADHD.
It has been reported that boys with ADHD and reading disabilities had significantly higher plasma MHPG levels than boys with ADHD only (Haperin et al, 1993; Halperin et al, 1997). In the latter study, they also demonstrated a significant negative correlation between plasma MHPG levels and the WISC-R verbal IQ, and the reading, spelling and arithmetic problems assessed by the WRAT-R (Wide-Range Achievement Test-Revised). This distinction was consistent with prior studies of others suggesting that ADHD with cognitive disabilities was a distinct subtype of ADHD (August and Garfinkel, 1989; McGee et al, 1989; Pennington et al, 1993). It has also been suggested that the type of attention deficit associated with parietal lobe defects tends to be a selective attention deficit (Posner and Peterson, 1990; Dyk an et al, 1979; Richards et l, 1990).
It has been proposed that ADHD + cognitive disorders was due to a dysregulation of NA metabolism of the LC involving adrenergic α2 receptors, and primarily affected the posterior attention system ofthe parietal cortex (Halperin et al, YEAR) Since these brain areas are in proximity to auditory and linguistic processing regions, this could account for the comorbid cognitive disabilities. It would be a mistake to assume that these are pure forms since ADHD is a polygenic disorder (Comings et al, 1996), and most individuals are likely to have inherited genes for both types. Studies in primates show that NA and defects in adrenergic α2 receptors also play a role in prefrontal lobe cognitive defects (Arnsten, 1997).
Various studies have indicated the involvement of the dopamine receptor in addictive behaviors. Cocaine patients show a drop in those neuronal activity levels that is consistent with a lessened ability to receive dopamine (Volkow et al, 1993). Neurons with D2 dopamine receptors were shown to become 25% smaller, and lost much of their ability to receive small amounts of dopamine from nearby neurons in morphine addicted rats (Nestler et al, 1996). Decreases in D2 receptors observed in opiate-dependent subjects have been suggested to indicate that the subjects had low D2 receptors prior to when they began abusing drugs, and that this reduction may have made them more vulnerable to drug self-administration (Wang et al, 1997).
Although the system of neurotransmitters involved in the biology of reward is complex, at least three other neurotransmitters are known to be involved at several sites in the brain: serotonin in the hypothalamus, the enkephalins (opioid peptides) in the ventral tegmental area and the nucleus accumbens, and the inhibitory neurotransmitter GABA in the Substantia nigra, ventral tegmental area and the nucleus accumbens (Stein and Belluzzi, 1986; Blum and Kozlowski, 1990). Interestingly, the glucose receptor is an important link between the serotonergic system and the opioid peptides in the hypothalamus. An alternative reward pathway involves the release of norepinephrine in the hippocampus from neuronal fibers that originate in the locus coeruleus.
There is evidence that the opoidergic and dopaminergic systems are anatomically and functionally interconnected, suggesting a role for the endogenous opioidergic system in mediating the effects of ethanol and other drugs on brain dopaminergic pathways associated with reward. Dopamine antagonists and lesions of the dopaminergic pathways in the brain affect pre-proenkephalin A activity (Morris et al, 1988; Normand et al, 1988). Behavioral, pharmacological and neurochemical studies implicate the opioidergic and dopaminergic systems in the reinforcing effects of ethanol and other drugs of abuse (Blum et al, 1976a, b; Blum et al, 1982a; Blum et al, 1977; Blum et al, 1973; Koob and Bloom, 1988; Weiss et al, 1993). Animal studies show that opiate receptor agonists increase preference for ethanol, whereas antagonists of these receptors reduce ethanol consumption (Blum et al, 1975; Le et al, 1993). Further, studies on animals and human alcoholics suggest the effectiveness of the opiate receptor antagonist in reducing the positive reinforcing effects of alcohol consumption (O'Malley, 1992; Swift et al, 1994; Blum et al, 1975; Volpicelli et al, 1992). Moreover, ethanol-induced increase of brain dopamine levels in animals is blocked by both opiate receptor antagonists naloxone and naltrexone (Widdowson and Holman, 1992; Benjamin et al, 1993). A recent review by Gianoukalis and de Waele (1994) support the role of endogenous opioids and drugs of abuse {i.e. alcohol).
In a normal person, these neurotransmitters work together in a cascade of excitation or inhibition between complex stimuli and complex responses, leading to a feeling of well being, the ultimate reward. In the cascade theory of reward, a disruption of these intercellular interactions results in negative emotions. Genetic anomalies, including certain polymorphisms, prolonged stress or longer term abuse of psychoactive drugs (including glucose) can lead to a self-sustaining pattern of abnormal cravings in both animals and human beings (Blum, 1991).
Pharmacological actions (bromocryptine, bupropion and N-propylnor- apomorphine) are partly determined by the individual's dopamine D2 genotype. Al carriers of the DRD2 gene are pharmacologically more responsive to D2 agonists. One study has already shown that the direct microinjection of the D2 agonist N- propylnor-apomorphine into the rat nucleus accumbens significantly suppresses the animal's symptoms after withdrawal from opiates, while dopamine per se suppresses alcohol withdrawal symptoms (Harris and Aston-Jones, 1994; Blum et al, 1976b). In this regard, there is evidence for dopamine/endogenous opioid peptide interactions in the nucleus accumbens and elsewhere in the brain, and it may be that overstimulation of the opioid peptide system by exogenous opiates leads to decreases in dopamine function (Pothos et al, 1991). When compared to normal non-alcohol preferring rats, alcohol preferring rats have fewer serotonin neurons in the hypothalamus, higher levels of enkephalins in the hypothalamus (because less is released), more GABA neurons in the nucleus accumbens and a lower density of D2 receptors in certain areas of the limbic system (McBride et al, 1995; Smith et al, 1997; and McBride et al, 1997).
Clinical trials have demonstrated that when amino-acid precursors of certain neurotransmitters (serotonin and dopamine) and D-phenylalanine, a substance that promotes enkephalin activity by inhibiting enzymatic cleavage (U.S. Patent Nos. 4,761 ,429 and 5,189,064) are administered to probands with either SUD or carbohydrate bingeing, was found to reduce craving, reduce incidence of stress, reduce relapse rates, and also increase the likelihood of recovery.
A number of laboratories have pursued the association between certain genes and various behavioral disorders, including linkage of the dopamine D2 receptor alleles with a number of impulsive-compulsive-addictive behaviors. Little is known about the resultant expression of polymorphisms linked to either the DAT, 10/10 allele and the DβH B, allele except studies showing increased dopamine transporter sites in Tourette's Disorder patients by SPECT scanning techniques (Malison et al, 1995, Tiihonen et al, 1995). ADHD, Tourette syndrome, conduct disorder, ODD, dyslexia, learning disorders, stuttering, drug dependence and alcoholism all show a male predominance. The molecular genetic studies of the DRD2, Z)βH, DAT
(Comings et al, 1996a) and clinical genetic studies (Comings, 1994b; 1994c; 1995b;
Bierderman et al, 1991 ; Comings and Comings, 1987), indicate these are etiologically related spectrum disorders. Defects in neurotransmitters has been advocated as involved in alcoholism (Blum, 1991). Studies of genes involved in neurological pathways are described below.
Androgent Receptor gene Specific mutations of the AR gene have been reported to cause a wide range of types of androgen insensitivity syndromes (Gottlieb et al, 1977). In addition, two sets of polymorphic tricnucleotide repeat sequences, CAG (Edwards et al, 1992) and GGC (Sleddens et al, 1993; Sleddens et al, 1992), resulting in polyamino acid tracts in the protein, are present in the first exon of the AR gene. When highly expanded, from 43 to 65 times, the CAG trinucleotide repeat has been shown to cause X-linked spinal muscular atrophy (La Spada et al, 1991). The repeat length in the normal population is 11 to 31 times (Edwards et al, 1992). The non-highly expanded alleles of micro- and minisatellites present in the normal population, might play a direct role in the regulation of genes. This was based on the observation that most short tandem repeats are associated with the formation of Z-DNA (Schroth et al, 1992), and Z-DNA has repeatedly been implicated in various aspects of gene regulation (Rich et al, 1984; Hamada et al, 1982; Wolff et al, 1996). Since the amount of Z-DNA formed is highly sensitive to the length of the repeats (Schroth et al, 1992), it was suggested that the size of the repeat alleles could themselves be related to phenotypic effects (Comings, 1997).
Some (Olweus et al, 1988; Mattsson et al, 1980; Schiavi et al, 1984; Kreuz and Rose, 1972) but not all (Bradford and McClean, 1984; Schaal et al, 1998) studies suggest a correlation between aggressive behavior and plasma testosterone levels. Aggressive conduct disorder is often a comorbid condition in subjects with TS and ADHD (Comings, 1995; Stewart et al, 1981; Biederman and Sprich, 1991) and there is a high degree of comorbidity between TS and ADHD (Comings and Comings, 1984, 1990; Knell and Comings, 1993).
Dopamine Dj Receptor Gene (DRDl) Sequencing of the DRDl gene in controls and in patients with schizophrenia, manic-depressive disorder and alcoholism, has failed to identify exon mutations that produce an effect on the phenotype and linkage studies in schizophrenia and TD (Jensen, 1993k; Gelertner et al, 1993k). The D, receptors in frontal cortex may play a role in memory (Comings et al, 1997k; Williams et al, 1995k). The opposing effect of the Dj and D2 receptor agonists on cocaine seeking behavior in rats have been reported (Self et al, 1996). TD probands, smokers, and pathological gamblers, were consistent with negative heterosis, in that the most consistent difference was a relative decrease in the frequency of 12 heterozygotes and an increase in 11 and 22 homozygotes of the Dde 1 polymorphism (Comings et al. (1996)). By contrast, positive heterosis was present at the DRD2 gene, with quantitative scores being highest for 12 heterozygotes and lowest for 11 and 22 homozygotes. While the results for ADHD at the DRDl locus alone was not significant, there was a significant additive effect of examining the presence of negative heterosis at the DRDl gene and/or positive heterosis at the DRD2 gene (Comings et al, 1997k). Dopamine D2 Receptor Gene (DRD2) Previous studies have shown a significantly increased prevalence of the D2A1 allele in individuals with ADHD, TS ,CD and SUD (Comings et al, 1991). Since each of these disorders is characterized by a poor response to stress and many criteria for the diagnosis of PTSD have many symptoms in common with ADHD and The National Vietnam Veterans Readjustment Study (Kulka et al, 1990) reported a significant correlation between PTSD and a history of childhood symptoms consistent with ADHD and CD. Subjects on an addiction treatment unit who had been exposed to severe combat conditions in Vietnam were screened for posttraumatic disorder (PTSD), and showed an correlation of individuals with PTSD as carrying the D2A1 allele (Comings, et al, 1996k).
An association between ADHD and the Taq Al allele of the DRD2 gene has been detected (Comings et al, 1991k). The stimulant methlphenidate increased regional blood flow while in others it decreased blood flow. The changes in frontal, temporal and cerebellar metabolism were related to the density of D2 receptors - the higher the density the greater the increases in blood flow. Methylphenidate decreased the relative metabolic activity in the basal ganglia. These results are consistent with the idea that genetic defects in dopamine metabolism, resulting in a dopaminergic state in the limbic system and frontal lobes result in a compensatory increase in dopaminergic activity in the basal ganglia, and that methylphenidate reverses these through a combination of enhancing brain dopamine activity in dopaminergic through its inhibition of the dopamine transporter (Volkow et al, 1996k), with a secondary decrease in dopaminergic activity in the basal ganglia and decrease in basal ganglia blood flow. These studies are also consistent with the results of others (Castellanos et al, 1996k). showing a positive correlation between the response to methylphenidate and CSF levels of HVA, a metabolite of dopamine whose levels in the CSF are related to D2 receptor density (Jonsson et al, 1996k). Methylphenedate consistently increased cerebellar metabolism, despite the paucity of D2 receptors in this structure (Volkow et al, 1996k; Hall et al, 1994k). This is consistent with the increasing evidence that the cerebellum play an important role in attention, learning and memory (Leiner et al, 1989k). An association between the Al genotype and regional blood flow has been reported. The Taql D2 Al carriers showed a significantly lower relative glucose metabolism in the putamen, nucleus accumbens, frontal and temporal gyri and medial prefrontal, occipito-temporal and orbital cortices than those with the A22 genotype (Nobel et al, 1997). The Taql D2 Al carriers had a significantly decreased dopamine D2 receptor Bmax in the basal ganglia (Noble et al, 1991k). Enkephalin increases blood flow in similar regions as methylphenidate and may therefore involve a dopaminergic mechanism (Blum et al, 1985k). A significant decrease in dopamine D2 receptor density was measured in individuals with detachment, social isolation, and lack of intimate friendships (Farde et al, 1997k).
Though the DRD2 gene polymorphisms have been associated with a number of psychological disorders, but no association was found between certain psychopathy in incarcerated drug users (Smith et al, 1993). The reports of an association between alcoholism and the DRD2 allele have been quite variable, an association between the D2AI allele and polysubstance/drug abuse has been found (Smith, et al, 1992, Noble, et al, 1993, O'Hara, et al, 1993, Comings, et al, 1994, U.S. Patent Nos. 5,210,016, U.S. 5,500,343). After the first association of the DRD2 Al and severe alcoholism (Blum et al, 1990), several groups were unable to replicate the observation. Two possible reasons were suggested: first, inadequate screening of controls for alcohol, drug and tobacco abuse; and second, sampling errors in terms of characterization of alcoholics for chronicity and severity of disease (Blum et al, 1997; Bolos et al, 1990; Gelertner et al, 1991; Schwab et al, 1991 ; Turner et al, 1992; Cook et al, 1992; Goldman et al, 1992; Goldman et al, 1993; Suarez et al, 1994).
Dopamine plays a role as a modulator of many different behaviors (LeMoal and Simon, 1991), and numerous studies have reported a significant association between alleles of the DRD2 gene and cocaine addiction, polysubstance abuse, smoking, attention deficit hyperactivity disorder (ADHD), Tourette syndrome, visual- perceptual disorders, conduct disorder, posttraumatic stress disorder, pathological gambling, and compulsive eating (Blum et al, 1995; Blum et al, 1996). Despite these associations, sequencing studies have failed to find any mutations in the exons that could explain these findings. These findings could be explained if the D2A1 allele was in linkage disequilibrium with an unknown non-exon mutation that played a role in the regulation of DRD2 function (Comings et al, 1991). Additionally the severity of alcoholism and the type of controls used have been reported as important determinants of DRD2A1 allele association with alcoholism (Noble et al, 1994; Geijer et a/., 1994; Parsian et al, 1991; Blum et al, 1992; Blum et al, 1990; Lawford et al, 1997).
Sib pair linkage analyses conducted in families multiply affected by alcoholism, using both the Taql "A" RFLP and a microsatellite repeat polymorphism at the DRD2 locus, indicated a significant correlation with this locus and the liability to develop heavy drinking. A corresponding mutation in the DRD2 gene has not been found, the effect may arise from a closely linked locus-outside the DRD2 gene itself (Cook et al, 1996). A single point mutations in exon 8 of the DRD2 gene in alcohol- dependent patients has been demonstrated (Finch et al, 1995), while others report no structural mutations in the coding regions ofthe DRD2 gene (Gejman et al, 1993).
The DRD2 gene A, allele has been found to associate with a number of behaviors including severe alcoholism, polysubstance dependence, crack/cocaine addiction, tobacco smoking, pathological gambling, lack of a major depressive episode, and carbohydrate bingeing or generalized to DSM- IV substance use disorder (Blum et al, 1996e; Blum et al, 1995b; Comings et al, 1996c). The MCMI-II assessed schizoid/avoidant cluster compared to other Axis II diagnostic clusters (antisocial, narcissistic, paranoid) significantly correlated with alcohol abuse scales (Corbisiero et al, 1991). Clusters of patients with MCMI-II elevations that indicated schizoid and avoidant qualities tended to stay in treatment fewer days and relapsed earlier (Fals-Stewart, 1992). High scores of schizoid/avoidant cluster correlated with inpatient male alcoholics (Matano et al, 1994) and cocaine dependent patients (Kranzler and Satel, 1994). Schizoid/avoidant behaviors including low levels of sensation were found to consume more alcohol and to have higher MAST scores than patients with high levels of sensation (Ohannessian and Hesselbrock, 1995); and avoidant personality is significantly correlated in subjects with severe binge eating disorder (Yanovski et al, 1993).
Molecular heterosis at the dopamine receptor genes was indicated in healthy individuals and alcoholics. Cerebrospinal fluid levels of monoamine metabolites consisting of HVA for dopamine, 5 -HI A A for serotonin, and MHPG for norepinephrine levels were compared in healthy volunteers to the DRD2 Taql A1A2 and B1B2 genotypes. The results indicate a statistically significant difference in the means ofthe 1,1+1,2 homozygotes vs. the 1,2, but not when analyzing the 1,1+1,2 vs. the 2,2 genotypes and for 1 vs. the 2 alleles. The Taql B1B2 polymorphism gave virtually identical results (Jonsson et al, 1996). In contrast, CSF HVA levels and the DRD2 Taql Al I 2 polymorphism were examined in Finnish and American alcoholics, and no association was found when examining the 1 vs. 2 alleles, and not the 1 ,1+1,2 vs. the 2,2 genotypes (Goldman et al, 1992).
Heterosis at the DRD2 gene was indicated by comparison of the CSF levels of HVA, to the DRD2 genotype using Taql polymorphism (Jonsson et al, 1996k). In a profile for the inattention score of TD subjects, the 12 heterozygotes showed the highest inattention score subjects who were 12 heterozygotes had the lowest levels of CSF HVA (Jonsson et al, 1996). The highest levels of HVA were seen in the 11 homozygotes, with the 22 homozygotes being intermediate. Some studies, but not all, showed a significantly lower level of CSF HVA in children (Shaywitz et al, 1979k) with ADHD and TD (Cohen et al, 1979k). A significant correlation was found between electrophysiological abnormalities and the DRD2 Al allele (Blum et al, 1994k). These abnormalities are seen in ADHD subjects as well as children of alcoholics (Comings et al, 1991k; Noble et al, 1994k).
A positive association of the Taq Al of the DRD2 gene to Attention Deficit
Disorder (ADHD) and Tourette's was reported (Comings et al, 1991 ; Comings et al, 1996a), while others found no association with ADHD probands (Sunohara et al, 1996). ADHD probands showed a significant association with the 48bp variant of the D4 gene, but not the DRD2, DRD3 or the serotonin transporter genes. The 7-fold repeat allele of the DRD4 occurred significantly more frequently in that children with ADHD. There is evidence for an association of the 7 repeat allele of the D4 receptor gene and novelty seeking (characterized as impulsive, exploratory, fickle, excitable, quick tempered and extravagant) (Epstein et al, 1996; Benjamin et al, 1996). The DRD2 Al allele in cocaine dependent probands was associated with the opposite: low novelty seeking, characterized by reflective, rigid, stoic, slow-tempered, avoidant, as well as having enhanced withdrawal depression (Compton et al, 1996). Molecular genetic studies have found an association of the D2 dopamine receptor (DRD2) Al allele with alcoholism and drug abuse (Blum et al, 1990). Reduced central dopaminergic function has been suggested in subjects who carry the Al allele (Al+) compared with those who do not (AT) (Nobel et al 1997). The genes responsible for alcoholism are unknown, although the many studies to date indicate a significant role for the DRD2 gene in more severe cases (Noble, 1993; Blum et al, 1995).
The DRD2 gene has been associated with the compulsive behavior {Comings and Comings, 1987b) and addictive, impulsive behaviors, including compulsive eating, gambling and smoking. (Self et al, 1996; Ogilvie et al, 1996; Blum et al, 1995b; Blum et al, 1996e). These behaviors have previously been reported to be associated with the DRD2 gene (Comings et al, 1993a; Noble et al, 1994d; Blum et al, 1996a; Comings et al. 1996c; Noble et al, 1994c; Noble, 1993; Comings et al, 1996e) in subjects distinct from the TS group.
Dopamine D2 receptor availability was significantly lower in alcoholics than in nonalcoholics, and was not correlated with days since last alcohol use (Volkow et al, 1997). The ratio DRD2 receptor to transporter availability was significantly higher in nonalcoholics than in alcoholics. Alcoholics showed significant reductions in D2 receptors (postsynaptic marker) but not in DA transporter availability tpresynaptic marker) when compared with nonalcoholics. Because D2 receptors in striatum are mainly localized in GABA cells, these results provide evidence of GABAergic involvement in the dopaminergic abnormalities seen in alcoholics.
Dopamine D3 Receptor Gene (DRD3) Knockout mice missing the DRD3 gene are considerably more active than their litter mates with normal DRD3 genes (Williams et al, 1995k). Negative heterosis has been reported for schizophrenia at the DRD3 locus (Crocq et al, 1992k) have observed a significant decrease in DRD3 Mscl 12 heterozygosity in TD (Comings et al, 1993j) and pathological gambling (Comings et al, 1996).
Dopamine D4 Receptor Gene (DRD4) In the Dopamine D4 receptor gene
(DRD4), a 48 bp and 16 amino-acid repeat polymorphism within the DNA coding for the third cytoplasmic loop responsible for binding to guanine -nucleotide proteins (Van Tol et al, 1992k; Lichter et al, 1993k) has been reported. This DNA region is repeated 2 to 1 1 times, with the most common alleles being the 2, 4, and 7 repeat. The 7 allele demonstrates a blunted response to dopamine in regards to intracellular adenyl cyclase inhibition (Asghari et al, 1995k). Two independent studies of normal subjects have shown an association between the presence of the 7 allele and novelty seeking, a trait associated with impulsivity (Benjamin et al, 1996k; Ebstein et al, 1996k). One study failed to find such an association (Malhotra et al, 1996). A study ADHD children compared to controls, reported that more ADHD children carried at least one 7 allele compared to controls (LaHoste et al, 1996k). An association between the 7 allele of the DRD4 gene in TD has been reported (Grice et al, 1996k). Other work in this area is not equivocal (Spielman et al, 1993k).
Dopamine Transporter Gene (DAT1) The DAT1 gene marker frequencies at the vesicular transporter locus showed substantial heterogeneity in different Caucasian-Americans originating from different European countries, but no association with substance abuse was evident (Uhl et al, 1993; Persico et al, 1993). Distributions of the DAT1 VNTR alleles do not distinguish any substance user or control sample for psychostimulant abusers (Persico et al, 1996), however an association was observed with Japanese alcoholics (Muramatsu and Higuchi, 1995). The DAT1 gene has also been implicated as having a role in compulsive and addictive disorders. Since one of the modes of action of cocaine is to inhibit dopamine transporter function (Ritz, et al, 1992; Ritz, et al, 1990), it has been implicated in the biology of drug addiction, as well as other disorders including Parkinson's disease (Uhl, 1990) and Tourette's syndrome (Singer, et al, 1991).
Increased dopamine transporter sites in Tourette's syndrome was demonstrated using SPECT scanning techniques (Malison et al, 1995), and dopamine transporter receptor sites were significantly increased in violent alcoholics compared to nonviolent alcoholics (Tiihonen et al, 1995). Studying postmortem samples of TS subjects, reported an increased number of dopamine uptake sites in the striatum suggesting either a greater number of DAT1 molecules or an increased number of dopamine nerve terminals (Singer et al, 1991). It is the site of action of methylphenidate (Volkow et al, 1995k) and dexedrine, compounds widely used in the treatment of ADHD. These stimulants inhibit the transport process resulting in an increase in synaptic dopamine. A significant increase in the level of dopamine transporter protein in the striatum of TD subjects vs. controls has been reported (Maison et al, 1995k). Studies of the DATl knockout mice, which are very hyperactive in confined spaces, showed a five fold increase in brain dopamine levels, down regulation of D2 receptors, uncoupling of D2 receptor function, and a 57% decrease in body size (Giros et al, 1996k). It is not known whether the less common DATl repeat alleles are associated with an increase or decrease in the number of DATl molecules.
An association between the 10 allele of the DATl gene was reported in cases of ADHD/ ADD (Cook et al, 1995k), and behavioral variables in Tourette Disorder (TD) (Comings et al, 1996). The significant increase in subjects with autism is consistent with studies suggesting that TS and autism are genetically related and involve similar sets of genes (Burd et al, 1987; Comings and Comings, 1991b; Sverd, 1991).
Significant increased prevalence of the nine-repeat allele VNTR polymorphism in the 3' untranslated region of the DATl gene was seen in 93 alcoholics displaying withdrawal seizures or delirium, compared with 93 ethnically matched non-alcoholic controls (Sander et al, 1997). The 5' UTR 40 bp repeat polymorphism in the DATl was examined in subjects with drug abuse and found no significant difference in the frequency of any ofthe 3' UTR repeat alleles compared to normal controls (Persico et al, 1993). The 9/10 genotype has been found to associate with "pathological violent" adolescents; and the 9/9 genotype is associated in alcohol dependence with withdrawal seizures or delirium. An association between the 9 allele of the 40 bp repeat of the DATl gene with cocaine induced paranoia has been reported (Gelernter et al, 1994a).
Dopamine-β-Hydroxylase DβH is one of the major enzymes for dopamine metabolism and catalyzes the conversion of dopamine to norepinephrine (NE). In study animals, the inhibition of DβH activity results in a decrease in norepinephrine levels which releases the inhibition of tyrosine hydroxylase resulting in the excessive production of dopamine. The later is associated with hyperactivity, aggression, self- stimulation, and stereotypic movements (Randrup and Scheel-Kruger, 1966; Shekin et al, 1983k). Studies of blood enzyme levels of DβH have implicated a role of this enzyme in sensation seeking (Kuperman et al, 1988k; Comings et al, 1996), ADHD and conduct disorder (Rogeness et al, 1982k; Rogeness et al, 1989k).
Disturbances in dopamine-Beta-hydroxylase (DβH) activity have previously been associated with childhood CD and alcoholism (Pliszka et al, 1991). It has been proposed that externalizing disorders such as CD were associated with a decrease in noradrenergic function and an increase in dopaminergic function, a pair of conditions that would be uniquely brought about by a DβH deficiency (Quay 1986). Others reported an increased frequency of the diagnosis of CD in emotionally disturbed boys with low plasma DBD levels. However, an outpatient study by Bowden et al, 1988 found that low DβH levels were much more likely in ADHD children who also had CD than ADHD children without CD (Rogeness et al, 1987; Pliszka et al, 1988; Bowden et al, 1988; Comings et al, 1996). In contrast, in outpatient studies at a juvenile detention center an association between CD and plasma DβH was not found. Umberkomen et al (1981) have shown a correlation between low DβH levels and sensation-seeking behaviors.
Examination of CSF DβH levels in patients with a variety of psychiatric disorders including major depression, bipolar affective disorder and schizophrenia found that the only significant correlation was between low CSF DβH and bipolar affective disorder (Lerner et al, 1978). Linkage studies between the DβH locus and schizophrenia (Aschauer and Meszaros, 1994), alcoholism, depression, manic- depression and Tourette's syndrome (Comings, et al, 1986) have been negative. However, some sib pair analyses suggest a weak linkage between the ABO blood group and DβH, and some psychiatric disorders such as depression and alcoholism (Wilson et al, 1992).
Linkage studies between the DβH locus and schizophrenia, alcoholism, depression, manic-depression, and Tourette syndrome have been negative (Aschauer and Meszaros, 1994; Comings et al, 1986). No association was found between the D HTaqlBl allele and pathological SAB (Blum et al, 1997). The Taql B1/B2 polymorphism was reported to be associated with controls screened to exclude drug, alcohol, and tobacco abuse. However, the BI allele of dopamine-beta-hydroxylase gene also associated TD probands, and ADHD probands (Comings et al. (1996)).
Cannabinoid Receptors (CB1) While the association of cannabinoid receptors with the reward pathways may be primary, it is more likely that the effect is secondary through the modulating effect of anandaide and cannabinoid receptors on dopamine metabolism. This is consistent with the similarity between the results with CB1 receptors and the DRD2 receptors. Like the CB1 gene the association of genetic variants of the DRD2 gene with polysubstance abuse has been more reproducible (OΗara et al, 1993; Smith et al, 1992; Noble et al, 1993; Comings et al, 1994) than the association with alcoholism per se. One interpretation of these observations is that the dopaminergic-cannabinoid reward pathways are activated more by drugs, especially cocaine and amphetamines, than by alcohol (DiChiara and Imperato. 1988).
Activation of the mesolimbic dopamine system is known to trigger a relapse to cocaine seeking behavior in animal models of drug dependence. This priming effect is enhanced by dopamine D2 agonists but inhibited by dopamine D, agonists (Self et al 1996). In this regard, the ability of anandamide to cause a decrease in the ratio of D, and D2 receptors in the striatum (Romero et al, 1995) may be the link that accounts for the role of CB1 variants in drug dependence.
Monamine Oxidase The E .4H1 polymorphism, associated with a T-»C variant at position 1460, and the EcoKV polymorphism, associated with a T- G variant at position 941, of the MAO-A cDNA has been examined (Hotamisligil and Breakefield, 1994). Since both involved substitutions in the third base of a codon, they were not associated with amino acid substitutions. They examined 40 cell lines of known MAO-A activity. All lines that carried the Fnu4Hl C variant also carried the EcoRV G variant. When the sample was divided into two groups on the basis of lower vs higher MAO-A activity, the less common Fn 4Hl C or + allele (the inventors' 2 allele), present in 25% of the cell lines, was significantly (R = 0.028) associated with the higher activity group. Lin et al. (1994) reported a significant increase in the more common MAO A Fn 4Hl T or 1 allele (Lin et al, 1994), associated with lower MAO levels (Lin et al, 1994) in manic depression, while Craddock et al. (1995) and Nothen et al ( 995) were unable to confirm this.
Vanyukov et al. (1993) examined the MAO A gene in 23 male and 34 female alcoholics compared to 31 male and 78 female controls, using a CA repeat polymorphism (Black et al. 1991). There was a trend in males (R = 0.17) but not in females (R = 0.8) for an association between higher molecular weight alleles (>115 bp) in young substance abusers, and a marginal association of the >115 bp alleles with age of onset (R = 0.03). Tivol et al (1996) have recently sequenced the exons of 40 control males who showed a > 100-fold variation in MAO A enzyme activity. There was remarkable conservation of the coding sequence. Only five polymorphisms were found. Of these, four involved the third codon position with no change in the amino acid sequence. The other was a neutral lys — arg substitution.
Nicotine Receptor Genes The gene for the CHRNA4 gene is located on chromosome 20ql3.2-13.3 (Steinlein et al, 1994) and consists of 6 exons over 17 kb of genomic DNA (Steinlein et al, 1996). A Ser248Phe missense mutation in the transmembrane domain 2 of the CHRNA4 gene was found to be associated with autosomal dominant nocturnal frontal lobe epilepsy (ADNFLE) in one extended
Australian pedigree (Steinlein et al, 1995). An insertion of three nucleotides (GCT) into the coding region for the C-terminal end of the M2 domain was found in a
Norwegian pedigree with autosomal dominant nocturnal frontal lobe epilepsy
(Steinlein et al, 1997b). Two other disorders of brain function, benign familial neonatal convulsions (Leppert et al, 1989; Malafosse et al, 1992) and low-voltage
EEG (Steinlein et al, 1992) have also been linked to the region of the CHRNA4 locus. D20S19, a highly polymoφhic locus, is in tight linkage with the genes for all three of these disorders (Steinlein et al, 1996).
A highly polymoφhic dinucleotide VNTR polymoφhism located in the first intron of the CHRNA4 gene was reported by Weiland and Steinlein (Weiland and
Steinlein, 1996). Single base pair polymoφhisms have also been reported (Steinlein, 1995; Phillips and Mulley, 1997; Guipponi et al, 1997; Steinlein et al, 1997a). Using three single base pair polymoφhisms Steilein et al. (1997a) found no association between the CHRNA4 gene and panic disorder. Using the Ser248Phe missense mutation associated with ADNFLE and four silent polymoφhisms, Steinlein et al, Ser248Phe missense mutation reported a modest increase in the frequency of the T allele of the Cfol 595 polymoφhism in common idiopathic generalized epilepsies of childhood (.085) versus controls (.027).
Micro/minisatellite polymorphisms Studies of behavioral phenotypes associated with micro/minisatellite polymoφhisms at different neuropsychiatric candidate genes have found a significant association between the shorter or longer alleles with various quantitative behavioral traits and mini- or microsatellites at the following genes: MAOA, MAOB, HTR1A, DATl, DRD4, HRAS, HTT, OB, CNR1, GABRA3, GABRB3, FRAJXA, and NO (Comings et al, 1996k; Comings et al, 19961; Comings et al, 1996m; Johnson et al. 1997; Comings et al, 1998; Gade et al, 1997). Significant phenotypic behavioral effects with specific size alleles of the same polymoφhisms ofthe DATl (Cook, 1995; Gelernter et al, 1994), DRD4 (Benjamin et al, 1996; Ebstein et /., 1996; Grice et al. 1996; Lahoste et al, 1996), HRAS (Herault et al, 1993; Eggers et al, 1995; Thelu et al, 1993), H7T (Ogilvie et al, 1996; Lesch et al, 1996), INS (Bennett et al, 1955; Kennedy et al, 1995; Pugliese et al, 1997; Vafiadis et al, 1997) and DBH (Wei et al, 1997) genes. These studies do not rule out the presence of an important role of single base pair changes in a subset of these length variants, (see below and Grice et al, 1996; Lichter et al, 1993; Krontiris et al, 1985).
The is evidence for an involvement of long triplet repeats in a variety of neurological disorders (Caskey et al, 1992) including fragile-X syndrome, Huntington's disease (Huntington's Disease Collaborative Research Group, 1993), myotonia dystrophica, Kennedy's disease, Friedreich's ataxia (Campuzano et al, 1996), and others (Caskey et al, 1992). At least five of these disorders involve intronic GAG repeats producing polyglutamine tracts in the amino acid sequence of the respective gene products. Obesity Related Genes Previous studies have failed to identify any mutations of the human OB gene in several hundred obese individuals (Ezzel, 1995; Hamilton et al, 1995; Considine et al, 1996b). However, prior studies (Comings, 1996b; Comings et al, 1996c) have suggested that the mutations involved in polygenic disorders may be outside the exons and that the polymoφhic dinucleotide repeats may themselves play a role in regulating the expression of the genes to which they are close to (Krontiris et al, 1993; Green and Krontiris, 1993; Trepicchio and Krontiris, 1992; Trepicchio and Krontiris, 1993; Bennett et al, 1955; Kennedy et al. 1995).
Taql polymorhisms of the apolipoprotein gene {APOE-D) was found to associate with obese subjects and between the APO-D and fasting-insulin. This work suggests that that the APO-D polymoφhism may be a genetic marker for both obesity and hyperinsulinemia (Vijayaraghavan et al, 1994).
Serotonin Genes Functional variants of this gene could account for the observed simultaneous increase or decreases of both serotonin and tryptophan in various disorders. Four different polymoφhisms of the human TD02 gene have been identified. Association studies show a significant association of one or more of these polymoφhisms and TS, ADHD, and drug dependence. The intron 6G-T variant was significantly associated with platelet serotonin levels (Comings et al, 1996a).
Multiple Gene Analysis Combined examination of the dopamine D4 receptor gene {DRD4), cannabinoid receptor gene (CNRl) and the GABAB3 receptor gene
(GABRB3) explained 25% of the variance of the trait of IV drug use (Saucier et al,
1996; Comings et al, 1997; Johnson et al, 1997). It was observed that testing for both the OB and the DRD2 gene explained 22.8%) ofthe variance of body mass index, demonstrating that polygenic factors influence body weight, while the association with psychiatric symptoms, determined by examination alone, accounted for a smaller percent (Comings et al, 1996b). Individual polymoφhisms at three dopaminergic genes: Taql Al of the dopamine D2 receptor (DRD2),TaqlBl of the dopamine B- hydroxylase (DβH), and the 10/10 genotype of the 40bp repeat of the dopamine transporter {DATl) genes, were shown to have significant association with TS, ADHD, and CD (Comings, 1996). The Role of Neurotransmitters and Amino Acid Precursors In addition to the genes thought to be involved in neurological disorders, neurotransmitters and pharmaceuticals have been studied for their roles in creating or alleviating certain psychological traits. In humans, it has been suggested that meso-prefrontal dopaminergic activity is involved in human cognition (Weinberger et al, 1988). In patients with Parkinson's disease and possibly in patients with schizophrenia, prefrontal activation during a cognitive task and with clinical signs of dopaminergic function (Weinberger et al, 1988k). Brain chemical turnover in animals have demonstrated changes in neurotransmitter levels following precursor amino acid loading, or systemic and direct central nervous system delivery (Blum et al, 1996a; Blum et al, 1996b). Animal studies implicate NE and dopamine in a wide range of attention-related behaviors involving search and exploratory activity, distractibility, response rate, discriminability and the switching of attention. Overall, the animal and human studies indicate a role for dopamine and NE in the early and late processing of information, respectively (Sara et al, 1994k). Several neurotransmitters, specifically, dopamine, serotonin, norepinephrine, GABA, glutamine, and opioid peptides which play vital roles in brain functioning and in mood regulation, can be dramatically influenced by the circulating levels of their precursor amino acid nutrients (Wurtman, 1981k). Data suggest that amino acid precursors and enkephalinase inhibitors provide a substantive effect on recovery from alcohol, cocaine, and food addictions (Blum et al, 1987a; Blum et al, 1987b; Blum et al, 1987c; Blum et al, 1989b; Blum et al, 1990; (Strandburg et al, 1996;.
One important function ofthe catecholamine innervation of the cerebral cortex may be the control of attention. Of particular interest are the catecholamine projections to the cerebral cortex from the reticular formation, namely dopamine neurons in the ventral tegmentum of the midbrain and the NE neurons of the locus coeruleus in the upper pons. Both acetylcholinergic (ACH) and dopaminergic systems (DA) have been found to be crucial for the maintenance of accurate cognitive performance. A series of studies, examining those aspects of cognitive function, revealed by the radial-arm maze, found that these two neurotransmitter systems interact in a complex fashion (Levin et al, 1995). Choice accuracy deficit induced by blockade of either muscarinic- or nicotinic-ACH receptors. The choice accuracy deficit induced by blockade of muscarinic receptors with scopolamine can be reversed by the dopamine receptor blocker, haloperidol. The specific DAD1 blocker SCH23390 also has this effect, whereas the specific D2 blocker raclopride did not. This effect is seen with the D2 antagonist raclopride, but not with the Dj antagonist SCH23390. The D2 receptor was indicated in nicotinic actions on cognitive function by the finding that the selective D2 agonist LY 1771555 reverses the choice accuracy deficit caused by mecamylamine. The effectiveness of these selective DA treatments in reversing cognitive deficits was due to ACH under-activation (Levin et al. 1990k).
Accumulating evidence suggests that serotonin may modulate cholinergic function in several regions of the mammalian brain and that these serotonergic/cholinergic interactions affect cognition. It is concluded that not all mnesic perturbations induced by concurrent manipulations of the serotonergic and cholinergic systems can be attributed to a serotonergic modification of the cholinergic system. The cognitive faculties of an organism arise from interactions among several neurotransmitters such as DA within brain structures such as, for instance, the hippocampus or the cortex, but also from influences on memory of other general functions that may involve cerebral substrates different from those classically related to mnesic functions (e.g., attention, arousal, sensory accuracy, etc.) (Cassel et al, 1995k).
Additionally, it has been determined that extrinsic modulation of hippocampal theta depends on the co-activation of cholinergic and GABA-ergic medial septal inputs. Cholinergic projections provide the afferent excitatory drive for hippocampal theta-on cells and septal GABA-ergic projections act to reduce the overall level of inhibition by inhibiting hippocampal GABA-ergic interneurons (hippocampal theta- off cells). Both activities must be present for the generation of hippocampal theta field and cellular activities. The balance between the cholinergic and GABA-ergic systems may determine whether hippocampal synchrony (theta) or asynchrony occurs (Smythe et α/., 1992).
Other neurotransmitters like Norepinephrine (NE) may also play a role in learning and memory. Neuromodulatory properties of NE suggest that the coeruleo- cortical (LC) NE projection should play an important role in attention and memory processes. For example, the gating and tuning action of NE released in target sensory systems would promote selective attention to relevant stimuli at the critical moment of change (Sara et al, 1994). Other research suggest that one consequence of LC activation during stress or physiological challengers may be to increase or maintain arousal via release of both DA and NE (Page et al, 1994).
It has been reported that discharge of NE LC neurons in behaving rats and monkeys suggest a role for the LC system in regulating attentional state or vigilance (Aston- Jones et al, 1991k). Additional research on studies of NE in the dentate gyrus support a role for the LC in promoting both short- and long-term enhancement of responses to complex sensory inputs and are consistent with a role for the LC in memorial as well as attentional processes (Harley, 1988k). NE applied exogenously or released endogenously can initiate both a short- and a long-term potentiation (LTP) of the dentate gyrus.
Studies dealing with the effects of the neurokinin substance P (SP) and its N- and C-terminal fragments on memory, reinforcement, and brain metabolism. It was shown that Sp, when applied peripherally, promotes memory and is reinforcing. Most important, however, is the finding that these effects seemed to be encoded by different SP sequences, since the N-terminal SP1-7 enhanced memory, whereas C-hepta- and hexapeptidsequences of SP proved to be reinforcing in a dose equimolar to SP. These differential behavioral effects were paralleled by selective and site-specific changes in DA activity, as both SP and its C-, but not N-terminus, increased DA in the nucleus accumbens (Nac), but not in the neo-striatum. These results show that the reinforcing action of peripheral administered SP may be mediated by its C-terminal sequence, and that this effect could be related to DA activity in the NAC (Huston et al, 1991 k).
In terms of dopaminergic activity, previous research has shown that bromocriptine, a D2 dopamine receptor agonist, can have a beneficial effect on visual- spatial working memory functions in normal human subjects (Kimberg et al, 1997). This form of memory, in which some aspect of a stimulus is maintained over a short interval of time, has also been found to be closely tied to prefrontal cortical function in both lesion and single unit recording studies with monkeys and in neuro-imaging studies in humans (Goldman et al, 1987k; Jonidas et al, 1993). A selective positive effect of bromocryptine, in reducing release rates in alcoholics as a function of dopamine D2 receptor genotype (Lawford, et al, 1995) has also been reported. In addition, it has been demonstrated a direct effect of dopamine antagonists on delay period activity of neurons in monkeys performing memory tasks (Williams et al, 1995k). Phentermine, a dopamine releaser, has been implicated in weight loss (Weintramb et fl/., 1992).
Moreover, pharmacological manipulation of brain dopamine concentration effects visual-spatial working memory in humans and in animals, the later effects localized to the prefrontal cortex. However, the effects of dopamine agonists on humans are still poorly understood. It has been hypothesized that bromocriptine would have an effect on cognitive functions associated with the prefrontal cortex via its effects on cortical dopamine receptors and on sub-cortical receptors in areas that project to the neocortex (Kimberg et al, 1997). They found that the effects of bromocriptine on young normal subjects depended on the subject's working memory capacity. High-capacity subjects performed more poorly on the drug, while low- capacity subjects improved. These results demonstrate an empirical link between a dopamine-mediated working memory system and higher cognitive function in humans. It has been shown that the DRD2 Al allele is also associated with visual- spacial memory deficits as well (Berman et al, 1995k).
A double-blind study demonstrated that a D2 agonist bromocryptine or a placebo administered to alcoholics who were carriers of the Al allele (Al/Nl and A1/A2 genotypes), or who only carried the A2 allele (A2/A2) reduced craving and anxiety among the Al carriers who were treated with bromocryptine. The attrition rate was highest among the Al carriers who were treated with placebo. The bromocryptine effect on the Al carriers was much more robust as one approached the six wk period of treatment. Dopamine D2 agonist bromocryptine can improve higher- level cognitive functions. Studies using sophisticated techniques in animals, including microdialysis measurements, have demonstrated changes in neurotransmitter output following precursor amino acid loading (Hernandez et al, 1988). In addition, behavioral changes have been demonstrated in animals following systemic and direct central nervous system delivery of precursor amino acids (Blum et al, 1972). While certain L-amino acids are neurotransmitter and neuromodulator precursors, their racemates, the D-amino acids also have biological activity. In particular, D-phenylalanine, D- leucine. other D-amino acids as well as certain metabolites {e.g., hydrocinnamic acid) decrease the degradation of opioid peptides which are central to regulation of mood and behavior (Blum et al, 1977; Delia Bella et al, 1980).
In some individuals scientists have described a phenylalanine deficiency (PHD) (Lou, 1994k). In this regard, phenylalanine and tyrosine constitute the two initial steps in the biosynthesis of dopamine, which, in its turn, is the metabolic precursor of NE. The extracellular phenylalanine concentration influences brain function in PHD by decreased dopamine synthesis. It has been shown to induce EEG slowing and has prolonged the performance time on neuropsychological tests. The tyrosine concentration in the CNS is reduced in PHD, possibly implying an insufficient substrate of tyrosine for catecholamine synthesis due to competition inhibition, for instance across the blood brain barrier. In experimental studies it has been shown that the synthesis and release of dopamine can be influenced by an increase in the availability of tyrosine. In PHD an extra dietary intake of three doses of tyrosine (160 mg/kg/24 h) induced a shortening of reaction time and decreased variability and in a double-blind, crossover study a similar dose has been reported to induce an improvement on psychological tests, while lower doses failed.
A combination of precursor amino acids having enkephalinase inhibition activity may be used for the treatment of cocaine dependence (U. S. Patent No. 5,189,064). It is known that acute use of cocaine can improve certain aspects of brain electrophysiological dysfunction (Maurer et al, 1988k). Chronic cocaine abuse alters attentional processing (Noldy et al, 1990k). It is known that acute use of cocaine can improve certain aspects of brain electrophysiological dysfunction (Jonsson et al, 1996). However, paradoxically, chronic cocaine abuse alters attentional processing (Braverman and Blum, 1996). Although still controversial, attentional processing has been shown to be dependent on biogenic amine regulation (Lyoo et al, 1996).
Obesity and Neurological Functions Obesity generally is defined as being 20% or more over ideal body weight. Numerous methods of weight reduction have been attempted including hypocaloric balanced diets, "fad" diets, behavior modification, drugs {i.e. D-phenflouramine, phenteramine, etc.), surgery, total starvation, jaw wiring, and combinations of these methods. Most of these are short- term approaches to the problem and have been only transiently effective and some can even pose serious danger (Lockwood and Amatruda, 1984). Even if weight loss is demonstrated in the short-term, the weight usually is regained following discontinuation of the weight-loss regiment. Despite the fact that about 28% of the American population is obese, obesity is widely perceived as a food-addiction, a self- imposed condition with cosmetic rather than health indications (Krai et al, 1989; Weintraub and Bray, 1989).
An understanding is emerging from recent studies of some of the causes of obesity and the difficulties of treating this condition. Studies of twins among the Pima Indians have substantiated a strong genetic basis for obesity (Bouchard, 1989; Stunkard et al, 1990). Obesity is a heterogeneous and prevalent disorder which has both genetic and environmental components. The relationship between macro selection of various foods and familial substance use disorder (SUD) has been documented throughout the literature and neurochemical studies have supported the commonality of reinforcement through dopaminergic systems by alcohol, nicotine, cocaine, and carbohydrates (Nobel, 1998; DiChiara, 1988). In this regard, both obesity and SUD can be considered appetitive compulsions. Some genes such as the dopamine D2 receptor (DRD2), and dopamine transporter (DATl) genes may be a risk factor not only for obesity (Noble et al, 1994; Comings et al, 1993; Blum et al, 1995a) but also for SUDs in general and other psychiatric disorders (Noble et al, 1994; Smith et al, 1992; Comings, 1994; Blum et al, 1995b; Comings et al, 1996; Cook et al, 1995). Additionally, the cloning and sequencing of the mouse ob gene and its human OB homologue raised hopes that defects in this gene may play a significant role in the cause of obesity in man and that Leptin, its gene product, would be useful in treatment (Zhang et al, 1994; Peileymounter et al, 1995). While genetic effects can act alone, in most cases the genetic profile only sets the stage defining the opportunity for a genetic-environmental interaction {i.e. dramatic increase in weight when coupled with increased food). For persons with such a genetic risk profile, obesity is a life-long condition requiring long term therapy as in other chronic diseases.
The specific causes of uncontrollable ingestive behavior for alcohol, drugs, and food (in particular, carbohydrates) are incompletely understood. Nevertheless, it is clear that these appetitive compulsive behaviors are a product of genetic predisposition and environmental insult factors. Numerous studies have implicated the interaction of opiates, opioid peptides, CCK-8, glycogen, DA, and insulin in glucose utilization and selective intake of carbohydrates (Morley and Levine. 1988; Moore et al, 1982; Morley et al, 1985; Riviere and Bueno, 1987). The primary neurotransmitters involved in eating behavior include the monoamines dopamine (DA), norepinephrine (Ne), epinephrine (EPI), and serotonin (5-HT); the inhibitory neurotransmitter gamma-aminobutyric (GABA); and a variety of neuropeptides such as the pancreatic polypeptides, opioid peptides, hormone-releasing factors, and various gut-brain peptides (for reviews see Cooper et al, 1988; Gosnell, 1987; Bouchard, 1994). There is extensive evidence for the role of a number of brain monoamines and neuropeptides in the control of normal eating behavior operating in concert at the mesolimbic reward system (Leibowitz and Hor, 1982). Analyses of cerebrospinal fluid in both humans and animals indicate specific disturbances in brain neurochemical function in association with abnormal eating patterns (Kaye et al, 1985; Kaye et al, 1984).
A study of overeaters demonstrated that study subjects taking a variant of PHENCAL™, which is a dietary supplement containing amino acid precursors, lost an average of 27 lbs in 90 days compared to 10 lbs lost in the control group (Blum, 1990). Finding that PHENCAL™ or other similar neuronutrients, (Blum et al, 1988c; Blum and Trachtenberg, 1988; Cold, 1996) with alcoholics, polydrug abusers, heroin abusers, and cocaine-dependent individuals facilitates recovery and further indicates a common mode of treatment for addiction to these diverse substances (Blum et al, 1996; Blum et al, 1997).
The Role of Nicotine Nicotine also releases dopamine, and nicotine has been found to improve memory performance in a variety of tests in rats, monkeys, and humans (DiChiara et al, 1988). Nicotine in a dose dependent fashion reduced incorrect responding on discrimination behavior in rats (Geller et al, 1970). This effect was similar to chlordiazepoxide but could not be mimicked by the stimulant caffeine (Geller et al, 1970). Nicotine, in the form of gum or skin patches (Sanberg et al, 1988; McConville et al, 1992; Sanberg et al, 1997) has been shown to be effective in the treatment of tics in some subjects with Tourette syndrome (TS), and cigarette smoking has been reported to enhance attention, arousal, learning and memory (Wesnes and Warburton, 1984; Warburton, 1992; Balfour and Fagerstrδm, 1996) and to improve the symptoms of ADHD (Coger et al, 1996; Conners et al, 1996; Levin et al, 1996).
It has been reported a placebo-controlled double-blind study to determine the effect of using nicotine in the treatment of adults with ADHD (Levime et al, 1996; Conners et al, 1996). Of the 17 subjects, 6 were smokers and 1 1 were nonsmokers. All meet DSM-IV criteria for adult ADHD. The drug was delivered via a transdermal patch at a dosage of 7 mg/day for nonsmokers and 21 mg/day for smokers. Active and placebo patches were given in a counter-balanced order approximately 1 wk apart. Nicotine caused a significant overall improvement on the Clinical Global Impressions (CGI) scale. This effect was significant even when only the nonsmokers were considered, which indicated that it was not due merely to relief of withdrawal from regular smoking. Nicotine caused significantly increased vigor as measured by the Profile of Mood States (POMS) test, and an overall significant reduction in reaction time on Continuous Performance Test. There was also a significant reduction in indices of inattention. Nicotine improved accuracy of time estimation and lowered variability of time-estimation response curves. Since smoking is significantly more common in adults with ADHD than those without ADHD (Conners et al, 1996). Interactions of nicotinic systems with dopamine systems may be important for this effect. A series of studies of nicotinic agonist and antagonist interactions with dopamine systems was conducted using rats in a win-shift working memory task in the radial-arm maze (Levin and Rose, 1995k). The working memory deficit caused by the nicotinic antagonist mecamylamine was potentiated by the D1/D2 DA antagonists haloperidol and the specific D2 antagonist raclopride. In contrast, the mecamylamine- induced deficit was reversed by co-administration of the D2/D3 agonist quinpirole. Nicotine also has significant interactions with dopamine drugs with regard to working memory performance in the radial-arm maze. The dopamine agonist pergolide did not by itself improve radial-arm choice accuracy. Nicotine was effective in reversing this deficit. When given together with nicotine, the D2/D3 agonist quinpirole improved RAM choice accuracy relative to either drug alone. Acute local infusion of mecamylamine to the midbrain dopamine nuclei effectively impairs working memory function in the radial-arm (Noble et al, 1998).
The Role of Chromium Salts (CrP and CrN) Trivalent chromium is a mineral essential for normal insulin function (Jeejeehboy et al, 1977; Schwartz et al, 1959). Some but not all previous research suggests that chromium supplementation may favorably alter risk factors for coronary artery disease (CAD) and non-insulin- dependent diabetes mellitus (NIDDM)( Abraham et al, 1992; Anderson et al, 1991 ; Donaldson et al, 1985; Glinsmann et al, 1966; Kaats et al, 1991 ; Levine et al, 1968; Page et al, 1991; Press et al, 1990; Roeback et al, 1991). Chromium is thought to cause these changes via its potentiating effect on insulin (Offenbacher et al, 1988).
Animal studies have supported the contention that CrP can lower insulin resistance and improve body composition (Liarn et al. 1993), one human study found positive changes in body composition with CrP supplements (Hasten et al, 1992), another reported positive, although not statistically significant changes in body composition (Hallmark et al, 1993), and a third failed to find any positive changes in body composition with CrP supplementation (Clancey et al, 1994). CrP supplementation has been indicated to improve body composition, particularly in the reduction of excess body fat (Page et al, 1992). However, previous work observing concurrent chromium supplementation and exercise training has been restricted to effects on body weight and composition, with conflicting results (Clancy et al, 1994; Evans et al, 1989; Evans et al, 1993; Hallmark et al, 1996; Hasten et al, 1992).
While there still is controversy regarding the effects of chromium salts (picolinate and nicotinate) on body composition and weight loss in general (Abraham et al, 1992; Anderson, 1995; Hallmark et al, 1993; Clancy et al, 1994; Bulbulian et al, 1996), some reports seem to support the positive change in body composition in humans (Kaats et al, 1996). In contrast, (Grant, et al, 1997; Bulbulian et al, 1996) reported weight gain with chromium picolinate with or without exercise in humans, while showing positive effects for the nicotinate salt in the same population (Kaats et al, 1992).
Chromium Picolinate (CrP) is the most heavily used, studied and promoted chromium compound, but in vitro work suggests that chromium nicotinate may be also viable in the area of weight loss and changes in body composition. Previous research has shown chromium picolinate supplementation decreasing fat mass and increasing fat- free mass (Kaats et al, 1991 ; Page et al, 1991). Pervious studies of exercise training have shown increases in fat free mass as well (Stefanick, 1993). Although studies with young men (Evans, 1989) and women (Hasten et al, 1992) suggest that combining exercise training with chromium picolinate supplementation increases the body composition changes that occur with exercise training, this finding has not been confirmed (Clancy et al, 1994; Hallmark et al, 1996). It has been reported that the nicotinate salt (CrN) may be even more important than the picolinate salt (Grant et al, 1997).
Nutritional Supplements in Treatment of Behavioral Disorders Perturbation of neurotransmitter actions may underlay a variety of psychiatric and behavioral disorders (Blum et al, 1996c; Persico and Uhl, 1997; Noble et al, 1991). Specifically, anomalous regulation of dopamine, serotonin, norepinephrine, gammaminobutyric acid (GABA), glutamine, and the opioid peptides are thought to play crucial roles in the addictive disorders, particularly those involving alcohol and cocaine abuse (Pohjalainen et al, 1996). Consequently, these observations have provided momentum to the idea that ingestion of selected nutrients could affect mood and therefore behavior in humans. While nutritional strategies have been employed in the past (Grandy et al, 1989), demonstrations of effectiveness have been decidedly limited. A substantive effect of a combination of amino acid precursors and enkephalinase inhibitors on recovery from certain RDS behaviors including alcohol, cocaine, and overeating have been indicated (Noble et al, 1993; Noble et al, 1994; Blum et al, 1994; Balldin et al, 1993; Duffy et al, 1994; American Psychiatric Association Task Force, 1991 , U.S. Patent No. 5,189,064).
Polygenic Analysis of Genes involved in Psychiatric and Other Polygenic Traits It has been hypothesized that psychiatric behaviors share genes in common and that once the dopamine-serotonin and other neurotransmitter balance is upset, the resulting brain dysfunction can result in a wide range of different behaviors (Comings,
1990a; Comings and Comings, 1991a; Winokur et al, 1970; Comings, 1994b;
Comings, 1995b). Others have supported the proposal that personality traits may have distinct neurochemical and genetic substrates mediated by genetic variability in dopamine transmission as well as other neurotransmitters (Cloninger, 1983;
Benjamin, et al, 1996, Epstein et al, 1996, Cloninger, 1991). The molecular genetic studies of the DRD2, DβH, DAT (Comings et al. 1996a), and clinical genetic studies
(Comings 1994b; Comings 1994c; Comings 1995b; Biederman et al, 1991 ; Comings and Comings 1987), indicate ADHD, Tourette's syndrome, conduct disorder, ODD. dyslexia, learning disorders, stuttering, drug dependence and alcoholism are etiologically related spectrum disorders, with male predominance.
In the past two decades a large proportion ofthe genes for these disorders have been identified, localized, cloned, and sequenced. As the number of such genes remaining to be identified has decreased there has been an increased interest in the more common polygenic disorders. It has often been suggested that the genes involved in these disorders will be far more difficult to identify. This difficulty is well illustrated by the psychiatric disorders. Despite large numbers of linkage studies of manic-depressive disorder, schizophrenia, Tourette syndrome, panic disorder, autism, and others, with the possible exception of bipolar disorder (Risch and Botstein, 1996), there have been few replicated findings. Many of the efforts to find the genes in complex disorders have simply attempted to force feed the single-gene single-disease model into service for polygenic disorders by using lod score analysis, other family based forms of linkage analyses, or the haplotype-relative risk technique (Falk and Rubinstein, 1987). Presently the most popular method used to identify the genes in complex disorders consists of whole genome screening of affected sib pairs. Non-parametric approaches to linkage (Weeks and Lange, 1988) are better suited to complex inheritance (but see Greenberg et al, 1996). However, when a given gene accounts for less than 8% of the variance, a large number of parent-child sets or sib- pairs must be examined (Carey and Williamson, 1991).
There has been an increased recognition that only association studies may have the power to identify genes with small contributions to the percent of variance of a given polygenic trait (Risch and Merikangas. 1996; Collins et al, 1997). Association studies, comparing the frequency of the mutant candidate genes in severely affected probands to totally unrelated, ethnically matched controls that are free of the disease, can identify these small effects (Weeks and Lathrop, 1995; Comings, 1996; Owen and McGuffin, 1993). The additive effect of the DRD2, DβH and DAT genes (Comings et al, 1996j), the DRDl and DRD2 genes (Comings et al, 1997a), the OB and DRD2 genes (Comings et al, 1996d), and other gene combinations genes in TS, ADHD, conduct disorders, stuttering, and related behaviors has been examined. In TS syndrome it has been found that identifying a role of three dopaminergic genes (DRD2, DβH and DATl) was best determined by an examination of a relatively large number of TS subjects, their relatives and controls, suggesting that TS and related disorders are polygenically inherited and that each gene contributes only a small percent ofthe variance of any behavior score (Comings et al, 1996a; Comings 1996b; Comings et al, 1996d; Comings 1996c).
Most psychiatric disorders are polygenic (Comings, 1996b) and that each gene accounts for less than 10%> and usually less than 5% of the variance of a given behavioral variable. In both studies, the strength ofthe associations was increased by the examination of the additive effect of more than one gene. One of the major impediments to the wider use of association studies is the lack of availability of suitable polymoφhisms at or near the many candidate genes that have been cloned and sequenced (Comings, 1994). However, even when this technique or classical linkage techniques are used, positive findings from one group of investigators are often not replicated in subsequent studies (Egeland et al, 1987; Kelsoe et al, 1989; Blum et al, 1990; Bolos et al, 1990). This technique can also produce false positives due to population stratification, however, this can be minimized using the haplotype relative risk procedure (Falk and Rubinstein, 1987) with large numbers of subjects (Comings, 1995). The small size of these effects, and the difficulties in replication have led to a feeling of pessimism about whether it will be possible to identify the genes involved in polygenic disorders (Moldin, 1997).
SUMMARY OF THE INVENTION
In the United States alone there are 18 million alcoholics, 28 million children of alcoholics, 6 million cocaine addicts, 14.9 million people who abuse other substances. 25 million people addicted to nicotine, 54 million people who are at least 20% overweight, 3.5 million school-age children with ADHD or Tourette's syndrome, and about 3.7 million compulsive gamblers. The inventors believe that genotyping humans for the alleles of the DRD2 gene as well as other genes related to psychological disorders in the present invention is indeed the first step toward rational treatment for a devastating problem in society.
The invention first provides a composition for the treatment of Reward Deficiency Syndrome (RDS) behaviors in a subject. In certain aspects, this composition includes at least one of the following components: an opiate destruction- inhibiting amount of at least one substance which inhibits the enzymatic destruction of a neuropeptidyl opiate, the substance being either amino acids, peptides. and structural analogues or derivatives thereof; a neurotransmitter synthesis-promoting amount of at least one neurotransmitter precursor, the neurotransmitter precursor being either a dopamine precursor such as L-Tyr, L-Phe and L-dopa, a serotonin precursor such as L-Tφ and 5-hydroxytryptophan, or a gamma amino butyric acid (GABA) precursor such as L-glutamine, L-glutamic acid, and L-glutamate; a tryptophan concentration enhancing amount of chromium picolinate or chromium nicotinate; a compound that releases enkephaline, the enkephaline releaser being, but not limited to, a peptide, and preferably a D-amino acid containing peptide; or an opiate antagonist amount of at least one compound which blocks the effects of an opiate at either the delta, mu, kappa, sigma, or epsilon receptors. The type of enkephalinase inhibitors, the neurotransmitter precursor, opiate destruction-inhibiting substance, opiate antagonist, and/or the chromium compound, in addition to the compounds specifically listed above, are further described herein this application and are encompassed by this invention. In certain preferred aspects of the invention, the composition is used in preventing or reducing a subject's unwanted weight. In certain other aspects of the invention, the composition is preferably used in the treatment of Attention Deficits disorder, attentional processing or memory. In this embodiment, for the treatment of Attention Deficits disorder, attention-deficit-hyperactivity disorder (ADHD) attentional processing or memory, the composition more preferably includes a neurotransmitter synthesis-promoting amount of at least one neurotransmitter synthesis promoting substance selected from the group Rhodila or hubazine. As used herein "derivative" may refer to a chemically modified compound, and "analog" refers to a different compound that is similar properties or structure to the compound it is being compared.
In certain aspects of the invention, this composition may be used in the treatment of all RDS related behaviors disclosed herein. RDS behaviors are those behaviors related to a chemical imbalance manifests itself as one or more behavioral disorders related to an individual's feeling of well-being with anxiety, anger or a craving for a substance. RDS behaviors include, alcoholism, SUD, smoking, BMI or obesity, pathological gambling, carbohydrate bingeing, axis 1 1 diagnosis, SAB, ADD/ADHD, CD, TS, family history of SUD, and Obesity, are described herein.
The invention also provides a method of treating a subject for RDS behaviors, including but not limited to SUD, Obesity, Smoking, Tourettes Syndrome, ADHD, Schizoid/Avoidant Behavior, Aggression, Posttraumatic stress syndrome, PMS or tobacco use. RDS behaviors are not specifically limited to these disorders, as many types of sub-disorders are encompassed by these conditions. For example, attention deficit hyperactivity disorder (ADHD) may manifest itself as alcohol, drugs, obsessive compulsive behaviors, learning disorders, reading problems, gambling, manic symptoms, phobias, panic attacks, oppositional defiant behavior, conduct disorder, academic problems in grade school, smoking, sexual behaviors, schizoid, somatization, depression, sleep disorders, general anxiety, stuttering, and tics disorders. All these behaviors, and others described herein as associated with RDS behaviors or genes involved in the neurological pathways related to RDS, are included as RDS behaviors as part of this invention. Additionally, many of the clinical terms used herein for many specific disorders that are RDS disorders are found in the Quick Reference to the Diagnostic Criteria From DSM-IV™, The American Psychiatric Association, Washington, D.C., 1994, 358 pages. Specific disorders whose definitions can be found in this reference, and their code numbers within the DSM- IV™ include Anxiety disorders, include Panic Disorder Without Agoraphobia, 300.01, Panic Disorder With Agoraphobia, 300.21, Agoraphobia Without History of Panic Disorder, 300.22, Specific Phobia. 300.29, Social Phobia, 300.23, Obsessive- Compulsive Disorder, 300.3, Posttraumatic Stress Disorder, 309.81, Acute Stress Disorder, 308.3, Generalized Anxiety Disorder, 300.02, Overanxious Disorder of Childhood, 300.02. Anxiety Disorder Due to [Indicate general medical condition], 293.89, Substance Induced Anxiety Disorder, 293.89, Anxiety Disorder NOS, 300.00; Attention Deficit and Disruptive Behavior Disorders, including Attention- Deficit/Hyperactivity Disorder, Predominately Inattentive Type, 314.00, Attention- Deficit/Hyperactivity Disorder, Predominately Hyperactivity-Impulsive Type, 314.01 Attention-Deficit/Hyperactivity Disorder, Combined Type, 314.01, Attention-Defi- cit Hyperactivity Disorder NOS, 314.9, Conduct Disorder, 312.8 Oppositional Defiant Disorder, 313.81, Disruptive Behavior Disorder NOS, 312.9; Bipolar Disorders including Bipolar I Disorder, 296.0x, 296.40, 296.4x, 296.6x, 296.5x, and 296.7, Bipolar II Disorder, 296.89, Cyclothymic Disorder, 301.13, Bipolar Disorder NOS, 296.80; Depressive Disorders including Major Depressive Disorder, Recurrent, 296.3, Dysthymic Disorder, 300.4, Depressive Disorder NOS, 31 1, Major Depressive Disorder, Single Episode, 296.2; Eating Disorders including Bulimia Nervosa, Nonpurging Type, 307.51, Bulimia Nervosa, Purging Type, 307.51, Anorexia Nervosa, 307.1, Eating Disorder NOS 307.50; Impulse Control Disorders including Intermittent Explosive Disorder, 312.34, Kleptomania, 312.32, Pyromania, 312.23, Pathological Gambling, 312.31, Trichotillomania, 312.39, Impulse Control Disorder NOS, 312.30; Personality Disorders including Antisocial Personality Disorder. 301.7, Avoidant Personality Disorder, 301.82, Obsessive-Compulsive Personality Disorder, 301.4 , Schizoid Personality Disorder, 301.20; Schizophrenia including Paranoid Type, 295.30, Disorganized Type, 295.10, Catatonic Type, 295.20, Undifferentiated Type, 295.90, Residual Type, 295.60. Schizoaffective Disorder, 295.70, Schizophreniform Disorder. 295.40; Sleep Disorders including Primary Sleep Disorders such as Dyssomnias which include Primary Insomnia 307.42, Primary Hypersomnia 307.44, Narcolepsy 347, Circadian Rhythm Sleep Disorder, 307.45, Dyssomnia NOS 307.47, Parasomnias which include Nightmare Disorder 307.47, Sleep Terror Disorder 307.46, Sleepwalking Disorder 307.46, Parasomnia NOS 307.47, Sleep Disorders Related to Another Mental Disorder which include
Insomnia Related to [Indicate Axis I or Axis II disorder] 307.42, Hypersomnia Related to [Indicate Axis I or Axis II disorder] 307.44, Other Sleep Disorders which include Sleep Disorder Due to [Indicate the General Medical Condition] 780.xx, Substance Induced Sleep Disorder 780. xx; Substance Use Disorders including Alcohol Related Disorders such as Alcohol-Induced Psychotic Disorder, with delusions, 291.5, Alcohol Abuse, 305.00, Alcohol Intoxication, 303.00, Alcohol Withdrawal, 291.8, Alcohol Intoxication Delirium, 291.0, Alcohol Withdrawal Delirium, 291.0, Alcohol-Induced Persisting Dementia, 291.2, Alcohol-Induced Persisting Amnestic Disorder, 291.1, Alcohol Dependence, 303.90, Alcohol-Induced Psychotic Disorder, with hallucinations, 291.3, Alcohol-Induced Mood Disorder, 291.8, Alcohol-Induced Anxiety Disorder, 291.8, Alcohol-Induced Sexual Dysfunction, 291.8, Alcohol-Induced Sleep Disorder, 291.8, Alcohol-Related Disorder NOS, 291.9, Alcohol Intoxication, 303.00, Alcohol Withdrawal, 291.8, Nicotine Related Disorders which include Nicotine Dependence, 305.10, Nicotine Withdrawal, 292.0, Nicotine-Related Disorder NOS, 292.9, Amphetamine Related Disorders which include Amphetamine Dependence, 304.40, Amphetamine Abuse, 305.70, Amphetamine Intoxication, 292.89, Amphetamine Withdrawal, 292.0, Amphetamine Intoxication Delirium, 292.81, Amphetamine-Induced Psychotic Disorder with delusions, 292.11, Amphetamine-Induced Psychotic Disorders with hallucinations, 292.12, Amphetamine-Induced Mood Disorder, 292.84, Amphetamine-Induced Anxiety Disorder, 292.89, Amphetamine-Induced Sexual Dysfunction, 292.89, Amphetamine-Induced Sleep Disorder, 292.89, Amphetamine Related Disorder NOS, 292.9, Amphetamine Intoxication, 292.89, Amphetamine Withdrawal, 292.0, Cannabis Related Disorders which include Cannabis Dependence, 304.30, Cannabis Abuse, 305.20, Cannabis Intoxication, 292.89, Cannabis Intoxication Delirium, 292.81. Cannabis-Induced Psychotic Disorder, with delusions,
292.11 , Cannabis-Induced Psychotic Disorder with hallucinations, 292.12, Cannabis- Induced Anxiety Disorder, 292.89, Cannabis Related Disorder NOS, 292.9, Cannabis Intoxication, 292.89, Cocaine Related Disorders which include Cocaine Dependence, 304.20, Cocaine Abuse, 305.60, Cocaine Intoxication. 292.89, Cocaine Withdrawal, 292.0, Cocaine Intoxication Delirium, 292.81 , Cocaine-Induced Psychotic Disorder with delusions, 292.1 1, Cocaine-Induced Psychotic Disorders with hallucinations,
292.12, Cocaine-Induced Mood Disorder, 292.84, Cocaine-Induced Anxiety Disorder, 292.89, Cocaine-Induced Sexual Dysfunction, 292.89. Cocaine-Induced Sleep Disorder, 292.89, Cocaine Related Disorder NOS, 292.9, Cocaine Intoxication, 292.89, Cocaine Withdrawal, 292.0; Hallucinogen Use Disorders which include Hallucinogen Dependence, 304.50, Hallucinogen Abuse, 305.30, Hallucinogen Intoxication, 292.89, Hallucinogen Withdrawal, 292.0, Hallucinogen Intoxication Delirium, 292.81, Hallucinogen-Induced Psychotic Disorder with delusions, 292.1 1, Hallucinogen-Induced Psychotic Disorders with hallucinations, 292.12, Hallucinogen- Induced Mood Disorder, 292.84, Hallucinogen-Induced Anxiety Disorder, 292.89, Hallucinogen-Induced Sexual Dysfunction, 292.89, Hallucinogen-Induced Sleep Disorder, 292.89, Hallucinogen Related Disorder NOS, 292.9, Hallucinogen Intoxication, 292.89, Hallucinogen Persisting Perception Disorder (Flashbacks), 292.89; Inhalant Related Disorders which include Inhalant Dependence, 304.60, Inhalant Abuse, 305.90, Inhalant Intoxication, 292.89, Inhalant Intoxication Delirium, 292.81, Inhalant-Induced Psychotic Disorder, with delusions, 292.11, Inhalant- Induced Psychotic Disorder with hallucinations, 292.12, Inhalant-Induced Anxiety Disorder, 292.89, Inhalant Related Disorder NOS, 292.9, Inhalant Intoxication, 292.89; Opioid Related Disorders which include Opioid Dependence, 304.00. Opioid Abuse, 305.50, Opioid Intoxication, 292.89, Opioid Intoxication Delirium, 292.81, Opioid-Induced Psychotic Disorder, with delusions, 292.11, Opioid-Induced Psychotic Disorder with hallucinations, 292.12, Opioid-Induced Anxiety Disorder, 292.89, Opioid Related Disorder NOS, 292.9, Opioid Intoxication, 292.89, Opioid Withdrawal, 292.0; Polysubstance Related Disorders which include Polysubstance Dependence, 304.80; Tic Disorders which include Tourette's Disorder, 307.23, Chronic Motor or Vocal Tic Disorder 307.22, Transient Tic Disorder 307.21, Tic Disorder NOS 307.20, Stuttering 307.0, Autistic Disorder, 299.00, and Somatization Disorder 300.81. Additionally, other RDS disorders are defined as would be known to one of skill in the art, such as Novelty Seeking, defined in (Clonigen et al, 1993). Other disorders, if not specifically defined herein, are the same as commonly known to one of skill in the art, including common abbreviations.
In certain aspects of the invention, the amount of each of the above mentioned compounds administered daily for use in the treatment of RDS behaviors or disorders may be of about 1, about 2, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 1 1, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24. about 25, about 26, about 27, about 28, about 29, about 30, about 31 , about 32, about 33, about 34, about 35, about 36, about 37, about 38, about 39, about 40. about 41, about 42, about 43, about 44, about 45, about 46, about 47, about 48, about 49, about 50, about 55, about 60, about 65, about 70, about 80, about 90, about 100, about 1 10, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200, about 220, about 240, about 260, about 280, about 300, about 325, about 350, about 375, about 400, about 425, about 450, about 475, about 500, about 550, about 600, about 650, about 700, about 725, about 750, about 775, about 800, about 825, about 850, about 875, about 900, about 925, about 950, about 975, about 1 ,000, about 1,100, about 1,200, about 1,300, about 1,400, about 1,500, about 1,600, about 1,700, about 1,800, about 1,900, about 2,000, about 2,100, about 2,200, about 2,300, about 2,400, about 2.500, about 2,600, about 2,700, about 2,800, about 2,900, about 3,000, about 3,250, about 3,500, about 3,750, about 4,000, about 4,250, about 4,500, about 4,750, about 5,000, about 5,250, about 5,500, about 5,750, about 6,000, about 6,250, about 6,500, about 6,750, about 7,000, about 7,250, about 7,500, about 7,750, about 8,000, about 8,250, about 8,500, about 8,750, about 9,000, about 9,250, about 9,500, about 9,750, about 10,000, about 11,000, about 12,000, about 13,000, about 14,000, about 15,000, about 16,000, about 17,000, about 18,000, about 19,000, about 20,000, about 21,000, about 22,000, about 23,000, about 24,000. about 25,000, about 26,000, about 27,000, about 28,000, about 29,000, about 30,000 mg or more. Additionally, all amounts within the above specified ranges, though not specifically listed, may be used and are encompassed by the invention. For example, ranges of about 4,751, about 4,752, about 4,753 mg etc. may be used in the invention, though not listed specifically in the preceding sentences.
In certain embodiments of the invention, wherein the RDS behavior is Obesity, the preferred ranges and components of the composition are 460 mg DL- phenylalanine, 25 mg L-tryptophan, 25 mg L-glutamine, and 5 mg pyridoxal -5'- phosphate administered daily. In other preferred aspects of this embodiment, the subject is tested using the methods disclosed herein or known to one of skill in the art to determine whether the subject has a family history of chemical dependency, wherein the family history indicates an improved likelihood for successful treatment. In other aspects of this embodiment, the treatment inhibits binge eating. In other aspects of the invention, the treatment inhibits craving. In preferred aspects, the composition contains chromium salts.
It is part of the invention that a subject is tested using a molecular biology assay, as described herein, for an allele associated with an RDS or psychological behavior, and the presence of such an diagnostic allele is indicative a subject more likely to respond positively to the compositions disclosed herein for therapy. In preferred aspects of this embodiment, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one ofthe following alleles: D2 Taql Al, BI, Cl or exon " haplotype HTR2A - C allele homozygous OB - homozygosity for < 208 BP alleles of 1875 dinucleotide repeat polymoφhism human chromosome 2 microsatellite polymoφhism, APO-D - Taql 2.2 or 2.7 BP, or OB gene D7S1875, where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment. In other preferred aspects of this embodiment, the composition includes an effective amount of chromium nicotinate, and the subject is tested for the presence of the DRD2 Al allele, wherein the presence of the DRD2 Al allele indicates an improved likelihood of response using the treatment. In other preferred aspects of this embodiment, the composition includes an effective amount of chromium picolinate, and the subject is tested for the presence of the DRD2 A2 allele, wherein the presence of the DRD2 Al allele indicates an improved likelihood of response using the treatment.
In one embodiment of the invention, wherein the RDS behavior is tobacco usage, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles: DI (homozygosity of Dde Al) D2 {Taql Al) D4 (VNTR 2) D5 (dinucleotide 13 alleles range 135-159 BP) DATl VNTR (10/10) DβH {Taql BI allele), where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
In another embodiment of the invention, wherein the RDS behavior further includes Autism, Tourette's Syndrome or ADHD, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles: DI (homozygosity of Dde Al) D2 {Taql 1) D4 (VNTR 2) D5 (dinucleotide 13 alleles range 135-159 BP) DATl VNTR (10/10) DβH {Taql BI allele) MAOA(X), where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment. In certain preferred aspects of this embodiment, the composition includes an effective amount of Rhodila or hubazine.
In one embodiment of the invention, wherein the RDS behavior is Pathological gambling the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles DI (homozygosity of Dde Al) D2 (Taql Al, BI, Cl), where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
In another embodiment of the invention, wherein the RDS behavior further comprises pathological violence, Schizoid/ Avoidant (SAB), Aggression, Anger,
Hostility, or Posttraumatic Stress Disorders, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the following alleles D2 {Taql Al, BI, Cl, exon 6"7) DATl (VNTR 10/10) mNOSIa - homozygosity for < 201 BP, where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
In another embodiment of the invention, wherein the RDS behavior is PMS the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein for the presence of at least one of the alleles from the DATl VNTR (10/10) D2 Taql Al, BI, Cl, exon 6"7 haplotype, or alleles from the DRDl, DRD2, DRD4, HTT, HTRIA, TDO2, DβH, MAO, COMT, GABRAB, GABRB3, PENk, ADRA2A or ADRN2C genes, where detection of the above mentioned alleles indicates an improved likelihood for a successful response to the treatment.
The invention further provides a method of determining a genetic predisposition of a subject to at least one RDS behavior, by detecting at least one allele from the group including, but not limited to the DRDl, DRD2, DRD3, DRD4, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A, ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDAR1, PENK, AR, CRF, HTRlD , HTR2A, HTR2C, interferon-γ, CD8A, or RS7 genes, where the allele is diagnostic for an RDS behavior. In one embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of at least one is a VΝTR polymoφhism of a MAOA gene allele, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including mania, OCD, sexual, sleep, grade school behavior, gambling, learning, inattention, ADHD, ADDR, impulsivity, MDE, CD, hyperactivity, phobia, schizoid behavior, general anxiety, somatization, drugs, IV drugs, read, ODD, tics, alcohol, or tobacco use.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of at least one DRD2 gene A, allele, the DAT gene, VΝTR 10/10 allele, or the DβH gene B, allele, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including schizoid or Avoidant. In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of an increased number of (NAT)n triplet repeats in the CNRl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including Drug Use.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of an increased number of the D7S1873, D7S1875, D7S514 or D7S680 dinucleotide repeats in the OB gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior including obesity, anxiety, depression, psychoses, hostility, paranoid ideation, obsessive-compulsive, symptom total, general symptom index, novelty seeking, overall total, neuroticism and conscientiousness. In this embodiment, it is preferred that the allele is the D7S1875 dinucleotide repeats is greater than 225 bp in length, and this allele is present in both copies of the CNR/ gene. In this embodiment, it is also preferred that another allele detected is the D2AI allele of the DRD2 gene. In this embodiment, it is also preferred that the RDS behavior is obesity.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the D2AI allele of the DRD2 gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including Tourette's Syndrome, manic symptoms, oppositional defiant, sexual, ADHD-R, schizoid, ADHD, tics, major depression, conduct, stuttering, obsessive-compulsive, somatization, alcohol abuse, learning, and sleep problems.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Taq Al allele of the DβH gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an RDS behavior, including Tourette's Syndrome, ADHD, smoking, learn, grade school, ADHD-R, oppositional defiant, tics, mania, alcohol, reading, drug abuse, sleep, stuttering, obsessive compulsive, somatization and major depression. In this embodiment, it is preferred that the alleles detected are the Taq BI allele and the Taq Al allele of the DβH gene, and that the RDS behavior is Tourette's Syndrome.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 10 allele of the DATl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to an Tourette's syndrome, autism, somatization, alcohol, ADΗD-R, major depression, panic, obsessive compulsive, general anxiety, mania, oppositional defiant, sexual, read, and ADHD.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 10 allele of the DATl gene, the Taq Al allele of the DβH gene, or the D2A1 allele of the DRD2 gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to ADHD, stuttering, ADHD-R, oppositional, defiant, tics, conduct, obsessive compulsive, mania, alcohol, general anxiety, panic schizoid, sleep, sexual, drugs, and major depression.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Ddel allele of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to alcohol, smoking, compulsive eating, tics, gambling, drugs, reading, shopping, oppositional defiant, major depressive episode, schizoid, ADHD, conduct disorder, obsessive compulsive, and mania.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Taql Al and the Taql A2 alleles of the DRD2 gene, wherein the presence of those alleles are diagnostic for a subject with a genetic predisposition to oppositional defiant, conduct disorder, eating, smoking, gambling, ADHD, obsessive compulsive, mania, and alcohol. In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 1 1 or the 22 genotype of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to Tourettes syndrome, smoking, and gambling. In this embodiment, it is preferred that the alleles detected are two copies per genome ofthe Ddel allele ofthe DRDl gene.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 1 1 genotype of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to oppositional defiant behavior, conduct disorder, compulsive eating, smoking, gambling, ADHD mania, stuttering, obsessive-compulsive, and schizoid behaviors.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the Ddel allele of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising gambling, smoking, compulsive eating, oppositional defiant, major depressive episode, ADHD, conduct disorder, schizoid, obsessive-compulsive, mania, and alcohol.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the 1 1 or the 22 genotype of the DRDl gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising alcohol, smoking, compulsive eating, tics, gambling, drugs, reading, shopping, gambling, and grade school problems.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the intron 6 G→A polymoφhism of the Tryptophan 2,3 dioxygenase gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising Tourettes Syndrome. In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the intron 6 G— T polymoφhism of the Tryptophan 2,3 dioxygenase gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising ADHD, alcohol dependence, drug dependence, pathological gambling.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the intron 6 DGGE polymoφhism of the Tryptophan 2,3 dioxygenase gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising ADHD, alcohol dependence, drug dependence, pathological gambling, and depression.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the low base pair alleles (<181 bp) polymoφhism of the ADRA2C dinucleotide repeat polymoφhism, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising drug use.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the two high base pair alleles for the >183 bp of the ADRA2C dinucleotide repeat polymoφhism, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising alcohol use.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the two homologous alleles for the presenilin-1 (PSI) polymoφhism. wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising alcohol and tobacco use. In this embodiment, it is preferred that the alleles detected are two homologous alleles of greater than 80 bp of the CA dinucleotide repeat polymoφhism ofthe PENK gene. In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of short GGC alleles of the AR gene, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising CD, ODD, or hyperactivity.
In another embodiment of the invention, the subject is genetically tested, or tested by a molecular biological assay, using the methods disclosed herein, for the presence of the DRD2 allele, wherein the presence of the allele is diagnostic for a subject with a genetic predisposition to comprising Type B behavior in alcoholics, cocaine addicts, or RDS probands.
The invention further provides a method for determining a genetic predisposition to a polygenic trait comprising detecting at least one allele associated from the group comprising the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A. ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDARl, PENK, AR, CRF, DRD3. DRD4. HTR1D , HTR2A, HTR2C, interferon-γ, CD8A, or RS7 genes. In one embodiment of the invention, the polygenic trait is ADHD, and the allele is associated with the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A, ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDARl, PENK, AR, or CRF genes. In another embodiment, the polygenic trait is a lack of susceptibility to ADHD, and the allele is associated with the DRD3, DRD4, HTRJDfi, HTR2A, HTR2C, interferon-γ, CD8A, or RS7 genes.
In another embodiment of the invention, the polygenic trait is OOD, and the allele is associated with the DRDl, DRD2, DRD3, DATl, HTT, HTRIA, HTR2A, HTR2C, DBH, ADRA2A, ADRA2C, MAOA, GABRA3, GABRB3, CNRl, CHRNA4, NMDARl, PENK, AR or CD8A genes.
In one embodiment of the invention, the polygenic trait is tics, and the allele is associated with the DRD7, DRD5, HTRIA, HTRlDβ, HTR2C, TD02, DBH, ADR2C, COMT, GABRA3, CNRl or CHRNA4 genes. In another embodiment of the invention, the polygenic trait is LD, and the allele is associated with the DRD7, HTR2C, TD02. DBH, ADR2A, ADR2C, MAOA, CNRl or CNRA4 genes.
In one embodiment of the invention, the polygenic trait is LDL, and the allele is associated with the HTT, OXYR, DRD2 or PS 1 genes.
In another embodiment of the invention, the polygenic trait is longevity, and the allele is associated with the PS 1 , OXYR or APOE genes.
The invention additionally provides a method for developing a diagnostic, polygenic assay by identifying the trait that is to be studied, creating a scale measuring the severity of the trait to be studied; selecting at least one candidate gene that may contribute to the trait, identify at least one polymoφhism associated with the candidate gene, correlating allelic patterns of the polymoφhism with the scale, and comparing the association of the allelic pattern to the correlation of the candidate gene to the trait. The allelic patterns that are positively associated with the trait are added together, to form a polygenic assay that is diagnostic for a subject's susceptibility to possess polygenic trait. It is also part of the invention that allelic patterns that are negatively associated with the trait are added to form a polygenic assay that is diagnostic for a subject's lack of susceptibility to posses a polygenic trait.
In one embodiment of this invention, the candidate genes include, but are not limited to, the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A,
ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDARl,
PENK, AR, CRF, DRD3, DRD4. HTR1D , HTR2A, HTR2C, interferon-γ, CD8A, or
RS7 genes.
In another embodiment of this invention, the polygenic traits include, but are not limited to ADHD, lack of ADHD, ODD, CD, LD, Tics, Drug Abuse/Dependence,
Smoking, osteoarthritis, elevated cholesterol levels, elevated LDL levels, or longevity.
In one embodiment of this invention, the polygenic assay to ADHD is the detection at least one allele associated with the DRDl, DRD2, DRD5, DATl, HTT, HTRIA, TD02, DBH, ADRA2A, ADRA2C, NET, MAOA, COMT, GABRA3, GABRB3, CNRl, CNRA4, NMDARl. PENK, AR, or CRF genes.
In another embodiment of this invention, the polygenic assay is to a reduced susceptibility to ADHD comprises detecting at least one allele associated with the DRD3, DRD4, H7R/Dβ, HTR2A, HTR2C, interferon-γ, CD8A, or RS7 genes.
In one embodiment of this invention, the polygenic assay to the OOD comprises detecting at least one allele associated with the DRDl, DRD2, DRD3, DATl, HTT, HTRIA, HTR2A, HTR2C, DBH, ADRA2A, ADRA2C, MAOA, GABRA3, GABRB3, CNRl, CHRNA4, NMDARl, PENK, AR or CD8A genes.
In another embodiment of this invention, the polygenic assay to the tics comprises detecting at least one allele associated with the DRDl, DRD5, HTRIA, H7R7Dβ, HTR2C, TD02, DBH, ADR2C, COMT, GABRA3, CNRl or CHRNA4 genes.
In one embodiment of this invention, the polygenic assay to the LD comprises detecting at least one allele associated with the DRD7, HTR2C, TD02, DBH, ADR2A, ADR2C, MAOA, CNRl or CNRA4 genes.
In another embodiment of this invention, polygenic assay to the elevated LDL levels comprises detecting at least one allele associated with the HTT, OXYR, DRD2, or PSI genes.
In one embodiment of this invention, the polygenic assay to the longevity comprises detecting at least one allele associated with the PSI, OXYR or APOE genes.
In another embodiment of this invention, the polygenic assay to the osteoarthritis further comprises detecting at least one allele associated with the COL2A1 , COL2A1, COL2A1, COL9A1, COL9A1, AGC1, IGF1, IGF1, IGF1R,
IGF1R, IGF2, IGF2R, TGFB1, TGFB2, ILIA, IL1B, IL1R1, IL1RN, MMP9, TIMP1 or Vitamin D3 genes. As used herein, it will be understood that the word "a" or "an" or "the" may mean one or more than one.
BRIEF DESCRIPTION OF THE DRAWINGS
The following drawings form part of the present specification and are included to further demonstrate certain aspects of the present invention. The invention may be better understood by reference to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.
FIG. 1. The DRD2 Gene in "Super Controls (Normals)" and Severe "RDS" Probands. The Linear trend analysis for comparing across the groups depicted had a p < 0.000001. The computer selected groups:
Group I (Cl): Carefully assessed for alcoholism, substance use disorder, polysubstance dependence, family history of chemical dependence and obesity nicotine dependence (smoking) BMI over 25, carbohydrate binging, autism,
Tourettes, ADHD, Axis II, pathological gambling and post-traumatic stress disorder. The inventors utilized DSMIV criteria to evaluate substance use disorder. (N=l 1)
Group II (C2): Same exclusion criteria of Group 1 except Axis II has included. (N=6)
Group III (C3): Same exclusion criteria of Groups I and II except positive family history of substance use disorder and obesity is included. (N=20)
Group IV (C4): Same exclusion criteria of Groups I, II, HI except smoking behavior (nicotine dependence) is included. (N=21)
Group V (C5): Same exclusion criteria of Groups I, II, III, IV, except benzodiazepine abuse/dependence is included. (N=31 )
Group VI (C6): Same exclusion criteria of Groups I, II, HI, IV, V except substance use disorder (i.e. alcohol and cocaine) is included. (N=74) Group VII (C7): Same exclusion criteria of Groups I, II, 111, W, V, VI except BMI over 25 is included. (N=140)
Group VIII (C8): Same exclusion criteria of Groups I, II, III, IV, V, VI, VII except a BMI over 25 with comorbid substance use disorder (abuse of alcohol and cocaine). (N=31)
Group IX (C9): Same exclusion criteria of Groups I, II, III, IV, V, VI, VII, VIII except for a BMI over 25 with comorbid polysubstance dependence {i.e. alcohol and cocaine). (N=l 1)
Moreover, the inventors also included for statistical comparison a total of 286 (N=286) healthy Caucasian (LI) males and females (screened for only alcohol and drug abuse and in some cases nicotine abuse) previously genotyped from the literature
(Blum et al, 1990, Blum et al, 1991, Noble et al, 1993, Parsian et al, 1991 ,
Comings et al, 1991 , Smith et al, 1992, Amedeo et al, 1993) with a D2A1 prevalence of 18.5%. Additionally, the inventors included a total of 714 (N=714) subjects (L2) with a D2A1 prevalence of 25.9 derived from the literature screened for only alcoholics or polysubstance dependence (Blum et al, 1990, Parsian et al, 1991,
Comings et al, 1993, Noble et al, 1994, Amedeo et al, 1993, Comings et al, 1994,
Noble 1993, Schwab et al, 1991. Uhl et al, 1992, O'Hara et al, 1993, Uhl et al,
1992). Moreover, the inventors also included a total of 980 (N=980) subjects (L3) with D2A1 prevalence of 32.9 (controls of unknown status) derived from the literature
(Bolos et al, 1990, Grandy et al, 1989, Gelernter et al, Uhl 1992, Goldman et al,
Finns 1994, Nothen et al, Noble et al, 1994, Jonsson et al, 1993, Hedebrand et al,
1993, O'Hara et al, 1993).
FIG. 2. The Effects of Phencal™ on Weight Loss. This figure shows the comparison weight in both the PHENCAL™ and non- PHENCAL™ groups after a two year period. At the end of the two year study, subjects taking PHENCAL™
(n=130) were a mean 23.5% overweight compared with 52.8% for the control group
(n=l 17) not taking PHENCAL™ {p < 0.0001). FIG. 3. Distribution of the alleles of the MAOA VNTR polymoφhism (total number of alleles = 768).
FIG. 4. Additive effect of an increasing numbers of variant additive genes on the ADHD score. It showed a progressive increasing trend from 1.0 for those with only 4 or 5 variant genes, to 25.0 for those carrying 15 variant genes. The p value for linear chi square test of a progressive increase in the ADHD score was < 10 .
FIG. 5. Additive and subtractive effect of all 29 genes on the ADHD score, and additive effect of only the additive genes. The open squares on the bottom represent the r values for each gene assigned random scores that matched the frequency of the observed scores. The progressively additive effect of the r~ values is shown by empty squares and the additive effect of using only the positive correlations are shown by squares containing an x. The lines whose points are marked by an "x" are additive genes, the line whose points are marked by a solid dot are additive and subtractive genes. The final r" using both the additive and subtractive genes was .0001. The final r using only the additive random genes was .0004. Neither was significant. In addition, although the commutative r was as high as .008 at the random PENK gene, this fell back to .0004 when the last random additive gene (CD8A) was added.
FIG. 6. Additive and subtractive effect of all 29 genes on split halves (n = 166) of the sample. Some genes are additive and subtractive in both sets, some are additive in one and subtractive in another. The solid dots represent the group I data, the solid squares represent the group two II data.
FIG. 7. Distribution of the number of variant genes for subjects with no DSM-IV ADHD symptoms versus those fulfilling DSM-IV criteria for ADHD.
FIG. 8. Additive effect of the four genes, H7T, OXYR, DRD2, and RS7 on cholesterol and LDL blood levels. This shows that the MAA technique identified four genes which when combined in the study of 154 subjects, gave significant results with ? = 2.0 x 10-4. The solid circles are the cholesterol data, the open circles are the low density lipoprotein data. DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Polygenes for Diagnosis of RDS and Other Polygenic Traits
The inventors believe that various psychological disorders are linked by a common biological substrate, a "hard-wired" system in the brain that provides pleasure in the process of rewarding certain behavior. The inventors propose in this invention that an inborn chemical imbalance that alters the intercellular signaling in the nucleus accumbens or other limbic reward regions could supplant an individual's feeling of well-being with anxiety, anger or a craving for a substance {i.e. alcohol) that can alleviate the negative emotions. This chemical imbalance manifests itself as one or more behavioral disorders for which the term "Reward Deficiency Syndrome" has been coined (Blum et al, 1996a).
In Reward Deficiency Syndrome or RDS, genetic defects in the reward pathways is best understood as a polygenic disorder, and genetic testing would require the testing of multiple genes. The present invention identified the correlation between the predisposition to RDS and alleles of a number of genes including but not limited to the dopaminergic genes DRDl, DRD2, DRD3, DRD4, DRD5, dopamine transporter gene (DATl); Serotonin genes HTT, HTRA, HTRDb, HTRA, HTRC, tryptophan 2.3- hydroxalase (TD02); Norepinephrine genes, DβH, ADRAA, ADRAC, NT, Catecholamine metabolizing genes, MAOA, COMT; GAGA genes, GABRAA, GABRAB; Canabinoid receptor gene, CNR; Nicotinic cholinergic, CHRNA; NMD A receptor gene, NMDAR; Enkephalin genes, PENK; Androgen receptor gene, AR; Interferon gamma gene, INFG; CDA: Presenilin-, RS-; CRF gene, CRF, obesity gene (OB), leptin receptor gene; serotonin HTRIA receptor gene, serotonin receptor (5HT2R) gene, catachol-0 methyl-transferase {COMT) gene, the neuronal nitric oxide synthase gene {nNOSla), Apolipo protein-D (APO-D) and, uncoupling protein (UCPl and UCP2).
The nature of RDS and related behaviors, being very complex, and the importance of a number of environmental factors, negates the possibility that one particular gene or environmental factor indeed contributes 100% as the determinant. While it is believed that, in general, the "reward cascade model", when impaired, leads to RDS behaviors, the inventors are careful to point out that while more than one gene may be responsible for a percent of the overall variance in one RDS subtrait, it may have little or nothing to do with another related RDS behavior.
Improved genotyping technology has made it commercially feasible to use a genetic approach to map genes involved in the etiology of common human diseases. Many disease genes have been identified via linkage analysis approaches which test for cosegregation within families of the disease trait with a random marker locus. The majority of these are genes involved in monogenic Mendelian diseases with simple patterns of inheritance (Weeks and Lathrop, 1995). Now, human geneticists are beginning to study the genetics of multifactorial diseases such as hypertension, diabetes, heart disease, multiple sclerosis, arthritis and RDS behaviors like obesity. Multifactorial diseases are caused by multiple genes interacting with each other and with environmental factors to create a gradient of genetic susceptibility to disease. The degree and type of epistasis, or interaction between these genes strongly influences the chances of detecting the genes via linkage analysis study. Even if there is no epistasis, the chances of success might be lowered if genetic heterogenity holds, where several distinct loci independently cause the trait. For complex diseases like RDS, traditional LOD score analysis is unlikely to be very powerful, because it assumes the presence of a single, major disease locus(with a specific mode of inheritance) that accounts for the majority ofthe genetic variance and it is now known that this is not true for RDS and so association studies are more powerful and preferred.
One important gap in the prior art in attempting to find a gene for alcoholism per se or RDS behaviors like TS and ADHD for example, is that the majority of workers, including the present inventors, focused on single gene approaches and therefore only were able to identify a small contribution to the overall variance, as with the DRD2 alleles. With TS for example the majority work also involved linkage studies using the model of autosomal dominant inheritance with reduced penetrance, and not association and to date, despite "exclusion" of virtually 100% of the genome, this approach has been unproductive. The inventors have shown that RDS is a polygenic spectrum disorder with genes being contributed by both parents. When Lod score linkage studies are attempted in a disorder that is actually polygenic, so many errors in labeling are made that a negative lod score will be obtained even with genes that are actually involved in defining the phenotype. In addition, when a disorder is polygenically inherited, arguments that the role of specific genes by linkage analysis have been excluded, as in the case of the DRD2 gene, no longer have validity (Devor et al, 1994; Gelernter et al, 1990).
In this invention reference will be made in some cases to a single gene of a polygenic set as a polygene. In the past decade the inventors have examined the potential role of several dozen genes in a range of behavioral and neurological phenotypes. Based on calculations of correlation coefficients the inventors find that regardless ofthe level of significance, the percent ofthe variance for QTVs accounted for by a given polymoφhism ranged from 0.5 to 2.5 percent. Due to this low level of effect of a given allele to a trait, association studies may be the only viable method of identifying the effect of polygenes. As the percentage of the phenotype accounted for a polygene decreases, the difficulty of identifying that effect increases, and the number of subjects that must be studied also increases. One of the criticisms of association studies is that if the controls are drawn from a different racial or ethnic group the presence or differences in gene frequency in such groups may produce erroneous results. While this can theoretically be eliminated by using the haplotype relative risk technique, for diabolic markers where the frequency of one allele is in the 0.1 to 0.2 range, and where the gene being investigated accounts for less than 20% of the variance, the power of this technique is severely limited. Finally, one of the objections of defenders of the association approach, especially for DRD2 studies, is the failure to carefully screen controls to exclude a number of already associated RDS behaviors (SUD, TS, ADHD, CD, SAB, among others), as well as the condition being examined, can lead to false assumptions of no association (Blum et al, 1995; Blum et al, 1997).
However, several meta-analyses of available data have demonstrated this association to be robust (Cloninger, 1991; Gorwood et al, 1994; Noble and Blum K, 1993; Pato et al, 1993; Cook and Gurling, 1994; Uhl et al, 1993; Blum et al, 1995;
Blum et al, 1997). An important factor in studies of DRD2A1 allele association with alcoholism (but it also holds for other RDS behaviors) is the type of comparative controls used. Combined analysis of previously used controls has shown the prevalence of the Al allele to be significantly higher in controls unassessed than those assessed for alcoholism and other relevant factors (Uhl et al, 1993; Noble et al, 1994a). This issue was highlighted in a recent study by Neiswanger et al, 1995 and Hill and Nyswander, 1997, who, by using "super-normal" controls, found a strong association of the Al Allele with alcoholism. This group posit that the use of such assessed control group is probably a more important explanation for previously observed divergent results than either sampling error or population stratification.
Super-Controls. The inventors evaluated 184 probands in a neuropsychiatric and medical clinic in Princeton, New Jersey where they carefully accessed controls, so that each individual was excluded for a number of RDS behaviors (including alcoholism, SUD, smoking, BMI or obesity, pathological gambling, carbohydrate bingeing, axis 1 1 diagnosis, SAB, ADD/ADHD, CD, TS, family history of SUD, and Obesity, and then genotyped for the TaqlD2Al and found unlike the unscreened Caucasian population in which 32.9% carry the DRD2A1 allele only one individual out of thirty which met the criteria for inclusion was found to carry the D2A1 allele or only 3.3%.(see FIG. 1). In fact when all the groups were compared, they found a progressive percent (%) increase in A1+ allelic prevalence being significantly higher in the comorbid polysubstance dependence group (severe) compared to the very well assessed controls. (X2 = 78.8, df = \, p < 0.000001).
One important embodiment of this application involves a method to detect a number of genetic variants, alone or in combination, based on their individual contribution to the RDS behavior being diagnosed. The inventors believe that by utilizing a combination of genes and detecting said specific polymoφhism or actual mutation one would be able to identify individuals at risk in a manner whereby greater accuracy would be achieved than if only one gene was detected as the original issued patents suggested with the DNA based detection of the dopamine D2 receptor gene. In order to provide a clearer overview of the magnitude of this potential some of the genes suspected as being involved in the reward pathway. While this illustrates the neurotransmitters involved in the reward pathways, the related genes that have reported polymoφhisms and the hypothetical effect that genetic defects have on substance abuse and other impulsive, addictive behaviors, the inventors suggest that these and probably many other genes unidentified would constitute a complete allomoφhic map of RDS. This serves as a basis to consider that with time and more research that genes affecting other neurotransmitters will be added to the polygenic set, and that other psychiatric disorders (especially for this invention "reward" and spectrum behaviors) are also polygenic and will be decipherable using this technique. In fact there is the possibility that a number of chromosomal loci and specific markers or genes will be found in the near future, but it is the intent here to develop a MULTI- PLEX GENESCAN™ to detect a number of already associated genes in impulsive- compulsive-addictive behaviors the inventors characterized as comprising Reward Deficiency Syndrome, as well as other polygenic traits. Additionally, a diagnostic method for polygenic traits, including RDS, called the Multiple Additive Associations (MAA) Technique, has been developed by the inventors.
Steps to the Multiple Additive Associations (MAA) Technique. The specific examples demonstrate the use of the MAA Technique to construct diagnostic assays for RDS related disorders. However, the inventors give a number of examples that are independent of psychiatric disorders and illustrate that the MAA technique can be generalized to all polygenic disorders and all polygenic traits. Thus, the inventors contemplate that the MAA technique as a procedure for all polygenic disorders. Polygenic disorders are characterized as being due to the additive effect of many genes each of which individually account for only a small percent of the variance of the phenotype. They are present to varying degrees in all individuals. Polygenic disorders are much more common than single gene disorders, affecting from 1 to 20 percent of the population. Some examples are hypertension, obesity, most psychiatric disorders, multiple sclerosis, lupus erythematosis, osteoporosis, coronary artery disease, rheumatoid arthritis, osteoarthritis, weight, height, blood pressure, age (longevity), psychological traits and any other trait that is determined in part by more than one gene or allele. The following teaches how the MAA technique is performed. The present MAA technique has the following unique added features. First, it dramatically expands the number of genes that can be examined to thousands. It places all quantitative or dichotomous traits on the same scale by using the correlation coefficient (r), and the percent of the variance (r2) instead of the trait itself. It incoφorates the concept that as individual genes are added they may be either additive (increase in r and r2) or subtractive (decrease in r and r2). It utilizes this increase or decrease to identify those genes that play a role in the disorder or trait, because they are additive, from those genes that do not play a role in the disorder or trait, because they are subtractive. It provides for a re-analysis using only the additive genes to estimate the total percent of the variance, r2, accounted for by the identified additive genes. By examining the additive effect of multiple genes rather than examining genes one-gene-at-a-time, the MAA technique has much more power to identify the genes involved in polygenic disorders than procedures such as lod score, sib pair, haplotype relative risk (Falk and Rubinstein, 1987), and transmission disequilibrium tests (Spielman and Ewens, 1996) that examine genes singly. The MAA technique shows that p values for associations studies examining one-gene-at-a-time have little relevance to whether a gene is involved in a polygenic disorder or trait. The MAA technique can be described as having the following steps, though certain steps are unique to the technique.
STEP 1. The first step is to identify the polygenic disorder or trait to be studied, i.e. attention deficit hyperactivity disorder (ADHD), depression, cholesterol level, weight, obesity, longevity, blood pressure, multiple sclerosis, or any other disorder or trait that is polygenic, or suspected of being polygenic. Unless specified, a structured diagnostic interview such as the DIS (Diagnostic Interview Schedule) (Robins et al, 1981) or SCID (Williams et al, 1992), are used to apply the DSM criteria to make psychiatric diagnoses of individuals with a psychological trait known or suspected of being polygenic. The inventors contemplate that the most recent DSM version in publication may be used to make such diagnosis, though older versions may be used as well.
STEP 2. The second step is setting a scale that measures the severity of the polygenic disorder. This can be a quantitative trait or dichotomous variable (QT or DV). For example if blood pressure is being studied the quantitative scale could be diastolic blood pressure, if height is studied the height in inches or cm could be used, if obesity is studied the scale could be weight or BMI, if depression is studied the scale could be the number of positive DSM-IV criteria for depression, etc. Dichotomous traits can also be used. For example, if 200 controls and 200 subjects with multiple sclerosis were studied, the controls could be scored as = 0 and those with multiple sclerosis scored as = 1. Score for traits, phenotypes or QTVs refer to the number magnitude of the trait. For example is I weight 200 lbs my weight score would be 200. If I have a cholesterol level of 250 my cholesterol score would be 250, etc. Scores for genes refer to assigning a 'score' of 0, 1 or 2 to the genotypes depending upon which genotypes were associated with the least, intermediate or greatest phenotypic effect.
STEP 3. The third step is to identify the candidate genes to be tested. As an example, this application shows the 29 candidate genes chosen for ADHD, oppositional defiant disorder, conduct disorder, learning disorders, alcohol were those genes that play a role in the regulation of neurotransmitters including dopamine, serotonin, norepinephrine, GABA, and others. One of ordinary skill in the art would recognize that any gene may potentially contribute to a polygenic trait. Selection of a candidate gene or set of genes to be used in the MAA technique would be facilitated by first selecting genes that would have some metabolic or physiological relationship to the trait being examined. Any gene or gene allele described or disclosed in the scientific literature, which is available in public libraries, or a computerized database such as Genbank, which is available from the National Center for Biotechnology Information, are contemplated as being candidate genes to be used in the MAA technique to create diagnostic or prognostic assays for a particular trait. One of skill in the art would recognize that there are other sources of genetic information, including personal knowledge or knowledge that is not published or publicly available, which can be used to identify candidate genes for most polygenic traits and disorders, and such resources may be used in the practice ofthe MAA method.
An example of candidate genes involved in a polygenic trait, such as height, or susceptibility to osteoporosis, would be genes involved in bone and/or connective tissue formation, growth, and/or regulation. Another trait that could be evaluated would be obesity, and candidate gene would include these genes plus the OB gene, the OB receptor gene, the neuropeptide Y gene and the neuropeptide Y receptor genes would be candidate genes. For a trait such as blood pressure, reasonable candidate genes would be those relating the norepinephrine, epinephrine, steroid, and rennin metabolism.
In the examples ofthe present invention, various genes were selected that were suspected of contributing to a polygenic trait. Of particular interest were genes suspected of contributing to RDS behaviors. The criteria for the selection of a gene included indications of their involvement, from the literature, in one or more RDS behaviors or other polygenic traits of interest, and/or experimental data by the inventors, which is described below. The inventors contemplate that the association of a gene or polymoφhism with a given trait may be used in a diagnostic assay for that trait, as well as provide guidance to the suitability of a gene and/or its specific polymoφhisms for inclusion in a MAA diagnostic assay for the polygenic trait of interest. The traits do not have to be associated with RDS for the gene or polymoφhism.
DRDl Gene. This particular gene in preliminary studies by the inventors did not associate with severe alcoholic probands compared to controls, thus, these additional findings with a larger sample was suφrising. The study showed that examination of both the DRDl and DRD2 dopamine receptor genes accounted for a greater proportion of the variance for a range of behaviors than either gene alone (Comings et al, 1997). The DI receptor gene polymoφhism may be more associated with polysubstance abusers rather than severe alcoholics.
Dopaminergic Genes, Violence and Schizoid/Avoidant Behaviors. Other findings support the concept of polygenic inheritance in complex personality disorders such as "pathological violence" and schizoid/avoidant behaviors (SAB). The inventors found a strong association between the DRD2 Al allele and "pathological violence" in adolescent probands and also found a similar association for the 10 allele of the dopamine transporter gene (DATl). Strong association was found for the DRD2A1 allele with SAB, no association was found for the DβH gene, however, albeit weaker an association was found for the DATl gene with SAB (Blum et al, 1997).
An examination of DβH alleles may be the most precise approach to examining the potential role of DβH in human behavioral disorders. This is the first study supporting a strong association between the DRD27α<7L47 allele with SAB and PV. Where these complex traits do not show simple Mendelian patterns of inheritance one would not expect simple genetic answers caused by a single gene. The relationship of dopamine genes to pathological violence is further described in Specific Example 17.
Dopamine D2 Receptor Gene. Putative mutations located in 3' and 5' non- coding regions of the gene that were maintained in linkage disequilibrium with the polymoφhic markers, may influence DRD2 transcription and/or mRNA stability and thus affect DRD2 receptor number, based on the following: a stronger association found with markers located on the flanking regions rather than at exonal point mutations; the reported lack of mutations in exons (except exon 8) of "Al -marked " DRD2 alleles; and the decreased DRD2 Bmax reported with presence of the Al marker in the absence of Kd changes (Noble et al, 1991). This may help explain the lack of association with one polymoφhism, the Taql D2. The lack of association with Taql D2 fits with population genetic analyses demonstrating that, whereas Taql A and B are in strong linkage disequilibrium with each other, the Al 3' flanking marker displays less disequilibrium with Taql D, whose weak association with pschostimulant preference might have therefore been expected (Suarez et al, 1994).
To further complicate matters, explanation for failure in some studies might be due to what Comings (co-inventor) refers to as molecular heterosis. This occurs when subjects heterozygous for a genetic polymoφhism show a significantly higher
(positive heterosis) or lower (negative heterosis) mean for a quantitative trait variable
(QTV) than subjects homozygous for either allele.
Positron emission tomography (PET) studies have shown decreased glucose metabolism in brain regions of detoxified alcoholics and cocaine abusers. In the present study, using F-deoxyglucose, regional glucose metabolism was determined in healthy nonalcohol/nondrug-abusing subjects with the Al or Al" allele. The mean relative glucose metabolic rate (GMR) was significantly lower in the Al than the Al" group in many brain regions, including the putamen, nucleus accumbens, frontal and temporal gyri and medial prefrontal, occipito-temporal and orbital cortices. Decreased relative GMR in the Al+ group was also found in Broca's area, anterior insula, hippocampus, and substantia nigra. A few brain areas, however, showed increased relative GMR in the Al+ group.
There are several lines of evidence suggesting a role for defects in dopamine metabolism in the etiology of stress disorders. Fewer numbers of dopamine D2 receptors in the brains of Al allele carriers may translate into lower levels of dopaminergic activity in those parts of the brain involved in reward. Al carriers may not be sufficiently rewarded by stimuli that A2 carriers find satisfying. This may translate into persistent cravings or stimulus-seeking behavior of Al carriers. Because dopamine is known to reduce stress or cravings, Al carriers may turn to other substances or activities that release additional quantities of dopamine in an attempt to gain temporary relief. Alcohol, cocaine, cannabis, nicotine, and carbohydrates (like chocolate) all cause the release of dopamine in the brain and bring about a temporary relief of craving. These substances can be used singly, in combination or to some extent interchangeably. Correspondingly, the DRD2 gene has been demonstrated in studies of ours (Comings et al, 1996b) and others (Noble et al, 1994; Lerman et al,
1997) to be associated with smoking.
Dopamine-β-Hydroxylase. Since DβH is located in the sympathetic nerve terminal and released into the circulation during the release of norepinephrine, the genes involved in its control could reside at loci other than the DβH gene itself. Thus, association studies between genetic markers at the DβH locus and ADHD, CD, alcoholism as well as other RDS related behaviors could be negative. On the other hand, if the serum levels of DβH are cofounded by a range of environmental factors, association studies with genetic markers of DβH could provide a more accurate assessment ofthe role ofthe DβH gene in these disorders than blood levels. These findings and other findings taken together indicate that polymoφhisms of the DβH gene may play a role in only specific RDS behaviors, and it is difficult from the past literature regarding blood levels of DβH or its products of activity (dopamine or norepinephrine) to predict genetic outcomes.
The Dopamine-Beta-Hydroxylase Gene in Drug Abuse and Other Traits.
The inhibition of DβH activity results in the excessive production of dopamine which is associated with hyperactivity, aggression, self-stimulation and stereotypic movements (Randrup and Scheel-Kruger, 1996). This suggest a possible role of DβH in aggression, ADHD and conduct disorder (CD) in humans. Increased frequency of the diagnosis of CD in emotionally disturbed boys with low plasma DβH levels has been reported (O'Connell et al, 1992; Rogeness et al, 1984; Rogeness, et al, 1986; Rogeness, et al, 1988; Rogeness, et al, 1987). Some studies have shown a correlation between low DβH levels and certain personality traits such as the extroversion scores on the Eysenck Personality Questionnaire (Roy and Brockington, 1987) and sensation seeking (Ballenger et al, 1983; Umberkoman-Wita et al, 1981), while in one study there was a positive association between plasma DβH and sensation seeking scores (Folstein and Rutter, 1977).
Another aspect of the invention involves association studies with the dopamine-beta hydroxylase gene and shows the first association between the DβH dinucleotide repeat polymoφhism and drug abuse patterns (Comings et al, 1996a).
The dinucleotide repeat polymoφhism for DβH was found to have a bimodel allelic distribution at below or above 175bp. Subjects were genotyped as homozygous for low (<174bp) or high (<176bp), or heterozygous. Generally, patients with the high bp homozygotes were found on the ASI to have greater number of previous drug treatments, longer history of cocaine use, more frequent IV injection of amphetamines, more frequent IV drug use. These subjects reported paternal alcoholism more often and a history of having been sexually abused in childhood. For the patients with the high bp genotype was associated with lower scores on Self- Acceptance, Enlighted Second Nature, and Self-Directiveness. Like the DRD2 Al allele, the DβH BI allele was most associated with the variables ADHD, obsessive-compulsive, manic, oppositional defiant, and sleep. Differences included the greater association of the DRD2 Al allele with the schizoid, sexual, conduct and stuttering variables, while the DβH BI allele was more strongly associated with learning, reading and school problems. The tendency for the variables associated with school performance, such as reading, learning and grade school, to rank high in the DβH studies is especially striking in contrast to the DRD2 studies where they tended to rank at the bottom. This may be related to the role of DβH in memory.
Tourette's syndrome (TS) may be one of the most complex recognizable forms of RDS. Since all of the behaviors associated with the inhibition of DβH activity are common in patients with Tourette's syndrome (TS) (Comings and Comings, 1984; Comings and Comings, 1987b; Knell and Comings, 1993; Comings, 1990) an association between the DβH Taq B polymoφhism (d'Amato et al, 1989) and TS, conduct disorder, attention deficit hyperactivity disorder (ADHD), autism, or related behaviors may exist.
Exclusion of DATl Gene in Morbid Obesity. The presence of the DRD2
Al allele indicates increased risk not only for obesity, but also for other related addictive behaviors and that a BMI over 25 by itself (without characterization of macroselection [carbohydrate bingeing] or comorbid SUD) is not a sufficient criterion for association with the DRD2 Al allele (Blum et al, 1996).
Work in the area of morbid obesity evaluating both the DRD2 Al and the DATl genes showed an association of only the DRD2A1 allele {p < 0.0001) and not the DATl gene in females at 34% or greater body fat as well as males at a body fat 28% or greater. The highest weight occurred in individuals having the DRD2A1/A1- DAT1- 10/10 haplotype suggesting contribution of both genes in morbid obesity with a much greater contribution being the D2 receptor gene.
The Cannabinoid Receptor Gene. The likelihood of intravenous drug (IV) drug use may be affected by both genetic and environmental factors. To explore these gene-culture etiologic factors, 77 male non-Hispanic Caucasian substance abusers and 70 ethnically matched controls were examined. Patients were administered the Addiction Severity Index; all probands were administered the Family Environment Scale and a childhood-experiences survey questionnaire, and were genotyped for dopaminergic, cannabinoid, and GABAergic genes. The inventors found a higher prevalence of IV drug use among subjects whose genotypes included only high molecular-weight alleles of the CR/ (cannabinoid) receptor gene and low molecular weight alleles of the GABRB3 gene. The CR7 gene is a tri-nucleotide repeat with at least 9 alleles, and the inventors found evidence that its effects on the phenotype may not be linearly predictable from the relative weight of the alleles, but are rather more complex in their interactions with IV drug use. Several environmental variables, including one from the Family Environment Scale, were associated with predisposition to IV drug use after the variance associated with the genetic variables was removed, although these environmental variables may themselves be under the influence of as yet unidentified genes.
Electrophysiological Abnormalities and Substance Use Disorder (SUD):
Correlation to the dopamine D2 receptor and Cannabinoid Receptor Genes. A significant association between severe substance use disorder (SUD) and the DRD2A1 allele relative to "super control" and a large number of literature controls has been observed (Blum et al. 1997; Hill et al, 1997). Decreased amplitude and latency of the P300 wave of evoked related potentials (ERP) has long been associated with alcohol and drug dependence (Braverman, R. et al, 1990). A significant prolongation of P300 latency correlated with three risk factors (1) parental SUD; (2) chemical dependency (i.e. cocaine dependence) and (3) carbohydrate bingeing. Decreased P300 amplitude correlated with family history of alcoholism and SUD, but did not correlate with the DRD2A1 allele.
In this application, the inventors present evidence for a significant association between decreased frontal lobe P300 amplitude and homozygosity for the >5 repeat alleles of the cannabinoid receptor gene (CBl). To determine if the same genotype is associated with alcohol or drug dependence, 98 subjects from an ATU and 69 controls were genotyped for the CBl repeat alleles. All subjects were non-Hispanic Caucasians. The ATU subjects were assessed using the Addiction Severity Index, the Diagnostic Interview Schedule, and the MAST-R. Drug and alcohol abuse/dependence was excluded from controls using only the MAST-R. The results showed a significant association of homozygosity for the 5 repeat alleles with a number of different types of drug dependence (cocaine, amphetamine, cannabis), with years of hallucinogen, inhalant, heroin, opiate, amphetamine, cocaine, and barbiturate use, with IV drug use and drug overdoses, and with legal problems associated with drug abuse(drug charges, drug convictions, driving violations, and weapons, assault, and vandalism charges). By contrast there was no significant association with the variables related to alcohol dependence. This could have been due to under accessed controls and/or assessment of severe alcoholism, especially for the complete RDS phenotype. However, these results are consistent with studies indicating cannabinoid receptors play a role in reward pathways and modulate dopamine metabolism.
The present invention identifies a significant relationship between brain electrical activity mapping (BEAM) abnormalities, and association with DRD2 genotypes. The inventors believe this has commercial value as a important confirmation test for diagnosing genetically induced predisposition to RDS behaviors. It is suggested the method involves the detection of said human dopamine receptor gene Al allele and the cannabinoid receptor gene (CNRl) to accompany a standard brain map (i.e. Nicolett(™)).
Moreover, a weighted linear trend revealed a significant worsening effect of event-related potentials in the presence of the DRD2A1 allele compared to the DRD2A2 genotype and comorbid SUD (p < 0.0001). Duncan's Range Test showed SUD with or without DRD2A1 allele significantly worsened the EP'S compared to DRD2A2 controls. These results suggest a role for the DRD2A1 allele in a non- behavioral pathophysiological phenotype involving brain function and potential addiction liability.
Serotonin Genes. Defects in serotonin metabolism, and abnormalities in both blood serotonin and tryptophan levels, have been reported in many psychiatric disorders. Tryptophan 2,3-dioxygenase (TD02) is the rate limiting enzyme for the breakdown of tryptophan to N-formyl kenurenine. The inventors sought to determine if genetic variants at the serotonin HTRIA gene were associated with the phenotypic expression of TS or any of its associated comorbid behaviors. There was a significant association between the presence of the less common (shorter and the longer alleles) and scores for ADHD, CD, and oppositional defiant disorder (ODD), tics, sexual and other behaviors. The contribution to these scores was modest, accounting for only 2- 4%> of the variance. The effects of the HTRIA and the DRD2 genes were additive and together accounted for 5.1 to 5.4 % of the variance of the ADHD, CD, and ODD scores. These results are consistent with the proposal that these are polygenic disorders, due in part to the chance convergence of variant genes affecting serotonin and dopamine metabolism, as well as environmental factors. The repeat sequences themselves may play a role in producing functional alleleomoφhic variants important in polygenic inheritance.
The T/C polymoφhism in the 5HT-2 receptor gene was also examined for possible association using Axis II Personality Disorders Structural Interview and the Addiction Severity Index (ASI) and the Buss-Durkey Hostility Scale (BHDS). In patient sample the 22 genotype was associated with diagnosis of borderline personality disorder (p < 0.05) and depression (p < 0.05). On the ASI this marker was associated with amount of money spent on drugs (p < 0.05) and a history of rape (p < 0.0.05) and shoplifting/vandalism(p < 0.05). On the BHDS, among the male controls, the 22 genotype was associated with elevated scores on the Assault (p < 0.01) and Indirect Hostility (p < 0.05), subscales. Among the female controls the 5HT-2R gene was associated with Indirect Hostility (p < 0.05), Negativism (p < 0.05), Verbal Hostility (p < 0.005), and Feelings of Guilt (p < 0.05), as well as total Hostility score (p < 0.01), but the polarity of the association was reversed (e.g., the 11 genotype was associated with higher values on all scores). The gender-reversal of genotype associations, suggests this is a complex gene that may interact with sex steroids.
Estrogen receptor, the Aromatase locus, and the Arginine Vasopressin
Genes and Conduct Disorder. Since knockout mice for estrogen receptors show aggressive behavior (Ogawa et al, 1996), a study of the dinucleotide repeat (del
Senno et al, 1992) at this gene might also be relevant to conduct disorder. Two other relevant genes would be those at the aromatase (CYP 19) locus (Polymeropoulos et al, 1991 ) and the arginine vasopressin (AVP) gene (Summar, 1992).
Nicotinic Receptors Genes. Nicotinic receptors in the prefrontal cortex are involved in delayed response tasks, while muscarinic receptors are more involved in general working memory (Granon et al, 1995). Many studies have shown an intimate interaction between nicotine and dopamine. As with other addicting drugs nicotine produces an increase in the release of dopamine in the mesolimbic and nucleus accumbens neurons (DiChiara and Imperato, 1988; Corrigall et al, 1994; Pontiefi et al, 1996) and robust self administration (Corrigall and Coen, 1989; Corrigall and Coen, 1991 ). However, tolerance rapidly develops with repeated administration (Lapin et al, 1989). While nicotine inhibits dopamine uptake unlike most dopamine uptake inhibitors, it inhibits it only by 50% (Irenwasser et al, 1991). Studies with dopamine uptake inhibitors and nicotinic receptor agonists and antagonists suggest the effect on dopamine uptake is mediated through nicotinic acetylcholine receptors (Irenwasser et al, 1991).
Neuronal Nitric Oxide Synthase (NOS) Gene. The nitric oxide synthase gene has recently been implicated in aggressive behavior in mice. Studies of ob/ob mice show increased levels of nitric oxide synthase (NOS) compared to non-ob/ob litter mates. Studies of NOS knockout mice have emphasized the important role of nitric oxide in aggressive and sexual behavior. Ob/ob mice also show significantly increased levels of norepinephrine in paraventricular nucleus and lateral hypothalamus and significantly decreased levels of dopamine in the arcuate-infundibulum (Oltman, 1983).
The relevance of a dinucleotide repeat polymoφhism of the neuronal nitric oxide synthase gene (nNOSla) was examined. Measures of hostility, diagnostic features and personality traits in a sample of 67 male non-Hispanic Caucasian substance abusers and 68 age-and ethnicity-matched controls were evaluated. The patient sample was evaluated using the AXIS- 1 1 Personality Disorders Structured Interview, The Addiction Severity Index (ASI), and the Cloniger Temperament and Character Inventory (TCI). The allelic distribution of patients and controls was marginally different (p = 0.056), with patients homozygous for high molecular weight alleles. On the AXIS-II interview, patients homozygous for the high molecular weight alleles (>201) met diagnostic criteria more often for schizophrenic (p < 0.05) and borderline (p < 0.05) personality disorders. On ASI this genotype was associated with increased scores on: expressed violent behavior in past 30 days (p < 0.005), history of forgery (p < 0.05), history of burglary (p < 0.0.05), alcohol use in past 30 days (p < 0.005), years of inhalant use (p < 0.0075), number of drug detoxes (p < 0.05), and number of days in past month experienced problems with alcohol (p < 0.005) and drugs (p < 0.005). This genotype was also associated with having fewer friends (p < 0.04), having less friendship with the friends they have (p < 0.0005), having been married more times (p < 0.05). On the TCI this genotype was associated with increased Impulsiveness (p < 0.01), and decreased scores on Attachment (p < 0.05), Dependence (p < 0.02), Reward Dependence (p < 0.05), Puφosefulness (p < 0.01), Self-Directiveness (p < 0.05), Empathy (p < 0.05), Helpfulness (p < 0.02), Pure-Hearted Conscience (p < 0.02), and Cooperativeness (p < 0.05).
Monoamine Oxidase Gene (MAO). MAO is one of the major enzymes responsible for the degradation of neurotransmitters in the synapses of the brain. Significant improvement in mood and other behaviors can occur by the administration of medications that inhibit MAO activity. Many studies have suggested a correlation between low MAO levels and alcoholism (Wiberg et al, 1977; Gottfries et al, 1975; Devor et al, 1994; 09); schizophrenia (Wyatt et al, 1979); depression (Sherif et al, 1991 ; Pandey et al, 1992); manic depressive disorder (Pandey et al, 1980); suicide (Gottfries et al, 1975; Sherif et al, 1991; Buchsbaum et al, 1976; Buchsbaum et al, 1977; Meltzer and Arora 1986); ADHD, also known as ADDH, (Skekim et al, 1982); and risk-taking, sensation seeking or externalizing personality traits (Vonknorring et al, 1991 ; Buchsbaum et al, 1976; Schooler et al, 1978; Shekim et al, 1989; Vonknorring et al, 1984). Yet other studies have failed to find associations with one or more of these traits (Mann and Stanley 1984; Propping et al, 1981 ; Tabakoff et al, 1988). Prior studies using both enzyme levels (Wiberg et al, 1977; Gottfries et al, 1975; Devor et al, 1994; Vonknorring et al, 1991) and genetic variants (Vanyukov et al, 1993) have indicated a role ofthe MAOA gene in substance abuse. In addition to the dopaminergic system and cannabinoid receptors, monoamine oxidase (MAO) has also been implicated as playing a significant role in RDS. The present invention also provides for the first association of Monamine Oxidase gene variants in Tourette syndrome. Genetic defects in the X-linked MAOA or MAOB genes could explain the male prominence of ADHD, TS and related disorders. The alleles of three repeat polymoφhisms, two of the MAOA and one of the MAOB gene in 351 Ts patients, relatives and controls were examined. Each subject completed a structured questionnaire that allowed an assessment of 23 different quantitative traits relating to behavioral, learning and school problems. There was a significant tendency for the longer base pair (bp) alleles of the MAO VNTR and MAOB polymoφhisms and the shorter bp alleles of the MAO CA-1 polymoφhism to be associated with higher scores for ADHD, stuttering, mania, depression, conduct, and learning problems. The most significant results were with the CA-1 repeat of the MAOA gene for ADHD (p = 0.005), major depression (p = 0.005) and stuttering (p = 0.007). While the regression coefficients for seven of the behaviors were significant at < 0.01, the R or percent of the variants at the sex-linked MAOA genes contribute to a range of behaviors, the degree of involvement was insufficient to explain the degree of male prominence for TS, ADHD or CD. The results are consistent with a polygenic mechanism of inheritance ofthe TS spectrum disorder and the hypothesis that minisatellites themselves may play a role in gene regulation.
The OB, Human chromosome 2, Uncoupling Protein-2 and APO-D genes in Obesity. Adoption studies show a higher degree of genetic loading for obesity in females than in males, and with the probability that genetic factors are more likely to be involved in obesity in the young, than in those older than 50 years of age where the incidence of obesity increases for a large percentage of the population, and where acquired factors such as a more sedentary life style, may be more important (Stunkard et al, 1986).
An important protein product involved in obesity is the serum protein Leptin.
Its synthesis is controlled by the OB gene and is thought to play a role in the regulation of body fat (Maffei et al, 1995). Leptin levels in humans have been found to be highly correlated with an individual's total adiposity (Considine et al, 1996). It was found that a microsatellite polymoφhism, D2S1788, mapped to chromosome 22p21 which showed strong evidence of linkage by lod score with serum leptin levels (Comuzzie et al, 1997). This locus accounted for 47% of the variation in serum leptin levels, and contains several potential candidate genes for obesity, including glucokinase regulatory protein (GCKR) and pro-opiomelacortin (POMC) (Comuzzie, 1997). N potential mechanism related to the POMC gene, is that it is the precursor for adrenocorticotropic hormone (ACTH), which acts on the cortex of the adrenal glands leading to the production of glucocorticoid. However it is possible to infer that the POMC gene also acts as a precursor to the opioid peptides.
A mitochondrial protein called uncoupling protein (UCPl) plays an important role in generating heat and burning calories (Νicholls and Locke, 1984). This pathway has been implicated in the regulation of body temperature, body composition and glucose metabolism (Himms-Hagen, 1990). However, UCPl -containing brown adipose tissue is unlikely to be involved in weight regulation in humans living in a thermalneutral environment. UCP-2, which has 59% amino identity to UCP-1, and has properties consistent with a role in diabetes and obesity (Fleury et al, REFERENCE). UCP-2 has a greater effect than UCP-1 on mitochondrial membrane potential when expressed in yeast. UCP-2 is widely expressed in adult human tissues, including tissues rich in macrophages, and it is upregulated in white fat in response to fat feeding.
The present invention couples polygenic analysis of all these obesity genes, which have a number of different physiological mechanisms. These differences may allow for additive effects rather than synergism leading to a more accurate DNA based prediagnostic test. Combining the DRD2, OB, Chromosomal 2, UCP-2 and APO-D genes in one sample is the preferred embodiment rather than any gene alone. Additionally, the invention determines probands that are morbidly obese as determined by not BMI (which is not the best obesity determinant) but by percent body fat: 34% for females and 28% for males.
The Polygene Approach in SUD. One of the unique advantages of examining the alleles of a number of different genes in the same set of subjects is that the relative effect of each gene can be compared for different quantitative variables. In addition, identification ofthe genotypes adds greater sophistication and precision to the analysis of environmental effects in that the effects of the genes can be dissected away from environmental causes.
Scores on the ten scales of Moos' Family Environmental Scale (FES) were employed as indicators of subject's family environment in childhood and adolescence. The data were analyzed using the Correlations and Partial Correlations software of SPSS (SPSS, Inc.).
The analysis for each drug variable began with stepwise regression using marker genotypes at seven gene loci as predictor. A p value of less than 0.05 was required to enter a variable in the production equation. After each regression, the variables associated with the least predictive gene were removed. The results showing the respective correlation coefficients for different genes and environmental factors, are shown in Table 1.
TABLE 1
STEPWISE MULTIPLE REGRESSION ANALYSIS
OF PREDICTIVE EFFECT OF SPECIFIC GENOTYPES
FOR VARIOUS DRUG AND ALCOHOL ABUSE VARIABLES
Alcohol Abuse Drug Abuse
IV Drug User Hallucinogen Marijuana Amphetamine Cocaine Yrs. Severity Severity
Yrs. Yrs. Yrs. Rating Rating
N 100 100 118 94 128 130 128
Genotypes
DRD71 .25** .19*
GABRB31 .26** .20** .19"
CNRT .28** 27** .23* .26* .17
DRD7 .27 ** .23* .24 ** .37 **
Alcohol Abuse Drug Abuse
IV Drug User Hallucinogen Marijuana Amphetamine Cocaine Yrs. Severity Severity
Yrs. Yrs. Yrs. Rating Rating
Total
R .46 .46 .32 .38 .26 .24 .41
Rz .21 .21 .14 .07 .06 .17
P .0002 .0001 .002 .003 .013 .007 < 0.0001
Correlation of FES Environment Variables with Significant Genetic Predictors Partialed Out
ICO0 .31 ** -.22** -.25 ** .23 ** .15 -.31 ** -.16
ARO' -.21* -.12 -.26 ** -.11 -.19* -.21 ! -.17
C* -.23< -.16 -.19* -.22" -.27 ** -.35 ** -.21 =
* < 0.5 DRD4 ± 7 alleles
Alcohol Abuse Drug Abuse
IV Drug User Hallucinogen Marijuana Amphetamine Cocaine Yrs. Severity Severity
Yrs. Yrs. Yrs. Rating Rating
** < 0.01 3 DβH Taq BI het. vs. homo.
DRDl 1 1 genotype ICO = Intellectual and Cultural Orientation from the FES
GABRB3 < 188 bp alleles 7 ARO = Active Recreational Orientation from the FES
CNRl > 5 / > 5 genotype C = Family Cohesion from the FES ***
^1
STEP 4. The fourth step is to identify one or more polymoφhisms associated with each gene. These can be single base pair restriction fragment length polymoφhisms (RFLPs), or dinucleotide, trinucleotide, or other repeat polymoφhisms, such as well as variable tandem repeats, or any other marker of a gene locus. Such polymoφhisms and methods of detection may be readily available in previously published or unpublished bodies of work, as previously described above for identifying candidate genes, in addition to the polymoφhisms disclosed herein. Alternatively, if a gene is suspected of contributing to a polygenic trait of interest, but no polymoφhism is currently available for use in the MAA technique after a review of the literature and genetic databases, one may perform genetic assays to determine polymoφhisms in a gene that may be used in the MAA technique. Such assays are commonly used and described in the literature', in addition to the techniques described herein. Methods for genetic screening to accurately detect mutations in genomic DNA, cDNA or RNA samples may be employed, depending on the specific situation.
The present invention concerns the detection, diagnosis, prognosis and treatment of RDS diseases, and the detection, diagnosis, and prognosis of polygenic traits using the MAA technique. Markers of alleles that contribute additively or subtractively to a polygentic trait, in the form of nucleic acid sequences isolated from an individual, and methods of identifying and detecting new markers to be used in MAA assays, are disclosed. These markers are indicators of a polygenic trait being assayed, and are diagnostic of the potential for an individual to exhibit a particular trait.
Those skilled in the art will realize that the nucleic acid sequences disclosed herein, as well as those available through public databases, such as found at the National Center for Biotechnology Information, the published scientific literature, may be used in the MAN technique, and thus will find utility in a variety of applications in the detection, diagnosis, prognosis and treatment or RDS or other polygenic traits. Examples of such applications within the scope of the present invention comprise amplification of one or more markers of a polygenic trait, using specific primers, detection of markers of a polygenic trait, such by hybridization with oligonucleotide or nucleic acid probes, incoφoration of isolated nucleic acids into vectors, and expression of RNA from the vectors.
The requirement to test for multiple genes in behavioral disorders and other polygenic traits is feasible and requires no new technology. The polymoφhisms and variants involved are to two types, 1) single base pair changes producing restriction fragment length polymoφhisms (RFLPs), and 2) short tandem repeat polymoφhisms (STRs) [ especially di-and trinucleotide repeats]. The methods for large scale testing for these are different for each type.
RFLP's. Applied Biosystems, a division of Perkin-Elmer Coφoration, has developed a new technology and instrumentation that allows the rapid testing for PCR™ based single pair RFLP type genetic polymoφhisms. This instrument, Applied Biosystems Prism 7200 sequence Detection System (TaqMan) allows for multiple gene testing. This approach uses standard primers to electrophorese the section of DNA containing the restriction endonuclease polymoφhism site. The unique aspect of this technology is that two short oligmers are then designed, one exactly matching one of the alleles, the other matching the other allele. A fluorescent dye is attached to one end of each, and a quenching dye is attached to the other end. If the match is perfect, when the DNA polymerase reaches the hybridized oligmer, it is digested into nucleotides as the polymerase passes. This releasers the quencher and the dye now fluoresces maximally. However, if the oligmer does not match, instead of the nuclease digestion, the oligomer is pushed off the site and the quenching persists. Dual wavelength reading of the plate allows distinction between 11,12,22 genotypes. The entire process of reading the results on 96 samples requires less than fifteen min and the results are fed into a computer for analysis and storage. This technology, aided by a computerized workstation to set up to PCR™ reactions, allows hundreds of different RFLPs to be examined in one day.
STRs. The same computerized workstation used above is used to set up the
PCR™ reactions for the STRs. The difference is that for the STRs the primers themselves are labeled with different fluorescent dyes. The accuracy necessary to identify alleles differing by only two bp is obtained from the Applied Biosystems 373 DNA sequencer which allows the sample labeled with a second dye. Each is detected by laser scanning at a different wavelength. For example, one PCR™ primer is labeled with fluorescent HEX Amidite (Applied Biosystems, Foster City, CA) or other fluorescent dye. Two μl of the 10 fold diluted PCR™ product is then added to 2.5 μl deionized formamide and 0.5 μl of ROX 500 standard, denatured for 2 min at 92 C and loaded on 6% denaturing polyacrylamide gel in an AB 373 DNA sequencer. The gel is electrophoresed for 5 h at a constant 25W. The gel is laser scanned and analyzed using the internal ROX 500 standards present in each lane. The peaks are recognized by Genotyper( version 1.1) based on the color fragments sized by base pair length.
Historically, a number of different methods have been used to detect point mutations, including denaturing gradient gel electrophoresis ("DGGE"), restriction enzyme polymoφhism analysis, chemical and enzymatic cleavage methods, and others. The more common procedures currently in use include direct sequencing of target regions amplified by PCR™ (see below) and single-strand conformation polymoφhism analysis ("SSCP").
Another method of screening for point mutations is based on RNase cleavage of base pair mismatches in RNA DNA and RNA/RNA heteroduplexes. As used herein, the term "mismatch" is defined as a region of one or more unpaired or mispaired nucleotides in a double-stranded RNA/RNA, RNA/DNA or DNA/DNA molecule. This definition thus includes mismatches due to insertion deletion mutations, as well as single and multiple base point mutations.
U.S. Patent No. 4,946,773 describes an RNase A mismatch cleavage assay that involves annealing single-stranded DNA or RNA test samples to an RNA probe, and subsequent treatment of the nucleic acid duplexes with RNase A. After the RNase cleavage reaction, the RNase is inactivated by proteolytic digestion and organic extraction, and the cleavage products are denatured by heating and analyzed by electrophoresis on denaturing polyacrylamide gels. For the detection of mismatches, the single-stranded products of the RNase A treatment, electrophoretically separated according to size, are compared to similarly treated control duplexes. Samples containing smaller fragments (cleavage products) not seen in the control duplex are scored as positive.
Currently available RNase mismatch cleavage assays, including those performed according to U.S. Patent No. 4,946,773, require the use of radiolabeled RNA probes. Myers and Maniatis in U.S. Patent No. 4,946,773 describe the detection of base pair mismatches using RNase A. Other investigators have described the use of an E. coli enzyme, RNase I, in mismatch assays. Because it has broader cleavage specificity than RNase A, RNase I would be a desirable enzyme to employ in the detection of base pair mismatches if components can be found to decrease the extent of non-specific cleavage and increase the frequency of cleavage of mismatches. The use of RNase I for mismatch detection is described in literature from Promega Biotech. Promega markets a kit containing RNase I that is shown in their literature to cleave three out of four known mismatches, provided the enzyme level is sufficiently high.
The RNase protection assay was first used to detect and map the ends of specific mRNA targets in solution. The assay relies on being able to easily generate high specific activity radiolabeled RNA probes complementary to the mRNA of interest by in vitro transcription. Originally, the templates for in vitro transcription were recombinant plasmids containing bacteriophage promoters. The probes are mixed with total cellular RNA samples to permit hybridization to their complementary targets, then the mixture is treated with RNase to degrade excess unhybridized probe. Also, as originally intended, the RNase used is specific for single-stranded RNA, so that hybridized double-stranded probe is protected from degradation. After inactivation and removal of the RNase, the protected probe (which is proportional in amount to the amount of target mRNA that was present) is recovered and analyzed on a polyacrylamide gel.
The RNase Protection assay was adapted for detection of single base mutations. In this type of RNase A mismatch cleavage assay, radiolabeled RNA probes transcribed in vitro from wild-type sequences, are hybridized to complementary target regions derived from test samples. The test target generally comprises DNA (either genomic DNA or DNA amplified by cloning in plasmids or by PCR™), although RNA targets (endogenous mRNA) have occasionally been used. If single nucleotide (or greater) sequence differences occur between the hybridized probe and target, the resulting disruption in Watson-Crick hydrogen bonding at that position ("mismatch") can be recognized and cleaved in some cases by single-strand specific ribonuclease. To date, RNase A has been used almost exclusively for cleavage of single-base mismatches, although RNase I has recently been shown as useful also for mismatch cleavage. There are recent descriptions of using the MutS protein and other DNA-repair enzymes for detection of single-base mismatches. Additional methods for detection of nucleic acids, and mutations are described herein.
Nucleic Acids As described herein, an aspect of the present disclosure is 29 previously known genes whose allelic polymoφhisms are markers of polygenic traits, including markers for such polygenic traits as ADHD, oppositional defiant disorder, conduct disorder, learning disorders, alcohol, cholesterol, and LDL.
In one embodiment, the nucleic acid sequences disclosed herein will find utility as hybridization probes or amplification primers. These nucleic acids may be used, for example, in diagnostic evaluation of tissue samples or employed to clone full length cDNAs or genomic clones corresponding thereto. In certain embodiments, these probes and primers consist of oligonucleotide fragments. Such fragments should be of sufficient length to provide specific hybridization to a RNA or DNA tissue sample. The sequences typically will be 10-20 nucleotides, but may be longer. Longer sequences, e.g., 40, 50, 100, 500 and even up to full length, are preferred for certain embodiments.
Nucleic acid molecules having contiguous stretches of about 10, 15, 17, 20, 30, 40, 50, 60, 75 or 100 or 500 nucleotides from a sequence selected from any gene that may be used in the diagnostic or treatment methods disclosed herein are contemplated. Molecules that are complementary to the above mentioned sequences and that bind to these sequences under high stringency conditions also are contemplated. These probes will be useful in a variety of hybridization embodiments, such as Southern and Northern blotting. In some cases, it is contemplated that probes may be used that hybridize to multiple target sequences without compromising their ability to effectively diagnose a polygenic trait.
Various probes and primers can be designed around the disclosed nucleotide sequences, or the sequences surrounding a polymoφhism useful as a marker, be it a gene disclosed herein or a gene latter added the set of 29 genes described herein. It is contemplated that other genes may be used to create new sets for examination of different polygenic traits, and the use of any other genes, or preferably gene polymoφhisms, in the MAA technique is encompassed as part of the invention. Primers may be of any length but, typically, are 10-20 bases in length. By assigning numeric values to a sequence, for example, the first residue is 1 , the second residue is 2, etc., an algorithm defining all primers can be proposed:
n to n + y
where n is an integer from 1 to the last number of the sequence and y is the length of the primer minus one (9 to 19), where n + y does not exceed the last number ofthe sequence. Thus, for a 10-mer, the probes correspond to bases 1 to 10, 2 to 11, 3 to 12 ... and so on. For a 15-mer, the probes correspond to bases 1 to 15, 2 to 16, 3 to 17 ... and so on. For a 20-mer, the probes correspond to bases 1 to 20, 2 to 21, 3 to 22 ... and so on.
In certain embodiments, it is contemplated that multiple probes may be used for hybridization to a single sample. The use of a hybridization probe of between 14 and 100 nucleotides in length allows the formation of a duplex molecule that is both stable and selective. Molecules having complementary sequences over stretches greater than 20 bases in length are generally preferred, in order to increase stability and selectivity ofthe hybrid, and thereby improve the quality and degree of particular hybrid molecules obtained. One will generally prefer to design nucleic acid molecules having stretches of 20 to 30 nucleotides, or even longer where desired. Such fragments may be readily prepared by, for example, directly synthesizing the fragment by chemical means or by introducing selected sequences into recombinant vectors for recombinant production. Accordingly, the nucleotide sequences of the invention may be used for their ability to selectively form duplex molecules with complementary stretches of genes or RNAs or to provide primers for amplification of DNA or RNA from tissues. Depending on the application envisioned, one will desire to employ varying conditions of hybridization to achieve varying degrees of selectivity of probe towards target sequence.
For applications requiring high selectivity, one will typically desire to employ relatively stringent conditions to form the hybrids, e.g., one will select relatively low salt and/or high temperature conditions, such as provided by about 0.02 M to about 0.10 M NaCl at temperatures of about 50°C to about 70°C. Such high stringency conditions tolerate little, if any, mismatch between the probe and the template or target strand, and would be particularly suitable for isolating specific genes or detecting specific mRNA transcripts. It is generally appreciated that conditions can be rendered more stringent by the addition of increasing amounts of formamide.
For certain applications, for example, substitution of amino acids by site- directed mutagenesis, it is appreciated that lower stringency conditions are required. Under these conditions, hybridization may occur even though the sequences of probe and target strand are not perfectly complementary, but are mismatched at one or more positions. Conditions may be rendered less stringent by increasing salt concentration and decreasing temperature. For example, a medium stringency condition could be provided by about 0.1 to 0.25 M NaCl at temperatures of about 37°C to about 55°C, while a low stringency condition could be provided by about 0.15 M to about 0.9 M salt, at temperatures ranging from about 20°C to about 55°C. Thus, hybridization conditions can be readily manipulated, and thus will generally be a method of choice depending on the desired results.
In other embodiments, hybridization may be achieved under conditions of, for example, 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2, 10 mM dithiothreitol, at temperatures between approximately 20°C to about 37°C. Other hybridization conditions utilized could include approximately 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 μM MgCl2, at temperatures ranging from approximately 40°C to about 72°C.
In certain embodiments, it will be advantageous to employ nucleic acid sequences of the present invention in combination with an appropriate means, such as a label, for determining hybridization. N wide variety of appropriate indicator means are known in the art, including fluorescent, radioactive, enzymatic or other ligands, such as avidin/biotin, which are capable of being detected. In preferred embodiments, one may desire to employ a fluorescent label or an enzyme tag such as urease, alkaline phosphatase or peroxidase, instead of radioactive or other environmentally undesirable reagents. In the case of enzyme tags, colorimetric indicator substrates are known which can be employed to provide a detection means visible to the human eye or spectrophotometrically, to identify specific hybridization with complementary nucleic acid-containing samples.
In general, it is envisioned that the hybridization probes described herein will be useful both as reagents in solution hybridization, as in PCR™, for detection of expression of corresponding genes, as well as in embodiments employing a solid phase. In embodiments involving a solid phase, the test DΝA (or RΝA) is adsorbed or otherwise affixed to a selected matrix or surface. This fixed, single-stranded nucleic acid is then subjected to hybridization with selected probes under desired conditions. The selected conditions will depend on the particular circumstances based on the particular criteria required (depending, for example, on the G+C content, type of target nucleic acid, source of nucleic acid, size of hybridization probe, etc.). Following washing of the hybridized surface to remove non-specifically bound probe molecules, hybridization is detected, or even quantified, by means ofthe label.
Amplification and PCR™. Nucleic acid used as a template for amplification is isolated from cells contained in the biological sample, according to standard methodologies (Sambrook et al, 1989). The nucleic acid may be genomic DNA or fractionated or whole cell RNA. Where RNA is used, it may be desired to convert the RNA to a complementary DNA. In one embodiment, the RNA is whole cell RNA and is used directly as the template for amplification. Pairs of primers that selectively hybridize to nucleic acids corresponding to genes of a polygenic trait are contacted with the isolated nucleic acid under conditions that permit selective hybridization. The term "primer", as defined herein, is meant to encompass any nucleic acid that is capable of priming the synthesis of a nascent nucleic acid in a template-dependent process. Typically, primers are oligonucleotides from ten to twenty or thirty base pairs in length, but longer sequences can be employed. Primers may be provided in double-stranded or single-stranded form, although the single-stranded form is preferred.
Once hybridized, the nucleic acid:primer complex is contacted with one or more enzymes that facilitate template-dependent nucleic acid synthesis. Multiple rounds of amplification, also referred to as "cycles," are conducted until a sufficient amount of amplification product is produced.
Next, the amplification product is detected. In certain applications, the detection may be performed by visual means. Alternatively, the detection may involve indirect identification of the product via chemiluminescence, radioactive scintigraphy of incoφorated radiolabel or fluorescent label or even via a system using electrical or thermal impulse signals (Affymax technology).
A number of template dependent processes are available to amplify the marker sequences present in a given template sample. One of the best known amplification methods is the polymerase chain reaction (referred to as PCR™) which is described in detail in U.S. Patent Nos. 4,683,195, 4,683,202 and 4.800,159, each incoφorated herein by reference in entirety.
Briefly, in PCR™, two primer sequences are prepared that are complementary to regions on opposite complementary strands of the marker sequence. An excess of deoxynucleoside triphosphates are added to a reaction mixture along with a DNA polymerase, e.g., Taq polymerase. If the marker sequence is present in a sample, the primers will bind to the marker and the polymerase will cause the primers to be extended along the marker sequence by adding on nucleotides. By raising and lowering the temperature of the reaction mixture, the extended primers will dissociate from the marker to form reaction products, excess primers will bind to the marker and to the reaction products and the process is repeated.
A reverse transcriptase PCR™ amplification procedure may be performed in order to quantify the amount of mRNA amplified. Methods of reverse transcribing RNA into cDN A are well known and described in Sambrook et al, 1989. Alternative methods for reverse transcription utilize thermostable, RNA-dependent DNA polymerases. These methods are described in WO 90/07641, filed December 21, 1990, incoφorated herein by reference. Polymerase chain reaction methodologies are well known in the art.
Another method for amplification is the ligase chain reaction ("LCR"), disclosed in EPA No. 320 308, incoφorated herein by reference in its entirety. In LCR, two complementary probe pairs are prepared, and in the presence of the target sequence, each pair will bind to opposite complementary strands of the target such that they abut. In the presence of a ligase, the two probe pairs will link to form a single unit. By temperature cycling, as in PCR™, bound ligated units dissociate from the target and then serve as "target sequences" for ligation of excess probe pairs. U.S. Patent 4,883,750 describes a method similar to LCR for binding probe pairs to a target sequence.
Qbeta Replicase, described in PCT Application No. PCT/US87/00880, incoφorated herein by reference, may also be used as still another amplification method in the present invention. In this method, a replicative sequence of RNA that has a region complementary to that of a target is added to a sample in the presence of an RNA polymerase. The polymerase will copy the replicative sequence that can then be detected.
An isothermal amplification method, in which restriction endonucleases and ligases are used to achieve the amplification of target molecules that contain nucleotide 5'-[alpha-thio]-triphosphates in one strand of a restriction site may also be useful in the amplification of nucleic acids in the present invention. Strand Displacement Amplification (SDA) is another method of carrying out isothermal amplification of nucleic acids which involves multiple rounds of strand displacement and synthesis, i.e. nick translation. A similar method, called Repair Chain Reaction (RCR), involves annealing several probes throughout a region targeted for amplification, followed by a repair reaction in which only two of the four bases are present. The other two bases can be added as biotinylated derivatives for easy detection. A similar approach is used in SDA. Target specific sequences can also be detected using a cyclic probe reaction (CPR). In CPR, a probe having 3' and 5' sequences of non-specific DNA and a middle sequence of specific RNA is hybridized to DNA that is present in a sample. Upon hybridization, the reaction is treated with RNase H, and the products of the probe identified as distinctive products that are released after digestion. The original template is annealed to another cycling probe and the reaction is repeated.
Still another amplification methods described in GB Application No. 2 202 328, and in PCT Application No. PCT/US89/01025, each of which is incoφorated herein by reference in its entirety, may be used in accordance with the present invention. In the former application, "modified" primers are used in a PCR™-like, template- and enzyme-dependent synthesis. The primers may be modified by labeling with a capture moiety (e.g., biotin) and/or a detector moiety (e.g., enzyme). In the latter application, an excess of labeled probes are added to a sample. In the presence of the target sequence, the probe binds and is cleaved catalytically. After cleavage, the target sequence is released intact to be bound by excess probe. Cleavage of the labeled probe signals the presence ofthe target sequence.
Other nucleic acid amplification procedures include transcription-based amplification systems (TAS), including nucleic acid sequence based amplification (NASBA) and 3SR (Gingeras et al, PCT Application WO 88/10315, incoφorated herein by reference). In NASBA, the nucleic acids can be prepared for amplification by standard phenol/chloroform extraction, heat denaturation of a clinical sample, treatment with lysis buffer and minispin columns for isolation of DNA and RNA or guanidinium chloride extraction of RNA. These amplification techniques involve annealing a primer which has target specific sequences. Following polymerization, DNA/RNA hybrids are digested with RNase H while double stranded DNA molecules are heat denatured again. In either case the single stranded DNA is made fully double stranded by addition of second target specific primer, followed by polymerization. The double-stranded DNA molecules are then multiply transcribed by an RNA polymerase such as T7 or SP6. In an isothermal cyclic reaction, the RNA's are reverse transcribed into single stranded DNA, which is then converted to double stranded DNA, and then transcribed once again with an RNA polymerase such as T7 or SP6. The resulting products, whether truncated or complete, indicate target specific sequences.
Davey et al, EPA No. 329 822 (incoφorated herein by reference in its entirety) disclose a nucleic acid amplification process involving cyclically synthesizing single-stranded RNA ("ssRNA"), ssDNA, and double-stranded DNA (dsDNA), which may be used in accordance with the present invention. The ssRNA is a template for a first primer oligonucleotide, which is elongated by reverse transcriptase (RNA-dependent DNA polymerase). The RNA is then removed from the resulting DNA:RNA duplex by the action of ribonuclease H (RNase H, an RNase specific for RNA in duplex with either DNA or RNA). The resultant ssDNA is a template for a second primer, which also includes the sequences of an RNA polymerase promoter (exemplified by T7 RNA polymerase) 5' to its homology to the template. This primer is then extended by DNA polymerase (exemplified by the large "Klenow" fragment of E. coli DNA polymerase I), resulting in a double-stranded DNA ("dsDNA") molecule, having a sequence identical to that of the original RNA between the primers and having additionally, at one end, a promoter sequence. This promoter sequence can be used by the appropriate RNA polymerase to make many RNA copies of the DNA. These copies can then re-enter the cycle leading to very swift amplification. With proper choice of enzymes, this amplification can be done isothermally without addition of enzymes at each cycle. Because of the cyclical nature of this process, the starting sequence can be chosen to be in the form of either DNA or RNA.
Miller et al, PCT Application WO 89/06700 (incoφorated herein by reference in its entirety) disclose a nucleic acid sequence amplification scheme based on the hybridization of a promoter/primer sequence to a target single-stranded DNA ("ssDNA") followed by transcription of many RNA copies of the sequence. This scheme is not cyclic, i.e. new templates are not produced from the resultant RNA transcripts. Other amplification methods include "RACE" and "one-sided PCR™" (Frohman, 1990, incoφorated herein by reference).
Methods based on ligation of two (or more) oligonucleotides in the presence of nucleic acid having the sequence of the resulting "di-oligonucleotide", thereby amplifying the di-oligonucleotide, may also be used in the amplification step of the present invention.
Following any amplification, it may be desirable to separate the amplification product from the template and the excess primer for the puφose of determining whether specific amplification has occurred. In one embodiment, amplification products are separated by agarose, agarose-acrylamide or polyacrylamide gel electrophoresis using standard methods (Sambrook et al, 1989).
Alternatively, chromatographic techniques may be employed to effect separation. There are many kinds of chromatography which may be used in the present invention: adsoφtion, partition, ion-exchange and molecular sieve, and many specialized techniques for using them including column, paper, thin-layer and gas chromatography.
Amplification products must be visualized in order to confirm amplification of the marker sequences. One typical visualization method involves staining of a gel with ethidium bromide and visualization under UV light. Alternatively, if the amplification products are integrally labeled with radio- or fluorometrically-labeled nucleotides, the amplification products can then be exposed to x-ray film or visualized under the appropriate stimulating spectra, following separation.
In one embodiment, visualization is achieved indirectly. Following separation of amplification products, a labeled, nucleic acid probe is brought into contact with the amplified marker sequence. The probe preferably is conjugated to a chromophore but may be radiolabeled. In another embodiment, the probe is conjugated to a binding partner, such as an antibody or biotin, and the other member of the binding pair carries a detectable moiety.
In one embodiment, detection is by Southern blotting and hybridization with a labeled probe. The techniques involved in Southern blotting are well known to those of skill in the art and can be found in many standard books on molecular protocols. See Sambrook et al, 1989. Briefly, amplification products are separated by gel electrophoresis. The gel is then contacted with a membrane, such as nitrocellulose, permitting transfer of the nucleic acid and non-covalent binding. Subsequently, the membrane is incubated with a chromophore-conjugated probe that is capable of hybridizing with a target amplification product. Detection is by exposure of the membrane to x-ray film or ion-emitting detection devices.
One example of the foregoing is described in U.S. Patent No. 5,279,721 , incoφorated by reference herein, which discloses an apparatus and method for the automated electrophoresis and transfer of nucleic acids. The apparatus permits electrophoresis and blotting without external manipulation of the gel and is ideally suited to carrying out methods according to the present invention.
All the essential materials and reagents required for detecting gene markers of one or more polygenic traits in a biological sample may be assembled together in a kit. This generally will comprise preselected primers for specific markers. Also included may be enzymes suitable for amplifying nucleic acids including various polymerases (RT, Taq, etc.), deoxynucleotides and buffers to provide the necessary reaction mixture for amplification.
Such kits generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker primer pair. Preferred pairs of primers for amplifying nucleic acids are selected to amplify the sequences specified in SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l l, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28. SEQ ID NO:29. SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34.
In another embodiment, such kits will comprise hybridization probes specific for genes involved in polygenic traits corresponding to the sequences specified in SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:l 1, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO:19, SEQ ID NO:20. SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25. SEQ ID NO:26, SEQ ID NO:27, SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30. SEQ ID NO:31, SEQ ID NO:32, SEQ ID NO:33 and SEQ ID NO:34. The inventors contemplate that any primers known to be effective to hybridize to an polymoφhic allele that is suspected of being diagnostic in the methods disclosed herein, particularly the MAN technique, may be used in such a kit. Such kits generally will comprise, in suitable means, distinct containers for each individual reagent and enzyme as well as for each marker hybridization probe.
DΝA segments encoding a specific gene may be introduced into recombinant host cells and employed for expressing a specific structural or regulatory protein. Alternatively, through the application of genetic engineering techniques, subportions or derivatives of selected genes may be employed. Upstream regions containing regulatory regions such as promoter regions may be isolated and subsequently employed for expression ofthe selected gene.
It will be understood that this invention is not limited to the particular probes disclosed herein and particularly is intended to encompass at least nucleic acid sequences that are hybridizable to the disclosed sequences or are functional sequence analogs of these sequences. For example, a partial sequence may be used to identify a structurally-related gene or the full length genomic or cDΝA clone from which it is derived. Those of skill in the art are well aware of the methods for generating cDΝA and genomic libraries which can be used as a target for the above-described probes (Sambrook et al, 1989). For applications in which the nucleic acid segments of the present invention are incoφorated into vectors, such as plasmids, cosmids or viruses, these segments may be combined with other DNA sequences, such as promoters, polyadenylation signals, restriction enzyme sites, multiple cloning sites, other coding segments, and the like, such that their overall length may vary considerably. It is contemplated that a nucleic acid fragment of almost any length may be employed, with the total length preferably being limited by the ease of preparation and use in the intended recombinant DNA protocol.
Novel Methodology to Detect multiple Genes in one DNA Sample It is expected that since a number of genes and their polymoφhic loci would be required to diagnose RDS and related behaviors, the inventors propose a Multiple-Gene Screen (GENESCREEN™). This could utilize novel DNA technology, such as the Gene Chip developed by Affymetrix. In summary, a glass chip is coated with light sensitive chemical compounds. These chemicals contain light-sensitive protecting groups that prevent the binding of DNA bases to the chip and to each other. When light is shone on the chemicals, however, the protecting groups are inactivated and a chemical coupling reaction can occur. Through the use of "masks" that allow light to shine on certain regions of the Chip, but not others, DNA bases can be bound to selected areas of the Chip. Each new base that is added has a protecting group attached so that the process can be repeated to couple one base to another. In this way, a large number of DNA probes of different sequences can be synthesized simultaneously on a single 1 /2-inch chip.
It takes only 80 chemical steps to construct any set of up to 400,000 probes that are up to 20 DNA bases long. It is not possible to build as many probes with as many different DNA sequences in a reasonable timeframe utilizing conventional DNA synthesis machines. These machines build probes in series rather than in the massively parallel manner employed by Affymetrix. In this rapid DNA analysis, sample DNA is first labeled with a fluorescent tag and then added to the probe array on the Chip. If the sample finds a complementary probe on the Chip, it will bind; if it does not find a complementary strand, it will wash off the Chip (segments of DNA that have complementary bases are said themselves to be complementary: the fragments ATTTGCGC (SEQ ID NO:l) will bind, for example to a complementary fragment with the sequence TNAACGCG (SEQ ID ΝO:2). The sequence and location of each probe is known, so the scanner can determine to which probe the sample has bound. Because the sequence of the probe on the Chip is known, the sequence of the sample DNA is also known, since its sequence will be complementary. The use of gene chips does not require the copying of messenger RNA into cDNAs and can quantitatively detect 1 messenger rNAs and cDNAs.
However, for the analysis proposed in this present invention other methods which depend on DNA machines might be quite adequate for commercialization. For example, Genotying by mass spectrometry is contemplated. As an alternative to using DNA chip technology to genotype many genes at a time, Sequenom (San Diego, CA) has adopted matrix-assisted laser desoφtion/ionization-time-of-flight mass spectrometry (MALDI-TOF) for mass genotyping of single-base pair and short tandem repeat polymoφhisms (Little et al, 1997; Braun, Little, Kδster, 1997; Braun et al, 1997). This is accomplished by the following steps. First, PCR™ amplification of the region of the polymoφhism with biotin attached to one of the primers is conducted (Jurinke et al, 1997). Second, immobilization of the amplified DNA to strepavidin beads occurs (Jurinke et al, 1997) Third, hybridization of a primer adjacent to the polymoφhism site is done (Braun, Little, Kδster, 1997). Fourth, extension with DNA polymerase past the polymoφhic site in the presence of dNTPs and ddNTPs which are not present in the deoxyform form is done. When suitably designed according to the sequence, this results in the addition of only a few additional bases (Braun, Little, Kδster, 1997). Fifth, the DNA is then processed to remove unused nucleotides and salts. Sixth, the short primer + polymoφhic site is removed by denaturation and transferred to silicon wafers using a piezoelectric pipette (O'Donnell et al, 1997). Seventh, the mass of the primer + polymoφhic site is then determined by delayed extraction MALDI-TOF mass spectrometry (Li et al, 1996; Tang et al, 1995). Single base pair and tandem repeat variations in sequence are easily determined by their mass. This final step is very rapid, requiring only 5 sec per assay. All of these steps are robotically automated. This technology has the potential of performing up to 20,000 genotypings per day. This technology is rapid, extremely accurate, and adaptable to any polymoφhism. It has a significant advantage over chip technology in that it is much more accurate, can identify both single base pair and short tandem repeat polymoφhisms, and adding or removing polymoφhisms to be tested can be done in a few sec at trivial cost.
Polygene Kit(s)-GeneScreen Testing Kits In terms of the various genes proposed in this application the following Table 2 details the potential gene-disorder kit based on the GENECHIP™ concept.
TABLE 2
Disorder Genes
Alcoholism DI, D2, D4, DATl, TD02, nNOSla
Drug abuse (including IV drug use DI, D2, D4, CNRl, GABAB3, TD02, HT-2R,
MAO A(X), COMT, nNOSla, DOMC, Preenkephalin
Stimulant- Withdrawal Depression D2
Substance Use Disorder (SUD) DI, CNRl
SUD sub-class: Alcoholism D2, GABAB3 n -p=> SUD sub-class: Polysubstance Abuse D4, HT-2R
SUD sub-class: IV Drug Abuse DATl, MAOA (X)
SUD sub-class: Stimulant Withdrawal COMT, nNosla
SUD sub-class: Stimulant Withdrawal: Depression TD02
Severity
SUD sub-class: Alcohol withdrawal DAT 1(9/9 allele)
Compulsivity DI, TD02
Compulsivity subclass: Pathological Gambling DI, D2, TD02 Compulsivity subclass: Sexual Compulsions
Disorder Genes
Obesity D2, OB, DATl, APOD , UCP2, CHROME-2
Obesity subclass: APOD, CHROME-2
Female Body Fat (>34%)
Obesity subclass: DATl, OB
Male Body Fat (>28%)
Obesity subclass:
BMI >25
Obesity subclass:
Carbohydrate Bingeing Attention Deficits 5HT- Transporter
Attention Deficits subclass: Autism DI, DATl
Attention Deficits subclass: Tourette's DI, D2, TD02, DβH, MAOA(X), HTRIA
Attention Deficits subclass: ADHD HTRIA, D2, DATl, DβH, TD02
Attention Deficits subclass: ADD MAOA (X)
Disorder Genes
Smoking Behavior DI, D2
Smoking Behavior subclass: Number of Packs Per
Day
Smoking Behavior subclass: Onset
Smoking Behavior subclass: Years Smoked
Smoking Behavior subclass: Relapse Personality Disorders DATl, D2
Personality Disorders subclass: Pathological D2, DATl, D4, CNRl
Violence
Personality Disorders subclass: Schizoid D2, DATl
Avoidant D2, DATl
Personality Disorders subclass: P300 D2, CNRl
Personality Disorders subclass: AER/VER D2
Personality Disorders subclass: Posttraumatic Stress D2
Personality Disorders subclass: Low Novelty Seeking D2
Personality Disorders subclass: High Novelty D4
Seeking
Personality Disorders subclass: Defense Style D2
NOT FURNISHED AT TIME OF PUBLICATION
It is the inventors proposal that in order to safely identify a high risk population for RDS behaviors all these genes must be tested. As other genes are found it is expected that they will also be tested. The initial plans for testing involves PCR™ techniques since only a few genes will constitute the testing panel. As these other genes are found it is expected that they too will be added to the GENECHIP™ (Affirmatrix, Santa Clara, CA).
STEP 5. The fifth step would be to assign a score to the genotypes based on independent studies showing which genotypes are associated with the highest quantitative scores and which are associated with the lowest scores. The scoring of the genes is based on the use of ANOVA to examine the magnitude of the mean Kellgren score for each genotype of each polymoφhism. These studies are performed in a set of subjects independent of those used for the MAA. For example, for the Taql A1/A2 polymoφhism of the dopamine D2 receptor gene, DRD2, all studies have shown that the 1 allele is associated with a range of impulsive, compulsive, additive behaviors, and some studies show that the heterozygous genotype, 12, was associated with the highest scores and the 1 1 and 22 genotypes with the lowest scores. Thus the DRD2 gene, using the Tαql A1/A2 polymoφhism was scored as those with genotype 22 or 1 1 = 0, and those with genotype 12 = 2. If independent studies showed that the 22 genotype was associated with the lowest score on the quantitative trait, 12 with an intermediate score on the quantitative trait, and 11 with the highest scores, the scoring would be 22 = 0, 12 = 1 and 1 1 = 2.
When dinucleotide or trinucleotide polymorhisms were used, even if there are many alleles, it is possible to divide the alleles into the shorter versus the longer alleles. If the longer alleles are associated with the greatest phenotypic effect, the scoring will be SS = 0, SL = 1 and LL = 2, where S is shorter alleles and L is longer alleles.
STEP 6. Set up a dummy polygenic or PG variable, by progressively adding the scores of each gene. For example, if for case 1 , the score for the first gene examined was 2, and for the second gene the score was 1, the PG score variable would be 3. The correlation coefficient, r, for 1 thru n cases against the quantitative trait variable score would be determined by regression analysis, preferably using any off- the-self statistical program. The percent of the variance is r . Then, for cases 1 thru n, the gene score for the 3rd gene is added and the process repeated. The final results are plotted.
STEP 7. Perform univariate regression analysis of PG versus QT or DV. The following is an example generalized to any quantitative trait or dichotomous variable. Before the analysis is begun, the dummy variable for the gene scores (PG) is set to = 0. Then each additional gene score is added, a regression analysis performed, the second gene score is added, the regression analysis is repeated. This is continued until all of the tested genes have been added. For example, the PG is initially set to 0. If the gene 1 score equals 2, the PG value is adjusted by 2, or PG = PG + 2. Regression of PG against QT or DV is then performed. If the gene 2 score equals 1, then the PG value is adjusted by 1, or PG = PG + 1. Alternatively, if the gene 2 score was equal to 2, then the PG value would instead have been adjusted by to, or PG = PG + 2. After the gene 2 score is added, then regression analysis of PG against PG against QT or DV is again performed.
One preferred method of analyzing the data would be to enter all the data into a statistical package such as SPSS. Using the values for the DRD2 gene as described under Step 5 above, the syntax file for the SPSS program would be opened and the following sample algorithm set up.
compute PG = 0. if (DRDl eq 2) PG = PG + 2. if (DRD2 eq 2) PG = PG + 2. if (DRD3 eq 2) PG = PG + 2. if (DRD4 eq 2) PG = PG + 2. if (DRD5 eq l) PG = PG + l . if (DRD5 eq 2) PG = PG + 2. if (DATl eq l) PG = PG + l . if(DATl eq 2) PG = PG + 2. regression variable = ADHD PG /dependent=ADHD /method=ENTER PG.
The PG variable is set to 0. Since the DRD7, DRD2, DRD3 and DRD4 genes were scored as 0 or 2 they required only a single line increasing PG by 2 if the subject carried the DRDl Ddel 1 1 genotype, and/or the DRD2 Taql 12 genotype and/or the DRD3 Mscl 1 1 or 22 genotype, and/or DRD4 46,47, or 77 genotype. By contrast the DRD5 and DATl genes were scored as 1 or 2, requiring two lines of code. Regression analysis is performed against the PG score against the QTV (ADHD score), as each gene is added.
STEP 8. Plot the results. The results are plotted with the progressively added genes on the X axis and the r2 on the Y axis, as shown in the line in FIG. 5 showing the additive and subtractive genes for ADHD.
STEP 9. Repeat the procedure using only the additive genes. This is shown in the line in FIG. 6 showing the additive genes.
TREATMENT OF RDS RELATED BEHAVIORS
Certain anti-craving substances which reduce the desire for euphoriants by virtue of enhancing the effectiveness of endogenous and or exogenous neuropeptides and neurotransmitters such as dopamine release in the nucleus accumbens, significantly reduces aberrant craving behavior, termed "RDS" behavior, for euphoriant substances to include but not limited to alcohol, cocaine, opiates, nicotine, glucose or other sugars, as well as certain acts such as sexual, gambling, aggression and violence. RDS behaviors have a common genetic basis, and based on adequate supplies of neurotransmitters in the meso-limbic system. The final pathway of reward involves dopaminergic activation at receptor sites (DI, D2, D3, D4, D5 and subtypes) and the density of these receptors are determined by their respective genes as well as genes responsible for dopamine, synthesis, storage, release and metabolism.
This invention proposes to couple the use of enhancement of synaptic dopamine release via enkephalinase inhibition and an enkephalin releaser such as kyotoφhin (Tyr-Arg) or its stable analog, TyrD-Arg, to promote a chronic occupancy of D2 receptors with potential for D2 receptor proliferation or up-regulation (Fitz et al, 1994).
This invention involves, in part, the idea of polygenic inheritance and therefore promotes the concept of multiple gene loci as determinants for identifying high risk candidates for RDS. Work involving quantitative trait loci studies in genetically distinguishable mouse strains provided negative evidence for the one single gene mechanism theory. Fifteen strains of mice were tested on their reaction to alcohol, moφhine and methamphetamine. These strains were found to react differentially to these three substances, which suggests that different genes determine the susceptibility to different addictive substances. The pattern of findings further suggests that genetically influenced sensitivity to alcohol is not a monolithic phenomenon. Rather, it is specific to the particular response variable studied (Crabbe et al, 1994).
Therefore an aspect of this invention is the genotyping certain of the above specified genes, and other genes suspected of contributing to RDS behaviors or other polygenic traits, to obtain haplotype profiles would be an important aspect of targeted treatment of RDS, related behaviors, or other polygenic traits. When a specific genetic variant has been identified to associate with a behavioral disorder, the inventors can utilize this knowledge to assist the clinician in pharmacogenetically targeting treatment. The invention couples the use of genotyping and precursor amino-acid loading, enkephalinase inhibition, enkephalin-induced release, narcotic antagonism, and chromium piccolinate or niccotinate for the preferential enhancement of dopamine in the nucleus accumbens as anti-craving compositions.
In the present invention, the inventors propose that an alteration in any of the genes that are involved in the expression of molecules in the reward cascade (which might be as many as 100 or more) might predispose an individual to RDS and related behaviors, even including ADHD and violence. While the above may be true, it is very difficult at this time to predict which particular genes are involved, that is, until the disclosure of the present invention as it relates to the MAA technique. However evidence for a role of at least the D2 dopamine receptor gene is profound and the inventors believe that the D2 dopamine receptor gene represents a major "reward gene" important in RDS and related behaviors. The preferred embodiment of this invention is to couple the TaqAl DRD2 alleles (Al , BI , Cl, haplotype polymoφhism between exon 6-7) and targeted treatment outcomes (i.e. attention processing, prevention of regained weight, smoking cessation, reduction of carbohydrate bingeing, reduction of AMA rate, elapse prevention in polysubstance dependence, and reduction in violent behavior, among others). The inventors will also provide examples of a number of likely genotypes based on specific genes as listed above which should respond best to certain drug classes.
In neurotransmitter reward-cascade model, the hypothalamic serotonergic neurons innervate and activate met-enkephalinergic neurons that, in turn, inhibit γ-aminobutyric acid (GABA) neurons, which then activate DA neurons of the ventral tegmentum. These DA neurons then project to the Acb and to Cluster Al (CA1) cluster cells in the hippocampus, where the neurotransmitter DA acts as the primary reward substrates (Stein and Beluzzi, 1978).
The nucleus accumbens and enkephalins in this complex circuit is important (Heidreder et al, 1988). DA release in the striatum was induced after local application of enkephalinase inhibitor, which suggests regulation by delta receptor stimulation (Chesselet et al, 1981 ). Indeed, Kelatoφhan may also protect against possible cholecysterkinine-8 (CCK-8) degradation by brain peptidases. This important satiety neuropeptide is colocalized with DA in the nucleus accumbens, and there is a close interaction between CCK-8, DA, and endogenous opioid peptides (Koob, 1992).
The neurotransmitters serotonin (5-HT), DA, norepinephrine (NE), and enkephalins have been shown to reduce intake of sweet foods. Thus compositions of the present invention are especially designed to enhance these food inhibitory neurotransmitters through precursor amino acid loading, including 1-tryptophan (5-HT precursor), l-phenylalanine (DA and NE precursor), as well the enkephalinase inhibitor d-phenylalanine (Blum et al, 1986). The inventors are currently performing research on Lewis rats to establish the effect of these agent categories. Lewis rats seem to have proclivity for polysubstance abuse, and serve as an important animal model for RDS behavior. In this regard, various dose regimens and combinations of the three agents (D-phenylalanine [DP A], naltrexone [NTX], Ty-D-Arg [TA]) are being employed against self-selection of either alcohol, cocaine, nicotine, cannabis or sugar. The combination of the three agents together will be most efficacious when compared to either combination of the other two agents. (See Table 3).
TABLE 3
Potency of anti-RDS agents in combination and singularly from highest to lowest
DPA + NTX + TA+Chromium salts
DPA + NTX+Chromium salts
DPA + TA+Chromium salts
NTX + TA+Chromium salts
DPA+Chromium salts
NTX+Chromium salts
TA+Chromium salts
Chromium salts
DPA = D-phenylalanine; NTX = naltrexone; TA = Ty-D-Arg
Compositions for Treating RDS. Although a variety of disorders are categorized as belonging to RDS and affect the dopaminergic system, one cannot treat all individuals suffering from RDS alike. Numerous other systems can be affected and require simultaneous treatment in order for an overall success to be achieved. In particular, disorders which involve drug or substance abuse must be treated individually. Thus although the overall treatment comprises giving a patient an effective dose of enkephalinase inhibitors, enkephalin releasers and amino acid precursors for the dopaminergic system, additional components are utilized to enhance the overall effect of treatment. Certain therapeutic agents are favored by the "gene-D2 receptor deficiency theory". It is well established that DRD2A1 carriers have low levels of DRD2 receptors. During stress patients need a full compliment of these receptors to cope in today's society. An important embodiment of this invention relates to the providing of certain precursor amino-acids, a trace metal such as Chromium piccolinate and/or chromium niccotinate, an enkephalinase inhibitor, a narcotic antagonist and an ekephalin releasing agent in therapeutic amounts (alone or in combination) to in fact cause a natural release of dopamine to induce D2 proliferation, especially in D2A1 carriers. This general concept has already been tested in cocaine addicts. A formulation developed by the prime inventor called TROP AMINE™ has been studied and utilized in patients. TROPAMINE™ has been compared to other medications, and shows a major benefit in terms of both detoxification and abstinence maintenance (Halikas et A, 1993). See Table 4.
TABLE 4
Rank Order of Treatment Effectiveness
Commonly Used Medications for the Treatment of Cocaine Abuse
Detoxification Abstinence Maintenance
Detoxification Number of Number of Effectiveness Maintenance Number of Number of Effectiveness
Medication Patients Physicians Medication Patients Physicians
Tropamine 190 17 4.00 Tropamine 150 17 3.50
Buspiran 11 2 4.00 Clonidine 15 2 3.00
Nortriptyliπe 100 3 4.00 Despiramine 8,824 306 2.84
Phenobarbital 2,250 10 4.00 Imipramine 2,940 129 2.64
"Benzo iezepines" 155 3 3.33 Fluoxetine 2,386 145 2.61
Clonidine 412 15 3.33 L-Tyrosine 350 9 2.60
Chlordiazepoxide 510 14 3.25 Carbamazapine 1,384 86 2.57
Diazepam 2.710 18 3.23 Bromocriptine 5,256 132 2.56
L-Tyrosine 510 9 3.13 Amantadine 6,527 119 2.39
Bromocriptine 15,51 1 262 2.95 L-Tryptophan 6,247 110 2.20
Amantadine 19,189 225 2.69 Neuroieptics 1,494 54 2.19
Desipramine 10,352 287 2.65 Naltraxone 1,255 40 2.15
Detoxification Abstinence Maintenance
Detoxification Number of Number of Effectiveness Maintenance Number of Number of Effectiveness
Medication Patients Physicians Medication Patients Physicians lmipramine 2,885 122 2.48 Phenobarbital 100 3 NR
L-Tryptophan 15,112 198 2.33 Composite of 853 47 2.64 "other drugs"
Fluoxetine 1,527 111 2.25
Bupranorphine 148 19 2.00
Naltrexone 817 31 1.68
0 Mazindol 11 2 1.00 0. Composite of "other 8,007 119 3.11 drugs"
TOTALS 79,760 468 2.43 TOTALS 37,166 381 2.57
A component of this embodiment is to first genotype the patient and then based on his/her genotype provide the appropriate cocktail. In terms of the D2 anomaly the inventors have developed an appropriate cocktail which is described herein. Table 5 summarizes the uses of compositions of the present invention as improved with specific genotypes. Tables 6-16 list the preferred components of these compositions that are useful for the treatment of various disorders. Also, see Tables 17-19 for a brief schematic of how certain elements effect reward induced by stimulants (cocaine, etc.), opiates and sedative-hypnotics.
TABLE 5 Polygenic Diagnosis and Anti-Craving Compositions: Targeted Prevention and Treatment
Selected Composition of RDS Behavior (Targeted Gene (SI)/Alleles Treatment Treated Effect of Treatment Study Type Associated for Improved Response
Alcotrol™ Substance Use Disorder Anti-craving, reduced anxiety, DBPC- DI (Increased frequency of Dde — special emphasis on reduced-relapse, reduced against Inpatient homozygosity of the Al allele) sedative-hypnotic abuse medical advice rates (AMA), D2 (Taq Al, BI , exon " haplotypes, (i.e. alcohol, opiates, improved physical and BESS Cl) barbiturates) scores
DBPC- DATl VNTR (10/10) Outpatient CNRl (homozygosity VNTR for < 5 bp repeat
MO A A (x)-VNTR < 335 bp
* nNOSla - homozygosity for < 201 BP allele.
Selected Composition of RDS Behavior (Targeted Gene (SI)7AlleIes Treatment Treated Effect of Treatment Study Type Associated for Improved Response
DBH - Taql Bl allele
Alcotrol™2 COMT - 108 Valine allele
Continued TDO2 - intron 6 (G→A) and/or
(G→T)
D4 VNTR 2 or 7 o Cocotrol™ Substance Use Disorder Same as for Alcotrol™ plus DBPC- D2 Taql Al , BI, Cl or exon ID
— special emphasis on reduction of cocaine dreams. Inpatient haplotype, DI (Increased frequency of psychostimulant abuse Dde homozygosity of the Al allele)
(cocaine, DBPC- Comt-108-Valine allele, D3 methamphetamine) Outpatient
Alcotox Sedative-hypnotic Reduce need for benzodinzipine, Inpatient OT DATl VNTR (9/9) withdrawal (including reduced withdrawal tremors, comparison to D2 r^I Al, Bl , Cl or exon 6"7 alcohol, opiates, reduced depression standard detox haplotype barbiturates) meds
Selected
Composition of RDS Behavior (Targeted Gene (SI)/AIIeles
Treatment Treated Effect of Treatment Study Type Associated for Improved Response
PHENCAL™ Obesity (carbohydrate weight loss, reduced bingeing DBPC - D2 ro?I Al, Bl, Cl or exon °" bingers, anorexia, episodes, positive body Outpatient haplotype bulemia) composition changes, prevention HTR2A - C allele homozygous of lost weight regained OB - homozygosity for < 208 BP alleles of 1875 dinucleotide repeat polymoφhism human chromosome 2 microsatellite polymoφhism, D2S1788
UCP-2 (polymoφhism to be determined)
APO-D - Taql 2.2 or 2.7 BP leptin receptor (polymorphism unknown)
Selected
Composition of RDS Behavior (Targeted Gene (SI)/Alleles
Treatment Treated Effect of Treatment Study Type Associated for Improved Response
Nicarest™ Smoking behavior Smoking cessation, ease of DBPC - DI (homozygosity of Dde Al) quitting, prevention of relapse Outpatient D2 (7α?I Al)
D4 (VNTR 2)
D5 (dinucleotide 13 alleles range 135-
159 BP) .. DATl VNTR (10/10)
A
DβH (Taql BI allele)
HyperGen™ Autism, Tourette's Enhanced performance tasks, DBPC - D 1 (homozygosity of Dde A 1 ) ADHD improved TOVA scores, Outpatient D2 (Taql Al) improved Cull/Blum ADHD D4 (VNTR 2) score, reduced hyperactivity D5 (dinucleotide 13 alleles range 135-
159 BP)
DATl VNTR (10/10)
DβH (7A?I Bl allele)
MAOA(X)
Selected
Composition of RDS Behavior (Targeted Gene (SI)/Alleles
Treatment Treated Effect of Treatment Study Type Associated for Improved Response
Gambotrol™ Pathological gambling Reduced dollars spent, reduced OT Outpatient DI (homozygosity of Dde Al) frequency of making bets, ease D2 (7Ac7l Al , Bl, Cl) of withdrawal
Tempamine Pathological violence, Reduced violent outbursts, OT Outpatient D2 (Taql Al , B 1 , C 1 , exon 6"7) Schizoid/A voidant lowered hostility levels, DATl (VNTR 10/10) (SAB), Aggression, normalized defense style, mNOSIa - homozygosity for < 201 Anger, Hostility, lowered anxiety, lowered SAB BP allele Posttraumatic Stress Disorder
Selected
Composition of RDS Behavior (Targeted Gene (SI)/Alleles
Treatment Treated Effect of Treatment Study Type Associated for Improved Response
PMX™" PMS reduced pain or cramps, reduced OT Outpatient Same as for Alcotrol™ and headaches, improved overall Cocotrol™ mood POMC/Pre- enkephalin/Dynoφhin/Oφhan
Opiate receptors delta, sigma, oφhan, mu, kappa, epsilon
Formulas are described in Tables 6 to 17
Alternate composition is restricted to the following: D-phenylanine 500 mg per capsule 6χ day; Tye-D-Arg - 1 mg per capsule 6χ day; Naltrexone 50 mg per capsule 1 to 3 per day. *GABRB3-homozygousity of dinucleotide repeat ≥l 85 bp HTRIA - TC polymoφhism HTR2A - C allele (homozygosity) ABBREVIATIONS:
ADHD = Attention Deficit Hyperactivity Disorder
DBPC = double-blind, placebo-controlled
PMS = Premenstrual Syndrome POME = Propiomelancortin OT = Open trial
X r
TABLE 6 Kantroll™
Composition Basic or core Core or "targeted" capsule capsule mg/capsule
Biotin 0.050 Core
Calcium 35.000 Core
Chromium nicolinate 0.033 Core
Chromium picolinate 0.033 Core
Copper 0.033 Core
5 -Hy droxytryptophan 2.5 Core
DL-phenylalanine 460.000 Core
Folic acid 0.030 Core
Iodine 0.025 Core
Iron 1.000 Core
L-glutamine 25.000 Core
Magnesium 2.500 Core
Methionine 50.000 Core
Niacin (non-flush) 10.000 Core
Pantothenic acid 0.330 Core
Selenium 0.012 Core
Vitamin A IU 277.710 Core
Vitamin B-2 0.800 Core
Vitamin B-l 0.375 Core
Vitamin B-6 1.000 Core
(P-5 phosphate)
Vitamin B-l 2 0.005 Core
Vitamin C 100.000 Core
Vitamin E IU 5.000 Core
Zinc 1.500 Core
L-carnitine 10.000 Obesity
Ginko B 25.000 Obesity, Focus Composition Basic or core Core or "targeted" capsule capsule mg/capsule
L-tyrosine 150.000 Gambling, , Agitation, Anxiety, Nicotine, Cocaine, Obesity
Ornithine aspartate 10.000 Obesity
Kola nut (caffeine) 20.000 Obesity
L-arginine 10.000 Obesity pyroglutamate
Camomile* 25.000 Nicotine
Taurine* 25.000 Agitation, Anxiety
Valerian* 10.000 Nicotine
Willow bark extract* 60.00 PMS symptoms
Note: For basic Reward Deficiency Syndrome behaviors which are generalized across symptoms, the inventors recommend administering the "core" Neutraceutical three times per day (before meal times). If the patient has a persistent set of addictive/impulsive/compulsive behaviors, or significantly severe addictive/impulse/compulsive behaviors, the inventors recommend administering the "Core" Neutraceutical plus the appropriate adjunctive Neutraceutical packet at the appropriate times daily.
For Obesity the patient should take the white colored capsules at the times in which he/she is directed to take the "core" neutraceutical. The patient should take the orange colored capsules before the morning meal.
For Nicotine Dependence the patient should take the blue colored capsules at bedtime.
TABLE 7 PHENCAL™
Composition per capsule (in mgs)
DL-phenylanine 500.000
L-glutamine 15.000
L-tyrosine 25.000 Composition per capsule (in mgs)
5 -Hy droxytryptophan 2.5 mg
Kola nut (caffeine) 20.000
L-carnitine 10.000
Chromium picolinate or 0.033 nicotinate
Calcium 35.000
Iron 1.000
Magnesium 2.500
Zinc 2.500
Biotin 0.050
Pantothenic acid 0.330
Iodine 0.025
Copper 0.333
Selenium 0.012
Vitamin C 13.300
Vitamin B-l 0.330
Vitamin B-2 0.500
Niacin (non-flush) 3.330
Vitamin E IU 5.000
Vitamin B-6 (P-5 phosphate) 0.330
Folic acid 0.066
Vitamin B-l 2 0.001
Ginko B 25.000
TABLE 8 Tropagen™
Composition per capsule (in mgs)
DL-phenylanine 250.000
L-glutamine 50.000
L-tyrosine 150.000
5 -Hy droxytryptophan 2.5 mg
Chromium picolinate or nicotinate 0.020
Calcium 25.000
Iron 1.500
Methionine 50.000
Magnesium 2.500
Zinc 5.000
Pantothenic acid 1.500
Vitamin C 100.000
Vitamin B-l 1.670
Vitamin B-2 2.500
Niacin (non-flush) 16.700
Vitamin B-6 (P-5 phosphate) 3.330
Folic acid 0.670
Vitamin B-l 2 0.670
TABLE 9 Alcotrol™
Composition per capsule (in mgs)
DL-phenylanine 480.000
L-glutamine 25.000
5 -Hydroxytryptophan 2.5 mg
Chromium picolinate or nicotinate 0.020
Calcium 25.000
Iron 1.500
Magnesium 2.500
Zinc 1.500
Biotin 0.050
Pantothenic acid 15.000
Vitamin A LU. 333.300
Copper 0.333
Selenium 0.012
Vitamin C 13.300
Vitamin B-l 2.417
Vitamin B-2 0.850
Niacin (non-flush) 3.300
Vitamin E LU. 5.000
Vitamin B-6 (P-5 phosphate) 3.000
Folic acid 0.670
Vitamin B-l 2 0.670
TABLE 10 Nicarest™
Composition per capsule (in mgs)
DL-phenylanine 500.000
L-glutamine 50.000
5 -Hydroxytryptophan 2.5 mg
L-tyrosine 125.000
Chromium picolinate 0.033
Calcium 50.000
Iron 1.000
Magnesium 2.500
Zinc 2.500
Biotin 0.050
Pantothenic acid 0.330
Iodine 0.025
Copper 0.333
Vitamin C 100.00
Vitamin B-l 2.417
Vitamin B-2 0.850
Niacin (non-flush) 3.330
Vitamin B-6 (P-5 phosphate) 3.000
Folic acid 0.670
Vitamin B-l 2 0.005
Chamomile 25.000*
Valerian root 10.000*
*at bedtime TABLE 11
PMX™
Composition per capsule (in mgs)
DL-phenylanine 375.000
L-glutamine 50.000
5 -Hydroxytryptophan 2.5 mg
Chromium picolinate 0.020
Calcium 50.000
Magnesium 25.000
Iron 1.500
Zinc 1.500
Biotin 0.050
Pantothenic acid 1.250
Vitamin A I.U. 277.710
Vitamin C 30.000
Vitamin B-l 0.375
Vitamin B-2 0.800
Niacin (non-flush) 10.000
Vitamin B-6 (P-5 phosphate) 1.000
Folic acid 0.030
Vitamin B-l 2 0.005
Chamomile 25.00
Willow bark extract 25.00
TABLE 12 HyperGen™
Composition per capsule (in mgs)
DL-phenylanine 400.000
L-glutamine 25.000
L-tyrosine 150.000
5-Hydroxytryptophan 2.5 mg
Methionine 50.000
Chromium picolinate 0.020
Calcium 25.000
Iron 1.000
Magnesium 2.500
Biotin 0.050
Pantothenic acid 15.000
Vitamin C 13.300
Vitamin B-l 0.375
Vitamin B-2 0.800
Niacin (non-flush) 10.000
Vitamin B-6 (P-5 phosphate) 3.330
Folic acid 0.030
Vitamin B-l 2 0.001 pharmaline 50 huberzine 150 μg
Ginko B 40.000
TABLE 13
Stress-X™
Composition per capsule (in mgs)
DL-phenylanine 400.000
Vitamin C 100.000
L-glutamine 35.000
5 -Hydroxytryptophan 2.5 mg
Calcium 25.000
Pantothenic acid 15.000
Niacin (non-flush) 3.300
Vitamin B-6 (P-5 phosphate) 3.000
Magnesium 2.500
Vitamin B-l 2.417
Iron 1.500
Zinc 1.500
Vitamin B-2 0.850
Folic acid 0.670
Biotin 0.050
Chromium picolinate 0.020
Vitamin B-l 2 0.005
Vitamin A I.U. 333.300
Vitamin E 5.000 I.U.
Taurine 0.005
Valerian root 25.000
TABLE 14 Tempamine™
Composition per capsule (in mgs)
Biotin 0.050
Calcium 25.000
Chromium picolinate 0.020
DL-phenylanine 400.000
Folic acid 0.670
Iron 1.500
L-glutamine 35.000
5 -Hydroxytryptophan 2.5000
L-tyrosine 100.000
Magnesium 2.500
Niacin (non-flush) 3.300
Pantothenic acid 15.000
Vitamin A I.U. 333.300
Vitamin B-l 2.417
Vitamin B-2 0.850
Vitamin B-6 (P-5 phosphate) 3.000
Vitamin B-l 2 0.005
Vitamin C 100.000
Vitamin E I.U. 5.000
Zinc 1.500
TABLE 15 Aggression
Composition per capsule (in mgs)
DL-Phenylanine 460.000
L-Glutamine 25.000
L-Tyrosine 100.000
5-Hydroxytryptophan 2.5 mg
Chromium Picolinate 0.020
Calcium 25.000
Iron 1.500
Magnesium 2.500
Zinc 1.500
Biotin 0.050
Pantothenic Acid 15.000
Vitamin A I.U. 333.300
Vitamin C 100.000
Vitamin B-l 2.417
Vitamin B-2 0.850
Niacin (non-flush) 3.300
Vitamin E I.U. 5.000
Vitamin B-6 (P-5 Phosphate) 3.000
Folic Acid 0.670
Vitamin B-l 2 0.005
TABLE 16 Gambotrol™
Composition per capsule (in mgs)
Calcium 25.000
Chromium Picolonate 0.020
DL-Phenylanine 400.000
Folic Acid 0.670
Iron 1.500
L-Glutamine 35.000
L-Tyrosine 100.000
5 -Hydroxytryptophan 2.5 mg
Magnesium 2.500
Methionine 50.000
Niacin (non-flush) 6.700
Pantothenic Acid 1.500
Vitamin B-l 1.670
Vitamin B-2 2.500
Vitamin B-6 (P-5 Phosphate) 3.330
Vitamin B-l 2 0.005
Vitamin C 100.000
Zinc 2.500
TABLE 17 Cocaine and Amphetamine Reward
Paradigm Effect on Reward
Intracranial Electrical Self-Stimulation Lateral hypothalamus Facilitation Ventral tegmental area Facilitation
Intracranial Self-Administration
Medial Prefrontal Cortex (Cocaine) Facilitation Nucleus accumbens (amphetamine) Facilitation
Intravenous Self-Administration
Noradrenaline receptor antagonists No change 5-HT receptor antagonists Facilitation M-opioid receptor antagonists No change D, and D2 dopamine receptor antagonists Inhibition Noradrenaline denervation (6-hydroxydopamine) No change 5-HT denervation (5,7-dihydroxytryptamine) Facilitation Dopamine denervation (6-hydroxydopamine) Nucleus accumbens Inhibition Ventral tegmental area Inhibition Medial prefrontal area No change
TABLE 18 Opiate Reward
Paradigm Effect on Reward
Intracranial Electrical Self-Stimulation
Lateral hypothalamus Facilitation Intracranial Self-Administration Nucleus accumbens Facilitation Lateral hypothalamus Facilitation Ventral tegmental area Facilitation Intravenous Self-Administration Opioid receptor antagonists M-receptor antagonists Inhibition Δ-receptor antagonists No change K-receptor antagonists No change Dopamine receptor antagonists Mixed results Dopamine denervation (6-hydroxydopamine) Nucleus accumbens No change
TABLE 19 Sedative/Hypnotic Reward
Paradigm Effect on Reward
Intracranial Electrical Self-Stimulation Lateral hypothalamus Facilitation
Intracranial Self-Administration Ventral tegmental area Facilitation
Oral Self-Administration
GABAA receptor antagonists Inhibition GABAΛ receptor agonists Facilitation Opioid receptor antagonists Inhibition Dopamine receptor antagonists Inhibition 6-HT receptor agonists Inhibition Noradrenaline synthesis inhibitors Inhibition
Treatment Methods In the present invention D-phenylalanine, D-leucine and any D-amino acid including hydrocinnamic acid (see Tables 6-16) are included in the treatment formulations. In addition, the enkephalinase inhibitors are included in the formulations, including, but not limited to: certain protein synthesis inhibitors, such as bacitracin, bestatin, and puromycin; peptide amino acids such as mono free form amino acids of the D-form, di- and tripeptides of the essential amino acids in the D- form; thiol benzyl amino acids (2-[mercapto-3-phenyl-propanoyl]-L-leucine); carboxyalkyl methyl esters (N-[(R,S)-2-carbethoxy-3-phenyl propanol]-L leucine); as well as a number of other structurally unrelated compounds such as secobarbitol, pyrophosphate, O-phenanthroline, phosphamidon, Z-leucine-NHOH, and Z-glycine- NHOH.
Further, the inventors realized that by also supplying an enkephalin releaser they could dramatically improve the response of the patient to treatment. Thus the enkephlin releasers Tyr-Arg and Tyr-D-Arg are also included in the treatment formulations. The linkage of numerous genetic alleles to a wide variety of impulsive, compulsive and addictive disorders suggest that a common mechanism is affected by both psychostimulants as well as non-psychostimulants to cause a preferential release of dopamine (DA) into the medial nucleus accumbens (Acb). The genetic basis of this mechanism involves at least polymoφhisms of the dopaminergic genes and regulating enzymes (D1-D5, DATl, DβH, MAOA, COMT); therefore, compositions that alter neurotransmission of the "reward cascade" (including serotonin, enkephalins, GABA and DA) should have beneficial effects for substance and behavioral disorders. Abused substances and behavioral disorders include, but are not limited to, alcohol, cocaine, nicotine, glucose, Cannabis, opiates and opiate derivatives, gambling, sexual compulsion, hyperactivity, chronic violent behavior and stress disorders, and also symptoms related to premenstrual syndrome (PMS).
In order to induce dopamine release at the nucleus accumbens, opiodergic activity is ultimately involved. Therefore it is expected that by combining an enkephalinase inhibitor to prevent the breakdown of the enkephalin and a releaser of enkephalin together would provide the greatest enhancement of opiodergic activity.
An important component of this embodiment is to first genotype the patient and then based on his/her genotype provide the appropriate cocktail. In terms of the D2 anomaly the inventors have developed an appropriate cocktail which is described herein.
Synthetic agonists are not preferred therapeutic agents. A given agonist may act on several receptors, or similar receptors on different cells, not just on the particular receptor or cell one desires to stimulate. As tolerance to a drug develops (through changes in the number of receptors and their affinity for the drug), tolerance to the agonist may likewise develop. A particular problem ,for example, bromocryptine or methamphetamine, is that it may itself create a drug dependency. It is known that both bromocryptine is self-administered by rhesus monkeys (Woolverton, et al. 1984).
In contrast, no tolerance was observed with D-phenylalanine (DPA). Tolerance and dependence do not develop in mice on a long-term administration of this substance at a dose of 500 mg/kg/day according to S.Ehrenpreis (The Chicago Medical School).
Further rational for the combination proposed herein also involves the understanding that releasers are effective only if they have something to release. They will not cure a state of dopamine depletion. Indeed, the inventors would be concerned that dopamine releasers by themselves would exacerbate the chronic depletion of dopamine. In this regard, precursors use a naturally regulated pathway. The precursor is converted to the neurotransmitter only when needed, and then the body distributes the product on the basis of need.
Prior art covers the use of DPA in the treatment of alcoholism and cocaine dependence as an anti-craving moiety. There is data by the Blum group which points to the use of DPA in combination with 1-tryptophan, l-glutamine, and pyridoxal-5' phosphate which describes a 90 day open trial on weight loss. In this investigation, the supplement group lost an average of 26 pounds compared to only 10 pounds in the controls. Moreover, only 18.2 % ofthe study group lost less than 15 pounds over a 90 day period compared to 81.8% of controls. While these results show that overweight individuals lose 2.7 times as much weight as patients without benefit ofthe product.
The inventors found in a group of 247 outpatients in a low calorie, fasting program for a two-year period that the group taking the supplement containing the DPA and other amino-acids and trace metals compared to a centrum vitamin group(only) showed 1) a twofold decrease in percent overweight for both males and females; 2) a 70% decrease in craving for females and a 63% decline in males; 3) a 66%) decrease in binge eating for females and a 41% decrease for males; the study group regained only 14.7% of the weight they lost during fasting while the control group regained only 41.7% of their lost weight; and 5) logistic regression modeling revealed that the supplement treatment, female gender, morbid obesity and family history of obesity were significant predictors of weight gain after two years.
This data shows that DPA alone or in combination with other amino-acid precursors and trace metals such as Chromium piccotinate or niccotinate produces this dramatic effect especially on prevention of weight gain or an ability to eradicate the regaining of weight lost over a two-year period. To date the inventors know of no product on the market which could boast such important findings including
(K) (ϊϊ) observations related to Redux (Interneuron, Cambridge, Mass) or Fastin (Smith/Kline Beacham, Philadelphia, PA).
Moreover, other studies have contributed to an understanding of mechanisms that have made it so difficult for the obese to lose weight and to maintain weight loss following discontinuation of a weight-loss regimen. These studies have demonstrated how the body "defends" a given weight, frequently referred to as the "set-point". In the face of decreased energy expenditure during a weight-loss program, the set-point is defended by the body: hunger increases, oxygen utilization is decreased, the gastrointestinal system becomes more efficient in absorbing nutrients and thyroid hormone output is decreased (Keesey, 1989). Moreover, as weight is lost the influence of any intervention, either hygienic or pharmacotherapeutic will diminish, leading either to the a stable weight or "plateau" that many dieters describe or even to regaining of weight. In this regard with this supplement it not only prevents regained weight from occurring, it also seems to overcome the plateau effect as well.
Comparison Studies on Fenfluramine alone and in combination with Phentermine vs PHENCAL™. Work with d-fenfluramine results in a sustained depression in body weight despite the return of ad-libitum food intake to normal levels. Studies to date in both humans and animals have failed to demonstrate an increase in metabolic rate after the administration of the drug. Instead fenfluramine appears to potentate the expenditure of energy whenever increases in energy expenditure occur. This drug potentates the thermic effect of food both in humans and animals. Tolerance does not appear to develop to its ability to potentate energy expenditure but this is not true for its ability to act as an anorectic (Levitsky and Troiano, 1992).
In consideration for a novel weight product the most important therapeutic effect has to do with the prevention of regaining of weight lost. In fact, Turner suggested that permanent weight loss is the goal of weight-reducing strategies and, based on current evidence with regard to this action, d-fenfluramine appears to exert a weight reducing effect over periods of up to 12 months without development of tolerance, a problem that has limited the long term use of other pharmacological agents used in the treatment of this disorder. While d-fenfluramine working through the serotonergic system facilitates weight loss in patients who do not respond satisfactorily to other weight loss strategies, follow-up of the longest study reported with d-fenfluramine suggests that continued therapy is required in severely overweight patients if weight loss is to be maintained. In regard to prevention of weight lost regained it appears that d-fenfluramine acts via decreases in daily energy intake varying between 13-25%. D-fenfluramine also works by decreasing the desire for fatty foods. The notion here is that with the PHENCAL™ formula even more than what is generally accepted for the first FDA approved drug for weight reduction since d-amphetamine and other stimulants has been achieved. The inventors believe that the results on utilizing amino-acid precursor loading and enkephalinase inhibition is by far the greatest advance to prevent weight regain.
Preferred Embodiments of Treatment. The basic treatment regime for RDS behaviors should contain at least one of the substances below alone or in combination (Table 20). This list contains the major constituents ofthe treatment in terms of either drug or "neutraceutical" (for specific formulas see Tables 6-16):
TABLE 20
Component for Treatment Contemplated Effective Dose Range Composition
D-phenylalanine 16 to 5000 mg or
Dl-phenylalanine 32 to 10,000 mg
Naltrexone- 1 to 1000 mg
Tyr- Arg 15μg to 15 mg or Tyr-D-Arg (at same dose range)
Chromium Piccolinate 10 μg to 10000 μg
Chromium Niccotinate 10 μg to 10000 μg
L-carnitine 1 to 200 mg
L-tyrosine 9 to 90,000 mg
L-Glutamine 3 to 30,000 mg
L-tryptophan 5 to 5.000 mg
5-Hydroxy-tryptophan 0.5 to 500 mg
L-Arginine pyroglutamate l to lOOO mg
Ornithine Aspartate 1 to 1000 mg
D-leucine 16 to 5000 mg
DL-leucine 32 to 10,000 mg
Hydrocinnamic acid 1 to 100 mg
Theanine (Taiyo Intl) 1 to 1000 mg
Hubazine 1.5 to 1500 μg
Vitamin B6 (as pyridoxine 1 to 1000 mg
HCl)
Rhodiola rosea extract 5 to 500 mg
(Pharmline)
Other enkephalinase inhibitors that are contemplated to be useful in the treatment methods (see previous patents, U.S. Patent No. 5.189,064, U.S. Patent No. 4,761 ,429 and Canadian Patent No. 1 ,321 , 146. incoφorated herein by reference).
Carbohydrate Bingeing or Anti-Obesity Compounds. In this regard it has been shown that amino-acid loading and enkephalinase inhibition as stated earlier effects a number of important associated weight problems the most important being the prevention of weight regained after a two-year period.
Anti-SUD Detail Protocol: Alcotrol™ and Cocotrol™ as a Function of Genotype. An open trial evaluation was conducted to determine the effectiveness of amino-acid precursor loading and enkephalinase inhibition in preventing relapse in both alcoholics and cocaine dependent probands utilizing a formula improved since the original patents. The study included a total of 280 patients observed over a two- year period. The criteria for relapse was whether or not the proband returned to regular use of either alcohol or cocaine, as assessed by a certified addiction specialist. The patients were divided into two groups: Group A = only a one-A-Day vitamin; Group B = for the alcoholics a variant of Alcotrol™ and for cocaine addicts a variant of Cocotrol™ (see Tables 8 and 9 for formulas).
After two years it was determined that a total of 78 patients in the control group relapsed after 2 years in the study which is 86% relapse rate. With the amino acid, none out of a total of 189 patients relapsed after a two year period or 0% relapse rate. The results indicate a very positive effect in preventing relapse in SUD patients. In essence this effect enhances the results seen in a patient attending a typical treatment facility which embraces the traditional 12 step approach to recovery.
Typography of Alcoholics and Cocaine Abusers: Genotyping Type A and B Probands. Researchers have been testing the concept of classifying or subtyping, alcoholics as Type A or Type B. and are now finding the concept useful in studying cocaine abuse. Subtyping is a system for classifying and studying individuals who share one or more common characteristics. Subtyping alcoholics provides a greater understanding of the complex interactions between genetic, personality, and environmental risk factors in the development of alcoholism, as well as resiliency against succumbing to these risk factors.
Alcohol abuse is more severe among Type B alcoholics than Type A. Type B alcoholism appears to have several characteristics: it is more related to hereditary factors than type A; it is more likely to occur among men; type B's are more impulsive and tend to have stronger family history of alcohol abuse; they have more childhood conduct disorder problems and more severe alcohol dependence, polydrug abuse, and psychiatric disorders, especially anti-social personality.
With regard to cocaine abusers certain vulnerability factors such as family history of alcoholism or drug abuse, sensation-seeking behavior, and childhood conduct problems seem to predispose cocaine users to a more virulent form of cocaine dependence-type B. Accordingly, other cocaine abusers who don't have these characteristics [type A] may develop their cocaine dependence more from social or environmental influences relative to inherited, temperamental or psychiatric influences.
Important features of the major three characteristics such as Predisease Risk
Factors [such as family history of substance abuse, childhood conduct disorder and ADHD, sensation-seeking traits, and age when drug abuse begun]; Substance Abuse Variables, [including frequency of cocaine use, years of heavy cocaine use, cocaine dependence symptoms, alcohol dependence symptoms, polydrug use, and medical and social consequences.]; and Psychiatric Problems [such as symptoms of depression and antisocial personality disorder and the severity of these psychiatric problems] were found in Type B cocaine abusers (Ball et al, 1995).
Moreover, Type B scored higher than Type A in assessments of sensation seeking, aggression, criminality, violence and impairment of social adjustment. The former type also used greater amounts of cocaine more frequently and for longer durations than Type A cocaine abusers. Type B's also suffered more adverse effects from their drug use, such as unconsciousness, and violence (among others), and they reported a greater degree of additional drug abuse to relieve withdrawal distress. Type B abusers become involved with cocaine at younger ages for: first use, first binge, first regular use, first daily use and first symptoms of addiction.
No differences were found between the two subtypes in regard to the length of time between first use of cocaine and first symptoms of dependence; route of use, such as snorting, smoking or injection; number of strategies used in attempting control use; and previous periods of abstinence from illicit drugs or alcohol. Interestingly, more than half of the participants were classified as type A's but among those in inpatient treatment, there were nearly equal numbers of Type A's and Type B's. Among the outpatient and not-in-treatment participants, 75 % were Type A.
An aspect of the present invention combines new work utilizing molecular genetic diagnosis with previously identified markers of Type B behavior to more accurately typograph both the alcoholic and cocaine abuser. The new genetic findings suprisingly fit the Type B associated variables (Ball et al, 1995). The following associations with only the DRD2 gene in by itself closely associates with almost all of the Type B parameters suggested by Ball et al, 1995. The evidence provided comes from a number of studies concerned with genotyping non-Hispanic Caucasians with polymoφhism of the dopamine D2 receptor gene (see Table 20-A).
TABLE 20-A
CLASSIFYING COCAINE ABUSERS BY GENOTYPE
Type B DRD2A1 Reference
Cause of Abuse More genetic 53% Noble et Problem al, 1993
Gender More Male < 0.05
Predisease Risk Family History (At least one p < 0.016 Noble et Factors parent being alcoholic a predictor) al, 1993.
ADHD p < 0.0001 Comings, et al, 1991.
Childhood Factors Deviant behavior (CD) before 1st p < 0.030 Noble et regular cocaine use /.A993.
Having 3 risk factors:FH+, Potent p < 0.007 Noble et cocaine, CD al, 1993.
Substance Abuse Potent cocaine use (mean % time ρ < 0.015 Variables using i.v., free base, and crack CLASSIFYING COCAINE ABUSERS BY GENOTYPE
Type B DRD2A1 Reference cocaine)
Mean no. of wk from 1st cocaine p < 0.033 Noble et use up to next use al, 1993.
Substance Abuse Using a higher number of drugs p < 0.0005 Comings, et Severity (spending over $25 per wk per al, 1994. drug
More money spent on All drugs p < 0.01 Comings, et (including Cocaine and other al, 1994. Stimulants, except opiates)
Age of Onset Al carriers = 23.2 yrs. vs A2 p < 0.026 Comings, et carriers = 26.7 yrs. al, 1994.
Psychopathology Higher severity, more Antisocial: Comings, et childhood violence p < 0.002 al, 1994.
adolescent violence p < 0.0001 Blum et al,
1996.
violent crime p < 0.01 1 Comings, et al, 1994.
Personality High impulsivity, sensation Comings et seeking P < 1x10"' al, 1996.
(pathological gambling)
Sch izo id/avo idant p < 0.006 Blum et al, (aloofness and detachment) 1997. ADHD The major problem of probands with ADHD is that they have problems with focusing. The inventors' recent studies show that one of their formulas called Kantroll™ effects a number electrophysiological outcomes (see Table 6A).
This is the first report, known to the inventors, in humans of the effects of daily ingestion of a specific amino acid mixture on cognitive event-related potentials (ERPs) associated with performance. Cognitive ERPs were generated by two computerized visual attention tasks, the Spatial Orientation Task(SOT) and Contingent Continuous Performance Task(CCPT), in normal young adult volunteers, where each subject acted as his own control for testing before and after 28-30 days of amino-acid ingestion. A statistically significant amplitude enhancement of the P300 component of the ERPs was seen after the composition for both tasks (p < .009), as well as improvement with respect to cognitive processing speeds (p < .015). The enhancement of neurological function observed in this study on normal controls is consistent with the facilitation of recovery of individuals with RDS (i.e. substance use disorder, attention deficit disorder, carbohydrate bingeing) following the ingestion of the amino acid supplement.
This work was not accomplished in ADHD probands. However, the rational is very strong, as a number of ADHD cases report positive results in terms of reduced hyperactivity and improved school work with the amino acid combination. The inventors have data that the DRD2 Al allele also correlates with P300 and abnormalities in AER and VER as previously pointed out in this invention. Also see the work of Comings on cannabis on p300 waves. Together this makes a strong case for treating with a specific formula (HyperGen™, see Table 12) or at least the enkephalinase inhibitor (dl-phenylalnine). Utilizing this rational the inventors also will have data on the relationship between the DRD2A allele and the standard computerized ADHD test called TOVA (this is currently being analyzed).
Attention Processing Disorder. One aspect of the invention is the treatment of attention processing disorder and other RDS related syndromes. The inventors base this treatment on the fact that attentional processing is governed by neurotransmitter function and certain specific neurotransmitters are responsible for normal brain cognitive functioning, which could be modulated by certain precursor amino acids. Understanding of electrophysiological functioning ofthe brain resides in the biogenetic aspects of the chemical mediators known to be involved in attentional processing.
One area of recent concern is the impaired cognition observed in children of alcoholics (as measured by P300 waves), and the poor focusing of patients diagnosed with ADD/ADHD. In this regard, evidence supports the concept that many disruptive, childhood and adolescent behavioral disorders including ADHD, Tourette's Disorder, learning disabilities, substance abuse, oppositional defiant disorder, and conduct disorder, are part of a spectrum of inter-related behaviors that have a strong genetic component, are poly-genetically inherited, share a number of genes in common that affect dopamine, serotonin, and other neurotransmitters, and are transmitted from both parents. Converging insights into attention- deficit/hyperactivity disorder support the notion that ADHD is best characterized behaviorally as a disorder of self-regulation or executive functioning. Anatomic neuro-imaging studies suggest that the relevant regulatory circuits include the prefrontal cortex and the basal ganglia, which are modulated by dopaminergic innervation from the midbrain and by stimulant medications which activate the dopaminergic receptors by either agonist activity or by dopamine release.
This invention provides a composition of matter (including the use of phenylalanine) which promotes neurotransmitter manipulation which leads to natural dopamine release which overcomes PHD as well as facilitate the proliferation of dopamine D2 receptors via occupancy by synaptic dopamine.
Precursor to Serotonin. Serotonin (5-hydoxytryptamine, 5HTP) is a CNS neurotransmitter. It is also found in the enterochromaffin system of the intestine, and in blood platelets. This neurochemical is biosynthesized by first hydroxylating L-tryptophan to obtain 5 -hydroxytryptophan and then decarboxylating the latter to obtain serotonin. The hydroxylation (the rate-limiting step) is performed by the enzyme tryptophan hydroxylase, while the decarboxylation is accomplished by the ubiquitous enzyme L-aromatic acid decarboxylase. This enzyme requires pyridoxal phosphate as a cofactor.
Serotonin is metabolized into 5-hydroxyindole-acetic acid by monoamine oxidase. This metabolite is then excreted in the urine. Central brain serotonin mechanisms may be important in the control of mood and behavior, motor activity, feeding and control of hunger, thermoregulation, sleep, certain hallucinatory states, and possibly some neuroendocrine control mechanisms in the hypothalamus.
Chronic use of cocaine reduces concentrations of serotonin and its metabolite. Cocaine apparently reduces uptake of the serotonin precursor tryptophan, thereby reducing serotonin synthesis. Cocaine also reduces tryptophan hydroxylase activity. Thus, cocaine decreases serotonergic action (Reith et al, 1985).
Treatment of rats with drugs which deplete serotonin (Fenfluramine, PCPA or 5-7-DHT) increased the content of both enkephalin and endoφhin in the hypothalamus but not in the brain regions. Since there was no alteration in content of either mRNA or the precursors-pro-enkephalin (PE) or propiomelanocortin, it was suggested that serotonergic transmission regulates opioid peptide utilization without affecting synthesis (Schwartz et al, 1985).
This finding supports the hypothesis that lowered release of enkephalin would result in a reduced dopamine activity manifest as a depressive state. Following intense exercise, certain behavior deficits occur which include pain, depression and sleep disorders. Restoration of the serotonergic transmission with L-Tryptophan should help restore positive mood. It was found that providing tryptophan in the diet, . e. precursor loading, had a definite effect on the cerebral metabolism of serotonin and related compounds (Moir and Eccleston, 1968). Brain serotonin content can depend upon the plasma tryptophan levels (Fernstrom and Wurtman, 1971). Rats fed tryptophan-poor diets had low serotonin levels in the brain, and L-tryptophan restored this deficiency. If tryptophan was injected into the bloodstream, the levels of tryptophan and serotonin in the brain were elevated nine- and two-fold, respectively. Infusion of tryptophan in neurological patients with both depression and insomnia resulted in six-fold elevations in cortical tryptophan levels (Gillman et al, 1981). Comparison of tryptophan (50 mg/kg) and tyrosine (100 mg/kg) or placebo in a double-blind crossover study in eight healthy men (Lieberman et al, 1983). Tryptophan, but not tyrosine. significantly reduced pain discriminibility. Other studies revealed that tryptophan reduced clinical pain (Seltzer et al, 1983), prevented migraine (Poloni et al, 1974), and reversed analgesic tolerance (Hosobuchi et al, 1980). It would appear that tryptophan via serotonergic activation results in enhanced endoφhinergic release which results in analgesia.
Unlike tyrosine hydroxylase, under normal physiological conditions, tryptophan hydroxylase is not saturated, i.e. the enzyme is not working to full capacity and thus tryptophan hydroxylase activity is significantly affected by L-tryptophan. The amount of available free L-tryptophan is dependent on a number of factors including the concentration of circulating L-tryptophan in the plasma at the rate of its uptake in the brain and presynaptic terminals. The inventors contemplate using L-tryptophan or 5HTP to restore the serotonergic system disrupted by cocaine.
5HTP is not as useful as a therapeutic agent. The rate of entry of L-tryptophan into the brain depends upon the ratio of free-bound tryptophan in the plasma, and this ratio is influenced by the concentration in the blood of neutral amino acids, insulin and pharmaceutic agents, which compete for the plasma protein binding sites, as well as for the tryptophan-uptake sites. Also, 5HTP is taken up by neurons other than just 5HT neurons; therefore the increases in 5HT synthesis are not selectively limited to serotonin neurons.
Inhibitors of enzymes involved in 5HT synthesis include irreversible tryptophan hydroxylase inhibitors (DL-parachlorophenylalanine, 6-Flurotryptophan and L-propyldoracetamide) and inhibitors of 5HTP decarboxylase (carbidopa and l-methyl-5HTP). Serotonin can be released into the synaptic cleft by the process of exocytosis in response to action potentials and to drugs. Facilitation of 5HT release can be accomplished with cocaine, (+)-amphetamine, methamphetamine, fenfluramine, parachloramphetamine, clorimipramine (clomipramine) and amitriptyline. Three types of 5HT receptors (5HT-1, -2 and -3) have been proposed. 5HT receptor agonists include LSD, quipazine, N,N-dimethyl-tryptamine (DMT). 5HT receptor antagonists include cyproheptadine, methysergide, LSD, 2-bromo-CSD (BOL), ketanserin, xylamidine, cinanserin and 1 -(-)-cocaine. Inactivation of 5HT involves high-affinity energy-dependent active-transport mechanism which exists to remove 5HT from the synaptic cleft back into the presynaptic neuron.
Inhibitors of neuronal uptake of 5HT include the tricyclic anti-depressants
(imipramine, desimipramine, amitriptyline, chlorimipramine, fluvoxamine; fenfluramine (an anorectic agent) and cocaine. Any 5HT not bound in storage will be converted into metabolites by MAO. However, if MAO is inhibited, serotonin is metabolized to N-Methyl, or N-N-dimethyl by O-methyl-transferase (COMT).
Enhancer/releaser of Opioid Peptides. Enhancer/Releaser of Opiod Peptides An aspect of this invention is the use of substances which inhibit the destruction of neuropeptidyl opiates. These opiates promote the synthesis and release of dopamine. It has been shown that the administration of opiate-like substances to animals increases the rate or striatal DA biosynthesis and metabolism, an effect which is mediated by special opiate receptors located on nigrostriatal dopaminergic terminals (Clouet et al, 1970; Biggio et al, 1978; Regiawi, 1980). Upon chronic administration of B-endoφhin or enkephalin dopaminergic tolerance develops (Iwatsubo et al, 1975; Arden, 1972). The postsynaptic DA receptor becomes supersensitive in tolerant animals (Schwartz et al, 1978).
Cocaine also affects opiodergic action. With chronic exposure cocaine to rats, dose-dependent alteration of naloxone binding was observed. Opiate receptor density was significantly decreased in several brain structures, while it was increased in the lateral hypothalamus. It appears that opiate binding was specifically affected in "reward centers" and not in other regions (Hammer et al, 1987). Furthermore, naloxone, in another study, effectively blocked the threshold lowering action of cocaine in reward centers of the brain (Bain and Korwetsky, 1987). Moreover, cocaine appears to affect the analgesic action of certain opiates (Misra et al, 1987). The inventors believe that the reinforcing action of cocaine may be mediated in part by opiate systems in brain reward centers, which are altered by chronic cocaine exposure.
Narcotic drugs were found to act at various "opiate receptors." The brain and other nervous tissue were found to possess endogenous opioids (EO). The related pentapeptides, methionine and leucine-enkephalin were identified in the brain (Hughes et al, 1975). The enkephalins activate both delta and mu receptors, while beta endoφhin activates the epsilon receptor. Endocrinologists were able to show that B-lipotropin (B-LPH), already recognized as a pituitary hormone, contained the Met-enkephalin sequence of five amino acids, and that B-LPH was hydrolyzed to an active opioid, B-endoφhin (Li et al, 1976).
Currently, the inventors know of at least three chemical families of EO's of different origin and with different function, although all peptides contain the sequence Tyr-Gly-Gly-Phe-X at their N-terminals. The endoφhin family includes the large precursor, pro-opiocortin, B-LPH, and B-endoφhin. The second family of EO's is the enkephalin family. Both [Met]enkephalin and [Leu]-enkephalin are derived from a large peptide precursor containing both sequences. Hexa- and hepta- peptides with one or two basic amino acids attached to the carboxyl end of enkephalin, and a hepta peptide; [Met]enkephalin-Arg-Phe seem to be naturally occurring intermediates (Hexum et al, 1980). The third family are kappa agonists, such as dynoφhins 1-13 and 1-17. These CNS components antagonize moφhine actions. Dynoφhin may act as a precursor of Leu-enkephalin which forms the N-terminus; conversion to the subendoφhin form (E5) will then result in altered receptor affinity (kappa to delta), illustrating a possible new regulatory role for enzyme modulating ligand expression.
Peptides from each family seem to act both as neurotransmitters and as neurohormones. The pentapeptide enkephalins are localized in nerve terminals and are released from neurons upon stimulation. Leu- and Met-enkephalins are released from the adrenal medulla into the blood and act as neurohormones. Beta-endoφhin is released from the pituitary gland into blood and it may act as a neurotransmitter in discrete areas of the brain (Bloom et al, 1978). Both endoφhins and enkephalins produce biochemical and pharmacological responses, including tolerance, dependencies and abstinence, similar to those produced by narcotic analgesic drugs when the EO's are administered to man or animals. The endogenous opiates, like the narcotic drugs, are members of the class "opioids." Enzymes which degrade enkephalins (E5) are generally called "enkephalinases."
It is well established that tissues contain a variety of peptidases which metabolize pentapeptididyl enkephalins (E5). Enzymes acting as enkephalinases include soluble and particulate bound aminopeptidases (Hersh, 1981) and others acting at the Gly3-Phe4 site such as peptidyl dipeptidases or metalloendopeptidases (Benuck et al. 1982; Schwartz et al, 1980). The metalloenzyme carboxypeptidase A cleaves enkephalin leaving Tyr-Gly-Gly-C and the terminal dipeptides Met-Phe or Leu-Phe. Unlike the biogenic amines, for which a single enzyme is largely responsible for inactivation at the target site, degradation of the enkephalins involves multiple enzymes, although the metalloendopeptidase would appear to be the principal enkephalinase. The scheme below illustrates the sites of action of enzymes associated with the degradation of E5.
One strategy to deal with the degradation is to provide E5 surrogates. For enkephalin, several chemical modifications are required to block degradation by tissue enzymes. These include: a) modification of N-terminal-Tyr inasmuch as tyrosine-modified analogs of methionine enkephalinase resist degradation (Coy and Kastin, 1980); b) presence of a D-amino acid in position 2 to block effects of amino peptidases: and/or c) modification or presence of a D-amino acid in positions 3-5 to block action of peptidyl dipeptidases or other enzymes acting at the Gly3-Phe4 bond. Other analogs could include D-Ala-enkephlamide or FK 33-824, as mu agonists; delta agonists such as enkephalin- Arg-Phe; and dynoφhin 1-13 or 1-17, which are kappa agonists (Wisler et α/., 1981).
It is unknown at the present time whether these agents, which are candidate E5 agonists, have potential addiction liability, tolerance and other toxicological problems associated with their clinical use. The probable addictive nature of many of these modified, enzyme resistant surrogates would significantly reduce their clinical application. A second, and preferred strategy to enhance enkephalin or endoφhin action in vivo is to use specific enzyme inhibitors. Certain enkephalin fragments
(Gly-Gly-Phe-Met or Gly-Gly-Phe-Leu, Phe-Met, Phe-Leu) can act as inhibitors of enkephalin and it is likely that larger enkephalin-type forms themselves also have inhibitory properties.
In this invention the term "enkephalinase inhibitors" includes but is not limited to D-Phenylalanine (DPA), DL-Phenylalanine (DLPA), hydrocinnamic acid, and D-amino acids such as D-Leucine. It is expected that other enkephalinase inhibitors selected from a group consisting of certain protein synthesis inhibitors (bacitracin, bestatin, and puromycin), peptide amino acids (free, D-form monoamino acids, di-and tripeptides of the essential amino acids in the D-form, thiol benzyl amino acids, (e.g., 2-[mercapto-3-phenylpropanoyl]-L-Leucine), carboxyl alkyl methyl esters, N-[(R,S)-2-carbethoxy-3-[phenyl propanol]-L leucine), benzomoφhan-enkaphalins, and other, structurally unrelated compounds such as secobarbital, pyrophosphate, o-phenanthroline, phosphamidon, Z-leucine-NHOFI, and Z-glycine-NHOH. Dipeptides D-Phe-D-Leu and D-Phe-D-Met and the polypeptide L-Tyr-Gly-Gly-D-Phe-D-Leu and L-Tyr-Gly-Gly-D-Phe-D-Met, together with D-Phe, D-Leu, and hydrocinnamic acid, are of particular interest.
D-phenylalanine has been known to inhibit carboxypeptidase A (Hartruck and Lipscomb, 1971) and more recently has been shown to possess analgesic properties (Ehrenpreis et al, 1978; Delia Bella et al, 1979) as well as antidepressant action (Beckmann et α/., 1977).
To evaluate the potency of D-phenylalanine as an inhibitor of enkephalinases it was shown that the compound indeed significantly reduced degradation of the oligopeptides (D-Ala2-D-Leu5) enkephalin (DAPLE) and Tyr-D-Ala-Gly-Phe (TAAGP), in rat intestinal mucosa (Gail et al, 1983). However, D-phenylalanine was much less effective when studied in vitro for inhibitory activity against both enkephalinase A and enkephalinase B activity obtained from calf brain (Amsterdam et al, 1983). Interestingly, the addition of just one amino acid to form the dipeptide D-Phe-Tyr markedly enhances the inhibitory potency. D-phenylalanine has been shown to inhibit the degradation of both enkephalins and B-endoφhin. It works better on the enzymes regulating enkephalin breakdown as compared to the enzymes regulating B-endoφhin. Its activity is also tissue-specific; in the hypothalamus, enkephalinase is 80% inhibited and endoφhinase 5%; in the cortex, enkephalinase 60%, but endoφhinase only 18%; in the striatum, enkephalinase 78% and endoφhinase 10%; and, in the spinal cord, enkephalinase 84%, endoφhinase 40% (Ehrenpreis et al, 1981). Other studies showed actual CNS increases of [Met]-enkephalin tripled within 90 min following DPA injection and remained high six days later (Balagot et al, 1983). Other increases of [Met]-enkephalin in the brain of mice was similarly found with hydrocinnamic acid, a known metabolite of D-phenylalanine.
Another aspect of this invention is to combine an enkephalinase inhibitor with an enkephalin releasing agent. The rationale for this is that by doing so the inventors could significantly enhance the effect of enkephalin on its respective opiate receptor sites (e.g., delta or mu). To accomplish this aim the inventors would prefer to use the peptide Tyr-Arg (Kyotoφhin), or its stable analog, Tyr-D-Arg, which has been shown to be analgesic and to enhance intracellular calcium in synaptosomes in rat brain striatal slices. These substances appear to be putative methionine-enkephalin releasers acting by an unknown mechanism (Ueda et al, 1986).
To provide both enkephalinase inhibition as well as enhanced neuronal enkephalin release the substance known as Kyotoφhin (Tyr-Arg) may be used at a daily dosage range of 15 μg-15 mg (Takagi et al, 1979). The more stable analog Tyr-D-Arg, at a daily dosage range of 15 μg-15 mg may be substituted as a enkephalin releaser (Tajima et al, 1980; Ueda et al, 1986). Thus, an enkephalin releaser may be combined with an enkephalinase inhibitor to achieve a high degree of enkephalinergic activity at the synapse to further augment the release of reuronal dopamine. This will act as a form of "replacement therapy" and reduce "craving" for cocaine, and other RDS behaviors disclosed herein. This treatment will be most useful during the 12 months following cocaine detoxification. Precursor to Gammabutyric Acid (GABA). GABA is an inhibitory neurotransmitter which controls the release of dopamine (Gessa et al, 1985). It seems to reduce seizure activity during alcohol withdrawal. The main synthetic pathway to gamma-aminobutyric acid (GABA) is via decarboxylation of L-glutamic acid by glutamic acid decarboxylase (GAD). Like other amino acid decarboxylases, this enzyme needs Vitamin B6 (pyridoxal phosphate) as a cofactor. GAD is found exclusively in the cytoplasm of synaptic GABA nerve terminals. The basic control of GABA synthesis is GAD which seems to be the rate limiting step in GABA synthesis. GABA can influence FAD activity by end-product inhibition. Saturation concentrations of L-glutamic acid are present in the presynaptic neuron; thus, increased substrate concentrations do not normally affect the rate of GABA synthesis. Therefore, the exogenous administration of L-glutamic acid may not significantly increase the neurotransmitter GABA, unless L-glutamic acid levels are abnormally low. However, it has been shown that a 10 day administration of glutamine (500 ng/kg, per day) with the drinking water to adult albino rats with different alcohol motivation resulted in a significant increase in the content of glutamate, GABA and taurine in the brain (Blum et al, 1991). Glutamine is an active intermediate in transport of ammonia from the brain and therefore may greatly affect catabolism of different amino acids in nervous tissue (Ostrovsky, 1984). After deamination, glutamine may become a precursor of glutamate and, accordingly, GABA (Thawki et al, 1983).
There are at least two types of GABA receptors: GABA-A receptor sensitive to the competitive blocking action of bicuculline and picrotoxin or picrotoxinin. These receptors are on postsynaptic structures and mediate classical inhibitory actions of GABA; and GABA-B receptors are located on presynaptic terminals and these receptors are insensitive to the blocker actions of bicuculline. GABA-B receptors can modify release of not only GABA in the CNS, but also NE from certain sites in the sympathetic nervous system.
It has been suggested that certain clinical malfunctions may be associated with GABA systems such as movement disorders, Huntington's chorea, epilepsy and alcoholism. Changes in affinity of GABA receptors for GABA, the benzodiazepine binding sites for benzodiazepines and or the barbiturate binding site for barbiturates is regulated by a protein "GABA-modulin." GABA-modulin, is similar to GTP regulator protein associated with receptors linked to adenylate cyclase. The activity of GABA-modulin is determined by phosphorylation.
GABA is typically associated with short inhibitory neurons in the hypothalamus, hippocampus, basal ganglia of the brain, substantia gelatinosa of the dorsal horn of the spinal cord and in the retina. Some long-axon pathways within the CNS have been identified as associated with GABAgeric activity.
GABA agonists include imidazole acetic acid, 3-aminopropane sulphonic acid, and THIP (4, 5, 6, 7, -tetrahydro-isoyazolo-[415-C]-pyridin-3-ol, and muscimol (3-hydroxy-5-amino-methylisoxazole) which is found in amanita muscaria. GABA antagonists include bicuculline, picrotoxin, picrotoxinin and benzylpenicillin.
There is a high-affinity sodium dependent uptake system present in presynaptic GABA nerve terminals and glial elements which inactivate released GABA by removing it from the extracellular space. Inhibitors of GABA uptake include, for the neuronal uptake type, diaminobutyric acid and cis-2, 3aminocyclohexane, carboxylic acid; for the glial uptake type B-alanine; and for the miscellaneous uptake type, nipecotic acid, benzodiazepines, neuroleptics and tricyclic antidepressants.
GABA, taken back into the presynaptic neuron after release and receptor interaction, is recycled as a potentially reusable transmitter. GABA is enzymatically metabolized in both the nerve terminal and glial tissue and converted, in the presence of A-oxoglutamic acid, to succini semialdehyde by the mitochondrial enzyme GABA amino tranferase (GABA-T). The succinic acid which is formed enters the tricarboxylic acid (Krebs) cycle. GABA-T requires pyridoxal phosphate as a co-factor. Succinic semialdehyde is rapidly oxidized to succinic acid by the enzyme succinic semialdehyde dehydrogenase which also involves NAD and NADH as co-factors. The inventors' formulation for RDS takes this fact into account by adding pyridoxal-5 -phosphate as a promoter ofthe oxidative-reductive pathway. In this regard. GABA concentrations can be increased by the administration, to animals, including humans, of the following inhibitors of GABA-T: ethanoloamine-P-sulphate, gamma acetylenic GABA, gamma vinyl GABA, gabcuculline, hydazinopropionic acid, sodium di-N-propylacetate (sodium valproate) and aminooxyacetic acid (inhibitor of Vitamin B6), L-glutamine (Bloom, 1985).
Precursor to Catecholamines (dopamine, norepinephrine). The catecholamines dopamine (DA), norepinephrine (NE) and epinephrine (E) are all neurotransmitters. Catecholamines are compounds which possess two adjacent hydroxyl (OH) groups on a benzene ring. In the body, such substances are synthesized form the aromatic amino acid L-tyrosine, which is hydroxylated to L-3, 4-dihydroxyphenylalanine (L-dopa) by the enzyme tyrosine hydroxylase. L-tyrosine is actively take up into noradrenergic nerve terminals. L-phenylalanine is a precursor of L-Tyrosine (Blum and Kozlowski, 1990; Schwartz et al, 1992).
Tyrosine hydroxylase is located in the cytoplasm of noradrenergic neurons and is the rate-limiting enzyme in the synthesis of NE. Extensive research has revealed that reduced pteridine cofactor, molecular oxygen and ferrous ions are all required for activity. In the cytoplasm, L-dopa is decarboxylated to DA by L-aromatic amino acid decarboxylase, an enzyme which requires pyridoxal phosphate (Vitamin B6) as a cofactor. The dopamine (DA) is actively taken up into granular storage vesicles in which the DA is hydroxylated to form norepinephrine (NE) by the enzyme dopamine-Bhydroxylase. This enzyme requires copper, molecular, oxygen and ascorbic acid as a cofactor. In some neurons in the CNS, NE is further converted to epinephrine (E) by the enzyme phenylethanolamine-N-methyltransferase.
Tyrosine hydroxylase activity is influenced by the following: "end product" inhibition, caused by increased concentration of NE within nerve terminals which decreases the rate of conversion of L-tyrosine into L-dopa; increased sympathetic activity from the CNS which increases the synthesis of NE; the angiotensin II mediated increases the rate of NE synthesis; and agonists (e.g., clonidine) and blockers (e.g., phentolamine) of adreno-receptors which change the rate of NE release by mechanisms involving adrenergic receptors located on the presynaptic terminal. Inhibitors of the enzymes of NE synthesis include: methyl-p-tyrosine (inhibits tyrosine hydroxylase); carbidopa (inhibits aromatic amino acid decarboxylase in tissues outside the CNS); and diethyldithiocarbonate, FAI63 and disulfiram (inhibitors of dopamine-B-hydroxylase).
NE is stored within the nerve terminal in multiple storage complexes and more than one anatomical location. One form of NE storage type is a granular complex found within vesicles in noradrenergic nerve terminals. The granular complex consists of NE bound to ATP, several proteins collectively called chromogranins, includes dopamine-B-hydroxylase and Mg++, Zn++ and Cu++.
The uptake of DA and NE into storage vesicles is an active-transport process which requires ATP as an energy source and Mg++ to activate the ATPase enzyme which is Mg++ dependent. This Mg++-dependent uptake process of NE and DA into storage vesicles is a separate and different process from the neuronal uptake process for NE across the nerve cell membrane, which is an Na.sup.+ /K.sup.+ -ATPase dependent.
The stability of the NE- ATP -protein- ion storage complex can be disrupted by some compounds which act as chelators of Mg++. This may be linked to the magnesium deficiency sometimes found in chronic cocaine abusers. In this regard, chronic administration of cocaine produces an increase in NE turnover.
Release of NE from nerve terminals occurs by a process of exocytosis, which is calcium dependent, whereby a vesicular membrane fuses with the plasma membrane and the vesicular contents, consisting of NE, ATP, dopamine-Bhydroxylase and chromogranins, are released into the synaptic cleft. One mechanism known to control the availability of NE to postsynaptic receptors operates by means of presynaptic receptors located on the terminal from which NE is released. The actions of NE in the synaptic cleft are terminated by removal from the synaptic cleft by an uptake system found on presynaptic nerve endings. There are two types of neuronal uptake of NE~uptake I and uptake II. Uptake I is energy dependent, requiring ATP which is broken down by a sodium dependent ATPase. This is a high-affinity process, which means that it is efficient at the eliminating low concentrations of NE from the synaptic cleft. The neuronal uptake system transports NE into the nerve terminal. Inside the nerve terminal most of the NE is taken up into storage vesicles. Inhibitors of this process include: cocaine, tricyclic anti-depressants, amphetamine and tyramine.
Uptake II involves the accumulation of NE by nonneuronal tissues. High plasma levels of NE derived from stimulation of the adrenal medulla, or intravenous injection of a catecholamine will be removed by uptake into non-nervous tissues such as liver, muscle and connective tissue. The NE or any other catecholamine diffuses back into the circulation or, more commonly is destroyed intracellularly by the enzymes monoamine oxidase (MAO) and catechol-O-methyltransferase (COMT).
MAO is found in all tissues which contain mitochondria, and is bound to their outer membranes. MAO is present in liver, brain, nerves, muscles and all actively metabolizing tissues. It oxidatively deaminates NE to c, 4-dihydroxymandelic acid which can then by O-methylated (by COMT) to give rise to 3-methoxy-4-hydroxy-mandelic acid. MAO in actuality describes a group of isoenzymes which possess different tissue distributions, substrate specificities, inhibitor characteristics and physical properties. For example, MAO A has a substrate preference for NE and 5HT, and is selectively inhibited by clorgyline. MAO B has a substrate preference for olopamine and phenylethylamine, and is selectively inhibited by deprenyl (selegiline). Other well known MAO inhibitors include iproniazid, nialamide, pargyline, tranclypromine and phenelzine.
COMT is found in large quantity in liver cells. In the CNS, COMT acts on E and NE which has not been inactivated by neuronal re-uptake. Pyrogallol, an inhibitor works by blocking the COMT dependent transfer of a methyl group from S-adenosyl-L-methionine to the hydroxyl group at the 3' position of the catechol ring of NE, E and DA. Dopamine is the precursor of NE and E, and plays a significant role in the CNS and at some ganglia in the autonomic nervous system. High intraneuronal amounts of DA inhibits tyrosine hydroxylase by end-product inhibition, thus decreasing the rate of DA synthesis. Furthermore, the rate-limiting step in the synthesis of DA is the conversion of tyrosine to L-dopa by tyrosine hydroxylase. Under normal situations tyrosine hydroxylase is completely saturated with L-tyrosine and thus increase in circulatory tyrosine levels do not increase the rate of DA synthesis. However, this fact changes when there is a deficit in both the amount of DA and when tyrosine hydroxylase is compromised as under the influence of cocaine.
L-dopa is actively taken up into DA neurons in the CNS where it is converted to DA. Following L-dopa therapy there is a significantly increase in the amount of DA synthesized and stored. By comparison with the dopaminergic system, there is relatively little increase in the synthesis of NE following L-dopa, treatment.
Dopamine is stored in storage granules where the catecholamine is complexed with chromogranins, divalent metal ions and ATP. DA is believed to be released into the synaptic cleft by exocytosis. As with NE, this is a calcium dependent process and occurs in response to action potentials reaching nerve terminals or to drugs. The following substances can increase DA release; cocaine, (+)-amphetamine, methylamphetamine, tyramine, amantadine, m-phenmetrazine, phentermine and nomifensine. In addition to causing the release of DA, these compounds can also, to different degrees, inhibit neuronal re-uptake of DA.
After DA is released into the synaptic cleft its action is terminated by a neuronal re-uptake system which is a high affinity, energy-dependent active-transport process. The system is similar to that already described for NE. Both MAO and COMT are responsible for the transformation of DA to 3, 4-dihydroxyphenylacetic acid (DOPAC) and homovanillic acid (HVA, 3-methoxy-4-hydroxy-phenylacetic acid), respectively. Cocaine, by virtue of blocking re-uptake of DA into presynaptic nerve terminals, prolongs the effect of release DA in the synaptic cleft.
Elevation of brain tyrosine levels results in an increase in L-DOPA synthesis in the brain. L-DOPA in turn is metabolized to dopamine. The synthesis and release of dopamine is elevated following tyrosine administration. Without increasing catecholamine levels, dietary tyrosine increases turnover and release of dopamine and norepinephrine. Stress, cold or certain drugs, induce an increase in nerve firing to lower the levels of catecholamines in the nerve terminals.
L-Phenylalanine is an essential amino acid which is also a precursor for the synthesis of the neurotransmitters dopamine and norepinephrine. These neurotransmitters, as measured by their metabolites, HVA, DOPAC, and MHPH, are significantly altered during periods of intense exercise and physical endurance. L-phenylalanine may be used instead or in combination with L-tyrosine or L-dopa to restore dopamine reserves after depletion by cocaine abuse.
The use of these precursors may be supplemented at appropriate stages of treatment with dopaminergic releasers, blockers, agonists or antagonists, or agents affecting the reuptake or degradation of dopamine, norepinephrine or epinephrine. However, and more importantly, the entire range of dopaminergic activity including synthesis, and release is regulated to some degree by certain opioid peptides (e.g., enkephalins and endoφhins). Centrally administered opioid peptides (endoφhins and enkephalins) produce elevations in levels of catecholamines in blood plasma in animals and humans (Clouet, 1982). In fact, blockade of presynaptic dopaminergic receptors results in an enhancement of B-endoφhin release, showing a unique reciprocal relationship. Compounds that may be used as precursors include L- tyrosine, L-phenyalanine, pharmaline.
Rhodiola Rhosea extract (pharmaline) Rhodiola rosea, or Golden Root, is a perennial herbaceous plant of the Oφine (Crassulaceae) family, growing in the Polar Arctic and Alpine regions. In the altai mountains, in Eastern Siberia, Tien-sdhein and in the Far East, the cultivation of Rhodiola rosea has been successfully mastered. It is possible to reproduce it both from seeds and by a vegetative method (Polozhy et al, 1985; Saratikov and Krasnov, 1987). The rhizomes contain phenol compounds, among them the most important are p-oxyphenylethanol (tyrasol) and its glycoside salidroside determining the biological activity of the Rhodiola preparations (Saratikav et al, 1968). Rhodiola possess stimulative and adaptogenic characteristics. It is thought that this compound improves the ability to perform physical work; reduce fatigue; shorten the recovery period after prolonged musclar workloads; and normalize cardiovascular activity. During intensive muscular work Rhodiola prevent loss of micurgic phosphates in brain and muscles by optimization of the processes of oxidative phosphorylation, stabilizing the muscular activity of lipids; improving the indicators of metabolism (activation of aminacyl-t-RNA-synthetase) in the skeletal muscles, increase ofthe RNA content, and increasing the blood supply to the muscles, especially to the brain (Saratikov et al, 1968; Saratikov, 1974). Rhodiola can increase attention span, memory; improve mental work and enhance performed work. The area of the brain involved in this activity is the thalamocortical and posterior hypothalamus (Marina et al. 1973). Various other action have been noted for Rhodiola and include; prevent development of hyper-and hypoglycemia, leukocytosis and leukopenia, erythrocytosis and erythropenia, hypoxia; reduce stress and bring about a cardio-protective action. The stress-regulative effect of Rhodiola involves it's normalizing effect on the hypophyso-adrenal and opiodergic system. It has also been found that Rhodiola increases the anti-tumor resistance of the organism. It significantly inhibits the growth of experimental tumors, decrease the frequency of their metastases; prolongs the life expectancy of animals with recidivistic tumors, and decrease the outcome of spontaneous tumors (Dementyeva and Yaremenko, 1983). Their is some evidence that Rhodiola also reduces neurosis and fights exhaustion (Saratikov, 1977).
Salidrosid (an extract of Rhodiola) Salidrosid (SAL) at 30 mg/kg prevented disulfiram-induced decrease of NE in the brain of animals. SAL influences brain NE by virtue of its ability to inhibit the activity of COMT and MAO. SAL does not decrease the permeability of the Blood Brain Barrier (BBB) for precursors of the catecholamines and serotonin, and this property makes it useful for the composition, particularly in embodiments for the treatment of attention processing disorder. Administration of rhodosine (which contains SAL, aglycone p-tyrosol and rosavin) at 0.2 mg/kg increases the brain concentration of DOPA, dopamine (DA), and 5-HT in the neocortex and a decrease of the level of NE in the caudate nucleus in the brain of the intact mice, 30 min after subcutaneous injection others have shown that SAL did not alter the levels of epinephrine (EPI) and DOPA: at a dose of 30 mg/kg, it decreased the content of NE by 26% and of %HT, by 15%; at a dose of 100 mg/kg, it decreased the concentration of NE, DA and 5-HT by 20. 28, and 23%, respectively. Studies involving the administration of L-dopa (50 mg/kg) and 50 HTP (100 mg/kg) to mice showed that salidrosid (30 mg/kg) increases the rise in exogenous DOPA and serotonin in animals by 26 and 13%, respectively, compared to saline-dopa-5HT- controls. These data indicate that the preparation increased the permeability of the blood brain barrier for the catecholamine precursor. Moreover, from the research of Petkov (1981) indicates that SAL decreases MOA activity and inhibits COMT activity thereby, slowing the inactivity of Catecholamines by O-methylation and oxidative deamination. Moreover, studies have shown that SAL does not alter the activity of %- HTP decarboxylase. Consequently, it does not influence the synthesis of serotonin from 5-HTP, but may slow the biotransformation of the amine, by slightly inhibiting MAO. Evidently the increase in the rise of serotonin in the brain in studies involving the combined administration of 5-HTP and SAL is governed by the capacity of the latter to increase the permeability ofthe blood brain barrier for 5-HTP.
The literature reveals a number of interactions with Rhodiola and neurotransmitter dynamics. In summary, a decrease of dopamine in the n. accumbens; an increase of 5-HT in the hypothalamus; an increase of NE in the hippocampus; and an agonistic activity of cholinergic receptors has been reported. Certain mechanisms are accepted in neuroscience related to the differential roles of various neurotransmitters in terms cognition. Cholinergic mechanisms underlie the fixation of memory trace. The noradrenergic system of the brain enhances positive reinforcement. The serotonergic mechanisms are more involved in the process of the consolidation of memory.
The effects of Rhodiola in rats was studied using several methods of active avoidance with negative and positive reinforcement (Petkov et al. (1986). Using the maze-method with negative (punitive) reinforcement, it has been found that Rhodiola extract in a single dose of 0.10 ml per rat essentially improves learning and retention after 24 h. Significant improvements of the long-term memory is also established in memory tests after 10 day treatment with the same dose of the extract. In a dose of 0.10 ml per rat the Rhodiola extract had a favorable effect on the training processes using the "staircase" method with positive (food) reinforcement as well. In contrast, with other methods used Rhodiola extract in the dose used (0.01 ml per rat) had no substantial effect on learning and memory, showing the inconsistency of this alcohol- aqueous extract.
Albino rats were used to study the effects of meclofenoxate and Rhodiola on the memory-impairing action of convulsant electroshock (Lazarova et al, 1986). While Meclofenoxate administered i.p. in a dose of 100 mg/kg body weight for five days prevented the retrograde amnesia observed after convulsant electroshock upon retention testing on the 3rd and 24th h after the end of the training session. In contrast, once again Rhodiola extract administered orally in a dose of 0.10 ml/rat for 10 days, which in other experimental approaches improved learning and memory, remained ineffective here.
Huperzine. Huperzine is a compound belonging to a class know as acetylcholinesterase inhibitors. It has been shown to inhibit the enzyme that is responsible for the breakdown of acetylcholine, an important neurotransmitter, or brain chemical, which is believed to be critical in learning and memory. Huperzine is a naturally occurring compound that was originally isolated from the club moss Huperzine Serrata. It has been used in Chinese folk medicine and more recently in limited clinical trials conducted in China as a treatment for age-related memory disorders. Results suggest that it improves learning and memory in certain patients. However, these suggested results have not been substantiated by clinical trials. This natural substance is contemplated for use with the composition of matter claimed in this patent to affect attentional processing. In humans the recommended dose to enhance memory is 150 μg daily (the therapeutic range is 1.50 to 1,500 meg daily).
The effects of huperzine A on memory impairments induced by scopolamine were evaluated using a radial maze task and inhibition of cholinesterase in vitro compared with the effects of E2020 and tacrine. Scopolamine (0.2 mg/kg) significantly impaired spatial memory in rats. Huperzine A (0.1-0.4 mg/kg, by mouth (p.o.)) E2020 (0.5-1.0 mg/kg, p.o.) and tacrine (1.0-2.0 mg/kg, p.o.) could reverse these scopolamine-induced memory deficits. The ratios of huperzine A, E2020 and tacrine for butyrylcholinesterase:acetylcholinesterase determined by a colourimetric method were 884.57, 489.05. and 0.80, respectively. The results demonstrated that huperzine A was the most selective acetylcholinterase inhibitor, and improved the working memory deficit induced by scopolamine significantly better than did E2020 or tacrine. indicating it may be a promising agent for clinical therapy of cognitive impairment in patients with Alzheimer's Disease (Cheng et al, 1996).
Huperzine A, a novel, potent, reversible, and selective acetylcholinesterase (AChE) inhibitor has been expected to be superior to other AChE inhibitors now for the treatment of memory deficits in patients with Alzheimer's disease. The effects of huperzine A on performance of AF64A-treated rats in the radial maze have been assessed (Zhi et al, 1995). AF64A (2 nmol per side, i.e. v.) caused significant impairment in rats' ability to perform the spatial working memory task. This behavioral impairment was associated with a significant decrease in the activity of choline acetyltransferase (ChAT) in the hippocampus. Huperzine A (0.4-0.5 mg kg-1, i.p.) significantly ameliorated the AF64A-induced memory deficit. These results suggest that AF64A is a useful agent for disrupting working memory processes by altering hippocampal cholinergic function, and such impairment can be effectively ameliorated by huperzine A (Zhi et al, 1995).
A major component of Huperazon™ is a proprietary extract of the club moss, Huperzia serrata used to treat Alzheimer's. Studies carried out in China indicated that the active substance in this extract Huperzine A, is a promising new treatment for Alzheimer's disease. Other studies indicate that Huperzine A is a superior acetylcholinesterase (AChE) inhibitor with excellent penetration into the CNS and a remarkable in vivo half-life. Two double-blind clinical trials carried out in China demonstrate that Huperzine A is both safe and effective for the long term treatment of Alzheimer's dementia. In addition to its activity as an AChE inhibitor, recent findings indicate that Huperzine A has other neuroprotective functions: Huperzine A inhibits glutamate-induced cytotoxicity in cultures of rat neonatal hippocampal and cerebella neurons; Huperzine A promotes dendrite outgrowth of neuronal cultures.
Alzheimer's disease is characterized by abnormalities and degeneration of neurons which depend upon acetylcholine and acetylcholine esterase for normal activity and viability. These cells located in the basal forebrain are also implicated in other neurological diseases such as Parkinson's disease. Huperzine A is a potent inhibitor of acetylcholine esterase, superior in activity to Cognex , the first drug licensed in the USA for Alzheimer's disease and E2020 which was licensed recently by Eisai Pharmaceuticals. In addition, Huperzine A has been shown to protect neuronal cells in culture from death caused by the excitoamino acid glutamate. Because of the dual pharmacological action of Huperzine A, Huperazon™ provides a unique and important activity for the treatment of attention deficit and senile memory deficits. Toxicology and efficacy studies of Huperzine A show it to be non-toxic even when administered at 50-100 times the human therapeutic dose. The extract is active for 6 h at a dose of 2 μg/kg with no remarkable side effects.
In Alzheimer's disease, double blind controlled studies of over 160 patients, showed significant improvement measured by Weschler scale results, at doses of only 150 μg given twice daily (3-5 μg/kg). In an assessment of patients by their caretakers comparing Huperzine A with a placebo 1 1 patients on the placebo reported an improvement in clear headedness as compared with 26 patients on the Huperzine A, 8 patients on the placebo demonstrated improved memory as compared with 16 on Huperzine A, and one patient demonstrated language improvement as compared with 8 on Huperzine A.
In comparing the improvement in memory between patients on Huperzine A and patients on piracetam, 50% of the patients on piracetam demonstrated improved memory as compared with 85%) on Huperzine A, 30% on piracetam demonstrated markedly improved memory as compared with 70% on Huperzine A, and 50% on piracetam demonstrated no improvement while only 15%> of the Huperzine patients demonstrated no improvement in memory.
Two important characteristics of Huperzine A distinguish it from Cognex® and E2020 as well as other experimental compounds in development. Huperzine A is highly specific for brain acetylcholine esterase (AChE) vs. AChE found elsewhere in the body. This selectivity is believed to be responsible for the relatively low toxicity of the extract. In addition, unlike the two approved drugs for Alzheimer's disease, Cognex® and E2020, Huperzine A has been shown to lack binding to receptors in the CNS that can cause side effects such as the muscarinic receptors Ml and M2.
The duration of action of Huperzine A at 3 h is superior to Cognex® (2 h) and physostigmine (30 min). In behavioral studies of learning and memory enhancement in animals, the difference between amounts of the extract effective for memory and learning and the no-toxic-effect dose (from toxicity studies) was 30-100 fold. These data strongly suggest that Huperzine A can be useful in treating Alzheimer's disease with minimal side effects.
Chromium Salts (such as Picolinate, Nicotinate, etc.). Dietary chromium is an essential nutrient whose value in human nutrition has been conclusively documented. Interest in chromium stems from the view that because chromium is an essential trace mineral and a cofactor to insulin, it could play a role in glucose, lipid, and amino acid metabolism by it's potentiating effects on insulin action. Supporting this argument is the observation that chromium deficiency results in impaired glucose tolerance, insulin resistance, elevated blood glucose levels, and symptoms of type 11 diabetes; in addition, adequate amounts of physiologically active forms of chromium can reduce insulin requirements in humans (Kaats et al, 1996).
The National Academy of Sciences has classified chromium as an essential trace mineral and recommends daily intakes of 50 to 200 μg. However, the most reliable studies report that intake among Americans (which is similar for other countries) is suboptimal - only 40% of the minimum for women and 60 % for men. There are more than 25 human studies documenting the beneficial effects of supplemental chromium on subjects living at home including improvements in glucose, insulin, and lipid levels; impaired glucose tolerance; adults with elevated cholesterol levels; insulin and hypoglycemic patients (Mertz, 1992).
To increase the bioavailability of chromium, several studies have suggested using picolinate acid, a naturally occurring metabolic derivative of tryptophan.
Picolinate acid appears to combine with trace metal ions in the intestines and blood, which facilitates the collection and use of essential trace metals (Evans and Bowman, 1992). Because deposition of body fat appears to be regulated in part by insulin, improvements in insulin utilization should lead to reductions in fat deposition. Enhancing the effects of insulin can also have positive effects on muscle tissue because insulin directs amino acids into muscle cells; once amino acids enter the muscle cells, they are assembled into proteins through insulin's effects on the cell's genetic material, that is, DNA and ribonucleic acid. This effect of Chromium is important for this invention since by doing so it reduces the competition of amino acids like valine or leucine thereby allowing for increased amounts of the amino acid tryptophan (Wurtman, 1982). Insulin also slows the breakdown, or catabolism, of body protein with a net effect of increasing the protein available for building tissue. Chromium can potentially facilitate the maintenance or addition of fat-free mass (FFM). It has been suggested that if CrP can lower insulin resistance it can improve body composition, as insulin resistance or deficiency results in impaired entry of glucose and amino acids into muscle cells and increased catabolism of muscle protein as well as insulin deficiency's potential to accelerator lipid deposition (Kaates et al. , 1996). Other references indicate that insulin resistance may help stabilize body fat in the obese patient, albeit at an obese level, acting much like a "set point" to prevent further weight gain (Eckel, 1992). In general, although animal studies have supported this contention (Liarn et al, 1993), one human study found positive changes in body composition with CrP supplements (Hasten et al, 1992), another reported positive, although not statistically significant changes in body composition (Hallmark et al, 1993), and a third failed to find any positive changes in body composition with CrP supplementation (Clancey et al, 1994). The controversial nature of the literature reveals that most human studies used small numbers of subjects, and subjects often followed exercise or conditioning programs that could increase the need for chromium at amounts higher than amounts provided in these studies.
Previous work observing concurrent chromium supplementation and exercise training has been restricted to effects on body weight and composition, with conflicting results (Clancy et al, 1994; Evans et al, 1989; Evans et al, 1993; Hallmark et al, 1996; Hasten et al, 1992) . Chromium Picolinate is the most heavily used, studied and promoted chromium compound, but in vitro work suggests that chromium nicotinate may be also viable in the area of weight loss and changes in body composition. In this regard, very recent work by the inventors suggest that the nicotinate salt may be even more important than the picolinate salt (Grant et al, 1997). This data is presented here as an example of the usefulness of Chromium Nicotinate as an addition to the basic composition of matter specified in the embodiment of this patent application.
Pharmaceutical Compositions. Aqueous compositions of the present invention comprise an effective amount of the various compounds disclosed to treat RDS related disorders, including obesity, ADHD, Tourettes syndrome, PMS, smoking, and any other related behavior described herein, dissolved or dispersed in a pharmaceutically acceptable carrier or aqueous medium. The phrases
"pharmaceutically or pharmacologically acceptable" refer to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to an animal, or a human, as appropriate.
As used herein, "pharmaceutically acceptable carrier" includes any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absoφtion delaying agents and the like. The use of such media and agents for pharmaceutical active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active ingredient, its use in the therapeutic compositions is contemplated. Supplementary active ingredients can also be incoφorated into the compositions. For human administration, preparations should meet sterility, pyrogenicity, general safety and purity standards as required by FDA Office of Biologies standards.
The biological material should be extensively dialyzed to remove undesired small molecular weight molecules and/or lyophilized for more ready formulation into a desired vehicle, where appropriate. The active compounds will then generally be formulated for parenteral administration, e.g., formulated for injection via the intravenous, intramuscular, sub-cutaneous, intralesional, or even intraperitoneal routes. The preparation of an aqueous composition that contains an active component or ingredient will be known to those of skill in the art in light of the present disclosure. Typically, such compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for using to prepare solutions or suspensions upon the addition of a liquid prior to injection can also be prepared; and the preparations can also be emulsified.
The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions; formulations including sesame oil, peanut oil or aqueous propylene glycol; and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
Solutions of the active compounds as free base or pharmacologically acceptable salts can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof and in oils. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
A compound for treatment of an RDS related disorder of the present invention can be formulated into a composition in a neutral or salt form. Pharmaceutically acceptable salts, include the acid addition salts (formed with the free amino groups of the protein) and which are formed with inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic, and the like. Salts formed with the free carboxyl groups can also be derived from inorganic bases such as, for example, sodium, potassium, ammonium, calcium, or ferric hydroxides, and such organic bases as isopropylamine, trimethylamine, histidine, procaine and the like. In terms of using peptide therapeutics as active ingredients, the technology of U.S. Patents 4,608,251 ; 4,601,903; 4,599,231;
4,599,230; 4,596,792; and 4,578,770, each incoφorated herein by reference, may be used. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetable oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absoφtion of the injectable compositions can be brought about by the use in the compositions of agents delaying absoφtion, for example, aluminum monostearate and gelatin.
Sterile injectable solutions are prepared by incoφorating the active compounds in the required amount in the appropriate solvent with various of the other ingredients enumerated above, as required, followed by filtered sterilization. Generally, dispersions are prepared by incoφorating the various sterilized active ingredients into a sterile vehicle which contains the basic dispersion medium and the required other ingredients from those enumerated above. In the case of sterile powders for the preparation of sterile injectable solutions, the preferred methods of preparation are vacuum-drying and freeze-drying techniques which yield a powder of the active ingredient plus any additional desired ingredient from a previously sterile- filtered solution thereof. The preparation of more, or highly, concentrated solutions for direct injection is also contemplated, where the use of DMSO as solvent is envisioned to result in extremely rapid penetration, delivering high concentrations of the active agents to a small area.
Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed. For parenteral administration in an aqueous solution, for example, the solution should be suitably buffered if necessary and the liquid diluent first rendered isotonic with sufficient saline or glucose. These particular aqueous solutions are especially suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this connection, sterile aqueous media which can be employed will be known to those of skill in the art in light of the present disclosure. For example, one dosage could be dissolved in 1 ml of isotonic NaCl solution and either added to 1000 ml of hypodermoclysis fluid or injected at the proposed site of infusion, (see for example, "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038 and 1570-1580). Some variation in dosage will necessarily occur depending on the condition of the subject being treated. The person responsible for administration will, in any event, determine the appropriate dose for the individual subject.
The active agents described herein may be formulated within a therapeutic mixture to comprise about 0.0001 to 1.0 milligrams, or about 0.001 to 0.1 milligrams, or about 0.1 to 1.0 or even about 10 milligrams per dose or so. Multiple doses can also be administered.
In addition to the compounds formulated for parenteral administration, such as intravenous or intramuscular injection, other pharmaceutically acceptable forms include, e.g., tablets or other solids for oral administration; liposomal formulations; time release capsules; and any other form currently used, including cremes.
One may also use nasal solutions or sprays, aerosols or inhalants in the present invention. Nasal solutions are usually aqueous solutions designed to be administered to the nasal passages in drops or sprays. Nasal solutions are prepared so that they are similar in many respects to nasal secretions, so that normal ciliary action is maintained. Thus, the aqueous nasal solutions usually are isotonic and slightly buffered to maintain a pH of 5.5 to 6.5. In addition, antimicrobial preservatives, similar to those used in ophthalmic preparations, and appropriate drug stabilizers, if required, may be included in the formulation. Various commercial nasal preparations are known and include, for example, antibiotics and antihistamines and are used for asthma prophylaxis. Additional formulations which are suitable for other modes of administration include vaginal suppositories and pessaries. A rectal pessary or suppository may also be used. Suppositories are solid dosage forms of various weights and shapes, usually medicated, for insertion into the rectum, vagina or the urethra. After insertion, suppositories soften, melt or dissolve in the cavity fluids. In general, for suppositories, traditional binders and carriers may include, for example, polyalkylene glycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%.
Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders. In certain defined embodiments, oral pharmaceutical compositions will comprise an inert diluent or assimilable edible carrier, or they may be enclosed in hard or soft shell gelatin capsule, or they may be compressed into tablets, or they may be incoφorated directly with the food ofthe diet. For oral therapeutic administration, the active compounds may be incoφorated with excipients and used in the form of ingestible tablets, buccal tables, troches, capsules, elixirs, suspensions, syrups, wafers, and the like. Such compositions and preparations should contain at least 0.1% of active compound. The percentage of the compositions and preparations may, of course, be varied and may conveniently be between about 2 to about 75% of the weight of the unit, or preferably between 25-60%. The amount of active compounds in such therapeutically useful compositions is such that a suitable dosage will be obtained.
The tablets, troches, pills, capsules and the like may also contain the following: a binder, as gum tragacanth, acacia, cornstarch, or gelatin; excipients, such as dicalcium phosphate; a disintegrating agent, such as corn starch, potato starch, alginic acid and the like; a lubricant, such as magnesium stearate; and a sweetening agent, such as sucrose, lactose or saccharin may be added or a flavoring agent, such as peppermint, oil of wintergreen, or cherry flavoring. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier. Various other materials may be present as coatings or to otherwise modify the physical form of the dosage unit. For instance, tablets, pills, or capsules may be coated with shellac, sugar or both. A syrup of elixir may contain the active compounds sucrose as a sweetening agent methyl and propylparabens as preservatives, a dye and flavoring, such as cherry or orange flavor.
Kits. Therapeutic kits of the present invention are kits comprising one or more of the agents or compounds described herein for the treatment of RDS and related behaviors. Such kits will generally contain, in suitable container means, a pharmaceutically acceptable formulation of any ofthe foregoing in a pharmaceutically acceptable formulation. The kit may have a single container means, or it may have distinct container means for each compound.
When the components of the kit are provided in one or more liquid solutions, the liquid solution is an aqueous solution, with a sterile aqueous solution being particularly preferred. The compound(s) for treatment of an RDS related disorder may also be formulated into a syringeable composition. In which case, the container means may itself be a syringe, pipette, or other such like apparatus, from which the formulation may be applied to an area of the body, injected into an animal, or even applied to and mixed with the other components ofthe kit.
However, the components of the kit may be provided as dried powder(s). When reagents or components are provided as a dry powder, the powder can be reconstituted by the addition of a suitable solvent. It is envisioned that the solvent may also be provided in another container means.
The following examples are included to demonstrate preferred embodiments of the invention. It should be appreciated by those of skill in the art that the techniques disclosed in the examples which follow represent techniques discovered by the inventor to function well in the practice of the invention, and thus can be considered to constitute preferred modes for its practice. However, those of skill in the art should, in light of the present disclosure, appreciate that many changes can be made in the specific embodiments which are disclosed and still obtain a like or similar result without departing from the spirit and scope ofthe invention. EXAMPLE 1
AMINO ACID LOADING AND ENKEPHALINASE INHIBITION
IN FAMILIAL OVEREATING
INTRODUCTION The inventors believe RDS is the response to one or more neurotransmitter deficits. Attempts to alleviate this neurotransmitter imbalance through drug-receptor activation will only substitute for lack of reward and will yield merely a temporary sense of well-being. In this regard, the inventors have shown that recovery from certain forms of uncontrollable ingestive behavior (i.e. SUD) is significantly facilitated by the use of neuronutrients designed to restore brain chemical deficits through the administration of both precursor amino acids and enkephalinase inhibitors (Blum et al, 1988a; Blum et al, 1988b; Brown et al, 1990). The inventors decided to evaluate the question of whether amino acid precursor loading and enkephalinase inhibition would enhance maintenance of weight loss in an outpatient setting over a two year period.
METHODS
Subject Selection and Program The subjects of this study were 247 outpatients in a very low calorie, supplemented fasting program at the Behavioral Medicine Group Clinic in Sacramento, California. Subjects used Optifast as a nutritional fasting product until they were within 15%> of their goal weight or until the patient elected not to continue fasting. The inventors contemplate that other diet regiments as prescribed under the care of a physician would work instead of Optifast . Standard Metropolitan Life Insurance height/weight tables were used to determine ideal weight. All subjects took Centrum vitamins during the entire study. Each subject gave informed consent and the protocol was approved by the Behavioral Medicine Medical Group Clinic Institutional Review Committee and the University of Texas Health Science Center at San Antonio Institutional Review Board under a protocol of obesity research.
The decision of whether or not a patient would take PHENCAL™ or not was made at the end of fasting. The patients that complained about having the highest bingeing score and the most difficult time from resisting certain carbohydrates like sweets (sweet tooth), breads, citrus fruits, pasta, etc. and who had had difficulty in loosing weight or even achieving their goal weight were considered to be the more difficult to treat. Patients complaining the most or patients who were not in control of their eating were selected to take PHENCAL™ (study group; N=130). If maintenance appeared to be effortless, then the patient was not offered PHENCAL™ (control group; N=117). For the selected subjects, PHENCAL™ treatment was begun at the end of fasting and continued during the maintenance period until the end of the study at two years. PHENCAL™ is an amino acid and vitamin supplement and is the forerunner of PHENCAL™ designed, developed and manufactured by 1899 Limited Liability Coφoration (San Antonio, Texas) and marketed by the Weider Nutrition Group (Salt Lake City, Utah). The selected patients took six capsules of PHENCAL™ per day, which consisted of 460 mg DL-phenylalanine, 25 mg L- tryptophan, 25 mg L-glutamine, and 5 mg pyridoxal -5'-phosphate. 33 μg chromium picolinate, and 10 mg L-carnitine.
Patients were weighed weekly before or after attending an educational class. The educational class attended by each patient was taught by the medical director of the program and a registered dietitian which was structured to include information about the disease of obesity, its prevalence in society, its potential prevention, its impact on one's health and welfare, its treatment, the role of family, the potential of a genetic disorder, the utilization of nutritional supplementation, the role of proper nutrition in eating, the concept of high protein, low fat and very low or no carbohydrates in diet, the role of exercise. In addition their psychological status and medical condition were monitored on a weekly basis. Psychological status was monitored as scores on rating scales for food craving, moodiness and binge eating. Craving and binging were recorded on a scale of 1 to 5. A score of 5 on the craving scale indicated feeling totally out of control and eating past discomfort. A score of 1 indicated a nagging desire even though the person knew he/she was satisfied and physiologically should not be craving. Moodiness was rated on a similar scale with 5 being very moody and 1 being minimally moody. Binging was recorded as number of episodes per wk of eating past the point of being full. Laboratory analysis of blood alternated every other wk while urinalyses provided information about medical condition. A chemistry panel and SMAC-CBC were performed on the blood, while urine was analyzed mainly for ketones and/or glucose. The educational class was one h per wk. Principles of nutrition, exercise, behavioral changes, and stress management to support weight loss and long term maintenance were emphasized.
Characteristics of the subject population. Of the 247 subjects, 84% were female. All subjects were Caucasian and the mean age was 40 years. The average subject was 74% overweight upon entry to the program.
The 130 study subjects taking PHENCAL™ did not differ significantly from the 1 17 control subjects in age, ideal weight, start weight, percent overweight, craving, mood swings, binge eating, or family history of obesity (see Table 20-B). However, they did differ in family history of chemical dependency (CD+). Of the subjects in the study group, 65% had a family history of chemical dependency (CD+) while 39% of the control subjects were CD+ (p < 0.005). Since subjects were selected to be in the study group if they complained more or had a loss of control during weight maintenance, these data suggest that CD+ subjects complained more and appeared to have a more difficult time during the weight maintenance period.
TABLE 20-B
No. of Age % % Ideal % Over- % %
Subjects (years) Female Weight weight OB CD
Total 247 39.8 84.2 130.2 74.3 68.1 52.3
Population
PhenCal 130 38.9 83.8 129.1 74.4 64.5 65.4
Group
Non- 117 40.7 84.6 131.4 74.3 71.8 39.3
PhenCal
Group
Subject characteristics. Numbers are presented as mean values. % Overweight=[start weight-ideal weight]/ideal weight; % OB=percentage of group that reported a family history of obesity; % CD=percentage of group that reported a family history of chemical dependence. Phencal™ is a product of 1899 Limited Liability Coφoration, San Antonio, Texas and Weider Nutrition Inc., Salt Lake City, Utah.
Gender Differences. The 208 females in the study were an average of 76% overweight at the start, while the 39 males were 66% overweight. Standard Metropolitan Life Insurance height/ weight tables were used to determine ideal weight. Almost three-quarters (73%) of the females were morbidly obese, (i.e. 50% or more overweight), compared with about half (49%) of the males. Females outnumbered males by more than five to one in this program. During the intake interview over 90% of the females in the study reported craving food, while slightly less than 80% of the males reported craving. Occurrence of binge eating also was significantly different between males and females. Eighty percent of females reported binge eating, versus only 64% of the males.
Familial Aspects of Patients. Upon entry to the program, each subject was asked about family history of obesity and family history of chemical dependency.
Slightly more than 70% of the females, and 56% of the males reported a family history of obesity. Of those with a family history of obesity, about twice as many subjects reported having an obese mother (73%) compared to an obese father (38%). Eleven percent of those with a family history of obesity reported both parents obese. Almost half of both females and males reported a family history of chemical dependency. In this case, however, it was the father that carried the trait. Of the subjects with a family history of chemical dependency, a full 86% reported their fathers were chemically dependent, compared with only 31% of the mothers. About two thirds (63%) of the morbidly obese (50% or more overweight) subjects reported having a mother that was obese and 60% reported having a father with some form of chemical dependency. Inasmuch as males represent only 16% of the total population, any statements with regard to family history subgroups are, at best, preliminary.
RESULTS
Maintenance of weight loss. The 247 subjects lost an average of 68.4 lbs over an average of 20.0 wk of fasting. The study group differed from the control group at the end of fasting and before beginning the PHENCAL™ but this difference was non-significant. The study group was 22% overweight at the end of fasting compared to 32% overweight for the control group. Despite this difference, statistical analysis demonstrated that the weight at the end of fasting did not affect the weight reduction at two years. At the end of the two year study, subjects taking PHENCAL™ were a mean 23.5% overweight compared with 52.8% for the control group not taking PHENCAL™ (p < 0.0001 )[See FIG. 2]. After two years subjects in the study group regained only 14.7% of their lost weight as compared to 41.7%> of the control subjects who regained their lost weight (p < 0.0001).
Influence of Genetics In comparison between study and control subjects by family history (OBA CD+, OB+/CD-, OB-/CD+, and OB-/CD- groups) all groups taking PHENCAL™ were significantly less overweight after 2 years than any control sub-group (p < 0.0001). In this example, OB is not the gene it is the family history of obesity. Nil groups with a history of OB+ were more overweight after two years than the comparable OB- groups (p < 0.05 ). Although not statistically significant subjects with a family history of chemical dependency responded well to PHENCAL™. Genetics and Gender. As a whole, every family history group of males regained dramatically less weight than the comparable group of females (p < 0.0001 ). In the best of cases (OB-/CD+) at the end of two years the males regained virtually none of the weight lost during the fast. Because females outnumbered males in this study by more than five to one. and since females differed in several characteristics from males, the inventors decided to further characterize females. Seventy percent of the females reported a family history of OB+ while 54% reported a family history of CD+. Only 12% reported neither a family history of CD- nor OB-. The females who were OB+ and CD+ were on the average 58% heavier than OB-/CD- females. Moreover, OB+/CD+ females were the most overweight; followed by OBACD- then OB-/CD+, with OB-/CD- females the least overweight. A similar progression emerged for food craving, binging, eating and moodiness scores, with OBACD+ females reporting the most craving, binging, and moodiness.
Food craving and binge eating. Patients' psychological status and medical condition were monitored. Psychological status was monitored qualitatively on clinical rating scales for food craving, moodiness, and binge eating. Five-point scales were used for food craving. A score of 5 on the craving scale indicated feeling totally out of control and eating past discomfort: a score of 1 indicated a nagging desire even though the person knew he or she was satisfied and physiologically should not be craving. Moodiness was related on a similar scale, with 5 being very moody and 1 being minimally moody. Bingeing was recorded as number of episodes per wk of eating past the point of being full. Compliance with the experimental regimen was assessed by interrogation.
At the end of the study craving was reduced three-fold in the subjects taking PHENCAL™ compared to the control group (at least p < 0.0001); craving was not reduced at all in the controls. The number of binge eating episodes was reduced significantly in the subjects taking PHENCAL™ as compared with controls who were not taking PHENCAL™. Upon entry into the study the subjects reported bingeing episodes 10.9 times per wk. At the end of the study the subjects reported binging behavior only 2.9 times per wk. In contrast upon entry of the study the non- PHENCAL™ control group reported episodes of 8.3 times per wk. At the end of the study the control group reported bingeing episodes of 8.3 times per wk indicating no significant change. After two years both the craving for food and binge eating were reduced three-fold in the group taking PHENCAL™ compared to the control group.
Multiple Regression and Analysis of Variance. A stepwise multiple regression was used to test the significance of predictors of percent weight gained back two years after the start of the treatment program. The predictors were categorized as absent (0) or present (1) and indicated whether or not the patient was morbidly obese, suffered from bingeing, suffered from craving, had a family history of chemical dependency, had a family history of obesity, female gender, and was administered PHENCAL™. The stepwise selection procedure (SPSS Version 6.13 (SPSS. Inc.. Chicago, IL) selected PHENCAL™ treatment, female gender, morbid obesity, and family history of obesity as significant predictors of weight gain after two years. Bingeing behavior, craving behavior, and family history of chemical dependency were not statistically significant as predictors. The overall model of selected predictors was significant (p < 0.0001) with 39.8% of the variability in two year weight gain explained by the predictors. The most influential predictor in the predictor set was PHENCAL™, followed by morbid obesity, female gender and family history of obesity (See Table 20-C). A second analysis compared the bingeing scores before and after the 2 year period between the PHENCAL™ group and the control Centrum group. A two factor Analysis of Variance with a between group factor for PHENCAL™ treatment and a repeated measures factor for before and after two years bingeing scores was found to have a significant interaction (p < 0.001). Paired t-tests were employed to test for changes in the bingeing scores separately for the PHENCAL™ and control groups. Statistically the control group had no detectable change while the change in bingeing was dramatically reduced for the PHENCAL™ group. TABLE 20-C
Variable Slope (B) Standard Beta Weight T P
Error of B
Morbid 0.1 1 0.050 0.130 2.4 0.180 obesity
Binge 0.023 o.oo: 0.420 7.70 <0.001 eating score
PhenCal -0.327 0.003 0.426 -7.80 <0.001 use (yes)
(Constant) 0.151 0.045 3.34 <0.001
DISCUSSION
The data presented in this two year, open trial study suggest the neuronutrient PHENCAL™ suppresses aberrant eating-behavior in known carbohydrate bingers while preventing regaining lost weight. The inventors believe the apparent beneficial effects of PHENCAL™ may be explained by the action of both the precursor amino acids and enkephalinase inhibition operating on mesolimbic reward circuitry. The inventors cannot at this time provide an exact mechanism of action for this neuronutrient mixture, nor can the inventors pinpoint which ingredient or combination of ingredients best suppresses carbohydrate binging in the inventors' study.
The neurotransmitters 5-HT, DA, NE, and enkephalins have been shown to reduce the intake of sweet foods (Leibowitz, 1985; Leibowitz et al, 1982; Kaye et al, 1984; Riviere et al, 1987; Blum et al, 1990). Thus PHENCAL™ was especially designed to enhance these food inhibitory neurotransmitters through precursor amino acid loading, including l-tryptophan (5-HT precursor), l-phenylalanine (DA and NE precursor), as well as the enkephalinase inhibitor d-phenylalanine, to raise enkephalins (Blum et al, 1986). A passable positive mechanism for the observed effects of PHENCAL™ in these studies includes restoration of deficient monoamines such as 5-HT, NE, EPI, as well as the neuropeptides met-enkephalin and CCK-8. All of which are considered to be eating (carbohydrate) substances influenced by either glucose or genetics (Frohman, 1983; Fullerton et al, 1985; Matsumura et al, 1984). It is noteworthy that PHENCAL™ induced its greatest effect on females with OB+ and CD+ compared to males with the same family history. This difference may be related to the recent findings of Comings et al. ( 996b), who observed that for females alone both genetic variants of the human obesity (OB) and the human dopamine D2 (DRD2) genes accounted for up to 22.8% of the variance of the Body Mass Index (BMI). In terms of the interaction between the OB and DRD2 genes in obesity the binding of leptin to the OB receptor may be involved. This binding activates an intermediate neurotransmitter or neuropeptide that has an effect on behavior as well as on appetite and metabolism. In this regard it is known that Ob/ob mice also show significant decreased levels of dopamine in the arcuate-infundibullum (Oltmans, 1983). Based on this work, the inventors believe glucose binding is, as previously proposed, similar to other chemical dependencies (i.e. alcohol, cocaine, heroin).
At two years the group taking the amino acid regimen of PHENCAL™ compared with the non-PHENCAL™ /Centrum vitamin group showed: 1) a twofold decrease in percent overweight for both males and females; 2) a 70% decrease in craving for females and 63% decrease for males; 3) a 66%) decrease in binge eating for females and 41% decrease for males.
EXAMPLE 2 CORRELATION OF VNTR ALLELES WITH
TOURETTE'S SYNDROME AND DRUG ABUSE
TS is a complex neuropsychiatric disorder characterized by chronic motor and vocal tics and a wide range of associated behaviors including alcohol and drug abuse, depression, and obsessive compulsive, attention deficit hyperactivity, conduct, sleep, learning, sexual and anxiety disorders (Comings and Comings, 1987c, Comings, 1990, Comings and Comings, 1993, Comings, 1995d). While TS is usually assumed to be inherited as an autosomal dominant trait, Gts, (Comings et al, 1984, Pauls and Leckman, 1986), linkage studies have excluded virtually the entire genome without finding the Gts gene (Fog, 1985; Tsui, 1994). However, a highly significant increase in conduct and oppositional defiant disorder with increased genetic loading for Gts and ADHD genes was recently demonstrated (Comings, 1995a). A pedigree study of the inheritance of Tourette's syndrome indicated that the disorder was probably polygenic unless the lifetime risk of the disorder was less than 12 per 1,000 (Comings et al, 1984). TS in school age boys showed a frequency of full TS of 1 in 90, and of probable TS of 1 in 40 (Comings et al, 1990). Similar results were seen in other studies (Kurlan et al, 1994), and the frequency of TS or chronic tics in Israeli soldiers was determined to be 2.6%> (Zohar et al, 1992). In more recent pedigree studies, when the entire spectrum of TS related behaviors (Comings, 1990, Comings, 1995d) is included, many families show evidence that the genes are inherited from both parents, and it has been argued that TS is a polygenic disorders (Comings, 1990; Comings and Comings, 1992; Comings, 1994b; Comings, 1995b; Kurlan et al, 1994).
Because of the wide spectrum of associated disorders and the evidence that Gts genes are inherited from both parents (Kurlan et al, 1994; Comings, 1990), it has been implied that TS is a polygenic disorder and that these genes (MAOACX), DBH, DRD2, DATl, etc.) involve the metabolism of dopamine, serotonin, norepinephrine and other neurotransmitters, with each gene contributing only 1 to 10% of the variance (Comings, 1996b; Comings, 1995a; Comings, 1995b; Comings, 1996a).
METHODS
Group I: The TS Group. The subjects included 57 controls, 229 TS probands most of whom were severely affected with multiple associated behavioral disorders (Comings 1990), and 90 affected and unaffected relatives of TS probands. All subjects were non-Hispanic Caucasians. The mean age, type of diagnosis (TS versus chronic motor tics), and other aspects of the subjects have been described elsewhere (Comings et al, 1996a).
Behavioral scores. Each TS control and TS proband or relative was required to fill out a questionnaire based on the Diagnostic Interview Schedule (Robins et al, 1981) or DSM-I1I-R (1987) criteria. This provided a structured review of a wide range of psychiatric symptoms. These symptoms were grouped into 27 different behaviors including ADHD, substance abuse, mood, anxiety, school performance, stuttering, tics and others. The questions used for these behavioral scores have been described in detail elsewhere (Comings 1995a; Comings 1994a; Comings 1994b: Comings 1995b; Comings et al, 1996a; Robins et al, 1981; Comings 1995c). Two behavioral scores were used to assess ADHD. The first, called ADHD, was based on the presence of at least half of a series of 22 ADHD variables from DSM-III and DSM-III-R criteria. The second, ADHD-R was based on the DSM-III-R diagnostic criteria. Three QTVs not used previously were inattention, impulsivity and hyperactivity. These were the three subscores that cumulatively produced the ADHD score. QTV abbreviations include CD for conduct disorder, ODD for oppositional defiant disorder (Comings 1995a), and MDE for major depressive episode (Comings 1995c) symptoms.
The rationale for examining comorbid behaviors is the prior observation that certain genes may be more strongly associated with specific comorbid behaviors present in TS than with the diagnosis per se (Comings et al, 1996a). This questionnaire is not meant to provide DSM-III-R or DSM-IV diagnoses but rather to provide a highly structured method of producing QTVs for different areas of behavior. The advantage of continuous traits is that they provide a greater range of severity than dichotomous diagnoses. The accuracy, utility and sensitivity of a questionnaire based approach to symptom evaluation has been demonstrated by others (Gadow and Sprafkin 1994; Gray son and Carlson 1991) by comparing the use of such an instrument to an interviewer administration of the same structured instrument. Review of the questionnaires with many hundreds of subjects has indicated they accurately reflect the information obtained by personal interview.
Group II: The Substance Abuse Group. The patients consisted of 120 non- Hispanic Caucasian males.
Assessments. All subjects were assessed with the Michigan Alcoholism Severity Test (Davis et al, 1987), a 24 item self-administered questionnaire revised to include drug abuse (MAST-R), the clinician administered Diagnostic Interview Schedule (DSM-III-R version) (Robins et al, 1981), to diagnose the presence of substance dependence disorders, and the clinician administered Addiction Severity Index Fifth Edition (Hodgins and Guebaly 1992) (ASI), to evaluate a range of alcohol and drug use variables. The inventors utilized the DRUG/ALCOHOL USE and the LEGAL STATUS sections of the ASI. To assess the use of specific substances, questions were asked about the lifetime use (in years) of alcohol use to intoxication, heroin, other opiates/analgesics, barbiturates, other sedatives/hypnotic/tranquilizers, cocaine, amphetamines, cannabis, hallucinogens, and inhalants. For each of the above, where relevant, the subjects were asked about the route of administration. The options were oral, nasal, smoking, and IV injection. The continuous variable #IV drugs used was calculated by adding up the total number of different drugs injected intravenously (IV). The variable IV drug use was a dichotomous variable of 0 for no IV drug use and <1 for use of one or more drugs IV. Questions relating to drug problems asked included "How many times have you had alcohol DTs? Overdosed on drugs?" "How many days in the past 30 days have you experienced Alcohol problems? Drug Problems? "How much would you say you spent during the past 30 days on alcohol? On drugs?" Questions were also asked about various legal aspects of drug and alcohol abuse. "How many times in your lifetime were you charged with driving while intoxicated?" "How many times in your lifetime were you arrested and charged with drug charges? "How many of these charges resulted in convictions?" When the responses could range from 0 to any number, they were scored as a "0" for a 0 and a " 1 " for any other number. Those questions relevant to alcohol use were summed for a total alcohol score and those relevant to drug use were summed for the drug score. An interviewer based severity assessment for the need for treatment for alcohol and/or drug abuse ranged from 0 (no treatment necessary) to 9 (treatment needed to intervene in a life-threatening situation).
Substance abuse control group. The controls for the substance abuse group were independent of the controls for the TS patients. They consisted of two sets. The first were 45 older male, non-Hispanic Caucasian students from the California State University at San Bernardino (mean age of 30.1 years). Those with significant problems with substance abuse were excluded on the basis of the MAST-R test. The second set consisted of the male parents of twins from the Minnesota Twin Family study. Since these are ascertained from the entire state simply on the basis of having had twins 1 1 or 17 years of age, they represent a more random set of all socioeconomic and educational groups than the college students. Although all the controls were scored as negative on the substance abuse variables, since the results of substance abuse assessments were not yet available on the twin controls, some may have been positive. However, since this is a random cross section of a predominately rural state the inventors assume the number of false negatives in this group is small.
PCR™ Polymorphism. The MAOA VNTR polymoφhism (Hinds et al,
1992) was utilized. This complex polymoφhism consists of a GT microsatellite directly adjacent to an imperfectly duplicate novel 23-bp VNTR mofit, with alleles differing in both the number of dinculeotide repeats and VNTR repeats. DNA was extracted from whole blood by standard procedures. Target DNA was amplified by PCR™ (Mullis et al, 1986). To label the PCR™ products 0.1 μM of each primer labeled with fluorescent HEX or FAM Amidite (Applied Biosystems, Foster City, CA) primers were used in the reactions (See Table 20-D). Two μl of the 10 fold diluted PCR™ product was added to 2.5 μl deionized formamide and 0.5 μl of ROX 500 standard (Applied Biosystems, Foster City, CA) and denatured for 2 min at 92°C and loaded on 6% polyacrylamide gel in an Applied Biosystems 373 DNA sequencer. The gel was electrophoresed for 5 h at 1 100 volts and constant 30tW. The gel was laser scanned and analyzed using the internal ROX 500 standards. The peaks were recognized by Genotyper (version 1.1) (Applied Biosystems) based on the color fragments sized by base pair length. Complete information for each sample was printed from every gel file and the compiled data was submitted for analysis.
Allele groups. To examine the hypothesis that the length ofthe MAOA alleles might correlate with a phenotypic effect, the alleles were divided into four groups (see
Results). These were labeled 1 to 4, shortest to longest to form the MAOA genotype variable. Females were utilized only in the TS group. Only those that were homozygous for a given allele group were included in the analysis.
Statistical Analyses. For the Tourette's syndrome group, ANOVA was used to examine the relative magnitude of each QTV for the four different allele groups.
Linear ANOVA was used to test for a significant progressive increase in means across the four allele groups. The SPSS (SPSS, Inc, Chicago, IL) statistical package was used. For linear ANOVA the subcommand polynomial was set to 1. MANOVA was used to determine if any of the QTVs were significant when all the variables were examined simultaneously. Multivariate linear regression analysis was used as a second approach to determine if any of the QTVs were significant when all the variables were examined simultaneously. The MAOA genotype was set as the dependent variable and the 27 QTVs were entered stepwise as the independent variables.
Chi square. The above studies indicated that the group with the longest alleles had the highest means for the majority of the QTVs. The potential progressive decrease in frequency of the <335 bp allele group was compared across four groups with progressively fewer TS symptoms: TS probands with ADHD, TS probands without ADHD, relatives with TS and relatives without TS.
MANOVA. For the Substance Abuse Group, MANOVA was used to determine if there was an significant association between the four MAOA allele groups and the two summary variables, the alcohol and the drug score. ANOVA was used to examine the means of the alcohol and drug scores for the four allele groups.
Linear χ square, was used to examine the potential progressive increase in the frequency of the <335 bp group across three groups: controls, the substance abusers without the behavior (ATU without), and the substance abusers with the behavior (ATU with). The ATU without group was included to rule out the possibility that this allele group might be increased in frequency in the substance abusers because of comorbidity for a different behavior. To help exclude this, the frequency of the allele group had to be at least 20% higher in the substance abusers with the behavior than without the behavior. Since the hypothesis was that the frequency of these alleles would progressively increase across these three groups, the linear χ square statistic was used.
Regression analysis. To determine the maximum percent of the variance of drug related variables accounted for by the MAOA gene, regression analysis was performed in which subjects carrying the <335 bp alleles were scored as 1, and those carrying the <335 alleles scored as 2. This was performed for the drug dependence variable ( controls = 1 , ATU without scored 2, and ATU with scored 3) since this was the χ square variable most highly associated with the MAOA gene.
RESULTS
Allele groups. The distribution for the alleles for both groups is shown in FIG. 3. Since this was a complex VNTR the alleles did not fall into a clear-cut pattern of even or odd numbers of base pairs. The results are shown exactly as they were generated by the Genotyper program. There were no alleles between bp 316 and 323 bp, thus producing two clear major groups of <320 and >320 bp. However, to allow an examination of the hypothesis that phenotypic effects might be related to size, the alleles of the larger 323 - 339 bp group were divided into three sub-groups consisting of alleles shorter than the main peak 320-333 bp, the main peak of 334 bp, and alleles longer than the main peak of <335 bp. There were 219 males and 156 females for a total of 375 subjects in the TS group. Of the females, 88 were heterozygotes. When these were removed it left 287 subjects in the study of which 36 were controls. In this final group, there were no significant differences in the frequency distribution of the four allele groups in males versus females.
The TS Group. The ANOVA results for each of the QTVs versus the four allele groups are shown in Table 20-D. The results for regular ANOVA are shown under F-ratio and p value. The F-ratio for linear ANOVA is shown under the F2 column, with a superscript of ' for those that were significant at < 0.05. The QTVs are ordered by the decreasing magnitude of the F-ratio in the F2 column. Those allele groups where the means were significantly less than for the <335 bp group, as determined by the Tukey test with α set at < 0.05, are shown by an asterisk. With the exception of stuttering, shopping and panic (which gave the lowest F-ratio), for the remaining 24 QTVs the means were highest for those subjects carrying the <335 alleles.
Statistical Analysis. The results of MANOVA for all 27 QTVs were significant for sexual (p = 0.012), learning problems (p = 0.023), gambling
0? = 0.025), and mania (p = 0.025). When all 27 QTVs were examined simultaneously in a stepwise multivariate regression analysis, the variable grade school problems (p = 0.012) and gambling (p = 0.038) were significant. Based on the r" values, the MAOA gene accounted for only 3.9% or the variance of these QTVs. Using Chi square analysis, there was a significant progressive decrease in the percent of subjects that carried the <335 alleles, progressing from TS probands with ADHD (24%, n = 129), to TS probands without ADHD (20.0%, n = 50), to relatives with TS (12.5%, n = 16) to non-TS relatives (5.6%, n = 56) (p = 0.003).
Substance Abuse Group. Controls versus ATU Subjects. For the 160 combined controls, the distribution of the four allele groups was as follows: < 320 - 34.4%, 320-333 - 38.1%, 334-335 - 21.3%, <335 6.3%. For the 120 ATU subjects, the frequencies were as follows: < 320 - 39.2%, 320-333 - 18.3%, 334 - 20.8%, <335 - 21.7%). These were significantly different, χ2 = 22.17, p = 0.00006. The frequency of the <335 bp group was comparable in the two control groups, 8.9% for the San Bernardino group and 5.2% for the parents ofthe twins (χ2 = 0.744, p = 0.38).
MANOVA. MANOVA for the alcohol and drug score indicated that while both showed a significant association with the MAOA gene VNTR alleles, this was more significant for the drug score (p = 0.001) than for the alcohol score (p = 0.012) (Table 21). The result for the combined MANOVA was also significant (p = 0.007). The N of 257 is smaller than the total of 160 controls + 120 ATU or 280, because only 97 ATU subjects had completed the ASI. By contrast, all 120 completed the DIS for verification of the DSM diagnosis of alcohol and/or drug dependence.
ANOVA. ANOVA for the two scores showing the means for each allele group, are shown in Table 22. As for the TS group, the highest means were present in the <335 bp allele group. For the drug score, the three other allele groups were significantly lower than for the <335 bp group by the Tukey test.
Chi Square. To determine if the MAO gene was preferentially associated with certain types of substance abuse, 14 of the variables relevant to the type of substance used were examined. The frequency of the <335 bp allele group in the controls versus ATU subjects without the behavior (ATU without) versus ATU subjects with the behavior (ATU with), is shown in Table 23. Since 14 types of substance use variables were examined only those with a p of less than 0.0036 (0.05/14) are considered significant with a Bonferroni correction. Only those with a p of < 0.01 are shown. The exception is alcohol dependence only. This is shown to illustrate the fact that there was little increase in frequency of the <335 bp alleles in subjects with alcohol dependence only compared to those with drug dependence, or drug and alcohol dependence. By contrast, the drug dependence only variable gave the highest value (χ2 = 1.4, p = 0.00003).
Regression analysis. The results of regression analysis of the allele group (<335 vs <335) versus the diagnosis of drug dependence gave the following results: r = 0.25, r2 = 0.0625, T = 4.305, and/? ≤ 0.0001.
Substance Abuse. Prior studies using both enzyme levels (Wiberg et al,
1977; Gottfries et al, 1975; Devor et al, 1994; Vonknorring et al, 1991) and genetic variants (Vanyukov et al, 1993) have suggested a role of the MAOA gene in substance abuse. The present results are consistent with those conclusions, especially for drug dependence. While MANOVA showed a significant association between the MAOA alleles and both the alcohol and drug scores, there is a great deal of comorbidity of these two forms of substance abuse. As shown in Table 23, when drug dependence and alcohol dependence were examined separately the association was much greater with drug than with alcohol dependence.
Male predominance. ADHD, Tourette's syndrome, conduct disorder, ODD, dyslexia, learning disorders, stuttering, drug dependence and alcoholism all show a male predominance. While the predominance in males is probably due in part to hormonal and environmental factors, X-linked genes could also be a factor. For the TS group, determination of r2 using a regression coefficient, indicated that for the different QTVs the MAOA gene accounted for at most 2.5% or less of the variance of any QTV suggesting that the X-linked MAOA gene does not account for the male predominance of TS, ADHD or related disorders. By contrast, the r2 for the absence or presence of the <335 bp alleles versus the diagnosis of drug dependence, suggested that up to 6.2% of the variance could be due to the MAOA gene. This could play a modest role in the male predominance of drug dependence. While the association of the longer minisatellite alleles with specific QTVs in the Tourette's syndrome group was modest, as shown in Table 21, there was a remarkable degree of uniformity in the trends across all the QTVs. Since this could have been a chance, random association, the inventors sought to determine if these results could be replicated in a totally separate group of subjects and controls. This group (The Substance Abuse Group) showed an even stronger association between the longer alleles of the MAOA VNTR, especially the <335 bp alleles, than was observed in the TS group. The pattern for the two groups is remarkably similar, with the highest scores for <335 bp alleles, modestly higher scores for the lowest size alleles (<320), and intermediate scores for the 334-335 bp alleles. This correlation with the size of the repeat alleles is consistent with the possibility that the minisatellites themselves play a role in the regulation ofthe MAO genes.
TABLE 20-D MAOA VNTR Polymorphism: Comparison of the Different Behavior Scores by ANOVA for the Different Allele Groups
Allele G roups by Size in bp
Behavior <320 320-333 334 <335 F-ratio P F2
N 82 43 110 52
Mania 1.43* 1.8 1.36* 1.9 1.59* 2.27 2.59 2.8 3.59 0.014 6.391
OCD 2.18 2.8 2.18 2.4 2.80 2.8 3.31 3.2 2.16 0.093 5.891 sexual 0.62* 1.1 0.47* 0.9 0.66* 1.2 1.25 1.6 3.91 0.009 5.821 sleep 0.36 0.7 0.38 0.8 0.49 0.9 0.76 1.1 2.31 0.075 5.561
Grade school 2.60 1.7 2.90 2.0 2.98 2.1 3.46 2.1 1.89 0.131 5.141
Gambling 0.13* 0.9 0.27 0.8 0.22 0.8 0.61 1.6 2.49 0.060 4.821 stuttering 0.13 0.3 0.1 1 0.3 0.25 0.4 0.23 0.4 2.23 0.084 4.41 ' learn 0.52* 0.9 0.65 1.0 0.54* 0.9 1.00 1.1 3.32 0.020 4.371 inattention 6.69 5.2 7.37 4.9 7.67 4.7 8.48 5.3 1.42 0.235 4.151
ADHD 19.43 14.9 20.95 13.5 21.18 13.9 24.80 15.3 1.53 0.206 3.741
ADDR 4.63 4.9 4.84 4.6 5.18 4.7 6.42 5.2 1.57 0.196 3.741 impulsivity 5.74 4.9 6.30 4.8 6.49 4.7 7.46 5.0 1.35 0.257 3.681 shopping 0.58 1.3 1.00 2.2 1.32 2.8 1.09 2.4 1.61 0.186 3.23
Allele Groups by Size in bp
Behavior <320 320-333 334 <335 F-ratio F7
N 82 43 110 52
MDE 3.00 2.8 3.29 3.1 3.45 3.1 3.92 3.1 1.01 0.385 2.90 CD 2.78 2.4 2.90 2.1 2.97 2.2 3.54 2.6 1.15 0.328 2.54 hyperactivity 6.91 5.6 7.27 5.2 7.00 5.4 8.86 5.9 1.59 0.190 2.29
Phobia 2.00 2.7 2.15 3.0 2.45 2.7 2.65 3.3 0.71 0.548 2.10 schizoid 1.31 2.3 0.68* 1.3 1.34 2.2 1.84 2.3 2.26 0.081 1.92 gen. anxiety 0.21 0.4 0.18 0.3 0.28 0.4 0.29 0.4 0.85 0.463 1.60 somatization 2.13 3.0 1.58 2.4 2.17 3.0 2.90 3.7 1.16 0.325 1.34 drugs 0.36 1.2 0.45 1.6 0.40 1.3 0.75 2.0 0.81 0.489 1.28 read 1.86 1.9 1.36 1.8 1.78 2.1 2.34 2.5 1.75 0.156 1.27
ODD 3.07 3.3 3.02 2.7 3.16 3.1 3.73 3.4 0.57 0.633 1.02 tics 2.81 3.7 3.04 3.4 2.84 3.5 3.57 4.1 0.55 0.642 0.73 alcohol 0.51 2.3 0.81 2.9 0.31 1.8 1.1 1 3.2 1.41 0.241 0.45 panic 2.91 2.0 3.09 2.1 3.18 2.2 2.98 2.2 0.27 0.845 0.20 smoking 0.07 0.3 0.1 1 0.3 0.05 0.2 0.77 0.3 0.53 0.662 0.10
significant at < 0.05, F2 = F-ratio for linear ANOVA significantly less than >335 at a = 0.05 by Tukey
(Mean and Standard Deviation given) (n = 287)
TABLE 21
MANOVA for Alcohol and Drug Scores for the Substance Abuse Group versus the MAOA Allele Groups (N = 257 Males only)
Variable F-ratio
Alcohol score 3.72 .012
Drug score 5.85 .001
Total (Wilks) 2.99 .007
TABLE 22 ANOVA for Alcohol and Drug Scores of the Substance Abuse Group versus
MAOA Allele Groups
Allele Group N Mean S.D. F-ratio
Alcohol Score
<320 94 2.27 3.1 320-333 81 1.49* 3.0 334-335 56 1.94 2.7 <335 26 3.73 3.52 3.72 0.012
Drug score
<320 94 3.59* 5.2 320-333 81 1.94* 3.8 334-335 56 3.34* 4.9 <335 26 6.42 6.2 5.85 0.0007
* significantly lower than the mean for >335 allele group at = 0.05 by the Tukey test. TABLE 23
Linear χ Square Analysis of the Number of Subjects Carrying the <335 bp
Alleles in the Controls versus the ATU subjects without the Behavior versus the
ATU Subjects with the Behavior
Control. ATU ATU without with
Behavior N % N % N % Chi sq. P
Drug dep. only 160 6.3 58 15.5 62 27.4 17.4 .00003
IV drug use 160 6.3 56 14.3 27 29.6 13.65 .00022
Over dosed 160 6.3 71 12.7 25 28.0 1 1.00 .0009
Barbiturate use 160 6.3 61 13.1 32 25.0 10.56 .0011
DUIs 160 6.3 34 8.8 62 21.0 9.92 .0016
Amphetamine use 160 6.3 19 5.3 77 19.5 9.37 .0022
OSH* use 160 6.3 67 14.9 26 23.1 8.96 .0027
Cocaine use 160 6.3 25 12.0 67 19.4 8.86 .003
Marijuana use 160 6.3 14 7.1 82 18.3 8.35 .004
Heroin use 160 6.3 68 14.7 28 21.4 8.05 .004
Opioid use 160 6.3 58 15.5 38 18.4 6.88 .009
Alcohol dep only 160 6.3 98 24.5 22 9.1 non-linear
* OSH = other opiates (than heroin or methadone), sedatives and hypnotics
EXAMPLE 3
POLYMORPHISMS OF DOPAMINE D2 RECEPTOR ASSOCIATES
WITH SCHIZOID/AVOIDANT BEHAVIORS
Subject Selection and Test Administration. Caucasian volunteers were recruited. There were 58 males and 71 females and the average age was 40.9 ± 1.8 and 47.3 ± 1.5 (mean ± SD) years, respectively. Prior to taking the second edition of the Millon Clinical Multiaxial Inventory (MCMI-II) computerized test, the volunteers donated 15 cc of blood by venipuncture. It is noteworthy, because of the concerns about racial and ethnic stratification, blood was drawn from non-Hispanic, Northern and Western European Caucasians with some exceptions since the most extensive data on controls comes from this group. For this study a total of 129 psychiatrically ill patients with and without comorbid drug or alcohol abuse were selected for both genotyping and assessment with the Millon Clinical Multiaxial Inventory (MCMI-II). The composition of the group consisted of the following: dysthymia (22.1%), generalized anxiety disorder (8.4%), Unipolar (24.5%), bipolar (12.9%), schizophrenia (5.2%), attention-deficit disorder (21.9%), and substance use disorder (18.1%).
The Millon Clinical Multiaxial Inventory was employed to assess the eleven known personality disorders including the schizoid/avoidant cluster in each subject. This test contains 175 items and most people can complete it in 20 to 30 min. Each of its 22 clinical scales was constructed as an operational measure of a syndrome derived from a theory of personality and psychopathology. The clinically oriented scales are coordinated directly with the official diagnostic system and its syndrome categories (DSM-IV). Separate scales have been constructed in line with the DSM-IV model to distinguish the more enduring personality characteristics of patients (Axis II) from the acute clinical disorders (Axis I). Actuarial base rate data, rather than analyzed standard score transformations, were employed in calculating and quantifying scale measures. A base rate of 60 is suggestive of a disorder. Base rates between 75 and 83 indicate a chronic or moderately severe disorder and greater than or equal to 84 signifies an uncontrollable pathological disorder. In this study the inventors chose to identify the study group by using Millon's Schizoid Avoidant cluster of behaviors in subjects achieving a percentile rank of 84 or higher on this particular cluster. The inventors classified subjects according to their MCMI-II scores, grouping the proband into four distinct base rates according to the following divisions: (1) scores below 60; (2) equal to 60 up to 73; (3) equal to 74 up to 83; and (4) equal to 84 up to 100. The demographics of the subject population is described in Table 24. TABLE 24
DIAGNOSTIC CHARACTERISTICS OF A PSYCHIATRICALLY-ILL
POPULATION UTILIZED IN EXAMPLE 3
Category of Diagnosis % of Subjects
Dysthymia 27.1
Generalized Anxiety Disorder 8.4
Unipolar 24.5
Bipolar 12.9
Schizophrenia 5.2
Attention Deficit Disorder 21.9
Substance Use Disorder 18.1
The MCMI-II test scores were validated on a different inpatient population by comparing 104 patients with Minnesota Multi-Phasic Personality Inventory (MMPI) personality disorder scales. Conservative significance levels were used to ensure valid conclusions. Schizoid, avoidant, dependent, histrionic, and narcissistic scales were correlated significantly, passive-aggressive, schizotypal, and borderline scales did not correlate with corresponding MCMI-II scales, therefore validating the use of this test to reliably measure abnormal personality traits (Shuler et al, 1994; Zimmerman et al, 1994) such as schizoid and avoidant behaviors.
For this study 30 "super" control subjects were screened to exclude a number of reward deficit behaviors including alcoholism, polysubstance dependence, smoking behavior, carbohydrate bingeing, a BMI>25, family history of substance use disorder, ADHD, pathological gambling and an Axis II diagnosis (including SAB), were genotyped for DRD2 A, and A2 alleles. Additional controls came from three sources of volunteers: A) adopting, foster or step-parents of Tourette's Disorder patients; B) subjects from an endocrinology clinic with thyroid cancer or non-insulin dependent diabetes mellitus; and C) hospital personnel including professionals, technicians, and maintenance workers. All 142 controls were screened to exclude ADHD, alcohol drug and tobacco abuse. The inventors genotyped 91 of these controls for the DATl 9 and 10 alleles and 51 controls for the DβH B, and B2 alleles. One important caveat to consider involves the subject selection to evaluate association of dopaminergic alleles with SAB. While the inventors are cognizant of possible statistical confounds with subjects having comorbid RDS behaviors (i.e. substance use disorder at 18.1% in this population), the inventors are equally cognizant that it would be quite difficult to exclude all RDS behaviors in patients presenting with SAB. Thus, the inventors must await additional studies in the future to address this issue specifically.
Genotyping. The total number of subjects genotyped for one or more dopaminergic genes in this study was 271. All subjects were genotyped based on a neutral identification number and read without knowledge of the individual being typed.
DRD2 Polymorphism. The D2A, and D2A2 genotyping was performed by hybridization of Southern blots as described (Blum et al, 1990a; Comings et al, 1995). A number of samples were also genotyped by a PCR™ technique (Noble et al, 1994d).
DβH Polymorphism. d'Amato and associates (d'Amato et al, 1989) reported the presence of two Taq DβH polymoφhisms entitled A and B. A DβH cDNA clone All (Lamouroux et al, 1987; Lamouroux et al, 1993) was used consisting of a 2.7 Kb insert at the EeoRI site. To improve labeling the vector was digested with BamHI and Sail to produce 5 bands. A 3.5 Kb fragment was labeled for testing the β polymoφhism. Digestion with Taql restriction endonuclease, electrophoresis in agarose, Southern transfer to a nylon filter, hybridization with 32P labeled probe, and autoradiography, demonstrated fragments of 2.8 Kb (B,) and 1.4 Kb (B2).
DAT, Repeat Polymorphism. The alleles at the 3' UTR were determined by PCR™ using the oligomers and PCR™ conditions reported by Vandenberg et al l992b). Following PCR™ amplification the products were electrophoresed in an 8% acrylamide gel with a set of size markers for visualization.
Statistics. Proportions were analyzed for 2 by 2 tables using Pearson's Chi- Square and Fisher's exact tests. Larger tables such as 2 by 3 tables were tested using Pearson's Chi-Square and Mantel Hensel Test for Linear trend. Differences between means were tested using Student's t-test. Multiple Logistic regression was used to analyze the contribution of one or several variables to predict the probability of having a high schizoid/avoidance score. The logistic model was assessed using the Hosmer- Lemeshow goodness of fit test, the c statistic which represents the area under the receiver operating characteristic (ROC) curve and the r-square or presence of variance accounted for by the SAS computer program Proc Logistic. Odds ratios were also computed for the predictor variables in any logistic regression model (Dunn and Clark, 1995).
Results. For the schizoid/avoidant data set analysis was conducted utilizing the χ square approach limiting potential association of the dopaminergic alleles to
MCMI- II schizoid and MCMI-II avoidant scores above 84 to ensure severity of the proposed phenotype. It was found that the DRD2 A! allele was found in 50% of schizoid (1 1/22) and 44% avoidant (12/27) subjects; DAT, 480 bp (VNTR 10/10 allele) was found in 72% of schizoid (13/18) subjects, and 62% of avoidant (13/21) subjects; DβH B, allele was found in 81.3% of schizoid (13/16) subjects and 82.4% of avoidant (14/17) subjects. With χ square, the DRD2 A, allele significantly associated with patients to have the schizoid/avoidant cluster (MCMI-II score >84) compared to
DRD2 A2 allele (χ2 = 7.6, df= l, p < 0.006). Homozygotes of the DRD2 A, allele showed the highest percentage of subjects having membership in the SAB cluster (≥84). Heterozygotes had approximately half of the percentage of SAB subjects as the homozygote group. Whereas, the group having only DRD2 A2 representation showed the lowest percentage of SAB (linear trend analysis: p < 0.005, A,/Aj = 83%,
A,/A2 = 41%. and A2/A2 = 23% ).
However, unlike the DRD2 A, allele data, χ square analysis failed to reveal association of DβH B, allele and DAT, 10/10 allele with schizoid/avoidant behaviors. Utilizing multiple variable associations with the dichotomized SAB scores using logistic regression testing for significant relationships with the DRD2 alleles, age and sex. both DRD2 A, allele and sex were significant predictors of SAB severity. With DRD2 A, allele the inventors found an odds ratio of 2.79 (p - 0.018) and with sex 3.6 (p — 0.0031), with a Hosmer-Lemeshow goodness of fit at p = 0.78. In 30 screened super controls (exclusion of alcoholism, polysubstance dependence, body mass index less than 25, smoking behavior, family history, pathological gambling, ADHD, schizoid/avoidant behavior) the prevalence of the DRD2 A, allele was 1/30 or 3.3%. In 91 screened controls the prevalence of the DAT, 10/10 allele was 34/91 or 37.4% as well as in 51 screened controls where the prevalence of the DβH B, allele was 27/51 or 53%.
With regard to the DRD2 A, allele (18/37 or 48.6%) a significant association was found when compared to both literature controls 185/714 or 26% (χ" = 9.2, df= 1 , /? = 0.0024; OR = 2.71) and super controls (χ2 = 16.8, df= 1, p = 0.00004; OR = 27.5) and SAB > 84. Moreover, a significant association was also found between the DAT, 480 bp (VNTR 10/10 allele) in those individuals diagnosed with SAB (18/28 or 64.3%) when compared to screened controls (χ = 6.3, df= l, p = 0.012; OR 3.0). A similar trend was found with carriers of the DβH B, allele assessed as having SAB (17/23 or 73.9%) compared to screened controls (χ = 2.89, df= l, p = 0.09; OR 2.52). Comparing all cases below MCMI-II scores of 84 and all cases of MCMI-II scores above 84 (severity score) utilizing a statistical technique called logistic regression analysis, DRD2 A, allele accounts for 8.3% of the variance which is statistically significant (χ = 7.5, df= 1 , p = 0.0059). In contrast, DAT, (10/10 allele) accounts for 1.6% of the variance; and the DβH B, allele accounts for 0.0025% ofthe variance and are not significant contributors to the variance.
When sex is examined as a univariate in a logistic regression model, contribution to the overall variance of sex alone was 9.9% (χ = 9.4, df= 1 , p - 0.0022). In a logistic regression model predicting high schizoid/avoidant MCMI- II score above 84, utilizing the DRD2 A, allele and gender as predictors, odds ratios for these predictors were 2.79 for DRD2 gene and 3.55 for male gender. The Hosmer- Lemeshow goodness of fit p value = 0.778 and the C statistic (area under the ROC curve) equals 0.714 and the combined contribution to the variance was 17.9%. Moreover, in a pilot study of 67 subjects genotyped for the DRD2 A, and A2 alleles, using the procedure discussed above, the inventors found no association with any of the other ten personality traits assessed by the MCMI-II test.
In conclusion, the inventors have performed an association study, that employed the MCMI-II self-report computerized test in order to reveal a contribution of polymoφhisms of three dopaminergic genes to an abnormal personality trait referred to as schizoid/avoidant cluster. The observed association did not appear to be due to population stratification since it was independent of the ethnicity, sex, or age of the subjects. Moreover, the frequency for schizoid/avoidant behaviors based in the general population is 1 - 4%. The lack of significant contribution of both the DAT, ( 10/10 repeat allele) and the DβH B, allele to the overall variance cannot be ruled out as yet due to sample size. In fact with a sample size of only 44 (due to missing values), these three gene polymoφhisms when combined in multivariate regression analysis account for roughly 7.6% of the genetic variance, as might be expected if there are multiple genes and other factors like gender involved in this complex behavioral disorder.
EXAMPLE 4 CANNABINOID RECEPTOR GENE ASSOCIATION WITH IV DRUG USE METHODS
Subjects. To minimize race as a confounding factor, all subjects were limited to 92 non-Hispanic Caucasians. The control group consisted of 62 older students (SB controls), and 52 subjects (LL controls). The latter consisted of 40 percent maintenance personnel, 43 percent secretaries and clerks, and 17 percent M.D.s or PhD.s. Both groups gave a total of 114 controls.
Assessments. The presence or drug or alcohol abuse/dependence was excluded from the LL controls based on personal interviews. All controls were assessed with the Michigan Alcoholism Severity Test, a 24 item self-administered questionnaire revised to include drug abuse (MAST-R). All SB controls with a MAST-R score of greater than 4 were excluded. In addition, all ATU subjects were assessed with the clinician administered Diagnostic Interview Schedule (DSM-III-R version), to diagnose the presence of substance dependence disorders, and the clinician administered Addiction Severity Index Fifth Edition, to evaluate a range of alcohol and drug use variables as described in Example 4.
Genotyping. DNA was extracted from whole blood by standard procedures.
DNA samples were amplified using the following primers as described by Dawson (1995) 5'-GCTGCTTCTGTTAACCCTGC-3' (SEQ ID NO:3) and 5'-TACATCTCCGTGTGATGTTCC-3' (SEQ ID NO:4). This identified alleles of a (AAT)n triplet repeat. To label the PCR™ products 0.1 μM of each primer labeled with fluorescent HEX Amidite (Applied Biosystems, Foster City, CA) primers. Two μl ofthe 10 fold diluted PCR™ product was loaded onto a 6% polyacrylamide gel and analyzed as described for the PCR™ polymoφhism analysis of the VNTR polymoφhism in Example 2.
Statistical Analysis Allele and genotype frequencies. The frequency of the different alleles in controls versus ATU subjects was examined using a recursive Monte Carlo test for significant differences (Roff and Bentzen, 1989) using the RxC program by George Carmody, Carleton Univ, Ottawa, Canada. The advantage of this computational approach is that χ square simulations with estimated standard errors can be completed without collapsing cells with small numbers of observations (especially zero). The frequency of the different genotypes was compared using χ square analysis.
Factor analysis. To address the statistical problem of analysis of a large number of variables, a preliminary factor analysis was performed, with a restriction to produce just two factors. Factor 1 tended to combine variables relating to drug dependence while Factor 2 tended to combine variables relating to alcohol dependence.
Allele Groups and Genotypes. Although the inventors have observed 9 different alleles consisting of 1 , and 3 to 10 repeats, none of the controls or ATU subjects in this study carried the 2 allele. The distribution of the 9 alleles in the controls and ATU subjects indicates most common allele was #4. It was present in 36.4% of the controls, 31.7% of the ATU subjects, and 20.2% of ATU subjects using IV drugs. The inventors' working hypothesis (Comings, 1996b; Comings, 1996a) has been that the microsatellites, primarily through the formation of Z-DNA (Hamada et al, 1982; Schroth et al, 1992), may play a direct role in gene regulation, and that the magnitude of the effect is dependent upon the length of the repeats. Since the major allele group was the 4 repeat, and there were very few 1 or 3 alleles, this allowed a natural division of the 9 alleles into two groups consisting of shorter alleles (<5), and longer alleles (<5). This produced three genotypes, <5/<5, heterozygotes, and <5/<5. To eliminate statistical complications, no other alleles, genotypes, or combinations of alleles were examined.
ANOVA. To further eliminate statistical complications related to the large number of variables, the initial test of the data involved the examination of Factors 1 and 2 versus the above three genotypes, by ANOVA. This was used to determine whether subsequent testing would suggest a primarily recessive model (<5/<5 versus heterozygotes + <5/≤, or <5/<5 versus heterozygotes + <5/<5); or dominant model (<5/<5 + heterozygotes versus <5/<5, or <5/<5 + heterozygotes versus <5/<5; or heterosis (heterozygotes versus <5/< + <5/<5). The results suggested a recessive model of <5/<5 versus heterozygotes + <5/<5. Again, to eliminate statistical complications, no other models were examined. If either factor 1 or factor 2 produced significant results, some of the subscores suggested by the factors analysis were studied by ANOVA, using the recessive model.
χ square analysis. The individual variables highlighted by the significant factor were further assessed using a 2 x 3 χ square test. The x2 dimensions consisted of the two genotype groups - homozygosity for the <5/<5 repeat alleles versus the remaining 'other' genotypes. The x3 dimensions consisted of: (1) controls, (2) ATU subjects who scored 0 on the given variable (ATU negative), and (3) ATU subjects who scored >1 on the given variable (ATU positive). The addition of the ATU negative group was necessary to rule out the possibility that an increase in the frequency of the >5/>5 genotype in ATU subjects might actually be due to an association with a comorbid disorder or variable other than the one being examined. The inventors expected three patterns: A. Significant - Linear. If the >5/>5 genotype was associated with a given variable the inventors expected a significant linear-like increase in percent of cases that were in the >5/>5 group progressing from the controls to the ATU negative cases negative for that variable, to the ATU positive cases positive for that variable. The significance of this progressive increase was tested using the linear χ square test (Mantel-Haenzel χ square of the SPSS Statistical Package, SPSS, Inc, Chicago, IL). Since the ≥5/>5 genotype could have been associated with more than one substance or variable, the inventors also required that the percentage of >5/>5 carriers to be at least 20% higher in the ATU positive than ATU negative group.
B. Significant - Non-linear. The >5/>5 genotype was considered to be unassociated with a given substance if the percentage of cases carrying the >5/>5 genotype was higher in the ATU negative than the ATU positive group, even if the p value was significant.
C. Non-significant - Non-linear. The >5/>5 genotype was also considered to be unassociated with a given substance if the p value was > 0.05.
RESULTS
Subject characteristics. The mean age of the ATU subjects, 39.7 years, (S.D. 7.0, range 23 to 52), compared to the controls of 38.4 years, (S.D. 12.6, range 21 to 71 years). These were not significantly different (F-ratio = 0.76, p = 0.38). All of the ATU subjects were males, while 45 (39.5%) of the controls were males and 69 (60.5%) were females.
Allele frequencies. The ATU subjects using drugs intravenously was chosen because clinical experience indicates it represents subjects with the most severe problems with drug dependence. When the frequency of all the alleles was compared in the controls versus the ATU group using 10,000 iterations of the Monte Carlo test, they were not significantly different (χ2 - 7.09, p = 0.54). When the controls were compared to the IV drug users the difference was borderline (χ2 = 14.49,/? = 0.065). For the controls 41 or 36.0%> were >5/>5 homozygotes, while 43 or 46.7% of the ATU subjects were >5/>5 homozygotes (p = NS). Of the 32 IV drug users 20 or 62.5% were >5/>5 homozygotes (χ2 = 7.23,/? = 0.007).
Although women were present in the control group, there was no significant difference in the prevalence of the >5/>5 genotype in the control males (37.8%, n = 45) versus females (34.8%, n = 69), χ2 = 0.106, /? = 0.74.
Factor analysi. Factor analysis was set to produce two factors. Factor 1 tended to consist of variables relating to drug abuse. These consisted of the variables relating to the IV use of drugs, number of drug charges, years of use of various drugs, the drug score, and a DSM diagnosis of a form of drug dependence. Factor 2 tended to consist of variables relating to alcohol use such as the number of DUI's, money spent on alcohol, alcohol severity score, number of alcohol detoxifications, alcohol score and DSM diagnosis of alcohol dependence.
The results of ANOVA analysis of Factor 1 and 2 are shown in Table 25. The mean Factor 1 score was highest for subjects homozygous for the >5/>5 alleles (0.198) than for subjects that were heterozygous (-0.151) or homozygous for the <5/<5 alleles (-0.085) (F-ratio = 2.85,/? = 0.060). This suggested a recessive model of homozygosity for the >5 repeat alleles versus heterozygosity + homozygosity for the >5 repeat alleles ('other'). When this model was examined by ANOVA the mean for factor 1 was significantly greater for those with the >5/>5 genotype for those with the 'other' genotypes (/? = 0.019). By contrast, there was no significant difference for means of factor 2, using either the three genotypes or the recessive model.
These initial results were consistent with the alleles of the CNRl gene being associated with drug dependence but not with alcohol dependence. To further examine this, the inventors tested the recessive model against the means for the alcohol score, the drug score and the number of drugs used IV (Table 26). The mean drug score for those with the >5/>5 genotype was significantly greater than for those with the other genotypes ( ? = 0.038). The mean number of drugs used intravenously (#IV) was also significantly greater for >5/>5 homozygotes than for other genotypes (p = 0.005). This was still significant with a Bonferroni corrected α of 0.5/3 or 0.016. By contrast, there was virtually no difference in the mean of the alcohol score for >5 homozygotes compared to the 'other' genotypes. To rule out the possibility that age might be a hidden covariate explaining the results, age was used as a covariate. The /? value for age was 0.404 versus 0.004 for the CNRl main effects, indicating that variations in age did not explain the results.
The association with the mean drug score led the inventors to question whether the CNRl gene might show a greater association with certain specific drugs. The four types of drug dependence were tested using the 2 x 3 χ square analysis (Table 27) outlined in the methods. Three types of drug dependence showed a significant increase in the frequency of the >5/>5 genotype across the three groups: cocaine, amphetamine, and cannabis dependence. There was no significant association with opioid dependence. None of these were significant using a Bonferroni corrected α of 0.05/4 or 0.0125.
Alcohol dependence only was also included for comparison puφoses. A higher percentage of the ATU subjects without alcohol dependence (50.7%) carried the >5/>5 genotype than those with alcohol dependence (29.6%).
Route of cocaine, amphetamine and heroin administration. Table 28 shows the results for the route of administration of these drugs. For cocaine, the prevalence of >5/>5 genotypes varied from 36.2% for those ATU subjects and controls not using cocaine, to 32.3% for those inhaling cocaine, to 55.6% for those smoking cocaine, to 68.4% for those injecting cocaine (p = 0.006). Similar results were obtained for the route of administration of amphetamines with 35.7% of those not using cocaine carrying the >5/>5 genotype versus 65.2% for those using amphetamines intravenously (p = 0.007). An equally high frequency of the >5/>5 genotype was noted for those using IV heroin.
Regression analysis. To obtain an estimate of the percent of the variance of the three quantitative scores that were attributable to the CNRl gene, the inventors performed a regression analysis where the genotype was scored as 2 for those with a >5/>5 genotype and 1 for those with other genotypes (Table 29). The CNRl gene accounted for virtually none of the alcohol score, for 2.1% of the total drug score, and 3.8% ofthe IV drug score (/? = 0.005).
The results show a significant association of the CNRl gene with a number of different types of drug dependence (cocaine, amphetamine, cannabis), and with IV drug use, a particularly severe form of drug dependence. The present results provide the first described association between a specific gene and IV drug use. By contrast there was no significant association with variables related to alcohol abuse/dependence.
A potential alternative explanation of the results is that despite the restriction of both groups to non-Hispanic Caucasians, a hidden ethnic stratification of the ATU subjects versus the controls accounts for the results. While this is always a concern in association studies, the association of the >5/>5 genotype with the drug dependence variables but absence of association with alcohol dependence variables despite having similar demographics to the ATU drug abuse subjects, the greater perturbation of dopaminergic reward pathways by most drugs compared to alcohol, and the intimate interaction between dopaminergic and cannabinergic metabolism, has a consistency that makes ethnic stratification a less likely explanation of the results. Age was also ruled out as a complicating variable.
TABLE 25
ANOVA of CNRl Genotypes versus Factor 1 and 2
ATU Subjects and Controls (n = 205)
Score Genotype N Mean S.D. F-ratio
Factor 1 <5/<5 32 -0.085 0.97
(drugs) heteroz. 91 -0.151 0.65
>5/>5 83 0.198 1.26 2.85 0.060
other 123 -0.134 0.75
>5/>5 83 0.198 1.26 5.62 0.019
Factor 2 <5/<5 32 -0.098 0.95
(alcohol) heteroz. 91 -0.042 1.00
>5/>5 83 0.084 1.02 0.52 0.593
other 123 -0.056 .98
>5/>5 83 0.084 1.02 0.98 0.32
TABLE 26
ANOVA of CNRl Genotypes versus Number of IV drugs,
Drug Score and Alcohol Score TU subjects and controls (n = 206)
Score Genotype N Mean S.D. F-ratio alcohol score other 123 2.52 3.41
>5/>5 83 2.57 3.02 0.010 0.921 drug score other 123 3.37 4.98
>5/>5 83 4.95 5.81 4.33 0.038
#IV drugs other 123 0.16 0.54
>5/>5 83 0.48 1.05 8.08 0.005 TABLE 27 χ Square Analysis for the Percent of >5/>5 Homozygosity of the CNRl Gene for
Controls, ATU negative and ATU positive Subjects
(n = 155)
Behavior Controls ATU- ATU A Chi P
N % N % N % square
Cocaine 1 14 36.0 72 38.9 20 70.1 5.36 0.020
Amphetamine 114 36.0 58 37.9 34 58.8 4.46 0.034
Cannabis 1 14 36.0 66 39.4 26 61.5 4.41 0.035
Opioid 1 14 36.0 82 45.8 10 50.0 2.01 0.155
Alcohol dep. c >nly 1 14 36.0 71 50.7 21 28.6 0.27 0.602
TABLE 28 CNRl Genotype and Route of Drug Administration.
8A. Cocaine Route N %>5/>5 Chi sq.*
No use 138' 36.2
Nasal 31 32.3
Smoke 18 55.6
IV 19 68.4 7.52 0.006
TOTAL 206
8B. Amphetamines Route N %>5/>5 Chi sq.
No use 129 35.7
Oral 1 1 9.1
Nasal/smoke 43 48.8
IV 23 65.2 7.19 0.007
TOTAL 206 8C. Heroin
Route N %>5/>5 ChTsqA p
No use Ϊ773 373
Nasal 6 33.3 smoke 2 50.0
IV 21 66.7 6.42 0.011
TOTAL 206
*Mantel-Haenzel linear χ square consisting of 1 14 controls of which 36.0% were >5/>5 homozygotes, and 24 ATU subjects of which 37.5% were >5/>5 homozygotes.
'consisting of 1 14 controls of which 36.0% were >5/>5 homozygotes, and 15 ATU subjects of which 33.3% were >5/>5 homozygotes.
^consisting of 1 14 controls of which 36.0% were >5/>5 homozygotes, and 64 ATU subjects of which 40.6% were >5/>5 homozygotes.
TABLE 29 Regression Analysis of CNRl Genotypes (>5/>5 = 2, other = 1) versus Number of IV drugs, Drug Score and Alcohol Score for ATU subjects and controls (n = 206)
Score r r2 T P
Alcohol score 0.007 0.0000 00.099 0.921
Drug score 0.144 0.0208 20.081 0.038
IV drug score 0.195 0.0381 20.844 0.005
EXAMPLE 5
GENETIC VARIANTS OF THE HUMAN OBESITY (OB) GENE
ASSOCIATED WITH BODY MASS, PSYCHIATRIC SYMPTOMS AND THE
DOPAMINE D2 RECEPTOR GENE (DRD2) METHODS AND MATERIALS
The Center for Health Promotion Group (CHP) The subjects from the
CHP study consisted of 21 1 non-Hispanic Caucasians. Based on power analyses of other studies of the association of genetic polymoφhisms with behavioral variables, the inventors sought a sample size of 200 to 225 subjects. Their ages ranged from 29 to 75 with an average age of 54 years, standard deviation (S.D.) 10.2 years. Of the group 98 were males and 1 13 females. The age, sex, weight, height, and waist-hip ratio were determined on each subject. Total body fat was determined by weighing in water. Each subject was asked to provide data on their greatest weight at different age intervals from age 16 to their present age. A fasting blood sample was obtained for determination of blood glucose, cholesterol, and insulin. Coded samples of blood were analyzed, blind to CHP data.
Each subject completed the NEO 5-factor personality inventory Costa and McCrae, 1992), and the Symptom Check List -90 (SCL-90). The subjects also answered the following set of questions: Do you eat because you are hungry? Binge eat? Snack between meals? Eat because bored? Eat because of stress? Eat breakfast?
Overeat at dinner? Crave sweets? Like vegetables? Prefer fatty or fried foods?
Possible responses were: 1 never 2 occasionally, 3 frequently, 4 very frequently, and 5 always.
Genetic Studies The inventors PCR™ amplified the D7S1873, D7S1875,
D7S514 and D7S680 dinucleotide repeats present on the YAC contig containing the human OB gene as previously described (Green et al 1995). Of these, D7S 1875 was closest to the OB gene. The inventors refer to this as OB\ %η$. The DRD2 gene Taq Al allele was examined using the primers previously described (Noble et al, 1994b).
Statistical Analyses of the genotypes The a priori hypothesis was that if either the shorter or the longer alleles of the D7S1875 dinucleotide repeat were associated with the BMI or other variables, individuals homozygous for the short (or long) alleles would have the highest scores, those heterozygous would have intermediate scores, and those homozygous for long (short) alleles would have the lowest scores. Thus, the means of the behavioral scores were compared for subjects with different allele groups using the ANOVA statistical programs from the SPSS (SPSS, Inc., Chicago, 111) with the subcommand "polynomial" set to 1 to test for a progressive linear relationship. When there were 3 or more groups, a Tukey analysis tested for significant individual differences between any of the groups at α = 0.05. Analysis of covariance (ANACOVA) was used to examine the effect of the OR1875 genotypes on the SCL-90 anxiety score using BMI, waist-hip ratio, age and sex as covariates. Additionally, chi square analysis was performed for the three OR.875 genotypes for variables with dichotomous breakpoints. Since the a priori assumption was that there would be a progressive linear increase or decrease across the three 0B\S75 genotypes, they are examined by the linear χ square test (Mantel-Haenszel χ square test in SPSS). Finally, regression analysis was use to determine the correlation (r) between OB and DRD2 genotypes or alleles. R2 provided the fraction of the variance accounted for by the relevant gene or combination of genes.
RESULT
The BMIs averaged 27.9, S.D. 7.2, with a range from 17.7 to 57.6. In an initial study the alleles at all four polymoφhisms were examined by dividing the alleles into a longer and a shorter group. Subjects were there genotyped into those homozygous for the shorter alleles, homozygous for the longer alleles, and heterozygous for short and long alleles. An examination of BMIs in the three genotype groups indicated the D7S1875 polymoφhism gave the highest F-ratio. Thus all subsequent studies, with the other variables, were done with this polymoφhism.
OB1875 allele distribution. The different alleles of the OR1875 polymoφhism for the CHP subjects ranged in size from 199 to 225 bp in length. The inventors' a priori approach to the examination of dinucleotide repeats in psychiatric disorders (Comings et al, 1996c) was to first divide the alleles into approximately equal groups if there is a natural tendency for a bimodal distribution. This was the case for the OR1875 polymoφhism and the cut was made at 208 bp. The resulting genotypes were <208 bp/<208 bp, <208 bp/ 208 bp, and >208 bp/>208 bp.
Obesity variables. For the whole group of males and females, the only significant association was with weight with a progressive decrease across the three genotype groups (<208/<208 n = 47, 183.83 kg, S.D. 45.39; heterozygotes n = 95, 177.56 kb, S.D. 44.00; >208/>208 n = 39, 161.29 kg, S.D. 45.17, F-ratio = 5.22, /? = 0.023. For BMI there was a progressive, but not significant, decrease in BMI from 28.92 for the <208/<208 homozygotes, to 27.96 for the heterozygotes, and 26.62 for the >208/>208 homozygotes. The differences by genotype in the means for plasma insulin, fasting blood glucose, cholesterol and percent fat were not significant. When the individual sexes were examined, for males the trends were the same. The BMI approached significance ( ? = 0.053), and weight was significantly different (p = 0.038). While the trends were again the same, none of the variables were significant for females only.
BMI by Age. Table 30 shows the comparison by ANOVA of the mean BMI at different ages of the subjects, for both males and females combined. The difference by genotype was significant for the subjects when they were 26 - 30 years old, and almost significant for when they were 16 - 20 years of age. When females alone were examined, again only the 26 - 30 age group gave significant results (/? = 0.028). When males only were examined, none of the age groups were significant. The BMIs for when the subjects were 26 to 30 years of age were divided into three groups of < 25, 25 to 34 and >35. There was a progressive increase in the frequency of the OR1875 <208/<208 genotype from 24% to 33% to 56% across the three BMI groups (linear χ square = 4.46, d. = 1,/? = 0.034.)
SCL-90. The results for the SCL-90 are shown in Table 31. The scores for the <208/<208 homozygotes were significantly higher for anxiety, depression, psychoses, hostility, paranoid ideation, obsessive-compulsive, symptom total, general symptom index, and overall total. For seven ofthe scores the p was < 0.025.
Analysis of Covariance. To examine the possibility that the psychiatric variables were simply secondary to a weight problem or the type of obesity (waist-hip ratio), the SCL-90 anxiety score was examined using the OR1875 genotype as the main effect, and BMI, waist-hip ratio, age and sex as covariates (Table 32). This showed that of the five variables only the OR1875 genotype showed a significant association with the anxiety score. The same was true for SCL-90 score for depression, total positive symptoms, and total symptoms.
DRD2 and BMI age group. ANOVA for the presence or absence of the
D2A1 allele was carried out to determine if the DRD2 gene was also playing a role in the age specific BMIs. The mean BMI was significantly greater for the individuals carrying the Al allele for the BMIs when subjects were 31 - 40 years of age (D2A1 + n = 54, 28.78, S.D. 8.56; D2A1- n = 70, 25.67, S.D. 5.21, F-ratio = 6.04, p = 0.015). As with the OB gene, the F-ratios tended to be lower for the older age groups, although the sample sizes were also smaller.
Combined OB1875 <2087<208 homozygosity and D2A1 allele. To determine if the effects of the OB and the DRD2 gene were additive, the BMIs were examined by dividing the subjects into those who were homozygous for the OR 1875 <208/<208 alleles and/or carried the D2A1 allele (Table 33). These results were quite significant. Those who were both homozygous for the OR1875 <208 alleles and/or carried the DRD2 D2A1 allele, had a significantly higher mean BMI whey they were 16 - 20, 21 - 25, 26 - 30, 31- 40, and 41 - 50 years. When the effects of these two genes were combined and the entire set of obesity variables examined, the differences were significant for waist hip ratio (/? = 0.033), weight (0.013), and insulin level (0.042).
Regression analysis. Univariate regression analysis allowed an examination of the percent of the variance (r2) for the age-specific BMIs accounted for by the OR gene or the OB + DRD2 gene (Table 34). For both males and females, for the OR gene only, r and r2 were significant only for the BMIs at 16 - 20 years and 26 -30 years of age. Here the OR gene accounted for approximately 3% of the variance for these two BMIs. However, when the effects of the OR and the DRD2 gene were combined, they accounted for 8.5 to 9.9% of the variance for the BMIs in the 16 - 20, 21 - 25, 26 - 30, and 31 - 40 year age groups. When females alone were examined, for the OR gene only, the correlations were significant only for the 31 to 40 age group (p = 0.029). When the combined effects of the OR and the DRD2 gene were examined, the correlation was significant for the subjects when they were 16 - 20, 21 - 25, 26 - 30, 31 - 40, and 41 - 50 years of age. The most significant correlations were for the 26 to 30 ( ? = 0.0004) and 31 to 40 ( ? = 0.0005) age group. Here the two genes accounted for 22.8% ofthe variance of the BMI.
N.E.Ο. Of the 5 N.E.O factors of agreeableness, conscientiousness, extroversion, neuroticism, and openness, only increased neuroticism was significant. The scores across the three OR1875 genotypes were 21.16, 17,82 and 14.86, F- ratio = 7.29, p = 0.008. Decreased conscientiousness was borderline significant (32.97, 34.67 and 35.65, F-ratio = 3.71, /? = 0.056).
Reasons for eating. Of the questions asked about reasons for eating, only two, eat because of stress, and eat breakfast, were significantly associated with the
OR 1875 genotypes. For 'eat because of stress,' the scores across the three genotypes were: 2.55, 2.32, 1.85, F-ratio = 4.54, /? = 0.034. For 'eat breakfast' the scores were
3.50, 4.15, 4.14, F-ratio 4.89,/? = 0.028.
When the BMIs based on the subjects' present weight were used, there was little evidence for a phenotypic effect of OR1875 genotypes. While there was a trend for the <208/<208 homozygotes to have the highest BMIs, for heterozygotes to be intermediate and for those homozygous for the >208/>208 alleles to have the lowers values, the results were not significant. Differences in the waist-hip ratio, percent fat, plasma insulin, and blood glucose were not significant, while differences in weight were significant (p - 0.02).
There was a trend for a significant or almost significant association with OR1875 <208/<208 homozygosity for the BMIs of subjects when they were 16 to 30 years of age, but little or no correlation for BMIs of subjects when they were 41 to 70 years of age. While this trend was also true for females alone, the opposite, but non- significant trend was seen for males alone (Table 30). These results suggested an association between variants of the OR gene and BMI in young but not older females, and no association with the BMI for males of any age. When the BMIs for males and females at age 26 to 30 years were divided into <25, 25 to 34, and <35 groups, there was a significant and progressive increase in the percent of subjects homozygous for the <208 alleles from 24% to 56%.
The association with psychiatric variables based on the SCL-90 were more dramatic. The two behaviors most often associated with obesity - anxiety and depression, were significantly associated with homozygosity for the OR 1875 <208 alleles ( ? = 0.003 - 0.0005). For anxiety, the mean score (0.85) for the 36 subjects that were homozygous for the <208 alleles, was more than twice that of the scores for heterozygotes (0.277) or >208/>208 homozygotes (0.203). One reasonable explanation for the association ofthe OR1875 <208 alleles with anxiety and depression could be that these alleles result in obesity and the anxiety and depression is secondary to the obesity. To investigate this the inventors performed analysis of covariance with BMI, waist-hip ratio, age and sex as covariates and the OR1875 alleles as the main effect. For anxiety this showed that the only variable that was significantly correlated with the SCL-90 anxiety score was the presence ofthe OR.875 >208 alleles (Table 32), suggesting that the OR gene had a primary effect on psychiatric symptoms and may play a direct causal role in the depression and anxiety associated with obesity.
To examine the role of the DRD2 gene in the CHP subjects, ANOVA was used to compare the BMIs at various ages in subjects with the D2A1 allele versus subjects not carrying the Al allele. As with the OR1875 alleles, there was a just significant association with the BMIs for the lower age groups i.e. 31 - 40 years, /? = 0.015.
To investigate the additive effect of two or more genes the inventors performed ANOVA for subjects homozygous for the OR1875 208 bp alleles and/or carrying the D A1 allele for the different age specific BMI groups. For males and females combined, there was a significant association between the presence of either OR1875 <208/<208 or D2A1 allele and higher BMIs for all groups from age 16 to 50 (Table 34). The /? values for all four of the age 16 to 40 groups were < 0.005. When females only were examined, despite the lower number of subjects the results were even more significant. Here the p value for the age 16 to 40 year old groups ranged from 0.0017 to 0.0004. There was a significant association for subjects carrying either or both genotypes or alleles for the waist-hip ratio, weight, and plasma insulin level.
As in previous studies (Comings et al, 1996f; Comings et al, 1996b;
Comings et al, 1997b) determination of the regression coefficient, r, between the genotype in question and a given score allowed the determination of r2 or the proportion of the variance of the score accounted for by the genes being studied. These results for the age specific BMI values are shown in Table 34. For males and females combined, the OR gene alone accounted for 3.2 and 3.0 percent of the variance of the BMI at 16 - 20, and 26 - 30 years of age, respectively. For females only, these values increased to 6.2 and 4.1%. When the effect of the OR gene and the DRD2 gene were combined, for males and females combined, these genes accounted for 8.5 to 9.9 percent of the variance of the BMIs when subjects were 16 to 40 years of age. When females only were examined, these two genes accounted for 19.1 to 22.8 percent of the variance of the BMI scores for subjects when they were 16 to 40 years of age ( ? = 0.0017 to 0.0004).
TABLE 30 Linear ANOVA for BMIs in CHP subjects by 0R1875 Genotype
BMI by Age Genotype N Mean S.D. F-ratio
Males and Females
16-20 years <208/<208 38 24.26 3.95 heterozygotes 63 22.66 3.74
>208/>208 27 22.50 3.64 3.58 0.061
21-25 years <208/<208 38 25.20 4.96 heterozygotes 65 24.22 4.56
>208/>208 27 23.54 4.80 2.02 0.139
26-30 years <208/<208 38 26.83 6.44 heterozygotes 65 24.79 4.67
>208/>208 27 24.22 5.57 4.05 0.046
31-40 years <208/<208 37 27.83 6.1 1 heterozygotes 65 26.92 6.35
>208/>208 26 25.79 9.14 1.31 0.275
41-50 years <208/<208 32 28.51 6.50 heterozygotes 60 27.86 8.07
>208/>208 24 27.38 6.21 0.33 0.564
51-60 years <208/<208 20 30.19 8.24 heterozygotes 43 27.52 6.61
>208/>208 14 28.40 9.89 0.64 0.424
61-70 years <208/<208 14 29.35 7.32 heterozygotes 23 26.66 3.57
>208/>208 7 26.61 6.98 1.67 0.202 BMI by Age Genotype N Mean S.D. F-ratio P
Females
16-20 years <208/<208 19 24.00 4.09 heterozygotes 35 21.78 3.72
>208/>208 21 21.83 3.48 3.18 0.078
21-25 years <208/<208 19 25.30 5.73 heterozygotes 37 23.17 4.89
>208/>208 21 22.86 4.86 2.20 0.140
26-30 years <208/<208 19 28.04 8.00 heterozygotes 37 23.93 5.1 1
>208/>208 21 23.60 5.87 4.99 0.028
31-40 years <208/<208 18 28.94 7.28 heterozygotes 37 26.35 7.77
>208/>208 21 25.46 10.08 1.61 0.208
41-50 years <208/<208 14 28.33 7.00 heterozygotes 34 28.28 8.84
>208/>208 19 27.51 6.85 0.10 0.752
51-60 years <208/<208 9 30.01 7.90 heterozygotes 20 27.1 1 5.22
>208/>208 12 29.07 10.26 0.03 0.859
61-70 years <208/<208 6 26.93 4.55 heterozygotes 10 25.23 4.28
>208/>208 6 26.69 7.65 0.006 0.939
Males
16-20 years <208/<208 19 24.51 3.89 heterozygotes 28 23.77 3.53
>208/>208 6 25.27 3.22 0.001 0.973
21-25 years <208/<208 19 25.09 4.19 heterozygotes 28 25.52 3.79
>208/>208 6 25.90 4.07 0.24 0.627 BMI by Age Genotype N Mean S.D. F-ratio p
26-30 years <208/<208 19 25.62 4.25 heterozygotes 28 25.94 3.80
>208/>208 6 26.39 4.01 0.18 0.671
31-40 years <208/<208 19 26.79 4.71 heterozygotes 28 27.67 3.76
>208/>208 5 27.19 3.38 0.25 0.619
41-50 years <208/<208 18 28.64 6.28 heterozygotes 26 27.31 7.07
>208/>208 5 26.88 3.74 0.49 0.488
51-60 years <208/<208 1 1 30.38 8.89 heterozygotes 23 27.88 7.71
>208/>208 2 24.45 0.15 1.21 0.278
61-70 years <208/<208 8 31.18 3.08 heterozygotes 13 27.74 0.71
>208/>208 1 26.11 -.- 1.98 0.174
TABLE 31 OR1875 Polymorphism and SCL-90 Scores by Linear ANOVA
SCL-90 Score Genotype N Mean S.D. F-ratio
Anxiety <208/<208 36 0.850 1.36 heterozygotes 65 0.277* 0.33
>208/>208 29 0.203* 0.29 12.72 0.0005
Depression <208/<208 0.935 0.79 heterozygotes 63 0.552* 0.59
>208/>208 30 0.453* 0.52 9.14 0.0030
Pscyhoticism <208/<208 35 0.426 0.60 heterozygotes 65 0.198* 0.28
>208/>208 30 0.183* 0.24 6.58 0.011
Hostility <208/<208 36 0.509 0.66 heterozygotes 66 0.255* 0.36
>208/>208 30 0.227* 0.38 6.36 0.013
Paranoid ideation <208/<208 37 0.527 0.56 heterozygotes 67 0.335 0.42
>208/>208 30 0.278 0.38 5.23 0.024
Obsessive-compulsive <208/<208 37 0.876 0.69 heterozygotes 64 0.703 1.03
>208/>208 31 0.443 0.42 4.34 0.039
Somatization <208/<208 33 0.715 0.72 heterozygotes 65 0.549 0.48
>208/>208 28 0.467 0.34 3.41 0.067
Interpersonal sensitivity <208/<208 34 0.732 0.73 heterozygotes 66 0.569 0.84
>208/>208 30 0.496 0.57 1.55 0.214
Phobia anxiety <208/<208 37 0.212 0.46 heterozygotes 66 0.076 0.18
>208/>208 30 0.138 0.41 1.05 0.305 SCL-90 Score Genotype N Mean S.D. F-ratio
Symptom total for <208/<208 29 33.72 21.48 scores > 0 heterozygotes 52 21.23* 15.50 >208/>208 27 20.85* 18.65 7.32 0.008
Symptom total for <208/<208 29 62.51 58.86 scores £ 0 heterozygotes 52 36.42* 33.15 >208/>208 27 31.44* 29.51 8.24 0.005
significant at = 0.05 by the Tukey test.
TABLE 32
Analysis of Covariance for SCL-90 Anxiety Variable with the OBιs 5
Polymorphism as the Main Effect, and BMI, Waist-Hip Ratio, Age and Sex as
Covariates
Anxiety Sum of d.f. Mean squares square
Covariates 1.369 4 0.342 0.518 0.677 BMI 0.263 1 0.263 0.447 0.505
WH ratio 0.046 1 0.046 0.078 0.780 Age 0.255 1 0.255 0.433 0.512 Sex 0.374 1 0.374 0.634 0.427
Main effect
OR1875 7.855 2 3.928 6.669 0.002 Explained 9.495 6 1.58 2.687 0.012 Residual 71.258 122 0.589 Total 81.345 128 0.636 TABLE 33
0R1875 <208/<208 Homozygosity and/or Presence ofthe DRD2 D2A1 Allele in the CHP Group - ANOVA for BMI at Different Ages
BMI by Age Genotype N Mean S.D. F-ratio P
Males and Females
16-20 years OR+ and/or D2A1 + 51 24.52 4.15
OR--andD2Al- 39 22.03 3.24 9.45 0.0028
21-25 years OR+ and/or D2A1 + 51 26.05 5.31
OR-andD2Al- 39 23.00 3.49 9.60 0.0026
26-30 years OR+ and/or D2A1 + 53 27.25 6.36
OR-andD2Al- 39 23.69 3.46 9.94 0.0022
31-40 years OR+ and/or D2A1 + 52 29.11 7.26
OR--andD2Al- 39 25.29 4.48 8.38 0.0048
41-50 years OR+ and/or D2A1+ 44 29.92 8.18
OR--andD2Al- 37 26.34 7.08 4.32 0.0408
51-60 years OR+ andor D2A1+ 51 30.06 7.39
OR-andD2Al- 39 26.77 6.97 2.83 0.0984
61-70 years OR+ andor D2A1 + 16 28.23 5.42
OR--andD2Al- 14 26.49 4.22 0.94 0.339
Females
16-20 years OR+ and/or D2A1 + 25 24.50 4.42
OR-andD2Al- 24 20.98 2.74 11.07 0.0017
21-25 years OR+ and/or D2A1 + 25 26.32 6.32
OR-andD2Al- 24 21.61 2.76 11.24 0.0016
26-30 years OR+ and/or D2A1 + 27 28.53 7.91
OR~andD2Al- 24 22.19 2.12 14.45 0.0004
31-40 years OR+ andor D2A1 + 26 31.09 8.98 BMI by Age Genotype N Mean S.D. F-ratio P
OR--andD2Al- 24 23.66 4.06 13.97 0.0005
41-50 years OR+ and/or D2A1 + 20 32.05 10.19
OR--andD2Al- 23 25.90 5.73 6.08 0.018
51-60 years OR+ and/or D2A1 + 9 31.10 7.23
OR-andD2Al- 16 27.01 5.61 2.48 0.128
61-70 years OR+ and/or D2A1 + 5 28.46 4.28
OR-andD2Al- 7 24.56 4.64 2.19 0.169
TABLE 34
Univariate Regression Analysis for <208/<208 Homozygosity and/or
Presence of the DRD2 D2A1 Allele for Subjects in the CHP Group at Different
Ages r r2 T P
0R1875 <208/<208 = : 1, other = 0: Males and Females
16 - 20 years 0.173 0.030 1.98 0.049
21 -25 years 0.131 0.017 1.49 0.137
26 - 30 years 0.181 0.032 2.09 0.038
31 - 40 years 0.108 0.012 1.22 0.222
41 -50 years 0.063 0.004 0.68 0.498
51 - 60 years 0.103 0.010 0.98 0.366
61 -70 years 0.215 0.046 1.45 0.153
OR! 875 <208/<208 = : 1, other = 0: Females
16-20 years 0.204 0.041 1.77 0.079
21 -25 years 0.171 0.029 1.49 0.141
26-30 years 0.248 0.062 2.22 0.029
31 - 40 years 0.146 0.021 1.28 0.205
41 -50 years 0.039 0.001 0.32 0.751
51-60 years 0.028 0.000 0.18 0.859 r r2 T P
61 - 70 years 0.017 0.000 0.08 0.938
0R1875 <208/<208 and/or D2A1 = 1, other = 0: Males and Females
16 - 20 years 0.312 0.097 3.07 0.0029
21 - 25 years 0.313 0.098 3.09 0.0026
26 - 30 years 0.315 0.099 3.15 0.0022
31 - 40 years 0.292 0.085 2.89 0.0048
41 - 50 years 0.228 0.052 2.08 0.041
51 - 60 years 0.227 0.051 1.68 0.098
61 - 70 years 0.181 0.032 0.97 0.339
OR1875 <208/<208 and/or D2A1 = 1, other = 0: Females
BMI 16-20 0.436 0.191 3.32 0.0017
BMI 21 - 25 0.439 0.193 3.35 0.0016
BMI 26 - 30 0.477 0.228 3.80 0.0004
BMI 31 - 40 0.472 0.223 3.72 0.0005
BMI 41 - 50 0.359 0.129 2.46 0.018
BMI 51 - 60 0.312 0.097 1.57 0.128
BMI 61 - 70 0.423 0.179 1.48 0.169
EXAMPLE 6 ADDITIVE EFFECTS ASSOCIATED WITH THREE DOPAMINE GENES
In the present study the additive effect of these three major genes affecting dopaminergic neurons was studied by determining if subjects who had inherited specific markers of all three genes tended to have higher (worse) behavioral scores than those who inherited less than three. The subtractive effect, the reciprocal of the addictive effect, was examined by determining if those who inherited none of these markers, tended to have lower (better) behavioral scores. Both effects were examined by determining if those who inherited 1 or 2 of the markers tended to have intermediate scores. This tests for the essence of polygenic inheritance - the requirement for the additive effect of several genes to produce a clinically significant effect on the phenotype. METHODS
Subjects The subjects were patients, or relatives of patients, treated for TS. The diagnoses of TS, chronic motor tic disorder or chronic vocal tic disorder, was based on the DSM-III-R criteria (American Psychiatric Association, 1987). The TS probands (n = 225) are defined as the individuals who sought medical care at this clinic. Of the probands. 82% had TS while the remaining 18% had either chronic motor tic disorder or chronic vocal tic disorder. Among the non-proband TS relatives (n = 60), 54% had TS, 31% had chronic motor tic disorder and 15% chronic vocal tic disorder. None ofthe non-TS relatives (N = 132) had chronic motor or vocal tics. All probands were personally interviewed and examined. Over 80% of the relatives were also personally interviewed. Each proband and their relatives were questioned about the racial and ethnic background for their four grandparents. For the DRD2 studies only non-Hispanic Caucasian probands, relatives and controls with northern and western European background were included. All subjects were over 6 years of age.
Ethnic stratification. Ethnic stratification was avoided in the present study.
All subjects were restricted to non-Hispanic Caucasians of northern or western European ancestry. The ethnic background of each subject was determined in all four grandparents. The number of different ancestral groups ranged from 1 to 12 with most subjects having 4 to 6 different ancestral groups. For the D2A1 allele, a total of 13 different studies have examined 714 controls screened to exclude alcohol and drug abuse. The prevalence ofthe D2A1 allele in these studies averaged 25.9% and ranged from 12.5 to 34.8%, all lower than the 40.7% in the 432 TS cases. (See also Super Control Study illustrated earlier in this application). When the mean behavioral scores were examined in D2A1 carriers versus non-carriers, several of the means were significant even when the controls were excluded from the analysis. The same was true for the combined examination of all three dopamine genes. Different subjects tended to score high on different behavioral scores. Despite this, there were many were significant results when the three groups of controls without, cases without and cases with, were examined. The chance of all these results actually being the result of hidden ethnic stratification rather than stratification by presence or absence of the variable being examined, seems remote. Positive results were obtained with all three of the dopamine genes examined, using the same polygenic set of controls and subjects. The likelihood that hidden ethnic stratification was involved in all three of these genes seems remote. These positive results are not simply a result of the fact that multiple behavioral variables are being examined, and thus a few should be significant by chance. The inventors have obtained totally non-significant results for all the behavioral variables for several other genes tested.
Controls. The controls (n = 67) came from three sources: a) adopting, foster or step parents of TS patients, b) subjects from an endocrinology clinic with thyroid cancer or non-insulin dependent diabetes mellitus. and c) hospital personnel including professionals, technicians, and maintenance workers. The endocrine patients were chosen as controls because both conditions are readily treatable with a high cure rate and produce a minimal disruption of daily living, present at a wide range of ages, and the patient base was the same at that for the TS subjects. All controls were screened to exclude ADHD, alcohol, drug and tobacco abuse.
Structured Questionnaire. Since 1987 all patients and available first degree relatives were required to fill out a detailed 31 page behavioral questionnaire modeled after the Diagnostic Interview Schedule (DIS) (Robins et al, 1991). The complete questionnaire is available elsewhere (Comings, 1990a). In addition to the DIS questions, there were many questions concerning demographic variables, all of the DSM-III and DSM III-R variables required for the diagnosis of ADHD, and questions about the type, location, duration and severity of motor and vocal tics (American Psychiatric Association, 1980, American Psychiatric Association, 1987). The responses to these questions were then entered into an SPSS data base. Various aspects of the use of this instrument and the use of symptom clusters are presented elsewhere (Comings, 1995c; Comings, 1994c; Comings, 1994a; Comings, 1995a).
Blood Samples. While blood samples were not obtained on every TS proband or relative attending the clinic, the selection was essentially random within the confines of the following considerations. First, providing blood samples was totally voluntary and many subjects, especially the younger ones, chose not to have blood drawn. Secondly, because of the concerns about racial and ethnic stratification, there was a tendency to draw blood from non-Hispanic, northern and western European Caucasians since the most extensive data on controls comes from this group. Third, if both parents were available, there was a preference for obtaining blood from these families versus families where one ofthe parents was unavailable.
Genotyping. All subjects were genotyped based on a neutral identification number and read without knowledge of the individual being typed. The D2A1 genotyping was performed by hybridization of Southern blots as described previously (Comings et al, 1991). Some were also genotyped by a PCR™ technique as previously described (Dawson, 1986). DβH genotyping was done as described in Example 3. The DATl repeat polymoφhism was genotyped as described in Example 3.
Criteria for Comorbid Conditions. The structured questionnaire allowed the examination of sets of related symptoms. The criteria for each of these was determined prior to the present study and include: alcohol abuse (Comings, 1994b), drug abuse (Comings, 1994c), obsessive-compulsive behaviors (Comings, 1994a), major depressive episode (Comings, 1995c), mania (Comings, 1995b), somatization disorder (Comings, 1995b), panic attacks (Comings, 1995b), phobias (Comings, 1995b), conduct disorder (Comings, 1995a), oppositional-defiant disorder (ODD) (Comings, 1995a), sexual disorders (Comings, 1994c) learning disorders (Comings, 1995b) and tic severity (Comings, 1995a). The ADHD score represented the sum of all 22 of the ADHD variables used in the questionnaire where no or never = 0, occasionally = 1 and often = 2. Based on prior studies (Knell and Comings, 1993) those with a score of 21 or greater were considered to have ADHD. Because of the inventors' particular interest in ADHD, the inventors also examined it using a second set of criteria based strictly on the DSM-III-R diagnosis where at least 8 out of 14 of the above 22 variables were required (American Psychiatric Association, 1987).
The accuracy, utility and sensitivity of a questionnaire based approach to symptom evaluation has been demonstrated by others (Kaφ, 1994; Grossman et al,
1994) by comparing the use of such an instrument to an interviewer administered structured instrument such as the Kiddie Schedule for Affective Disorders and Schizophrenia, both given to the same subjects. The following are the criteria for some of the symptoms or scores that were not published at the time of this writing or may require clarification. To assess general performance in school (the Grade School symptom), the inventors asked the following question: "For grades 1 to 6 was your school performance on the whole below average, average, or above average in the following: a) math, b) reading, and c) writing. The possible answers were below average (2), average (1), above average (0). The results were summed across the three subjects with the worst score being 6 and the best 0. For the dichotomous variable a score of 4 or more was considered positive for grade school problems. Individuals were considered to have had problems with learning disabilities (the Learning disabilities symptom) if they ever had to be placed in an educationally handicapped, learning handicapped, learning disorder or resource class. Subjects were asked about the presence of all of the 16 phobias (the Phobias symptom) in the DIS and were considered to have problems with phobias if they had difficulty with 3 or more. The phobia score was the total number of DIS listed phobias for a given subject. Panic attacks (the Panic attacks symptom) were considered to have been present at some time if individuals answered yes to the DIS question, "Have you ever had a spell or attack (not due to a physical illness) when all of a sudden you felt frightened, anxious, or very uneasy where most people would not be afraid?" The panic score represented the total number of DIS panic attacks symptoms for a given subject. To evaluate reading problems (the Reading Problems symptom) individuals were asked, "What is the greatest number of years you were felt to be behind your peers in reading, if any? For example, if when you were in the 6th grade and you were only reading at 4th grade level, you would have been 2 years behind." Those who answered 2 years or more were considered to have had reading problems. Stuttering (the Stuttering symptom) was evaluated by the question, "Have you ever had problems with stuttering?" To have been scored positive for general anxiety (the General Anxiety symptom) individuals had to answer yes to both of the following DIS questions, "Have you ever had period of excessive anxiety or worry about various things in your life?" and "If yes, have these feeling persisted for a period of 6 months or more when they were present more than they were absent?" Problems with somatization (the Somatization symptom) were considered to be present if the individuals answered yes to 3 or more of the DIS questions concerning somatization. The somatization score represented the total number of DIS somatization symptoms for a given subject. Sleep problems (the Sleep symptom) were considered to be present if any one of the following were present daily or almost daily: problems getting to sleep at night, sleep walking, night terrors, early wakening and unable to get back to sleep, sleep talking, or nightmares. The sleep score represented the total number of the above sleep score symptoms that occurred daily or almost daily. Individuals with sexual disorders (the Sexual symptom) were scored positive for the if any of the following were present (^Comings, 1994a): 1. Frequent public exhibitionism, 2. Sex drive much greater than average, 3. prefer the same sex or both sexes, 4. A precocious interest in sexual things, 5. As a child drew dirty pictures much more than other children of their age, 6. Persistently felt they were born to the wrong sex, 7. Dressed as the opposite sex other than for Halloween or a costume party, 8 - 1 1. A period of 6 months or more of being sexually aroused by objects, or children, or masochistic or sadistic fantasies. The sexual behavior score represented the total number of the above sexual behavior problems in a given subject. Subjects with schiziod behaviors (the Schizoid Behaviors symptom) were scored positive if they answered yes to two or more of the DIS questions on schizophrenic symptoms. The schizoid score represented the total number of DIS schizoid symptoms in a given subject. Subjects were assayed for tics (the Tics symptom) by questions about the presence and age of onset of 8 different motor tics and 9 different vocal tics. The number of such tics was added up to produce a tic score. Thus, the presence of multiple different tics was scored higher than few tics. The above provided dichotomized results for χ square analysis, and scores for comparing the means in D A1 allele carriers versus non-carriers.
Grouping of Cases. The above information allowed subjects to be placed into two different types of groupings. The first was based on the presence or absence of chronic motor and/or vocal tics. These groups were TS probands, relatives of TS probands with TS or chronic tics, relatives of TS probands without chronic tics, and controls without tics. A second grouping consisted of a) controls without drug, alcohol or tobacco abuse and without the behavioral condition in question (controls without), b) TS probands or their relatives without the behavioral condition in question (cases without), and c) TS probands or their relatives with the behavioral condition in question (cases with). Thus, for example, since the controls as well as the subjects completed the structured questionnaire, for obsessive compulsive behaviors the comparison would be between controls without substance abuse and without obsessive compulsive behaviors, versus TS probands and relatives without obsessive compulsive behaviors versus TS probands and relatives with obsessive compulsive behaviors. Of the TS probands in the polygenic set only 3% were mild, 74% were moderate, and 23% were severe.
Statistics. When examining individual behaviors, such as behavior x, there would be two possible reasons for a significant increase in the prevalence of a marker in TS probands with behavior x versus controls without behavior x: a) the marked gene may play a role in behavior x, or b) the marked gene may be increased in frequency because it is associated with behavior y, which itself is associated with behavior x. To distinguish between a) and b) the inventors required that there be a significant, progressive, linear increase in the prevalence ofthe marker across all three groups, controls without (without x and very likely without y), cases without (without x but often with y), and cases with (with x and often with y). The SPSS (SPSS, Inc, Chicago, IL) statistical packages were used. When comparing dichotomous variables for a progressive series of controls without versus cases without versus cases with, the SPSS Mantel-Haenzel χ square statistic for a progressive linear trend was used. For comparison of the means of a given behavioral score in subjects with the D?A1 allele (D2A1A1 or D2A1A2) versus subjects without the Al allele (D2A2A2) the Student's t-test was used.
For uniformity for each of the genes studied the inventors genotyped the same group subjects for three different genes. This group was termed the polygenic set. Subjects were placed into this set before they were genotyped for DβH or DATl alleles. The selection criteria for the polygenic set required that subjects had to be non-Hispanic Caucasians, had to have filled out the structured questionnaire, had to have agreed to have blood drawn, had to have produced a sufficient amount of DNA to genotype all three genes, and had to be either a control, a TS proband or the relative of a proband. Since the same subjects were tested, this allowed the means for the behavioral scores to be compared for the different genes. There are 319 subjects in the polygenic set. In addition, a significant number of subjects were genotyped for one of the genes, but not for all three. For each gene, this was termed the total set and varied in size for the different genes. In every case the total set included the polygenic set plus additional non-polygenic set cases. To avoid losing data or power, for each behavior, the total set was also examined. However, to save space, only the /? values for the total set are given in the last column of the appropriate tables. The t-test analyses compared the means of the different behavioral variables for subjects with the allele or marker being tested versus those without the allele or marker. Again, where appropriate, the /? value for the total set is given in the final column ofthe respective tables.
For the quantitative tests of the means of the different behavioral scores, the inventors envisioned two somewhat opposing strategies. The first was to examine as large a number of subjects as possible, on the assumption that the greater the number of subjects examined the less the chance for a type II error. For this strategy controls, relatives and TS probands were examined. The second strategy was to only compare the extremes, i.e. controls versus TS probands, on the assumption that this would compare individuals with the least versus the greatest degree of expression of the mutant genes. The results will be presented for the first strategy, and the results of the second will be discussed if they are more informative than examining the larger set. Bonferroni adjusted α values are given in the appropriate tables, i.e. for multiple comparisons of subjects in mutually exclusive categories.
ANOVA analysis was performed using linear contrast (Dunn and Clark, 1995), to determine if there was a significant linear decrease in the means of a number of continuous behaviors across the four groups where 3 of 3, 2 of 3, 1 of 3, and 0 of 3 markers were present. The Tukey test was incoφorated into the analysis to determine if any of the individual group scores were significantly different from each other, at α = 0.05. To estimate the percent of the variance due to the three dopaminergic genes, multiple linear regression analysis was performed using 1 as the presence of the marker and 0 as the absence of the marker versus the different behavioral scores, for all three genes simultaneously. R2 gave proportion of the variance due to each gene and the sum of r2 for all three genes. This provided the total proportion of the variance accounted for by all three genes together, for each specific behavior.
RESULTS
The number, mean age and sex distribution of the subjects in the four groups of subjects for the total set, are shown in Table 35. It was expected that the mean age of the TS probands would be less than for the other groups and this was the case. It was also expected that the M:F sex ratio of the TS probands and relatives with TS would be higher than in the non-TS groups and this was also the case. However, since the genes tested are all autosomal, the sex ratio itself would not be expected to be a factor. To study this the inventors performed χ square analyses on the presence or absence of the different markers versus sex. These were not significant.
Taq Al allele of the DRD2 gene. Controls without vs cases without vs cases with. The prevalence of the D A1 allele in the four groups of TS probands, TS relatives with chronic tics, TS relatives without chronic tics, and controls, for the polygenic set and total set are shown in Table 36. In both cases there was a significant progressive increase by Mantel-Haenszel linear χ square, in the prevalence of the Al allele from controls (23.5 and 26.9%) to TS probands (41.5 and 41.7%).
The results of determining the prevalence of the D A1 allele in controls without, versus cases without versus cases with, for the polygenic set, and the /? values for the significant associations for the total set, are shown in Table 37. The most significant association was with manic symptoms, where 21.2% of controls who never had manic symptoms carried the D2AI allele, compared to 28.7% of cases without manic symptoms, versus 52.2% ofthe cases with symptoms (p = 0.00024). The other significant variables, in order, were oppositional defiant, sexual, ADHD-R, schizoid, ADHD, tics, major depression, and conduct. The most significant association for the total set was with sexual (p = 0.0007), stuttering (p = 0.0008), schizoid ( ? = 0.0016) and mania ( ? = 0.0017).
T-statistic for Means for D A1 Carriers Versus D2A2A2 Carriers. Since the majority of the behavioral assessments involved a continuous score, it was also useful to examine the means of these scores for all subjects based on whether they carried the D2A1 allele (D2AIAI and D2A1A2) or not (D2A2A2). These results for subjects in the polygenic set are shown in Table 38A listed by decreasing t-test value. The p values for the significant behaviors in the total set are shown in the last column. The significant variables, in order, were ADFID, mania, ADHD-R, conduct, tics, oppositional defiant, schizoid, and sexual. For the total set three additional variables, stuttering, obsessive-compulsive, and somatization were also significant. Most of these remained significant when the controls were deleted (Table 38-B). For comparison with the results used for all three dopaminergic genes together, the significant results for controls and TS probands for the polygenic set are listed in Table 38-C. Here conduct ranked the highest, followed in order by mania, ADHD, tics, schizoid, obsessive-compulsive, and oppositional defiant. To determine if homozygosity for the D2A1 allele (D2A1/D2A1) gave higher mean behavior scores than heterozygotes (D2A1/D2A2) the means for these two groups for all the behavioral scores were examined. For every variable except the tic score, the mean was lower for the homozygotes than the heterozygotes. In only three variables was this significant - alcohol, grade school and read.
Taq BI allele of the DβH gene The Taq BI allele in various psychiatric disorders. Of 148 non-Hispanic Caucasian controls tested, 60.8%> carried the DβH BI allele. Of those screened to exclude alcohol, drug and tobacco abuse or dependence. 52.9% carried the BI allele (Table 39). Using an α of 0.05, there was a significant increase in prevalence of the BI allele to 70.5% in 352 TS probands ( ? = 0.012). To determine if severity of TS played a role, the TS probands were divided by a global rating into mild (to mild to require treatment of any aspect of the TS spectrum), moderate (some aspect requiring treatment), and severe (some aspect of the TS spectrum causing a major disruption in their life, Comings and Comings, 1985). There was an increase in prevalence of the BI allele from 54.3% for mild, to 72.1% for moderate, to 72.7% for severe. The prevalence of the BI allele for the moderate cases was significant at/? = 0.0071.
The prevalence of the BI allele was 73.1% for 78 subjects with ADHD
(p = 0.019) and 73.1% for 104 smokers (p = 0.012). The prevalence of the BI allele in the other groups was not significantly increased over that in controls. While the association of the B 1 allele with TS and smoking was significant only without a Bonferroni correction, there is some concern that such a correction may inappropriately increase type II errors (Rothman, 1990). In a post hoc analysis of Bl/Bl homozygosity verses B1/B2 heterozygosity in the three grades of TS, it was noticed that 37.1% of mild, 49% of moderate, and 62% of severe TS cases were B1/B2 heterozygotes (Mantel-Haenszel linear χ square = 6.25, p = 0.012).
Controls without, cases without, cases with. The results for the prevalence of the DβH Taq BI allele for 319 subjects in the polygenic set are shown in Table 40. ADHD was the most significant with a BI allele prevalence of 47.1%, for the controls without substance abuse or ADHD, 70.6% for the cases without ADHD, and 81.9% of cases with ADHD ( ? = 0.0001 ). Other significant behavioral variables, in order, were learn, grade school, ADHD-R, oppositional defiant, tics, mania, alcohol, reading, drug abuse, sleep, stuttering, and obsessive compulsive. The results for the total set were similar with ADHD again the most significant. When males only were examined in the total set sleep was most significant ( ? = .00005), then ODD (p = 0.002), and ADHD ( ? = 0.005).
T-statistic for means for BI Carriers Versus B2B2 Carriers. Table 41-A shows the results when the polygenic set was restricted to controls and TS probands. ADHD was again at the top of the list and was significant at /? = 0.020. The only other significant behavior was grade school, /? = 0.029. The significant results for the total set, are listed in Table 41-B. Oppositional defiant behavior, sleep, ADHD and read were significant at α = 0.05. To determine if homozygosity for the BI allele (Bl/Bl) gave higher mean behavior scores than heterozygotes (B1/B2) the means for these two groups for all the behavioral scores were examined. There were no significant differences for any of the behavioral variables for homozygotes versus heterozygotes.
10/10 genotype of the DATl gene. The frequency of the different DATl alleles for the entire set of subjects examined is shown in Table 42. To simplify the analyses the prevalence of the 10/10 genotype was compared to the prevalence of the 10/x or x/x genotypes for Tourette's syndrome and autism, and different categories of behavioral disorders. Of the 91 controls, 37.4% carried the 10/10 genotype. This increased to 52.3%) for 241 TS probands (/? = 0.015). There was no significant difference in the mild, moderate and severe TS subjects. Among 36 subjects with autism 58.3% were 10/10 (p = 0.031). The results for TS probands and TS relatives were still significant after a Bonferroni correction. Examination of the frequency of the 10 allele gave comparable results (last two column in Table 42).
Controls without, cases without, cases with. These results for the polygenic set of 319 subjects, are shown in Table 43. The variable with the highest χ square was somatization with 21.1% of the controls without somatization problems carrying the 10/10 genotype, versus 46.8% of the TS probands or relatives without somatization problems, versus 60.3% of TS probands or relatives with somatization problems ( ? = 0.002). The other significant variables, in order of the magnitude of the χ square, were alcohol, ADHD-R, major depression, panic, obsessive compulsive, general anxiety, and mania. The significant results for the modestly larger total set of 357 subjects, are shown in the last column of Table 43. The major difference was the addition ofthe oppositional defiant, sexual, read, and ADHD as significant variables.
T-statistic for Means for 10/10 genotype Versus the non-10/10 genotype.
When the total set was examined, the variables somatization and major depression showed significantly higher means for those with the 10/10 genotype (Table 44-A). None of the variables were significant for all subjects of the polygenic set.. The results for the controls and TS probands only, for the polygenic set, are given in Table 44-B. This is the set used in the examination of the additive effects of the three. Here the following variables, in order, were significant: general anxiety, major depression, ADHD-R, ADHD, and alcohol.
Comparisons of all three dopaminergic genes. The results for each of the behavioral scores studied across all three genes, are shown in Table 45. The groups consisted of those who inherited all three markers (Group 1 ), 2 of the 3 (Group 2), 1 ofthe 3 (Group 3) and none ofthe 3 (Group 4). The comorbid behavior showing most significant linear association with the four gene groups was ADHD (/? = 0.0002). For example, the ADHD score for those who inherited 3 of 3 markers was 30.04, for those who inherited 2 of 3, 24.74, for 1 of 3, 20.42, and 0 of 3, 14.07. The mean for group 4 (none of 3) was significantly less than the mean scores for both group 1 and 2, and the mean for group 3 was significantly less than for group 1. The next most significant was the score for stuttering - 1.17,1.06, 0.94, and 0.46 ( ? = 0.0002). The respective scores for oppositional defiant behaviors for groups 1 through 4. were 5.04, 3.91, 3.38 and 1.93 (/? = 0.0023). The respective scores for conduct disorder were 4.08, 3.05, 2.87, and 1.93 (/? = 0.0023). The other significant variables were tics, obsessive- compulsive, mania, alcohol, and general anxiety. While the remaining behaviors were not significant, 16 of 20 showed the same progressive linear decrease with less genetic loading. The results were similar when the entire polygenic set was used, but moderately less significant.
To examine these relationships in further detail, the most significant behavioral score, ADHD, was divided into 8 groups representing all possible combinations of the markers of the three genes (Table 46). This confirmed the additive and subtractive trend. A similar breakdown of the tic score is also presented. These results were similar to those for the 4 gene categories and were significant for the same variables.
To examine the possibility that the results might somehow be driven by an unidentified aspect of the controls, the analysis was repeated using only subjects with
TS (probands and relatives). Despite the narrowed range of the scores, and the resultant higher /? values, ADHD, ADHD-R, somatization and major depression were significant at /? < 0.05, and conduct, oppositional defiant, and mania were marginally significant at/? < 0.07. For example, the values for the ADHD score for groups 1 to 4 were 29.9, 26.1, 23.0 and 22.9 respectively (p = 0.01); for conduct score were 5.1, 4.0,
3.8, and 3.2; and for oppositional defiant score were 3.8, 3.3, 2.9, and 2.7. The results for the estimation of the proportion of the variance for the more significant behavioral variables is shown in Table 47. In general the DRD2 gene contributed the most to the variance. For the major behaviors associated with TS, between 3.0 and 7.6%> of the variance was accounted for by the three dopamine genes. In this study an attempt was made to eliminate genetic variations that could be due to ethnic background or other similar disorders. This involved the following. 1. All subjects were non-Hispanic Caucasians. 2. Not only were the controls screened for ADHD, drug, alcohol and tobacco abuse/dependence, they were assessed by the same structured instrument used for the TS probands and relatives. This permitted exclusion of controls that possessed the behavior being studied. The dramatic effect this had is illustrated by the fact that for the total set, the resulting variation in the prevalence of the D2A1 allele in controls ranged from 35.0% to 23.8%, and the variation in number of eligible controls from 67 to 40 for the different behaviors. 3. A large number of subjects were examined to avoid type II errors. Thus, for the DRD2 locus 484 subjects were studied in the total set and 319 for the polygenic set. 4. All subjects were administered the same structured review of psychiatric symptoms, based on the DIS. TS is a complex spectrum disorder (Comings, 1995d, Comings, 1990) and this allowed the examination of a number of different behaviors to test the possibility that the D2A1 allele might be strongly associated with some behaviors but not others, rather than rely on a single dichotomous diagnostic entity (TS or not TS). 5. The inclusion of TS probands, TS relatives with and without TS, and controls, provided the opportunity for a much wider range of behavior scores to be examined. 6. To eliminate concerns about the inappropriate selection of controls, the results were also analyzed without including the controls. 7. The inclusion rather than puφoseful exclusion of probands with comorbid conditions, since individuals may have a greater degree of genetic loading. 8. Collection of many more severely affected probands rather than focusing on the large families of the type used for linkage studies, where the non-proband patients are often more mildly affected. 9. The examination of the effect of combining two or more genes on the phenotype, in this case the Taq Al allele of the DRD2 gene, the Taq BI allele of the DβH gene, and the 10/10 genotype of the DATl gene. To accomplish this all three genes were tested in the same set of subjects.
Dopamine D2 receptor gene The D2A1 Allele in TS probands versus other groups. As shown in Table 36, for the total set, 41.7% of the TS probands carried the D2A1 allele, versus 35.0% for the relatives with TS, versus 28.8% for the relatives without TS, versus 26.9% for the controls without substance abuse disorders. This progression was significant at/? = 0.0038. The results for the inventors' controls (26.9%o) were indistinguishable from the prevalence of the D2AI allele of 25.9% in a total of 714 non-Hispanic controls screened to exclude alcohol and drug abuse/dependence (Comings et al, 1996e). The prevalence in the inventors' TS probands (41.7%) was also virtually indistinguishable from that of the total of the 432 TS subjects genotyped by the inventors and others, of 40.7%. While these results are consistent with a role of the DRD2 gene in TS, they do not define which part of the spectrum of behaviors are primarily affected. To determine that, the inventors examined the prevalence of the D A1 allele in the three groups - controls without, cases without, and cases with the behaviors in question.
Twenty separate symptom clusters relating to impulsive, compulsive, addictive, affective, anxious, sleep and learning behaviors were examined (Tables 37 and 38). (Twenty-one including the double assessment of ADHD). The variables significantly associated with the D2A1 allele were sexual, stuttering, obsessive- compulsive, schizoid, manic, ADHD-R, tics, ADHD, conduct, oppositional defiant, alcohol abuse, learning, and sleep problems. All other behaviors showed the same trend but were not significant. The results for the two most significant (stuttering and sexual) and least (phobias) significant behaviors for the total set. Manic behaviors were the most significant for χ square studies of the polygenic set and ranked high on the tables. This is consistent with the inventors' studies of the behaviors in relatives of TS probands suggesting that manic symptoms represented the highest form of expression of the Gts genes (Comings, 1995d).
The lack of association between the presence of the D2AI allele and the severity of tics when only TS probands are examined, agrees with the results of Devor
(1992) and Gelernter et al,( 1994b). However, when controls and non-TS relatives were included, the tic score was significant. In addition, when cases were stratified by other behaviors the D2A1 allele was associated with many of them.
Dopamine β-hydroxylase. The prevalence of the DβH Taq BI allele was modestly, but significantly higher in 352 TS probands (70.5%) than in 148 controls (60.8%). The only other group of subjects that showed a significantly elevated prevalence of the B I allele was smokers at 73.1%.
For the polygenic set of 319 subjects, the 13 variables significantly associated with the DβH BI allele were, in order, ADHD, learn, grade school, ADHD-R, oppositional defiant, tics, mania, alcohol, reading, drug abuse, sleep, stutter, and obsessive-compulsive. However, for several of these, especially those of borderline significance (alcohol, drug abuse, stutter, obsessive-compulsive), the prevalence ofthe BI allele was higher in the TS probands and relatives without the behavior than in those with the behavior, suggesting the /? values were being driven by the lower frequencies in the controls. The results were similar for the larger total set of 455 subjects except for the addition of somatization and major depression and the non- significance of stuttering.
For the polygenic set, the prevalence of the B 1 allele in controls ranged from 46.9 to 56.5%. When the means of the behavioral scores were examined for controls and TS probands, with both the polygenic set and the total set, ADHD, grade school, oppositional defiant, and sleep were significant. The inventors' studies demonstrate that oppositional defiant behavior was consistently more significantly associated with the B 1 allele than conduct disorder.
To examine the possible role of the DATl gene, the inventors compared the prevalence of the 10/10 genotype for different behaviors in controls, TS probands and relatives of TS subjects, as in the studies ofthe DRD2 and DβH genes. This showed a significant association with a number of variables for the comorbid behaviors including somatization, alcohol dependence, ADHD, major depression, obsessive- compulsive, general anxiety, manic, sexual and oppositional defiant disorder.
While the present results support those of Gelernter et al. (1994a) showing an apparent physiological effect associated with alleles of the 40 bp repeat of the DATl gene, the inventors' results also suggest that the psychopathology is associated with the 10 allele rather than with the 9 allele. This was further supported by the finding that in every behavior that showed a significant effect, there was a progressive decrease in the frequency of the 9 genotype. For example, for somatization the frequency of the 9 allele decreased from 0.37 in the controls to 0.29 in the relatives without somatization, to 0.20 in the relatives with somatization, while the frequency of the 10 allele increased from 0.54 to 0.70 to 0.77 across the same groups. It is of interest that the frequency of the most common allele, 10, appears to increase still further in the presence of various sets of behavioral symptoms. One possible explanation is that the 9 allele was originally the normal allele and the 10 allele has increased in frequency by selection because of its association with one or more of the listed behaviors.
All three dopaminergic genes. To study the additive and subtractive effects required that the inventors obtain DNA samples on a significant number of relatively severely affected TS probands. their relatives, and controls, and that the same subjects be genotyped for all genes. This was done with 319 samples. An a priori assumption was one of two strategies would provide the more power. The first strategy involved examining the whole polygenic set, including largely unaffected relatives, to increase the power. The second strategy was to examine a sub-portion of the polygenic set consisting only of controls and TS probands. This would provide the widest range of scores and a greater dichotomization by severity. While both techniques gave positive results, the latter proved to be the more effective. The results showed that for all but four of the behaviors examined (somatization, major depression, sleep and reading), there was a linear decrease in scores progressing from subjects that carried 3 of the 3 markers, to those with 2 of 3, 1 of 3, and 0 of 3.
The inventors have proposed that TS and ADHD are fundamentally the same genetic disorder (Comings and Comings, 1984; Comings and Comings, 1987a; Knell and Comings, 1993; Comings and Comings, 1993). The demonstration that when these three dopaminergic genes were combined, two of the behaviors that were most significant were ADHD and tics, provides confirmation for this hypothesis at a molecular genetic level. The significant correlation with other behaviors supports the concept that they constituted a spectrum of genetically inter-related behaviors. Examination of other genes can tip the phenotype in directions less influenced by dopaminergic genes. The tryptophan 2,3 -dioxygenase gene, with its effect on serotonin levels, is one example (Comings et al, 1996d). No evidence for more than a linear additive effect ofthe three genes, i.e. no evidence of epistasis. was found.
When the behavior most significantly associated with these three genes, ADHD, was examined in more detail, by listing all possible combinations of the three markers, these results were also consistent with an additive and subtractive effect. The data showed that the loading for three genes can account for a range of clinically significant scores from no diagnosis of ADHD to an unambiguous diagnosis. As there are still some subjects with all three markers who had no symptoms of ADHD, and some with none of the three markers who had clear cut ADHD there are clearly other genes involved. Thus screening for TS and ADHD may include allelic variants of other genes that have been implicated in these disorders.
Not all of the behavioral scores showed this degree of correlation with each of the eight permutations. To illustrate this, the results for the same type of dichotomization is shown in Table 46 for the tic score. While there is again an approximate and significant linear decrease in tic score across the different permutations, subjects positive for the D2A1 allele, but negative for the DβH BI and DATl 10/10 genotype, presented a notable discontinuity with a mean score of 5.0. Whether this is a statistical aberration due to the relatively small number of subjects in each group, or an indication that the DRD2 allele has a stronger effect on tics than the other genes, must await further studies. The studies of the DRD2 gene by itself, showed a significant association with tic severity
The present finding that stuttering ranked just below ADHD and higher than tics per se, support this proposal that stuttering is another manifestation of the Gts genes. These observations regarding conduct and oppositional defiant disorder stand in contrast the generally held assumption that these two behavioral disorders are entirely due to psychosocial factors, including poor parenting. While no one can doubt the critically important role of competent parenting, genetic factors may play the major role in conduct and oppositional defiant disorder when parenting styles or environmental factors are not at fault. Proportion of the variance accounted for the dopamine genes. Calculation of the correlation coefficients using multiple linear regression analysis allowed an estimation of the proportion of the variance for the different behaviors accounted for by these three dopaminergic genes. For all three genes this ranged from 7.6% of the variance for the ADHD score to 1.3% of the variance for stuttering (Table 47). To obtain an estimate of the relative importance of the three genes, the r2 value was summed across all the behavioral variables. This suggested the relative importance of the three genes was in the approximate ratio of 3:2: 1 for the DRD2, DATl and DβH genes respectively. This conclusion is supported by the fact that for the DRD2 gene, r was significant for eight of the behavioral variables (conduct, mania, schizoid, grade school, tics, OCD, ODD and phobia), for the DATl gene, r was significant for three of the variables (depression, general anxiety and alcohol abuse). While for the DβH gene r was significant for none of the variables, the three with the highest values were ADHD, ODD, conduct, reading and learning disorders. These results also provide support for the concept that different genes and combinations of genes play a role in how the phenotype will be expressed (Comings, 1995a). For example, all three genes are about equally involved in ADHD and ODD, while in conduct disorder the involvement is DRD2 > DβH > DATl . For learning and reading, the order was DβH » DAT > DRD2.
Since the concordance rate for chronic tics in identical twins is less than 100%
(Price, et al, 1985) a portion of the variance (about 10 to 20%) is due to environmental factors. The Taq polymoφhisms used for the DRD2 and DβH gene are not the sequence changes responsible for the functional variations in the genes, but are only in linkage disequilibrium with the functional mutations, these estimates ofthe percent of variance involved are probably underestimated, i.e. they would be higher if the functional mutations themselves were being tested. Finally, these estimates represent an average across all cases, controls and TS probands, whether they had the behavior in question or not. For example, only 41 of the 282 cases or 14.5% had problems with stuttering, while 43.7% had conduct problems. The percent of the variance accounted for by those who actually had the behaviors in question, is probably much higher. These results are consistent with the polygenic, polyfactorial nature of the these disorders. The relatively low proportion of the variance accounted for by these three genes, despite the significant associations for controls without, cases without and cases with, provides insight into why standard linkage analyses have been unproductive, and how sensitive this association approach is for polygenes.
TABLE 35 Age and Sex of the Different Subject Groups
Age
Group N Mean Age S.D.
TS probands 225 16.83 12.1 1
Relatives with TS 60 27.72 14.73
Relatives without TS 132 38.07 1 1.95
Controls 67 42.31 14.86
TOTAL 484
Sex
Group N Males N Females N Total % Males
TS probands 188 37 225 84
Relatives with TS 37 23 60 62
Relatives without TS 51 81 132 39
Controls 27 40 67 40
TOTAL 484
TABLE 36 Prevalence of the D2A1 allele in the Various Subject Categories
Category N A1A1 A1A2 A2A2 %A1 Freq. χ2*
A. Polygenic Set (n = 319)
TS probands 142 9 50 83 41.5 0.24
Relatives with TS 39 0 1 1 28 28.2 0.14
Relatives without TS 104 4 24 76 26.9 0.15
Controls 34 1 7 26 23.5 0.14 6.99
B. Total set (n = 484)
TS probands 225 13 81 131 41.7 0.24
^
b Relatives with TS 60 2 19 39 35.0 0.19
Relatives without TS 132 4 34 94 28.8 0.16
Controls 67 3 15 49 26.9 0.16 8.35
Mantel-Haenzel linear χ square based on D2AI prevalence.
TABLE 37 Association of the D2A1 allele with various comorbid behaviors for the polygenic set
Score Controls Cases Cases without without with χ2* P* p* for total set
N % N % N %
Manic 33 21.2 216 28.7 69 52.2 13.47 0.00024 0.0017
Opposit. Defiant 34 23.5 206 29.6 79 46.8 8.31 0.0039 0.0274
Sexual 27 25.9 204 28.4 88 46.6 8.19 0.0042 0.0007
ADHD-R 34 23.5 210 30.5 75 45.3 6.63 0.010 0.0085
Schizoid 32 25.0 194 30.4 88 44.3 5.92 0.015 0.0016 ADHD 34 23.5 163 30.1 1 16 41.4 5.42 0.020 0.01 10
Tics 34 23.5 104 26.9 181 38.7 5.27 0.022 0.0088
Major Depression 25 24.0 176 30.1 109 41.3 4.70 0.030 N.S.
Conduct 26 23.1 161 30.4 124 39.5 3.93 0.047 0.0135
Obsess. -comp. 32 21.9 216 32.4 69 40.6 3.59 0.059 0.0013
Reading 18 16.7 116 31.0 169 36.7 3.01 0.082 N.S.
Learning 29 20.7 190 32.6 95 37.9 2.70 0.100 0.041
Sleep 28 21.4 202 32.7 83 38.6 2.64 0.103 0.049
Score Controls Cases Cases without without with χ2* P* p* for total set
Panic attacks 28 21.4 178 32.6 100 38.0 2.58 0.107 N.S.
Stuttering 33 21.2 241 32.8 41 39.0 2.53 0.1 1 1 0.0008
Alcohol abuse 34 23.5 262 33.6 23 43.5 2.53 0.1 1 1 0.037
Phobias 23 17.4 182 33.0 103 36.9 2.40 0.120 N.S.
Drug abuse 34 23.5 258 33.7 27 40.7 2.09 0.147 N.S.
Somatization 19 26.3 154 32.5 78 39.7 1.78 0.182 N.S.
Gen. Anx. 26 15.4 226 35.4 67 32.8 0.98 0.322 N.S.
Grade school 30 23.3 187 34.2 88 34.1 0.60 0.436 N.S. i_»
Hi. Controls without = Controls without alcohol or drug or tobacco abuse/dependence and without the behavior in question
Cases without = TS probands and TS relatives that did not have the behavior in question
Cases with = TS probands and TS relatives that did have the behavior in question
* Mantel-Haenszel linear χ square or/? value based on the Mantel-Haenszel linear χ square.
TABLE 38
Comparison of Mean Behavior Scores for D2AI Carriers vs D2A2A2 Carriers
A. Polygenic Set, controls, TS relatives and TS probands (N = 319, D2A1 = = 106, D2A2A2 = 213)
Score 1— -D2A1 — | 1— D2A2A2--| t P p for total set*
Mean S.D. Mean S.D.
ADHD 20.77 13.22 15.53 13.60 3.28 0.001 0.003
Mania 2.00 2.49 1.16 1.83 3.19 0.002 0.003
ADHD-R 4.97 4.42 3.40 4.30 3.02 0.003 0.012
Conduct 3.01 2.39 2.24 1.99 2.87 0.005 N.S.
Tics 3.05 3.74 1.92 3.00 2.70 0.008 0.042
<. Oppositional Defiant 3.1 1 3.22 2.22 2.79 2.44 0.016 N.S.
^ $ Schizoid 1.66 2.19 1.1 1 1.34 2.41 0.017 0.007
Sexual 0.78 1.33 0.46 0.96 2.19 0.030 0.017
Obsessive-compulsive 2.90 3.05 2.28 2.64 1.79 0.074 0.009
Drugs 0.59 1.68 0.34 1.24 1.34 0.181 N.S.
Somatization 2.62 3.31 2.1 1 2.87 1.24 0.217 0.048
Learn 0.57 0.89 0.45 0.81 1.17 0.245 N.S.
Major depression 3.76 3.09 3.35 3.01 1.13 0.260 N.S.
Score | D2A1 — | 1— D2A2A2~| t P p for total set*
Mean S.D. Mean S.D.
Stuttering 0.16 0.37 0.11 0.32 1.1 1 0.268 0.002
Phobia 2.61 2.82 2.28 2.74 1.00 0.319 N.S.
Panic 3.17 2.20 2.94 2.07 0.92 0.360 N.S.
Read 1.78 1.93 1.57 1.99 0.91 0.365 N.S.
Sleep 0.47 0.79 0.39 0.79 0.77 0.443 N.S.
Grade school 2.75 1.93 2.57 1.95 0.75 0.457 N.S.
Alcohol 0.60 2.27 0.41 1.93 0.72 0.471 N.S.
Gen. Anxiety 0.23 0.43 0.21 0.41 0.40 0.692 N.S.
-ft, Total set: N = 417, D2A1 = 153, D2A2A2 = 264
B. Total set, TS relatives and TS probands Only (N = 417, D2A1 = 153, D2A2A2 = 264)
Score -D2A1- --D2A2A2-I p for total set*
Mean S.D. Mean S.D.
Mania 2.03 2.48 1.37 1.94 2.83 0.005 Conduct 3.15 2.36 2.50 2.13 2.82 0.005 Schizoid 1.81 2.24 1.22 1.74 2.80 0.006 Stuttering 0.24 0.43 0.13 0.34 2.69 0.008 ADHD 22.26 12.87 18.71 2.94 2.60 0.010
Obsessive-comp. 3.24 3.1 1 2.48 1.69 2.51 0.013 Somatization 2.93 3.51 2.01 2.70 2.49 0.014 Sexual 0.80 1.29 0.50 1.00 2.44 0.015 ADHD-R 5.28 4.46 4.36 4.62 1.99 0.048 Tics 3.1 1 3.54 2.52 3.32 1.67 0.096
C. Polygenic set, controls and TS probands only.
Score | D2A1 — | 1— D2A2A2--| t P p for total set*
Mean S.D. Mean S.D.
Conduct 3.65 2.47 2.64 2.10 2.80 0.006
Mania 2.31 2.50 1.40 1.95 2.54 0.012
ADHD 25.57 12.16 21.23 4.53 2.12 0.036
Tics 4.25 3.88 3.06 3.44 2.06 0.042
Schizoid 1.91 2.58 1.20 1.53 2.02 0.046
Obsessive-comp. 3.40 3.24 2.44 2.80 2.01 0.047
Oppositional Defiant. 4.31 3.27 3.30 3.17 2.01 0.046
TABLE 39 Prevalence of the DβH Taq B Alleles in Various Psychiatric Disorders
Disorder N 11 12 22 %1 O.R. freql χ2*
Controls 148 21 69 58 60.8 0.37
Screened cont. 51 6 21 24 52.9 0.32
TS 352 71 177 104 70.5 1.54 0.45 6.29
Mild 35 6 13 16 54.3 0.76 0.36 0.014
Moderate 251 58 123 70 72.1 1.67 0.48 7.24
Severe 66 7 41 18 72.7 1.72 0.42 4.82
ADHD 78 18 39 21 73.1 1.75 0.48 5.46
^> Alcoholism 23 3 13 7 69.6 1.47 0.41 1.77
-^Autism 40 6 21 13 67.5 1.34 0.41 1.95
Depression 28 6 8 14 50.0 0.64 0.36 0.06
Drug abuse 29 2 17 10 65.5 1.22 0.36 1.18
Gamblers 1 1 1 1 1 56 44 60.4 0.98 0.35 0.78
Smokers 104 29 47 28 73.1 1.75 0.51 6.18
TOTAL 913
Comparison ofthe prevalence ofthe BI allele in screened controls (no alcohol, drug or tobacco abuse/dependence) versus the disorder in question.
O.R. = odds ratio
Bonferroni corrected α = 0.05/8 = 0.0065.
it
TABLE 40 βH Taq BI allele (11 + 12 Genotype) in Controls, TS Probands and Relatives, for the polygenic set
Score Controls without Cases without Cases with χ2* P
N % N % N %
ADHD 34 47.1 163 70.6 116 81.9 15.14 0.00010
Learn 29 48.3 190 72.6 95 81.1 10.13 0.0014
Grade school 30 46.7 187 72.2 88 79.5 9.48 0.0021
ADHD-R 34 47.1 210 74.3 75 78.7 8.52 0.0035
Opposit. defiant 34 47.1 206 74.8 79 77.2 7.21 0.0070
Tics 34 47.1 104 75.0 181 75.7 7.17 0.0074
Mania 33 48.5 216 75.0 69 76.8 6.02 0.014 > Alcohol 34 47.1 262 76.0 23 69.6 5.92 0.018 Reading 18 44.4 1 16 73.3 169 76.9 5.42 0.019
Drug abuse 34 47.1 258 76.0 27 70.4 5.33 0.021
Sleep 28 53.6 202 74.3 83 78.3 4.63 0.031
Stutter 33 48.5 241 76.3 41 73.2 4.56 0.032
Obsess. -comp. 32 46.9 216 75.9 69 73.9 4.33 0.037
Schizoid 32 50.0 194 76.8 88 73.9 2.94 0.086
Score Controls without Cases without Cases with χ2* P
N % N % N %
Somatization 19 47.4 154 76.0 78 75.6 2.62 0.105
Panic attacks 28 50.0 178 76.4 100 74.0 2.43 0.1 19 Major dep. 25 52.0 176 75.6 109 75.2 2.40 0.121 Conduct 26 50.0 161 77.0 124 73.4 1.61 0.203 Sexual 27 55.6 204 74.5 88 72.7 1.12 0.288 Phobias 23 56.5 182 76.4 103 73.8 0.70 0.401 Gen. Anx. 26 53.8 226 75.2 67 70.1 0.62 0.430
^ o
TABLE 41 Comparison of Mean Behavior Scores for DβH Taq BI Carriers vs B2B2 Carriers
Score |- — BI — | |— B2B2 — | t P Mean S.D. Mean S.D.
A. Polygenic set Controls and TS probands. (N = 176, BI = 124, B2B2 = 52)
ADHD 24.48 13.57 19.07 12.72 2.37 0.020 Grade school 3.26 1.96 2.55 1.88 2.22 0.029
B. Total set. Controls and TS Probands (N = 292, BI = 207, B2B2 = 85)
Oppositional 4.16 3.19 3.08 3.12 2.68 0.008
Defiant
Sleep 0.63 1.03 0.36 0.70 2.60 0.010
ADHD 25.17 13.73 20.86 14.66 2.31 0.023
Read 2.14 2.04 1.57 2.09 2.1 1 0.037
TABLE 42
Prevalence of the Different DATl 40 bp Repeat Polymorphism Genotypes and Frequencies of the Alleles for Different Groups of Patients
Subjects N 6/6 8/9 9/9 8/10 9/10 10/10 9/11 10/11 11/12 %10/10 O.R. f9 f10 χ2* X2<
Controls 91 0 12 40 34 0 37.4 0.36 0.61
Tourette's S. 241 2 15 92 126 52.3 1.84 0.25 0.72 5.89 0.015 7.93 0.0048
Mild 15 0 8 0 55.3 1.92 0.25 0.74 1.37 N.S 1.75 0.184
Moderate 132 0 56 66 50.0 1.92 0.30 0.70 3.47 0.062 4.27 0.039
^ Severe 94 2 0 8 0 31 52 0 1 0 53.3 2.08 0.25 0.72 5.99 0.014 5.15 0.023
IT)
^ TS Relatives 103 0 0 7 0 37 57 0 2 0 55.3 2.08 0.25 0.72 6.27 0.012 5.43 0.019
Autism 36 0 12 21 0 0 58.3 2.35 0.22 0.75 4.62 0.032 4.63 0.031
Total 471
O.R. = odds ratio
* χ square of comparison of prevalence of 10/10 genotype in controls versus the subjects in question ** * χ square of comparison of the frequency ofthe 10 allele in controls versus the subjects in question Bonferroni corrected α = 0.05/3 = 0.017.
TABLE 43
Association of the Dopamine Transporter 10/10 Genotype with Various Comorbid Behaviors (1 = 10/10 Genotype)
Score Controls without Cases without Cases with χ2* R* p* for
N %1 N %1 N %1 set
Somatization 19 21.1 154 46.8 78 60.3 9.51 0.0020 0.0009
Alcohol 34 35.3 262 50.4 23 69.6 6.37 0.01 1 0.0027
ADHD-R 34 35.3 210 49.5 75 58.7 5.02 0.024 0.004
Major depression 25 24.0 176 50.0 109 55.0 5.39 0.020 0.006
Panic 28 28.6 178 50.0 100 55.0 4.53 0.033 0.010
Obsessive-compulsive 32 31.3 216 50.5 69 56.5 4.59 0.032 0.010 7 * ~> Gen. Anx. 26 26.9 226 50.9 67 56.7 4.94 0.026 0.01 1
Mania 33 33.3 216 50.5 69 56.5 4.07 0.044 0.012
Oppositional Defiant 34 35.3 206 50.5 79 55.7 3.32 0.068 N.S.
Sexual 27 33.3 204 50.0 88 55.7 3.41 0.064 0.013
Read 18 38.9 1 16 49.1 169 53.8 1.63 0.201 0.043
ADHD 34 35.3 163 51.5 1 16 53.4 2.29 0.129 0.049
Sleep 28 35.7 202 50.5 83 55.4 2.66 0.102 N.S.
Stutter 33 33.3 241 52.3 41 51.2 1.96 0.164 N.S.
Score Controls without Cases without Cases with χ2* P* p* for
N %1 N %1 N %1 set
Drug abuse 34 35.3 258 51.9 27 51.9 1.99 0.158 N.S.
Learn 29 37.9 190 51.1 95 53.7 1.56 0.210 N.S.
Tics 34 35.3 104 55.8 181 49.7 0.49 0.482 N.S.
Schizoid 32 37.5 194 52.6 88 51.1 0.78 0.370 N.S.
Grade school 30 36.7 187 52.4 88 47.7 0.19 0.659 N.S.
Conduct 25 34.6 161 54.0 124 49.2 0.21 0.644 N.S.
Phobia 23 21.7 182 54.9 103 46.6 0.40 0.525 N.S. ; : * Mantel-FIaenszel linear χ square or ? based on the Mantel-Haenszel linear χ square.
TABLE 44
Comparison of the Mean Behavioral Scores in Controls and Cases
Score |— 10/10 — j |-10/x x/x--| t P
Mean S.D. Mean S.D.
A. Total set Controls, TS probands and their relatives.
(N = 357, 10/10 = 182, 10/x, x/x = 175)
Somatization 2.69 3.30 1.94 2.68 2.11 0.036
Maj. Dep 3.87 3.05 3.20 2.98 2.1 1 0.036
B. Polygenic set, Controls and TS probands only. (N = 176, 10/10 = 85, 10/x,x/x = 91)
Gen. Anxiety 0.33 0.47 0.16 0.37 2.55 0.012
Major depression 4.00 3.04 2.87 2.83 2.53 0.012
ADHD-R 6.60 4.75 4.91 4.45 2.43 0.016
ADHD 25.44 13.94 20.42 13.28 2.43 0.016
Alcohol 0.68 2.46 0.09 0.70 2.11 0.037
TABLE 45
Comparison of the Behavior Score Means for Controls and TS Probands
Behavior Group Mean S.D. F ratio p**
ADHD ϊ 30.04 1097
2 24.74 13.53
3 20.42* 13.77
4 14.07*# 13.11 14.77 0.0002 Stuttering ϊ L17 049
2 1.06 0.55
3 0.94 0.62
4 0.46*#Λ 0.64 14.61 0.0002 ADHD-R ϊ 775 418
2 6.43 4.74 Behavior Group Mean S.D. F ratio /?* *
3 4.82* 4.53
4 3.53* 4.12 9.87 0.0020
Opposit. defiant 1 5.04 3.05
2 3.91 3.20
3 3.38 3.25
4 1.93* 2.84 9.56 0.0023
Tics 1 4.95 4.41
2 3.71 3.30
3 3.28 3.65
4 1.40* 2.97 9.56 0.0023
Conduct 1 4.08 2.51
2 3.05 2.35
3 2.87 2.23
4 1.93* 1.22 8.61 0.0038
Obsess, comp. 1 3.37 3.51
2 3.02 3.03
3 2.75 2.91
4 1.13 1.99 5.48 0.020
Mania 1 2.29 2.52
2 2.11 2.22
3 1.40 2.12
4 0.87 1.59 5.21 0.024
Alcohol 1 1.21 3.45
2 0.35 1.70
3 0.20 1.07
4 0.00 0.00 4.50 0.035
Gen. Anxiety 1 0.33 0.48
2 0.29 0.46
3 0.20 0.40
4 0.07 0.25 4.39 0.038 Behavior Group Mean S.D. F ratio p**
Panic 1 3.45 2.39
2 3.37 2.44
3 2.97 2.15
4 2.13 1.12 3.79 0.053
Schizoid 1 1.91 2.88
2 1.66 2.24
^ j 1.26 1.45
4 0.78 1.42 3.41 0.067
Sleep 1 0.83 1.04
2 0.64 0.86
3 0.44 0.89
4 0.46 0.74 2.10 0.149
Sexual 1 1.12 1.96
2 0.62 1.13
3 0.58 1.16
4 0.53 0.99 2.01 0.158
Drugs 1 0.87 2.29
2 0.34 1.32
3 0.34 1.32
4 0.20 0.77 1.92 0.168
Major depr. 1 3.83 3.07
2 2.91 2.10
3 2.94 2.79
4 2.80 2.93 1.88 0.173
Learn 1 0.87 0.99
2 0.80 0.90
3 0.78 1.03
4 0.47 0.74 1.67 0.197
Phobia 1 2.83 2.82
2 2.67 2.81 Behavior Group Mean S.D. F ratio /?**
2.41 2.79
4 2.00 1.96 1.00 0.318
Grade school 1 3.33 2.00
2 3.09 1.97
3 2.97 2.02
4 2.80 1.74 0.71 0.399
Somatization 1 3.09 3.02
2 2.68 3.74
3 1.69 2.14
4 2.69 4.02 0.43 .525
Read 1 2.00 1.88
2 1.98 1.98 j 2.10 2.23
4 1.86 2.41 0.02 .893
Group 1 = D2A1+, DβHBl+.DATl 10/10+ n = 24
Group 2 = 2 of 3 + n = 67
Group 3 = 1 or 3 + n = 70
Group 4 = D2A1-, DβHBl-.DATl 10/10- n = 15 Total = 176
* significantly different from group 1 at α = 0.05 by Tukey test.
# significantly different from group 2 = 0.05 by Tukey test. Λ significantly different from group 3 = 0.05 by Tukey test.
_ F-ratio by linear contrast for the 4 gene groups using ANOVA ** p value based on F-test
TABLE 46
Mean Behavioral Scores for Some Behaviors by Whether All, Some, or None of the DRD2, DβH and DATl Alleles were Present
Gene Combination N Mean S.D.
ADHD Score
D2+ DβH+ DATl + 24 30.04 10.97 D2+DβH+DATl- 22 25.04 12.72 D2-DβH+DATl + 34 25.91 14.83 D2+ DβH- DATl + 11 20.54 10.75 D2+ DβH- DATl - 10 21.50 12.90 D2-DβH+DATl- 43 19.96 13.20 D2-DβH-DATl + 16 20.94 16.38 D2- DβH- DATl - 14 14.07 12.10
Tic score
D2+ DβH+ DATl + 24 4.95 4.40 D2+DβH+DATl- 22 4.00 3.18 D2-DβH+DATl + 34 3.91 3.59 D2+DβH-DATl + 11 2.54 2.54 D2+ DβH- DATl - 10 5.00 4.96 D2-DβH+DATl- 44 2.84 3.31 D2- DβH- DATl + 16 3.43 3.52 D2- DβH- DATl - 15 1.40 2.97
TABLE 47
Multiple Linear Regression Analysis and Proportion ofthe Variance Accounted for by the Genes DRD2, DβH and DATl; Controls and TS Probands only
Behavior DRD21 DβH DATl Total
Scores r r2 r r2 r r2 %*
Conduct 0.217# 0.047 0.114 0.013 0.030 0.0009 6.0
Mania 0.197# 0.039 0.055 0.0003 0.084 0.0007 5.0 Behavior DRD21 DβH DATl Total
Scores r r2 r r r r %*
Schizoid 0.169# 0.028 0.046 0.0021 0.048 0.0023 3.3
Grade school 0!65# 0.026 -0.025 0.0006 0.0004 0.0000 2.9
Tics 0.155# 0.024 0.109 0.01 18 0.108 0.01 16 4.7
OCD 0.153# 0.023 0.040 0.0016 0.066 0.0043 3.0
ODD 0.149# 0.022 0.136 0.0184 0.108 0.0117 5.2
Phobia 0.149# 0.022 -0.041 0.0016 0.016 0.0002 2.5
Sex 0.142 0.020 -0.023 0.0005 0.061 0.003 2.6
Gen. anxiety- 0.141 0.020 -0.053 0.0028 0.180# 0.032 5.9
ADHD 0.125 0.016 0.166 0.0275 0.186 0.0346 7.6
Panic 0.123 0.015 0.004 0.0000 0.1 13 0.0128 3.0
Drugs 0.104 0.011 0.047 0.0022 0.024 0.0006 1.4
Stuttering 0.086 0.007 -0.005 0.0000 0.067 0.0045 1.3
Somatization 0.080 0.006 0.035 0.0012 0.075 0.0056 1.4
Alcohol 0.073 0.005 0.050 0.0025 0.160# 0.025 3.4
Depression 0.070 0.005 -0.023 0.005 0.183# 0.033 4.1
Sleep 0.041 0.002 0.088 0.0077 0.1 19 0.014 2.3
Learn -0.013 0.0002 0.125 0.0156 0.040 0.016 1.7
Read -0.063 0.004 0.127 0.0161 -0.049 0.002 2.4
Total 0.32 0.11 0.20
*Based on r2 from multiple r for all three genes. #/? < 0.05 EXAMPLE 7 DOPAMINE DI RECEPTOR GENE IN ADDICTIVE BEHAVIOR
METHODS
The three groups examined were the Tourette's syndrome (TS) group, the Smoking Cessation Group, and the Pathological Gambling Group. The subjects in all three groups were restricted to non-Hispanic Caucasians.
The TS Group. This group included controls without alcohol or drug abuse, TS probands most of whom were severely affected with multiple associated behavioral disorders (Comings, 1995b; Comings, 1990a) and relatives of TS probands. All meet DSM-IV criteria for TS and all were personally interviewed. The controls for the TS group consisted of adopting and step parents of TS probands, subjects with non-psychiatric disorders, and professional and non-professional hospital staff. Both the TS subjects and the controls have been described in detail elsewhere (Comings et al, 1996f; Comings, 1995b; Comings, 1994b; Comings, 1994c; Comings, 1995a).
Behavioral scores. Each control and TS proband or relative was required to fill out a questionnaire based on the Diagnostic Interview Schedule (Robins et al, 1981) or DSM-III-R (American Psychiatric Association, 1987) criteria for a range of disorders. The symptoms were grouped into 23 different quantitative variables assessing the number of symptoms relating to attention deficit hyperactivity disorder (ADHD) (2 scores), alcohol, drugs, obsessive compulsive behaviors, learning disorders, reading problems, gambling, manic symptoms, phobias, panic attacks, oppositional defiant behavior, conduct disorder, academic problems in grade school, smoking, sexual behaviors, schizoid, somatization, depression, sleep disorders, general anxiety, stuttering, and tics. The questions used for these behavioral scores have been described in detail elsewhere (Comings 1995a; Comings 1994a; Comings 1994b; Comings 1995b; Comings et al, 1996a; Robins et al, 1981 ; Comings 1995c). The rationale for examining comorbid behaviors is the same as described in Example 2. Some of the symptoms that were especially relevant to the present study related to tobacco, alcohol and drug use, compulsive eating, and gambling. The alcohol score consisted of the summation of "no" or "yes" answers to 18 questions derived from the MAST test for alcohol use (Comings, 1994b; Comings 1990a). The drug score was based on "no" or "yes" answers to nine questions based on the Diagnostic Interview Schedule (Robins et al, 1981; Comings, 1994c) concerning drug abuse/dependence. The variable for smoking was based on the question, "Have you ever smoked cigarettes, cigars or a pipe daily for more than a month or more" where "yes" was scored as 1 and "no" as 0. The variable for shopping score was based on the summation of responses to the following questions: "Have you ever bought more items than you really needed to buy to meet you needs? Have you ever gotten into financial trouble because of buying more things than you could afford? Have you ever run up a total balance on all your credit cards that was greater than your net monthly income? Have you ever shopped to fill a feeling of emptiness? Do you ever shop to get a feeling of happiness? Have you ever taken things without paying for them? The "no" response were scored as 0, the "occasionally" responses as 1, and the "often" responses as 2. The gambling score was derived from nine "yes" or "no" questions relevant to the severity of involvement in gambling described previously as the Gambling Score (Comings et al, 1996e). The evaluation of compulsive eating was based on "yes" or "no" responses to the question "Did you ever consider yourself a compulsive eater?"
Smoking Cessation Group. The second group consisted of individuals attending a smoking cessation clinic. These subjects and their own independent set of controls have been described in more detail in a previous study of the role of the DRD2 gene in smoking (Comings et al, 1996a). Here the variable for smoking assessment was the average number of packs of cigarettes smoked per day. The controls were screened to exclude all type of substance abuse including alcohol, tobacco, and other drugs.
Pathological Gamblers. The third group consisted of pathological gamblers derived from a prior study of the role of the DRD2 gene in pathological gambling. The details of patients ascertainment, and assessment have been described in detail elsewhere (Comings et al, 1996e).
Genotyping. To examine the DRDl gene the inventors utilized the Ddel polymoφhism consisting of an A to G change in the 5' UTR, tested by the PCR™ procedure as previously described (Cichon et al 1994a). The marker for the DRD2 gene was the Taql A1/A2 polymoφhism (Grandy et al, 1989).
Statistical Analysis. In the TS groups, the means of the behavioral scores were compared for subjects with different genotypes using the ANOVA statistical programs from the SPSS Statistical package (SPSS, Inc., Chicago, 111). A Tukey analysis tested for significant individual differences between any of the individual groups when more than two groups were examined. In situations where a progressive increase in the means of different scores across different genotypes were expected, the linear ANOVA was used by setting the subcommand of polynomial = 1 in the SPSS Statistical Package. Based on the results of the ANOVA analyses, χ square analyses were carried out comparing the frequency of the genotype associated with the highest mean behavioral scores in the following three different groups. The first consisted of controls without the behavior being examined. Since the controls were also required to fill out one or more questionnaires, it was possible determine whether specific behaviors were present or absent in the controls. For the TS group, the presence or absence of a behavior in both controls and subjects was based on the dichotomous breakpoints as described in previous studies (Comings, 1995b). The controls without a given behavior were termed controls without. The same dichotomous breakpoints allowed the TS probands and their relatives to be divided into two groups, those without the specific behavior being examined, and those with that behavior. These groups were termed cases without and cases with and formed the second and third group. The a priori hypothesis was that if there was a significant association between a given genotype and the behavior in question, there should be a progressive increase in the frequency of this genotype across these three groups. The use of the cases without and cases with groups controlled for the possibility that the frequency of that genotype might be increased in the TS subjects because it was associated with a behavior other than the one being examined. Since the inventors assumed there would be a progressive increase in the frequency of the genotype across these three groups, the linear χ square test (Mantel-Haenszel test in the SPSS Statistical Package) was used. To assure that the results partially match a linear increase across the three groups the inventors also required that the frequency of the genotype being tested be at least 20% higher in the cases with than in the cases without group. As in the study of dopaminergic genes in TS (Comings et al, 1996f), it was found that regression analysis was helpful in determining the percent of the variance of the different behavior scores accounted for by a specific gene. This provided r, and r2 provided the fraction of the variance of a given quantitative trait that was accounted for by that gene.
Correction for multiple analyses. Since 23 different behaviors were examined in the TS group it was necessary to make an adjustment in the level of significance. While an α of 0.05 would be too liberal an of 0.05/23 or 0.002 was considered too conservative. Thus an intermediate α of 0.05/10 or 0.005 was chosen. Since the study of the Smoking Cessation group using the a priori hypotheses based on the results in the TS group, and involved the examination of a single variable, packs smoked per day, an α of 0.05 was used. Finally, since the examination of the pathological gamblers only involved the comparison of genotype frequencies, an α of 0.05 was used.
RESULTS
The TS Group. The allele frequency for the Ddel polymoφhism for the controls (n = 63) was 0.34 for the 1 allele, and 0.66 for the 2 allele. The allele frequency for the TS probands (n = 227) was 0.37 for the 1 allele and 0.63 for the 2 allele. These were not significantly different χ 2 = 0.43, d.f. = 1, /? = 0.51. The distribution the genotypes for the Ddel polymoφhism for the controls and TS group are shown in Table 48-A. The 1 1 genotype was present in 4.9% of the controls and 17.5% of the TS group, χ 2 = 3.75, d.f. = 1, /? = 0.053. The differences in the percent of those carrying either the 1 1 or the 22 genotype was 41.3%> in controls and 57.3% in TS probands. This was significant, χ 2 = 5.08, d.f. = \, p = 0.024. In prior studies of the Taql A1/A2 alleles of the DRD2 gene, it has been consistently observed that a wide range of quantitative scores show the highest scores for 12 heterozygotes, intermediate scores for 22 homozygotes, and the lowest scores for 1 1 homozygotes. Based on these studies, the percentage of 12 heterozygotes in the three subject groups was examined. These results for the TS group are shown in Table 48-B. Of 73 controls, 19.2% were 12 heterozygotes, while of 345 TS probands, 35.3% were heterozygotes, χ 2 = 7.19, d.f. = \,p = 0.0073.
The interaction between the DRDl and the DRD2 genes was tested by examining the percentage of subjects that were homozygous for the DRDl Ddel 11 or 22 alleles and heterozygous for the DRD2 Taql A1/A2 alleles. The respective figures were 17.9% for the controls and 33.2% for the TS probands, χ 2 = 5.71, d.f. = 1., p = 0.016.
The association between the Ddel genotype and 23 quantitative trait variables was examined by ANOVA (Table 49). While none were significant at α = 0.005, the p value for the alcohol score was 0.0096. Of the seven scores with a p value of < 0.20, five were related to addictive behaviors - alcohol use, smoking, compulsive eating, gambling, and shopping. Those with the 1 1 genotype had the highest scores. For example, for the alcohol use variable, those with the 1 1 genotype had a mean score of 1.30, compared to 0.23 for those with the 12 genotype, and 0.42 for those with the 22 genotype. Ofthe total of 23 variables, those carrying the 1 1 genotype had the highest means for all variables except learning disorders and somatization.
On the basis of these results, the inventors then examined whether there was progressive increase in the frequency of the 1 1 genotype for different behaviors across the three groups of controls without, cases without, and cases with (Table 50). There were three behaviors where the linear increase was significant at α >.005, and where the frequency of the 1 1 genotype was at least 20% higher in the cases with than in the cases without group. These were, in order of significance, gambling, alcohol use, and compulsive shopping. For example, for the gambling score the prevalence of the 1 1 genotype increased from 4.6% for the controls without gambling problems to 15.5% for the cases without gambling problems, to 33.3% for the cases with gambling problems (p = 0.00095). When an α of >.05 was used, the three additional variables - drug use, compulsive eating, and smoking - were all related to addictive behaviors.
Univariate regression analysis (Table 51 -A) was significant at p > 0.005 for two behaviors - gambling and alcohol use. With an α of >.05, the four additional variables were compulsive eating, smoking, tics and reading. The next most significant behavior was shopping. Based on r for the Dde polymoφhism the DRDl gene contributed to 3.6% of the variance of the gambling score, 2.8% of the alcohol score, 1.9% of the compulsive eating score, and 1.6% ofthe smoking score.
Prior to examining the potential interaction of the DRDl and DRD2 gene by multivariate regression analysis, the inventors first examined the effect of the DRD2 gene, based on the Taql A1/A2 polymoφhism, using univariate regression analysis. Subjects carrying the DRD2 1 1 and 22 homozygotes were scored as 1, and 12 heterozygotes were scored as 2. At α = >.005 the DRD2 gene was significantly associated with oppositional defiant behavior, conduct disorder, compulsive eating, smoking, gambling and ADHD (Table 51-B). At α>.05 additional variables were mania, stuttering, obsessive-compulsive, and schizoid behaviors. Based on the r values, heterozygosity for the Taq Al allele accounted for 4.2% of the variance of the oppositional defiant score, 3.8% ofthe variance of the conduct disorder score, 4.1% of the eating score, 3.3% ofthe smoking score and 2.9% of the gambling score.
Multivariate regression analysis showed that r was significant for both the
DRDl and the DRD2 gene for gambling, compulsive eating, and smoking (Table 51C). For each of these, the results were additive such that when combined the DRDl and DRD2 genes accounted for 5.9 to 4.8 percent of the variance of these scores. The alcohol score was included to show that the 1 1 genotype of the DRDl gene had a significant effect, while in this group the effect of the DRD2 Al allele was not significant.
The additive effect of the DRDl and DRD2 genes was also examined using univariate regression analysis where those with both the DRDl Dde 11 and the DRD2
Taq A12 genotype were scored as 3, those with either genotype were scored as 2, and those with neither genotype were scored as 1 (Table 5 ID). Those variables that were significant at a > 0.005 were in order gambling, smoking, compulsive eating, oppositional defiant, ADHD, conduct disorder, obsessive-compulsive, mania and alcohol use.
The additive effect of the DRDl and DRD2 genes was also examined using linear ANOVA for three groups consisting of those that were DRDl Ddel 12 or 22 and DRD2 Taql 11 or 22 (neither); DRDl Ddel 11 or DRD2 Taql 12 (either); or DRDl Dde 1 1 and DRD2 Taq 12 (both) (Table 52). At α >.005, this showed a significant progressive increase in mean scores from the neither, to the either, to the both groups for the variables compulsive eating, smoking, oppositional defiant, ADHD, conduct disorder, obsessive compulsive, mania, and alcohol behavioral variables.
The additive effect of the DRDl and DRD2 gene was also examined using linear χ square for the frequency ofthe presence of either the DRDl Dde 11 genotype, or the DRD2 Taq A12 genotype, or both (Table 53). Those variables that were significant at a >.005, and where the mean for the cases with group was at least 20%) higher than for the cases without group were in order - mania, alcohol, obsessive - compulsive, conduct disorder, schizoid, sexual, compulsive eating and major depressive episode. The results for the variables alcohol use, compulsive eating and mania.
Since there was a significant difference between the controls and TS probands in the percentage of subjects carrying the DRDl Ddel 1 1 or 22 genotype, the inventors also examined the percentage of subjects carrying with the 1 1 or 22 genotype across the three groups controls without, cases without, and cases with. The following variables were significant at α >.05 and had a mean for the cases with that was at least 20% higher than for cases without - gambling, alcohol use, and grade school problems.
Smoking Cessation Group. The frequency of the Ddel 1 allele in the 61 smoking controls was 0.35, and in the 177 smokers it was 0.34 (Table 48A). Among controls, 4.9% carried the 1 1 genotype versus 17.5% of the smokers, χ2 = 5.88, d.f. = 1, /? = 0.015. Among the controls 39.3% carried the 1 1 or the 22 genotype versus 66.1% ofthe smokers, χ2 = 13.45, d.f. = 1,/? = 0.0002.
For the DRD2 gene, among the controls 26.2% carried the 12 genotype versus 42.8% of the smokers, χ2 = 5.69, d.f. = 1 , /? = 0.017. For the controls, 24.1% carried both the DRDl 1 1 or 22 genotype and the DRD2 12 genotype, versus 45.5% for the smokers, χ2 = 8.25, d.f. = 1 , /? = 0.0041.
The variable examined in the smoking cessation group was packs smoked per day. Since all the controls had completed the behavioral questionnaire, which included the same questions about smoking used in the TS group, it was possible to exclude those controls that had ever smoked cigarettes, cigars or a pipe, and well and those with drug or alcohol abuse. These individuals constituted the 0 packs/day group. The subjects in the smoking cessation group were divided into those who smoked 1 to 1 1/2 and 2 to 2 1/2 packs per day. (Since only those smoking at least 1 pack per day were admitted to the study, there were no subjects smoking less than 1 pack per day.) The results for the DRDl gene are shown in Table 54. The percentage of subjects carrying the 1 1 genotype increased from 4.9%> to 16.4% to 18.0% across these three groups, χ ~ 5.14, /? = 0.023. The percentage of subjects carrying either the 1 1 or the 22 genotype increased from 39.3%, to 61.8%, to 68.0%) across these three groups, χ" " 12.87, /? = 0.00033. The percent of subjects heterozygous for the DRD2 Taql A1/A2 polymoφhism increased from 26.2%, to 34.5%, to 46.3% across these three groups, χ" ~ 7.99, p = 0.0047. The percent of subjects that were both homozygous for the DRDl 1 1 or 22 and heterozygous for the DRD2 Taql A1/A2 alleles, increased from 24.1, to 34.5, to 50.4 across these three groups, χ2 = 23.48, /? = 0.0001.
The interaction of the DRDl and DRD2 genes for smoking was also examined using multivariate linear regression analysis (Table 55). This showed that the DRDl and DRD2 gene, as marked by these polymoφhisms, each contributed about equally. Combined they accounted for 10.5 percent ofthe variance of the packs/day variable.
Pathological Gamblers. Unlike the TS and the smoking cessation group, the pathological gambling group did not have its own set of controls. Thus, for comparative puφoses the TS and smoking cessation controls were combined to form the Total control group, and this was used for the pathological gamblers. For the gamblers, 14.1% were homozygous for the DRDl Ddel 1 allele, χ2 = 5.39, p = 0.020, and 55.8% were homozygous for either the 1 1 or the 22 genotype, χ^ = 6.75, ? = 0.009. For the DRD2 gene, 45.7% of the gamblers carried the Taql 12 group, χ2 = 18.61, p = <.0001. Of the gamblers 23.3% were carried the DRDl 1 1 or 22 genotype and the DRD2 Taql 12 genotype.
Despite the many studies indicating an interaction between the dopamine D] and D2 receptors in a range of psychiatric disorders, there has been a paucity of studies examining the potential association between genetic variants of the DRDl gene and behavior, or the potential interaction of genetic variants of the DRDl and DRD2 genes. The inventors were interested in the possibility that variants of the DRDl gene, or an additive effect of the DRDl and DRD2 genes, might also play a role in these behaviors. The inventors chose the DRDl Ddel polymoφhism (Cichon et al, 1994a) because it was a PCR™ based test and the minor allele was common in the general population. Since the previous studies of the DRD2 gene have shown the value of examining the interactions of more than one gene, the association between the genetic variants of the DRDl gene alone, and the potential additive effects of the Taql A polymoφhism of the DRD2 gene were examined. To minimize the effect of race only non-Hispanic Caucasians were studied. To minimize the effects of chance, the inventors sought to cross replicate any findings by examining three different groups of subjects, two of which had their own set of controls.
Allele and Genotype Frequencies. The results of the allele and genotype frequencies are shown in Table 48A. For the DRDl variant, the frequencies of the Ddel 1 allele in controls and subjects was virtually identical. For the three groups, TS probands, smokers and gamblers, the frequency of the 1 allele was 0.37, 0.34 and 0.35 respectively. For the TS and smokers control groups the frequency was 0.34 and 0.35 respectively. Many reports of association studies in psychiatric disorders limit themselves to a comparison of gene frequencies in controls versus subjects with a specific disorder. A similar limitation would have suggested that the DRDl gene played no role in any of these disorders. However, since the distribution of genotypes may be different, despite a similarity of gene frequencies, the inventors also examined genotype frequencies. This showed a significant increase in the prevalence of the 11 genotype in the smokers and gamblers, and borderline significant ( ? = 0.053) increase in the TS probands. There was a significant increase in homozygosity for either allele for all four groups with p values of 0.024, 0.0002, 0.009 and 0.0001 for the TS probands. smokers, gamblers and totals, respectively. The latter three were still significant if a Bonferroni corrected α of < 0.5/4 or 0.0125 was used.
The allele and genotype frequencies for the Taq Al allele of the DRD2 gene are shown in Table 48B. Based on these results, in the present study the inventors have examined the percentage of A1/A2. In the subject groups of TS probands, smokers, gamblers, and totals, the results were 35.3. 42.8, 45.7 and 40.0 percent respectively. For the TS, smoker and total controls the results were 19.2, 26.2 and 22.4 percent respectively. In all four groups the prevalence of the A1/A2 heterozygotes was significantly higher in the subjects than in the controls with p values of 0.0073, 0.017, <.0001 and 0.0001. In three of the four groups, the results were still significant with a Bonferroni corrected α >.05/4 or 0.0125.
The above results indicated a significant negative association with heterozygosity for the DRDl alleles, and a significant positive association with heterozygosity for the DRD2 alleles. To examine the potential interaction of the DRDl and DRD2 genes, the inventors divided the cases into those who were not heterozygous for the DRDl alleles (i.e. were 11 or 22 homozygotes) and were heterozygous for the DRD2 alleles. Since these genotypes were optimized for both genes, this group was termed both. The second group, termed either, consisted of those that were either DRDl 1 1 or 22 homozygotes or DRD2 heterozygotes. The third group, termed neither, were heterozygous at the DRDl alleles, and 11 or 22 homozygotes for the DRD2 alleles. These results are shown in Table 48-C. The percentage of subjects that were in the both group was significantly higher for the TS probands (33.2) versus the TS controls (17.9), p = 0.016; significantly higher for the smokers (45.5) versus the smokers controls (24.1), /? = 0.0041, and significant higher for the total subjects (34.3) versus the total controls (20.8), p - 0.0033. The percentage of subjects in the both group was not significantly increased for the gamblers (23.3).
TS group Since the initial exploratory studies of the potential role of the DRDl gene in behavior was performed on the TS group, and since more than one behavior was studied, these results will be presented in more detail. The inventors first compared the means of the 23 different groups of behaviors in the different DRDl genotypes using ANOVA. Of the seven behaviors that gave of/? value of less than 0.2, five were addictive behaviors - alcohol use, smoking, compulsive eating, gambling and shopping. While the alcohol use variable was the most significant (p = 0.0096) none were significant at α >.005 (see Methods). All of the quantitative traits shown in Table 49, and 14 of the remaining 16 variables, had the highest means for the 1 1 homozygotes. While the mean scores in the 22 homozygotes were often higher than in the 12 heterozygotes, the relative magnitude of the scores for the 11 versus the 22 heterozygotes indicted that in the TS group of subjects, homozygosity for the 1 1 allele showed a greater association with elevated scores than homozygosity for the 22 allele.
Based on the ANOVA results, the inventors examined the percentage of subjects that carried the 1 1 genotype in the controls without, versus the cases without versus the cases with groups (Table 50). A an αt< 0.005, three behaviors, gambling, alcohol use and shopping, were all significant. For gambling, this percentage increased from 4.5 to 15.2 to 35.2 percent ( ? = 0.00095). All six of the traits significant at αt< 0.05 were addictive behaviors.
Similar results were obtained using univariate regression analysis were those who were homozygous for the DRDl Ddel 1 allele were scored as 2, and those with the 12 or 22 genotypes were scored as 1. The gambling and alcohol use variables were significant at α < 0.005 (Table 51). Univariate regression analysis for the DRD2 gene, where A1/A2 heterozygotes were scored as 2, and homozygotes as 1, seven different traits were significant at α < 0.005 (Table 5 IB). These included three addictive behaviors, compulsive eating, gambling and smoking. Using multivariate regression analysis there were only three traits where both the DRDl and the DRD2 gene gave significant results, gambling, compulsive eating, and smoking (Table 51 C). The same results were obtained using univariate regression analysis where those in the both group were scored as 3, those in the either group as 2, and those in the neither group as 1 (Table 5 ID). Here the /? values for gambling, smoking and compulsive eating were < 0.0001.
To evaluate the magnitude of the scores, the inventors examined the means for those in the neither, either or both groups by ANOVA (Table 52). Here, eight traits, including compulsive eating, smoking, and alcohol use were significant at α < 0.005. The means were consistently highest in the both group. The final test was an examination of the percentage of subjects that were either DRDl 1 1 homozygotes, or DRDl A1/A2 heterozygotes. or both, across the controls without, cases without and cases with groups (Table 53). Alcohol use and compulsive eating were among the eight traits significant at α >.005. For alcohol use the percentage increased from 23.9 to 46.9 to 70.6 across the three groups, p = 0.00005.
Combined these results were consistent with a role of the DRDl gene in a number of addictive and other behaviors, and with a additive effect of genetic variants at the DRDl and DRD2 genes. While both homozygosity for both the DRDl 1 and the 2 alleles gave higher scores than 12 heterozygosity, in the TS group, homozygosity for the 1 allele gave the strongest associations with a number of traits.
Smoking cessation group. To determine if the inventors could replicate any of these findings in a totally different group of subjects, the inventors utilized individuals from a prior study of the role of the DRD2 gene in smokers (Comings et al, 1996a). All subjects in this group smoked at least one pack of cigarettes per day, and had tried unsuccessfully to stop smoking. As discussed above, when taken as a group the smokers showed a significant increase in the prevalence of the DRDl Ddel 1 1 genotype and the 1 1 or 22 genotype. To explore the relationship between the DRDl gene and smoking in more detail, the inventors examined the quantitative trait of packs smoked per day (Tables 54 and 55). There was a progressive and significant increase in the percentage of subjects with the DRDl 1 1 genotype of 4.9 to 16.4 to 18.0 percent across three groups of controls smoking 0 packs per day, and smokers using 1 - 1 1/2 packs per day, and smokers using 2 to 2 1/2 packs per day, /? = 0.023. In contrast to the TS group, for smokers the 1 1 or 22 homozygote group gave more significant results. Thus, the percentage of homozygous subjects increased from 39.3 for the 0 packs per day controls, to 61.8 for the smokers using 1 - 1 1/2 packs per day, to 68.0 for the smokers using 2 - 2 1/2 packs per day, ? = 0.00033. The percentage of subjects heterozygous for the DRD2 A1/A2 alleles increased from 26.2 to 34.5 to 46.3 percent across these three groups, /? = 0.047. As with the TS group, the effect of the DRDl and DRD2 genes were additive. Thus, the percentage of subjects in the both group increase from 24.1 to 34.5 to 50.4 across these three groups, /? = 0.0001. To further examine the additive effect of the DRDl and DRD2 genes in smokers, the inventors examined the packs per day variable using multivariate regression analysis. There was a comparable effect of both genes, and combined they accounted for 10.5 percent ofthe variance ofthe packs per day variable.
Gamblers. As discussed above, there was a significant increase in the percentage of subjects that were DRDl 1 1 homozygotes, or 1 1 or 22 homozygotes in gamblers compared to total controls, and a significant increase in the percentage of subjects that were DRD2 A1/A2 heterozygotes. Unlike the TS and the smokers groups, these effects were not additive in the gamblers since the percentage of subjects in the both group was not increased over the total controls.
Heterozygosity. The inventors' observations of the mean scores for a range of behaviors in number of different subject groups, suggest that genetic variants at the DRDl and DRD2 genes may also show heterosis. It was of interest that the effect was opposite in the two genes. Thus, the DRD2 gene Taql A1/A2 heterozygotes had more abnormal scores most variables, while for the DRDl gene heterozygotes had more normal scores. The inventors assume that both polymoφhisms are in linkage disequilibrium with other mutations that affect the function of the DRDl and DRD2 genes (Comings et al, 1991). The mechanism of action of this apparent heterozygous advantage/disadvantage is unknown. It is also unknown whether the opposite effect in the two genes is due to the fact they have opposite effects on cyclic AMP, or simply due to chance variations in the types of other mutations they are associated with, by linkage disequilibrium. The present results indicate the role of polygenic inheritance of the DRDl plus the DRD2 genes in addictive behaviors. While an integral part of polygenic inheritance is the critical role of combinations of genes, this study also illustrates the critical effect of combinations of alleles.
The importance of subject ascertainment. Were able to confirm a role of the DRDl gene across three independent sets of subjects, and the importance of the additive effect ofthe DRDl and DRD2 genes in two independent sets of subjects. The inventors' preliminary studies of subjects ascertained because the primary diagnosis was alcoholism or drug addiction, have supported the role of the DRDl gene, and the additive effect of the DRDl and DRD2 genes in some, but not all types of substance abuse. This is a not unexpected aspect of polygenic inheritance. Since the DRDl and DRD2 genes individually accounted for less than 6 percent of the variance of a given trait, and combined accounted for less than 1 1 percent of the variance of a trait, these moderate effects could be easily overwhelmed by differences in subject ascertainment. For example, it is very likely that abnormalities of a number of receptors are involved in various types of substance abuse including dopamine, serotonin, cannabinoid, nitric oxide, nicotinic muscarinic, GABA, and others. The diagnosis of Tourette's syndrome is dependent upon the presence of motor tics, and dopamine plays a major role in the regulation of muscle movement. Thus, it would be expected that comorbid substance abuse or other addictive behaviors in TS would be more likely to involve genetic defects of dopamine receptors, than in a group of subjects ascertained on the basis of any type of substance abuse.
Importance of testing at a symptom rather than diagnostic level. These and previous studies (Comings and Comings, 1987b) suggest that single dichotomous diagnostic categories may be so broad that they result in a significant loss of power in association studies. For example, TS subjects can range from individuals with a few mild tics and no other problems, to individuals with a devastating combination of tics, stuttering, ADHD, obsessive-compulsive, conduct, anxiety, mood, substance abuse and learning disorders. If a given gene contributes to TS but is especially associated with stuttering, and stuttering is present in only 20% of the cases, the role of that gene could be missed in a comparison of controls versus all TS probands, but would probably be detected in a comparison of controls without stuttering versus TS probands with stuttering. This concept was of particular importance in the present study. In the TS group, the behavioral variables that were significantly associated with the DRDl gene were those involving addictive behaviors. This was unlikely to be a chance finding because animal studies also suggested a role of the DRDl in addictive traits, and because the finding was replicated in three different groups of subjects.
There are several caveats concerning the present study. Since the DRDl Ddel polymoφhism is a neutral base change, the inventors assume it is in linkage disequilibrium with mutations in regions at or near the DRDl locus that effect the dopamine D, receptor density. A frequent concern of association studies is the possibility that the results may be due to a hidden racial or ethnic stratification, rather than the gene itself. While the inventors attempted to minimize this by restricting the studies to non-Hispanic Caucasians, and by replicating the findings in three independent groups of subjects, this remains a possible explanation. A second potential problem, especially in the TS group, is the examination of 23 different quantitative traits. This was compensated for by the use of a very conservative α of >.005. When the combined effects of the DRDl and DRD2 genes were examined, many of the /? values were less than 0.001, well below a full Bonferroni correction of 0.05/23 or 0.0022. In addition, the clustering of the significant results around addictive behaviors (alcoholism, compulsive eating, gambling, shopping, and smoking), provided some internal consistency. A final caveat is that homozygosity for the DRDl 1 1 allele was emphasized in the tables for the TS group, while 1 1 or 22 homozygosity was emphasized in the tables for the smoking group. However, as shown in Table 48, 11 or 22 homozygosity was significant across all three study groups. The feature all three groups had in common was the decrease in mean scores for the DRDl 12 heterozygotes and the increase in mean scores for the DRD2 A1/A2 heterozygotes. The ascertainment bias discussed above may also play a role determining why homozygosity for the 1 allele may be more important in one group of subjects, while homozygosity for both the 1 and the 2 alleles may be more important in another group. TABLE 48 Allele and Genotype Frequencies in All Three Subject Groups
N 11 12 22 %11 %11,22
1A. DRDl Ddel
I. Tourette 's syndrome Group
Controls 63 4 37 22 0.34 0.66 6.4 41.3
TS probands 227 36 97 94 0.37 0.63 15.91 57.32
II. Smoking Cessation Group
Controls 61 3 37 21 0.35 0.65 4.9 39.3 Smokers 177 31 60 86 0.34 0.66 17.53 66.14
III. Gambling group
Gamblers 163 23 72 68 0.36 0.64 14.1" 55.8°
Total controls 124 7 74 43 0.35 0.65 5.7 40.3
Total subjects 567 90 229 248 0.36 0.64 15.87 59.68
χ sq = 3.75 p = 0.053 χ sq = 5.08 /? = 0.024 χ sq. 5.88 /? = 0.015 χ sq. 13.45 p = 0.0002 χ sq. 5.39 /? = 0.020 (gamblers versus total controls) χ sq. 6.75 /? = 0.009 (gamblers versus total controls)
7 χ sq. 8.81 p = 0.003
8 χ sq 15.38 /? = 0.0001
TABLE 48 (continued)
N 11 12 22 P q %12
IB. DRD2 Taql
I. Tourette's syndrome Group
Controls 73 3 14 56 .15 .85 19.2 TS probands 345 17 122 206 .23 .77 35.31
II. Smoking Cessation Group
Controls 65 6 17 42 .22 .78 26.2 Smokers 194 7 83 104 .25 .75 42.82
III. Gambling group
Gamblers 186 -» j 85 98 .24 .76 45.7J
Total controls 138 9 31 98 .20 .80 22.4
Total subjects 725 27 290 408 .24 .76 40.04
' χ sq = 7.19 P = 0.0073
2 χ sq. = 5.69 /? = 0.017 χ sq. 18.61 p = <.0001 (gamblers versus total controls) 4 χ sq. 15.26 /? = 0.0001
TABLE 48 (continued)
N neither either both %both
IC. DRDl Ddel 11, 22 plus DRD2 ' Taql 12
I. Tourette 's Syndrome Group
Controls 67 4 51 12 17.9 TS probands 214 19 124 71 33.2'
II. Smoking Cessation Group
Controls 58 17 27 14 24.1 Smokers 176 64 32 80 45.52
III. Gambling Group
Gamblers 154 32 86 36 23.3
Total Controls 125 21 78 26 20.8
Total Subjects 544 1 15 242 187 34.33 χ sq. 5.71 /? = 0.016 χ sq. 8.25 /? = 0.0041 χ sq 8.63 p = 0.0033
neither: DRDl 12 and DRD2 11 , 22 either: DRDl 12 and DRD2 12, or DRDl 1 1, 22 and DRD2 1 1, 12 both: DRDl 1 1 , 22 and DRD2 12
TABLE 49 DRDl Results using ANOVA in The TS Group ΔIIPI. j Gπ
I I
11 12 22 n = 43 n = 136 n = 125
Behavior M S.D. M S.D M S.D. F-ratio* P alcohol 1.30 3.3 0.23* 1.2 0.42 2.2 4.17 0.0096 smoking 0.97 0.4 0.77* 0.5 0.81 0.5 2.80 0.062 comp. eating 1.17 0.5 0.94 0.6 0.94 0.5 2.71 0.068 tics 4.51 4.5 3.17 3.6 3.23 3.8 2.18 0.115 gambling 0.41 1.2 0.12 0.7 0.15 0.8 2.00 0.136 maj.dep.epi. 4.27 3.0 3.64 3.1 3.25 2.9 1.88 0.154 shopping 1.56 2.9 1.00 2.3 0.78 2.2 1.74 0.177 significantly less than genotype 1 1 at α = 0.05 by the Tukey test
TABLE 50 χ Square Analysis for the DRDl Dde 11 Genotype in the Tourette's Syndrome Group
Behavior Controls without Cases without Cases with Chi P
N % N % N % square
Gambling 67 4.5 217 15.2 17 35.3 10.91 0.00095
Alcohol 70 5.7 216 15.3 18 33.3 9.08 0.002
Shopping 54 7.4 182 13.7 52 26.9 7.85 0.005
Drugs 70 5.7 209 15.8 25 24.0 6.50 0.011
Eating 49 6.1 185 15.1 43 23.3 5.35 0.020
Smoking 70 5.7 218 16.4 15 20.0 5.02 0.024
TABLE 51 Univariate Regression Analysis for the DRDl Ddel 11 Genotype and Different Behavioral Scores in the Tourette's Syndrome Group Behavior r r T Behavior
31N DRDl Ddel (12,22 = 1, 11 = 2) gambling 0.190 0.036 3.36 alcohol 0.168 0.028 2.97 compulsive eating 0.139 0.019 2.33 smoking 0.129 0.016 2.26 tics 0.119 0.014 2.98 reading 0.112 0.012 1.97 shopping 0.095 0.009 1.67
31B. DRD2 Taql (11,22 = 1, 12 = 2) oppositional defiant 0.205 0.042 3.59 conduct disorder 0.197 0.038 3.43 compulsive eating 0.202 0.041 3.37 smoke 0.184 0.033 3.21 gambling 0.173 0.029 2.98
ADHD 0.163 0.027 2.82 mania 0.156 0.024 2.70 stuttering 0.148 0.022 2.55 obsess-comp. 0.146 0.021 2.53 schizoid 0.136 0.018 2.34
31C. DRDl and DRD2 gambling
DRDl 0.171 0.029 3.00 DRD2 0.168 0.028 2.94 F 0.243 0.059 9.10 compulsive eating DRDl 0.124 0.015 2.8 DRD2 0.201 0.040 3.38 F 0.237 0.056 7.91 smoking Behavior r r T
DRDl 0.119 0.014 2A9
DRD2 0.181 0.032 3.18
F 0.219 0.048 7.37 Alcohol
DRDl 0.189 0.035 3.30
DRD2 0.060 0.000 1.05
F 0.199 0.040 6.07
31D. Both DRDl 11 and DRD2 12 = 3; either = 2, neither = 1 (N = 293) gambling 0.240 0.057 4.21 smoking 0.219 0.047 3.84 compulsive eating 0.236 0.055 3.97 oppositional def. 0.196 0.038 3.42
ADHD 0.176 0.031 3.05 conduct disorder 0.174 0.030 3.01 obsess-comp. 0.172 0.029 2.99 mania 0.171 0.029 2.98 alcohol use 0.162 0.026 2.82 tics 0.134 0.018 2.32 schizoid 0.1 18 0.014 2.23
TABLE 52 DRDl + DRD2 Results using ANOVA in The TS Group (neither = DRDl 12,22 and DRD2 11,22; either = DRDl 11 or DRD2 12; both = DRDl 11 and DRD2 12)
I - - Allele Groups -- -1
Behavior neither either both F-ratio# P n = 168 n = 112 n = 15
M S.D. M S.D M S.D. comp. eating 0.87- 0.6 1.06 0.5 1.42 0.5 15.76 0.0001 smoking 0.73- 0.5 0.91 0.4 1.13 0.3 14.71 0.0002 oppositional 3.05* 3.1 4.21 3.3 5.06 3.7 1 1.70 0.0007 def.
ADHD 20.31 * 14.5 24.63 13.6 28.60 12.7 9.31 0.0025 conduct dis. 2.58* 2.1 3.54 2.4 4.26 3.0 9.15 0.0027 obsess-comp. 2.47* 3.0 3.40 3.2 4.27 4.1 8.93 0.0030 mania 1.43 2.0 2.06 2.4 2.80 2.7 8.89 0.0031 alcohol 0.24Λ 1.5 0.53Λ 2.0 1.93 4.1 7.99 0.0050
# linear ANOVA
* significantly lower than either at = 0.05 by Tukey test Λ significantly lower than both at α = 0.05 by Tukey test
- significantly lower than either or both at α = 0.05 by Tukey test
TABLE 53 χ Square Analysis for the Percent of Subjects with either DRDl 11 or DRD2 12 Genotype, or both, in the Tourette's Syndrome Group
Behavior Controls Cases without Cases with Chi P
N % N % N % squar e mania 63 22.2 153 44.4 75 57.3 16.82 0.00004 alcohol 67 23.9 21 1 46.9 17 70.6 16.51 0.00005 obsess-comp. 64 23.4 155 44.5 73 57.5 15.87 0.00007 conduct dis. 54 22.2 94 41.5 134 53.7 15.45 0.00008 schizoid 62 25.8 144 44.4 82 57.3 13.94 0.0002 sexual 52 26.9 158 41.1 85 56.5 1 1.94 0.0005 comp. eating 46 23.9 181 47.0 41 58.5 10.76 0.0010
MDE 46 28.3 134 44.0 94 55.3 9.12 0.0025
Only subjects where cases with was at least 20% greater than cases without are shown.
TABLE 54
DRDl and DRD2 in Smoking Cessation Group
Number (%)
Packs smoked per day
Genotype 0 1-11/2 2 -21/2 Total
DRDl 11 3 (4.9) 9 (16.4) 22 (18.0) 204
12,22 58 46 100 34
TOTAL 61 55 122 238 5.14 0.023*
DRDl 11,22 24 (39.3) 34 (61.8) 83 (68.0) 141
12 37 21 39 97
TOTAL 61 55 122 238 12.87 0.00033* Packs smoked per day
Genotype 0 1-11/2 2 -21/2 Total
DRD2 12 17 (26.2) 20 (34.5) 63 (46.3) 100
11,22 48 38 73 159
Total 65 58 136 259 7.99 0.0047*
DRD1 and DRD2 Neither 17 23 41 81
Either 27 13 19 59
Both 14 (24.1) 19 (34.5) 61 (50.4) 94
Total 58 55 121 234 23.48 0.0001**
* linear χ square d.f. = 1 ** Perason χ square d.f = 4
TABLE 55
Multivariate Linear Regression Analysis of DRDl and DRD2 Genes in Smoking Cessation Group r r2 T P
DRDl Ddel 12 0.232 0.054 30.73 0.0002
DRD2 Taql 12 0.220 0.048 30.54 0.0005
F 0.325 0.105 13.63 O.0001
EXAMPLE 8
EFFECTS OF TREATMENT WITH ENKEPHALINASE INHIBITORS
AND RELEASERS
In this example, the effectiveness of interactions of d-Phenylalananine (other enkephalinase inhibitors), Tyr-D-Arg (an enkephalin releaser) and Naltrexone (narcotic antagonist) on the release of dopamine into the nucleus accumbens(Acb) of both the Lewis (polydrug preferring) and the Fischer (non-polydrug preferring) rats will be examined. Both Lewis and Fischer rats will be divided into two groups: acute and chronic. The chronic group will be given daily doses of three drugs: 500 mg/kg d-phenylalanine (DPA) - 1-5 mg/kg of Tyr-D-Arg (TDA) and 1-2 mg/kg of naltrexone (NX) (DuPont, Wilmington, DE) every morning for 18 days. On the 19th day microdialysis sampling will be begun for either the chronic treatment or acute groups. The combination of drugs will vary: administering all three; any combination of any two; each drug alone. Acute doses of the three drugs will be as follows: DPA = 500 mg/kg i.p.. TDA 5 mg/kg i.p., NX i.p. 2 mg/kg.
Microdialysis Method Seven days prior to the study all rats will be surgically implanted under sodium pentobarbital anesthesia (50 mg/kg) with microdialysis probes in the left Acb at steriotaxic coordinates (relative to bregma): A + 2.0, LI .2, and V-8.0 (from skull). The probes will be of concentric design and constructed from 0.5 mm outer diameter stainless steel tube (Small Parts Company, Roanoake, VA). Each probe will have 2 mm of exposed dialysis membrane, having an outer diameter of 250 μM (Spectra/POr hollow cellulose fiber, MWC05000, Spectrum Medical Industries, Los Angeles, C A) which covers essentially the vertical extent of the Acb.
Dialysis Recovery Rates As determined by in vitro studies, relative recovery rates for the probes will be approximately 3.9% dopamine (DA), 4.1% for 3,4- dihydroxphenylacetic acid (DOPAC) and 3.2% for homovanillic acid (HVA). Immediately after implantation, probe infusion will be begun and continues for the duration of the study. Electrochemical measurements will be made with dual glassy carbon working electrodes coupled to two LC-4C detectors (Bioanalytical Systems, Inc., West Lafayette, IN), both set at +0.7V versus a Ag/ACl reference electrode. One electrode will be used for DA detection and the other for DOPAC and HVA detection. Dialysis samples begin after animals have recovered from the surgery for 20-24 h. Dialysis samples will be collected until dialysate levels of DA, DOPAC, and HVA are stable. Three 20 min baseline pre-injection samples will be then collected. Prior to any chronic injection, the pre-dialysate will be analyzed for baseline amounts. The chronic injections start after this baseline is established. For the acute rat group the drug combinations occur prior to collection at a fixed predetermined interval which varies according to the studies. A total of six 20 min samples will be collected over a 2 h period following drug administration. Rats in both the chronic and acute groups will be also observed for locomotor and stereotypic behavior from the inception of the study. After completion of all collections, standard histological analysis will be carried out on all rat brains to verify probe locations.
Self-Selection Other studies involving effects of the drug combinations on self-selection in Lewis vs. Fischer rats will also be done to specifically determine effects of DPA alone and in combination with TDA and NX to systematically reduce craving for alcohol, cocaine, sugar solutions, cannabis, and nicotine. The inhibition of central tegmental GABAergic activity by the combination of DPA and TDA which will inhibit the activity of GABA Transmission should be most powerful in increasing significantly the amounts of DA into the Acb. The use of NX appears to prevent alcohol induced euphoria.
EXAMPLE 9
ASSOCIATION OF DRD2A1 ALLELE AND PER CENT BODY FAT
METHODS
Obese Subjects. The goal of the study was to obtain a subject group consisting predominately but not necessarily exclusively of morbidly obese subjects. Females with fat content of 34% or greater, and males with a fat content of 28% or greater were considered morbidly obese.
Controls. The controls consisted of parents of twins from the Minnesota Twin Family study. Since these are ascertained from the entire state simply on the basis of having twins 11 or 17 years of age, they represent a more random set of all socioeconomic and educational groups than the college students. Since the results of substance abuse assessments were not yet available on the twin controls the inventors have listed these as "unscreened control." Since the subjects in the obese sample were also not screened for substance abuse, this makes the controls comparable to the subjects for the presence of obesity.
RESULTS. The obese group consisted of 91 subjects, 76 females and 15 males. Of the females, 60 or 78.9% were morbidly obese and the remaining 16 or 21.1% were overweight but with a %> fat of less than 34%). Of the males, 12 or 80% were morbidly obese, and the remaining 3 or 20% were overweight but had a % fat of less than 28%. Since the proportion of subjects that were not morbidly obese was too small to allow a separate statistical analysis, the two groups were combined for analysis.
The prevalence of the DRD2 D2A1 alleles in the obese subjects versus controls are shown in Table 56. For the total of males and females, of the obese subjects 67.0% carried the D2A1 allele compared to 32.3% of unscreened controls, χ =32.95, /? < 0.00001. This figure is virtually identical to the 32.9% figure for 980 unscreened Caucasian controls reported in the literature since 1990 (Table 57). The prevalence of 68.4% is significantly higher than for the controls. The results for the DATl gene are shown in Table 58. In contrast to the DRD2 gene, there was no significant increase in the prevalence ofthe 10/10 genotype in the obese subjects compared to the controls.
TABLE 56
Minnesota twin controls - unscreened for substance abuse
D2A
1 1 12 22 Tot %12
M + F N 14 83 203 300
% 0.047 0.277 0.677 1 0.323
F N 7 46 99 152 % 0.046 0.303 0.651 1 0.349
M N 7 37 104 148 % 0.047 0.250 0.703 1 0.297
Obesity Sample - % fat end unscreened for substance abuse
D2A
11 12 22 Tot %12
M+F N 5 58 30 92
% 0.055 0.615 0.330 1 0.670
F N 5 47 24 76
% 0.066 0.618 0.316 1 0.684 M N 0 9 6 15
% 0.000 0.600 0.400 0.600
TABLE 57
Controls 11 12 22 Total %1 Controls - Status Unknown
Bolos et al, 1990 4 17 41 62 33.9
Grandy et α/., 1989 2 14 27 43 37.2
Comings et al, 1995 0 21 67 88 23.9
Gelenter et al, 3 21 44 68 35.3
Uhl, 1992 3 27 71 101 29.7
Goldman Finns 4 38 70 1 12 37.5
Goldman 1993 1 1 42 1 14 167 31.7
Nother et al, 5 26 38 69 44.9
Noble et al, 1994 2 18 38 58 34.5
Jonsson et al, 1993 4 13 38 53 32.1
Hedebrand et al, 1993 4 19 38 61 37.7
O'Hara et al, 1993 (White non-users) 6 39 115 160 28.1
Total= 44 278 658 980 32.9
TABLE 58
DATl Other Total
.10/10
M+F N 160 122 282
% 0.567 0.433 1
F N 89 63 146
% 0.568 0.432 1
M N 77 59 136
% 0.566 0.434 1
M+F N 44 47 91 % 0.484 0.516 1
F N 38 38 76
% 0.500 0.500 1
M N 6 9 15
% 0.400 0.600 1
EXAMPLE 10
ANALYSIS OF OTHER POLYGENIC ALLELES
FOR THE DETECTION OF RDS Tryptophan 2,3 dioxygenase. Defects in serotonin metabolism, and abnormalities in both blood serotonin and tryptophan levels, have been reported in many psychiatric disorders. Tryptophan 2,3-dioxygenase (TDO2) is the rate limiting enzyme for the breakdown of tryptophan to N-formyl kenurenine. Functional variants of this gene could account for the observed simultaneous increases or decreases of both serotonin and tryptophan in various disorders. Four different polymoφhisms of the human TD02 gene have been identified. Association studies show a significant association of one or more of these polymoφhisms and Tourette syndrome (TS), attention deficit hyperactivity disorder (ADHD) and drug dependence. The intron 6 variant was significantly associated with platelet serotonin levels. Only the association with TS was significant with a Bonferroni correction ( ? = 0.005).
Subjects. The TS probands, TS family members, ADHD probands, two-thirds ofthe autism probands, and most of the controls were patients, or relatives of patients, treated at the TS and other clinics of the City of Hope National Medical Center (COH). The diagnoses of TS, chronic motor tic disorder or chronic vocal tic disorder, ADHD and autism, were based on the DSM-III-R (American Psychiatric Association, 1987) criteria. The TS probands are defined as the TS individuals who sought medical care at this TSS-ADHD clinic. All probands and the majority of the relatives were personally interviewed and examined by D.E.C. Of the probands, 82% had TS while the remaining 18% had either chronic motor tic disorder or chronic vocal tic disorder. The TS family members were parents of TS probands, whether they had TS or not. One-third of the autistic subjects came from Sagamore Children's Hospital, Dix Hills, NY (J.S.). Each proband and their relatives were questioned about the racial and ethnic background of their four grandparents, and only subjects where all four grandparents were non-Hispanic Caucasians, were included. Al subjects signed informed consents and the studies were approved by the Institutional Review Board. The smokers (Comings et al, 1996a), pathological gamblers (Comings et al, 1996b), and individual with alcohol dependence (Comings et al, 1994) and drug dependence (Comings et al, 1994) were derived from studies of the role of the DRD2 gene in these disorders. The selection and source of these subjects is described in detail in these respective manuscripts.
The DNA samples on the subjects with schizophrenia and depression were isolated from brain samples on subjects with these diagnoses form the national Neurological Research Bank (V.A. Wadsworth Hospital, CA). The subjects with schizophrenia had chronic schizophrenia, usually with histories of long term mental hospitalization. The subjects with depression had committed suicide and had histories of chronic depression. The diagnoses of schizophrenia and depression were based on DSM-III or DSM-IIIR criteria with concurrence by more than one reviewing psychiatrist. Subjects with concomitant alcoholism or drug abuse were excluded.
Controls. The COH controls came from four sources: a) unrelated grandparents from CEPH (Centre d'Etude du Polymoφhisme Humain) families; b) adopting, foster or step parents of TS patients; c) subjects from an endocrinology clinic with thyroid cancer or non-insulin dependent diabetes mellitus; and d) hospital personnel including professionals, semi-professionals, technicians, and maintenance workers. This wide range of controls were used to avoid potential selection problems that can arise when a more restricted source is used. The endocrine patients were chosen as controls because both conditions are readily treatable with a high cure rate and produce a minimal disruption of daily living, present at a wide range of ages, and the patient base was the same as that for the TS subjects. All controls were screened to exclude alcohol, drug and tobacco abuse.
PCR™ Amplification of the Mutant Region of Intron 6. The PCR™ reaction to amplify the TDO2 target sequence was as follows: 10 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2, 0.05% Tween 20, 0.05% NP-40, 100 μM each dATP, dCTP, dTTP, dGTP, 0.1 μM primers. The primers were no. 116 GACACTTCTGGAATTAGTGGAGG (SEQ ID NO:5), and no. 117 GAAGTTAAATCCATGTGGCTC (SEQ ID NO:6). The following was added to 20 μl: 0.5 U AmpliTaq (Perkin-Elmer, Foster City, CA), 1 μl (250 ng) genomic DNA. The reactions were run on a PE-9600 thermal cycler (Perkin Elmer) or a PTC- 100 programmable thermal controller (MJ Research, Inc., Watertown, MA) using the following protocol: 94°C 5 min, then 30 cycles of 94°C, 30 sec, 60°C 30 sec, 72°C 1 min, then 72°C for 5 min. To determine if amplification occurred, 10 μl of the reaction mixture was electrophoresed on a 1.5% agarose gel in TBE buffer.
Cloning and Sequencing. The PCR™ product of primers 1 16 (SEQ ID NO:5) and 1 17 (SEQ ID NO:6) were ethanol precipitated, and resuspended in TE buffer (Tris HCl 10 mM, EDTA 1 mM). The fragments were cloned into modified Blue Script pBdT (Hoton and Graham, 1991). A 20 μl ligation reaction contained the following: 20 μl 10 x ligation buffer (Boehringer Mannheim), 100 ng of each PCR™ product, pBdT and 1 μl T4 ligase. This was incubated for 18 h at 11°C. The sequence of the fragment was determined on an Applied Biosystems, Inc. (Foster City, CA) automated sequencing instrument using end primers T3, T7 and internal primers nos. 129 GCTGATTTTCAGACTGAGTGTG (SEQ ID NO:7) and 130 CTACAAACATATTTAAACATATGTT (SEQ ID NO:8).
Denaturing gradient gel electrophoresis. The DNA between intron 6 oligomers no. 116 (SEQ ID NO:5) and 117 (SEQ ID NO:6) was amplified by PCR™ yielding a 1359 bp fragment. The fragment was digested with Rasl to give 816, 470 and 60 bp fragments. These were electrophoresed in a 20-80% denaturing 6.5% acrylamide gel at 60°C, 70 V, for 16 hr (Grey, 1992). The PCR™ was carried out in a buffer of 10 mM Tris HCl. 50 mM KCl, 1.5 mM MgCl2, 0.05% Tween 20, 0.05% NP 40, pH 8.3 with 0.2 μM of each primer and 0.2 mM of each deoxyNTP. Rasl digestion of 20 μl of PCR™ product was carried out using 2.3 μl of 10X reaction 1 buffer (New England Biolabs, Beverly, MA) 5 U enzyme (in 1 μl) with digestion at 37°C overnight to discern the size ofthe fragment. BsFL Digestion. From the above PCR™ reaction a 10 μl aliquot was digested using 1.5 U of restriction enzyme BsR and final 1 x buffer (supplied by New England BioLabs, Beverly, MA) and incubated at 55°C overnight. A 10 μl aliquot of the digested product was subjected to electrophoresis in a 4% metaphor agarose (F.M.C. Products, Rockland, ME) gel for 1 h at 100 V in 1 x TBE (Tris-borate 100 mM, EDTA 1 mM). The gel was stained in ethidium bromide. Three different sizes of the fragments were expected. When the polymoφhic site was G/G, the DNA was completely digested giving 673 bp and 359 bp fragments. When the polymoφhic site was A/A the 1032 bp fragment was undigested. G/A heterozygotes had three fragments, 1032 bp, 673 bp and 359 bp.
Oligonucleotide Ligation Assay (OLA). The oligonucleotides used in the OLA for the G— »T variant were are follows: For the G specific oligomer OLA-G CTATTCTTATCCCTCTTTTCTTAA-(HEO)l (SEQ ID NO:9). For the T specific oligomer OLA-T ATATTCTTATCCCTCTTTTCTTAAT-(HEO)3 (SEQ ID NO: 10). The G specific oligomer had 1 , and the T specific oligomer had 3 U of hexaethylene oxide phosphamide added to the 5' end to vary the molecular weight of these two oligomers (Grossman et al, 1994). The common oligomer was
FAM-TATATATTACGGTTTATTACCGT-PO4 (SEQ ID NO: 1 1), where FAM was 5' carboxyfluorescein phosphoramidite (Applied Biosystems, Foster City, CA). When the G specific and the common oligomers were joined by the ligase reaction the predicted weight of the two was 50.5 bp. When the T specific and the common oligomers were joined the predicted weight was 56.5 bp. The reaction mixture for the OLA reactions consisted ofthe following: 20 mM Tris HCl, pH 7.6, 100 mM KCl, 10 mM MgCl2, 10 mM dithiothreitol, 1 mM NAD, 0.1 % Triton X-100, 10 nM oligomers. Ten U ligase (New England Biolabs) and 1 μl of PCR™ product were added to each 20 μl of reaction mixture. The reactions were run on a PE-9600 thermal cycler using the following cycling protocol: 20 cycles of 94°C 30 s, 54°C 2 min 30 s. Each 2 μl of reaction was mixed with 0.5 μl of deionized formamide and heated to 92°C for 2 min to denature. All 2.5 μl were loaded onto a 8% acrylamide gel in TBE and 8 M urea and electrophoresed for 3 h. The reaction products were identified either by electrophoresis in the Applied Biosystems DNA Sequencer using fluorescent stained primers, or by silver staining. The latter consisted of a double stain, first with Stains- All, then with silver stain. The gel was placed in a 0.01%) solution of Stains-All (Eastman Kodak, Rochester, NY) prepared in 50% formamide pH 7.5, for 20-30 min then destained in 2% glycerol overnight. The gel was then washed twice, 30 min each, in 10% ethanol, 0.5% acetic acid. The gel was then incubated for 20-30 min in 0.1% AgNO3 solution, washed twice with deionized water, then placed in a freshly prepared solution of 1.5% NaOH, 0.01% NaBH4, 4 ml 37% formaldehyde in 1 1 distilled water. The bands develop within 10-20 min and the reaction was then stopped using 0.75%> Na2CO3 and fixed in 5% acetic acid.
The Identification of the G-»T Variant by Dpnll Digestion. The sequence immediately 3' to the G-→-T was GATA. GATC is the recognition site for the Dpnll restriction endonuclease. The 3' 23 bp oligomer was designed to match the ATC sequence immediately 3' to the G->T variant as follows (oligomers underlined and the two g sites for the variants double underlined):
5'-TCATTAATCCTCTGGGTATTGTAAATGTGGATTTAGGTTAATGTATTATA TATAATGCCAAATAATGGCAGATAAGAATAGGGAGAAAAAGAATTA-3'
(SEQ ID NO:12) 5'-ATTAATCCTCTGGGTATTGT-3' (SEQ ID NO:13) 5'-TAGTCTTATCCCTCTTTTTCTTA-3' (SEQ ID NO: 14) This mismatch in the third position rarely compromises its effectiveness as a PCR™ primer. The 5' primer was chosen to provide a product of 92 bp. When the G— >T variant is A, only a 92 bp fragment is present.
The conditions for the PCR™ reaction were as follows: 0.1 μM for each primer, 0.2 mM each dNTP, 50 mM KCl, 10 mM Tris HCl, 1.5 mM MgCl2, 0.001% (w/v) gelatin, 2.5 U per 100 μl AmpliTaq DNA polymerase (Perkin-Elmer, Foster City, CA), 80 ng genomic DNA. The PCR™ cycles were 94°C for 4 min; 30 cycles of 94°C for 30 sec, 52°C for 90 sec, 72°C for 120 sec; followed by 72°C for 5 min. The conditions for the Dpnll digestion were 10 μl of PCR™ product, 0.05 μl of 10 U μf1 of Dpnll; 1.5 μl of: 1M NaCl, 0.5 M Bis HCl, 0.1 M MgCl2, 10 mM dithiothreitol, pH 7.9; 3.5 μl H O, at 37°C overnight. The products were electrophoresed in 4% Metaphor agarose. CCCCT repeat amplification. The oligomers used for detecting the intron 5 CCCCT repeat were no. 166 5'-CTCTTACAATAGAAGAAACCATTT-3' (SEQ ID NO: 15) and no. 167 the inverse complement of 5'-TCTCCTCTCTTTCCCTTCCC-3' (SEQ ID NO: 16). The amplification conditions were 5 min at 95°C, then 30 cycles of 95°C for 1 min, 50°C for 1 min, and 72°C for 1 min, followed by 5 min at 72°C. The final concentrations in the reaction mixture were 50 mM KCl, 1.5 mM MgCl2, 10 mM Tris, pH 8.3, 0.1 μM of primers, 200 μM each of dATP, dCTP, dTTP, 100 μM each of dGTP and 7-deazo-dGTP, and 0.5 μl template.
Identification of the exon 7 A-»C mutation (Asn→His) polymorphism. The primers for the PCR™ amplification of the A— >C variant were 5'-GCATGGCTGGAAGAACTCC-3' (SEQ ID NO: 17) 5' primer and
5'-TCTTCCAGGCCTCTGGTCATAT-3' (SEQ ID NO: 18) 3' primer. This produced a 89 bp product that was digested at the C variant site by Ndel into 67 and 22 bp pieces.
Association studies. The approach used was to compare the prevalence of various alleles in probands versus unrelated controls, of the same racial group. Bonferroni correction α in Tables 59, 60 and 61 , were 0.05/10 or 0.005. These studies were performed over a period of several years. As new polymoφhisms were identified, if initial studies of several hundred subjects suggested the variant was not significantly associated with a behavioral phenotype, no further subjects were examined. As a result, the number of subjects studied varied for the different variants.
TABLE 59 RESULTS OF INTRON 6 G→A TD02 POLYMORPHISM
Group GG GA AA %A OR Cl χ
Controls 141 136 3.5
ADHD 113 110 2.7 0.74 0.2-3.2 0.16 NS
Alcohol dep. 65 65 0 0 0.0 0.00 2.36 NS
Autism 65 61 6.2 1.78 0.5-6.8 0.72 NS
Depression 16 14 12.6 3.88 0.7-21.9 2.70 NS
Drug Dep. 71 69 0 2.8 0.79 0.2-4.2 0.78 NS
Path. 166 158 8 0 4.8 1.38 0.4-4.3 0.30 NS gambling
Schizophrenia 41 41 0 0 0.0 0.00 1.45 NS
Smokers 93 92 1 0 1.1 0.30 0.03-2.6 1.37 NS
TS 299 268 29 2 10.4 3.15 1.1-7.8 5.93 0.015
TS carriers 151 135 14 2 10.6 3.22 1.1-9.0 5.43 0.020
OR = odds ratio GA, AA GG Cl = confidence interval of the OR Fisher's exact test used where appropriate.
TABLE 60 RESULTS OF INTRON 6 G→T TD02 POLYMORPHISM
Group GG GT TT %T OR Cl χ
Controls 197 166 30 15.7
ADHD 108 81 25 25.0 1.78 1.0-3.2 3.89 0.048
Alcohol dep. 65 61 6.1 0.35 0.1-1.0 3.88 0.049
Autism 65 58 10.8 0.65 0.3-1.5 0.97 NS
Depression 19 16 0 15.8 1.00 0.2-3.6 0.00 NS*
Drug Dep. 73 52 19 2 28.7 2.16 1.1-4.1 5.81 0.016
Path. 165 127 33 5 23.0 1.60 0.9-2.7 3.10 0.078 gambling
Schizophrenia 43 33 10 0 23.3 1.62 0.7-3.6 1.41 NS
Smokers 108 88 18 18.6 1.22 0.6-2.2 0.388 NS
TS 320 263 52 17.7 1.16 0.7-1.9 0.37 NS
TS carriers 134 119 14 1 11.1 0.67 0.3-1.3 1.37 NS
OR = odds ratio GT, TT/GG Cl = confidence interval ofthe OR * Fisher's exact test
TABLE 61 RESULTS OF INTRON 6 EITHER G→A OR G→T TD02 POLYMORPHISM
Group G/G A or T A+T %A or T OR Cl
Controls 135 112 23 17.0
ADHD 96 68 27 29.1 2.01 1.1-3.7 4.80 0.028
Alcohol dep. 64 60 6.3 0.32 0.1-1.0 4.31 0.038
Autism 64 53 11 17.2 1.01 0.4-2.2 0.01 NS
Depression 15 10 0 33.3 2.43 0.8-7.8 2.36 NS*
Drug Dep. 70 47 23 0 32.9 2.38 1.2-4.7 6.63 0.010
Path, 165 123 38 25.4 1.66 0.9-2.9 3.10 0.078 gambling
Schizophrenia 34 26 8 0 23.5 1.50 0.6-3.7 0.76 NS
Smokers 84 69 15 0 17.9 1.06 0.5-2.1 0.24 NS
TS 271 190 80 1 29.9 2.08 1.2-3.5 7.81 0.005
TS carriers 98 74 21 24.5 1.58 0.8-3.0 1.96 NS
OR = odds ratio A or T, A and T/GG GG Cl = confidence interval ofthe OR * Fisher's exact test
Non-random allelic association. Since family studies were not performed, phase specific haplotype frequencies could not be determined, thus mitigating against classical methods of analysis of linkage disequilibrium (Lewontin and Kojima, 1960; Lewontin, 1964). The degree of non-random allelic association among the four different polymoφhisms studied was estimated by cross-tabulations among subjects where two or more of the tests were performed on the same individuals. All subjects in all diagnostic categories were included in these analyses.
Analysis by specific behaviors. In studies of the role of the dopamine D2 receptor gene DRD2, DβH and DATl genes in TS (Comings et al, 1996c), the inventors have found that analysis by different clusters of behavioral symptoms were quite informative. This examined the prevalence of specific alleles in controls without the behavior in question versus TS probands and relatives with the behavior in question.
Serotonin and tryptophan levels. The techniques for analysis of the platelet serotonin levels, serotonin platelet ratios, and plasma tryptophan levels are given elsewhere (Comings, 1990b).
RESULTS
Controls. The unrelated CEPΗ grandparents constituted 60% of the controls. To determine if any of the inventors' own control groups gave different results, the frequencies of the polymoφhisms were compared across the different groups. There were no significant differences by chi square analysis.
Intron 6 DGGE polymorphism. The polymoφhisms were determined on polyacrylamide gel electrophoresis. The results with the original intron 6 DGGE polymoφhism are shown in Table 62. The less frequent band representing allele 2 was present in 12.1% of 91 controls. This was significantly increased to 21.5% in 40 TS patients, 28.4% in 26 pathological gamblers, 50% in 10 drug addicts and 37.5% in eight subjects with depression who had committed suicide. However, these numbers were small and the inventors wanted to identify the variant involved before progressing to a study of a larger number of subjects. Sequencing studies identified two polymoφhisms, a G— >T variant and a second G— A variant two base pairs apart (Comings et al, 1995). The inventors first used a ligation assay to examine these variants separately, then developed a simpler procedure using modifier primers and restriction endonucleases (see Methods). TABLE 62 INITIAL RESULTS OF DGGE POLYMORPHISM OF INTRON 6 OF TD02
Group 11 12 22 %2 OR Cl λ
Controls 91 80 11 12.1
Depression 37.5 4.36 0.91-20.8 3.91 0.083*
Drug Dep. 10 50.0 7.23 1.8-29.2 9.71 0.008*
Path, 26 16 7 3 38.5 4.55 1.6-12.3 9.55 0.007* gambling
TS 40 29 9 2 27.5 2.76 1.1-7.0 4.72 0.031
OR = odds ratio of 12, 22/11 Cl = confidence interval ofthe OR * Fisher's exact test two tailed
G-»A variant. The results of the intron 6 G-→A variant are shown in Table
59. Of the 141 controls, only 3.5%) carried the A allele. Of the 10 groups examined, the only significant results at α = 0.05 were an increase of the A allele to 10.4% in 299 TS subjects (odds ratio 3.15), and 10.6% in 151 TS first degree relatives. Neither of these were significant at a Bonferroni corrected/? value of 0.05/10 or 0.005.
G→T variant. The results of the G→T variant are shown in Table 60. Ofthe
197 controls, 15.7% carried the T allele. This increased to 25/0% in 108 subjects with
ADHD (p = 0.048), to 28.7% in 73 subjects with drug or polysubstance dependence (/? = 0.016) and decreased to 6.1% in 65 subjects with alcohol dependence (p = 0.049).
None of these were significant at α = 0.005.
Either G-»A or G—»T variant. The inventors examined the prevalence of the presence of either the G— A or G->T polymoφhism (Table 61). Of the 135 controls where both tests were performed, 17% carried either allele. This increased to 29.1% for 96 subjects with ADHD ( ? = 0.028), 32.9% for 70 subjects with drug dependence ( ? = 0.01), and 29.9% for 271 subjects with TS ( ? = 0.005). It decreased to 6.3%o for 64 subjects with alcohol dependence (/? = 0.03). Only the results with TS were significant at α = 0.005.
Exon 7 A-»C, 748 Asn→His variant. The inventors were hopeful that the Asn→His variant would be informative since it was an exon variant and involved an amino acid that is important in heme binding. The C or His allele was present in 6.3%> of 48 controls and this figure varied little for subjects with ADHD, autism, schizophrenia and TS, and none were significant.
CCCCT polymorphism. The base pair length and frequency of alleles at the CCCCT repeat region at the 3' end of intron 5 for all subjects tested were as follows:
Allele size Frequency
210 bp 0.018 240 bp 0.838
215 bp 0.053 245 bp 0.018
220 bp 0.023 260 bp 0.005
230 bp 0.045
The 240 allele and the 240/240 genotype were by far the most frequent. For puφoses of analysis, the frequency of the 240/non~240 and non-240/non-240 genotypes was compared to the frequency of the 240/240 genotype. For the 125 controls, 31.2% carried the 240/non-240 or the non-240/non-240 genotype. The prevalence for the other groups was virtually identical ranging from 22.1 to 30.5%, and none were significantly different from the controls.
Non-random allelic association. Table 63 shows the results of the estimates of non-random allelic association between the four TDO2 variants studied. Although a total of 1245 subjects were tested for both the G-»A and G→T variant, only 10 subjects were heterozygous for both the A and the T allele and one was a TT homozygote and a A heterozygote, indicating both variants were on the same chromosome. Each variant allele was relatively rare, 18.0% the T allele and 24.1% either. These results indicated these two adjacent variants (2 bp apart) were present on separate chromosomes and the observed distributions did not differ from the chance combination of independent events. Of the 312 subjects tested for both the G→T and the A→C variant (Table 63-B), none were heterozygous for both. For the entire set only 7.4% carried the C allele on the same chromosome (an AC heterozygote in a AA homozygote). Of the 621 subjects tested for both the G→A and the CCCCT polymoφhisms (Table 63-D), only six were heterozygous for the A and a non-240 bp CCCCT allele, and one non-240/non-240 homozygote was a GT heterozygote. These distributions did not differ from chance, suggesting that they are on completely separate chromosomes.
Finally, of the 696 subjects tested for both the G→T and the CCCCT polymoφhisms, (Table 63-E), 80 (47.6%) of the 169 240/non-240 heterozygotes were GT heterozygotes, 19 (70.3%) of the non-240/non-240 homozygotes were GT or TT, and 10 (100%) of the TT homozygotes were non-240/non-240 homozygotes. This relationship was highly significant (χ~ = 421.07, p < 0.00001) indicating a high degree of non-random allelic association between the non-240 CCCCT variants and the T allele. The results suggest that at least 50% of non-240 alleles occur on T allele chromosomes and at least 78% of T alleles occur on non-240 allele chromosomes.
TABLE 63
ESTIMATES OF NON-RANDOM ALLELIC ASSOCIATION BETWEEN THE
FOUR DIFFERENT TD02 VARIANTS (df= 4)
63A. Intron 6 T→A versus T→G
G GT TT Total 1
944 194 19 1 157
GA 70 10 81
AA 2.74 0.60
Total 1021 204 20 1245
63B. Intron 6 G→T versus Exon 7 A→C (Asn→His) G GT TT Total γ2 ~p
_ _ _ _ _
AC 18 0 0 18
CC 1 0 0 1 5.43 0.24
Total 246 60 6 312
63C. Intron 6 G→A versus Exon 7 A→-C (Asn→-His)
G GA AA Total χ2 ~p~
~A 254 16 0 270
AC 20 1 1 22
CC 2 0 0 2 9.72 0.045
Total 276 17 1 294
63D. Intron 6 G→A versus Intron 5 CCCCT polymorphisms
G GA AA Total χ2 ~P ~
240/240 426 17 5 448
240/x 144 6 0 150
x x 21 1 0 23 1.97 0.74
Total 591 25 621
63 E. Intron 6 G→-T versus Intron 5 CCCCT polymorphisms
G GA TT Total
240/240 473 28 0 501 240/x 88 80 168
x/x 10 27 421.07 O.00001
Total 569 117 10 696
Comparison by individual behaviors. When the means of the different behavior scores were compared for either A or T allele, only the results for the presence of multiple phobias were significant, with a mean score of 2.89 for those with neither (/? = 0.043). When the prevalence of either variant in controls without phobias versus TS probands and relatives without phobias versus TS probands and relatives with phobia was compared, the results for phobias had the highest linear χ (3.45) but was not significant (/? = 0.06). Here the prevalence of either increased from 18.8% to 24.15 to 34.1% across these three groups. None if the individual behaviors were significantly associated with the non-240 bp alleles of the CCCCT polymoφhism.
TDO2 polymorphisms and serotonin levels. Data were available on platelet serotonin and blood tryptophan levels from a previous study (Comings, 1990b). Since some subjects were involved in both studies it was possible to determine if there was any difference in the platelet serotonin or blood tryptophan levels in subjects with different TD02 alleles. These results are shown in Table 64. For the G→A variant there was no significant change in serotonin platelet ratio in the G/A and A/A compared to G/G subjects by either ANOVA analysis or by the Mann- Whitney non- parametric test. The distribution of the values for the serotonin/platelet ratio for those with the GG or GT, TT genotype.
While the range of values was similar, the distribution differed from a normal distribution. Forth those carrying the GG genotype ofthe G→-T polymoφhism. many of the values were clustered in the 0.5-1.25 range. By contrast, few of those carrying the T allele were in this range. There was also an outiiner of a 10.9 value for the T allele group. When this outiiner was not eliminated, the mean serotonin/platelet ratio was significantly higher for those carrying the T allele (p = 0.003). When this value was excluded the /? value dropped to 0.081. However, the T allele group still had a significantly higher mean with the more appropriate Mann- Whitney non-parametric test. For the CCCCT repeat polymoφhism, as expected, those carrying the non-240 allele had higher serotonin/platelet ratios. However, the differences were not significant. The tryptophan levels were not significant for any of the polymoφhisms.
EXAMPLE 11 ADDITION OF GENETIC ASSOCIATIONS PSI Gene Polymorphism. The presenilin-1 (PSI) polymoφhism is a bi- allelic marker, located on chromosome 14, which has been implicated in Alzheimer's disease. In view of reports that cigarette smokers are at reduced risk of developing Alzheimer's disease the inventors examined the PS-1 gene in a series of 132 non- Hispanic Caucasian subjects for whom alcohol and cigarette use patterns had been determined. The inventors found that homozygotes for this gene (genotypes 1/1 and 2/2) were significantly more often cigarette smokers ( ? < 0.05), and had significantly elevated scores on the Michigan Alcoholism Screening Test (MAST) (/? < 0.01).
The subjects' genomic DNA was extracted from whole blood by standard procedures. PCR™ method (Saiki et al, 1988) was used to amplify the target DNA using, 0.1 μM of each primers (5' CACCCATTTACAAGTTTAGC 3' (SEQ ID NO: 19) and 5' CACTGATTACTAATTCAGGATC 3' (SEQ ID NO:20) in separate reactions. The reactions were denatured first at 94°C for 5' followed by second step of denaturation at 94°C for 30", 50°C annealing for 30" and an extension at 72°C for 30". The second step was repeated in 34 cycles and the last extension step at 72°C for 5'. The amplified products 199 bp were digested with 2.5 U of restriction enzyme BamHI at 37°C overnight.
The digested products were run on 10%> PAGE at 150V for 2 h and stained with ethidium bromide. The genotypes were noted based on the restriction cut site A-C producing two fragments 181 bp and 18 bp (Wragg et al, 1996).
The ADRA2C dinucleotide repeat polymorphism. The ADRA2C dinucleotide repeat polymoφhism, at chromosome 4p, spans basepairs 179-193. The human genome database accession number for this polymoφhism is M94915. The inventors examined this genetic marker in a series of 53 non-Hispanic Caucasian substance abusers and found that the presence of low basepair alleles (<181 bp) was associated with more severe drug use patterns (cocaine, amphetamine, and heroin use), but less severe alcoholism use. The inventors constructed a genotype from the dinucleotide repeat alleles in the following fashion: genotype 1 =homozygosity for <181 bp; genotype 2=heterozygosity (allele 1 <181 bp, allele 2 >183 bp), and genotype 3=homozygosity for > homozygosity for >183 bp. Genotype 1 was associated with increased amount of money spent on drugs (/? < 0.01), increased number of years of amphetamine use (p < 0.05), and increased number of years of heroin use ( ? < 0.05). Conversely, the high base pair alleles (genotype 3) was associated with greater alcohol use in past 30 days ( ? < 0.01), increased number of years of alcohol use (p < 0.05), and designation of alcoholism (rather than drugs) as the principal reason for seeking treatment (/? < 0.05).
The human genome accession number for this polymoφhism is GDB196352 and sequences is M94915. Subjects' genomic DNA was extracted from whole blood by standard procedures. PCR™ (Saiki et al, 1988) was used to amplify the target DNA using, 0.1 μM of each fluorescence labelled primers (5ΑGTGGGCAGGGCGGGGCAGGT 3' (SEQ ID NO:21) and
5' CGCTGCCTCCCTTCCACCTGTTG 3' (SEQ ID NO:22) in separate reactions. The reactions were denatured first at 94°C for 5', followed by second step of denaturation at 94°C for 30", 57°C annealing for 30" and extension at 72°C for 30". The second step was repeated 29 times in a cycle and the program ends with an extension step at 72°C for 5'. For gel analysis each reaction is made of 0.5 μl of the diluted (15 μl in 75 μL of deionised water) amplified PCR™ product, 2.5 μl of mix containing 2.0 μl deionized formamide + .25 μl of ROX 500 standard + .25 μl Blue doxtran dye and denatured for 2' at 92°C. The denatured sample was loaded on 6% PAGE of Applied Biosystems 373 DNA sequencer (GeneScan™) and gel was run for 5 h at 1500 volts and at constant 30 W. Gel is preprocessed and analysed using the internal standard (ROX 500). Two peaks were recognized by genotyper (version 1.1) based on the color and the size of the fragments. The values assigned are in fractions showing its accuracy determination of the allele sizes. Complete information for each sample is printed from every gel file and the compiled data is subjected for analysis. The inventors examined the dinucleotide repeat polymoφhism, a CA repeat at the 3'end, of the PENK gene in a series of 64 substance abusers. The inventors found that subjects homozygous for the high base pair alleles (>80 basepairs) had significantly more severe alcoholism and drug addiction. The high base pair alleles were associated with increased number of years of drinking to intoxication ( ? < 0.05), increased number of drug detoxification treatments (p < 0.01), increased number of years of heroin use (/? < 0.05), greater number of drug treatments ( ? < 0.05), and more frequent use of methadone maintenance therapy (/? < 0.05).
EXAMPLE 12 DETERMINING ALLELIC POLYMORPHISMS SUSCEPTIBLE TO
THERAPY WITH PHENCAL™
To determine which RDS genes, and specifically, which polymoφhisms are diagnostic of individuals who are most susceptible to pharmacological intervention to suppress particular RDS behaviors, potential candidates will be tested for specific polymoφhisms in RDS genes, undergo various psychometric assays to identify RDS behaviors, and/or subjected to pharmacological treatment with the compositions disclosed herein. The presence of particular RDS gene or genes' polymoφhisms can be statistically evaluated relative to the presence of RDS behaviors identified by psychometric assays and/or changes in RDS behaviors upon treatment using the compositions disclosed herein. RDS gene polymoφhisms that show a statistically significant correlation, such as a /? < 0.05, to an RDS behavior that is suppressed by neutonutrient compositions is thus identified as diagnostic of individuals that are more likely to be successfully treated using neuronutrient composition. The general formula of components of a RDS treatment composition is given at Table 4, and it is contemplated that one or more of the components listed will be effective in treating persons demonstrating one or more RDS behaviors described herein. Additionally, Tables 6-16 contain specific formulations that are preferred in the treatment of specific RDS behaviors described herein. Also, see Tables 17-19 for a brief schematic of how certain elements effect reward induced by stimulants (cocaine, etc. ), opiates and sedative-hypnotics. Specific examples of the method of treatment combined with genetic diagnosis for RDS behaviors is described below: Carbohydrate Bingeing or Anti-Obesity. In terms of the genetic link to carbohydrate bingeing and successful treatment, the inventors are currently genotyping a number of probands and providing the subjects with 6 capsules a day of the PHENCAL™ formula and measuring pounds lost in a 90 day period, carbohydrate bingeing scores and over the next 6-8 months determining regaining of weight. This will be against a placebo. It will be determined if the greatest improvement occurs with the various genotypes under study. For the obesity study, the inventors will determine the following genes and possibly others and their respective polymoφhisms, already provided herein, relative to successful treatment with PHENCAL™: DI D2, D4, DATl, DβH, COMT. MAOA(x), TD02, APO-D. Chromosome-2 marker, UCP-2. CNRl, GABAB3, HTR2A, HTRIA and nNOSla.(see Table 5).
Details of Protocol: PHENCAL™ and a Close Variant Containing Chromium Nicotinate Salt in Clinical Response as a Function Of Genotype Study Participants. Participants in this study will be morbidily obese and weigh between 130-180% of ideal weight or for females have 34% body fat and for males have 28% body fat. The patients will between the ages of 18-65 years of age. Patients will be excluded if they have hypertension, diabetus mellitus or other debilitating diseases.
Study Design. This clinical trial will be a double-blind-placebo-controlled study of subjects administered either 6 capsules per day of PHENCAL™ (for general formula, see Table 4, and for specific formula, see Table 7) compared to a matching placebo (manufactured by Weider Nutrition Group, Salt Lake City, Utah). This will be a 14 wk study. The first two-wk involve an intensive work-up including blood screening and buccal swab DNA collection as well as scale weight measurements. Once the subject enrolls in the study and signs a standard informed consent, residual lung volumes will be measured by an independent local pulmonary laboratory using a Collins Helium Dilution pulmonary functioning unit (Warren E. Collins, Inc, Braintree, Mass.). Under water tests (displacement method) will be conducted using a Whitmore Volumeter (Whitmore Enteφrises, San Texas) that correlates highly with hydrostatic weighing and has a test re-test reliability between 0.96 and 0.99 (Ward et al, 1978). A detecto commercial platform scale (Model 8850, Deteco Scale company, Web City, Missouri) calibrated to 1/10 of a pound will be used to obtain scale weights. Additionally, the inventors will measure bone density utilizing the Dual Energy X-Ray Absoφtometry (DE&A) Test.
Within the 2 wk period of completing all these tests, subjects will be provided with their test results except for their genotypes (which will be kept blind until the study is ready to be analyzed) and randomly selected one of the precoded bottles containing either PHENCAL™ or its matched placebo. The subjects will be asked to consume 6 capsules per day-two at breakfast, lunch and dinner at about one-h prior to eating. The manufacture will act as the trustee and will code each batch prior to dispensing. None of the investigators, research technicians dispensing the product, or subjects will know which code corresponds to either PHENCAL™ or matched placebo. Unlike some other studies especially those accomplished with either d- fenfluroamine or phenteramine alone or in combination, no dietary or exercise information will be provided and subjects will be asked to pursue whatever program they wished during the test period as long as they rigorously take the supplements as prescribed. (In a certain number of subjects the inventors may incoφorate "The Optimal Health Diet Plan" which has been developed by Dr. Gilbert Kaats. San Antonio, Texas). Subjects will visit the center every wk to pick up another bottle supplement or placebo and to obtain a scale weight. At the conclusion of the test period (an additional 12 wk from the start of ingestion of the capsules), subjects will complete an ending body composition test. All data is being computerized and will be analyzed by the Department of Computing Research at the University of Texas Health Science Center-Houston-San-Antonio, Texas. At the time of analysis the trustee will be required to release the code. The actual amount of PHENCAL™ and placebo consumed will be calculated from their self-report of product usage.
In this study the major outcome measure will be comparisons of average changes in body composition variables between subjects receiving a placebo or
PHENCAL™. PHENCAL™ without chromium, and PHENCAL™ containing chromium picolinate, chromium nicotinate, or a combination of the two will be evaluated. The mean body composition change will be compared in the subgroups based on genotypes. A number of haplotypes across all the genes tested as described above will be analyzed by using the standard multiple gene regression analysis as utilized by Comings as discussed earlier (see the OBKIT™ for specifics on genotyping).
Anti-Smoking. Utilizing the Nicorest™ formula a number of heavy smokers will be genotyped according to the basic plan of the inventors. Following a regime of Nicorest™ 6 capsules (see Table 10) a day for 90 days, outcome will be measured in terms of: ease as to quitting; Withdrawal symptoms (including depression); Relapse. This data will be evaluated against all of the above genes. A complete history of smoking will be taken according to the previous work of Comings et al. (1996) (see the NICOKIT™ for specifics on genotyping).
Detail Protocol: Alcotrol™ and Cocotrol™ as a Function of Genotype.
Studies will include outpatients who will be given the anti-alcohol and anti-cocaine formula and outcome will be measured in terms of early detox withdrawal symptoms, and relapse rates as measured by either not returning to program or known to return to the drug of choice (See Table 5).
Subject Participation. In this study all patient will be assessed using the
Minnesota Multiphasic Personality Inventory (MMPI) and blood analyses
(CBC/SMAC-24) which is carried out upon admission. No further blood test are taken at the end of the study. The groups are: alcohol-Alcotrol™; alcohol-Placebo; stimulant abuser (cocaine)-Cocotrol™; stimulant abuser-Placebo.
Study design. Age, weight sex, race and entry BAL will be tested as possible covariates for the dependent measures. No one in the in-patient treatment facility, physicians, nurses and subjects, nor the data collector, will be provided information regarding which subjects are receiving Alcotrol™ or Cocotrol™ or Matched Placebo. The dosage will be two capsules per day of each formula (see Tables 8 and 9), given in divided doses one h before meals. TEST MEASUREMENTS
Skin Conductance Level (SCL). The electrical properties of the skin have been widely utilized in the assessment of emotional response. This technique has proven quite reliable as a measure of stress levels in the patient (for example, extent of anxiety or anger). As such, this is an indirect measure of stress levels in the patient. The Sci, the inverse of the galvanic skin resistance (GSR), monitors absolute skin conductance level as measured by micromhos (Edelberg, 1972). A correlation exists between orienting and anxiety responses which by sympathetic activation results in increase in skin conductance. Thus, a decrease in conductance is associated with a decrease in autonomic arousal (Luthe, 1969). To make these measurements an Autogen 3000 is attached to the middle three fingers of the dominant hand of each patient, and a reading is obtained. Measurements will be carried out for each patient selected for study at unscheduled times so the patient is not aware of when he/she will be measured.
Clinical Measurements. The Physical (coincident with the Clinical Institute
Withdrawal Assessment for Alcohol [CIWA-A] (Shaw et al, 1981) and BESS scores are subjective measures applied to each patient during the entire stay in this 28-day in- patient treatment center. Both the Physical and BESS Scores have been described (Blum et al, 1989). During the course of the treatment changes in these factors will be observed daily by the clinical director, staff physicians, and the clinical nursing director, and their observations will be discussed and coordinated to arrive at a consensus. On admittance each patient is assigned a baseline score value of 5. Each day improvement or regression will be noted with a range of improvement from 6-10, and arrange of regression from 0-4; 5 indicated no change from admittance status.
Genotyping. Each patient upon admittance to the clinic will be given the
DNA-buccal swab test as depicted in the SUDKIT™ of this application. All the genotypes will be kept blind to the entire staff including the medical director. When the data is ready to be analyzed the genotypes will be released only to the Department of Computing Resource University of Texas-Houston/ San Antonio for statistical puφoses. The genes to be tested include: DI, D2, D4, DATl (10/10,9/9), TD02, nNOSla, CNRl, GABAB3, HT2R, MAOA(X), COMT. Statistical Analysis of Data. Effects of Alcotrol™ and Cocotrol™ treatment will be analyzed for the alcohol and stimulant abuser groups alone in combination against the placebo. Most importantly, the inventors will evaluate the treatment responses on stress and the clinical measurements to include Physical and Bess scores as a function genotype.
Detailed Protocol: HyperGen™ in ADHD Probands as a Function of Genotype
Study Participants. The inventors are in the process of administering in a double-blind-placebo controlled study 6 capsules per day of the HyperGen™ formula to ADHD children in an outpatient clinic utilizing the ADHD scale, TOVA tests and CCPT. The inventors then compare pre-and post test scores for the tests and correlate outcome with the various genes in question. This study involves ADHD subjects in an out patient clinic at two sites (Texas and Tennessee). The subjects have been diagnosed by a number of psychometric tests including the TOVA, and a ADHD scale (Cull and Blum, 1997) and the Wisconsin card sorting test. The participants have histories negative for psychiatric conditions exclusive of Axis II diagnosis. All subjects at the time of testing are free of prescription medications, and each subject is required to sign an informed consent and an agreement to take the capsules according to protocol.
Study Design. The subjects perform the entire test battery twice (including TOVA, Cull/Blum ADHD Scale and performance tasks (see below), which forms a test-re-test model. Initial testing is done on day zero (pre-test) and then again after 90 days (post-test). In between the subjects are asked to consume either HyperGen™ or a matched placebo at a dose of 6 capsules per day (two at breakfast, lunch and dinner about one-h before eating). The composition of HyperGen™ is shown in Table 12. This is a double-blind-placebo controlled study and the manufacturer holds the precoded information which is provided to the statician at the end of the study. None ofthe personnel or subjects have information pertaining to the coded bottles.
Performance Tasks. Two performance paradigms are used to elicit electrophysiological response: Spatial Orientation. This is a reaction time task (SOT), (Posner et al, 1988) where priming cues' are presented in the left and right visual fields. Reaction times are compared for when the priming cues' are and are not available. Through a comparison of reaction times, it allows for an assessment of the individuals' ability to switch attention smoothly between the visual fields. In this study the task is structured so it allows for evaluation of a more elemental stage of attentional processing that pertains to the more covert operations of attention, and tends to load more heavily on the more automatic stages of attention (Defiance et al, 1993).
Contingent Continuous Performance. The Contingent Continuous Performance Task (CCPT) is a variant of a classic theme, incoφorating elements of both selective and sustained attention. This task is analyzed to ensure quality of performance to index the more controlled stages of attentional processing. Letters of the alphabet are presented one at a time in the center of the screen. Basically, the individual is asked to respond with his dominant hand, by pressing the left mouse button (right-handed group) to a specific letter ordeπe.g., "T" if immediately preceded by another "T1. The initial "T" in a pair of "Ts" serves as a Warning cue, with the second: "t" being the Target. All other letters are considered Distracters, which are to be ignored by the subject. The basic calculation of the data is according to previous work (Defiance et al, 1997). It is noteworthy that the prefrontal cortex appears to be most heavily involved in sustaining attention and effort, which are important factors with regard to overall performance on this task, and are very sensitive to stimulant medication (Sostek et al, 1980).
Recording Scheme. The EEG is recorded from 28 active recording sites referenced to linked earlobes (A1-A2) as described (Defrance et al. 1996). The onset of each stimulus presentation triggered an 800 msec. Sampling of EEG from which the ERP's are constructed: included in each epoch is a 100 msec prestimulus sampling that is used for baseline correction.
Data Analysis. The basic analysis follows previous work (Defiance et al,
1997) and in general includes the evaluation of three parameters, each of which may vary according to the efficiency of an individuals attentional processing. These parameters are: latency, amplitude, symmetry (spatial distribution) of components of the ERP's (Defiance et al, 1996).
This work would correlate the changes on attentional processing attributed to HyperGen™ to gene alleles that have been associated with ADHD (as discussed earlier and indicated in the HYPERKIT™ described in this application). It is at least expected that subjects carrying the DRD2A1 allele. the DβH BI allele, the VNTR 10/10 repeat of the DATl, and polymoφhisms of the TDO2, MAOA(X), and the HTRIA genes will show the greatest response.
Anti- Violence and Aggression. Since an association has been found between "pathological Violence" and dopaminergic polymoφhisms (i.e. DRD2 and DATl alleles) as well associations with schizoid and avoidant behavior it is logical to evaluate the use of an aggression formula with these behaviors as depicted in Tables 14 and 15. The dose will be 6 capsules a day against a standard placebo. The outcome measure will be reduction in number of non-motivational outbursts in various probands (i.e. adolescents and prisoners) and a general calming with lowered hostility. The outcome measures will be correlated with genotype (see TEMPKIT) as discussed above within a 6 month time frame. In this study, the inventors will use either the of the formulas corresponding to Tables 14 or 15. This study will be accomplished on 40 incarcerated youth at the Youth Center at Larned Kansas.
EXAMPLE 13
A MULTIPLE ADDITIVE ASSOCIATIONS TECHNIQUE (MAA) FOR THE
IDENTIFICATION OF GENES IN POLYGENIC DISORDERS: RESULTS
FOR ADHD AND COMORBID DISORDERS
ADHD is the most common disorder treated by most pediatric psychologists and psychiatrists, estimated to be present in 2 to 8 percent of school age children. There is clear evidence that ADHD is an organic, neurological and/or a genetic disorder. Compared to controls, the fathers of ADHD or hyperactive children have a greater frequency of ADHD, alcoholism, and antisocial personality disorder (ASPD), and the mothers had a greater frequency of ADHD, alcoholism, and "hysteria" or hysterical personality (Morrison and Stewart, 1971 ; Cantwell, 1972). The sibling of ADHD children have a greater frequency of ADHD (Augest and Stewart, 1972; Pauls, et al, 1983; Weiner et al, 1977), particularly if one parent had ADHD or if the children are identical twins (Hechman, 1994). The ratio of these behaviors in sibling versus half-siblings ranged from 2.0 to 5.2, consistent with a genetic etiology of ADHD. Children of a parent with ASP had a significant increase in the frequency of ADHD, rages and temper tantrums compared to normal children (Cadoret et al, 1978).
More relatives of ADHD probands had ADHD compared to 8% of the relatives of controls. There was also a significantly increased risk for major depressive disorders, oppositional defiant disorder (ODD), conduct disorder, antisocial personality disorder, alcohol dependence, drug or alcohol dependence, anxiety disorders including generalized anxiety disorders (Biederman et al, 1990). ADHD and mood disorders may share common familial vulnerabilities (Biederman's et al, 1990), ADHD with conduct disorder may be a distinct subtype of ADHD (Farone et al, 1993a), and that ADHD and anxiety disorders (Hodge et al, 1986) and ADHD and learning disorders (LD) (Farone et al, 1993b) are transmitted independently in families.
Defects in dopamine metabolism have long been implicated in the etiology of ADHD. Lesions ofthe dopaminergic neurons ofthe limbic system (ventral tegmental area) results in hyperactivity, hyper-responsivity, poor response to stress, and a spectrum of other disorders in rodents (Lemoal et al, 1976; Lemoal et al, 1991). Chemical destruction of frontal lobe dopaminergic neurons shortly after birth produces an animal model of ADH